WO2023243971A1 - Pharmaceutical composition for preventing or treating demyelinating disease, comprising kinase inhibitor as active ingredient - Google Patents

Pharmaceutical composition for preventing or treating demyelinating disease, comprising kinase inhibitor as active ingredient Download PDF

Info

Publication number
WO2023243971A1
WO2023243971A1 PCT/KR2023/008064 KR2023008064W WO2023243971A1 WO 2023243971 A1 WO2023243971 A1 WO 2023243971A1 KR 2023008064 W KR2023008064 W KR 2023008064W WO 2023243971 A1 WO2023243971 A1 WO 2023243971A1
Authority
WO
WIPO (PCT)
Prior art keywords
zebrafish
demyelinating disease
kinase
apoptosis
disease
Prior art date
Application number
PCT/KR2023/008064
Other languages
French (fr)
Korean (ko)
Inventor
박해철
이윤경
김수현
최용문
송명진
김판수
정귀완
Original Assignee
고려대학교 산학협력단
재단법인 경기도경제과학진흥원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 고려대학교 산학협력단, 재단법인 경기도경제과학진흥원 filed Critical 고려대학교 산학협력단
Publication of WO2023243971A1 publication Critical patent/WO2023243971A1/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/34—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having five-membered rings with one oxygen as the only ring hetero atom, e.g. isosorbide
    • A61K31/341—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having five-membered rings with one oxygen as the only ring hetero atom, e.g. isosorbide not condensed with another ring, e.g. ranitidine, furosemide, bufetolol, muscarine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/35—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom
    • A61K31/352—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom condensed with carbocyclic rings, e.g. methantheline 
    • A61K31/353—3,4-Dihydrobenzopyrans, e.g. chroman, catechin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47—Quinolines; Isoquinolines
    • A61K31/4709—Non-condensed quinolines and containing further heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/517—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with carbocyclic ring systems, e.g. quinazoline, perimidine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system

Definitions

  • the present invention relates to a pharmaceutical composition for preventing or treating demyelinating disease, including as an active ingredient a kinase inhibitor that has been confirmed to promote motility recovery and oligodendrocyte regeneration in demyelinating disease-induced zebrafish.
  • Demyelinating disease is a nervous system disease that occurs when the myelin sheath surrounding axons is damaged.
  • Multiple sclerosis is a representative demyelinating disease, an autoimmune disease that attacks and destroys the body's own myelin sheath due to immune regulation dysfunction, or inflammatory dehydration that occurs in the central nervous system. It is known as inflammatory demyelinating disease.
  • This disease has a prevalence of approximately 2.5 million people worldwide and 2,500 people in Korea, its etiology is still unclear, and treatments currently in use or under development are aimed at lowering the frequency of disease recurrence by controlling the immune response. The progression can only be slowed down, and the damaged myelin cannot be restored, making fundamental treatment impossible. Therefore, for complete treatment, it is necessary to develop a treatment that can promote remyelination by oligodendrocytes in areas where demyelination has progressed, in addition to suppressing the autoimmune response, which is the existing method.
  • Zebrafish is a vertebrate with high genetic and functional similarity to the human genome. It has more than 80% homology with human disease genes, and its nervous system and various organ formation processes are very similar to those of humans, making it suitable for research on human diseases. It is an important animal model on which much research is being conducted worldwide.
  • zebrafish is easy to genetically manipulate, making it possible to develop knock-out and transgenic models, and since embryos are transparent during the development process, transgenic zebrafish that express fluorescent proteins specifically for oligodendrocytes and myelin can be used. In this case, it is the only vertebrate in which the myelination and demyelination process of nerve cells can be observed in vivo.
  • zebrafish is a very suitable model for screening candidate substances for disease treatment. Based on these advantages, zebrafish was used in the present invention.
  • the zebrafish used in the present invention is a transgenic zebrafish produced by applying the Q (QF2-QUAS) system, and enhanced-potency nitroreductase (epNTR), a chemical genetic technique, is used to specifically kill oligodendrocytes.
  • Q Q
  • epNTR enhanced-potency nitroreductase
  • MTZ metronidazole
  • the epNTR / MTZ system is a method in which epNTR reduces MTZ in a pro-drug state and converts it into a cytotoxic substance, thereby inducing the death of oligodendrocytes.
  • a zebrafish model in which demyelination is induced can be produced through the death of oligodendrocytes in transgenic zebrafish.
  • the model manufactured in this way can be usefully used to evaluate the effectiveness of candidate substances for developing treatments for demyelinating diseases.
  • kinases are very important in all signaling pathways that regulate metabolism, cell signaling, protein regulation, cell transport, and secretion, and are being studied as potential drug targets in various diseases.
  • 38 kinase inhibitors have been approved as treatments.
  • various kinases including AKT, JNK1, FYN, and RHO kinases, are known to play an important role in the differentiation and migration of oligodendrocytes and the myelination formation process.
  • BTK Bruton's tyrosine kinase
  • the present invention aimed to discover effective substances through evaluation of the effectiveness of kinase inhibitors in improving demyelinating disease.
  • the technical problem to be achieved by the present invention is to provide a pharmaceutical composition for preventing or treating demyelinating diseases.
  • the present invention provides four types of kinase inhibitors finally selected as a result of screening for drugs to treat demyelinating diseases using a demyelinating disease animal model using transgenic zebrafish for the prevention or treatment of demyelinating diseases. do.
  • the present invention provides a pharmaceutical composition for preventing or treating demyelinating diseases, comprising as an active ingredient at least one kinase inhibitor selected from the group consisting of the above four types of kinase inhibitors.
  • the present invention provides a method of treating demyelinating disease, comprising administering the four types of kinase inhibitors to a patient who develops demyelinating disease or is likely to develop the disease.
  • the four types of kinase inhibitors selected as treatment substances for demyelinating diseases in the present invention are 3BDO, ONO-7475, AZ12601011, and Theaflavin 3,3'-digallate.
  • the selected kinase inhibitor can restore decreased mobility, which is a symptom of demyelinating disease.
  • the selected kinase inhibitor can promote the regeneration of oligodendrocytes.
  • the selected kinase inhibitor can be dissolved in embryonic medium and administered to the subject at a concentration of 10 nM to 10 ⁇ M once per day for 4 days.
  • the present invention uses transgenic zebrafish that specifically express fluorescence in oligodendrocytes to induce demyelination, and then induces four types of kinase inhibitor active substances that exhibit significant effects on recovery of motility and regeneration of oligodendrocytes.
  • the selected kinase inhibitor can be used as a treatment for demyelinating diseases.
  • Figure 1 shows an experimental schematic diagram (A) and the results of the experiment (B) for confirming changes in motility in a zebrafish model of demyelinating disease following tacrine treatment.
  • Figure 2 is a schematic diagram (A) of an experiment and the results of the experiment (B) for confirming the death and regeneration of glial cells in a zebrafish model of demyelinating disease following tacrine treatment.
  • Figure 3 is a schematic diagram of a toxicity test of a kinase inhibitor and its results.
  • Figure 4 is a schematic diagram of a drug screening experiment using a zebrafish model of demyelinating disease.
  • Figure 5 shows the results of confirming changes in zebrafish motility caused by a total of 160 types of kinase inhibitors treated in zebrafish with demyelinating disease.
  • Figure 6 shows the results of confirming the level of oligodendrocytes in zebrafish by a total of 17 types of kinase inhibitors treated in zebrafish with demyelinating disease.
  • Figure 7 shows the targets of the four types of kinase inhibitors finally selected as drugs for treating demyelinating diseases.
  • the present inventors created an animal model that can quickly and efficiently induce demyelinating disease, and developed a rare disease at the site of the disease in which demyelination has progressed. It was confirmed that the animal model operates effectively in verifying the effectiveness of drug candidates for the development of treatments that can promote remyelination by dendritic cells.
  • the transgenic zebrafish of the present invention contains a plasmid vector containing the QF2 gene operating under the MBP promoter (specifically, mbpa:QF2pA plasmid) and a plasmid vector containing epNTR and a reporter gene operating under the QUAS promoter (specifically, QUAS: epNTR-p2a-mCherry plasmid) is microinjected with a transposase into a zebrafish fertilized egg, grown into an adult (F0), and then crossed with a wild-type zebrafish, which expresses a fluorescent protein in the obtained zebrafish. It can be prepared by selecting zebrafish (F1).
  • MBP promoter specifically, mbpa:QF2pA plasmid
  • a plasmid vector containing epNTR and a reporter gene operating under the QUAS promoter specifically, QUAS: epNTR-p2a-mCherry
  • demyelinating disease animal model of the present invention can be prepared by treating the transgenic zebrafish of the present invention with MTZ (metronidazole).
