WO2023277069A1

WO2023277069A1 - Method for producing negative-strand rna virus vector and produced negative-strand rna virus vector

Info

Publication number: WO2023277069A1
Application number: PCT/JP2022/025983
Authority: WO
Inventors: 晃一佐伯
Original assignee: 株式会社レプリテック
Priority date: 2021-06-30
Filing date: 2022-06-29
Publication date: 2023-01-05
Also published as: TW202400795A; JPWO2023277069A1; AU2022302552A1; WO2024004235A1; CN117651774A; EP4365298A1; CA3225564A1

Abstract

The present disclosure provides a method for producing a negative-strand RNA virus vector. The present disclosure specifically provides a method for producing a negative-strand RNA virus vector in the presence of a PKR inhibitory factor.

Description

Method for producing minus-strand RNA viral vector and produced minus-strand RNA viral vector

The present invention relates to a method for producing a minus-strand RNA viral vector and the produced minus-strand RNA viral vector.

Minus-strand RNA viral vectors, typified by Sendai virus vectors, can be useful for gene transfer or for cytokine induction. Minus-strand RNA viral vectors typified by Sendai virus vectors can be advantageously produced in packaging cells by producing them from cDNA (Patent Document 1).

E3L of vaccinia virus is a double-stranded RNA-binding protein and has been reported to promote interferon resistance and intracellular proliferation (Non-Patent Document 1). Inhibition of protein kinase R (PKR) using K3L, E3L, VAI RNA, EBER, σ3, TRBP, and combinations thereof in the production of poxvirus or vaccinia virus, PKR being a double-stranded RNA binding protein is disclosed (Patent Document 2). It has been disclosed that C8L and K3L are pseudosubstrates of protein kinase R (PKR) (Non-Patent Document 2). It has been suggested that NS5A or NS5A(1-148) may inhibit antiviral activity against HCV (Non-Patent Document 3). A virus production method using VAI RNA has been disclosed (Patent Document 3).

WO2005/071092 WO98/040500 WO95/011983

The present invention provides a method for producing a minus-strand RNA viral vector and the produced minus-strand RNA viral vector.

The present inventors found that, in a method for producing a minus-strand RNA ^virus , It was found that allowing the packaging cell to express the genomic RNA of the minus-strand RNA virus to form the minus-strand RNA virus increased the amount of virus produced in the packaging cell.

According to the present invention, for example, the following inventions can be provided.
(1) A method for producing a negative-strand RNA virus or viral vector, comprising:
from a gene encoding a protein kinase R (PKR) inhibitory factor (e.g., a PKR inhibitory viral factor, human nc886, human p58 ^IPK , or NS5A, or a combination thereof) operably linked to a regulatory sequence; expressing and supplying the factor to packaging cells;
Expressing the genomic RNA of a minus-strand RNA virus or viral vector in a packaging cell to form a minus-strand RNA virus or viral vector in the presence of said factor {e.g., a PKR-inhibiting factor, e.g., a PKR-inhibiting expressing the genomic RNA of the minus-strand RNA virus or viral vector in the packaging cell in the presence of the viral factor of to form the minus-strand RNA virus or viral vector; The described DNA can be used to express the genomic RNA and the PKR inhibitory factor},
recovering the formed negative-strand RNA virus or viral vector;
including
Preferably, the relationship between said virus or viral vector and said PKR-inhibiting agent is heterologous, and/or the relationship between said regulatory sequence and said PKR-inhibiting agent is heterologous.
Method.
(2) The method according to (1) above, wherein the minus-strand RNA virus or viral vector is a Sendai virus vector.
(3) the PKR inhibitory factor is adenovirus VAI RNA, EB virus EBER, human nc886, HIV virus TAR, poliovirus 2A ^pro , vaccinia virus E3L, reovirus δ3, influenza virus NS1 , human p58 ^IPK , hepatitis C virus NS5A, vaccinia virus K3L, HIV virus Tat, herpes simplex virus Us11, and herpes simplex virus ICP34.5, and orthologs thereof. The method according to (1) or (2) above.
(4) The method according to any one of (1) to (3) above, wherein the minus-strand RNA virus or viral vector is produced in the absence of a helper virus.
(5) The method according to any one of (1) to (4) above, wherein the genomic RNA further comprises a gene encoding a PKR inhibitory factor operably linked to the regulatory sequence.
(6) The method according to any one of (1) to (5) above, wherein the packaging cell has genomic DNA having a gene encoding a PKR inhibitory factor operably linked to a regulatory sequence.
(7) The method according to any one of (1) to (6) above, wherein the packaging cells are Vero cells or LLC-MK2 cells.
(8) Any one of (1) to (7) above, wherein the packaging cells are a cell population consisting of Vero cells or a cell population consisting of LLC-MK2 cells, and do not contain other cells. The method described in .
(9) The RNA genome of a negative-strand RNA virus or viral vector that expressably contains a gene encoding any one or more of the PKR inhibitory factors.
(10) A minus-strand RNA virus or viral vector comprising the RNA genome of (9) above.
(11) The minus-strand RNA virus or viral vector according to (10) above, further comprising a target gene.
(12) A composition comprising the minus-strand RNA virus or viral vector of (10) or (11) above.
(13) A DNA encoding the RNA genome of (9) above.
(14) A gene expression vector comprising the DNA of (13) above operably linked to a control sequence.

(15) The composition according to (12) above, which has an infectious titer of 1×10 ⁵ CIU/mL or more.
(16) The composition according to (12) above, which has an infectious titer of 1×10 ⁶ CIU/mL or more.
(17) The composition according to (12) above, which has an infectious titer of 1×10 ⁷ CIU/mL or more.
(18) The method according to any one of (1) to (8) above, wherein the PKR inhibitory factor has the sequence set forth in any one of SEQ ID NOS: 4-31.
(19) The minus-strand RNA virus or viral vector according to any one of (9) to (11) above, wherein the PKR inhibitory factor has a sequence according to any one of SEQ ID NOS: 4-31.
(20) The composition according to (12) above, wherein the PKR inhibitory factor has a sequence according to any one of SEQ ID NOS: 4-31.
(21) The DNA according to (13) above, wherein the PKR inhibitory factor has a sequence according to any one of SEQ ID NOS: 4-31.
(22) The gene expression vector according to (14) above, wherein the PKR inhibitory factor has a sequence according to any one of SEQ ID NOS: 4-31.

(23) The above (1), wherein expressing the factor is carried out by introducing into the packaging cell a plasmid vector having a gene encoding the factor operably linked to a first control sequence. The method according to any one of (8).
(24) The above ( 1) The method according to any one of (8).
(25) expressing the factor is performed by introducing into the packaging cell a plasmid vector having a gene encoding the factor operably linked to a first regulatory sequence; and
(1) to above, wherein the expression of the genomic RNA is performed by introducing a plasmid vector having a gene encoding the genomic RNA operably linked to a second regulatory sequence into the packaging cell. (8) The method according to any one of the above.
(26) Forming a negative-strand RNA virus or viral vector comprises placing in the packaging cell a plasmid having a gene encoding viral genomic RNA operably linked to a second control sequence and a third control (1) to (8) above, comprising introducing a plasmid having a gene encoding a viral component operably linked to a sequence and expressing the genomic RNA and the viral component in the cell. The method according to any one of
(27) The method according to (26) above, wherein the third regulatory sequence is the EF1α promoter and the viral component comprises either or both of the N protein and the L protein. (28) The above (26), wherein the third regulatory sequence is the EF1α promoter, and the viral component is one or more selected from the group consisting of N protein, P protein and L protein, or all of them. the method of.
(29) The method according to (28) above, wherein the packaging cells are Vero cells.
(30) The method according to (26) above, wherein the third regulatory sequence is the EF1α promoter and the viral component comprises either or both of the P protein and the L protein. (31) The method according to (26) above, wherein the third regulatory sequence is the EF1α promoter and the viral component is the L protein.
(32) The method according to (30) above, wherein the packaging cells are LLC-MK2 cells.
(33) The method according to (31) above, wherein the packaging cells are LLC-MK2 cells.

(34) the PKR inhibitory factor is
A method according to any of the above, comprising (i) E3L or a portion thereof, preferably a peptide comprising at least the C-terminal 107 amino acids of E3L, and (ii) K3L.
(35) the PKR inhibitory factor is
A method according to any of the above, comprising (i) E3L or a portion thereof, preferably a peptide comprising at least the C-terminal 107 amino acids of E3L, and (iii) Y3.
(36) The method according to (34) above, wherein the PKR inhibitory factor further comprises VAI.
(37) The method according to (35) above, wherein the PKR inhibitory factor further comprises VAI.
(38) The method according to any of the above, wherein the PKR inhibitory factor comprises VAI, and VAI is a molecule having the sequence set forth in SEQ ID NO:17.
(39) The method according to any of the above, wherein the PKR inhibitory factor comprises VAI and the PKR inhibitory factor is a molecule having the sequence set forth in SEQ ID NO:19.
(40) The method according to any of the above, wherein the PKR inhibitory factor is a molecule having the sequence set forth in any of SEQ ID NOS: 18, 21-26.
(41) The method according to any of the above, wherein the PKR inhibitory factor comprises nc886.
(42) The method according to any of the above, wherein the PKR inhibitory agent is a molecule having the sequence set forth in SEQ ID NO: 13 or 14.

(43) The method according to (5) above, wherein the genomic RNA has a gene encoding a target protein, and the PKR inhibitory factor is VAI or a sequence according to any one of SEQ ID NOS: 17-26. wherein VAI is contained in the 3'UTR of a gene encoding said protein of interest.
(44) The method according to any of (43) above, wherein the packaging cell has genomic DNA having a gene encoding a PKR inhibitory factor operably linked to a regulatory sequence.
(45) The method according to (44) or (45) above, wherein the packaging cells are Vero cells or LLC-MK2 cells.
(46) Any one of (44) to (46) above, wherein the packaging cells are a cell population consisting of Vero cells or a cell population consisting of LLC-MK2 cells, and do not contain other cells. The method described in .

(47) The RNA genome according to (9) above, which has a gene encoding a target protein, and wherein the PKR inhibitory factor has VAI or a sequence according to any one of SEQ ID NOS: 17-26. molecule, wherein the RNA molecule having a sequence set forth in VAI or any of SEQ ID NOS: 17-26 is contained in the 3'UTR of a gene encoding said protein of interest.
(48) A minus-strand RNA virus or viral vector comprising the RNA genome of (47) above.

(49) A method for producing a negative-strand RNA virus or viral vector, comprising:
expressing the factor from the gene encoding NS5A operably linked to regulatory sequences and supplying it to packaging cells;
expressing the genomic RNA of a negative-strand RNA virus or viral vector in a packaging cell in the presence of NS5A to form a negative-strand RNA virus or viral vector;
recovering the formed negative-strand RNA virus or viral vector;
including
the relationship between said virus or viral vector and said NS5A is heterologous and/or the relationship between said regulatory sequence and said NS5A is heterologous;
Method.
(50) A method for producing a negative-strand RNA virus or viral vector, comprising:
expressing the factor from a gene encoding the PKR-inhibiting factor operably linked to regulatory sequences and supplying it to packaging cells, wherein the PKR-inhibiting factor is human nc886 (VTRNA2-1) and either or both of human p58 ^IPK ;
allowing the packaging cell to express the genomic RNA of the negative-strand RNA virus or viral vector in the presence of the PKR inhibitory factor to form a negative-strand RNA virus or viral vector;
recovering the formed negative-strand RNA virus or viral vector;
including,
wherein the relationship between the regulatory sequence and the PKR inhibitory factor may be heterologous;
Method.
(51) The method according to (49) or (50) above, wherein the minus-strand RNA virus or viral vector is a Sendai virus vector.
(52) The method according to any one of (49) to (51) above, wherein the genomic RNA further comprises a gene encoding a PKR inhibitory factor operably linked to the regulatory sequence.
(53) The method according to any one of (49) to (52) above, wherein the packaging cell has genomic DNA having a gene encoding a PKR inhibitory factor operably linked to a regulatory sequence.
(54) The method according to any one of (49) to (53) above, wherein the packaging cells are Vero cells or LLC-MK2 cells.
(55) Any one of (49) to (54) above, wherein the packaging cells are a cell population consisting of Vero cells or a cell population consisting of LLC-MK2 cells, and do not contain other cells. The method described in .
(56) The RNA genome of a negative-strand RNA virus or viral vector that expressably comprises a gene encoding any one or more of the PKR inhibitory factors.
(57) A minus-strand RNA virus or viral vector comprising the RNA genome of (56) above.
(58) The minus-strand RNA virus or viral vector of (57) above, further comprising a gene of interest.
(59) A composition comprising the minus-strand RNA virus or viral vector of (57) or (58) above.
(60) A DNA encoding the RNA genome of (56) above.
(61) A gene expression vector comprising the DNA of (60) above operably linked to a control sequence.

