WO2023273762A1

WO2023273762A1 - Spatial conformational epitope mediating efficient retention of cd3 within cells and application thereof

Info

Publication number: WO2023273762A1
Application number: PCT/CN2022/096017
Authority: WO
Inventors: 李俊; 张鹏潮; 张银航
Original assignee: 苏州方德门达新药开发有限公司
Priority date: 2021-06-30
Filing date: 2022-05-30
Publication date: 2023-01-05
Also published as: CN115536740A

Abstract

The present invention relates to a spatial conformational epitope mediating efficient retention of CD3 within cells and an application thereof. Specifically, the present invention provides an epitope peptide of CD3ε, an antibody specifically binding thereto or an antigen-binding fragment thereof, and an application thereof. The present invention can effectively retain molecules containing CD3ε in cells, thereby reducing the graft versus host reaction.

Description

Stereoconformational epitopes mediating effective retention of CD3 in cells and their applications

technical field

The invention relates to a spatial conformation epitope that mediates effective retention of CD3ε in cells, a polypeptide or an antibody specifically combined with it, and applications thereof.

Background technique

With the development of tumor treatment, chimeric antigen receptor T cell (Chimeric antigen receptor-T, CAR-T) immunotherapy has gradually become a treatment method that has attracted much attention. The chimeric antigen receptor (CAR) expressed by CAR-T cells generally includes an extracellular antigen-binding domain, a transmembrane domain and an intracellular signaling domain. Usually, CAR-T cells are transduced and expanded by the patient's own T cells through the CAR gene, and then reinfused back into the patient. CAR-T cells can effectively recognize tumor antigens and induce specific anti-tumor immune responses without being restricted by the major histocompatibility complex (MHC). At present, the US FDA has approved the marketing of two autologous CAR-T cell products, Novartis’s Kymriah and Kate’s YesCAR-Ta, for the treatment of refractory relapsed non-Hodgkin’s lymphoma and acute lymphoblastic leukemia. Relevant clinical trials have proved that CAR-T has great anti-tumor potential as a fully personalized living cell drug (Maude et al.2018; Park et al.2018; Schuster et al.2017).

The preparation and reinfusion strategies of the above two CAR-T drugs are to collect the patient's own peripheral blood, isolate T cells, integrate the coding gene of CAR into the genome of T cells through a viral vector, and then expand and cultivate them. infused into the patient. This fully individualized CAR-T cell production not only has a long production cycle and high cost, but also brings many uncertainties to the reinfusion therapy. For example, the failure of CAR-T cell production due to insufficient number or malfunction of the isolated T cells, the rapid progression of the patient's disease during cell production and the loss of the therapeutic window, etc. Therefore, a common expectation in the field of CAR-T is ready-to-use (off-the-shelf) allogeneic (i.e. universal) CAR-T cells from healthy donors to effectively avoid or solve the above-mentioned production and treatment-related problems , and greatly reduce production costs.

To prepare allogeneic CAR-T cells, it is first necessary to solve a major safety problem, that is, graft-versus-host disease (GVHD). GVHD is an immune rejection reaction against normal tissues and organs of the recipient induced by alloreactive T cells in the graft that recognizes allotype tissue antigens of the host, and can be fatal in severe cases. GVHD is mediated by TCR (T cell receptor, TCR) on the surface of allogeneic T cells. The TCR is a characteristic marker on the surface of all mature T cells. TCR binds and assembles with multiple CD3 subunits in the endoplasmic reticulum (ER) in the cell through non-covalent bonds, and finally exists in the form of TCR-CD3 antigen recognition complex on the cell surface.

The allogeneic CAR-T technology based on non-gene editing has also received close attention from the industry. This technology comes from a report in 1995. The author found that expressing a specific antibody carrying an endoplasmic reticulum retention signal in the cell can effectively retain the IL-2 receptor protein in the endoplasmic reticulum, and almost never appear on the cell surface. Achieving loss-of-function similar to gene editing (Richardson et al. 1995). This technique has recently been borrowed to find peptides that can effectively downregulate the surface TCR/CD3 complex and whether there are general rules, such as which protein or epitope in the TCR/CD3 complex is most effectively recognized by the antibody contained in the peptide. Antibodies against different epitopes of the same target have differences in the activity of down-regulating surface TCR/CD3 complexes (Kamiya et al. 2018; WO2019032916A1; US20180086831A1).

There is an urgent need in the field to study the spatial conformational epitopes that mediate the effective retention of CD3ε in cells.

Contents of the invention

The first aspect of the present invention provides an epitope of CD3ε, and the epitope is an epitope peptide.

In one or more embodiments, the epitope mediates intracellular retention of CD3ε.

In one or more embodiments, the epitope comprises glutamic acid at position 56, histidine at position 61, asparagine at position 62, arginine at position 101, lysine at position 104 and Aspartic acid at position 107. In one or more embodiments, the epitope further comprises glycine at position 54, serine at position 55, glutamine at position 60, lysine at position 64 and aspartic acid at position 69 of SEQ ID NO:1.

In one or more embodiments, the epitope comprises amino acids 56, 60-65, 69-71, 101, 104, 107 of SEQ ID NO:1.

In one or more embodiments, the epitope comprises amino acids 56, 60-65, 69-71, 101-107 of SEQ ID NO: 1.

In one or more embodiments, the epitope comprises amino acids 56, 60-71, 101-107 of SEQ ID NO: 1.

In one or more embodiments, the epitope comprises amino acids 56-65, 69-71, 101-107 of SEQ ID NO: 1.

In one or more embodiments, the epitope comprises amino acids 56-71, 101-107 of SEQ ID NO: 1.

In one or more embodiments, the epitope comprises amino acids 56-107 of SEQ ID NO: 1.

In one or more embodiments, the epitope comprises amino acids 54-107 of SEQ ID NO: 1.

In one or more embodiments, the epitope is a steric epitope, the amino acids of the epitope forming a steric conformation that binds the antibody or antigen-binding fragment thereof.

In one or more embodiments, the epitope is represented by the following formula (I):

X ₁ X ₂ …X ₅₅ EX ₅₇ …X ₆₀ HNX ₆₃ …X ₁₀₀ RX ₁₀₂ X ₁₀₃ KX ₁₀₅ X ₁₀₆ DX ₁₀₈ …X ₂₀₇

(I)

Wherein, each X in X ₁ -X ₅₅ and X ₁₀₈ -X ₂₀₇ is independently any amino acid or none, and each of the other Xs is independently any amino acid.

In one or more embodiments, the epitope is represented by the following formula (II):

X ₁ X ₂ …X ₅₃ GSEX ₅₇ X ₅₈ X ₅₉ QHNX ₆₃ KX ₆₅ …X ₆₈ DX ₇₀ …X ₁₀₀ RX ₁₀₂ X ₁₀₃ KX ₁₀₅ X ₁₀₆ DX ₁₀₈ …X ₂₀₇

(II)

Wherein, each X in X ₁ -X ₅₃ and X ₁₀₈ -X ₂₀₇ is independently any amino acid or none, and each of the other Xs is independently any amino acid.

In one or more embodiments, the epitope peptide is represented by the following formula (III):

X ₅₃ X ₅₄ X ₅₅ EX ₅₇ …X ₆₀ HNX ₆₃ …X ₁₀₀ RX ₁₀₂ X ₁₀₃ KX ₁₀₅ X ₁₀₆ D

(III)

Wherein, each X is independently any amino acid.

In one or more embodiments, the epitope peptide is represented by the following formula (IV):

GSEX ₅₇ X ₅₈ X ₅₉ QHNX ₆₃ KX ₆₅ …X ₆₈ DX ₇₀ …X ₁₀₀ RX ₁₀₂ X ₁₀₃ KX ₁₀₅ X ₁₀₆ D

(IV)

Wherein, each X is independently any amino acid.

In one or more embodiments, the epitope is a fragment of SEQ ID NO: 1 comprising amino acids 56, 61, 62, 101, 104 and 107, and optionally amino acids 54, 55, 60, 64 and 69 .

In one or more embodiments, the epitope is a fragment of SEQ ID NO: 1 comprising amino acids 56, 60-65, 69-71, 101, 104, 107.

In one or more embodiments, the epitope is a fragment of SEQ ID NO: 1 comprising amino acids 56, 60-65, 69-71, 101-107.

In one or more embodiments, the epitope is a fragment of SEQ ID NO: 1 comprising amino acids 56, 60-71, 101-107.

In one or more embodiments, the epitope is a fragment of SEQ ID NO: 1 comprising amino acids 56-65, 69-71, 101-107.

In one or more embodiments, the epitope is a fragment of SEQ ID NO: 1 comprising amino acids 56-71, 101-107.

In one or more embodiments, the epitope is a fragment of SEQ ID NO: 1 comprising amino acids 56-107.

In one or more embodiments, the epitope is a fragment of SEQ ID NO: 1 comprising amino acids 54-107.

In one or more embodiments, the fragments are at least 1 amino acid, at least 2 amino acids, at least 3 amino acids, at least 4 amino acids, at least 5 amino acids, at least 6 amino acids, at least 7 amino acids, at least 8 amino acids in length. amino acids, at least 9 amino acids, at least 10 amino acids, at least 11 amino acids, at least 12 amino acids, at least 13 amino acids, at least 14 amino acids, at least 15 amino acids, at least 16 amino acids, at least 52 amino acids, at least 54 amino acids.

In one or more embodiments, glutamic acid at position 56, histidine at position 61, asparagine at position 62, arginine at position 101, lysine at position 104 and aspartic acid at position 107 in the epitope acid, and optionally Glycine 54, Serine 55, Glutamine 60, Lysine 64, and Aspartate 69 are bound to the antibody or antigen-binding fragment thereof.

The present invention also provides an anti-CD3ε antibody or an antigen-binding fragment thereof that binds an epitope of CD3ε, or a variant having at least 90% sequence identity to said anti-CD3ε antibody or an antigen-binding fragment thereof and retaining its epitope-binding activity , the epitope is located in the 54-107th position of SEQ ID NO:1, preferably, the epitope comprises glutamic acid at position 56, histidine at position 61, asparagine at position 62 of SEQ ID NO:1 , 101 arginine, 104 lysine and 107 aspartic acid.

