WO2024008959A1

WO2024008959A1 - Prevention and control of alga bloom

Info

Publication number: WO2024008959A1
Application number: PCT/EP2023/068931
Authority: WO
Inventors: Erwann Loret; Anne-Laure RENAULT
Original assignee: Viralga Sas
Priority date: 2022-07-08
Filing date: 2023-07-07
Publication date: 2024-01-11

Abstract

The present invention relates to an isolated ribonucleic acid molecule to prevent and control bloom of alga.

Description

PREVENTION AND CONTROL OF ALGA BLOOM

FIELD OF INVENTION

[0001] The present invention relates to new ribonucleic acid molecules, new polypeptides and new polypeptides, that may be of use in the biological control of algae blooms, in particular blooms of green algae such as from the genus Ulva.

BACKGROUND OF INVENTION

[0002] Algae blooms, which result from the uncontrolled proliferation of macroalgae, are particularly hazardous for both the sea environment, including marine fauna, and human’s health. The rapid proliferation of the macroalgae also decreases the biodiversity for other algae species.

[0003] The genus Ulva is an algae genus commonly found in green algae blooms, in particular Ulva lactuca. Ulva lactuca is able to grow both with a holdfast such as rocks or free floating. In addition, it is capable of reproducing both by sexual reproduction and by fragmentation of the thallus, drastically increasing the proliferative capacities of this algae. Finally, Ulva lactuca can adapt to various degrees of water salinity, or symbiosis with bacteria. This species is therefore particularly potent at causing green algae blooms. Ulva lactuca blooms result from eutrophication due to human activities, in particular intensive agriculture and wastewater treatment plant (Renault & Loret, manuscript in preparation), that reject noticeable amounts of nutriments in the marine environment

[0004] The earliest Ulva lactuca blooms were reported in Northern Ireland in 1904. Decades after this first report, blooms were described worldwide particularly at Venice (Italy), Galicia (Spain), Tokyo Bay (Japan), Melbourne (Australia), and most notably in Qingdao bay (China) covering two third of the Yellow see since 2010 (Dominguez & Loret 2019). In Europe, the biggest Ulva lactuca blooms occur in the north coast of Brittany since 1970. The main response to algae blooms remains the collection of macroalgae washed up on beaches. In addition, the degradation of the algae induces the production of toxic acidic vapors, such as, e.g., H2S vapors. There is therefore an unmet need to provide a safe and efficient solution to control macroalgae proliferation, in particular macroalgae of the genus Ulva, in particular of the species Ulva lactuca, in order to slow down or stop green macroalgae blooms in the seawater or in the land of a contaminated coastline.

SUMMARY

[0005] The present invention relates to an isolated ribonucleic acid molecule having at least 75% sequence identity with SEQ ID NO: 1, over the entire length.

[0006] In some embodiments, the ribonucleic acid molecule comprises a ribonucleic acid sequence having at least 75% sequence identity with SEQ ID NO: 2, over the entire length, preferably encoding a first polypeptide (polypeptide Pl).

[0007] In some embodiments, the ribonucleic acid molecule comprises a ribonucleic acid sequence having at least 75% sequence identity with SEQ ID NO: 3, over the entire length, preferably encoding a second polypeptide (polypeptide P2).

[0008] In some embodiments, the sequence of the ribonucleic acid molecule consists of SEQ ID NO: 1.

[0009] The present invention further relates to an isolated polypeptide Pl having at least 75% amino acid identity with SEQ ID NO: 4, over the entire length.

[0010] The present invention further relates to an isolated polypeptide P2 having at least 75% amino acid identity with SEQ ID NO: 5, over the entire length.

[0011] The present invention further relates to an alga cell, preferably a green alga cell, comprising the ribonucleic acid molecule according to the invention, and/or expressing polypeptide Pl, according to the invention, and/or expressing polypeptide P2, according to the invention. [0012] In some embodiments, polypeptide Pl is encoded by a ribonucleic acid molecule according to the invention, and/or polypeptide P2 is encoded by a ribonucleic acid molecule according to the invention.

[0013] In some embodiments, the alga cell is a green alga cell. In some embodiments, the green alga cell belongs to the genus Ulva.

[0014] The present invention further relates to an algicide composition comprising at least one ribonucleic acid molecule according to the invention, and/or at least one polypeptide Pl according to the invention, at least one polypeptide P2 according to the invention.

[0015] The present invention further relates to the use of at least one ribonucleic acid molecule according to the invention, and/or at least one polypeptide Pl according to the invention, and/or at least one polypeptide P2 according to the invention and/or an algicide composition according to the invention, for biologically controlling an alga, preferably a green alga, more preferably a green alga belonging to the genus Ulva.

[0016] The present invention further relates to the use of at least one ribonucleic acid molecule according to the invention, and/or at least one polypeptide Pl according to the invention, and/or at least one polypeptide P2 according to the invention and/or an algicide composition according to the invention, for preventing a bloom of an alga, preferably a green alga, more preferably a green alga belonging to the genus Ulva.

[0017] The present invention further relates to a method for the biological control of an alga, preferably a green alga, more preferably a green alga belonging to the genus Ulva, comprising the step of contacting the alga with an effective amount of a ribonucleic acid molecule according to the invention, and/or a polypeptide Pl according to the invention, and/or a polypeptide P2 according to the invention, and/or an algicide composition according to the invention.

[0018] The present invention further relates to a method for preventing a bloom of an alga, preferably a green alga, more preferably a green alga belonging to the genus Ulva, comprising the step of contacting the alga with an effective amount of a ribonucleic acid molecule according to the invention, and/or a polypeptide Pl according to the invention, and/or a polypeptide P2 according to the invention, and/or an algicide composition according to the invention.

[0019] In some embodiments, the biological control is to be performed in a marine environment.

DEFINITIONS

[0020] In the present invention, the following terms have the following meanings:

[0021 ] “About” preceding a figure encompasses plus or minus 10%, or less, of the value of said figure. It is to be understood that the value to which the term “about” refers is itself also specifically, and preferably, disclosed.

[0022] “At least one” includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 25, 50, 75, 100, 250, 500, 750, 10³, 10⁴, 10⁵, 10⁶, 10⁷, 10⁸, 10⁹, 10¹⁰, 10¹¹, 10¹², 10¹³, 10¹⁴, 10¹⁵ or more.

[0023] “Isolated”, when referred to a subject matter, such as, e.g., a ribonucleic acid, a polypeptide or a polypeptide, as defined herein, is intended to mean that said subject matter is no longer within its original and/or natural environment. In some embodiments, the terms “isolated” and “purified” are intended to be synonyms.

[0024] “Ribonucleic acid” or “RNA” refers to any polyribonucleotide, which may be unmodified or modified RNA. “Ribonucleic acid” includes, without limitation single- and double- stranded RNA, and RNA that is a mixture of single- and double-stranded regions, positive and negative RNAs that may be single-stranded or double-stranded or a mixture of single- and double-stranded regions. In addition, “Ribonucleic acid” also includes RNAs containing one or more modified bases as well as RNAs with backbones modified for stability or for other reasons. “Modified” bases include, for example, tritylated bases and unusual bases such as inosine. A variety of modifications has been made to RNA in the state of the art; thus, “ribonucleic acid” embraces chemically, enzymatically or metabolically modified forms of polyribonucleotides as typically found in nature, as well as the chemical forms of RNA characteristic of microorganisms and eukaryote cells, or from synthetic origin.