(71) A gene expression vector (preferably a plasmid) for the RNA genome, comprising a regulatory sequence (preferably a promoter sequence), a first DNA and a second DNA in that order,
the first DNA encodes the RNA genome of an RNA virus;
The second DNA encodes a protein kinase R (PKR) inhibitory factor (e.g., a PKR inhibitory viral factor (preferably VAI RNA, EBER, nc886, and TAR, and orthologs thereof)). ,
forming a contiguous region comprising a first DNA and a second DNA, the region being operably linked to a regulatory sequence, whereby the first DNA and the second DNA are united A gene expression vector that is transcribed into the RNA of
(72) The gene expression vector of (71) above, wherein the protein kinase R (PKR) inhibitory factor is VAI.
(73) The gene expression vector according to (71) above, further comprising a self-cleaving ribozyme sequence between the first DNA and the second DNA.
(74) The gene expression vector of (72) above, further comprising a self-cleaving ribozyme sequence between the first DNA and the second DNA.
(75) The gene expression vector according to (71) above, further comprising a self-cleaving ribozyme sequence between the regulatory sequence and the first DNA.
(76) The gene expression vector of (72) above, further comprising a self-cleaving ribozyme sequence between the control sequence and the first DNA.
(77) The gene expression vector of (73) above, further comprising a self-cleaving ribozyme sequence between the regulatory sequence and the first DNA.
(78) The gene expression vector of (74) above, further comprising a self-cleaving ribozyme sequence between the regulatory sequence and the first DNA.
(79) The invention according to any one of the above, wherein the VAI RNA is part of SEQ ID NOS: 19, 20, and 23-26 and may have a sequence comprising the nucleotide sequence set forth in SEQ ID NO: 17. .
(80) (i) VAI RNA, wherein the VAI RNA is part of SEQ ID NOS: 19, 20, and 23-26 and corresponds to a sequence comprising the nucleotide sequence set forth in SEQ ID NO: 17; and (ii) VAI Any of the above inventions having a sequence that includes either or both of the 5' and 3' sequences of RNA.

Figure 1A is the secondary structure of VAI RNA. The 74th base is indicated by an arrow. FIG. 1B is a sequence containing VAI RNA and its mutated sequence. FIG. 2 shows the results of experiments confirming the reconstitution efficiency of minus-strand RNA viral vectors produced in the presence or absence of VAI. FIG. 3 shows the results of an experiment confirming the infectious titer of the minus-strand RNA viral vector produced in FIG. FIG. 4 shows the results of experiments confirming the reconstitution efficiency of minus-strand RNA viral vectors produced in the presence or absence of nc886. FIG. 5 shows the results of experiments confirming the reconstitution efficiency of minus-strand RNA viral vectors produced in the presence or absence of PKR-inhibiting viral factors. FIG. 6 shows the results of an experiment confirming the infectious titer of the minus-strand RNA viral vector produced in FIG. FIG. 7 shows the results of experiments confirming the reconstitution efficiency of minus-strand RNA viral vectors produced in the presence or absence of a fusion sequence of a PKR inhibitor. FIG. 8 shows the results of an experiment in which expression promoters were compared in LLC-MK2-F cells and the reconstitution efficiency of minus-strand RNA viral vectors produced in the presence or absence of PKR inhibitors was confirmed. FIG. 9 shows the results of an experiment in which expression promoters were compared in Vero-F cells and the reconstitution efficiency of minus-strand RNA viral vectors produced in the presence or absence of PKR inhibitors was confirmed. FIG. 10 shows the results of experiments confirming the reconstitution efficiency of minus-strand RNA viral vectors produced in the presence or absence of multiple PKR inhibitors. FIG. 11 shows the results of an experiment confirming the infection titer of the minus-strand RNA viral vector produced in FIG. FIG. 12 shows the results of an experiment confirming the reconstitution efficiency of negative-strand RNA viral vectors produced with or without a PKR inhibitory factor in the viral genome. FIG. 13 shows the results of an experiment confirming the infection titer of the minus-strand RNA viral vector produced in FIG. Fig. 14 shows the results of confirming the reconstitution efficiency of a minus-strand RNA viral vector with VAI RNA extended to the 5' and 3' sides. FIG. 15 shows the effect of introducing a hammerhead ribozyme between the T7 promoter and the DNA encoding the SeV genome and the efficiency of SeV reconstitution using packaging cells that constitutively expressed a PKR inhibitor. Figure 16 shows that the introduction of the hammerhead ribozyme between the T7 promoter and the DNA encoding the SeV genome and the introduction of the HDV ribozyme between the DNA encoding the SeV genome and the VAI RNA increased the SeV reconstitution efficiency. shows the effect on FIG. 17 shows the results of PCR experiments demonstrating that the HDV ribozyme self-cleavages VAI RNA from the SeV genome. FIG. 18 shows the effect of introducing VAI (330 bp) 74c into the SeV reconstitution plasmid on SeV reconstitution efficiency. FIG. 19 shows the effect of introducing VAI (330 bp) 74c into the SeV reconstitution plasmid in combination with E3Y3 on SeV reconstitution efficiency. FIG. 20 shows the effect of introducing VAI (330 bp) 74c into the SeV reconstituting plasmid in combination with E3Y3 on SeV infectious titer. FIG. 21A shows maps of the pCAG-SeV and pEF1-SeV constructs used in the experiment. FIG. 21B shows the reconstitution efficiency of pCAG-SeV and pEF1-SeV. Figure 22 shows the effect of VAI RNA on the reconstitution efficiency of mumps virus (MuV; family Paramyxoviridae, genus Rubulavirus). FIG. 23 shows the effect of VAI RNA on the reconstitution efficiency of measles virus (MeV; family Paramyxoviridae, genus Morbillivirus). FIG. 24 shows the effect of E3Y3 on the reconstitution efficiency of vesicular stomatitis virus (VSV; family Rhabdoviridae, genus Vesiculovirus). Figure 25 shows the reconstitution efficiency of SeV, MeV, MuV using heterologous RNA polymerases. Figure 26 shows the efficiency of VSV reconstitution using heterologous RNA polymerases. Figure 27A shows a map of the p3vLPNP construct used in the experiment. FIG. 27B shows the results of reconstitution of SeV with pCAG-SeV or pEF1-SeV and p3vLPNP.

Specific description of the invention

As used herein, a "minus-strand RNA viral vector" is a recombinant virus obtained by modifying a virus having a minus-strand RNA genome (that is, a minus-strand RNA virus) for introduction of a target gene. Negative-strand RNA viruses include Orthomyxoviridae (orthomyxoviruses such as influenza virus), Paramyxoviridae (paramyxoviruses such as the genus Mobilivirus), Rhabdoviridae (rhabdoviruses such as rabies virus), filo Viridae (filoviruses such as Ebola and Marburg virus), and Bunyaviridae (buniaviruses such as Hantavirus). Paramyxoviruses include viruses of the subfamily Orthoparamyxovirinae. Viruses of the subfamily Orthoparamyxovirinae include viruses of the genus Respirovirus, such as Sendai virus.

As used herein, "protein kinase R" (PKR) is a protein kinase that is activated by double-stranded RNA. PKR is encoded by the EIF2AK2 gene in humans. PKR contains an N-terminal double-stranded RNA binding domain and a C-terminal kinase domain. The kinase domain has an apoptosis-inducing function. PKR is activated by dimerization by binding to double-stranded RNA, followed by autophosphorylation. Activated PKR phosphorylates the eukaryotic translation initiation factor eIF2α. Phosphorylation of eIF2α inhibits translation of intracellular mRNA. Activated PKR can also induce apoptosis in cells to prevent viral spread. Some viruses possess factors that oppose PKR (ie, PKR-inhibiting viral factors). For example, certain viruses produce decoy RNAs that bind to PKR and prevent its activation. Decoy RNAs include adenovirus VAI RNA (e.g., having the sequence set forth in SEQ ID NO: 17), EB virus EBER (e.g., having the sequence set forth in SEQ ID NO: 4), and HIV TAR (e.g., having the sequence having the sequence described in number 5). Poliovirus 2A ^pro (eg, having the sequence shown in SEQ ID NO: 6) is known as a molecule that induces degradation of PKR. For RNA agents, a terminator (eg, T7 terminator for T7 polymerase) may be ligated to the 3' end of the nucleotide encoding the RNA. Factors that mask viral double-stranded RNA to prevent activation of PKR include vaccinia virus E3L (e.g., having the sequence set forth in SEQ ID NO: 7), reovirus σ3 (e.g., having the sequence set forth in SEQ ID NO: 8). ), herpes simplex virus Us11 (eg, having the sequence set forth in SEQ ID NO:29), and influenza virus NS1 (eg, having the sequence set forth in SEQ ID NO:28). Pseudosubstrates include K3L of vaccinia virus (eg, having the sequence set forth in SEQ ID NO: 10) and Tat of HIV (eg, having the sequence set forth in SEQ ID NO: 11). Molecules that induce substrate dephosphorylation include ICP34.5 of herpes simplex virus (eg, having the sequence set forth in SEQ ID NO: 12). These factors are PKR inhibitory viral factors. These factors can be naturally occurring.

As used herein, "nc886" is a non-coding RNA, also referred to as VTRNA2-1, CBL3, and hvg-5. nc886 functions as a direct inhibitor of PKR. nc886 can have, for example, the sequence set forth in SEQ ID NO:13. As used herein, “p58 ^IPK ” is a protein that is found as a cytoplasmic protein and functions as an inhibitor of PKR. The p58 ^IPK can be, for example, human p58 ^IPK , and can have, for example, the sequence of SEQ ID NO:9. These factors can be naturally occurring.

As used herein, "NS5A" is a nonstructural protein possessed by hepatitis C virus (HCV). NS5A is a phosphorylated protein and has been shown to be essential for HCV genome replication. In addition, NS5A (for example, having the sequence set forth in SEQ ID NO: 15) can inhibit antiviral activity against HCV and brain myocardial virus (Medical Journal of Kobe University, 2003, 64(1/2): 7-15 reference). NS5A may be deleted from its C-terminal side (for example, after the 149th amino acid). For example, NS5A can be NS5A(1-148), having amino acids 1-148 thereof (eg, having the sequence set forth in SEQ ID NO: 16). These factors can be naturally occurring.

In some embodiments, the VAI RNA can be (i) a nucleic acid comprising the sequence set forth in SEQ ID NO: 17, and (ii) 1, 2, 3, 4, or 5 nucleic acids in the sequence set forth in SEQ ID NO: 17 are , deletions, substitutions, insertions, and/or additions, or (iii) a sequence having 90% or more or 95% or more identity to the sequence set forth in SEQ ID NO: 17 or (iv) a fragment thereof, and
It can be a nucleic acid that has the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR). According to Examples described later, the viral reconstitution rate is improved by inhibiting PKR in packaging cells. Accordingly, the PKR to be inhibited is preferably the animal species from which the packaging cells are derived. For example, Vero cells are derived from African green monkeys and LLC-MK2 cells are derived from rhesus monkeys. Therefore, it is preferable to inhibit African green monkey and rhesus monkey PKR in these cells, respectively.

In a preferred embodiment, the VAI RNA may have the 5' sequence of the VAI RNA added to its 5' end. In a preferred embodiment, the VAI RNA may extend 5' to include the 5' flanking region. Sequences added to the 5' end include the sequences at positions 1-84 of SEQ ID NOs: 19, 20, and 23-26, or a portion thereof that is contiguous with VAI RNA. For example, VAI RNA may have the nucleotide sequence set forth in SEQ ID NO:34.

In a preferred embodiment, the VAI RNA may have the 3' sequence of the VAI RNA added to its 3' end. In a preferred embodiment, the VAI RNA may extend 3' to include the 3' flanking region. Sequences added to the 3' end include the sequences of positions 265-330 of SEQ ID NOs: 19, 20, and 23-26, or a portion thereof that is contiguous with VAI RNA. For example, VAI RNA may have the nucleotide sequence set forth in SEQ ID NO:35.

In a preferred embodiment, VAI RNA may have the 5' sequence of VAI RNA added to its 5' end and the 3' sequence of VAI RNA added to its 3' end. . In a preferred embodiment, the VAI RNA may extend 5' and 3' to include a 5' flanking region and a 3' flanking region, respectively. Sequences added to the 5' end include the sequences at positions 1-84 of SEQ ID NOs: 19, 20, and 23-26, or a portion thereof that is contiguous with VAI RNA. Sequences added to the 3' end include the sequences of positions 265-330 of SEQ ID NOs: 19, 20, and 23-26, or a portion thereof that is contiguous with VAI RNA.

In a preferred embodiment, the VAI RNA is part of SEQ ID NOS: 19, 20, and 23-26 and is a sequence corresponding to a sequence comprising the nucleotide sequence set forth in SEQ ID NO: 17, wherein: (i) VAI RNA and (ii) a sequence containing either or both of the 5' and 3' sequences of VAI RNA. For example, the VAI RNA may have a sequence that is part of SEQ ID NOS: 19, 20, and 23-26 and includes the nucleotide sequence set forth in SEQ ID NO:17.