In one or more embodiments, the epitope is as described in the first aspect of the present invention.

In one or more embodiments, the anti-CD3ε antibody is a monoclonal antibody.

In one or more embodiments, the anti-CD3ε antibody is a neutralizing antibody.

In one or more embodiments, the anti-CD3ε antibody or antigen-binding fragment thereof comprises a heavy chain variable region and a light chain variable region,

The heavy chain variable region has the following HCDRs:

HCDR1: GYTFISYT,

HCDR2: X ₁ NPRSGYT, wherein X ₁ is any amino acid,

HCDR3: AX ₂ X ₃ X ₄ YYDYX ₅ X ₆ FAY, wherein X ₂ , X ₃ , X ₄ , X ₅ , X ₆ are any amino acids,

The light chain variable region has the following LCDRs:

LCDR1: SSVSY,

LCDR2: DTS,

LCDR3: QQWSSX ₇ PPT, where X ₇ is any amino acid.

In _one or more embodiments, X is alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan, threonine , Glycine, Asparagine, Glutamine, Serine, Tyrosine, or Cysteine. Preferably, X is _I or T.

_In one or more embodiments, X is lysine, arginine or histidine. Preferably, _X2 is K or R.

_In one or more embodiments, X is glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, valine, or isoleucine. Preferably, _X3 is T or S.

_In one or more embodiments, X is glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, alanine, valine, leucine, iso Leucine, proline, phenylalanine, methionine, or tryptophan. Preferably, _X4 is G or A.

_In one or more embodiments, X is aspartic acid, glutamic acid, lysine, arginine, histidine, tyrosine, phenylalanine, or tryptophan. Preferably, X ₅ is D or H.

_In one or more embodiments, X is glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, alanine, valine, leucine, iso Leucine, proline, phenylalanine, methionine, or tryptophan. Preferably, X ₆ is G or A.

_In one or more embodiments, X is glycine, asparagine, glutamine, serine, threonine, tyrosine or cysteine. Preferably, _X7 is Q or N.

In one or more embodiments, the heavy chain variable region has the following HCDRs:

HCDR1 as shown in SEQ ID NO:2: GYTFISYT,

HCDR2 as shown in SEQ ID NO:3: TNPRSGYT,

HCDR3 as shown in SEQ ID NO:4: AKTGYYDYHAFAY.

In one or more embodiments, the light chain variable region has the following LCDRs:

LCDR1 as shown in SEQ ID NO:5: SSVSY,

LCDR2 as shown in SEQ ID NO:6: DTS,

LCDR3 as shown in SEQ ID NO:7: QQWSSQPPT.

In one or more embodiments, the heavy chain variable region has the sequence set forth as residues 659-778 of SEQ ID NO: 16 or a sequence having at least 90% sequence identity thereto.

In one or more embodiments, the light chain variable region has the sequence set forth as residues 538-643 of SEQ ID NO: 16 or a sequence having at least 90% sequence identity thereto.

In one or more embodiments, the antibody has the sequence set forth as residues 538-778 of SEQ ID NO: 16 or a sequence having at least 90% sequence identity thereto.

In one or more embodiments, the antibody or antigen-binding fragment thereof is a single chain antibody.

In one or more embodiments, the antibody or antigen-binding fragment thereof further comprises a localization sequence and an optional signal peptide.

In one or more embodiments, the positioning sequence is selected from an endoplasmic reticulum retention sequence, a Golgi retention sequence, an E3 ubiquitin ligase binding sequence, a proteasome targeting sequence or a lysosome targeting sequence; preferably, the The endoplasmic reticulum retention sequence comprises or consists of any one of SEQ ID NOs: 10-15, wherein X is any amino acid.

In one or more embodiments, the signal peptide is shown in residues 516-537 of SEQ ID NO:16.

The present invention also provides a kit comprising a polypeptide having the sequence of the epitope described in the first aspect herein and the antibody or antigen-binding fragment or variant thereof described herein.

In one or more embodiments, the polypeptide has the sequence shown in amino acids 54-107 or 56-107 of SEQ ID NO:1.

In one or more embodiments, the kit further includes reagents for detecting CD3ε by antigen-antibody reaction, such as coating solution, blocking solution, secondary antibody, chromogenic solution, and stop solution.

The present invention also provides nucleic acid molecules having a coding sequence for an epitope described herein, an antibody or antigen-binding fragment thereof, or its complement.

The invention also provides nucleic acid constructs comprising nucleic acid molecules of the invention. In one or more embodiments, the nucleic acid construct is a cloning vector, an integrating vector or an expression vector.

The invention also provides lentiviruses comprising the nucleic acid constructs of the invention.

The invention also provides cells, preferably engineered T cells, expressing the antibodies or antigen-binding fragments thereof described herein.

In one or more embodiments, the cells contain the nucleic acid molecules, nucleic acid constructs and/or lentiviruses described herein.

In one or more embodiments, the antibody or antigen-binding fragment thereof down-regulates expression of the TCR/CD3 complex in the cell.

In one or more embodiments, the antibody or antigen-binding fragment thereof comprises a localization sequence and optionally a signal peptide.

In one or more embodiments, the cells are T cells expressing a therapeutic protein. Preferably, the therapeutic protein is a chimeric antigen receptor.

In one or more embodiments, the T cells contain the expression cassette of the therapeutic protein and the expression cassette of the antibody or antigen-binding fragment thereof, or the coding sequence of the therapeutic protein and the antibody or its The coding sequences of the antigen-binding fragments are in the same expression frame.

In embodiments where the coding sequence of the therapeutic protein and the coding sequence of the antibody or antigen-binding fragment thereof are in the same expression frame, the coding sequence of the therapeutic protein and the coding sequence of the antibody or antigen-binding fragment thereof comprise Linker sequences that enable expression of multiple cistrons on a single vector.

In one or more embodiments, the linker sequence is a coding sequence for a 2A peptide.

In one or more embodiments, the 2A peptides include F2A, P2A or T2A peptides.

In one or more embodiments, the chimeric antigen receptor contains from the N-terminus to the C-terminus: a single-chain antibody against a tumor antigen, a hinge region, a transmembrane region, and an intracellular region.

In one or more embodiments, the chimeric antigen receptor specifically binds to one or more of the following tumor antigens: EGFRvIII, mesothelin, GD2, Tn antigen, sTn antigen, Tn-O - Glycopeptide, sTn-O-glycopeptide, PSMA, CD97, TAG72, CD44v6, CEA, EPCAM, KIT, IL-13Ra2, leguman, GD3, CD171, IL-11Ra, PSCA, MAD-CT-1, MAD-CT -2, VEGFR2, LewisY, CD24, PDGFR-β, SSEA-4, folate receptor α, ERBB, Her2/neu, MUC1, EGFR, NCAM, ephrin B2, CAIX, LMP2, sLe, HMWMAA, o-acetyl Genes - GD2, folate receptor beta, TEM1/CD248, TEM7R, FAP, pod protein, HPV E6 or E7, ML-IAP, CLDN6, TSHR, GPRC5D, ALK, polysialic acid, Fos-related antigen, neutrophils Elastase, TRP-2, CYP1B1, sperm protein 17, beta human chorionic gonadotropin, AFP, thyroglobulin, PLAC1, globoH, RAGE1, MN-CA IX, human telomerase reverse transcriptase, intestinal carboxyl esterase , mut hsp 70-2, NA-17, NY-BR-1, UPK2, HAVCR1, ADRB3, PANX3, NY-ESO-1, GPR20, Ly6k, OR51E2, TARP, GFRα4 and any of these antigens presented on MHC Polypeptide fragments of one, and CD5, CD10, CD19, CD20, CD21, CD22, CD23, CD24, CD25, CD27, CD30, CD34, CD37, CD38, CD40, CD53, CD69, CD72, CD73, CD74, CD75, CD77 , CD79a, CD79b, CD80, CD81, CD82, CD83, CD84, CD85, CD86, CD123, CD135, CD138, CD179, CD269, Flt3, ROR1, BCMA, FcRn5, FcRn2, CS-1, CXCR4, CXCR5, CXCR7, IL -7/3R, IL7/4/3R and IL4R.

In one or more embodiments, the hinge region is selected from a CD8α hinge region, an IgG1 Fc CH2CH3 hinge region, an IgD hinge region, a CD28 extracellular hinge region, an IgG4 Fc CH2CH3 hinge region, and a CD4 extracellular hinge region.

In one or more embodiments, the transmembrane region is selected from the group consisting of CD28 transmembrane region, CD8 transmembrane region, CD3ζ transmembrane region, CD134 transmembrane region, CD137 transmembrane region, ICOS transmembrane region and DAP10 transmembrane region one or more of.

In one or more embodiments, the intracellular region is selected from one or more intracellular regions of CD28, CD134/OX40, CD137/4-1BB, LCK, ICOS, DAP10, CD3ζ and Fc310.

In one or more embodiments, the chimeric antigen receptor comprises a signal peptide.

In one or more embodiments, the anti-tumor antigen single chain antibody is an anti-CD19 single chain antibody.

In one or more embodiments, the hinge region is a CD8α hinge region.

In one or more embodiments, the transmembrane region is a CD8 transmembrane region.

In one or more embodiments, the intracellular region comprises a 4-1BB intracellular region and a human CD3ζ intracellular region.

In one or more embodiments, the light chain variable region sequence of the anti-CD19 single chain antibody comprises or consists of amino acids 23-129 of SEQ ID NO:16.

In one or more embodiments, the heavy chain variable region sequence of the anti-CD19 single chain antibody comprises or consists of amino acids 148-267 of SEQ ID NO:16.

In one or more embodiments, the sequence of the hinge region comprises or consists of amino acids 268-312 of SEQ ID NO:16.

In one or more embodiments, the sequence of the transmembrane region comprises or consists of amino acids 313-336 of SEQ ID NO:16.

In one or more embodiments, the 4-1BB intracellular region comprises or consists of amino acids 337-378 of SEQ ID NO:16; the CD3ζ intracellular region comprises amino acids 379-490 of SEQ ID NO:16 or consisting of it.

In one or more embodiments, the signal peptide of the chimeric antigen receptor comprises or consists of amino acid residues 1-22 of SEQ ID NO:16.