[0025] “Bloom” refers to a rapid and excessive growth of a population. By extension, “algae bloom” refers to a rapid and excessive growth of algae in a given marine environment. In practice, green algae blooms may be accountable for a “green tide”, which refers to the green coloration of the seawater due the presence of an excessive concentration of green algae in a given perimeter. As used herein, an “algae bloom” is considered as being a pollution matter, because polluted waters, in particular seawaters, and coastline areas, in particular shores and beaches, may become life-threatening to both animal and human, due to the toxic vapors, in particular H2S vapors, that are emitted upon the degradation of the algae. Similarly, the term “red tide”, which refers to the red coloration of the seawater due the presence of an excessive concentration of red algae in a given perimeter, may be used to refer to red algae blooms.

[0026] “Marine environment” refers to the ecosystem from the seawater, including the open sea (or deep sea), the seashore, the estuaries, the coastline. In practice, the coastline encompasses any land or ground surface in direct contact with the sea, e.g., rocks, beaches.

[0027] “Control”, “biological control” and “controlling” refer to both the steps, including prophylactic or preventative step, undertaken to prevent or slow down (lessen) a specific deleterious phenomenon, in particular an algae bloom. The environments in need of these steps include those already experiencing said specific deleterious phenomenon, in particular an algae bloom, as well as those prone to experience the specific deleterious phenomenon or those in which the specific deleterious phenomenon is to be prevented. The specific deleterious phenomenon is successfully “controlled” if, after receiving an efficient amount of the ribonucleic acid and/or one or more polypeptide(s) or polypeptide(s) according to the present invention, the environment shows observable and/or measurable reduction in or absence of one or more of the parameters associated with said specific deleterious phenomenon; better quality of the environment. The above parameters for assessing successful control and improvement in the environment are readily measurable by routine procedures familiar to a skilled in the art. In one embodiment, the specific deleterious phenomenon is macroalgae blooms, in particular Ulva lactuca blooms.

[0028] “Preventing” refers to keeping from happening, and/or lowering the chance of the occurrence of, at least one parameter of a specific deleterious phenomenon.

[0029] “Promoting death” refers to the ability to kill a target. By extension “promoting death of the algae” is intended to refer to the killing or the degradation of the algae. In practice, dead algae are no longer capable of growing, spreading and promote a colored tide, such as a green tide or a red tide. In one embodiment, the death of the algae may be accompanied by, or be the consequence of, a whitening, or bleaching, of the tissues of the algae. In practice, the whitening or bleaching of algae’s tissues may be visibly observed by a naked eye.

[0030] “Identity”, when used in a relationship between the sequences of two or more nucleic acid sequences or of two or more polypeptides or polypeptides, refers to the degree of sequences relatedness between nucleic acid sequences polypeptides or polypeptides (respectively), as determined by the number of matches between strings of two or more nucleotides or of two or more amino acid residues, respectively. “Identity” measures the percent of identical matches between the smaller of two or more sequences with gap alignments (if any) addressed by a particular mathematical model or computer program (i.e., “algorithms” . Identity of related nucleic acid sequences or polypeptides or polypeptides can be readily calculated by known methods. In one embodiment, the term identity is measured over the entire length of the sequence to which it refers.

[0031] “Polypeptide” refers to a linear polymer of at least 50 amino acids linked together by peptide bonds. In some embodiments, a polypeptide refers to a structural polypeptide, i.e., a polypeptide involved in a 2D and/or 3D substructure (assembly of subunits). In some embodiments, the polypeptide refers to a functional polypeptide, i.e., a polypeptide having enzymatic properties. “Polypeptide”, as used herein, refers to a “precursor polypeptide” encoded by one open reading frame (ORF), and susceptible to be cleaved into two or more polypeptides. The term “polypeptide” as used herein can be used interchangeably with the term “polyprotein”. [0032] “Protein” refers to a functional entity formed of one or more peptides or polypeptides, and optionally of non-polypeptides cofactors. In some embodiments, a protein refers to a structural protein, z'.e., a protein involved in a 2D and/or 3D substructure (assembly of subunits). In some embodiments, the protein refers to a functional protein, z'.e., a protein having enzymatic properties.

[0033] As used herein, the expressions “Viva alga” and “alga of the genus Viva” are meant to refer to the same subject matter and may substitute to one another.

DETAILED DESCRIPTION

[0034] A first aspect of the invention relates to an isolated ribonucleic acid molecule having at least 75% sequence identity with SEQ ID NO: 1, over the entire length.

[0035] As used herein, the term “at least 75% sequence identity” encompasses 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and 100% sequence identity.

[0036] In practice, the level of identity of 2 ribonucleic acid sequences may be performed by using any one of the known algorithms available from the state of the art.

[0037] In some embodiments, the isolated ribonucleic acid molecule according to the invention has at least 80%, preferably at least 90%, more preferably at least 95%, even more preferably at least 99% sequence identity to SEQ ID NO: 1, over the entire length.

[0038] In certain embodiments, the isolated ribonucleic acid molecule is represented by a ribonucleic acid sequence consisting of SEQ ID NO: 1. In practice, ribonucleic acid molecule consisting of sequence SEQ ID NO: l is a 8,970 bases RNA molecule.

[0039] In some embodiments, the ribonucleic acid molecule according to the invention is produced by methods known in the art. In some embodiments, the method for producing the ribonucleic acid molecule of the invention comprises the steps of (i) cultivating a single stranded positive RNA virus whose genomic RNA comprises of consists of the sequence of SEQ ID NO: 1, (ii) extracting the viral genomic RNA comprising of consisting of SEQ ID NO: 1, and optionally (iii) purifying the extracted RNA.

[0040] In some embodiments, the method is performed by infecting a culture of green algae. In some embodiments, the method is performed by infecting a culture of algae of the genus Ulva, preferably Ulva lactuca. In some other embodiments, the method is performed by infecting a culture of red algae. In some embodiments, the method is performed by infecting a culture of algae of the genus Ulva, preferably Ulva lactuca.

[0041] In one embodiment, the culture is performed by cloning in a bioreactor. In another embodiment, the culture is performed in a culture basin comprising at least 100 litter of seawater or at least 1,000 litter of seawater, preferably at least 1,000 litter of seawater.

[0042] In some embodiments, the isolated ribonucleic acid molecule according to the invention is single stranded or double stranded. In some embodiments, the isolated ribonucleic acid molecule according to the invention is single stranded.

[0043] In some embodiments, the isolated ribonucleic acid molecule according to the invention is a positive or negative sense RNA molecule. In some embodiments, the isolated ribonucleic acid molecule according to the invention is a positive sense RNA molecule.

[0044] In some embodiments, the isolated ribonucleic acid molecule according to the invention is a single stranded, positive sense RNA molecule.

[0045] In some embodiments, the isolated ribonucleic acid molecule according to the invention is comprised in, or consists of, the genomic RNA of a virus. In some embodiments, the virus is a single stranded, positive sense RNA virus. In some embodiments, the virus belongs the Dicistroviridae family of viruses. In some embodiments, the virus is a Dicistrovirus. In some embodiments, the virus is lytic virus. In some embodiments, the virus is non-integrative. [0046] In some embodiments, the virus is non-enveloped. In some embodiments, the virus is not a lysogenic virus. In some embodiments, the virus genomic RNA does not encode an integrase.