In some embodiments, the EBER can be (i) a nucleic acid comprising the sequence set forth in SEQ ID NO:4, and (ii) 1, 2, 3, 4, or 5 nucleic acids in the sequence set forth in SEQ ID NO:4 are It can be a nucleic acid consisting of a deleted, substituted, inserted and/or added sequence, or (iii) contains a sequence that is 90% or more or 95% or more identical to the sequence set forth in SEQ ID NO: 4 can be a nucleic acid, or (iv) can be a fragment thereof, and
It can be a nucleic acid that has the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).

In some embodiments, the TAR can be (i) a nucleic acid comprising the sequence set forth in SEQ ID NO:5, and (ii) 1, 2, 3, 4, or 5 nucleic acids in the sequence set forth in SEQ ID NO:5 are It can be a nucleic acid consisting of a deleted, substituted, inserted and/or added sequence, or (iii) contains a sequence that is 90% or more or 95% or more identical to the sequence set forth in SEQ ID NO:5 can be a nucleic acid, or (iv) can be a fragment thereof, and
It can be a nucleic acid that has the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).

In some embodiments, the 2A ^pro can be a peptide comprising (i) the sequence set forth in SEQ ID NO:6, and (ii) 1, 2, 3, 4, or 5 amino acids in the sequence set forth in SEQ ID NO:6 , deletions, substitutions, insertions, and/or additions, or (iii) a sequence having 90% or more or 95% or more identity with the sequence set forth in SEQ ID NO: 6 or (iv) a fragment thereof, and
It can be a peptide that has the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).

In some embodiments, E3L can be a peptide comprising (i) the sequence set forth in SEQ ID NO:7, and (ii) 1, 2, 3, 4, or 5 amino acids in the sequence set forth in SEQ ID NO:7 are It can be a peptide consisting of a deleted, substituted, inserted and/or added sequence, or (iii) contains a sequence that is 90% or more or 95% or more identical to the sequence set forth in SEQ ID NO:7 may be a peptide, or (iv) a fragment thereof, and
It can be a peptide that has the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).

In some embodiments, σ3 can be (i) a peptide comprising the sequence set forth in SEQ ID NO:8, and (ii) 1, 2, 3, 4, or 5 amino acids in the sequence set forth in SEQ ID NO:8 are It can be a peptide consisting of a deleted, substituted, inserted and/or added sequence, or (iii) contains a sequence that is 90% or more or 95% or more identical to the sequence set forth in SEQ ID NO:8 may be a peptide, or (iv) a fragment thereof, and
It can be a peptide that has the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).

In some aspects, the p58 ^IPK can be a peptide comprising (i) the sequence set forth in SEQ ID NO:9, and (ii) 1, 2, 3, 4, or 5 amino acids in the sequence set forth in SEQ ID NO:9 , deletions, substitutions, insertions, and/or additions, or (iii) a sequence having 90% or more or 95% or more identity to the sequence set forth in SEQ ID NO:9 or (iv) a fragment thereof, and
It can be a peptide that has the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).

In some embodiments, K3L can be a peptide comprising (i) the sequence set forth in SEQ ID NO: 10, and (ii) 1, 2, 3, 4, or 5 amino acids in the sequence set forth in SEQ ID NO: 10 are It can be a peptide consisting of a deleted, substituted, inserted and/or added sequence, or (iii) contains a sequence that is 90% or more or 95% or more identical to the sequence set forth in SEQ ID NO: 10 may be a peptide, or (iv) a fragment thereof, and
It can be a peptide that has the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).

In certain aspects, Tat can be a peptide comprising (i) the sequence set forth in SEQ ID NO: 11, and (ii) 1, 2, 3, 4, or 5 amino acids in the sequence set forth in SEQ ID NO: 11 are It can be a peptide consisting of a deleted, substituted, inserted and/or added sequence, or (iii) contains a sequence that is 90% or more or 95% or more identical to the sequence set forth in SEQ ID NO: 11 may be a peptide, or (iv) a fragment thereof, and
It can be a peptide that has the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).

In one aspect, ICP34.5 can be a peptide comprising (i) the sequence set forth in SEQ ID NO: 12, (ii) 1, 2, 3, 4, or 5 amino acids in the sequence set forth in SEQ ID NO: 12 may be a peptide consisting of a deleted, substituted, inserted and/or added sequence, or (iii) a sequence having 90% or more or 95% or more identity with the sequence set forth in SEQ ID NO: 12 or (iv) a fragment thereof, and
It can be a peptide that has the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).

In some embodiments, nc886 can be (i) a nucleic acid comprising the sequence set forth in SEQ ID NO: 13, and (ii) 1, 2, 3, 4, or 5 nucleic acids in the sequence set forth in SEQ ID NO: 13 are It can be a nucleic acid consisting of a deleted, substituted, inserted and/or added sequence, or (iii) contains a sequence that is 90% or more or 95% or more identical to the sequence set forth in SEQ ID NO: 13 can be a nucleic acid, or (iv) can be a fragment thereof, and
It can be a nucleic acid that has the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).

In some embodiments, nc886 can be (i) a nucleic acid comprising the sequence set forth in SEQ ID NO: 14, and (ii) 1, 2, 3, 4, or 5 nucleic acids in the sequence set forth in SEQ ID NO: 14 are It can be a nucleic acid consisting of a deleted, substituted, inserted, and/or added sequence, or (iii) contains a sequence that is 90% or more or 95% or more identical to the sequence set forth in SEQ ID NO: 14 can be a nucleic acid, or (iv) can be a fragment thereof, and
It can be a nucleic acid that has the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).

In some embodiments, the VAI RNA can be (i) a nucleic acid comprising the sequence set forth in SEQ ID NO: 18, and (ii) 1, 2, 3, 4, or 5 nucleic acids in the sequence set forth in SEQ ID NO: 18 are , deletions, substitutions, insertions, and/or additions, or (iii) a sequence having 90% or more or 95% or more identity to the sequence set forth in SEQ ID NO: 18 or (iv) a fragment thereof, and
It can be a nucleic acid that has the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).

In some embodiments, the VAI RNA can be (i) a nucleic acid comprising the sequence set forth in SEQ ID NO: 19, and (ii) 1, 2, 3, 4, or 5 nucleic acids in the sequence set forth in SEQ ID NO: 19 are , deletions, substitutions, insertions, and/or additions, or (iii) a sequence having 90% or more or 95% or more identity to the sequence set forth in SEQ ID NO: 19 or (iv) a fragment thereof, and
It can be a nucleic acid that has the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).

In some embodiments, the VAI RNA can be (i) a nucleic acid comprising the sequence set forth in SEQ ID NO:20, and (ii) 1, 2, 3, 4, or 5 nucleic acids in the sequence set forth in SEQ ID NO:20 are , deletions, substitutions, insertions, and/or additions, or (iii) a sequence having 90% or more or 95% or more identity to the sequence set forth in SEQ ID NO: 20 or (iv) a fragment thereof, and
It can be a nucleic acid that has the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).

In some embodiments, the VAI RNA can be (i) a nucleic acid comprising the sequence set forth in SEQ ID NO:21, and (ii) 1, 2, 3, 4, or 5 nucleic acids in the sequence set forth in SEQ ID NO:21 are , deletions, substitutions, insertions, and/or additions, or (iii) a sequence having 90% or more or 95% or more identity to the sequence set forth in SEQ ID NO: 21 or (iv) a fragment thereof, and
It can be a nucleic acid that has the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).

In some embodiments, the VAI RNA can be (i) a nucleic acid comprising the sequence set forth in SEQ ID NO:22, and (ii) 1, 2, 3, 4, or 5 nucleic acids in the sequence set forth in SEQ ID NO:22 are , deletions, substitutions, insertions, and/or additions, or (iii) a sequence having 90% or more or 95% or more identity to the sequence set forth in SEQ ID NO: 22 or (iv) a fragment thereof, and
It can be a nucleic acid that has the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).

In some embodiments, the VAI RNA can be (i) a nucleic acid comprising the sequence set forth in SEQ ID NO:23, and (ii) 1, 2, 3, 4, or 5 nucleic acids in the sequence set forth in SEQ ID NO:23 are , deletions, substitutions, insertions, and/or additions, or (iii) a sequence that is 90% or more or 95% or more identical to the sequence set forth in SEQ ID NO: 23. or (iv) a fragment thereof, and
It can be a nucleic acid that has the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).

In some embodiments, the VAI RNA can be (i) a nucleic acid comprising the sequence set forth in SEQ ID NO:24, and (ii) 1, 2, 3, 4, or 5 nucleic acids in the sequence set forth in SEQ ID NO:24 are , deletions, substitutions, insertions, and/or additions, or (iii) a sequence having 90% or more or 95% or more identity to the sequence set forth in SEQ ID NO: 24 or (iv) a fragment thereof, and
It can be a nucleic acid that has the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).

In some embodiments, the VAI RNA can be (i) a nucleic acid comprising the sequence set forth in SEQ ID NO:25, and (ii) 1, 2, 3, 4, or 5 nucleic acids in the sequence set forth in SEQ ID NO:25 are , deletions, substitutions, insertions, and/or additions, or (iii) a sequence having 90% or more or 95% or more identity to the sequence set forth in SEQ ID NO: 25 or (iv) a fragment thereof, and
It can be a nucleic acid that has the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).

In some embodiments, the VAI RNA can be (i) a nucleic acid comprising the sequence set forth in SEQ ID NO:26, and (ii) 1, 2, 3, 4, or 5 nucleic acids in the sequence set forth in SEQ ID NO:26 are , deletions, substitutions, insertions, and/or additions, or (iii) a sequence having 90% or more or 95% or more identity to the sequence set forth in SEQ ID NO: 26 or (iv) a fragment thereof, and
It can be a nucleic acid that has the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).

In some embodiments, NS1 can be a peptide comprising (i) the sequence set forth in SEQ ID NO:28, and (ii) 1, 2, 3, 4, or 5 amino acids in the sequence set forth in SEQ ID NO:28 are It can be a peptide consisting of a deleted, substituted, inserted and/or added sequence, or (iii) contains a sequence that is 90% or more or 95% or more identical to the sequence set forth in SEQ ID NO: 28 may be a peptide, or (iv) a fragment thereof, and
It can be a peptide that has the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).

In some embodiments, Us11 can be a peptide comprising (i) the sequence set forth in SEQ ID NO:29, and (ii) 1, 2, 3, 4, or 5 amino acids in the sequence set forth in SEQ ID NO:29 are It can be a peptide consisting of a deleted, substituted, inserted and/or added sequence, or (iii) contains a sequence that is 90% or more or 95% or more identical to the sequence set forth in SEQ ID NO: 29 may be a peptide, or (iv) a fragment thereof, and
It can be a peptide that has the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).

In some embodiments, E3K3 can be a fusion sequence of part or all of E3L (e.g., the C-terminal 107 amino acid sequence of E3L) and part or all of K3, preferably part of E3L (more preferably , the C-terminal 107 amino acid sequence of E3L) and K3, and may be a peptide having a function of inhibiting PKR (for example, PKR such as human PKR and monkey PKR). In certain aspects, E3K3 can be a peptide comprising (i) the sequence set forth in SEQ ID NO:30, and (ii) 1, 2, 3, 4, or 5 amino acids in the sequence set forth in SEQ ID NO:30 are It can be a peptide consisting of a deleted, substituted, inserted and/or added sequence, or (iii) contains a sequence that is 90% or more or 95% or more identical to the sequence set forth in SEQ ID NO: 30 may be a peptide, or (iv) a fragment thereof, and
It can be a peptide that has the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).

In some embodiments, E3Y3 can be a fusion sequence of part or all of E3L (e.g., the C-terminal 107 amino acid sequence of E3L) and part or all of Y3, preferably part of E3L (more preferably , the C-terminal 107 amino acid sequence of E3L) and Y3, and may be a peptide having a function of inhibiting PKR (for example, PKR such as human PKR and monkey PKR). In certain aspects, E3Y3 can be a peptide comprising (i) the sequence set forth in SEQ ID NO:31, and (ii) 1, 2, 3, 4, or 5 amino acids in the sequence set forth in SEQ ID NO:31 are It can be a peptide consisting of a deleted, substituted, inserted and/or added sequence, or (iii) contains a sequence that is 90% or more or 95% or more identical to the sequence set forth in SEQ ID NO: 31 may be a peptide, or (iv) a fragment thereof, and
It can be a peptide that has the function of inhibiting PKR (eg, PKR such as human PKR and monkey PKR).