  • transgenic zebrafish developed using the conventional Gal4-UAS system induces death of oligodendrocytes through long-term treatment of 60 hours with high concentration of MTZ (10 mM)
  • the above-described transgenic zebrafish of the present invention were able to confirm that treatment with a low concentration of MTZ (2 mM) for a short period of 18 hours induced oligodendrocyte death at a stronger level than in the existing model.
  • the transgenic zebrafish of the present invention can reduce drug usage by 1/5 compared to the conventional one and can efficiently cause demyelinating disease in 1/3.3 reduced time.
  • the present invention provides a method for screening substances for treating demyelinating disease using the demyelinating disease animal model of the present invention.
  • the present inventors Using the demyelinating disease animal model we prepared, the present inventors identified four types of kinase inhibitors that restore decreased mobility, which is a symptom of demyelinating disease, and inhibit the death of oligodendrocytes and/or promote their regeneration, and used them to treat demyelinating disease. It is provided for therapeutic purposes.
  • the present inventors treated the manufactured demyelinating disease animal model with a total of 160 types of kinase inhibitors that are expected to be applicable to the treatment of demyelinating disease, and 17 types of kinases that restore the motility of zebrafish with induced demyelinating disease. Inhibitors were identified. Additionally, imaging-based analysis was performed on zebrafish treated with 17 types of kinase inhibitors selected through behavior-based analysis. As a result, four types of kinase inhibitors that promote the regeneration of oligodendrocytes were identified.
  • the four types of kinases finally selected as treatments for demyelinating diseases are 3BDO, ONO-7475, AZ12601011, and Theaflavin 3,3'-digallate.
  • the first effective substance, 3BDO is a butyrolactone derivative with the structure of formula 1 below and is known to inhibit autophagy regulated through mTOR. Additionally, autophagy is known to play a very important role in the maturation process of Schwann cells and oligodendrocytes. In addition, since abnormal autophagy flux is associated with various neurological disorders characterized by abnormal myelination, it is believed that autophagy plays an important role in demyelinating diseases and has the potential to be a therapeutic target. mTOR signaling, another target of 3BDO, is also reported to be very close to the myelination process.
  • oligodendrocyte-specific mTOR knock-down mice of the central nervous system According to reported research results, the number of mature oligodendrocytes was reduced in oligodendrocyte-specific mTOR knock-down mice of the central nervous system, and the onset of myelination was delayed and the expression of myelination-related proteins was also delayed, resulting in mTOR It can be seen that it plays an important role in the differentiation and myelination of oligodendrocytes.
  • the second active substance, ONO-7475 has the structure of formula 2 below and is a drug that targets Trk receptors.
  • Brain-derived neurotrophic factor (BDNF) one of the pro-myelinating molecules, promotes myelination through Trk receptors. It has been reported that BDNF-Trk signaling is likely to affect the survival and differentiation of oligodendrocyte progenitor cells for remyelination after demyelination.
  • the third active substance, AZ12601011, has the structure of formula 3 below and is a drug that targets TGF- ⁇ receptor.
  • TGF- ⁇ signal has been reported to play a dual role in controlling the death and proliferation of Schwann cells in developing nerves. there is.
  • Theaflavin 3,3'-digallate the fourth active substance, has the structure of formula 4 below and is known to have anticancer efficacy. It targets Akt, ERK, MEK, and NF- ⁇ B, and in fact, Akt, ERK, and MEK are very closely related to myelination. Akt is involved in not only myelination of the peripheral nervous system but also the synthesis of myelination-related proteins in Schwann cells, and activation of ERK1/2 in oligodendrocytes has been reported to promote myelination recovery after injury. Additionally, it has been reported that non-activated microglia promote the survival and maturation of oligodendrocyte progenitor cells through NF- ⁇ B.
  • Example 1 Zebrafish breeding and management
  • transgenic zebrafish that express epNTR specifically in oligodendrocytes
  • polymerase chain reaction was performed using epNTR gene-specific primers containing attB1 and attB2 sequences.
  • the polymerase chain reaction product obtained through this was cloned into a middle entry vector from BP clonase (Invitrogen).
  • a multi-site gateway LR reaction was performed to create mbpa:QF2 and QUAS:epNTR-p2a-mCherry plasmid constructs.
  • the 5'-entry vector containing the mbpa promoter, the intermediate entry vector containing QF2, the 3'-repression vector containing the poly A sequence, and the destination vector were incubated with LR clone reaction enzyme (LR II clonase, Invitrogen).
  • LR II clonase Invitrogen
  • mbpa:QF2pA plasmid was produced by reacting with .
  • the 5'-entry vector with the QUAS promoter inserted, the intermediate entry vector with the epNTR gene inserted, the 3'-entry vector with the P2A peptide-conjugated red fluorescent protein (mCherry) gene inserted, and the target vectors were incubated with the LR clone reaction enzyme.
  • QUAS:epNTR-p2a-mCherry plamid was produced by reacting with .
  • the plasmid DNA created in this way was microinjected with transposase into the 1-cell stage of zebrafish fertilized eggs, then grown into adults ( founder, F0), and then crossed with wild-type zebrafish to produce zebrafish (Zebrafish that express red fluorescent protein).
  • F1 was selected to prepare transgenic zebrafish.
  • Primers used to prepare plasmid DNA are as follows.
  • Fertilized wild-type zebrafish embryos were distributed 10 to each well of a 48-well plate, treated with 10 ⁇ M kinase inhibitor for 4 days, and then reared in an incubator maintained at a temperature of 28.5°C with a light/dark cycle of 14:10 hours.
  • To evaluate embryo toxicity, hatching rate, survival rate, malformation rate, swimming abnormality, etc. were observed under a stereomicroscope to select a concentration that did not cause toxicity. The selection criteria are shown in Figure 1, and based on the toxicity evaluation results, the treatment concentration was selected as 10 nM ⁇ 10 ⁇ M based on the standards shown in Figure 1.
  • Example 4 Induction of oligodendrocyte death
  • MTZ (2mM, Sigma-Aldrich) was prepared by dissolving in embryonic medium containing 0.08% dimethyl sulfoxide (DMSO), and 2mM was administered to fry at 5 days (5 dpf) after fertilization of transgenic zebrafish. Death of oligodendrocytes was induced by treatment with MTZ for 18 hours.
  • DMSO dimethyl sulfoxide
  • Zebrafish that were treated with 2mM MTZ for 18 hours to induce death of oligodendrocytes were divided into 1 a group that was transferred to embryonic medium (E3) and had a recovery period, 2 a group that had a recovery period in embryonic medium for 2 days, and then was treated with 250, a positive substance. It is divided into a group treated with nM tacrine, and a group treated with a kinase inhibitor. Kinase inhibitors were treated for 4 days at concentrations determined through embryotoxicity assessment.
  • Oligodendrocytes were identified at 20-25 ⁇ m intervals using the Z-Stack function of NIS-Elements AR Analysis 4.30 software (Nikon) at 20x magnification and 568 nm laser using a Nikon A1Si laser-scanning confocal microscope (Nikon). I took about a few shots. The captured images were combined into one image using software, and the number of living oligodendrocytes was measured to compare the control group and the experimental group.
  • a t-Test was performed for comparative analysis between the control and experimental groups, and when a drug treatment group was added, comparative analysis of three or more groups was performed using one-way analysis of variance (ANOVA) and post-hoc analysis. -hoc Tukey's Multiple Comparison Test was performed. Statistical significance in all data was judged to be valid when the P two-tailed probability value was less than 0.05, and all statistical analyzes were performed using GraphPad Prism 7 software.
  • 5 dpf transgenic zebrafish were separated into three groups: a control group, a group treated with MTZ and recovered in embryonic medium (E3), and a group treated with MTZ and recovered in 250 nM tacrine.
  • the control group was maintained in embryo medium, and the remaining two experimental groups were treated with 2mM MTZ for 18 hours and then transferred to embryo medium for a recovery period.
  • One of the two experimental groups was transferred to embryo medium containing 250 nM tacrine on the second day of the recovery period and maintained.
  • motility was measured at 1-day intervals starting from day 1 of the recovery period, and it was confirmed that the MTZ-treated group had a statistically significant decrease in motility compared to the control group.