[0047] By the means of bioinformatic tools and algorithms, the inventors found out that the ribonucleic acid molecule of sequence consisting of SEQ ID NO: 1 may encode two open reading frames (ORFs), namely ORF1 encoding a first polypeptide Pl, and ORF2 encoding a second polypeptide P2. In some embodiments, the two ORFs are nonoverlapping.

[0048] In some embodiments, the ribonucleic acid molecule comprises a ribonucleic acid sequence having at least 75% sequence identity with SEQ ID NO: 2, over the entire length.

[0049] In certain embodiments, the ribonucleic acid molecule comprises a ribonucleic acid sequence having at least 75% sequence identity with SEQ ID NO: 2, over the entire length, preferably encoding a first polypeptide (polypeptide Pl).

[0050] In some embodiments, the ribonucleic acid molecule comprises a ribonucleic acid sequence having at least 80%, preferably at least 90%, more preferably at least 95% sequence identity with SEQ ID NO: 2, over the entire length.

[0051] In certain embodiments, the ribonucleic acid molecule comprises a ribonucleic acid sequence consisting of SEQ ID NO: 2.

[0052] In some embodiments, the ribonucleic acid molecule comprises a ribonucleic acid sequence having at least 75% sequence identity with SEQ ID NO: 3, over the entire length.

[0053] In certain embodiments, the ribonucleic acid molecule comprises a ribonucleic acid sequence having at least 75% sequence identity with SEQ ID NO: 3, over the entire length, preferably encoding a second polypeptide (polypeptide P2). [0054] In some embodiments, the ribonucleic acid molecule comprises a ribonucleic acid sequence having at least 80%, preferably at least 90%, more preferably at least 95% sequence identity with SEQ ID NO: 3, over the entire length.

[0055] In certain embodiments, the ribonucleic acid molecule comprises a ribonucleic acid sequence consisting of SEQ ID NO: 3.

[0056] In some embodiments, the ribonucleic acid molecule comprises a ribonucleic acid sequence having at least 75% sequence identity with SEQ ID NO: 2, over the entire length, and a ribonucleic acid sequence having at least 75% sequence identity with SEQ ID NO: 3, over the entire length.

[0057] In some embodiments, the ribonucleic acid molecule comprises a ribonucleic acid sequence consisting of SEQ ID NO: 2, and a ribonucleic acid sequence consisting of SEQ ID NO: 3.

[0058] In some embodiments, the sequence of the ribonucleic acid molecule consists of SEQ ID NO: 1.

[0059] The present invention further relates to a desoxyribonucleic acid molecule encoding a ribonucleic acid molecule as described hereinabove. In certain embodiments, encoding the ribonucleic acid molecule according to the invention involves at least one step of alternative splicing. In one embodiment, the desoxyribonucleic acid molecule is linear. In another embodiment, the desoxyribonucleic acid molecule is circular. In some embodiments, the desoxyribonucleic acid molecule is in a form selected from the group comprising or consisting of a plasmid, a cosmid, an artificial chromosome and the like.

[0060] Another aspect of the invention pertains to an isolated polypeptide Pl having at least 75% amino acid identity with SEQ ID NO: 4, over the entire length.

[0061] As used herein, the term “at least 75% amino acid identity” encompasses 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and 100% amino acid identity. [0062] In certain embodiments, the isolated polypeptide Pl has least 80%, preferably at least 90%, more preferably at least 95% sequence identity with SEQ ID NO: 4, over the entire length.

[0063] In some embodiments, the isolated polypeptide Pl has an amino acid sequence consisting of SEQ ID NO: 4.

[0064] In some embodiments, the isolated polypeptide Pl is encoded by a ribonucleic acid sequence having at least 75%, preferably at least 85%, more preferably at least 95%, even more preferably at least 99%, sequence identity with SEQ ID NO: 2, over the entire length. In some embodiments, the isolated polypeptide Pl is encoded by a ribonucleic acid sequence as set forth in SEQ ID NO: 2.

[0065] In some embodiments, the pro-polypeptide Pl is susceptible to be cleaved into at least one viral polypeptide selected from the group comprising or consisting of CrPV, DCV, 2B, 2C, 3 A, VPgs, PSIV, 3D, IAPV, ABPV, KBV, SINV-1 and TrV. In some embodiments, the pro-polypeptide Pl is susceptible to be cleaved into at least one viral polypeptide involved in a function selected from the group comprising or consisting of: inhibition of RNA interference; inhibition of SG assembly, membrane remodeling; RNA helicase, membrane permeabilization, viral replication complex formation, viral poly protein processing, negative strand RNA synthesis, viral replication, membrane permeabilization during viral entry, host translation shut off, induction of JAK-STAT pathway, induction of apoptosis, induction of heat shock responses.

[0066] In practice, the inventors observed that the amino acid sequence of polypeptide Pl may share some identity with amino acid sequences from databases, including amino acid sequences of viral origin.

[0067] In some embodiments, the polypeptide Pl according to the invention is post- translationally modified, for example phosphorylated, glycosylated, methylated, acetylated, nitrosylated and the like.

[0068] A still further aspect of the invention relates to an isolated polypeptide P2 having at least 75% amino acid identity with SEQ ID NO: 5, over the entire length. [0069] In certain embodiments, the isolated polypeptide P2 has least 80%, preferably at least 90%, more preferably at least 95% sequence identity with SEQ ID NO: 5, over the entire length.

[0070] In some embodiments, isolated polypeptide P2 has an amino acid sequence consisting of SEQ ID NO: 5.

[0071] In some embodiments, the isolated polypeptide P2 is encoded by a ribonucleic acid sequence having at least 75%, preferably at least 85%, more preferably at least 95%, even more preferably at least 99%, sequence identity with SEQ ID NO: 3, over the entire length. In some embodiments, the isolated polypeptide P2 is encoded by a ribonucleic acid sequence as set forth in SEQ ID NO: 3.

[0072] In some embodiments, the pro-polypeptide P2 is susceptible to be cleaved into two or more viral envelope polypeptide(s).

[0073] In certain embodiments, the pro-polypeptide P2 may be cleaved into 4 distinct viral envelope polypeptides, herein referred to as VP1, VP2, VP3 and VP4. In some embodiments, any one of VP1, VP2, VP3, VP4 may be critical for the cell entry of the virus.

[0074] In some embodiments, VP1 has at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% sequence identity with the amino acid sequence SEQ ID NO: 6. In some embodiments, VP1 has the amino acid sequence of SEQ ID NO: 6.

[0075] In some embodiments, VP2 has at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% sequence identity with the amino acid sequence SEQ ID NO: 7. In some embodiments, VP2 has the amino acid sequence of SEQ ID NO: 7.

[0076] In some embodiments, VP3 has at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% sequence identity with the amino acid sequence SEQ ID NO: 8. In some embodiments, VP3 has the amino acid sequence of SEQ ID NO: 8. [0077] In some embodiments, VP4 has at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% sequence identity with the amino acid sequence SEQ ID NO: 9. In some embodiments, VP4 has the amino acid sequence of SEQ ID NO: 9.

[0078] In practice, the inventors observed that the amino acid sequence of polypeptide P2 may share some identity with amino acid sequences from databases, including amino acid sequences of viral origin.

[0079] In some embodiments, the polypeptide P2 according to the invention is post- translationally modified, for example phosphorylated, glycosylated, methylated, acetylated, nitrosylated and the like.