As used herein, "packaging cells" are cells that produce viral vectors. In general, from the viewpoint of improving safety, the viral genome of a viral vector performs one or more functions selected from the group consisting of propagation, replication, and spread (including infection of other cells). The factor has been destroyed and engineered so that it cannot proliferate, replicate, or spread after cell infection. However, when the viral vector is produced, it is produced while compensating for the factors destroyed by the packaging cells in order to allow its growth, replication and spread. Thus, the packaging cell complements the disrupted viral factors to produce the viral vector and expresses a portion of the disrupted viral factors to restore viral production. Packaging cells may stably or transiently harbor such factors in their genome. In either case, during virus production, complemented viral factors are supplied intracellularly to the packaging cells. As an example, for example, a Sendai virus vector is classically obtained by producing a Sendai virus whose genome lacks the F gene, using packaging cells that supply the F gene. The supplied F gene is activated in the presence of trypsin, but a type of F gene (F5R) that is activated by furin, which is ubiquitously present in cells, has also been developed, increasing the convenience of virus production. (see for example WO2005/071085A). In recent years, techniques for producing Sendai virus from cDNA have been developed. For example, vectors have been constructed using Z strains, which are attenuated strains, as a basic skeleton, and have been devised to further enhance safety for medical application to humans. For example, techniques have been developed to delete any one or more of the F, HN, and M genes from the viral genome to render the virus non-transmissible. For example, an F gene-deleted viral genome is preferably used. The viral genome is operably linked to regulatory sequences (eg, the T7 promoter) that can drive production of the viral genome. This allows the Sendai virus genome to be produced in the packaging cells from the cDNA. When using a T7 promoter as a control sequence (eg, first, second, or third control sequence), T7 RNA polymerase can be supplied, for example, by a helper virus such as vaccinia virus. expressing in the packaging cells N, P, F, and L operably linked to regulatory sequences that drive transcription by an RNA polymerase (e.g., pol II), thereby supplying viral particle components; Viral particles can be formed within the packaging cells. For example, LLC-MK2 cells derived from monkey kidney are used as packaging cells. This results in viral particles that can infect cells once, but cannot subsequently spread to other cells. Virus particles can be used after concentration and/or purification, if desired. When a foreign gene is incorporated into the virus, the virus' own regulatory sequences are optionally introduced to allow transcription by an RNA-dependent RNA polymerase.

According to the present invention, a method for producing a minus-strand RNA virus or a minus-strand RNA virus vector is provided. Negative-strand RNA viruses include Orthomyxoviridae (orthomyxoviruses such as influenza virus), Paramyxoviridae (paramyxoviruses such as the genus Mobilivirus), Rhabdoviridae (rhabdoviruses such as rabies virus), filo Viridae (filoviruses such as Ebola and Marburg virus), and Bunyaviridae (buniaviruses such as Hantavirus). The minus-strand RNA virus is preferably a Paramyxoviridae virus, preferably a Paramyxoviridae, and preferably a Sendai virus.

As used herein, the term "regulatory sequence" refers to a sequence that has the activity of driving a gene operably linked thereto and transcribing RNA from the gene. A control sequence is, for example, a promoter. Promoters include, for example, class I promoters (which can be used for transcription of rRNA precursors), class II promoters (which are composed of a core promoter and an upstream promoter element and can be used for transcription of mRNAs), and class III promoters (which can be used for transcription of mRNA). , II, and III).

In one aspect, a minus-strand RNA viral vector has a disrupted (e.g., deleted) factor on its genome that is related to proliferation or infection of a minus-strand RNA virus into cells, and proliferation in cells other than packaging cells. or has reduced or no substantial infectivity. As noted above, such vectors are rendered initially infective in cells by making them under conditions that supply the packaging cells with factors for disrupted growth or infection. This ensures that vectors obtained from packaging cells are infective, but vectors that subsequently infect cells other than packaging cells are unable to produce more infectious particles, thereby resulting in vector safety has been improved.

In one aspect, the method of the present invention comprises:
(A) expressing from a gene encoding a protein kinase R (PKR) inhibitory factor operably linked to a first regulatory sequence and supplying the factor to the packaging cell;

The first regulatory sequence can be a promoter that can transcribe RNA, for example, mRNA, and for example, various pol II promoters can be used. The pol II promoter is not particularly limited, but includes, for example, CMV promoter, EF1 promoter (EF1α promoter), SV40 promoter, MSCV promoter, hTERT promoter, β actin promoter, CAG promoter, and CBh promoter. Promoters capable of transcription of RNA also include promoters that drive bacteriophage-derived RNA polymerase, such as T7 promoter, T3 promoter, and SP6 promoter, and pol III promoters, such as U6 promoter. For circular DNA it may preferably be the T7 promoter and for linear DNA it may preferably be the SP6 promoter. A promoter may also be an inducible promoter. These promoters can be preferably used for transcription of RNA factors. An inducible promoter is a promoter that can induce expression of a polynucleotide operably linked to it only in the presence of an inducer driving the promoter. Inducible promoters include promoters that induce gene expression by heating, such as heat shock promoters. Inducible promoters also include promoters in which the inducer that drives the promoter is a drug. Such drug-inducible promoters include, for example, Cumate operator sequences, λ operator sequences (eg, 12×λOp), tetracycline system-inducible promoters, and the like. Tetracycline-based inducible promoters include, for example, promoters that drive gene expression in the presence of tetracycline or its derivatives (eg, doxycycline), or reverse tetracycline-regulated transactivator (rtTA). Examples of tetracycline-inducible promoters include the TRE3G promoter.

Certain viruses are equipped with PKR-inhibiting viral factors to combat PKR. In the present invention, a PKR-inhibiting viral factor naturally possessed by such viruses can be used as the PKR-inhibiting viral factor. Therefore, the species from which the viral genome and the PKR-inhibiting viral factor are derived may be homologous, but preferably heterologous.

Protein kinase R (PKR) inhibitory factors include, for example, decoy RNA that binds to PKR. Decoy RNAs include, for example, VAI RNA, EBER, nc886, and TAR, and orthologues thereof. In one preferred embodiment, the decoy RNA can be VAI RNA and its orthologues, particularly from adenovirus. In one preferred aspect, the decoy RNA may be EBER and its orthologues, particularly from Epstein-Barr (EB) virus. In one preferred aspect, the decoy RNA may be nc886 and its orthologues, particularly of human origin. In one preferred aspect, the decoy RNA may be TAR and its orthologues, particularly derived from human immunodeficiency virus (HIV). These factors can be preferably used in the present invention.

As VAI, one having the sequence set forth in SEQ ID NO: 17 can be used. The VAI may further comprise its preceding and following sequences on the adenoviral genome. Thus, a PKR-inhibiting viral agent may have the sequence set forth in SEQ ID NO:19. VAI may further include VAII. For example, the PKR-inhibiting viral agent may have the sequence set forth in SEQ ID NO:21. VAI may have one or more mutations selected from the group consisting of substitutions, deletions, insertions and additions. For example, a PKR-inhibiting viral agent can have a sequence with a substitution at base 74 of VAI corresponding to base 74 in the sequence set forth in SEQ ID NO:17. Substitution of the 74th base in the sequence shown in SEQ ID NO: 17 may be any one of G, A and C, preferably C. In preferred embodiments, the PKR-inhibiting viral agent may have a sequence set forth in SEQ ID NO:18 or 20. In one preferred aspect, the PKR-inhibiting viral agent may have a sequence set forth in SEQ ID NO:22 or 23.
Also, for example, a PKR-inhibiting viral factor may have a sequence having a substitution at the VAI base corresponding to the 191st base in the sequence set forth in SEQ ID NO:19. In a preferred embodiment, the PKR-inhibiting viral agent may have the sequence set forth in SEQ ID NO:24.
In another preferred aspect, the PKR-inhibiting viral agent may have the sequence set forth in SEQ ID NO:25. In another preferred embodiment, the PKR-inhibiting viral agent may have the sequence set forth in SEQ ID NO:26.

nc886 may have the sequence of SEQ ID NO: 13 in certain aspects. nc886 may further comprise sequences before and after VAI. nc886 may further have sequences before and after VAI and have the sequence set forth in SEQ ID NO:14.

Protein kinase R (PKR) inhibitory agents also include molecules that induce the degradation of PKR. Molecules that induce degradation of PKR include, for example, 2A ^pro and its orthologues. In one preferred aspect, the molecule that induces degradation of PKR can be 2A ^pro and its orthologues, particularly from poliovirus. These factors can be preferably used in the present invention.

Protein kinase R (PKR) inhibitory factors also include factors that mask viral double-stranded RNA. Agents that mask viral double-stranded RNA can mask viral double-stranded RNA to prevent activation of PKR. Factors that mask viral double-stranded RNA include, for example, E3L, σ3, Us11 and NS1 and their orthologues. In one preferred embodiment, the factor that masks viral double-stranded RNA can be E3L and its orthologs, particularly from vaccinia virus. In certain preferred embodiments, it may be σ3 and its orthologues, particularly from reoviruses. In certain preferred embodiments, it may be Us11 and its orthologs, particularly from herpes simplex virus (HSV). In a preferred embodiment, the viral double-stranded RNA masking agent can be NS1 and its orthologs, particularly from influenza virus. These factors can be preferably used in the present invention.

Protein kinase R (PKR) inhibitory agents also include agents that inhibit PKR dimerization. Factors that inhibit PKR dimerization include, for example, p58 ^IPK and NS5A and their orthologs. In one preferred embodiment, the agent that inhibits PKR dimerization can be p58 ^IPK and its orthologues, particularly of human origin. In one preferred aspect, the agent that inhibits PKR dimerization can be NS5A and its orthologs, particularly from hepatitis C virus (HCV). These factors can be preferably used in the present invention. NS5A may be deleted from its C-terminal side (for example, after the 149th amino acid). For example, NS5A can be NS5A(1-148) with amino acids 1-148 thereof.

Protein kinase R (PKR) inhibitory factors also include PKR pseudosubstrates. Pseudosubstrates include, for example, K3L and Tat and their orthologues. In one preferred embodiment, the pseudosubstrate can be K3L and its orthologues, particularly from vaccinia virus. In one preferred subject, the pseudosubstrate is Tat and its orthologues, particularly from HIV. These factors can be preferably used in the present invention.

Protein kinase R (PKR) inhibitory factors also include molecules that induce substrate dephosphorylation. Molecules that induce substrate dephosphorylation include, for example, ICP34.5 and its orthologues. In one preferred embodiment, the molecule that induces substrate dephosphorylation is ICP34.5 and its orthologs are derived from herpes simplex virus (HSV). These factors can be preferably used in the present invention.

In certain aspects, the protein kinase R (PKR) inhibitory agent is adenovirus VAI RNA, EB virus EBER, human nc886, HIV virus TAR, poliovirus 2A ^pro , vaccinia virus E3L, reovirus δ3 , influenza virus NS1, human p58 ^IPK , hepatitis C virus NS5A, vaccinia virus K3L, HIV virus Tat, herpes simplex virus Us11, and herpes simplex virus ICP34.5, and orthologs thereof. One or more to be selected.

The protein kinase R (PKR) inhibitory factor may, in some embodiments, be stably integrated into the genome of the packaging cell. Expression can be driven by a first control sequence. The first regulatory sequence can be a constitutive promoter or an inducible promoter.

A protein kinase R (PKR) inhibitory agent may, in certain embodiments, be transiently introduced into packaging cells. For example, protein kinase R (PKR) inhibitory agents can be carried on plasmid DNA. Plasmid DNA can be introduced into cells using techniques well known to those of skill in the art, thereby allowing protein kinase R (PKR) inhibitory factors to be expressed intracellularly from the plasmid DNA. Expression can be driven by a first control sequence. The first regulatory sequence can be a constitutive promoter or an inducible promoter.

In some embodiments, packaging cells can be, for example, Vero cells or LLC-MK2 cells. In one aspect, the packaging cells can be a cell population consisting of Vero cells or a cell population consisting of LLC-MK2 cells. In some embodiments, no cells other than packaging cells are used for virus production. In one aspect, the packaging cell expresses the F gene. In one preferred embodiment, the packaging cells constitutively express the F gene. In one preferred embodiment, the F protein can be activated with trypsin. In one preferred aspect, the F protein can be F5R. In one preferred aspect, compositions for reconstitution of SeV are provided comprising Vero cells or LLC-MK2 cells. Reconstitution refers to supplying virus or viral vector components to packaging cells to form the virus or viral vector. Reconstitution of SeV can be performed as described herein.

According to the present invention, there is provided a method for producing a minus-strand RNA virus or a minus-strand RNA viral vector, comprising:
(B) expressing the genomic RNA of a minus-strand RNA virus or viral vector in packaging cells to form a minus-strand RNA virus or viral vector in the presence of the factor {e.g., a PKR inhibitory factor, e.g., expressing the genomic RNA of a negative-strand RNA virus or negative-strand RNA viral vector in packaging cells in the presence of a PKR-inhibiting viral agent to form a negative-strand RNA virus or negative-strand RNA viral vector}
A method is provided comprising:

The genomic RNA of a negative-strand RNA virus or negative-strand RNA viral vector can be expressed, for example, from a gene expression vector having DNA encoding the genomic RNA operably linked to a second regulatory sequence. A gene expression vector can be used, for example, as long as it is a vector that at least transiently expresses the genomic RNA in cells, and a preferred example is a plasmid vector. The genomic RNA contains 511F for the P protein, 69E, 116A and 183S for the M protein, 262T, 264R and 461E for the HN protein, and 1197S and 1796E for the L protein to minimize vector cytotoxicity. It may have mutations (see, for example, WO2003/025570). When the genomic RNA is produced in the cell, it complexes with other virus particle components (e.g., F, N, P, L) supplied to the packaging cell to form a virus or virus vector (virus particle). be done. At this time, if a protein kinase R (PKR) inhibitory factor, NS5A, or nc886, or their equivalent is present in the cell, the amount of virus particles produced increases. Packaged cells can be cultured under conditions suitable for culture. The gene encoding the viral genome can be driven by the T7 promoter. In this case, the packaging cells can be supplied with T7 polymerase. Genes encoding the viral genome may be driven by the CAG promoter or the EF1 promoter.