  • 5 dpf transgenic zebrafish were divided into 4 groups: 1 control group, 2 group recovered in embryo medium after MTZ treatment, 3 group recovered in embryo medium containing 250 nM tacrine, and 4 group recovered in embryo medium containing kinase inhibitor. Separated into groups. The control group was maintained in embryo medium, and the remaining three experimental groups were treated with 2mM MTZ for 18 hours and then transferred to embryo medium and given a recovery period for 2 days. Two of the three experimental groups were maintained on the second day of the recovery period by being transferred to embryo medium containing 250 nM tacrine and embryo medium containing a kinase inhibitor, respectively. After transferring to each medium, the motility of all four groups was measured on day 1 ( Figure 4).
  • kinase inhibitors that significantly restored the decrease in motility observed in the MTZ-treated group were selected.
  • 17 types were identified that statistically significantly restored motility (Figure 5).
  • the 17 types of kinase inhibitors that exhibit the motility recovery effect are listed in Table 2 below.
  • the present invention confirms the effectiveness of four types of kinase inhibitors in preventing and treating demyelinating diseases in a zebrafish disease model and provides them for the prevention and treatment of demyelinating diseases, and is expected to be widely used as a treatment for rare diseases for which there is no cure. It is expected.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The present invention relates to a pharmaceutical composition for preventing or treating demyelinating disease, comprising as an active ingredient a kinase inhibitor that has been confirmed to promote motility recovery and oligodendrocyte regeneration in demyelinating disease-induced zebrafish. The present invention is expected to overcome the limitations of currently developed treatments for demyelinating disease, which simply relieve secondary symptoms caused by the disease, and to contribute to the fundamental treatment of demyelinating disease.

Description

키나아제 저해제를 유효성분으로 포함하는 탈수초성 질환 예방 또는 치료용 약학적 조성물 Pharmaceutical composition for preventing or treating demyelinating disease containing a kinase inhibitor as an active ingredient
본 발명은 탈수초성 질환 유도 제브라피쉬에서 운동성 회복 및 희소돌기아교세포 재생을 촉진하는 것으로 확인된 키나아제 저해제를 유효성분으로 포함하는 탈수초성 질환 예방 또는 치료용 약학적 조성물 등에 관한 것이다.The present invention relates to a pharmaceutical composition for preventing or treating demyelinating disease, including as an active ingredient a kinase inhibitor that has been confirmed to promote motility recovery and oligodendrocyte regeneration in demyelinating disease-induced zebrafish.
탈수초성 질환 (demyelinating disease)은 축색돌기를 둘러싼 수초가 손상되어 나타나는 신경계통 질환이다. 다발성 경화증 (multiple sclerosis)은 대표적인 탈수초성 질환으로, 인체 내 면역 조절 기능 장애로 인하여 자신의 미엘린 수초 (myelin sheath)를 공격하여 파괴하는 자가 면역 질환 (autoimmune disease), 또는 중추신경계에서 발생하는 염증성 탈수초성 질환 (inflammatory demyelinating disease)으로 알려져 있다. 이 질환은 전 세계적으로 250만명 가량, 국내에서는 2,500여명의 유병률을 보이고 있음에도 불구하고, 여전히 병인이 명확하지 않고, 현재 사용 중이거나 개발 중인 치료제들은 면역반응 조절을 통하여 질환의 재발 빈도를 낮추거나, 진행 정도만을 늦출 수 있어 손상된 수초는 회복시킬 수 없어 근본적이 치료가 불가능한 실정이다. 따라서 완전한 치료를 위해서는 기존의 방법인 자가 면역 반응의 억제와 더불어 탈수초화가 진행된 부위에서 희소돌기아교세포에 의한 재수초화를 촉진할 수 있는 치료제 개발이 필요하다.Demyelinating disease is a nervous system disease that occurs when the myelin sheath surrounding axons is damaged. Multiple sclerosis is a representative demyelinating disease, an autoimmune disease that attacks and destroys the body's own myelin sheath due to immune regulation dysfunction, or inflammatory dehydration that occurs in the central nervous system. It is known as inflammatory demyelinating disease. Although this disease has a prevalence of approximately 2.5 million people worldwide and 2,500 people in Korea, its etiology is still unclear, and treatments currently in use or under development are aimed at lowering the frequency of disease recurrence by controlling the immune response. The progression can only be slowed down, and the damaged myelin cannot be restored, making fundamental treatment impossible. Therefore, for complete treatment, it is necessary to develop a treatment that can promote remyelination by oligodendrocytes in areas where demyelination has progressed, in addition to suppressing the autoimmune response, which is the existing method.
제브라피쉬는 인간 유전체와 높은 유전학적 및 기능적 유사성을 가진 척추동물로서, 인간의 질병 유전자와 80% 이상의 상동성을 보유하며, 신경계 및 각종 기관형성과정이 사람과 매우 유사하기에 인간의 질환연구를 위하여 세계적으로 많은 연구가 이루어지고 있는 중요한 동물모델이다. 이와 함께 제브라피쉬는 유전자 조작이 용이하여 knock-out 및 형질전환 모델 개발이 가능하며, 발생과정 중 배아가 투명하기 때문에 희소돌기아교세포 및 수초 특이적으로 형광단백질을 발현하는 형질전환 제브라피쉬를 이용할 경우, 생체 내에서 신경세포의 수초화 및 탈수초화 과정 관찰이 가능한 유일한 척추동물이기도 하다. 또한 대량의 배아 확보가 가능하기 때문에 질환 치료제 후보물질의 스크리닝에 매우 적합한 모델로 이러한 장점을 바탕으로 본 발명에서 제브라피쉬를 활용하였다.Zebrafish is a vertebrate with high genetic and functional similarity to the human genome. It has more than 80% homology with human disease genes, and its nervous system and various organ formation processes are very similar to those of humans, making it suitable for research on human diseases. It is an important animal model on which much research is being conducted worldwide. In addition, zebrafish is easy to genetically manipulate, making it possible to develop knock-out and transgenic models, and since embryos are transparent during the development process, transgenic zebrafish that express fluorescent proteins specifically for oligodendrocytes and myelin can be used. In this case, it is the only vertebrate in which the myelination and demyelination process of nerve cells can be observed in vivo. In addition, because it is possible to secure a large number of embryos, zebrafish is a very suitable model for screening candidate substances for disease treatment. Based on these advantages, zebrafish was used in the present invention.
본 발명에서 활용한 제브라피쉬는 Q (QF2-QUAS) system을 적용하여 제조한 형질전환 제브라피쉬로, 희소돌기아교세포 (oligodendrocyte)만을 특이적으로 사멸시키기 위하여 화학유전학 기법인 enhanced-potency nitroreductase (epNTR) / metronidazole (MTZ) system을 활용하였다. epNTR / MTZ system은 epNTR이 전구 약물 (pro-drug) 상태의 MTZ를 환원 (reduction)하여 세포독성 (cytotoxin)을 나타내는 물질로 전환시켜 희소돌기아교세포의 사멸을 유도할 수 있는 방법으로, 이를 통하여 형질전환 제브라피쉬에에서 희소돌기아교세포의 사멸을 통해 탈수초화 유발 제브라피쉬 모델을 제조할 수 있다. 이렇게 제조된 모델은 탈수초성 질환 치료제 개발을 위한 후보물질들의 유효성 평가에 유용하게 활용 가능하다.The zebrafish used in the present invention is a transgenic zebrafish produced by applying the Q (QF2-QUAS) system, and enhanced-potency nitroreductase (epNTR), a chemical genetic technique, is used to specifically kill oligodendrocytes. ) / metronidazole (MTZ) system was used. The epNTR / MTZ system is a method in which epNTR reduces MTZ in a pro-drug state and converts it into a cytotoxic substance, thereby inducing the death of oligodendrocytes. A zebrafish model in which demyelination is induced can be produced through the death of oligodendrocytes in transgenic zebrafish. The model manufactured in this way can be usefully used to evaluate the effectiveness of candidate substances for developing treatments for demyelinating diseases.