[0080] In another aspect, the invention relates to an alga cell comprising the ribonucleic acid molecule as defined herein, and/or expressing polypeptide Pl as defined herein, and/or expressing polypeptide P2 as defined in the instant invention.

[0081] In certain embodiments, the polypeptide Pl is encoded by a ribonucleic acid molecule as defined herein, and/or the polypeptide P2 is encoded by a ribonucleic acid molecule according to the instant invention.

[0082] In some embodiments, the alga cell expresses polypeptide Pl and polypeptide P2, as defined in the instant invention.

[0083] In some embodiments, the alga is a green alga or a red alga. In one embodiment, the alga is a green alga. In a more preferred embodiment, the green alga is a green alga belonging to the genus Ulva. In another embodiment, the alga is a red alga.

[0084] In some embodiments, the alga cell is a green alga cell or a red alga cell.

[0085] In one embodiment, the alga cell is a green alga cell. In certain embodiments, the green alga cell belongs to the genus Ulva.

[0086] In some embodiments, an alga of the genus Ulva is selected in the group comprising an alga of the species Ulva acanthophora, Ulva anandii, Ulva arasakii, Ulva armoricana, Ulva atroviridis, Ulva beytensis, Ulva bifrons, Ulva brevistipita, Ulva burmanica, Ulva californica, Ulva chaetomorphoides, Ulva clathrate, Ulva compressa, Ulva conglobata, Ulva cornuta, Ulva covelongensis, Ulva crassa, Ulva crassimembrana, Ulva curvata, Ulva denticulate, Ulva diaphana, Ulva elegans, Ulva enter omorpha, Ulva erecta, Ulva expansa Ulva fasciata, Ulvaflexuosa, Ulva geminoidea, Ulva gigantea, Ulva grandis, Ulva hookeriana, Ulva hopkirkii, Ulva howensis, Ulva indica, Ulva intestinalis, Ulva intestinaloides, Ulva javanica, Ulva kylinii, Ulva lactuca, Ulva laetevirens, Ulva laingii, Ulva linearis, Ulva linza, Ulva lippii, Ulva litoralis, Ulva littorea, Ulva lobate, Ulva marginata, Ulva micrococca, Ulva mutabilis, Ulva neapolitana, Ulva nematoidea, Ulva ohnoi, Ulva olivascens, Ulva pacifica, Ulva papenfussii, Ulva parva, Ulva paschima, Ulva patengensis, Ulva percursa, Ulva pertusa, Ulva phyllosa, Ulva polyclada, Ulva popenguinensis, Ulva porrifolia, Ulva procera, Ulva profunda, Ulva prolifera, Ulva pseudocurvata, Ulva pseudolinza, Ulva pulchra, Ulva quilonensis, Ulva radiata, Ulva ralfsii, Ulva ranunculata, Ulva reticulata, Ulva rhacodes, Ulva rigida, Ulva rotundata, Ulva saifullahii, Ulva scandinavica, Ulva serrata, Ulva simplex, Ulva sorensenii, Ulva spinulosa, Ulva stenophylla, Ulva sublittoralis, Ulva subulata, Ulva taeniata, Ulva tanneri, Ulva tenera, Ulva torta, Ulva tuberosa, Ulva uncialis, Ulva uncinate, Ulva uncinate, Ulva usneoides, Ulva utricularis, Ulva utriculosa, Ulva uvoides and Ulva ventricosa.

[0087] In certain embodiments, the alga of the genus Ulva is selected in a group comprising an alga of the species Ulva armoricana and Ulva lactuca. In one embodiment, the alga of the genus Ulva is an alga of the species Ulva lactuca.

[0088] Within the scope of the invention an alga of the species Ulva lactuca may also refer to an Enteromorpha alga.

[0089] In another embodiment, the alga cell is a red alga cell. In certain embodiments, the red alga cell belongs to the genus Acrothamnion or Sphaerococcus, preferably the red alga cell belongs to the genus Sphaerococcus. In one embodiment, the alga of the genus Sphaerococcus an alga of the species Sphaerococcus Coronopifolius . In one embodiment, the alga of the gnus Acrothamnionis an alga of the species Acrothamnion preissii. [0090] In certain embodiments, the red alga cell is used as a reservoir for the ribonucleic acid and/or the polypeptide according to the invention. In certain embodiments, the red alga cell is used to enable, enhance, accelerate, or otherwise facilitate the proliferation or multiplication of the ribonucleic acid and/or the polypeptide according to the invention.

[0091] Without wanting to be bound to a theory, the inventors consider that expression of the ribonucleic acid according to the invention, and optionally both polypeptide Pl and polypeptide P2, in a green alga cell within a green alga’s tissue may promote the whitening or bleaching of said green alga’s tissue, which results in the death of the green alga’s tissue and hence to the death of the green alga. In addition, the inventors also consider that expression of the ribonucleic acid according to the invention, and optionally both polypeptide Pl and polypeptide P2, in a green alga cell may result in the production of viral particles which may be released from whitened or bleached green alga.

[0092] A further aspect of the invention relates to an algicide composition comprising at least one ribonucleic acid molecule as defined herein, and/or at least one polypeptide Pl as defined herein, and/or at least one polypeptide P2 as defined herein.

[0093] As used herein, the term “algicide composition” refers to a composition which promotes the control of alga’s blooms, by delaying, inhibiting or stopping the proliferation of alga, preferably a green alga, in particular a green alga belonging to the genus Ulva. In some embodiments, the algicide composition according to the invention promotes the death of the alga, in particular a death mediated by the whitening or bleaching of the alga’s tissues. In practice, the bleaching of alga’s tissues is monitored or evaluated by the observation of a white coloration of the alga’s tissues.

[0094] In some embodiments, the algicide composition comprises an effective amount of at least one ribonucleic acid molecule according to the instant invention. In certain embodiments, the algicide composition comprises an effective amount of at least one polypeptide Pl, and/or at least one polypeptide P2 according to the instant invention. In some embodiments, the algicide composition comprises an effective amount of at least one polypeptide Pl and at least one polypeptide P2 according to the instant invention. [0095] In some embodiments, the ribonucleic acid molecule according to the invention may be encapsulated, so as to avoid its degradation. In practice, the encapsulation may be obtained naturally, z'.e., by the mean of capsid or capsid-like polypeptides, in particular of viral origin. In some embodiments, the capsid or capsid-like polypeptides may be encoded by the polypeptide P2. Alternatively, the encapsulation may be obtained artificially as disclosed in the state of the art.

[0096] In some embodiments, the algicide composition further comprises one or more algicide agent. In one embodiment, the one or more algicide agent is a chemical agent. Non-limitative examples of chemical algicide agents include cybutryn, copper (II) sulfate and hexachlorobutadiene. In another embodiment, the one or more algicide agent is a biological agent. Non-limitative examples of biological algicide agents include bacteria of the phylum cyanobacteria and plants of the haloragaceae family.

[0097] The invention also relates to the use of a ribonucleic acid molecule as defined herein, and/or a polypeptide Pl as defined herein, and/or a polypeptide P2 as defined herein, and/or an algicide composition as defined herein, in the biological control of an alga, preferably a green alga, in particular a green alga belonging to the genus Ulva.

[0098] In another aspect, the invention further pertains to the use of a ribonucleic acid molecule as defined herein, a polypeptide Pl as defined herein, a polypeptide P2 as defined herein, or an algicide composition as defined herein, in preventing a bloom of an alga, preferably a green alga, in particular a green alga belonging to the genus Ulva.