In some embodiments, the packaging cells can be further supplied with SeV components (eg, N, P, and L, and equivalents thereof) to facilitate SeV formation in the packaging cells. The SeV components can be supplied, for example, by introducing a plasmid vector into the packaging cells.

In one aspect, the genes encoding the viral particle components (eg, N, P, L) are each operably linked to a third regulatory sequence. In one aspect, the genes encoding the viral particle components (eg, F, N, P, L) each operably linked to a third regulatory sequence are integrated on a plasmid. In some aspects, the third regulatory sequence can be a CAG promoter (eg, having the sequence set forth in SEQ ID NO:2). In some aspects, at least one or all of the third regulatory sequences can be a non-CAG promoter, such as the EF1α promoter (eg, having the sequence set forth in SEQ ID NO:1). In a preferred embodiment, the genes encoding the viral particle components (eg, N, P, L) are carried on one or more gene expression vectors (preferably plasmids). In this case, these components may be operatively linked to one control sequence or to multiple control sequences. A control sequence can be, for example, the CAG or EF1 promoter.

In one aspect of the present invention, the method for producing a negative-strand RNA virus or negative-strand RNA viral vector comprises:
(C) further comprising recovering the formed negative-strand RNA virus or negative-strand RNA viral vector.

Virus particles formed in cells can be collected as appropriate. Viral particles formed intracellularly can be released extracellularly. Therefore, virus particles can be recovered from the culture medium. The recovered virus particles can be purified and/or concentrated as appropriate. Thus, an isolated, purified, or concentrated viral vector is provided. The resulting viral vector can be stored as appropriate. Storage can be performed, for example, in a deep freezer (eg, about -80°C), in a freezer (eg, about -20°C), or in a refrigerator (about 4°C). Storage can also be performed in liquid nitrogen. The viral vector is subjected to titer determination as necessary. Viral titers can be determined by methods well known to those skilled in the art.

In certain aspects, the infectious titer of the minus-strand RNA virus or minus-strand RNA viral vector obtained by the method of the present invention is 1×10 ⁵ CIU/mL or more, 2×10 ⁵ CIU/mL or more, or 3×10 ⁵ CIU. /mL or more, 4×10 ⁵ CIU/mL or more, 5×10 ⁵ CIU/mL or more, 6×10 ⁵ CIU/mL or more, 7×10 ⁵ CIU/mL or more, 8×10 ⁵ CIU/mL or more, 9 x10 ⁵ CIU/mL or more, 1 x 10 ⁶ CIU/mL or more, 2 x 10 ⁶ CIU/mL or more, 3 x 10 ⁶ CIU/mL or more, 4 x 10 ⁶ CIU/mL or more, 5 x 10 ⁶ CIU/mL or more mL or more, 6×10 ⁶ CIU/mL or more, 7×10 ⁶ CIU/mL or more, 8×10 ⁶ CIU/mL or more, 9×10 ⁶ CIU/mL or more, 1×10 ⁷ CIU/mL or more, 2× It can be 10 ⁷ CIU/mL or greater, 3 x 10 ⁷ CIU/mL or greater, 4 x 10 ⁷ CIU/mL or greater, or 5 x 10 ⁷ CIU/mL or greater.

In certain aspects of the present invention, the relationship between the species from which the virus or viral vector is derived and the species from which the PKR inhibitory factor is derived may be heterologous. In this aspect, the species relationship from which the first regulatory sequence and the PKR inhibitory factor are derived may be homologous.

In certain aspects of the present invention, the relationship between the species from which the first regulatory sequence and the PKR inhibitory factor are derived may be heterologous. In this aspect, the relationship between the species from which the virus or viral vector is derived and the species from which the PKR inhibitory factor is derived can be homogeneous.

In one aspect of the present invention, the relationship between the species from which the virus or viral vector is derived and the species from which the PKR-inhibitory factor is derived is heterologous, and the first regulatory sequence and the PKR-inhibitory factor are derived from Species relationships can be heterogeneous.

In one aspect of the present invention, the gene encoding the PKR inhibitory factor is integrated into the genome of the packaging cell. In one aspect of the invention, the gene encoding the PKR inhibitory factor is incorporated into a vector (eg, plasmid DNA) that is introduced into packaging cells. The position of integration is before the N gene, between the N gene and the P gene, between the P gene and the M gene, between the M gene and the HN gene, between the HN gene and the L gene, or between the L gene on the SeV genome. can be behind. The location of integration may be in the 3'UTR of the gene encoding the protein of interest when the factor is RNA. In general, the N gene is sometimes written as the NP gene.

In a preferred embodiment of the present invention, a gene encoding a PKR inhibitory factor is integrated into the RNA genome of a minus-strand RNA virus or minus-strand RNA viral vector. In this embodiment, the gene encoding the PKR inhibitory factor may be further integrated into the genome of the packaging cell or into a vector (eg, plasmid DNA) introduced into the packaging cell. Thus, in one preferred embodiment, a gene encoding a PKR-inhibitory factor is integrated into the RNA genome of a negative-strand RNA virus or negative-strand RNA viral vector and introduced into the genome of or into the packaging cell. It is further incorporated into a vector (eg, plasmid DNA) that carries By doing so, the PKR inhibitory factor is supplied from the packaging cell even when the number of genomes is small, and the PKR inhibitory factor is supplied from the genome when the genome is increased. Stranded RNA viral vectors can be successfully propagated. In addition, even after infecting another cell (non-packaging cell) with the obtained minus-strand RNA virus or viral vector, the PKR inhibitory factor is supplied from the viral genome, and the virus or viral vector is successfully transferred to the cell. can grow within As a result, for example, the effect of increasing the expression level of the target gene mounted on the virus or viral vector can be obtained.

In one aspect of the present invention, virus particles are produced in the absence of helper virus.

In one aspect of the present invention, the virus or viral vector is a paramyxovirus or a paramyxovirus vector, and the RNA genome is an F gene-deficient RNA genome. In this aspect, the first regulatory sequence can be the CAG promoter or the EF1 promoter, such as the EF1 promoter. Also in this aspect, the second regulatory sequence is the T7 promoter, and the T7 RNA polymerase can be produced by transcription and translation from the cell genome or plasmid. In certain preferred subjects, the Paramyxovirus is Sendai virus. In a preferred embodiment, the Paramyxovirus vector is a Sendai virus vector.

In some aspects, the Paramyxovirus or Paramyxovirus vector is capable of expressing the N, P, and L proteins. In some aspects, the Paramyxovirus or Paramyxovirus vector does not express one, two, or three selected from the group consisting of the F, HN, and M proteins. For example, the RNA genome lacks RNAs encoding 1, 2, or 3 proteins selected from the group consisting of F, HN, and M proteins. In one preferred embodiment, the Paramyxovirus or Paramyxovirus vector does not express the F protein.

In one aspect, the Paramyxovirus or Paramyxovirus vector has an RNA genome capable of expressing V protein and/or C protein.

According to the present invention, an RNA genome of a minus-strand RNA virus or a minus-strand RNA virus vector and a DNA encoding the RNA genome are provided. The RNA genome, in one aspect, expressably comprises genes encoding any one or more of the PKR-inhibiting factors (eg, PKR-inhibiting viral factors). The present invention also provides a minus-strand RNA viral vector comprising the above RNA genome. A negative-strand RNA virus or negative-strand RNA viral vector further has a viral particle that contains the RNA genome. Such viruses or viral vectors can exhibit stronger growth potential after cell infection. In a preferred embodiment, the minus-strand RNA virus is Paramyxovirus, more preferably Sendai virus. In a preferred embodiment, the minus-strand RNA viral vector is a Paramyxovirus vector, more preferably a Sendai virus vector. In one aspect, the DNA encoding the RNA genome is operably linked to a second regulatory sequence. In one aspect, a gene expression vector is provided comprising DNA encoding the RNA genome operably linked to a second regulatory sequence.

In certain preferred embodiments, an RNA genome (especially a SeV genome) comprising DNA encoding said genomic gene expression vector is flanked either or both upstream and downstream of said RNA genome by a self-cleaving ribozyme (e.g. a hammer head ribozyme or HDV ribozyme). In addition, the gene expression vector may contain sequences of other factors (e.g., PKR-inhibiting factors and factors that promote RNA amplification) via the sequence of the self-cleaving ribozyme (e.g., hammerhead ribozyme or HDV ribozyme). may be ligated so that the RNA genome and the sequences of said other factors are transcribed into a series of RNAs. By constructing in this way, after the RNA genome is transcribed, the RNA can be cleaved at the sequence of a self-cleaving ribozyme (e.g., hammerhead ribozyme or HDV ribozyme) to remove said other factor, RNA is obtained which consists essentially of the genome. For example, by linking a PKR-inhibiting factor or a factor that promotes amplification of RNA as the sequence of another factor, the action is exhibited to amplify the genome, and then the other factor is completed. It can be removed from the genome. For example, the other factor can be placed 5' to the RNA genome, and a hammerhead ribozyme sequence can be placed between the other factor and the region encoding the RNA genome, or is located 3' of the RNA genome, and the sequence of the HDV ribozyme can be placed between the region encoding the RNA genome and the other elements mentioned above. More specifically, the gene expression vector comprising DNA encoding the RNA genome includes, for example, a promoter (eg, T7 promoter, CAG promoter, and EF1 promoter), a first self-cleaving ribozyme (eg, 3' the sequence of a self-cleaving ribozyme, preferably a hammerhead ribozyme), the DNA encoding the RNA genome, the sequence of a second self-cleaving ribozyme (e.g., a 5' self-cleaving ribozyme, preferably an HDV ribozyme), and others. may be configured to include an array of factors in this order. In another preferred embodiment, promoters (e.g., T7 promoter, CAG promoter, EF1 promoter, etc.), sequences of other factors, first self-cleaving ribozymes (e.g., 3′ self-cleaving ribozymes, preferably hammer head ribozyme), DNA encoding the RNA genome, and the sequence of a second self-cleaving ribozyme (e.g., 5' self-cleaving ribozyme, preferably HDV ribozyme) in this order. . The self-cleaving ribozyme is shown above only as an example, and preferred embodiments are not limited to this. In particular, when a self-cleaving ribozyme is used, the self-cleaving ribozyme can be arranged so that the RNA genome has 6n bases (where n is a natural number). The gene expression vector may, for example, further include a terminator sequence (eg, a T7 terminator sequence for T7 polymerase) downstream of the sequence of the other factor. Various sequences of self-cleaving ribozymes (eg, hammerhead ribozymes) are known. Examples of self-cleaving ribozymes include, but are not limited to, hammerhead ribozymes, hepatitis delta virus (HDV) ribozymes, twister ribozymes, twister-sister ribozymes, pistol ribozymes, hairpin ribozymes, and hatchet ribozymes. be done. These self-cleaving ribozymes can be, for example, 5' self-cleaving ribozymes and/or 3' self-cleaving ribozymes. Among them, the sequence of Hh-Rbz (eg, SEQ ID NO: 36) as the 3′ self-cleaving ribozyme, and the sequence of hepatitis delta virus ribozyme (HDV-Rbz) (eg, SEQ ID NO: 37) as the 5′ self-cleaving ribozyme. can be used.

In a preferred embodiment, a gene expression vector that expresses an RNA virus component may further carry a PKR-inhibitory factor or an RNA amplification-promoting factor. Said gene expression vector provides said component via the sequence of said self-cleaving ribozyme (e.g., as described above, which can be, for example, a hammerhead ribozyme or HDV ribozyme) via the sequence of another factor (e.g., A PKR-inhibiting factor or factor that promotes amplification of RNA) may be ligated so that the RNA genome and the sequence of the other factor are transcribed into a sequence of RNA. Alternatively, in a preferred embodiment, the PKR inhibitory factor and/or the factor promoting RNA amplification may be carried independently on a plasmid.

According to the present invention, there is provided a combination of a gene expression vector for the genome, which contains DNA encoding the RNA genome of the virus, and a vector for reconstitution of the virus, which contains DNAs which encode the components of the virus. be done. The combination can be used to reconstitute the viral particles in the cell by co-expression in the cell. In one aspect, a combination is provided for use in reconstituting a viral particle, the combination comprising DNA encoding the RNA genome of the virus and DNA encoding the components of the virus, the DNA comprising , which contains DNA encoding sufficient factors to form viral particles and is carried in one or more gene expression vectors. The RNA genome and DNA encoding the viral components are operably linked to regulatory sequences. A regulatory sequence can be a promoter, such as, but not limited to, the T7 promoter, the CAG promoter, and the EF1 promoter.