생체 내 단백질 및 지질 등의 분자는 인산화 (phosphorylation) 상태에 따라 활성 및 반응성, 다른 분자와의 결합력 등이 변화한다. 따라서 키나아제 (kinase)는 물질대사 및 세포간의 신호 전달 (cell signaling), 단백질 조절 (protein regulation), 세포 수송, 분비를 조절하는 모든 신호전달경로에서 매우 중요하여 다양한 질환에서 잠재적인 약물 타겟으로 연구되어 왔으며, 실제로 38개의 키나아제 저해제 (kinase inhibitor)가 치료제로 승인되었다. 또한 AKT 및 JNK1, FYN, RHO 키나아제를 비롯한 다양한 키나아제들이 희소돌기아교세포의 분화 및 이동, 수초화 형성 과정에서 중요한 역할을 하는 것으로 알려져 있으며, 최근 Bruton’s tyrosine kinase (BTK) inhibitor가 임상 2상 시험을 통하여 재발성 다발성 경화증 환자에서 효과적으로 탈수초화 장애를 감소시킨 것으로 보고되어 새로운 신약 후보로 제시되고 있다. 따라서 본 발명에서는 키나아제 저해제에 대한 탈수초성 질환 개선 효능 유효성 평가를 통한 유효물질 발굴을 목표로 하였다.Molecules such as proteins and lipids in vivo change their activity, reactivity, and binding ability with other molecules depending on their phosphorylation status. Therefore, kinases are very important in all signaling pathways that regulate metabolism, cell signaling, protein regulation, cell transport, and secretion, and are being studied as potential drug targets in various diseases. In fact, 38 kinase inhibitors have been approved as treatments. In addition, various kinases, including AKT, JNK1, FYN, and RHO kinases, are known to play an important role in the differentiation and migration of oligodendrocytes and the myelination formation process. Recently, Bruton's tyrosine kinase (BTK) inhibitor has been tested through phase 2 clinical trials. It has been reported to effectively reduce demyelination disorders in patients with relapsing multiple sclerosis and is being proposed as a new drug candidate. Therefore, the present invention aimed to discover effective substances through evaluation of the effectiveness of kinase inhibitors in improving demyelinating disease.
본 발명이 이루고자 하는 기술적 과제는 탈수초성 질환의 예방 또는 치료용 약학적 조성물을 제공하는 것이다.The technical problem to be achieved by the present invention is to provide a pharmaceutical composition for preventing or treating demyelinating diseases.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당해 기술분야의 통상의 기술자에게 명확하게 이해될 수 있을 것이다.However, the technical problem to be achieved by the present invention is not limited to the problems mentioned above, and other problems not mentioned can be clearly understood by those skilled in the art from the description below.
상기 과제를 해결하기 위하여, 본 발명은 형질전환 제브라피쉬를 이용한 탈수초성 질환 동물모델을 이용하여 탈수초성 질환 치료 약물 스크리닝 한 결과 최종 선정된 4종 키나아제 저해제를 탈수초성 질환의 예방 또는 치료 용도에 제공한다.In order to solve the above problems, the present invention provides four types of kinase inhibitors finally selected as a result of screening for drugs to treat demyelinating diseases using a demyelinating disease animal model using transgenic zebrafish for the prevention or treatment of demyelinating diseases. do.
또한, 본 발명은 상기 4종 키나아제 저해제로 이루어진 군으로부터 선택되는 1종 이상의 키나아제 저해제를 유효성분으로 포함하는 탈수초성 질환의 예방 또는 치료용 약학적 조성물을 제공한다.In addition, the present invention provides a pharmaceutical composition for preventing or treating demyelinating diseases, comprising as an active ingredient at least one kinase inhibitor selected from the group consisting of the above four types of kinase inhibitors.
또한, 본 발명은 탈수초성 질환이 발병하거나 상기 질환 발병 가능성이 높은 환자에 상기 4종 키나아제 저해제를 투여하는 단계를 포함하는 탈수초성 질환의 치료방법을 제공한다.In addition, the present invention provides a method of treating demyelinating disease, comprising administering the four types of kinase inhibitors to a patient who develops demyelinating disease or is likely to develop the disease.
본 발명에서 탈수초성 질환 치료 물질로 선별된 4종의 키나아제 저해제는 3BDO, ONO-7475, AZ12601011, 및 Theaflavin 3,3'-digallate이다.The four types of kinase inhibitors selected as treatment substances for demyelinating diseases in the present invention are 3BDO, ONO-7475, AZ12601011, and Theaflavin 3,3'-digallate.
본 발명의 일 구현예로서, 상기 선별된 키나아제 저해제는 탈수초성 질환의 증상인 운동성 감소를 회복시킬 수 있다.In one embodiment of the present invention, the selected kinase inhibitor can restore decreased mobility, which is a symptom of demyelinating disease.
본 발명의 다른 구현예로서, 상기 선별된 키나아제 저해제는 희소돌기아교세포의 재생을 촉진할 수 있다.As another embodiment of the present invention, the selected kinase inhibitor can promote the regeneration of oligodendrocytes.
본 발명의 다른 구현예로서, 상기 선별된 키나아제 저해제는 상기 개체에 1회/1일 10 nM ~ 10 µM의 농도로 배아 배지에 녹여 4일간 투여될 수 있다.In another embodiment of the present invention, the selected kinase inhibitor can be dissolved in embryonic medium and administered to the subject at a concentration of 10 nM to 10 µM once per day for 4 days.
본 발명은 희소돌기아교세포 특이적으로 형광을 발현하는 형질전환 제브라피쉬를 이용하여 탈수초화를 유발 후, 운동성 회복 및 희소돌기아교세포의 재생에 유의한 효과를 나타내는 4종의 키나아제 저해제 유효물질을 발굴하였는바, 선별된 상기 키나아제 저해제는 탈수초성 질환의 치료제로 이용될 수 있다.The present invention uses transgenic zebrafish that specifically express fluorescence in oligodendrocytes to induce demyelination, and then induces four types of kinase inhibitor active substances that exhibit significant effects on recovery of motility and regeneration of oligodendrocytes. As discovered, the selected kinase inhibitor can be used as a treatment for demyelinating diseases.
도 1은 타크린(tacrine) 처리에 따른 탈수초성 질환 제브라피쉬 모델에서의 운동성 변화 확인을 위한 실험 모식도(A)와 실험의 결과이다(B).Figure 1 shows an experimental schematic diagram (A) and the results of the experiment (B) for confirming changes in motility in a zebrafish model of demyelinating disease following tacrine treatment.
도 2는 타크린(tacrine) 처리에 따른 탈수초성 질환 제브라피쉬 모델에서의 회소돌기아교세포의 사멸 및 재생 확인을 위한 실험 모식도(A)와 실험의 결과이다(B).Figure 2 is a schematic diagram (A) of an experiment and the results of the experiment (B) for confirming the death and regeneration of glial cells in a zebrafish model of demyelinating disease following tacrine treatment.
도 3은 키나아제 억제제의 독성 실험 모식도와 그 결과이다.Figure 3 is a schematic diagram of a toxicity test of a kinase inhibitor and its results.
도 4는 탈수초성 질환 제브라피쉬 모델을 이용한 약물 스크리닝 실험의 모식도이다.Figure 4 is a schematic diagram of a drug screening experiment using a zebrafish model of demyelinating disease.
도 5는 탈수초성 질환 제브라피쉬에 처리된 총 160종 키나아제 저해제에 의한 제브라피쉬의 운동성 변화를 확인한 결과이다.Figure 5 shows the results of confirming changes in zebrafish motility caused by a total of 160 types of kinase inhibitors treated in zebrafish with demyelinating disease.
도 6은 탈수초성 질환 제브라피쉬에 처리된 총 17종 키나아제 저해제에 의한 제브라피쉬의 희소돌기아교세포의 정도를 확인한 결과이다.Figure 6 shows the results of confirming the level of oligodendrocytes in zebrafish by a total of 17 types of kinase inhibitors treated in zebrafish with demyelinating disease.
도 7은 탈수초성 질환 치료 약물로 최종 선정된 4종 키나아제 억제제의 타겟을 나타낸 것이다.Figure 7 shows the targets of the four types of kinase inhibitors finally selected as drugs for treating demyelinating diseases.
본 발명자들은 신경세포의 수초화 및 재수초화에 작용하는 신경 조절물질과 이의 기전을 연구하기 위하여 빠르고 효율적으로 탈수초화 질환을 유도할 수 있는 동물모델을 제조하고, 탈수초화가 진행된 질환의 발생 부위에서 희소돌기아교세포에 의한 재수초화를 촉진할 수 있는 치료제 개발을 위한 약물 후보물질의 유효성 검증에 상기 동물모델이 효과적으로 작동함을 확인하였다.In order to study neuromodulators and their mechanisms that act on myelination and remyelination of nerve cells, the present inventors created an animal model that can quickly and efficiently induce demyelinating disease, and developed a rare disease at the site of the disease in which demyelination has progressed. It was confirmed that the animal model operates effectively in verifying the effectiveness of drug candidates for the development of treatments that can promote remyelination by dendritic cells.