Also provided herein is a composition comprising the antibody or antigen-binding fragment thereof described herein and optionally the therapeutic protein, nucleic acid molecule, nucleic acid construct, lentivirus or cell described herein, and pharmaceutically acceptable excipients .

The present invention provides the use of the epitope of the present invention in the preparation of CD3ε-specific antibodies or antigen-binding fragments thereof or cells expressing the antibodies or antigen-binding fragments thereof. The CD3ε-specific antibody or antigen-binding fragment thereof mediates efficient intracellular retention of CD3ε.

The present invention provides a method for expressing cells of CD3ε-specific antibody or antigen-binding fragment thereof, comprising: immunizing an animal with the epitope peptide described herein or a recombinant antigen comprising the epitope peptide, so that the splenocytes of the animal and the myeloma Cell fusion to obtain cells expressing antibodies or antigen-binding fragments thereof; or, using the epitope peptides described herein or recombinant antigens containing the epitope peptides to immunize animals, using the nucleic acid of the animal's antibody-secreting B cells as a template to amplify The gene sequence of the heavy chain and/or light chain variable region of the antibody is obtained by increasing, and the antibody or its antigen-binding fragment is recombinantly expressed in the cell, and the cell of the antibody or its antigen-binding fragment is obtained.

In one or more embodiments, the animal is mouse, rat, sheep, rabbit, dog, monkey.

The present invention also provides a method for preparing an antibody, comprising: culturing the cells expressing the CD3ε-specific antibody or antigen-binding fragment thereof prepared by the method herein and optionally collecting the antibody.

The present invention provides antibodies or antigen-binding fragments thereof or coding sequences thereof, nucleic acid molecules, nucleic acid constructs or lentiviruses described herein, and optionally therapeutic proteins in the preparation of chimeric antigen receptor T cells or T cells for cancer therapy Applications.

The application of the antibody or its antigen-binding fragment or its coding sequence in the preparation of reagents or vaccines for specific detection of CD3ε in the present invention.

Description of drawings

Figure 1. The effect of polypeptides containing different anti-CD3 antibody sequences on the TCR and CD3 protein levels on the surface of CAR-T cells.

Figure 2. Amino acid sequence of CD3ε.

Figure 3, 2B4 clone and OKT3 clone antibodies show strong binding sites for CD3ε.

Figure 4, detection of the binding level of the 2B4 clone antibody to the point mutation CD3ε.

Figure 5, Detection of the binding level of the OKT3 cloned antibody to the point mutation CD3ε.

detailed description

It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described in the following (such as the embodiments) can be combined with each other to form a preferred technical solution.

The inventors used the CD3εγ complex protein as an immunogen to prepare a series of monoclonal antibodies that recognize CD3ε; and then used the detection of the expression level of the TCR/CD3 complex on the surface of T cells to screen out the most effective down-regulation of T cells through endoplasmic reticulum retention. A monoclonal antibody (2B4) expressed by the TCR/CD3 complex on the cell surface; furthermore, the inventors provided a spatial conformational epitope that mediates effective retention of CD3ε in cells. Based on this, the inventors have developed a method for effectively retaining molecules containing CD3ε in cells and reducing graft-versus-host reactions.

Antigens and Antibodies

Herein, the term "epitope" is a sequence or result that exists on the surface of an antigen and determines the specificity of the antigen, also known as an antigenic determinant. An epitope peptide is one or more peptide segments consisting of such sequences. Antigens specifically bind to corresponding antibodies or cells through epitopes. The "spatial conformation epitope" mentioned herein refers to the spatial conformation formed by the amino acids of the epitope in the absence of a linear continuous sequence for binding to an antibody or its antigen-binding fragment. The conformational epitope bound by the antibody requires at least 5 amino acids, and the number of amino acids is usually 5-17 amino acids (Nevagi R J, et al. 2018). A single protein antigen molecule has many different epitopes, including linear epitopes (that is, the epitopes are composed of linearly continuous amino acids) and spatial conformational epitopes (that is, the amino acids that make up such epitopes are not completely linear and continuous). Therefore, epitope is the target structure recognized by immune cells, and it is also the basis for the specificity of immune response. Its nature, number and spatial configuration determine the specificity of antigen.

Compared with the CD3ε epitope known in the prior art, the spatial conformation epitope of CD3ε provided by the present invention has been verified by experiments to effectively down-regulate the expression of the TCR/CD3 complex on the surface of T cells. The sequence of CD3ε is shown in SEQ ID NO:1. The epitope of CD3ε of the present invention is located in the 54th-107th position of SEQ ID NO:1. The epitope comprises glutamic acid at position 56, histidine at position 61, asparagine at position 62, arginine at position 101, lysine at position 104 and aspartic acid at position 107 of SEQ ID NO:1. The epitope may also comprise glycine at position 54, serine at position 55, glutamine at position 60, lysine at position 64 and aspartic acid at position 69 of SEQ ID NO:1. These above-mentioned amino acids bind to the antibody or its antigen-binding fragment.

In some embodiments, the epitope is a polypeptide whose amino acid sequence is shown in formula (I): X ₁ X ₂ ... X ₅₅ EX ₅₇ ... X ₆₀ HNX ₆₃ ... X ₁₀₀ RX ₁₀₂ X ₁₀₃ KX ₁₀₅ X ₁₀₆ DX ₁₀₈ ... X ₂₀₇ (I), wherein, each X in X ₁ -X ₅₅ and X ₁₀₈ -X ₂₀₇ is independently any amino acid or none, and each of the remaining Xs is independently any amino acid. Preferably, the amino acid sequence of the epitope is shown in the following formula (II): X ₁ X ₂ ... X ₅₃ GSEX ₅₇ X ₅₈ X ₅₉ QHNX ₆₃ KX ₆₅ ... X ₆₈ DX ₇₀ ... X ₁₀₀ RX ₁₀₂ X ₁₀₃ KX ₁₀₅ X ₁₀₆ DX ₁₀₈ ... X ₂₀ ₇ (II), wherein each X in X ₁ -X ₅₃ and X ₁₀₈ -X ₂₀₇ is independently any amino acid or nothing, and each of the remaining Xs is independently any amino acid.

In some embodiments, the epitope is a fragment of SEQ ID NO: 1 comprising amino acids 56, 61, 62, 101, 104, and 107, and optionally amino acids 54, 55, 60, 64, and 69. The fragment may be one or more fragments comprising the above amino acids. Wherein any one of the plurality of fragments comprises any two of the above amino acids and the sequence therebetween, and the group composed of the plurality of fragments comprises all of the above amino acids. The length of the fragment can be any number of amino acids, for example, 1-207 amino acids in length. In a specific example, the epitope is a fragment of SEQ ID NO: 1 comprising amino acids 56-107 or 54-107.

The present invention also provides an anti-CD3ε antibody or an antigen-binding fragment thereof, which binds to the epitope described herein, the epitope comprising glutamic acid at position 56 and histidine at position 61 of SEQ ID NO:1 , 62 asparagine, 101 arginine, 104 lysine and 107 aspartic acid. The antibodies are preferably monoclonal antibodies and/or neutralizing antibodies. As used herein, "antibody" refers to a polypeptide comprising immunoglobulin sequence elements sufficient to allow it to specifically bind an antigen or epitope. Specific binding refers to the reaction between an antibody or antigen-binding fragment thereof and the antigen it is directed against. In certain embodiments, an antibody that specifically binds to an antigen (or an antibody specific to an antigen) refers to an antibody that is less than about 10 ^-5 M, such as less than about 10 ^-6 M, 10 ^-7 M, Binds the antigen with an affinity (KD) of 10 ⁻⁸ M, 10 ⁻⁹ M or 10 ⁻¹⁰ M or less. The antibodies described herein are preferably monoclonal antibodies.

As is known in the art, natural intact antibodies are tetramers comprising two identical heavy chain polypeptides and two identical light chain polypeptides. Each heavy chain comprises at least four domains: an amino-terminal variable domain VH, a constant domain CH1, a constant domain CH2, and a carboxy-terminal constant domain CH3. Each light chain comprises two domains: an amino-terminal variable domain VL and a carboxy-terminal constant domain CL. Each variable domain comprises three "complementarity determining regions": CDR1, CDR2, and CDR3, and four "framework" regions: FR1, FR2, FR3, and FR4. "Antigen-binding fragment" means a fragment of an antibody that specifically binds to a target antigen. Antibodies or antigen-binding fragments thereof include Fab fragments, Fab' fragments, F(ab')2 fragments, Fd' fragments, Fd fragments, Fv fragments, disulfide bonded Fv fragments, single chain antibodies (scFv), isolated CDRs Or CDR group, polypeptide-Fc fusion, single domain antibody, camel antibody, masking antibody, small module immune drug, bifunctional antibody, nanobody, Humabody antibody.

In an exemplary embodiment, the heavy chain variable region of an anti-CD3ε antibody of the invention or an antigen-binding fragment thereof has the following HCDRs: HCDR1: GYTFISYT, HCDR2: X ₁ NPRSGYT (SEQ ID NO: 19), wherein X ₁ is any Amino acid, HCDR3: AX ₂ X ₃ X ₄ YYDYX ₅ X ₆ FAY (SEQ ID NO: 20), wherein X ₂ , X ₃ , X ₄ , X ₅ , X ₆ are any amino acids. The light chain variable region of an exemplary anti-CD3ε antibody or antigen-binding fragment thereof has the following LCDRs: LCDR1: SSVSY, LCDR2: DTS, LCDR3: _QQWSSX7PPT (SEQ ID NO: ₂₁ ), where X7 is any amino acid. _X1 is alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan, threonine, glycine, asparagine, glutamine Amide, serine, tyrosine or cysteine, preferably I or T _; X2 is lysine, arginine or histidine, preferably K or R; _X3 is glycine, asparagine, gluten Aminoamide, serine, threonine, tyrosine, cysteine, valine or isoleucine, preferably T or S; _X4 is glycine, asparagine, glutamine, serine, threonine acid, tyrosine, cysteine, alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine or tryptophan, preferably G or A _; X5 is aspartic acid, glutamic acid, lysine, arginine, histidine, tyrosine, phenylalanine or tryptophan, preferably D or H _; X6 is glycine, Asparagine, Glutamine, Serine, Threonine, Tyrosine, Cysteine, Alanine, Valine, Leucine, Isoleucine, Proline, Phenylalanine, Methanol Thionine or tryptophan, preferably G or A; X ₇ is glycine, asparagine, glutamine, serine, threonine, tyrosine or cysteine, preferably Q or N. In one or more embodiments, the heavy chain variable region has the sequence set forth as residues 659-778 of SEQ ID NO: 16 or a sequence having at least 90% sequence identity thereto. In one or more embodiments, the light chain variable region has the sequence set forth as residues 538-643 of SEQ ID NO: 16 or a sequence having at least 90% sequence identity thereto.