A Sendai virus or Sendai virus vector may further have a target gene in its RNA genome. A gene of interest can be a gene that one wishes to introduce into a cell. The gene of interest can be expressed in the introduced cells to produce RNA or protein. The gene of interest is expressably carried in the RNA genome. A gene of interest can be a foreign gene. A foreign gene is a term used to distinguish it from a gene endogenous to the cell into which it is introduced.

Preparation of Minus-strand RNA Viral Vectors Minus-strand RNA viral vectors were expressed in virus packaging cells. Specifically, the efficacy of PKR inhibitors upon expression was evaluated.

Sendai virus (SeV) was used as a negative-strand RNA virus vector. Sendai virus was collected from the culture supernatant 3 days after introduction of the plasmid mixture into the F gene-expressing cells. The plasmid mixture contained pSeV-EmGFP carrying the Sendai virus genome operably linked to a T7 promoter. The Sendai virus genome contained a gene encoding EmGFP so that the proliferation of the genome could be detected by fluorescence. The Sendai virus genome was assumed to have a deletion of the F gene.

(1) F gene-expressing cells were prepared as follows.
The SeV F gene (Kozak sequence added, optimized for human codons) was loaded into pCAGGS-neo to construct pCAGGS-F-neo. The resulting plasmid was transfected into Vero cells or LLC-MK2 cells using ViaFect (Promega), and selected using 1-2 mg/mL G418 disulfate solution (Nacalai Tesque) to express F gene. cells were obtained. The resulting cells are designated as Vero-F and LLC-MK2-F.

(2) F gene-deleted SeV was produced as follows.
ACCESSION: The sequence information of the SeV-Z strain of AB855655 and the J. Phys. General Virology (1997), 78, 2813-2820. pSeV/dF, in which the F gene-deleted SeV genome is transcribed with a T7 promoter, was constructed based on the information of pSeV. To minimize the cytotoxicity of the SeV-Z strain, the following amino acid mutations were made in pSeV/dF: P protein: 511F, M protein: 69E, 116A, and 183S, HN proteins: 262T, 264R, and 461E and L proteins: 1197S and 1796E (see, eg, WO2003/025570). The resulting plasmid was named pSeV/TSdF. EmGFP, which is a GFP mutant, was used as a gene of interest (GOI) to evaluate SeV rearrangement. The GOI is installed in front of the N gene (hereinafter referred to as "+"), between the P gene and the M gene (hereinafter referred to as "PM"), and between the M gene and the HN gene (hereinafter referred to as "MHN"). ) and between the HN gene and the L gene (hereinafter referred to as “HNL”). The EmGFP gene was placed in front of the SeV N gene, and pSeV+EmGFP/TSdF was mainly used.

(3) A plasmid for SeV reconstitution was constructed as follows.
pCAGGS-NP, pCAGGS-P4C(-), pCAGGS-L, pCAGGS-F5R and pCAGGS-T7 were constructed with reference to WO2005/071092, and this combination is referred to as "CAG". In addition, a reconstruction plasmid set with a Kozak sequence added and optimized for human codons and having a promoter different from the above: pCAGGS-NPco, pCAGGS-P4C (-) co, pCAGGS-Lco, pCAGGS-F5Rco, pCAGGS- T7co, pEF1-NPco, pEF1-P4C(-)co, pEF1-Lco, pEF1-F5Rco, and pEF1-T7co were constructed. Furthermore, in T7, 430P, 849I, and 880Y mutations are introduced with reference to P2001-54387A, and 644Y and 667Y mutations are introduced with reference to P2003-61683A. built. The combination of pEF1-NPco, pEF1-P4C(-)co, pEF1-Lco, pCAGGS-F5Rco and pCAGGS-T7mco is denoted as "EFnpL". The combination of pEF1-NPco, pCAGGS-P4C(-)co, pCAGGS-Lco, pCAGGS-F5Rco and pCAGGS-T7mco is denoted as EFnCAGpL. A combination of pCAGGS-NPco, pCAGGS-P4C(-)co, pEF1-Lco, pCAGGS-F5Rco and pCAGGS-T7mco is denoted as CAGnpEFL.

(4) A plasmid having a PKR inhibitor was constructed as follows.
The non-coding RNA evaluation sequence was mounted on a pT7 plasmid having a T7 promoter and a T7 terminator, pT7-VAI (180 bp; SEQ ID NO: 17), pT7-VAI74a (180 bp; V = A in SEQ ID NO: 18), pT7-VAI74c ( 180 bp; V=C in SEQ ID NO: 18), pT7-VAI74a (330 bp; M=A in SEQ ID NO: 26), pT7-VAI-VAII (478 bp; SEQ ID NO: 21), pT7-nc886 (108 bp; SEQ ID NO: 13), pT7-nc886 (272 bp; SEQ ID NO: 14) was constructed. In order to disrupt the BamHI recognition sequence in the Apical Stem of VAI (Fig. 1), a sequence having base substitutions (T74A, T74C) at the 74th base of VAI was constructed. Similarly, a sequence having a base substitution (G191C) at base 191 was constructed to disrupt the NheI recognition sequence on the 3' side of VAI (M=A in SEQ ID NO: 26). These base substitutions were designed on the assumption that they would not affect the secondary structure of RNA and would not affect the function of VAI. A pT7 plasmid was constructed carrying nc886 (108 bp) as another PKR inhibitor. In order to extend the sequence, nc886 (272 bp) having VAI sequences before and after each was constructed (SEQ ID NOS: 13, 14). As a control plasmid, pT7-IRES having an IRES sequence under the T7 promoter was constructed.

(5) A plasmid having a PKR inhibitor was constructed as follows.
The translated sequences were basically added with Kozak sequences and optimized for human codons. pCAGGS-E3L, pCAGGS-K3L, pCAGGS-Y3, pCAGGS-E3K3, pCAGGS-E3Y3, pCAGGS-NS1, pCAGGS-σ3, pCAGGS-Us11 were constructed. E3L (SEQ ID NO: 7) and K3L (SEQ ID NO: 10) are vaccinia virus sequences, Y3 (SEQ ID NO: 27) is the C-terminal 106 amino acid sequence of SeV C protein, NS1 (SEQ ID NO: 28) is the influenza virus sequence, σ3 (SEQ ID NO: 8) is a reovirus sequence, Us11 (SEQ ID NO: 29) is an HSV-1 sequence, E3K3 (SEQ ID NO: 30) is a fusion sequence between the C-terminal 107 amino acid sequence of E3L and K3L, E3Y3 (SEQ ID NO: 31) was a fusion sequence between the C-terminal 107 amino acid sequence of E3L and Y3.

(6) SeV Reconstitution in the Presence or Absence of a PKR Inhibitor The ratio of SeV reconstitution plasmid to transfection reagent was in accordance with WO2005/071092. Specifically, plasmids and transfection reagents (TransIT-LT1 Reagent or ViaFect) of the following weights were mixed to obtain a plasmid mix.

Conditions without PKR inhibitors:
NP, P4C (-), F5R, T7: 0.5 μg each
L: 2 μg
pSeV: 5 μg
Total plasmid: 9 μg
TransIT-LT1 Reagent or ViaFect: 15 μL

Conditions with PKR inhibitors:
NP, P4C (-), F5R, T7: 0.5 μg each
L: 2 μg
pSeV: 5 μg
Plasmid with PKR inhibitor: 1 μg
Total plasmid: 10 μg
TransIT-LT1 Reagent or ViaFect: 16.5 μL

Below, unless otherwise noted, the weight of the plasmid and the volume of the transfection reagent were mixed at a ratio of 9:15.

A plasmid and a transfection reagent were mixed in 225 μL of OptiMEM, transfected into F gene-expressing cells in a 12-well plate being cultured in 500 μL of medium (10% FBS/E-MEM), and cultured at 37°C. The cells were cultured at 32° C. from the day after transfection. Medium changes were performed daily with serum-free medium (ITS-X/NEAA/E-MEM) supplemented with 2.5 μg/mL trypsin. As an indicator of successful SeV reconstitution, EmGFP-positive cells were observed from the day after transfection (an increase in the number of EmGFP-positive cells indicates an improvement in SeV reconstitution efficiency). The fluorescence intensity of the microplate was measured using the system ECLIPSE Ti2-E (Nikon). The culture supernatant on day 3 of transfection was collected, diluted 10 to 100,000 times, infected with Vero cells seeded in a 96-well plate, and the number of GFP-positive cells was counted 3 days after infection using ECLIPSE Ti2-E. The infection titer was calculated.

(7) SeV Reconstitution in the Presence of VAI A cell population containing only LLC-MK2-F was used as SeV reconstitution cells. CAGnpEFL was used as a plasmid for SeV reconstruction. pSeV used pSeV+EmGFP/TSdF. VAI was used as a PKR inhibitor. VAI uses pT7-VAI (180 bp) and pT7-VAI-VAII (478 bp) as wild-type (wt) sequences, and pT7-VAI74a (180 bp), pT7-VAI74c (180 bp) and pT7-VAI74a ( 330 bp) was used. pT7-IRES was used as a control (Ctrl) plasmid for VAI. In the cells combined with VAI, unlike the control, EmGFP fluorescence-positive cells were observed from the day after transfection. Comparing the fluorescence intensity from EmGFP from day 3 cells, 18-fold over control in the presence of VAI (180 bp) wt, 34-fold over control in the presence of VAI (180 bp) 74a, and 34-fold over control in the presence of VAI (180 bp) 74c It was 53-fold that of the control, 63-fold that of the control in the presence of VAI-VAII, and 146-fold that of the control in the presence of VAI (330 bp)74a. Three days after the start of SeV reconstitution, the culture supernatant was infected with Vero cells. 180 bp) 282 times higher than the control in the presence of 74c, 476 times higher than the control in the presence of VAI-VAII, and 1962 times higher than the control in the presence of VAI (330 bp) 74a (Fig. 3). Thus, it is clear that VAI significantly enhances the SeV reconstitution efficiency.

According to WO2005/071092, the recovery efficiency of the SeV vector is very low in LLC-MK2, and even when the recovered cells were inoculated into chicken eggs, the HA activity of SeV could not be confirmed in LLC-MK2-derived cells. . SeV reconstitution using 293T cells showed an infection titer of about 10 ² CIU/mL using the culture supernatant 3 days after reconstitution (Beaty, SM. et al., mSphere. 2, e00376-16 (2017)). On the other hand, in this example, 2×10 ⁷ CIU/mL was achieved 3 days after reconstitution, indicating a marked increase in the infectious titer.

(8) SeV Reconstitution in the Presence of nc886 A cell population containing only LLC-MK2-F was used as SeV reconstitution cells. CAGnpEFL was used as a plasmid for SeV reconstruction. pSeV used pSeV+EmGFP/TSdF. As plasmids containing PKR inhibitors, pT7-nc886 (108 bp), pT7-nc886 (272 bp) and pT7-VAI74a (330 bp) were used.

Comparing the fluorescence intensity derived from EmGFP from cells on day 3 after reconstitution, it was 17 times higher than control in the presence of nc886 (108 bp), 52 times higher than control in the presence of nc886 (272 bp), and VAI (330 bp) in the presence of 74a. was 381 times that of the control (Fig. 4).

(9) Reconstitution of SeV in the Presence of PKR-Inhibiting Viral Factor Cells containing only LLC-MK2-F or cells containing only Vero-F were used as cells for SeV reconstitution. CAGnpEFL was used as a plasmid for SeV reconstruction. pSeV+EmGFP/TSdF was used as pSeV. Any one of pT7-VAI74a (330 bp), pCAGGS-E3L, pCAGGS-K3L, pCAGGS-NS1, pCAGGS-σ3, pCAGGS-Us11, and pCAGGS-Y3 was used as the PKR-inhibiting plasmid. Fluorescence intensity derived from EmGFP from cells 3 days after reconstitution was measured. As shown in FIG. 5, EmGFP-derived fluorescence intensity from cells increased in all test groups compared to controls. Compared to the control, LLC-MK2-F cells improved the SeV reconstitution efficiency by 100-fold or more, and VERO-F cells improved the SeV reconstitution efficiency by 10-fold or more in VAI, E3L, σ3, and Us11 (Fig. 5). Also, as shown in FIG. 6, infection titers were elevated in all test groups compared to controls. In titration, it was VAI, E3L, σ3, and Us11 that showed high values in both LLC-MK2-F and Vero-F cells (Fig. 6).