본 발명의 형질전환 제브라피쉬는 MBP 프로모터 하에서 작동하는 QF2 유전자를 포함하는 플라스미드 벡터(구체적으로, mbpa:QF2pA plasmid)와 QUAS 프로모터 하에서 작동하는 epNTR 및 리포터 유전자를 포함하는 플라스미드 벡터(구체적으로, QUAS:epNTR-p2a-mCherry plasmid)를 제브라피쉬의 수정란에 유전자전이효소 (transposase)와 함께 미세주입 (microinjection) 후 성체(F0)로 키운 후 야생형 제브라피쉬와 교배 후 확보된 제브라피쉬에서 형광 단백질을 발현하는 제브라피쉬(F1)을 선별함으로써 제조될 수 있다.The transgenic zebrafish of the present invention contains a plasmid vector containing the QF2 gene operating under the MBP promoter (specifically, mbpa:QF2pA plasmid) and a plasmid vector containing epNTR and a reporter gene operating under the QUAS promoter (specifically, QUAS: epNTR-p2a-mCherry plasmid) is microinjected with a transposase into a zebrafish fertilized egg, grown into an adult (F0), and then crossed with a wild-type zebrafish, which expresses a fluorescent protein in the obtained zebrafish. It can be prepared by selecting zebrafish (F1).
또한, 본 발명의 탈수초성 질환 동물모델은 상기 본 발명의 형질전환 제브라피쉬에 MTZ(metronidazole)를 처리함으로써 제조될 수 있다.Additionally, the demyelinating disease animal model of the present invention can be prepared by treating the transgenic zebrafish of the present invention with MTZ (metronidazole).
종래의 Gal4-UAS system을 이용하여 개발된 형질전환 제브라피쉬는 고농도의 MTZ (10 mM)를 60시간의 장시간 처리를 통해 희소돌기아교세포의 사멸이 유발되는 반면 본 발명의 상술한 형질전환 제브라피쉬는 저농도의 MTZ (2 mM)를 18시간의 단시간 처리를 통해 기존의 모델보다 강력한 수준으로 희소돌기아교세포의 사멸이 유발됨을 확인할 수 있었다. 본 발명의 형질전환 제브라피쉬는 종래의 그것보다 약물 사용량을 1/5 감소시킬 수 있으며, 1/3.3 감소된 시간 안에 효율적으로 탈수초성 질환을 유발할 수 있다. While the transgenic zebrafish developed using the conventional Gal4-UAS system induces death of oligodendrocytes through long-term treatment of 60 hours with high concentration of MTZ (10 mM), the above-described transgenic zebrafish of the present invention were able to confirm that treatment with a low concentration of MTZ (2 mM) for a short period of 18 hours induced oligodendrocyte death at a stronger level than in the existing model. The transgenic zebrafish of the present invention can reduce drug usage by 1/5 compared to the conventional one and can efficiently cause demyelinating disease in 1/3.3 reduced time.
이에, 본 발명은 본 발명의 탈수초성 질환 동물모델을 이용한 탈수초성 질환 치료 물질 스크리닝 방법을 제공한다.Accordingly, the present invention provides a method for screening substances for treating demyelinating disease using the demyelinating disease animal model of the present invention.
본 발명자들은 제조한 탈수초성 질환 동물모델을 이용하여 탈수초성 질환의 증상인 운동성 감소를 회복시키고 희소돌기아교세포의 사멸 억제 및/또는 그 재생을 촉진하는 4종 키나아제 저해제를 확인하고 이를 탈수초성 질환의 치료 용도로 제공한다.Using the demyelinating disease animal model we prepared, the present inventors identified four types of kinase inhibitors that restore decreased mobility, which is a symptom of demyelinating disease, and inhibit the death of oligodendrocytes and/or promote their regeneration, and used them to treat demyelinating disease. It is provided for therapeutic purposes.
구체적으로, 본 발명자들은 제조된 탈수초성 질환 동물모델에 탈수초성 질환의 치료에 적용가능할 것으로 기대되는 총 160종의 키나아제 저해제를 처리하고 탈수초성 질환이 유도된 제브라피쉬의 운동성을 회복하는 17종 키나아제 저해제를 확인하였다. 그리고 행동기반 분석을 통해 선별된 17종 키나아제 저해제를 처리한 제브라피쉬를 이미징 기반 분석을 추가로 수행하였다. 그 결과 희소돌기아교세포의 재생을 촉진하는 최종 4종 키아나제 저해제를 확인하였다.Specifically, the present inventors treated the manufactured demyelinating disease animal model with a total of 160 types of kinase inhibitors that are expected to be applicable to the treatment of demyelinating disease, and 17 types of kinases that restore the motility of zebrafish with induced demyelinating disease. Inhibitors were identified. Additionally, imaging-based analysis was performed on zebrafish treated with 17 types of kinase inhibitors selected through behavior-based analysis. As a result, four types of kinase inhibitors that promote the regeneration of oligodendrocytes were identified.
최종적으로 탈수초성 질환의 치료제로 선별된 4종 키나아제는 3BDO, ONO-7475, AZ12601011, 및 Theaflavin 3,3'-digallate이다.The four types of kinases finally selected as treatments for demyelinating diseases are 3BDO, ONO-7475, AZ12601011, and Theaflavin 3,3'-digallate.
첫 번째 유효물질인 3BDO는 하기 화학식 1의 구조를 갖는 butyrolactone 유도체로서 mTOR를 통해 조절되는 autophagy를 억제하는 것으로 알려져 있다. 또한, autophagy는 슈반세포와 희소돌기아교세포의 성숙 과정에서 매우 중요한 역할을 하는 것으로 알려져 있다. 그리고, 비정상적인 autophagy flux는 비정상적인 수초화를 특징으로 하는 다양한 신경 장애와 관련이 있기에 autophagy가 탈수초성 질환에 중요한 역할을 함과 동시에 치료 타겟으로의 가능성도 있다고 판단된다. 3BDO의 또 다른 타겟인 mTOR 신호전달도 수초화 과정과 매우 밀접한 것으로 보고되고 있다. 보고된 연구 결과에 따르면, 중추신경계의 희소돌기아교세포 특이적 mTOR knock-down 마우스에서 성숙한 희소돌기아교세포의 수가 감소하였고, 수초화의 개시 지연과 동시에 수초화 관련 단백질들의 발현 시기도 지연되어, mTOR가 희소돌기아교세포의 분화 및 수초화에 중요한 역할을 함을 알 수 있다.The first effective substance, 3BDO, is a butyrolactone derivative with the structure of formula 1 below and is known to inhibit autophagy regulated through mTOR. Additionally, autophagy is known to play a very important role in the maturation process of Schwann cells and oligodendrocytes. In addition, since abnormal autophagy flux is associated with various neurological disorders characterized by abnormal myelination, it is believed that autophagy plays an important role in demyelinating diseases and has the potential to be a therapeutic target. mTOR signaling, another target of 3BDO, is also reported to be very close to the myelination process. According to reported research results, the number of mature oligodendrocytes was reduced in oligodendrocyte-specific mTOR knock-down mice of the central nervous system, and the onset of myelination was delayed and the expression of myelination-related proteins was also delayed, resulting in mTOR It can be seen that it plays an important role in the differentiation and myelination of oligodendrocytes.
[화학식 1][Formula 1]
Figure PCTKR2023008064-appb-img-000001
Figure PCTKR2023008064-appb-img-000001
두 번째 유효물질인 ONO-7475는 하기 화학식 2의 구조를 가지며 Trk receptor를 타겟으로 하는 약물로, pro-myelinating molecule 중 하나인 brain-derived neurotrophic factor (BDNF)는 Trk receptor를 통하여 수초화를 촉진하는 것으로 보고되어 있어 BDNF-Trk 신호전달은 탈수초화 후, 재수초화를 위한 희소돌기아교세포 전구세포의 생존 및 분화에 영향을 미칠 가능성이 있다.The second active substance, ONO-7475, has the structure of formula 2 below and is a drug that targets Trk receptors. Brain-derived neurotrophic factor (BDNF), one of the pro-myelinating molecules, promotes myelination through Trk receptors. It has been reported that BDNF-Trk signaling is likely to affect the survival and differentiation of oligodendrocyte progenitor cells for remyelination after demyelination.
[화학식 2][Formula 2]
Figure PCTKR2023008064-appb-img-000002
Figure PCTKR2023008064-appb-img-000002
세 번째 유효물질인 AZ12601011은 하기 화학식 3의 구조를 가지며 TGF-β receptor를 타겟으로 하는 약물로, TGF-β 신호는 발달 중인 신경에서 슈반세포의 사멸과 증식을 조절하는 이중적인 역할을 하는 것으로 보고되어 있다.The third active substance, AZ12601011, has the structure of formula 3 below and is a drug that targets TGF-β receptor. TGF-β signal has been reported to play a dual role in controlling the death and proliferation of Schwann cells in developing nerves. there is.