Herein, a single-chain antibody (scFv) refers to an antibody fragment that has the ability to bind to an antigen and is composed of an antibody light chain variable region (VL region) amino acid sequence and a heavy chain variable region (VH region) amino acid sequence connected by a hinge. Herein, a linker or hinge is a polypeptide fragment connecting different proteins or polypeptides, the purpose of which is to keep the connected proteins or polypeptides in their respective spatial conformations, so as to maintain the function or activity of the proteins or polypeptides. Exemplary linkers include G and/or S-containing linkers.

In the present invention, an antibody or antigen-binding fragment thereof includes a mutant having at least 70% sequence identity to a reference sequence and retaining the antigen-binding activity of said antibody or antigen-binding fragment. Said mutants include: having at least 70%, at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 97% sequence identity with the reference sequence and retaining the biological activity of the reference sequence amino acid sequence. Sequence identity between two aligned sequences can be calculated using, for example, NCBI's BLASTp. Mutants also include amino acid sequences having one or several mutations (insertions, deletions or substitutions) in said amino acid sequence while still retaining the biological activity of the reference sequence. The number of mutations usually refers to within 1-50, such as 1-20, 1-10, 1-8, 1-5 or 1-3. Substitutions are preferably conservative substitutions. For scFv, the mutation can occur in the CDR region or in the FR region, as long as the biological activity of the reference sequence remains after the mutation. For example, in the art, conservative substitutions with amino acids with similar or similar properties generally do not change the function of the protein or polypeptide. "Amino acids with similar or similar properties" include, for example, families of amino acid residues with similar side chains, which families include amino acids with basic side chains (e.g., lysine, arginine, histidine), amino acids with acidic side chains, chain amino acids (such as aspartic acid, glutamic acid), amino acids with uncharged polar side chains (such as glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine amino acids), amino acids with non-polar side chains (e.g. alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), Amino acids with β-branched side chains (eg threonine, valine, isoleucine) and amino acids with aromatic side chains (eg tyrosine, phenylalanine, tryptophan, histidine). Therefore, substitution of one or several positions in a polypeptide of the invention with another amino acid residue from the same side chain class will not substantially affect its activity.

Antibodies are bound to localization sequences that direct them to subcellular structures. The positioning sequence can be located at the N-terminal or C-terminal of the polypeptide. The localization sequence includes an endoplasmic reticulum retention sequence, a Golgi apparatus retention sequence, an E3 ubiquitin ligase binding sequence, a proteasome localization sequence, or a lysosome localization sequence. The endoplasmic reticulum retention sequence suitable for use in the present invention may be an endoplasmic reticulum retention sequence well known in the art. An endoplasmic reticulum retention sequence may be located at the C-terminus of an adjacent polypeptide. The positioning sequence and its adjacent polypeptide can be connected directly, or can be connected through a linker sequence well known in the art, such as the linker sequence containing G and S mentioned above. Exemplary endoplasmic reticulum retention sequences include or consist of any of SEQ ID NOs: 10-15, wherein X is any amino acid.

An antibody or antigen-binding fragment thereof described herein may also include a signal peptide. The signal peptide may be a membrane protein signal peptide, such as a signal peptide of an antibody heavy chain, a signal peptide of an antibody light chain, a CD8 signal peptide, a CD28 signal peptide, and a CD4 signal peptide. An exemplary signal peptide used herein is shown as residues 516-537 of SEQ ID NO:16.

The antibodies or antigen-binding fragments thereof described herein can be obtained by various methods, such as production by hybridomas, single-cell sequencing, chemical synthesis, or expression by cells by constructing expression vectors. Therefore, the present invention includes a method for preparing hybridoma cells and using the hybridoma cells to prepare antibodies, comprising: immunizing animals with the epitope of the present invention or a recombinant antigen comprising the epitope peptide, and making the spleen cells of the animal and the myeloma cells Fusing, obtaining cells expressing the antibody or antigen-binding fragment thereof, and optionally culturing the fused cells. The method for recombinantly expressing the epitope peptide or the recombinant antigen comprising the epitope peptide can be any method for recombinantly expressing the polypeptide in the art, for example, the coding sequence of the epitope peptide is introduced into the cell through the expression vector and then expressed, and the method described below is passed The method for constructing expression vectors to express antibodies from cells is similar. The antibodies, preferably monoclonal antibodies, described herein can be obtained by culturing the hybridoma cells. The present invention also includes a method for obtaining antibody-expressing cells using single-cell sequencing methods and using the cells to prepare antibodies, including: immunizing animals with the epitope peptides described herein or recombinant antigens containing the epitope peptides, and secreting The nucleic acid of the B cell of the antibody is used as a template to amplify the gene sequence of the heavy chain and/or light chain variable region of the antibody, and recombinantly express the antibody or its antigen-binding fragment in the cell to obtain the expressed antibody or its antigen-binding fragment cells, and optionally cultured cells. Among them, amplifying and obtaining the gene sequence of the heavy chain and/or light chain variable region of the antibody includes, for example, isolating antigen-specific B cells from tissues (such as spleen) or peripheral blood, and secreting B cells from a single antibody by single-cell PCR technology. The antibody heavy and light chain variable region genes are amplified in cells. After the heavy chain and light chain variable region genes are linked into an antibody or its antigen-binding fragment (such as scFv), it can be transformed into cells (such as Escherichia coli or yeast) for expression using conventional methods to obtain the antibody or its antigen-binding fragment. Methods of chemical synthesis are well known in the art. The method of expression from cells by constructing an expression vector is as follows.

Therapeutic peptides and CAR

The invention also provides cells, such as engineered T cells, that express the antibodies described herein, or antigen-binding fragments thereof. Therapeutic polypeptides can be further expressed in the engineered T cells. In allogeneic therapy, these T cells were effective in avoiding graft-versus-host reactions. In the treatment of autologous reinfusion, the T cells prepared by the method of the present invention avoid the exhaustion of CD8+ T cells caused by the simultaneous activation of the TCR/CD3 complex and CAR, thereby improving the therapeutic effect.

The "therapeutic protein" or "therapeutic polypeptide" described herein refers to molecules that exert corresponding therapeutic activity after being expressed in cells (especially T cells), which may be natural or isolated from the natural environment, or manufactured Substances, including but not limited to: proteins or polypeptides derived from viruses, bacteria, plants, animals, small molecular active peptides, antigens or fragments thereof (such as antigenic epitopes, antigenic determinants), antibodies or fragments thereof (such as heavy chain , light chain, Fab, Fv, scFv), antigen receptor (such as chimeric antigen receptor CAR), fusion protein or polypeptide, etc.

Therefore, the present invention also provides a CAR-T cell comprising a chimeric antigen receptor (CAR) targeting a tumor antigen of interest and a polypeptide of the antibody or antigen-binding fragment thereof described herein. The present invention also provides a CAR-T cell, comprising a nucleic acid molecule encoding a chimeric antigen receptor (CAR) targeting a tumor antigen of interest and a nucleic acid molecule of an antibody or an antigen-binding fragment thereof.

Herein, suitable T cells may be various T cells well known in the art, especially various T cells routinely used in cellular immunotherapy, including but not limited to peripheral blood T lymphocytes, cytotoxic killer T cells, helper T cells Cells, suppressor/regulatory T cells, γδT cells, cytokine-induced killer cells, tumor infiltrating lymphocytes, etc., and any one or more mixtures of the above cells. Herein, CAR-T cells refer to T cells expressing at least a chimeric antigen receptor.

Herein, chimeric antigen receptor has a well-known meaning in the art. It is an artificially engineered receptor capable of anchoring specific molecules (such as antibodies) that recognize tumor cell surface antigens on immune cells (such as T cells) , allowing immune cells to recognize tumor antigens and kill tumor cells. Chimeric antigen receptors suitable for use herein can be various CARs known in the art. Typically, a CAR comprises a polypeptide that binds a tumor antigen, a hinge region, a transmembrane region, and one or more intracellular signaling regions. Common tumor antigens of interest and their specific molecules are known in the art. In a preferred embodiment, the tumor antigen-binding polypeptide of the present invention is a single-chain antibody that specifically binds a tumor antigen.

In embodiments where the single chain antibody to the tumor antigen is an anti-CD19 single chain antibody, the tumor antigen of interest is CD19 and the single chain antibody of interest is a single chain antibody that specifically binds CD19. In one or more embodiments, the anti-CD19 single chain antibody is derived from FMC63. Exemplarily, the light chain variable region sequence of an anti-CD19 single-chain antibody comprises SEQ ID NO: 16 amino acids 23-129 or consists of it; the heavy chain variable region sequence of an anti-CD19 single-chain antibody comprises SEQ ID NO: 16 amino acids 148-267 or consist thereof, wherein the heavy chain variable region and the light chain variable region are connected by a linker sequence containing G and S.

Other parts contained in the CAR suitable for the present invention, such as the hinge region, transmembrane region, intracellular signal region and optional signal peptide can be the hinge region, transmembrane region and intracellular signal area.

Exemplarily, the sequence of the hinge region of human CD8α comprises or consists of amino acid residues 268-312 of SEQ ID NO: 16; the amino acid sequence of the transmembrane region comprises or consists of amino acid residues 313-336 of SEQ ID NO: 16 Composition; The amino acid sequence of intracellular signal region can be as shown in SEQ ID NO:16 the 337th-490th amino acid residue; Exemplary signal peptide amino acid sequence can comprise SEQ ID NO:16 the 1st-22th amino acid residue or consists of it. In one or more embodiments, the CAR contains an optional anti-tumor antigen single-chain antibody, a hinge region, a transmembrane region, and one or more intracellular regions from the N-terminus to the C-terminus. The amino acid sequence of an exemplary chimeric antigen receptor comprises or consists of amino acid residues 23-490 of SEQ ID NO: 16, or comprises or consists of amino acid residues of SEQ ID NO: 16.