[0099] Another aspect of the invention relates to a method for the biological control of an alga, preferably a green alga, in particular a green alga belonging to the genus Ulva, comprising the step of contacting the alga with an effective amount of a ribonucleic acid molecule as defined herein, and/or a polypeptide Pl as defined herein, and/or a polypeptide P2 as defined herein, and/or an algicide composition as defined herein.

[0100] A further aspect of the invention pertains to a method for preventing a bloom of an alga, preferably a green alga, in particular a green alga belonging to the genus Ulva, comprising the step of contacting the alga with an effective amount of a ribonucleic acid molecule as defined herein, a polypeptide Pl as defined herein, a polypeptide P2 as defined herein, or an algicide composition as defined herein.

[0101] In some embodiments, the method comprises the steps of a) contacting the alga with an effective amount of a ribonucleic acid molecule, and/or a polypeptide Pl, and/or a polypeptide P2, and/or an algicide composition according to the instant invention, within a given perimeter; b) observing the whitening or bleaching of the alga’s tissue in the given perimeter; wherein biological control of a alga or prevention a bloom of a alga is operant when substantial amount of alga’s tissues is whitened or bleached.

[0102] As used herein, the term “substantial amount” encompasses at least 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% of the alga’s tissues, preferably green alga’s tissues, from the treated perimeter is whitened or bleached.

[0103] In some embodiments, the given perimeter is a marine environment.

[0104] In certain embodiments, the biological control is to be performed in a marine environment.

[0105] Within the scope of the instant invention, “a marine environment in need thereof’ refers to a seawater ecosystem experiencing or prone to experience Ulva blooms.

[0106] In some embodiments, the marine environment may be limited to seawaters, in particular deep sea, seashore, estuaries, and the like.

[0107] In some embodiments, the marine environment may be artificial, for example marine aquariums or artificial marine reserves.

[0108] In practice, assessing whether a marine environment is in need of controlling and/or preventing blooms of an alga of the genus Ulva may be performed by measuring one or more of the following parameters, including the average seawater salinity, the average seawater surface temperature and the average concentration of Ulva in said environment.

[0109] Illustratively, measuring the average seawater salinity, i.e., the concentration of salt (in grams) per kg of seawater, may be performed by any method known in the state of the art. Non-limitative examples of methods suitable for measuring seawater salinity includes the measure of electrical conductivity (EC), the measure of total dissolved solids (TDS). In some embodiments, a marine environment in need of controlling and/or preventing blooms of an alga of the genus Ulva may have an average salinity comprised of from about 30 g to about 40 g of salt per kg of seawater. Within the scope of the invention, the expression “from about 30 g to about 40 g of salt per kg of seawater” includes 30 g, 31 g, 32 g, 33 g, 34 g, 35 g, 36 g, 37 g, 38 g, 39 g and 40 g of salt per kg of seawater.

[0110] Illustratively, measuring the average seawater surface temperature may be performed by any method known in the state of the art. Non-limitative examples of methods suitable for measuring the average seawater surface temperature includes satellite microwave radiometers, infrared (IR) radiometers, in situ buoys. In some embodiments, a marine environment in need of controlling and/or preventing blooms of an alga of the genus Ulva may have an average surface temperature comprised of from about 12°C to about 25°C, preferably from about 14°C to about 20°C. Within the scope of the invention, the expression “from about 12°C to about 25°C” includes 12°C, 13°C, 14°C, 15°C, 16°C, 17°C, 18°C, 19°C, 20°C, 21°C, 22°C, 23°C, 24°C and 25°C.

[0111] Illustratively, measuring the average concentration of an alga of the genus Ulva may be performed by any method known in the state of the art. In practice, the biomass of algae in seawater may be assessed by any one of the well-established methods. Non- limitative examples of methods suitable for measuring the biomass of algae includes the measure of carbon biomass as ash-free dry mass, the measure of the particulate organic carbon (POC), or the quantification of chlorophyll a in a seawater sample. [0112] In some embodiments, algae blooms, preferably green algae blooms, more preferably Ulva green algae blooms, may be controlled in the seawater, in particular prior to running aground on the coastline, in particular on rocks or on beaches.

[0113] In some other embodiments, algae blooms, preferably green algae blooms, more preferably Ulva green algae blooms, may be controlled on the coastline, including any land or ground surface ground surface in direct contact with the sea, e.g., rocks, beaches.

[0114] In practice, the effective amount of a ribonucleic acid molecule, a polypeptide Pl, a polypeptide P2, or an algicide composition according to the instant invention may be contacted with the alga, preferably green alga, more preferably Ulva green alga, that are lying on the coastline. In some embodiments, Ulva algae are killed prior to its natural biodegradation. In practice, the natural biodegradation is initiated when significant amounts of toxic acidic vapors are emitted, in particular H2S vapors. Illustratively, once dead, the green algae may be safely removed and/or stored prior to their final destruction.

[0115] In some embodiments, the death of an alga, preferably a green alga, more preferably a green alga of the genus Ulva, may be assessed by the decolorating of the green tissues of algae into white tissues. As used herein, the decolorating of the green tissues of algae into white tissues may also referred to as the “bleaching” of the green tissues of algae. In practice, observation of dead (necrotic) white tissues may be visually assessed or assessed by the mean of naked eye (also referred to unaided eye), or by optical microscopy. In certain embodiments, white tissues may be observed from about 1 day to about 15 days after contacting the effective amount of a ribonucleic acid molecule, a polypeptide Pl, a polypeptide P2, or an algicide composition according to the instant invention with the alga, preferably the green alga, more preferably the Ulva algae, preferably at day light and/or at a temperature of from about 20°C to about 30°C. Within the scope of the instant invention, the expression “from about 1 day to about 15 days” encompasses 1 day, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 and 15 days. Within the scope of the instant invention, the expression “from about 20°C to about 30°C” encompasses 20°C, 21°C, 22°C, 23°C, 24°C, 25°C, 26°C, 27°C, 28°C, 29°C and 30°C. [0116] By “effective amount”, it is meant a level or amount of ribonucleic acid, polypeptide(s), or of an algicide composition, that is necessary and sufficient for slowing down or stopping the proliferation or the bloom of an alga, preferably a green alga, more preferably a green alga belonging to the genus Ulva.

[0117] In some embodiments, an effective amount of the ribonucleic acid to be used may range from about 1 * 10⁵ to about 1 * 10¹⁵ copies per kg or L of alga.