[화학식 3][Formula 3]
Figure PCTKR2023008064-appb-img-000003
Figure PCTKR2023008064-appb-img-000003
네 번째 유효물질인 Theaflavin 3,3'-digallate는 하기 화학식 4의 구조로 항암 효능이 알려져 있다. Akt 및 ERK, MEK, NF-κB를 타겟으로 하며, 실제로 Akt 및 ERK, MEK은 수초화와 매우 밀접한 연관성이 있다. Akt는 말초신경계의 수초화뿐만 아니라 슈반세포에서 수초화 관련 단백질의 합성도 증가시키는데 관여하며, 희소돌기아교세포에서 ERK1/2의 활성화는 손상 후, 수초화 복구를 촉진하는 것으로 보고되어 있다. 또한, 활성화되지 않은 미세아교세포는 NF-κB를 통해 희소돌기아교세포의 전구세포의 생존 및 성숙을 촉진하는 것으로 보고되어 있다. Theaflavin 3,3'-digallate, the fourth active substance, has the structure of formula 4 below and is known to have anticancer efficacy. It targets Akt, ERK, MEK, and NF-κB, and in fact, Akt, ERK, and MEK are very closely related to myelination. Akt is involved in not only myelination of the peripheral nervous system but also the synthesis of myelination-related proteins in Schwann cells, and activation of ERK1/2 in oligodendrocytes has been reported to promote myelination recovery after injury. Additionally, it has been reported that non-activated microglia promote the survival and maturation of oligodendrocyte progenitor cells through NF-κB.
[화학식 4][Formula 4]
Figure PCTKR2023008064-appb-img-000004
Figure PCTKR2023008064-appb-img-000004
이하에서, 첨부된 도면을 참조하여 실시예들을 상세하게 설명한다. 그러나, 실시예들에는 다양한 변경이 가해질 수 있어서 특허출원의 권리 범위가 이러한 실시예들에 의해 제한되거나 한정되는 것은 아니다. 실시예들에 대한 모든 변경, 균등물 내지 대체물이 권리 범위에 포함되는 것으로 이해되어야 한다.Hereinafter, embodiments will be described in detail with reference to the attached drawings. However, various changes can be made to the embodiments, so the scope of the patent application is not limited or limited by these embodiments. It should be understood that all changes, equivalents, or substitutes for the embodiments are included in the scope of rights.
실시예에서 사용한 용어는 단지 설명을 목적으로 사용된 것으로, 한정하려는 의도로 해석되어서는 안된다. 단수의 표현은 문맥상 명백하게 다르게 뜻하지 않는 한, 복수의 표현을 포함한다. 본 명세서에서, "포함하다" 또는 "가지다" 등의 용어는 명세서 상에 기재된 특징, 숫자, 단계, 동작, 구성요소, 부품 또는 이들을 조합한 것이 존재함을 지정하려는 것이지, 하나 또는 그 이상의 다른 특징들이나 숫자, 단계, 동작, 구성요소, 부품 또는 이들을 조합한 것들의 존재 또는 부가 가능성을 미리 배제하지 않는 것으로 이해되어야 한다.The terms used in the examples are for descriptive purposes only and should not be construed as limiting. Singular expressions include plural expressions unless the context clearly dictates otherwise. In this specification, terms such as “comprise” or “have” are intended to designate the presence of features, numbers, steps, operations, components, parts, or combinations thereof described in the specification, but are not intended to indicate the presence of one or more other features. It should be understood that this does not exclude in advance the possibility of the existence or addition of elements, numbers, steps, operations, components, parts, or combinations thereof.
다르게 정의되지 않는 한, 기술적이거나 과학적인 용어를 포함해서 여기서 사용되는 모든 용어들은 실시예가 속하는 기술 분야에서 통상의 지식을 가진 자에 의해 일반적으로 이해되는 것과 동일한 의미를 가지고 있다. 일반적으로 사용되는 사전에 정의되어 있는 것과 같은 용어들은 관련 기술의 문맥 상 가지는 의미와 일치하는 의미를 가지는 것으로 해석되어야 하며, 본 출원에서 명백하게 정의하지 않는 한, 이상적이거나 과도하게 형식적인 의미로 해석되지 않는다.Unless otherwise defined, all terms used herein, including technical or scientific terms, have the same meaning as generally understood by a person of ordinary skill in the technical field to which the embodiments belong. Terms defined in commonly used dictionaries should be interpreted as having a meaning consistent with the meaning in the context of the related technology, and unless explicitly defined in the present application, should not be interpreted in an ideal or excessively formal sense. No.
또한, 첨부 도면을 참조하여 설명함에 있어, 도면 부호에 관계없이 동일한 구성 요소는 동일한 참조부호를 부여하고 이에 대한 중복되는 설명은 생략하기로 한다. 실시예를 설명함에 있어서 관련된 공지 기술에 대한 구체적인 설명이 실시예의 요지를 불필요하게 흐릴 수 있다고 판단되는 경우 그 상세한 설명을 생략한다.In addition, when describing with reference to the accompanying drawings, identical components will be assigned the same reference numerals regardless of the reference numerals, and overlapping descriptions thereof will be omitted. In describing the embodiments, if it is determined that detailed descriptions of related known technologies may unnecessarily obscure the gist of the embodiments, the detailed descriptions are omitted.
[실시예][Example]
실시예 1 : 제브라피쉬 사육 및 관리Example 1: Zebrafish breeding and management
본 연구의 모든 실험 과정은 고려대학교 의과대학 동물실험 윤리위원회 (Korea University Institutional Animal Care & Use Committee, IACUC)의 승인을 받았으며, 국립수의과학 검역원의 동물 실험 규정에 따라 실험을 수행하였다. 본 연구에서는 야생형 제브라피쉬, Tg(mbpa:QF2), Tg(QUAS:epNTR-p2a-mCherry) 형질전환 제브라피쉬가 사용되었으며, 성체 (adult) 및 배아 (embryo) 제브라피쉬는 명암주기 14:10 시간, 수온 28.5℃가 유지되는 시스템에서 사육되었다. 형태학적 특징을 정의하기 위하여 제브라피쉬 배아와 치어 (larvae)의 단계는 수정 후 며칠 (days post-fertilization, dpf)로 사용되었다.All experimental procedures in this study were approved by the Korea University Institutional Animal Care & Use Committee (IACUC), and experiments were conducted in accordance with the animal experiment regulations of the National Veterinary Science and Quarantine Service. In this study, wild-type zebrafish, Tg(mbpa:QF2), and Tg(QUAS:epNTR-p2a-mCherry) transgenic zebrafish were used, and adult and embryonic zebrafish were used on a light/dark cycle of 14:10 hours. , were raised in a system where the water temperature was maintained at 28.5℃. To define morphological characteristics, zebrafish embryo and larvae stages were used as days post-fertilization (dpf).