The above-mentioned parts that form the chimeric antigen receptor herein, such as the signal peptide, the light chain variable region and the heavy chain variable region, the hinge region, the transmembrane region and the intracellular signal region of the single-chain antibody, etc., can be directly interacted with each other. or can be linked by a linker sequence well known in the art, such as a linker sequence comprising G and S. The therapeutic protein of the present invention and the antibody can be connected directly, or can be connected through a linker sequence, such as a linker sequence containing G and S. Alternatively, the therapeutic protein and the antibody also contain linking sequences capable of expressing multiple polycistrons on a single vector, such as 2A peptides, including F2A, P2A, T2A peptides and the like. In one or more embodiments, the amino acid sequence of the 2A peptide comprises or consists of amino acids 494-515 of SEQ ID NO:16. The 2A peptide can also be connected to the polypeptides on both sides by conventional G and S-containing linkers.

nucleic acid molecule

The invention includes nucleic acid molecules encoding the antibodies or antigen-binding fragments thereof of the invention. A nucleic acid molecule of the invention may be in the form of DNA or RNA. Forms of DNA include cDNA, genomic DNA or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be either the coding strand or the non-coding strand. The present invention also includes degenerate variants of nucleic acid molecules encoding polypeptides or proteins, that is, nucleic acid molecules that encode the same amino acid sequence but differ in nucleotide sequence.

The nucleic acid molecule of the present invention may be the coding sequence of a therapeutic protein such as CAR and the coding sequence of an antibody or an antigen-binding fragment thereof, or an expression cassette of a therapeutic protein and the protein or polypeptide. Herein, the coding sequence refers to the nucleic acid sequence that directly determines the amino acid sequence of its protein product (such as CAR, single-chain antibody, hinge region, transmembrane region, intracellular signal region, or the antibody or antigen-binding fragment thereof described herein, etc.) part. The boundaries of the coding sequence are usually determined by the ribosome binding site (for prokaryotic cells) immediately upstream of the 5' open reading frame of the mRNA and the transcription termination sequence immediately downstream of the 3' open reading frame of the mRNA. A coding sequence may include, but is not limited to, DNA, cDNA, and recombinant nucleic acid sequences. Herein, the expression cassette refers to the complete elements required to express the gene of interest, including the promoter, gene coding sequence and PolyA tailing signal sequence. The nucleic acid molecules described herein can be two independent nucleic acid molecules, respectively containing the coding sequence of the therapeutic protein and the coding sequence of the antibody, such as the expression cassette of the therapeutic protein and the expression cassette of the polypeptide; The coding sequence of the protein and the coding sequence of the antibody can be connected into one nucleic acid molecule through a linker, such as the coding sequence of the therapeutic protein and the coding sequence of the antibody are in the same expression frame, or the two expression frames are connected into the same nucleic acid molecule through a suitable linker. nucleic acid molecule. In some embodiments, the nucleic acid molecule of the present invention is a nucleic acid molecule in which the coding sequence of the therapeutic protein and the coding sequence of the polypeptide are in the same expression frame, which contains a promoter, a nucleic acid sequence encoding the therapeutic protein and polypeptide, and PolyA tailed signal. In one or more embodiments, the nucleic acid molecule further comprises a coding sequence for an optional endoplasmic reticulum retention sequence.

In certain embodiments, the coding sequence or expression cassette is integrated into the genome of the T cell. Thus, in these embodiments, the T cells described herein have stably integrated into their genomes expression cassettes encoding the therapeutic proteins and antibodies described herein.

The nucleic acid molecules described herein can generally be obtained by PCR amplification. Specifically, primers can be designed according to the nucleotide sequence disclosed herein, especially the open reading frame sequence, and a commercially available cDNA library or a cDNA library prepared by a conventional method known to those skilled in the art can be used as a template, related sequences were amplified. When the sequence is long, it is often necessary to carry out two or more PCR amplifications, and then splice together the amplified fragments in the correct order. Alternatively, the nucleic acid molecules described herein can also be directly synthesized.

Nucleic acid constructs and cells

Methods for constructing expression vectors for expression by cells involve nucleic acid constructs. The nucleic acid constructs herein comprise the nucleic acid molecules described herein, and one or more regulatory sequences operably linked to these sequences. The nucleic acid molecules of the invention can be manipulated in a variety of ways to ensure expression of the antibody or therapeutic protein. Before inserting the nucleic acid construct into the vector, the nucleic acid construct can be manipulated according to the differences or requirements of the expression vector. Techniques for altering the sequence of nucleic acid molecules using recombinant DNA methods are known in the art.

The regulatory sequence may be a suitable promoter sequence. The promoter sequence is usually operably linked to the coding sequence of the protein to be expressed. The promoter can be any nucleotide sequence that shows transcriptional activity in the host cell of choice, including mutated, truncated, and hybrid promoters, and can be derived from an extracellular sequence that encodes either homologous or heterologous to the host cell. Or intracellular polypeptide gene acquisition. The control sequence may also be a suitable transcription terminator sequence, a sequence recognized by a host cell to terminate transcription. A terminator sequence is operably linked to the 3' end of the nucleotide sequence encoding the polypeptide. Any terminator that is functional in the host cell of choice may be used in the present invention. The regulatory sequence may also be a suitable leader sequence, an untranslated region of an mRNA important for translation by the host cell. A leader sequence is operably linked to the 5' end of the nucleotide sequence encoding the polypeptide. Any terminator that is functional in the host cell of choice may be used in the present invention. The regulatory sequences may also be an origin of replication functional in at least one organism, convenient restriction enzyme sites and one or more selectable markers. For example, in certain embodiments, the invention utilizes a lentiviral vector comprising an origin of replication, a 3'LTR, a 5'LTR, a nucleic acid molecule as described herein, and optionally a selectable marker .

In certain embodiments, the nucleic acid construct is a vector. The vector can be a cloning vector, an expression vector, or a homologous recombination vector. The nucleic acid molecules of the invention can be cloned into many types of vectors, eg, plasmids, phagemids, phage derivatives, animal viruses and cosmids. Cloning vectors can be used to provide the coding sequences of the therapeutic proteins and polypeptides of the present invention, such as a nucleic acid molecule comprising the coding sequences of the therapeutic proteins and polypeptides. Expression vectors can be provided to cells as viral vectors. Expression of a nucleic acid molecule of the invention is typically achieved by operably linking the nucleic acid molecule of the invention to a promoter, and incorporating the construct into an expression vector. Viral vector technology is well known in the art and described, for example, in Sambrook et al. (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York) and other handbooks of virology and molecular biology. Viruses that can be used as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, and lentiviruses. Homologous recombination vectors are used to integrate the expression cassettes described herein into the host genome.

To assess expression of a therapeutic protein or antibody, the expression vector introduced into the cell may also contain a selectable marker gene or reporter gene to facilitate the identification and selection of expressing cells from the population of cells sought to be transfected or infected by the viral vector. In other aspects, selectable markers can be carried on a single piece of DNA and used in a co-transfection procedure. Both the selectable marker and the reporter gene may be flanked by appropriate regulatory sequences to enable expression in the host cell. Useful selectable markers include, for example, antibiotic resistance genes such as neo and the like.

Methods of introducing genes into cells and expressing genes into cells are known in the art. Vectors can be readily introduced into host cells, eg, mammalian, bacterial, yeast or insect cells, by any method known in the art. For example, expression vectors can be transferred into host cells by physical, chemical or biological means. Physical methods for introducing nucleic acid molecules into host cells include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. Biological methods for introducing nucleic acid molecules of interest into host cells include the use of DNA and RNA vectors. Chemical means of introducing nucleic acid molecules into host cells include colloidal dispersion systems, such as macromolecular complexes, nanocapsules, microspheres, beads; and lipid-based systems, including oil-in-water emulsions, micelles, mixed micelles, and lipid body. Biological methods for introducing nucleic acid molecules into host cells include the use of viral vectors, such as vectors derived from lentiviruses, poxviruses, herpes simplex virus I, adenoviruses and adeno-associated viruses, especially retroviral vectors. The selected gene can be inserted into a vector and packaged into a retroviral particle, such as a lentiviral particle, using techniques known in the art. The recombinant virus can then be isolated and delivered to subject cells in vivo or ex vivo. Reagents for lentiviral packaging are well known in the art, for example, conventional lentiviral vector systems include pRsv-REV, pMDlg-pRRE, pMD2G and objective interfering plasmids. In one embodiment, the lentiviral vector pWPXL is used. Therefore, in certain embodiments, the present invention also provides a lentivirus for activating T cells, the virus comprising the retroviral vector described herein and the corresponding packaging genes, such as gag, pol, vsvg and/or rev.

Herein, a host cell contains, expresses and/or secretes an antibody or antigen-binding fragment thereof and optionally a therapeutic polypeptide described herein. Herein, when it is mentioned that a cell contains or contains, expresses, or secretes a molecule such as a polypeptide, "contains" means that the molecule is contained in or on the surface of the cell; "expression" means that the cell produces the molecule "secretion" means that the cell secretes the expressed molecule out of the cell. Host cells include not only T cells that are ultimately used for the purpose of disease treatment, but also various cells used in the process of producing CAR-T cells, such as E. coli cells, for example, providing the coding sequence of the protein of the present invention or providing the carrier described. In certain embodiments, provided herein is a CAR-T cell stably expressing an antibody described herein.

Pharmaceutical compositions and kits

This article also provides a pharmaceutical composition, which contains the antibody or its antigen-binding fragment or T cell described herein and pharmaceutically acceptable auxiliary materials. Herein, pharmaceutically acceptable excipients refer to carriers, diluents and/or excipients that are pharmacologically and/or physiologically compatible with the subject and the active ingredient, including but not limited to: pH regulators, topical Active agents, carbohydrates, adjuvants, antioxidants, chelating agents, ionic strength enhancers and preservatives. More specifically, suitable pharmaceutically acceptable adjuvants may be adjuvants commonly used in the art for administration of antibodies or antigen-binding fragments thereof or T cells (such as CAR-T cells).