[0118] Within the scope of the instant invention, from about IxlO⁵ to about IxlO¹⁵ copies includes IxlO⁵, 2xl0⁵, 3xl0⁵, 4xl0⁵, 5xl0⁵, 6xl0⁵, 7xl0⁵, 8xl0⁵, 9xl0⁵, IxlO⁶, 2xl0⁶, 3xl0⁶, 4xl0⁶, 5xl0⁶, 6xl0⁶, 7xl0⁶, 8xl0⁶, 9xl0⁶, IxlO⁷, 2xl0⁷, 3xl0⁷, 4xl0⁷, 5xl0⁷, 6xl0⁷, 7xl0⁷, 8xl0⁷, 9xl0⁷, IxlO⁸, 2xl0⁸, 3xl0⁸, 4xl0⁸, 5xl0⁸, 6xl0⁸, 7xl0⁸, 8xl0⁸, 9xl0⁸, IxlO⁹, 2xl0⁹, 3xl0⁹, 4xl0⁹, 5xl0⁹, 6xl0⁹, 7xl0⁹, 8xl0⁹, 9xl0⁹, IxlO¹⁰, 2xlO¹⁰, 3xl0¹⁰, 4xlO¹⁰, 5xl0¹⁰, 6xlO¹⁰, 7xlO¹⁰, 8xl0¹⁰, 9xlO¹⁰, IxlO¹¹, 2xlOⁿ, 3xl0ⁿ,

4xlOⁿ, 5xl0ⁿ, 6xlOⁿ, 7xlOⁿ, 8xl0ⁿ, 9xlOⁿ, IxlO¹², 2xl0¹², 3xl0¹², 4xl0¹², 5xl0¹²,

6xl0¹², 7xl0¹², 8xl0¹², 9xl0¹², IxlO¹³, 2xl0¹³, 3xl0¹³, 4xl0¹³, 5xl0¹³, 6xl0¹³, 7xl0¹³,

8xl0¹³, 9xl0¹³, IxlO¹⁴, 2xl0¹⁴, 3xl0¹⁴, 4xl0¹⁴, 5xl0¹⁴, 6xl0¹⁴, 7xl0¹⁴, 8xl0¹⁴, 9xl0¹⁴ and IxlO¹⁵ copies, per kg or L of alga.

[0119] In certain embodiments, an effective amount of the polypeptide Pl and/or polypeptide P2 according to the invention may range from about 0.001 mg to about 3,000 mg, per kg or L, preferably from about 0.05 mg to about 1,000 mg, per kg or L.

[0120] Within the scope of the instant invention, from about 0.001 mg to about 3,000 mg includes, from about 0.001 mg, 0.002 mg, 0.003 mg, 0.004 mg, 0.005 mg, 0.006 mg, 0.007 mg, 0.008 mg, 0.009 mg, 0.01 mg, 0.02 mg, 0.03 mg, 0.04 mg, 0.05 mg, 0.06 mg, 0.07 mg, 0.08 mg, 0.09 mg, 0.1 mg, 0.2 mg, 0.3 mg, 0.4 mg, 0.5 mg, 0.6 mg, 0.7 mg, 0.8 mg, 0.9 mg, 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 6 mg, 7 mg, 8 mg, 9 mg, 10 mg, 20 mg, 30 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, 100 mg, 150 mg, 200 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, 800 mg, 850 mg, 900 mg, 950 mg, 1,000 mg, 1,100 mg, 1,150 mg, 1,200 mg, 1,250 mg, 1,300 mg, 1,350 mg, 1,400 mg, 1,450 mg, 1,500 mg, 1,550 mg, 1,600 mg, 1,650 mg, 1,700 mg, 1,750 mg, 1,800 mg, 1,850 mg, 1,900 mg, 1,950 mg, 2,000 mg, 2,100 mg, 2,150 mg, 2,200 mg, 2,250 mg, 2,300 mg, 2,350 mg, 2,400 mg, 2,450 mg, 2,500 mg, 2,550 mg, 2,600 mg, 2,650 mg, 2,700 mg, 2,750 mg, 2,800 mg, 2,850 mg, 2,900 mg, 2,950 mg and 3,000 mg per kg or L.

[0121] In certain embodiments, the polypeptide Pl and/or polypeptide P2 according to the invention is to be used to deliver from about 0.001 mg/kg to about 100 mg/kg, from about 0.01 mg/kg to about 50 mg/kg, preferably from about 0.1 mg/kg to about 40 mg/kg, preferably from about 0.5 mg/kg to about 30 mg/kg, from about 0.01 mg/kg to about 10 mg/kg, from about 0.1 mg/kg to about 10 mg/kg, and more preferably from about 1 mg/kg to about 25 mg/kg, of alga weight.

BRIEF DESCRIPTION OF THE DRAWINGS

[0122] Figure 1 is a scheme showing a statistical analysis of in vitro Breton Ulva lactuca proliferation with distinct samples of seawater of the bay of Marseille. Seawater samples collected in June 2018 in three different spots in the bay of Marseille. X (RN) was 43°18’N, 5°16’E; Y (RS) was 43°15’N, 5°19’E and Z (PR) was 43°14’N, 5°21’E. Seawater samples were divided in three groups of tubes (n=36). Breton Ulva lactuca collected in June 2018 at Brehec (north coast of Brittany 48°43’N 2°06’W) were cut in pieces of 1 cm² and put in the three groups of tubes corresponding to spots X, Y and Z in the bay of Marseille collected one day before sampling (DI). Ulva lactuca proliferation was carried out at 25°C with seawater in 50 ml tubes closed with a tape to induce anoxia. Proliferation was observed in 25 tubes/36 (69 %) in the X spot that corresponds to open sea, while it was 14 tubes/36 (39%) in the Y spots and only 1 tube/36 (2.7 %) in the Z spot, the closest of the shore (see the inserted graph). In tubes where Ulva lactuca could proliferate, confluence was reached after one week and acidity was detected. No acidity was observed in tubes where Ulva lactuca could not grow and Ulva lactuca became white after 5 days. Seawater from the Z spot was kept from D30 to DI 80 before to be incubated again with Breton Ulva lactuca and proliferation was observed in 12 tubes/36 (33 %) for D30 and in 36 tubes/36 (100 %) for D180 (see the inserted graph). [0123] Figure 2 is a photograph showing that Ulva lactuca became white in five days when incubate at 20°C and day light exposure with seawater from Z spot of the bay of Marseille.

[0124] Figure 3 is a photograph showing an agarose gel, the lanes corresponding to nested PCR amplicons obtained with seawater samples (BL-21, BL-22 D23 and BL-20 W7), seawater from a previous bleaching experiment (Gold) and seawater used with a newly infected alga. The right lane corresponds to the negative control. The expected amplicon size with the primer couple used is 191 bp.

[0125] Figure 4A-4C is set of photographs showing a bleaching experiment on Ulva in 1 m³ tanks infected with Gold 2 (Tanks 2 and 3), Gold 1 (Tank 4) or not infected (Tankl). The Tanks are represented at Day 12 (Fig. 4A), Day 15 (Fig. 4B) and Day 19 (Fig. 4C) of the experiment.

[0126] Figure 5A-5B is set of graphs showing standard’s dilution and q-PCR amplification. Fig. 5A shows melting curves obtained after q-PCR amplification of diluted standard samples; standard samples were analyzed in quadruplicates. Fig. 5B shows the standard curve defined using the log (dilution factors) and the Ct values of the 7 standards.

EXAMPLES

[0127] The present invention is further illustrated by the following examples.

Example 1 :

Materials and Methods

Bleaching of Ulva lactuca with seawater

[0128] Green algae were collected in the North coasts of Brittany (48°46’ N, 3°06’W) (Trieux, France). Proliferation assays were carried out in vitro with seawater samples from the bay of Marseille (Provence, South of France) (43°18’ N 5°16’E; RN). Green tubular algae were collected in November 2018 after a bloom in the Trieux fjord. Incubation was performed at 20°C for one month and with day light exposure with sea water collected in June 2018 in the north bay of Marseille.