실시예 2 : Plasmid DNA 및 형질전환 제브라피쉬 제조Example 2: Preparation of plasmid DNA and transgenic zebrafish
희소돌기아교세포 특이적으로 epNTR을 발현하는 형질전환 제브라피쉬를 제조하기 위하여 attB1과 attB2 시퀀스가 포함된 epNTR 유전자 특이적 프라이머를 제조 및 이용하여 중합효소 연쇄반응을 수행하였다. 이를 통해 확보된 중합효소 연쇄반응 산물은 BP 클론 반응 효소 (BP clonase, Invitrogen)로부터 중간 진입 벡터 (middle entry vector)에 클로닝 되었다. 다음으로는 mbpa:QF2, QUAS:epNTR-p2a-mCherry plasmid construct를 제작하기 위하여 multi-site gateway LR 반응을 수행하였다. mbpa promoter가 포함된 5’-진입 벡터, QF2가 포함된 중간 진입 벡터, poly A 서열이 포함된 3’-진압 벡터, 그리고 목적 벡터 (destination vector)들을 LR 클론 반응 효소 (LR Ⅱ clonase, Invitrogen)와 반응시켜 mbpa:QF2pA plasmid를 제작하였다. 또한, QUAS promoter가 삽입된 5’-진입 벡터, epNTR 유전자가 삽입된 중간 진입 벡터, P2A 펩타이드가 결합된 적색 형광단백질 (mCherry) 유전자가 삽입된 3‘-진입 벡터 그리고 목적 벡터들을 LR 클론 반응 효소와 반응시켜 QUAS:epNTR-p2a-mCherry plamid를 제작하였다. 이렇게 만들어진 plasmid DNA는 제브라피쉬 수정란 1세포기에 유전자전이효소 (transposase)와 함께 미세주입 (microinjection) 후, 성체 (Founder, F0)로 키웠고, 야생형 제브라피쉬와 교배하여 적색 형광단백질을 발현하는 제브라피쉬 (F1)를 선별하여 형질전환 제브라피쉬를 제조하였다. Plasmid DNA 제조에 사용된 프라이머는 다음과 같다.To prepare transgenic zebrafish that express epNTR specifically in oligodendrocytes, polymerase chain reaction was performed using epNTR gene-specific primers containing attB1 and attB2 sequences. The polymerase chain reaction product obtained through this was cloned into a middle entry vector from BP clonase (Invitrogen). Next, a multi-site gateway LR reaction was performed to create mbpa:QF2 and QUAS:epNTR-p2a-mCherry plasmid constructs. The 5'-entry vector containing the mbpa promoter, the intermediate entry vector containing QF2, the 3'-repression vector containing the poly A sequence, and the destination vector were incubated with LR clone reaction enzyme (LR II clonase, Invitrogen). mbpa:QF2pA plasmid was produced by reacting with . In addition, the 5'-entry vector with the QUAS promoter inserted, the intermediate entry vector with the epNTR gene inserted, the 3'-entry vector with the P2A peptide-conjugated red fluorescent protein (mCherry) gene inserted, and the target vectors were incubated with the LR clone reaction enzyme. QUAS:epNTR-p2a-mCherry plamid was produced by reacting with . The plasmid DNA created in this way was microinjected with transposase into the 1-cell stage of zebrafish fertilized eggs, then grown into adults (Founder, F0), and then crossed with wild-type zebrafish to produce zebrafish (Zebrafish that express red fluorescent protein). F1) was selected to prepare transgenic zebrafish. Primers used to prepare plasmid DNA are as follows.
attB1_epNTR_F: attB1_epNTR_F:
GGGGACAAGTTTGTACAAAAAAGCAGGCTCCATGGATATTATTAGTGTGGCCCTGAAGAGGGGGACAAGTTTGTACAAAAAAGCAGGCTCCATGGATATTATTAGTGTGGCCCTGAAGAG
attB1_epNTR_R: attB1_epNTR_R:
GGGGACCACTTTGTACAAGAAAGCTGGGTCCGCCACCTCTGTCAGTGTGATGTTCTGAGGGGACCACTTTGTACAAGAAAGCTGGGTCCGCCACCTCTGTCAGTGTGATGTTCTGA
실시예 3 : 키나아제 저해제의 농도 결정을 위한 독성 평가Example 3: Toxicity Assessment to Determine Concentration of Kinase Inhibitors
야생형 제브라피쉬의 수정된 배아를 48-well plate 각 well마다 10개씩 분주하고, 10 µM 키나아제 저해제를 4일 동안 처리 후, 명암주기 14:10 시간, 온도 28.5℃가 유지되는 배양기에서 사육되었다. 배아 독성 평가를 위하여 실체현미경 하에서 부화율, 생존율, 기형 발생율, 유영 이상 등을 관찰하여 독성이 나타나지 않는 농도를 선정하였다. 선정 기준은 도 1에 나타내었으며, 독성 평가 결과를 바탕으로 도 1에 나타낸 기준으로 처리 농도는 10 nM ~ 10 µM으로 선정하였다.Fertilized wild-type zebrafish embryos were distributed 10 to each well of a 48-well plate, treated with 10 µM kinase inhibitor for 4 days, and then reared in an incubator maintained at a temperature of 28.5°C with a light/dark cycle of 14:10 hours. To evaluate embryo toxicity, hatching rate, survival rate, malformation rate, swimming abnormality, etc. were observed under a stereomicroscope to select a concentration that did not cause toxicity. The selection criteria are shown in Figure 1, and based on the toxicity evaluation results, the treatment concentration was selected as 10 nM ~ 10 µM based on the standards shown in Figure 1.
실시예 4 : 희소돌기아교세포 사멸 유도Example 4: Induction of oligodendrocyte death
MTZ (2 mM, Sigma-Aldrich)는 0.08% 다이메틸 설폭사이드 (dimethyl sulfoxide, DMSO)가 포함된 배아 배지에 용해하여 제조하였고, 형질전환 제브라피쉬 수정 후, 5일째 (5 dpf) 치어에 2 mM MTZ를 18시간 동안 처리하여 희소돌기아교세포의 사멸을 유도하였다.MTZ (2mM, Sigma-Aldrich) was prepared by dissolving in embryonic medium containing 0.08% dimethyl sulfoxide (DMSO), and 2mM was administered to fry at 5 days (5 dpf) after fertilization of transgenic zebrafish. Death of oligodendrocytes was induced by treatment with MTZ for 18 hours.
실시예 5 : 키나아제 저해체 처리Example 5: Kinase inhibitor treatment
2 mM MTZ를 18시간 동안 처리하여 희소돌기아교세포의 사멸이 유발된 제브라피쉬는 ① 배아 배지 (E3)로 옮겨 회복기를 갖는 그룹, ② 배아 배지에서 2일 동안 회복기를 가진 후, 양성 물질인 250 nM tacrine이 처리되는 그룹, ③ 키나아제 저해제가 처리되는 그룹으로 나뉜다. 키나아제 저해제는 배아독성 평가를 통해 결정된 농도로 4일 동안 처리되었다.Zebrafish that were treated with 2mM MTZ for 18 hours to induce death of oligodendrocytes were divided into ① a group that was transferred to embryonic medium (E3) and had a recovery period, ② a group that had a recovery period in embryonic medium for 2 days, and then was treated with 250, a positive substance. It is divided into a group treated with nM tacrine, and a group treated with a kinase inhibitor. Kinase inhibitors were treated for 4 days at concentrations determined through embryotoxicity assessment.
실시예 6 : 제브라피쉬의 운동성 분석Example 6: Analysis of zebrafish motility
5 dpf에 2 mM MTZ에 18시간 노출된 형질전환 제브라피쉬는 3일 동안 배아 배지에서 회복기를 가진 후, 9 dpf 시기에 운동성 측정을 수행하였다. 운동성 측정을 위하여, 9 dpf 형질전환 제브라피쉬는 48-well plate에 1마리씩 (500 µl/well) 분주되어 행동실험실에서 2시간 동안의 적응시간이 주어졌으며, 2시간 후, 48-well plate를 DanioVision (BOM-DV-SYS-EDU, Noldus)로 옮겨 장비 안에서 30분의 적응시간을 주었다. 적응이 완료된 후, 5분 동안 장비에 연결된 카메라와 EthoVision XT software를 통해 제브라피쉬의 움직임이 촬영 및 분석되었으며, 운동성은 1분마다 총 5분간 측정하여, 최종적으로 1분간 움직인 거리 (distance moved, 단위 mm)의 평균치로 대조군과 실험군을 비교하였다.Transgenic zebrafish exposed to 2 mM MTZ for 18 hours at 5 dpf had a recovery period in embryo medium for 3 days, and then motility was measured at 9 dpf. To measure motility, 9 dpf transgenic zebrafish were dispensed one at a time (500 µl/well) into a 48-well plate and given 2 hours of adaptation time in the behavioral laboratory. After 2 hours, the 48-well plate was placed in a DanioVision (BOM-DV-SYS-EDU, Noldus) and given 30 minutes of acclimatization time in the equipment. After adaptation was completed, the movements of the zebrafish were filmed and analyzed through a camera connected to the equipment and EthoVision XT software for 5 minutes, and motility was measured every minute for a total of 5 minutes, ultimately measuring the distance moved in 1 minute (distance moved, The control group and the experimental group were compared with the average value (unit mm).