Typically, the pharmaceutical composition contains a therapeutically effective amount of an antibody or antigen-binding fragment thereof or T cells. A therapeutically effective amount refers to a dose that can achieve treatment, prevention, alleviation and/or alleviation of a disease or condition in a subject. The therapeutically effective dose can be determined according to factors such as the patient's age, sex, disease and its severity, and other physical conditions of the patient. Herein, a subject or a patient generally refers to a mammal, especially a human.

Also provided herein is a kit for detecting CD3ε, comprising a polypeptide and the antibody or antigen-binding fragment thereof described herein, wherein the sequence of the polypeptide is the sequence of the epitope described herein. In one or more embodiments, the kit further includes reagents for detecting CD3ε by antigen-antibody reaction, such as coating solution, blocking solution, secondary antibody, chromogenic solution, and stop solution.

Also provided herein is a kit for vector transfection comprising the nucleic acid construct described herein. The kit may also contain various reagents suitable for transfecting the nucleic acid construct into cells, and optionally instructions to guide those skilled in the art to transfect the recombinant expression vector into cells.

therapy

The invention also includes an antibody or cell therapy wherein T cells are genetically modified to express the therapeutic proteins and antibodies described herein, and the antibody or T cells are administered to a subject. For example, administered antibodies or CAR-T cells are able to kill the recipient's tumor cells. The anti-tumor immune response induced by CAR-T cells can be active or passive immune response. Alternatively, the CAR-mediated immune response can be part of an adoptive immunotherapy step in which CAR-T cells induce an immune response specific for the antigen-binding portion of the CAR.

The diseases suitable for treatment with the CAR, polypeptides, their coding sequences, nucleic acid constructs, expression vectors, viruses or CAR-T cells of the present invention are related to the tumor antigen single-chain antibody contained in the CAR. Therefore, the diseases described herein include various types of cancers related to the aforementioned tumor antigens, including solid tumors and blood tumors, such as adenocarcinoma, lung cancer, colon cancer, colorectal cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer , cholangiocarcinoma, gallbladder cancer, esophageal cancer, pancreatic cancer, and prostate cancer, as well as leukemias and lymphomas, such as B-cell lymphoma, mantle cell lymphoma, acute lymphoblastic leukemia, chronic lymphocytic leukemia, hairy cell leukemia, and acute myeloid leukemia etc. In the embodiment where the tumor antigen is CD19, the diseases that can be treated by using the CARs, polypeptides, their coding sequences, nucleic acid constructs, expression vectors, viruses or CAR-T cells described herein comprising anti-CD19 single chain antibodies are preferably CD19-mediated diseases; such as acute/chronic B-lineage lymphocytic leukemia, non-Hodgkin's lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, and mantle cell lymphoma, etc.

Antibodies, antigen-binding fragments thereof, or T cells of the invention may be administered alone or as pharmaceutical compositions. The antibodies, antigen-binding fragments thereof, or cells of the invention can be administered in a manner suitable for the disease to be treated (or prevented). The amount and frequency of administration will be determined by various factors, such as the patient's condition, and the type and severity of the patient's disease. Administration of the compositions may be by any convenient means, including by injection, infusion, implantation or transplantation. The compositions described herein can be administered to a patient subcutaneously, intradermally, intratumorally, intranodally, intraspinally, intramuscularly, by intravenous injection or intraperitoneally. In one embodiment, an antibody, antigen-binding fragment thereof, or T cell of the invention is administered to a patient by intradermal or subcutaneous injection. In another embodiment, the antibody, antigen-binding fragment thereof or T cell composition of the invention is administered preferably by intravenous injection. Compositions of T cells can be injected directly into tumors, lymph nodes or sites of infection.

In some embodiments of the invention, antibodies, antigen-binding fragments thereof, or T cells or compositions thereof of the invention may be combined with other therapies known in the art. Such therapies include, but are not limited to, chemotherapy, radiation therapy, and immunosuppressants. For example, treatment may be combined with radiotherapy or chemotherapy agents known in the art to treat tumor antigen-mediated diseases.

Herein, "anti-tumor effect" refers to a biological effect that can be represented by a decrease in tumor volume, a decrease in the number of tumor cells, a decrease in the number of metastases, an increase in life expectancy, or an improvement in various physiological symptoms associated with cancer.

The present invention adopts CD3ε to prepare hybridoma to obtain antibody 2B4, and takes the gene sequence of anti-CD19 antibody as an example, searches human CD8α hinge region, human CD8 transmembrane region, 4-1BB intracellular region, human CD3ζ cell region from NCBI GenBank database Sequence information such as the inner region and anti-CD3 single-chain antibody, the whole gene synthesis of the chimeric antigen receptor and the gene fragment of the antibody 2B4scFV are inserted into the lentiviral vector. The recombinant plasmid packs the virus in 293T cells, infects T cells, and makes T cells express the chimeric antigen receptor. The method for realizing the transformation of T lymphocytes modified by the chimeric antigen receptor gene of the present invention is based on the lentivirus transformation method. On the surface of the transgenic T lymphocytes, the transformed nucleic acid is expressed through transcription and translation. The proportions of TCR+ and CD3+ populations on the cell surface of the CAR-T cells prepared by the present invention were greatly reduced, being 9.9% and 25.5% respectively.

Exemplary implementation:

1. An epitope peptide of CD3ε, comprising amino acids 56, 61, 62, 101, 104 and 107 of SEQ ID NO:1,

Preferably, said epitope peptide is a steric epitope peptide,

Preferably, the epitope peptide also comprises amino acids 54, 55, 60, 64 and 69 of SEQ ID NO: 1,

More preferably, the epitope peptide comprises amino acids 56-107 of SEQ ID NO: 1, or comprises amino acids 54-107 of SEQ ID NO: 1.

2. An epitope peptide of CD3ε, said epitope peptide is shown in the following formula (I):

(I)

Wherein, each X in X ₁ -X ₅₅ and X ₁₀₈ -X ₂₀₇ is independently any amino acid or none, and each of the remaining Xs is independently any amino acid,

Preferably, the epitope peptide is represented by the following formula (III):

X ₅₄ X ₅₅ EX ₅₇ … X ₆₀ HNX ₆₃ … X ₁₀₀ RX ₁₀₂ X ₁₀₃ KX ₁₀₅ X ₁₀₆ D

(III)

wherein _X54 and _X55 are each independently any amino acid or none, and the remaining X are each independently any amino acid, or

Preferably, the epitope peptide is represented by the following formula (IV):

(IV)

Wherein, X is each independently any amino acid,

More preferably, the epitope peptide is a fragment of SEQ ID NO: 1 comprising amino acids 56, 61, 62, 101, 104 and 107, and optionally amino acids 54, 55, 60, 64 and 69, or, The epitope peptide is a fragment of SEQ ID NO: 1 comprising amino acids 56-107 or a fragment of SEQ ID NO: 1 comprising amino acids 54-107.

3. Use of the epitope peptide described in

item

1 or 2 in the preparation of CD3ε-specific antibodies or antigen-binding fragments thereof or cells expressing CD3ε-specific antibodies or antigen-binding fragments thereof.

4. A method for preparing cells expressing CD3ε-specific antibodies or antigen-binding fragments thereof, the method comprising:

(1) immunizing animals with the epitope peptide described in

item

1 or 2 or a recombinant antigen comprising the epitope peptide,

(2) fused animal spleen cells with myeloma cells to obtain cells expressing the antibody or its antigen-binding fragment,

or

(1) immunizing animals with the epitope peptide described in

item

1 or 2 or a recombinant antigen comprising the epitope peptide,

(2) using the nucleic acid of the animal's antibody-secreting B cells as a template to amplify the gene sequence of the heavy chain and/or light chain variable region of the antibody, and

(3) recombinantly expressing the antibody or its antigen-binding fragment in cells to obtain cells expressing the antibody or its antigen-binding fragment,

Preferably, the animals are mice, rats, sheep, rabbits, dogs, monkeys.

5. A method for preparing an antibody or its binding fragment, comprising: culturing the cells prepared by the method of item 4 and optionally collecting the antibody or its binding fragment.

6. An antibody or antigen-binding fragment thereof that binds to the epitope peptide of CD3ε as described in

item

1 or 2,

Preferably, the antibody or antigen-binding fragment thereof comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region has the following HCDRs:

HCDR1 as shown in SEQ ID NO:2: GYTFISYT,

HCDR2 as shown in SEQ ID NO:3: TNPRSGYT,

HCDR3 as shown in SEQ ID NO:4: AKTGYYDYHAFAY,

The light chain variable region has the following LCDRs:

LCDR1 as shown in SEQ ID NO:5: SSVSY,

LCDR2 as shown in SEQ ID NO:6: DTS,

LCDR3 as shown in SEQ ID NO:7: QQWSSQPPT,

Preferably, the antibody or antigen-binding fragment thereof further comprises a localization sequence; more preferably, the localization sequence is selected from an endoplasmic reticulum retention sequence, a Golgi apparatus retention sequence, an E3 ubiquitin ligase binding sequence, a proteasome localization sequence or Lysosomal targeting sequence.

7. A nucleic acid molecule having the coding sequence of the epitope peptide according to

item

1 or 2 and/or the antibody or antigen-binding fragment thereof according to item 4 or 5 or its complementary sequence.

8. A cell comprising:

(1) expressing the antibody or antigen-binding fragment thereof described in item 6, and/or

(2) Containing the nucleic acid molecule described in item 7.

9. A pharmaceutical composition, comprising the antibody or antigen-binding fragment thereof of item 6, the nucleic acid molecule of item 7 and/or the cell of item 8, and pharmaceutically acceptable excipients.

10. The antibody or antigen-binding fragment thereof described in item 6, the nucleic acid molecule described in item 7, and/or the cell described in item 8 are used in the preparation of chimeric antigen receptor T cells, T cells for cancer treatment, and specific detection of CD3ε Application in reagents or vaccines.