[0129] Seawater samples were collected in surface in June 2018, 2019 and 2020, in 3 different spots at Marseille (Figure 1), 2 different spots in Provence, and 3 different spots in Brittany (see Table 1). Seawater samples were divided in three groups of tubes (n=36). Breton Ulva lactuca collected in June 2018 at Brehec (north coast of Brittany 48°43’N 2°6’O) were cut in pieces of 1 cm² and put in the three groups of falcon tubes (50 ml) corresponding to spots X, Y and Z in the bay of Marseille collected one day before sampling (DI).

[0130] Ulva lactuca were becoming white under day light at 20°C in five days (Figure 2).

Nucleic acids recovering from bleached Ulva lactuca samples

[0131] About 250 g of bleached leaves of Ulva lactuca were collected and grinded in a blender in about 500 mL of buffer comprising 0.5 M potassium phosphate buffer, pH 7.5. The grinded material was then filtered through gauze. 250 mL of chloroform were added and the mixture was stirred for 10 min at 4°C, and centrifuged to separate the phases at 500*g for 10 min at 4°C. The upper aqueous phase was collected and filtered through Miracloth and further centrifuged at 5,000*g for 10 min at 4°C. The supernatant was filtered through Miracloth, and transferred to an Erlenmeyer flask on ice.

Metagenomic analysis

[0132] Seawaters from tubes displaying bleached Ulva tissues were filtered by the means of a first filter with pore diameter of 0.45 pm and a second filter with pore diameter of 0.22 pm. Filtered samples were stored at -80°C previous to analysis.

[0133] RNA extraction from bleached Ulva tissues was performed with the MasterPure™ Epicentre® Tissue Samples, according to the manufacturer’s instructions.

[0134] TransNGS® Tn5 Index for Illumina® was used for multiplex sample preparation (library) for next generation sequencing. Primers N701, N702 and N505 were used, according to the manufacturer’s instructions.

Bioinformatic tools

[0135] Bioinformatic tools used in this study are the followings: Trimmomatic; SPAdes; BLASTp, BLASTx, BLASTn; HMM search; Prodigal; Genemark; Geneious; Bowtie; Primer-BLAST and primer 3; Gene aligners: MUSCLE, CLUSTALW; i-Tasser; ESyPred3D Web Server 1.0.

Results

Nucleic acid content analysis in bleached Ulva samples

[0136] Ulva lactuca samples from Trieuc fjord (Brittany, France 48°46’N, 3°06W) treated with seawater samples from Spot MU (La Ciotat, France; 43°09’N, 5°36’E; sample BL_15-09-2021) and which have undergone bleaching (presence of white tissue) were analyzed for their RNA content (see Table 2).

[0137] Table 2 below indicates the raw data stats for 20 samples.

[0138] First, bioinformatic analysis confirmed that Ulva genome could be retrieved from the samples, as 18S rRNA gene from Ulva lactuca was recovered (data not shown).

[0139] Sample BL_15-09-2021 contains abundant amount of RNA having the sequence of SEQ ID NO: 1. Bioinformatic analysis of this sequence revealed that it is a single positive stranded RNA with a poly A, of 8,970 bp. The RNA sequence SEQ ID NO: 1 is dicistronic, z'.e., comprises 2 non-overlapping open reading frames (ORFs), encoding 2 of SEQ ID NO: 4 and SEQ ID NO: 5 (pro-polypeptide 1 and pro-polypeptide 2, respectively). Characterization of the identified RNA sequence

[0140] Genomic organization of the RNA sequence SEQ ID NO: 1 was found to be parented to the genomic organization of viruses belonging to the family of Dicistroviridae . Pro-polypeptide 1 (SEQ ID NO: 4) shares with other Dicistroviridae viruses- the encoding sequence for RNA helicase, a protease (3C-protease) and a RNA dependent RNA polymerase (RdRpl). Pro-polypeptide 2 (SEQ ID NO: 5), on the other hand, shares with other Dicistroviridae viruses the encoding sequence for a structural polyprotein (VP1, VP2, VP3 and VP4) that after maturation is supposed to form viral structural proteins. [0141] Table 3 below indicates the percentage similarity of pro-polypeptide 1 (SEQ ID

NO: 4) with existing sequenced pro-polypeptides.

[0143] Table 4 below indicates the percentage similarity of pro-polypeptide 2 (SEQ ID NO: 5) with existing sequenced pro-polypeptides.

[0144] In addition, this RNA molecule is polyadenylated at the 3’ terminus (n=25 bp).

The RNA molecule actively undergoes transcription and promotes infection [0145] Upon viral RNAs purification, it was observed that the seawater samples comprise high levels of the virus-like single strand RNA, as well as a double stranded RNA (“ds RNA”), that would be indicative evidence that the RNA molecule replicates. In addition, because the RNA molecule possesses several binding sites for RNA- dependent RNA polymerase (“RDRP”), this would explain why there is a smear of intermediates replicative forms.

[0146] Consequently, the newly identified RNA molecule is able to replicate in the presence of Ulva lactuca.

Abundance of the RNA molecule in the sample

[0147] 1,912,720 out of the 36,616.914 reads were assembled to produce contigs, meaning that approximately 5.22% of the sequence reads recruited against the newly identified RNA molecule of sequence SEQ ID NO: 1. In addition, the RNA molecule of sequence SEQ ID NO: 1 represented 100 orders of magnitude higher as compared to the 18S rRNA gene of Ulva lactuca. Mode of action

[0148] In silico bioinformatic analysis demonstrated that the RNA molecule lacks the sequences encoding integrases that are typical and absolutely necessary to follow a lysogenic cycle. Thus, the RNA molecule belongs to a strict lytic virus, that does lead to killing the host cell. This agrees with the observations that putatively infected tissue of

Ulva lactuca loses the typical green pigmentation in addition to signs of degeneration (e.g., less consistency of tissue).

Example 2: Materials and Methods

Primers

[0149] The following set of primers was used for the PCR and qPCR reactions:

- Forward primer (F2): TGGGCATAATTGCGATTGTGTATTG (SEQ ID NO: 10);

- Reverse primer (R2): GTCTATTCGGGAGGTTACTCGA (SEQ ID NO: 11). Nested PCR

[0150] The reaction mix for the PCR was as follow:

[0151] Table 5: Mix PCR

[0152] The program used was as follow:

[0153] Table 6: PCR program

qPCR

[0154] Table 7: Mix qPCR

[0155] The program used was as follow:

[0156] Table 8: qPCR program

[0157] RT-Neg reactions were tested too, to be sure that there is no remaining of endogenous DNA in the sample after DNAse treatment.

Samples [0158] Seawater was sampled at the following locations: MU (Latitude 43°09’; Longitude 5°36’E), RN (Latitude 43°18’; Longitude 5°17’E)

[0159] The “Gold” sample is a seawater extract resulting from a previous series of bleaching experiments at La Ciotat (Provence, France). Ulva collected in Brittany at Saint Brieuc (BR: Latitude 48°43’; Longitude 2°56’W) on October 10^th 2021 were kept green and healthy in a control tank (20 L) with sea water also collected in Brittany. Two bleaching experiments were carried out at La Ciotat, one started on March 29^th 2022 and stopped on April 12^th 2022, called Gold 1 (6 liters), and another one started on April 22^th 2022 and stopped in May 11^th 2022, called Gold 2 (20 liters). Sea water was from Mugel calanque (MU: Latitude 43°09’; Longitude 5°36’E) and Ulva were from control tank.

[0160] The following marine organisms were tested: Elb - E3b: Sea anemone; E4b: Starfish; E5b: Marine red algae; E6b: Posidonia.