(10) Reconstitution of SeV in the Presence of Fusion Sequence A cell population containing only LLC-MK2-F or a cell containing only Vero-F was used as SeV reconstitution cells. CAGnpEFL was used as a plasmid for SeV reconstruction. pSeV+EmGFP/TSdF was used as pSeV. Any one of pCAGGS-E3L, pCAGGS-K3L, pCAGGS-E3K3, pCAGGS-E3Y3, and pCAGGS-Y3 was used as the PKR-inhibiting plasmid. Fluorescence intensity derived from EmGFP from cells 3 days after reconstitution was measured. Then, as shown in FIG. 7, EmGFP-derived fluorescence intensity from cells increased in all test groups compared to the control. E3Y3 also improved the SeV reconstruction efficiency compared to E3K3 (Fig. 7). In addition, when EFnpL was used as a plasmid for SeV reconstitution and the SeV reconstitution efficiency on day 3 after infection was compared, E3Y3 was 3.5 times higher than E3L in LLC-MK2-F cells, and Vero-F was 3.5 times higher than E3L. A 6.8-fold improvement was observed for E3Y3 over E3L in cells.

(11) Reconstitution of SeV using cells constitutively expressing PKR inhibitor Vero-F cells were transfected with pCAGGS-E3L-Hyg or pCAGGS-E3Y3-Hyg, and 500 μg/mL hygromycin B (Nacalai Cells were selected using Tesk) to obtain Vero-F-E3L and Vero-F-E3Y3 cells, stable lines that constitutively express E3L and E3Y3, respectively. A combination of SeV reconstitution plasmids pEF1-NPco, pEF1-P4C(-)co, pEF1-Lco, pCAGGS-F5Rco and pCAGGS-T7mco (EFnpL) and pSeV+EmGFP/TSdF were used in these cells. Fluorescence intensity derived from EmGFP from cells 3 days after reconstitution was measured. A two-fold improvement in SeV reconstitution efficiency was observed in Vero-F-E3Y3 cells.

(12) Comparison of promoters for expression A combination of the CAG promoter and the EF1 promoter was examined for comparison with the prior art. LLC-MK2-F and Vero-F cells were used. pSeV+EmGFP/TSdF was used as pSeV. E3Y3 was used as a PKR inhibitor. CAG with all N, P, L driven from the CAG promoter; EFnpL with all N, P, L driven from the EF1α promoter; EFnCAGpL with N driven from the EF1α promoter and P and L from the CAG promoter; In the combination of CAGnpEFL in which P is driven from the CAG promoter and L is driven from the EF1α promoter, the effect of different promoters on SeV reconstitution efficiency was investigated. Fluorescence intensity derived from EmGFP from cells 3 days after reconstitution was measured.

As a result, in LLC-MK2 cells, as shown in FIG. 8, codon optimization alone of the plasmid used for SeV reconstitution did not sufficiently improve SeV reconstitution efficiency (PKR inhibitor E3Y3 CAG in the absence). In contrast, in the presence of E3Y3, SeV rearrangement was observed with sufficient efficiency by driving with any promoter. In the system in which N and P were expressed using the CAG promoter and L was expressed using the EF1a promoter in the presence of the PKR inhibitor E3Y3, SeV reconstitution efficiency was improved 271-fold compared to CAG (conventional plasmid).

In addition, in Vero cells, as shown in FIG. 9, in the presence of the PKR inhibitor E3Y3, the reconstitution efficiency was improved with any promoter. Compared to the conventional plasmid), the SeV reconstitution efficiency was improved 48-fold.

(13) Reconstitution of SeV in the Presence of a Combination of PKR Inhibitors As cells for reconstitution of SeV, a cell population containing only LLC-MK2-F or a cell population containing only Vero-F was used. pSeV+EmGFP/TSdF was used as pSeV. VAI and E3Y3 were used as PKR inhibitors. As plasmids for SeV reconstruction, CAGnpEFL was used for LLC-MK2-F, and CAGnpEFL and EFnpL were used for Vero-F. As a result, as shown in FIG. 10, the combination of PKR inhibitors improved the SeV reconstitution efficiency more than 1000-fold compared to the control without PKR inhibitors.

In addition, as shown in FIG. 11, the infection titer of the culture supernatant on day 3 from the start of SeV reconstitution was higher in the LLC-MK2-F cell reconstitution system than in the PKR inhibitor-free control. In the reconstituted system of VERO-F cells, it improved 7460 times.

(14) Reconstitution of SeV carrying a PKR inhibitor SeV carrying a gene encoding a PKR inhibitor was evaluated for SeV reconstitution efficiency. A cell population containing only LLC-MK2-F was used. CAGnpEFL was used as a plasmid for SeV reconstruction. pSeV includes pSeV(PM)EmGFP/TSdF, pSeV(PM)EmGFP-VAI74a/TSdF (loaded with VAI (180bp)74a), and pSeV(PM)EmGFP-VAI74aL/TSdF (loaded with VAI(330bp)74a). was used. EmGFP-VAI74a had the sequence as shown in SEQ ID NO:32. EmGFP-VAI74aL had the sequence as shown in SEQ ID NO:33.

The results were as shown in Figures 12 and 13. As shown in FIG. 12, compared to the reconstitution efficiency of the control (EmGFP), SeV with VAI (180 bp) 74a improved the reconstitution efficiency by 3 times and SeV with VAI (330 bp) 74a by 16 times. did. In addition, as shown in FIG. 13, the infection titer of the culture supernatant on day 3 after the start of SeV reconstitution was 3 for SeV carrying VAI (180 bp) 74a compared to the reconstitution efficiency for the control (EmGFP). fold, SeV with VAI (330 bp) 74a was 66 fold.

(14-2) Effect of addition of 5' or 3' sequence of the sequence on VAI (180 bp) 74c A cell population containing only LLC-MK2-F was used as SeV reconstitution cells. CAGnpEFL was used as a plasmid for SeV reconstruction. pSeV used pSeV+EmGFP/TSdF. As plasmids containing PKR inhibitors, pT7-VAI (180 bp) 74c, pT7-VAI (264 bp) 74c3p, pT7-VAI (246 bp) 74c5p, and pT7-VAI (330 bp) 74c were used. VAI (264 bp) 74c3p (SEQ ID NO: 34) is obtained by adding an 84-mer on the 3' side of VAI to the 3' side of VAI (180 bp) 74c. In addition, VAI (246 bp) 74c5p (SEQ ID NO: 35) is obtained by adding an 86-mer on the 5' side of VAI to the 5' side of VAI (180 bp) 74c.

Comparing the fluorescence intensity derived from EmGFP from cells 3 days after reconstitution with that in the presence of pT7-VAI (180 bp)74c, as shown in FIG. pT7-VAI (246 bp) 74c5p was 6.8-fold and pT7-VAI (330 bp) 74c was 15.7-fold. This suggested that the VAI 5'-side sequence more strongly contributes to the improvement of the rearrangement efficiency.

(15) Effect of EBER1 Integration on Viral Growth A cell population containing only LLC-MK2-F was used as SeV reconstitution cells. CAGnpEFL was used as a plasmid for SeV reconstruction. pSeV used pSeV+EmGFP/TSdF. As a plasmid containing a PKR inhibitor, pT7-EBER (337 bp) was used. In this plasmid, sequences before and after VAI are introduced before and after EBER1, respectively. Comparing the fluorescence intensity derived from EmGFP from cells 3 days after reconstitution, it was 3.8 times higher than the control in the presence of EBER1 (337 bp).

(16) Effect of NS5A148 integration on virus proliferation

A cell population containing only LLC-MK2-F was used as SeV reconstitution cells. CAGnpEFL was used as a plasmid for SeV reconstruction. pSeV used pSeV+EmGFP/TSdF. As a plasmid containing a PKR inhibitor, pCAGGS-NS5A148 was used. This plasmid produces NS5A148, which has the amino acid sequence set forth in SEQ ID NO:16. Comparing the fluorescence intensity derived from EmGFP from the cells 3 days after reconstitution, it was 7.3 times that of the control in the presence of NS5A148.

(17) Introduction of Hammerhead Ribozyme Sequence A cell population containing only Vero-F or a cell population containing only cloned Vero-F-E3Y3 was used as SeV reconstitution cells. CAGnpEFL was used as a plasmid for SeV reconstruction. As pSeV, pSeV+EmGFP/TSdF or pSeV+EmGFP/TSdF(Hh) having a hammerhead ribozyme sequence (SEQ ID NO: 36) under the T7 promoter sequence was used. Comparing the fluorescence intensity derived from EmGFP from cells on day 3 after reconstitution, no EmGFP-positive cells were observed in Vero-F cells using pSeV+EmGFP/TSdF (control: Ctrl). -EmGFP positive cells were observed in E3Y3 cells. As shown in FIG. 15, in Vero-F-E3Y3 cells using pSeV+EmGFP/TSdF(Hh), the fluorescence intensity of EmGFP was 37.7 times higher than in Vero-F cells.

We conducted further experiments. A vector was constructed in which a hammerhead ribozyme (Hh-Rbz) sequence was placed between the T7 promoter of the plasmid that transcribes the SeV genome and the region encoding the SeV genome (pSeV/TSdF(Hh)). Hh-Rbz having the sequence shown in SEQ ID NO: 36 was used. Furthermore, a vector (pSeV/TSdF(Hv)) was constructed in which the HDV ribozyme (HDV-Rbz) sequence was placed immediately below the region encoding the SeV genome, and VAI (330 bp) 74c was placed downstream thereof. HDV-Rbz having the sequence shown in SEQ ID NO:37 was used. A T7 terminator (SEQ ID NO: 38) was placed downstream of VAI (330 bp) 74c. Thus, when the SeV genome is transcribed, only the SeV genome portion is cut out by the action of hammerhead ribozyme and HDV ribozyme, and other factors such as VAI are removed from the SeV genome. A cell population containing only LLC-MK2-F was used. CAGnpEFL was used as a plasmid for SeV reconstruction. pSeV used pSeV+EmGFP/TSdF (control), pSeV+EmGFP/TSdF (Hh), and pSeV+EmGFP/TSdF (Hv). Comparing the fluorescence intensity derived from EmGFP from cells 3 days after reconstitution, pSeV+EmGFP/TSdF(Hh) was 52.5 times higher than the control, and pSeV+EmGFP/TSdF(Hv) was 506.5 times higher than the control, as shown in FIG. was seven times.

VAI (330 bp) 74c was integrated into the SeV genome obtained using the following primer set (L primer) that amplifies the L gene of the SeV genome and a primer set (Hv primer) that amplifies VAI (330 bp) 74c. We considered whether or not
Forward primer for L gene amplification: TGGGTCATTCCCTGACCAGA (SEQ ID NO: 39)
Reverse primer for L gene amplification: CAGCTTCGATCGTTCTGCAC (SEQ ID NO: 40)
Forward primer for VAI amplification: ATCGAGCCTTATGACAGC (SEQ ID NO: 41)
Reverse primer for VAI amplification: GATACCCTTGCGAATTTATCCACC (SEQ ID NO: 42)

The SeV genome transcribed above was collected from Vero cells and cDNA was synthesized. KOD One PCR Master Mix -Blue- (Toyobo) was used as the PCR enzyme. As shown in FIG. 17, the primer set for amplifying the L gene (L primer) amplified a part of the L gene as expected in the plasmid (pSeV) carrying the gene encoding SeV, and also in the SeV genome. Part of the L gene was amplified as expected. In contrast, Hv primers did not amplify VAI (330 bp) 74c in the SeV genome. This suggests that the VAI (330 bp) 74c was cleaved and lost from the SeV genome by the HDV ribozyme after the SeV genome was transcribed from the plasmid. Even in that case, as shown in FIG. 16, it is clear that the SeV reconstruction efficiency is improved.

(18) Introduction of VAI (330 bp) 74c into a plasmid for SeV reconstitution The above (17) described introduction of VAI (330 bp) 74c into a plasmid carrying a gene encoding the SeV genome. In this example, VAI (330 bp) 74c was introduced into a plasmid expressing the components of the SeV particle for reconstituting SeV. Specifically, a reconstruction experiment was performed as follows.

VAI (330 bp) 74c was additionally loaded into a reconstitution plasmid such as pCAGGS or pEF1 expressing NP, P, L, T7, and F5R, respectively, to obtain a reconstitution plasmid carrying VAI (330 bp) 74c. (Denoted as "pCAGGSv" and "pEFv", respectively). pCAGGSv-NPco, pCAGGSv-P4C(-)co, pEFv-Lco, pCAGGSv-T7mco, and pCAGGSv-F5Rco, as well as combinations thereof, are denoted as vCAGnpEFL. A cell population containing only LLC-MK2-F was used as cells for reconstitution. vCAGnpEFL was used as a plasmid for SeV reconstruction. CAG was used as a control. pSeV+EmGFP/TSdF was used as pSeV. Comparing the fluorescence intensity derived from EmGFP from cells 3 days after reconstitution, vCAGnpEFL-mix was 43 times higher than the control, as shown in FIG.