The present invention is described in further detail by referring to the following experimental examples. These examples are provided for illustrative purposes only and are not intended to be limiting unless otherwise specified. Accordingly, the invention should in no way be construed as limited to the following examples, but rather should be construed to encompass any and all variations that become apparent as a result of the teaching presented herein. The methods and reagents used in the examples, unless otherwise stated, are conventional methods and reagents in the art.

Example

Example 1 - Preparation and identification of mouse anti-human CD3 monoclonal antibody

1. Use CD3εγ complex protein (Cat.No.CDG-H52W6, ACRO) as the immunization antigen, add complete Freund's adjuvant at a ratio of 1:1 for the initial immunization, mix well until fully emulsified, and use conventional subcutaneous injection for 6-8 weeks Inject 100 μl subcutaneously into Balb/c mice at the age of 12, and repeat booster immunization every two weeks, a total of 2 times. The booster immunization is added with incomplete Freund's adjuvant at a ratio of 1:1. Level. Intrasplenic injection was used for the last immunization, and the dose was the same as before. The mice were sacrificed 3 days later, and the spleen was taken out. The spleen single cell suspension was obtained by conventional methods, and the cell viability was detected to be >90%.

2. Mix spleen cells and SP2/0 mouse myeloma cells at a ratio of 10:1, centrifuge, and co-precipitate, place the centrifuge tube containing the mixed cells in a water bath at 37°C, and add it with a 1 ml pipette in about 45 seconds l ml 50% PEG (1400MW) preheated to 40°C, shake gently while adding, add 20-30ml fresh serum-free medium preheated to 37°C within 90 seconds, let stand for 10 minutes, centrifuge and precipitate The cells were added to 20% FCS RPMI-1640 medium, transferred to a 96-well cell culture plate for culture, 1×HAT selection medium was added after 24 hours, and cultured in a 37°C, 5% CO2 incubator. Fresh medium was replaced every 3 days until colonies grew out.

3. Select a single clone to form a well, take the supernatant after 2 weeks, and measure the expression level of the antibody by ELISA method. The positive clones obtained by the primary screening are transferred to a 24-well plate for culture, and then the supernatant is identified after re-screening. If it is still needed Positive clones were subcloned, passaged under conventional conditions, and stabilized to the fifth passage, and 1B3, 2B4, 6B8, 6D2, 9E8, 11G7, 12H5, 16C2, 17D10, and 18E4 were frozen and stored as materials for subsequent research.

4. Identify the subtype of the monoclonal antibody obtained above by using the test paper rapid assay (Argen company), and determine the heavy chain variable region sequence and light chain variable region of the obtained mouse anti-human CD3 monoclonal antibody sequence. It was found that the 2B4 clone has high homology with the amino acid variable region sequence of the currently known CD3 antibody clone hum291 (VH and VL sequences are shown in SEQ ID NO: 8 or 9).

Example 2 - vector construction

1. From the NCBI website database, the hinge region of human CD8α, the transmembrane region of human CD8, the intracellular region of 4-1BB, the intracellular region of human CD3ζ, the heavy chain and light chain variable regions of anti-human CD19 antibody (clone FMC63), Heavy and light chain variable region gene sequence information for control anti-human CD3 antibodies (clone OKT3 and clone hum291). The remaining anti-CD3 antibody sequences are from Example 1 and have been humanized. All relevant amino acid sequences are codon-optimized on the website https://www.thermofisher.com/order/geneartgenes to ensure that it is more suitable for expression in human cells without changing the encoded amino acid sequence.

2. Using overlapping PCR, the above sequences were sequentially divided into anti-CD19-scFv gene, human CD8 hinge region gene, human CD8 transmembrane region gene, 4-1BB intracellular region gene, human CD3ζ intracellular region, F2A and CD3-scFv gene, The anti-CD3-scFv gene and endoplasmic reticulum retention sequence (AEKDEL) are connected to form complete gene sequence information. The amino acid sequence comprising the signal peptide is shown in residues 1-22 and residues 516-537 of SEQ ID NO:16.

3. The nucleotide sequence of the CAR molecule was seamlessly cloned into the BamHI/EcoRI site of the lentiviral plasmid pWPXL (Addgene), and transformed into competent Escherichia coli (Stbl3).

4. Send the recombinant plasmid to Suzhou Jinweizhi Biotechnology Co., Ltd. for sequencing, and compare the sequencing result with the fitted sequence to verify whether the sequence is correct. The sequencing primers are

Sense sequence: TCAAGCCTCAGACAGTGGTTC (SEQ ID NO: 17)

Antisense sequence: CCAGTCAATCTTTCACAAATTTTG (SEQ ID NO: 18).

Example 3 - Viral packaging

After the sequencing was correct, the plasmid was extracted and purified using Qiagen’s plasmid purification kit, and the purified plasmid was transfected into 293T cells by the calcium phosphate method for lentiviral packaging experiments (Molecular Therapy-Methods & Clinical Development, 2016, 3: 16017 ), thus preparing the following lentiviral vectors: control (CAR19-F2A-GFP), sample control 1 (CAR19-F2A-hun291scfv-AEKDEL), sample control 2 (CAR19-F2A-OKT3scfv-AEKDEL), sample 1 (CAR19 -F2A-1B3-scfv-AEKDEL), sample 2 (CAR19-F2A-2B4-scfv-AEKDEL), sample 3 (CAR19-F2A-6B8-scfv-AEKDEL), sample 4 (CAR19-F2A-6D2-scfv-AEKDEL ), sample 5 (CAR19-F2A-9E8-scfv-AEKDEL), sample 6 (CAR19-F2A-11G7-scfv-AEKDEL), sample 7 (CAR19-F2A-12H5-scfv-AEKDEL), sample 8 (CAR19-F2A -16C2-scfv-AEKDEL), sample 9 (CAR19-F2A-17D10-scfv-AEKDEL), sample 10 (CAR19-F2A-18E4-scfv-AEKDEL).

The separation of embodiment 4-PBMC and T cell

Peripheral blood PBMC isolation, T cell isolation and activation, in vitro culture

Select healthy donors with negative HBV, HCV and HIV tests, draw blood from the median cubital vein, separate the buffy coat of PBMC by Ficoll density gradient centrifugation, measure the percentage of CD3+T cells according to the whole blood flow cytometry, and calculate the number of CD3+T cells, according to DynaBeads The ratio of CD3/CD28 to CD3+T cells is 3:1, absorb the amount of magnetic beads used, incubate with buffy coat cells for 30 minutes, and separate CD3+T cells. CD3+T cells are activated by Dynabeads CD3/CD28 (Life Technology) for 24 hours The proportion of CD25+CD69+T cells was detected by flow cytometry.

Example 5 - lentiviral transduction and T cell culture

After CD3+ T activation, lentiviral transduction was performed. Coat the 24-well plate with Novonectin and incubate at 37°C for 2 hours, and configure the cell suspension with the various lentiviruses (MOI=3) and Tscm (2U/ml, nearshore protein) prepared above to form a transducer device In the coated 24-well plate, the cell density was adjusted to 1.0E+06/ml, centrifuged at 500 g for 30 min, and placed in an incubator at 37° C. and 5% CO2 for static culture for 48 hours after centrifugation. After lentivirus transfection, culture in Xvivo15 medium containing 5% FBS, supplement Tscm (final concentration 2U/ml) every other day, count and adjust the cell density to 0.5E+06/ml, culture until harvest on the 8th-10th day cell.

Example 6-CAR Positive Rate and CAR-T Cell TCR or CD3 Average Fluorescent Intensity

Count and collect 5.0E+05 cells, wash the cells twice and resuspend in 100 ul buffer containing 4% BSA. Add 8ul of anti-human TCR or CD3 antibody to each tube of cells, vortex and mix well, and incubate at 4°C for 30 minutes. After staining and incubation, wash the cells repeatedly, dilute the fluorescently labeled anti-CAR19 antibody Protein L 500x, resuspend the cells, 200ul per tube, vortex and mix, and incubate at 4°C for 30 minutes. The cells were washed repeatedly, resuspended in 500 ul of buffer containing 4% BSA, 4 ul of 7AAD dye was added to each tube, vortexed and incubated for 10 minutes at room temperature in the dark. Finally, the samples were transferred to a flow tube, and the CAR19 transfection efficiency and the TCR or CD3 surface level of the CAR19+ T cell population were detected on a Calibr flow cytometer.

First, the widely used anti-human CD3 murine antibody (OKT3) was evaluated. In order to avoid the rejection caused by the mouse sequence in clinical application, it was humanized and tested at the cell level. The results are shown in Figure 1 and Table 1, the expression of polypeptides containing humanized OKT3 antibody sequences can down-regulate the activity of TCR/CD3 complexes on the cell surface, and in transduction positive cells (CAR+), the TCR- and CD3-populations The proportions are 62.00% and 52.60% respectively. However, the proportion of TCR/CD3+ population is still high, which will bring great challenges to the purification of CAR-T cells and also bring great risks to clinical application.

Peptides containing antibody 2B4 sequences can most effectively down-regulate the level of TCR/CD3 complexes on the cell surface, and up to 91.40% of CAR+ cells do not express surface TCR; up to 89.59% of CAR+ cells do not express surface CD3 (Figure 1 and Table 1 ). At the same time, we also found that the hum291 clone with high amino acid variable region sequence homology with the 2B4 clone did not show the same excellent ability to down-regulate the TCR/CD3 complex on the cell surface as 2B4 (the proportion of the TCR- and CD3-populations of hum291 82.1% and 50.2%, respectively).

Table 1

a: ratio of Q4/ratio of Q2+Q4

Example 7 - Ability of T cells to secrete IFN-γ

The lentivirus-transfected T cells in each group were cultured in vitro until the 8th day, and the TCR-dependent T cell activation antibody OKT3 was added to the final concentrations of 50ng/ml, 100ng/ml, 150ng/ml, and 200ng/ml, respectively. Dilute the CAR-T cell samples of each group to an appropriate multiple with X-VIVO15 culture medium, take out the corresponding number of bars as needed, add 100ul of diluent RD1-51 to each well, mix the diluted samples, and take 100ul into the well (complete within 15 minutes); cover with parafilm and incubate at room temperature for 2 hours. After the incubation is complete, completely remove the solution in the well, add washing solution, let stand for 1 minute, repeat this step, and wash four times in total; add 200ul of human IFN-γ coupling reagent to each well, cover with a new parafilm, and incubate at room temperature 2 hours; add 200ul of substrate solution to each well, and incubate at room temperature in the dark for 30 minutes; after incubation, add 50ul of stop solution to each well, mix well and detect on a microplate reader (set wavelength to 450nm, correct wavelength to 570nm/540nm).