[0161] Seawater samples and marine organism samples were stored in RNAlater stabilization reagent.

Results

Nested PCR

[0162] Nested PCR was performed to confirm the ability of the couple of primers.

[0163] Amplificons were detected at the expected size (191 bp) for all seawater samples (Figure 3), validating the protocol. qPCR

[0164] Quantitative PCR was performed with the same set of primers as for nested PCR on several samples of marine organisms (Elb to E6b) and seawater (MU, PR, RS, WF, RN and Gold) in order to detect the RNA molecule responsible for Ulva bleaching.

[0165] 4 out of 14 samples showed amplification of the 191 bp amplicon from the RNA molecule (see Table 10). [0166] As expected, the RNA molecule was found in the Gold sample. It was also found in the RN and MU samples, the MU sample being the one with the highest amount of the RNA molecule, as illustrated by the low CT value. Interestingly, the RNA-molecule was also found in the E5b sample, corresponding to the red alga Sphaerococcus Coronopifolius.

[0167] Table 9: qPCR results

Example 3 :

[0168] In a previous series of experiments, the Applicant performed bleaching experiments in 6 L and 20 L tanks. A Scale Up bleaching experiment was performed on June 2022 with four 1 m³ tanks containing Ulva (10 cm layer) and sea water (800 L).

Materials and Methods

[0169] Every day from May to September 2021, 10 tons of Ulva were collected in the bay of Hillion (Britany, France). [0170] In four separate 1 m³ tanks, a layer up to 10 cm of green Ulva collected in the bay of Hillion (Britany, France) from May to September 2021 was added to 800 L of sea water collected in Hillion bay on June 2^nd 2022. The tanks were exposed to sunlight. Sea water temperature had an average of 15°C (± 5°C). [0171] Then, the tanks received different treatments :

- Tank 1 : control (nothing added),

- Tanks 2 and 3: addition of 10 liters of Gold 2 (see Example 2),

- Tank 4: addition of 6 liters of Gold 1 (see Example 2).

[0172] The four tanks were full green at Day 1.

Results

[0173] At Day 12 (June 13^th 2022), 50 % of Ulva were white due to viral lyses (bleaching) in tanks 2 and 3. Bleaching was starting in tank 4. The control tank 1 was green, as in day 1 (Figure 4A).

[0174] At Day 15 (June 16^th 2022), full bleaching was observed in Tanks 2, 3 and 4 and Tank 1 was green as in Day 1. The water, not the Ulva, in tank 4 was slightly green, probably due to the development of cyanobacteria (Figure 4B).

[0175] At Day 19 (Junie 20^th 2022), Ulva completely disappeared in Tanks 2 and 3. Few bleached Ulva were still visible in tank 4 and some bleaching due to dehydration appeared in Tank 1. Sampling was made on June 26^th 2022 for pH measurement (Figure 4C).

Example 4:

Materials and Methods

Primers, PCR mix and PCR program

[0176] See Example 2

Results

Standard’s dilution and q-PCR amplification

[0177] To assess copy number of virus in samples, the plasmid pUC57-Brick containing the full sequence of the virus, a T7 promoter and a T7 terminator were used. This plasmid construction is referred as ‘Standard’ (S). [0178] Seven serial dilutions of the standard were performed to determine the standard curve and the virus copy number in tested samples (see Table 10, Table 11, and Figure 5A-5B)

[0179] Table 10: Standard’s details

[0180] Table 11: Ct values of the 7 standards

Q-PCR amplification of samples and virus copy number assessment

[0181] q-PCR results showed that the virus is naturally present in Brittany. Notably, sea water collected at St-Michel-en-Greve (1) and Auray showed copy number of virus higher to those measured in bleaching experiments dated from BL-Dl-Sept 2022, BL-D12-Sept 2022 and from bleaching experiments 1, 2 and 3 (see Table 12).

[0182] Table 12: detection of the virus after q-PCR amplification of tested samples

[0183] The virus was thus identified on numerous occasions in 2022 on samples of bleached Ulva and on the red alga S. Coronopifolius, which seems to survive viral infection and act as a reservoir for the virus to reinfect Ulva when it reappears in winter.

Claims

1. An isolated ribonucleic acid molecule having at least 75% sequence identity with SEQ ID NO: 1, over the entire length.

2. The isolated ribonucleic acid molecule according to claim 1, wherein the ribonucleic acid molecule comprises a ribonucleic acid sequence having at least 75% sequence identity with SEQ ID NO: 2, over the entire length, preferably encoding a first polypeptide (polypeptide Pl).

3. The isolated ribonucleic acid molecule according to claim 1 or 2, wherein the ribonucleic acid molecule comprises a ribonucleic acid sequence having at least 75% sequence identity with SEQ ID NO: 3, over the entire length, preferably encoding a second polypeptide (polypeptide P2).

4. The isolated ribonucleic acid molecule according to any one of claims 1 to 3, wherein the sequence of the ribonucleic acid molecule consists of SEQ ID NO: 1.

5. An isolated polypeptide Pl having at least 75% amino acid identity with SEQ ID NO: 4, over the entire length.

6. An isolated polypeptide P2 having at least 75% amino acid identity with SEQ ID NO: 5, over the entire length.

7. An alga cell, preferably a green alga cell, comprising the ribonucleic acid molecule as defined in any one of claims 1 to 4, and/or expressing polypeptide Pl, as defined in claim 5, and/or expressing polypeptide P2, as defined in claim 7.

8. The alga cell according to claim 7, wherein polypeptide Pl is encoded by a ribonucleic acid molecule according to claim 2, and/or polypeptide P2 is encoded by a ribonucleic acid molecule according to claim 3.

9. The alga cell according to claim 7 or 8, wherein the alga cell belongs to the genus Ulva.

10. An algicide composition comprising at least one ribonucleic acid molecule according to any one of claims 1 to 4, and/or at least one polypeptide Pl according to claim 5, at least one polypeptide P2 according to claim 6.

11. Use of at least one ribonucleic acid molecule according to any one of claims 1 to 4, and/or at least one polypeptide Pl according to claim 5, and/or at least one polypeptide P2 according to claim 6 and/or an algicide composition according to claim 7 for biologically controlling an alga, preferably a green alga, more preferably a green alga belonging to the genus Ulva.

12. Use of at least one ribonucleic acid molecule according to any one of claims 1 to 4, and/or at least one polypeptide Pl according to claim 5, and/or at least one polypeptide P2 according to claim 6 and/or an algicide composition according to claim 10 for preventing a bloom of an alga, preferably a green alga, more preferably a green alga belonging to the genus Ulva.

13. A method for the biological control of an alga, preferably a green alga, more preferably a green alga belonging to the genus Ulva, comprising the step of contacting the alga with an effective amount of a ribonucleic acid molecule according to any one of claims 1 to 4, and/or a polypeptide Pl according to claim 5, and/or a polypeptide P2 according to claim 6, and/or an algicide composition according to claim 10.

14. A method for preventing a bloom of an alga, preferably a green alga, more preferably a green alga belonging to the genus Ulva, comprising the step of contacting the alga with an effective amount of a ribonucleic acid molecule according to any one of claims 1 to 4, and/or a polypeptide Pl according to claim 5, and/or a polypeptide P2 according to claim 6, and/or an algicide composition according to claim 10.

15. The method according to claim 13 or 14, wherein the biological control is to be performed in a marine environment.