(19) Introduction of VAI (330 bp) 74c into SeV Reconstitution Plasmid An experiment was performed under the conditions of (18) above, in which E3Y3 was additionally introduced. As pSeV, pSeV+EmGFP/TSdF (control) and pSeV+EmGFP/TSdF (Hv) were used. Comparing the fluorescence intensity derived from EmGFP from cells 3 days after reconstitution, Hv+vCAGnpEFL-mix+E3Y3 was 2,836 times higher than the control, as shown in FIG. Comparing the infection titers of the obtained culture supernatants, Hv+vCAGnpEFL-mix+E3Y3 was 29,925 times higher than the control, as shown in FIG. SeV reconstruction was possible even if F5R and E3Y3 were not used during reconstruction.

(20) Other vector constructions A SeV genome plasmid driven by a CAG promoter or an EF1 promoter in addition to the T7 promoter was constructed (see Fig. 21A). The SeV genomic plasmid with the CAG promoter is denoted as pCAGGS-SeV, and the SeV genomic plasmid with the EF1 promoter is denoted as pEF1-SeV. A cell population containing only LLC-MK2-F was used as cells for reconstitution. CAGnpEFL was used as a plasmid for SeV reconstruction. As the SeV genome plasmid, pSeV+EmGFP/TSdF (Hv), pCAG-SeV+EmGFP/TSdF (Hv), or pEF1-SeV+EmGFP/TSdF (Hv) was used. Comparing the fluorescence intensity derived from EmGFP from cells 3 days after reconstitution, pCAG-SeV was 1.44 times higher than the control (pSeV) and pEF1-SeV was 1.6 times higher than the control (pSeV), as shown in Figure 21B. there were.

(21) Paramyxovirus reconstitution experiment other than SeV (MuV)
As cells for reconstitution of mumps virus (MuV; family of Paramyxoviridae, genus Rubulavirus), a cell population containing only LLC-MK2 was used. MuV-mix was used as a plasmid for MuV reconstruction. MuV-mix contained the following plasmids: pCAGGS-MuV-N, pCAGGS-MuV-P, pCAGGS-MuV-L, pCAGGS-T7mco. pMuV+EmGFP/mini was used as pMuV. As a plasmid containing a PKR inhibitor, pT7-VAI (330 bp)74c was used. The reference sequence of the MuV genome was the sequence registered under Accession: KY295913. The MuV minigenome was generated by removing everything between the leader and trailer sequences from the above reference sequence.

In summary, the following plasmids were used for MuV reconstitution.
pMuV+EmGFP/mini
pCAGGS-MuV-N
pCAGGS-MuV-P
pCAGGS-MuV-L
pCAGGS-T7mco

　Comparing the fluorescence intensity derived from MuV-reconstituted EmGFP from cells 3 days after reconstitution with the control, it was 184-fold in the presence of VAI (330 bp) 74c, as shown in FIG.

(22) Paramyxovirus reconstitution experiment other than SeV (MeV)
As cells for reconstitution of measles virus (MeV; genus Morbillivirus, family Paramyxoviridae), a cell population containing only LLC-MK2 was used. MeV-mix was used as a plasmid for MeV reconstruction. MeV-mix contained the following plasmids: pCAGGS-MeV-N, pCAGGS-MeV-P, pCAGGS-MeV-L, pCAGGS-T7mco. pMeV+EmGFP/mini was used as pMeV. As a plasmid containing a PKR inhibitor, pT7-VAI (330 bp)74c was used. The reference sequence of MeV was the sequence registered under Accession: KY295921. The MeV minigenome was constructed by removing everything between the leader and trailer sequences from the above reference sequence.

In summary, the following plasmids were used in the reconstitution of MeV.
pMeV+EmGFP/mini
pCAGGS-MeV-N
pCAGGS-MeV-P
pCAGGS-MeV-L
pCAGGS-T7mco
pT7-VAI(330)74c

Comparing the EmGFP-derived fluorescence intensity of MeV reconstitution from cells 3 days after reconstitution with control, as shown in FIG. was 120 times.

(23) Paramyxovirus reconstitution experiment (VSV) other than SeV
As cells for reconstitution of vesicular stomatitis virus (VSV; family Rhabdoviridae, genus Vesiculovirus), a cell population containing only LLC-MK2 was used. VSV-mix (including pCAGGS-VSV-N, pCAGGS-VSV-P, pCAGGS-VSV-L, and pCAGGS-T7mco) was used for VSV reconstruction. As the VSV genome plasmid, pVSV-ΔG-GFP-2.6 (Kerafast) was used. pCAGGS-E3Y3 was used as a PKR inhibitor.

When comparing the EGFP-derived fluorescence intensity from the cells 7 days after reconstitution, as shown in FIG. 24, the fluorescence intensity was five times higher when E3Y3 was used.

(24) Reconstitution of SeV, MeV, and MuV using heterologous RNA polymerase The following includes pCAGGS-NPco (SeV), pCAGGS-P4C (-) co (SeV), pEF1-Lco (SeV), and pCAGGS-T7mco The plasmid mixture for SeV reconstitution is designated as "SeV-mix". A plasmid mixture for MeV reconstruction containing pCAGGS-MeV-N, pCAGGS-MeV-P, pCAGGS-MeV-L and pCAGGS-T7mco is referred to as "MeV-mix". Furthermore, a plasmid mixture for MuV reconstruction containing pCAGGS-MuV-N, pCAGGS-MuV-P, pCAGGS-MuV-L and pCAGGS-T7mco is referred to as "MuV-mix".

The MeV genome plasmid used was pMeV+EmGFP/mini, which carries EmGFP in the MeV minigenome that does not express MeV constituent proteins (N, P, M, F, H, L). The MuV genome plasmid used was pMuV+EmGFP/mini, in which EmGFP was incorporated into the MuV minigenome that does not express MuV constituent proteins (N, P, M, F, SH, HN, L). The SeV genome plasmid used was pSeV+EmGFP/TSdF(Hv). A cell population containing only LLC-MK2-F was used as these reconstituting cells.

Comparing the fluorescence intensity derived from EmGFP from cells 3 days after reconstitution, as shown in FIG. was reconfigured. Similarly, the MeV and MuV genomes have also been reconstructed by heterologous polymerases. When comparing the fluorescence intensity of the SeV genome reconstructed using SeV-mix as 1, the fluorescence intensity was 0.68 when MeV-mix was used and 0.65 when MuV-mix was used. (See FIG. 27). Comparing the fluorescence intensity of the MeV genome reconstructed using MeV-mix as 1, the fluorescence intensity was 0.31 when SeV-mix was used and 0.71 when MuV-mix was used. (See FIG. 25). When comparing the fluorescence intensity of the MuV genome reconstructed using MuV-mix as 1, the fluorescence intensity was 1.22 when SeV-mix was used and 0.86 when MeV-mix was used. (See FIG. 25).

(25) Construction of VSV Using Heterologous RNA Polymerase A cell population containing only LLC-MK2 was used as cells for reconstitution of VSV. SeV-mix was used for reconstruction of VSV. As the VSV genome plasmid, pVSV-ΔG-GFP-2.6 (Kerafast) was used. As a PKR inhibitor, pCAGGS-E3Y3 was used.

Comparing EGFP-derived fluorescence intensity from cells 3 days after reconstitution, as shown in FIG. When E3Y3 was introduced into E3Y3, the fluorescence intensity was 47.5 times higher than that in the absence of E3Y3.

Furthermore, a plasmid (p3vLPNP) that expresses NP, P, and L from one plasmid was constructed (see FIG. 27A). pSeV avoided the use of T7 polymerase by being driven by the CAG promoter (pCAG-SeV) or the EF1 promoter (pEF1-SeV). As above, SeV was reconstituted with a cell population containing LLC-MK2 only. The results were as shown in Figure 27B. As shown in FIG. 27B, 7 days after reconstitution, EmGFP fluorescence was observed in both pCAG-SeV and pEF1-SeV, confirming that SeV was reconstituted. However, when T7 polymerase was additionally supplied by the pCAGGS-T7mco plasmid, the efficiency of reconstitution was greatly improved.

Description of Sequence Listing SEQ ID NO: 1: Example of sequence of EF1α promoter SEQ ID NO: 2: Example of sequence of CAG promoter SEQ ID NO: 3: Example of sequence of gene encoding EmGFP SEQ ID NO: 4: Sequence of EBER of EB virus SEQ ID NO: 5 : Sequence of TAR of HIV SEQ ID NO: 6: 2A ^pro of poliovirus
SEQ ID NO: 7: E3L of vaccinia virus
SEQ ID NO: 8: Reovirus σ3
SEQ ID NO:9: Human p58 ^IPK
SEQ ID NO: 10: K3L of vaccinia virus
SEQ ID NO: 11: HIV Tat
SEQ ID NO: 12: ICP34.5 of herpes simplex virus
SEQ ID NO: 13: nc866
SEQ ID NO: 14: long version of nc866 SEQ ID NO: 15: NS5A
SEQ ID NO: 16: NS5A (1-148)
SEQ ID NO: 17: VAI (180mer)
SEQ ID NO: 18: VAI (c.74U>V)
SEQ ID NO: 19: VAI (330mer)
SEQ ID NO: 20: VAI (330mer; c.74U>V)
SEQ ID NO:21: VAI-VAII
SEQ ID NO: 22: VAI (180mer: c.74U>M)
SEQ ID NO: 23: VAI (330mer: c.74U>M)
SEQ ID NO: 24: VAI (330mer; c.191C>D)
SEQ ID NO: 25: VAI (330mer; c.74U>V, c.191C>D)
SEQ ID NO: 26: VAI (330mer; c.74U>M, c.191C>G)
SEQ ID NO: 27: C-terminal 106 amino acids of C protein of Sendai virus SEQ ID NO: 28: NS1 of influenza virus
SEQ ID NO: 29: Us11 of herpes simplex virus
SEQ ID NO: 30: Fusion protein E3K3
SEQ ID NO: 31: fusion protein E3Y3
SEQ ID NO: 32: EmGFP-VAI (74U>A)
SEQ ID NO: 33: EmGFP-VAI74aL (74U>A)
SEQ ID NO: 34: VAI (264 bp) 74c3p
SEQ ID NO: 35: VAI (246 bp) 74c5p
SEQ ID NO: 36: Example of Hh-Rbz sequence SEQ ID NO: 37: Example of HDV-Rbz sequence SEQ ID NO: 38: Example of T7 terminator sequence SEQ ID NO: 39: Forward primer for L gene amplification SEQ ID NO: 40: L gene amplification SEQ ID NO: 41: forward primer for VAI amplification SEQ ID NO: 42: reverse primer for VAI amplification

Claims

A method for producing a negative-strand RNA virus or viral vector, comprising:
expressing a protein kinase R (PKR) inhibitory factor from a gene encoding the factor operably linked to regulatory sequences and supplying the factor to packaging cells;
expressing the genomic RNA of a negative-strand RNA virus or viral vector in a packaging cell to form a negative-strand RNA virus or viral vector in the presence of said factor;
recovering the formed negative-strand RNA virus or viral vector;
including
the PKR-inhibiting factor is a PKR-inhibiting viral factor or nc886 or p58 IPK ;
the relationship between said virus or viral vector and said PKR-inhibitory agent is heterologous, and/or the relationship between said regulatory sequence and said PKR-inhibitory agent is heterologous;
Method.
The method according to claim 1, wherein the negative-strand RNA virus or viral vector is a Sendai virus vector.
The PKR inhibitory factor is adenovirus VAI RNA, EB virus EBER, HIV virus TAR, poliovirus 2A pro , vaccinia virus E3L, reovirus δ3, influenza virus NS1, human p58 IPK , C NS5A of hepatitis virus, K3L of vaccinia virus, Tat of HIV virus, human nc886, Us11 of herpes simplex virus, and ICP34.5 of herpes simplex virus, and one or more selected from the group consisting of orthologs thereof; 3. A method according to claim 1 or 2.
The method according to any one of claims 1 to 3, wherein the minus-strand RNA virus or viral vector is produced in the absence of a helper virus.
The method according to any one of claims 1 to 4, wherein said genomic RNA further comprises a gene encoding a PKR inhibitory factor operably linked to a regulatory sequence.
The method according to any one of claims 1 to 5, wherein the packaging cell has genomic DNA having a gene encoding a PKR inhibitory factor operably linked to a regulatory sequence.
The method according to any one of claims 1 to 6, wherein the packaging cells are Vero cells or LLC-MK2 cells.
The method according to any one of claims 1 to 7, wherein the packaging cells are a cell population consisting of Vero cells or a cell population consisting of LLC-MK2 cells and do not contain other cells. .
An RNA genome of a negative-strand RNA virus or viral vector that expressably contains a gene encoding any one or more of the PKR inhibitory factors.
A minus-strand RNA virus or viral vector comprising the genome according to claim 9.
The minus-strand RNA virus or viral vector according to claim 10, further comprising a target gene.
A composition comprising the negative-strand RNA virus or viral vector according to claim 10 or 11.
A DNA encoding the RNA genome according to claim 9.
A gene expression vector comprising the DNA of claim 13 operably linked to regulatory sequences.