The results showed that compared with the control group, the IFN-γ secretion ability of the cells containing the 2B4 antibody sequence completely disappeared in all the experimental groups, indicating that there was no functional TCR/CD3 complex on the cell surface of the cells, which was completely consistent with the previous experimental results. unanimous. However, cells containing OKT3 antibody and hum291 antibody sequences still have the ability to secrete IFN-γ, so 2B4 antibody can better retain the expression of TCR/CD3 complex in cells.

Example 8-2B4 Antibody and OKT3 Antibody Binding Epitope Determination

1) In order to determine the specific steric epitope of the 2B4 antibody binding to the CD3 antigen, antigen competition binding experiments showed that OKT3 and 2B4 competed for binding to CD3, indicating that the steric epitope of the OKT3 and 2B4 antibody binding to the CD3 antigen may exist to a certain extent overlap. Therefore, according to the epitope information of OKT3, we designed primers to construct a mutation library of CD3ε sequence, and selected the mutation positions located at amino acids 54-56, 60-65, 69-71, 101, 104, and 107 of the target CD3ε, respectively. amino acid mutation to alanine.

2) Using the mutation library, 15 mutants (CD3ε mutant plasmids 1-15, corresponding to amino acids 54-56, 60-65, 69-71, 101, 104, and 107 respectively) were prepared according to the method in Example 1. Mutant CD3ε).

3) 15 CD3ε mutant plasmids (1 μg) and CD3γ plasmids (1 μg) were co-transfected into 293T cells respectively, and the expression of intracellular CD3 molecules was detected according to the method in Example 5 after 48 hours of transfection.

CD3 is a transmembrane protein found on T cells. There are four subtypes, namely CD3δ, CD3ε, CD3γ and CD3ζ. CD3γ/CD3ε exist in the form of heterodimerization. Antibodies to the CD3γ/CD3ε complex recognize only this complex, but do not bind CD3γ or CD3ε monomers. According to Figure 4, CD3ε mutant plasmid 3, CD3ε mutant plasmid 5, CD3ε mutant plasmid 6, CD3ε mutant plasmid 13, CD3ε mutant plasmid 14 and CD3ε mutant plasmid 15 could not effectively bind to the 2B4 antibody. It shows that glutamic acid at position 56 of CD3ε, histidine at position 61 of CD3ε, asparagine at position 62 of CD3ε, arginine at position 101 of CD3ε, lysine at position 104 of CD3ε, and aspartic acid at position 107 of CD3ε are The steric binding epitope of antibody 2B4.

According to FIG. 5 , neither CD3ε mutant plasmid 3 nor CD3ε mutant plasmid 13 could effectively bind to the OKT3 antibody. It indicated that glutamic acid at position 56 of CD3ε and arginine at position 101 of CD3ε are the spatial binding epitopes of antibody OKT3.

The 2B4 antibody and the OKT3 antibody exhibited different epitope binding abilities to the CD3ε protein (Table 2 and Figure 3). Our experiments have confirmed that 2B4 recognizes CD3 as a spatial epitope, which partially overlaps with the recognition epitope of OKT3. The spatial epitope recognized by 2B4 must contain at least 56 glutamic acid, 61 histidine, 62 asparagine, 101 Arginine at position 104, lysine at position 104 and aspartic acid at position 107. The spatial epitope recognized by 2B4 further includes 5 amino acids of glycine at position 54, serine at position 55, glutamine at position 60, lysine at position 64, and aspartic acid at position 69.

Table 2

质粒序号Plasmid number	突变位置mutation position	2B4染色强度2B4 staining intensity	OKT3染色强度OKT3 staining intensity
CD3εCD3ε	无none	++++++	++++++
CD3ε突变1 CD3ε mutant 1	G54AG54A	++++	++++
CD3ε突变2 CD3ε mutant 2	S55AS55A	++++	++++++
CD3ε突变3 CD3ε mutant 3	E56AE56A	--	--
CD3ε突变4 CD3ε mutant 4	Q60AQ60A	++++	++++++
CD3ε突变5CD3ε mutant 5	H61AH61A	--	+ +

CD3ε突变6CD3ε mutation 6	N62AN62A	--	++
CD3ε突变7CD3ε mutant 7	D63AD63A	++++++	++++++
CD3ε突变8 CD3ε mutation 8	K64AK64A	++++	++++++

CD3ε突变9 CD3ε mutation 9	N65AN65A	++++++	++++++
CD3ε突变10 CD3ε mutation 10	D69AD69A	++++	++++++
CD3ε突变11 CD3ε mutation 11	E70AE70A	++++++	++++++
CD3ε突变12 CD3ε mutation 12	D71AD71A	++++++	++++++
CD3ε突变13 CD3ε mutation 13	R101AR101A	--	--
CD3ε突变14 CD3ε mutation 14	K104AK104A	--	+ +

CD3ε突变15CD3ε mutation 15	D107AD107A	--	++++++

Claims

A CD3ε epitope peptide comprising amino acids 56, 61, 62, 101, 104 and 107 of SEQ ID NO:1,

Preferably, said epitope peptide is a steric epitope peptide,

Preferably, the epitope peptide also comprises amino acids 54, 55, 60, 64 and 69 of SEQ ID NO: 1,

More preferably, the epitope peptide comprises amino acids 56-107 of SEQ ID NO: 1, or comprises amino acids 54-107 of SEQ ID NO: 1.
A kind of epitope peptide of CD3ε, described epitope peptide is as shown in following formula (I):

X 1 X 2 …X 55 EX 57 …X 60 HNX 63 …X 100 RX 102 X 103 KX 105 X 106 DX 108 …X 207

(I)

Wherein, each X in X 1 -X 55 and X 108 -X 207 is independently any amino acid or none, and each of the remaining Xs is independently any amino acid,

Preferably, the epitope peptide is represented by the following formula (III):

X 54 X 55 EX 57 … X 60 HNX 63 … X 100 RX 102 X 103 KX 105 X 106 D

(III)

wherein X54 and X55 are each independently any amino acid or none, and the remaining X are each independently any amino acid, or

Preferably, the epitope peptide is represented by the following formula (IV):

GSEX 57 X 58 X 59 QHNX 63 KX 65 …X 68 DX 70 …X 100 RX 102 X 103 KX 105 X 106 D

(IV)

Wherein, X is each independently any amino acid,

More preferably, the epitope peptide is a fragment of SEQ ID NO: 1 comprising amino acids 56, 61, 62, 101, 104 and 107, and optionally amino acids 54, 55, 60, 64 and 69, or, The epitope peptide is a fragment of SEQ ID NO: 1 comprising amino acids 56-107 or a fragment of SEQ ID NO: 1 comprising amino acids 54-107.
Use of the epitope peptide according to claim 1 or 2 in the preparation of CD3ε-specific antibodies or antigen-binding fragments thereof or cells expressing CD3ε-specific antibodies or antigen-binding fragments thereof.
A method for preparing cells expressing CD3ε-specific antibodies or antigen-binding fragments thereof, the method comprising:

(1) immunizing animals with the epitope peptide according to claim 1 or 2 or a recombinant antigen comprising the epitope peptide,

(2) fused animal spleen cells with myeloma cells to obtain cells expressing the antibody or its antigen-binding fragment,

or

(1) immunizing animals with the epitope peptide according to claim 1 or 2 or a recombinant antigen comprising the epitope peptide,

(2) using the nucleic acid of the animal's antibody-secreting B cells as a template to amplify the gene sequence of the heavy chain and/or light chain variable region of the antibody, and

(3) recombinantly expressing the antibody or its antigen-binding fragment in cells to obtain cells expressing the antibody or its antigen-binding fragment,

Preferably, the animals are mice, rats, sheep, rabbits, dogs, monkeys.
A method for preparing an antibody or its binding fragment, comprising: culturing the cells prepared by the method of claim 4 and optionally collecting the antibody or its binding fragment.
An antibody or antigen-binding fragment thereof that binds to the epitope peptide of CD3ε as claimed in claim 1 or 2,

Preferably, the antibody or antigen-binding fragment thereof comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region has the following HCDRs:

HCDR1 as shown in SEQ ID NO:2: GYTFISYT,

HCDR2 as shown in SEQ ID NO:3: TNPRSGYT,

HCDR3 as shown in SEQ ID NO:4: AKTGYYDYHAFAY,

The light chain variable region has the following LCDRs:

LCDR1 as shown in SEQ ID NO:5: SSVSY,

LCDR2 as shown in SEQ ID NO:6: DTS,

LCDR3 as shown in SEQ ID NO:7: QQWSSQPPT,

Preferably, the antibody or antigen-binding fragment thereof further comprises a localization sequence; more preferably, the localization sequence is selected from an endoplasmic reticulum retention sequence, a Golgi apparatus retention sequence, an E3 ubiquitin ligase binding sequence, a proteasome localization sequence or Lysosomal targeting sequence.
A nucleic acid molecule having the coding sequence of the epitope peptide according to claim 1 or 2 and/or the antibody or antigen-binding fragment thereof according to claim 4 or 5 or its complementary sequence.
A cell that:

(1) expressing the antibody or antigen-binding fragment thereof of claim 6, and/or

(2) Containing the nucleic acid molecule according to claim 7.
A pharmaceutical composition comprising the antibody or antigen-binding fragment thereof of claim 6, the nucleic acid molecule of claim 7 and/or the cell of claim 8, and pharmaceutically acceptable excipients.
The antibody or antigen-binding fragment thereof according to claim 6, the nucleic acid molecule according to claim 7, and/or the cell according to claim 8 are used in the preparation of chimeric antigen receptor T cells, T cells for cancer treatment, and specific detection of CD3ε application in reagents or vaccines.