실시예 7 : 희소돌기아교세포 이미징Example 7: Oligodendrocyte imaging
5 dpf에 2 mM MTZ에 18시간 노출된 형질전환 제브라피쉬는 6일 동안 배아 배지에서 회복기를 가진 후, 12 dpf 시기에 희소돌기아교세포의 세포사멸 및 재생 관찰을 위한 이미징을 수행하였다. 이미징을 위해 12 dpf 형질전환 제브라피쉬는 glass-bottomed 35-㎜ dish (MatTek)에서 0.03% tricaine (Sigma-Aldrich)로 마취시킨 후, 0.8% low-melting-point agarose (SeaPlaque™ GTG™ Agarose)로 고정시켰다. 희소돌기아교세포는 Nikon A1Si laser-scanning confocal microscope (Nikon)을 이용하여 20x 배율, 568 ㎚ 레이저에서 NIS-Elements AR Analysis 4.30 software (Nikon)의 Z-Stack 기능을 통해 0.9 ㎛의 간격으로 20-25장 정도 촬영하였다. 촬영된 이미지들은 software를 통해 합쳐 하나의 이미지로 만들었으며, 살아있는 희소돌기아교세포 수를 측정하여 대조군과 실험군을 비교하였다.Transgenic zebrafish exposed to 2 mM MTZ for 18 hours at 5 dpf had a recovery period in embryonic medium for 6 days, and then imaging was performed to observe apoptosis and regeneration of oligodendrocytes at 12 dpf. For imaging, 12 dpf transgenic zebrafish were anesthetized with 0.03% tricaine (Sigma-Aldrich) in a glass-bottomed 35-mm dish (MatTek) and then anesthetized with 0.8% low-melting-point agarose (SeaPlaque™ GTG™ Agarose). fixed. Oligodendrocytes were identified at 20-25 µm intervals using the Z-Stack function of NIS-Elements AR Analysis 4.30 software (Nikon) at 20x magnification and 568 ㎚ laser using a Nikon A1Si laser-scanning confocal microscope (Nikon). I took about a few shots. The captured images were combined into one image using software, and the number of living oligodendrocytes was measured to compare the control group and the experimental group.
실시예 8 : 통계적 분석Example 8: Statistical Analysis
운동성 및 탈수초화의 정량적 분석을 위해서 대조군 및 실험군 두 그룹간의 비교분석은 t-Test를 수행하였고, 약물 처리군이 추가될 시, 세 그룹 이상의 비교분석은 one-way analysis of variance (ANOVA)와 post-hoc Tukey’s Multiple Comparison Test를 수행하였다. 모든 데이터에서 통계적 유의성은 P 양측 검정 (two-tailed probability) 값이 0.05 미만일 때 유효성을 가지는 것으로 판단하였으며, 모든 통계분석은 GraphPad Prism 7 software를 통해 수행하였다.For quantitative analysis of motility and demyelination, a t-Test was performed for comparative analysis between the control and experimental groups, and when a drug treatment group was added, comparative analysis of three or more groups was performed using one-way analysis of variance (ANOVA) and post-hoc analysis. -hoc Tukey's Multiple Comparison Test was performed. Statistical significance in all data was judged to be valid when the P two-tailed probability value was less than 0.05, and all statistical analyzes were performed using GraphPad Prism 7 software.
[실험예][Experimental example]
실험예 1. 약물 스크리닝 플랫폼으로서 탈수초성 질환 제브라피쉬의 유효성 확인Experimental Example 1. Validation of zebrafish with demyelinating disease as a drug screening platform
탈수초성 질환 제브라피쉬 모델에서의 운동성 변화 관찰 및 이에 대한 tacrine (Tocris)의 효능을 확인하기 위하여 실험을 진행하였으며, 실험 모식도는 도 1A에 나타내었다.An experiment was conducted to observe changes in motility in a zebrafish model of demyelinating disease and to confirm the efficacy of tacrine (Tocris), and a schematic diagram of the experiment is shown in Figure 1A.
5 dpf 형질전환 제브라피쉬는 대조군과 MTZ 처리 후, 배아 배지 (E3)에서 회복시킨 그룹, MTZ 처리 후, 250 nM tacrine에서 회복시킨 3 그룹으로 분리하였다. 대조군은 배아 배지에서 유지되었고, 나머지 두 실험군은 2 mM MTZ를 18시간 동안 처리 후, 배아 배지로 옮겨 회복기를 주었다. 두 실험군 중 한 실험군은 회복기 2일째에 250 nM tacrine이 포함된 배아 배지로 옮겨 유지되었다. 3 그룹 모두 회복기 1일째부터 1일 간격으로 운동성 측정을 하였으며, MTZ가 처리된 그룹에서는 대조군에 비해 통계적으로 유의하게 운동성이 감소함을 확인하였다. 또한, 두 실험군이 대조군 수준으로 운동성이 회복되는 시간을 확인한 결과, MTZ에 의해 감소된 운동성이 대조군 수준으로 회복되는데 있어, 배아 배지에서 회복된 그룹 (6일) 보다 tacrine이 포함된 배아 배지에서 회복된 그룹 (4일)이 2일 더 빠르게 회복됨을 확인하였다 (도 1B).5 dpf transgenic zebrafish were separated into three groups: a control group, a group treated with MTZ and recovered in embryonic medium (E3), and a group treated with MTZ and recovered in 250 nM tacrine. The control group was maintained in embryo medium, and the remaining two experimental groups were treated with 2mM MTZ for 18 hours and then transferred to embryo medium for a recovery period. One of the two experimental groups was transferred to embryo medium containing 250 nM tacrine on the second day of the recovery period and maintained. In all three groups, motility was measured at 1-day intervals starting from day 1 of the recovery period, and it was confirmed that the MTZ-treated group had a statistically significant decrease in motility compared to the control group. In addition, as a result of checking the time for motility to recover to the control level in the two experimental groups, the motility reduced by MTZ was recovered to the control level in the embryo medium containing tacrine compared to the group recovered in embryo medium (6 days). It was confirmed that the group (4 days) recovered 2 days faster (Figure 1B).
다음으로 위 3 그룹에서 동일한 방법으로 MTZ와 tacrine을 처리 후, 1일 간격으로 희소돌기아교세포의 사멸 및 재생을 관찰하였다 (도 2A). 그 결과, MTZ에 의해 희소돌기아교세포의 사멸이 유발되었으며, 대조군 수준으로 희소돌기아교세포가 재생되는 시간을 확인한 결과, 배아 배지에서 회복된 그룹 (11일) 보다 tacrine이 포함된 배아 배지에서 회복된 그룹 (8일)이 3일 더 빠르게 재생됨을 확인하였다 (도 2B).Next, after treating the three groups above with MTZ and tacrine in the same manner, death and regeneration of oligodendrocytes were observed at one-day intervals (Figure 2A). As a result, the death of oligodendrocytes was induced by MTZ, and as a result of checking the time for oligodendrocytes to regenerate to the control level, the group recovered in embryonic medium containing tacrine than the group recovered in embryonic medium (11 days). It was confirmed that the group (8 days) regenerated 3 days faster (Figure 2B).
실험예 2. 탈수초성 질환 제브라피쉬를 이용한 약물 스크리닝Experimental Example 2. Drug screening using zebrafish for demyelinating disease
실험예 1의 결과를 통해 본 기술을 통해 제조된 형질전환 제브라피쉬에서 탈수초성 질환 표현형이 명확히 나타남을 확인하였고, 약물의 효능 검증도 가능한 모델로 평가되어 총 160종의 키나아제 저해제에 대한 유효성 평가를 도 3에 따라 수행하였다. 160종 키나아제 저해제 정보는 하기 표 1과 같다.Through the results of Experimental Example 1, it was confirmed that the demyelinating disease phenotype was clearly displayed in the transgenic zebrafish produced through this technology, and it was evaluated as a model capable of verifying the efficacy of drugs, evaluating the effectiveness of a total of 160 types of kinase inhibitors. It was performed according to Figure 3. Information on 160 types of kinase inhibitors is shown in Table 1 below.
Well IDWell ID Product NameProduct Name TargetTarget
001_A02001_A02 cFMS Receptor Inhibitor IIcFMS Receptor Inhibitor II c-Fmsc-Fms
001_A03001_A03 (-)-BAY-1251152(-)-BAY-1251152 CDKCDK
001_A04001_A04 Umbralisib (hydrochloride)Umbralisib (hydrochloride) PI3KPI3K
001_A05001_A05 SCH-1473759 (hydrochloride)SCH-1473759 (hydrochloride) Aurora KinaseAurora Kinase
001_A06001_A06 SulfatinibSulfatinib FGFR; VEGFRFGFR; VEGFR
001_A07001_A07 PamapimodPamapimod Autophagy; p38 MAPKAutophagy; p38 MAPK
001_A08001_A08 CP-547632 (hydrochloride)CP-547632 (hydrochloride) FGFR; VEGFRFGFR; VEGFR
001_A09001_A09 BI-1347BI-1347 CDKCDK
001_A10001_A10 AS2863619 (free base)AS2863619 (free base) CDK; STATCDK; STAT
001_A11001_A11 PI-828PI-828 Casein Kinase; PI3KCasein Kinase; PI3K
001_B02001_B02 EB-3DEB-3D AMPK; ApoptosisAMPK; Apoptosis
001_B03001_B03 (Rac)-GSK547(Rac)-GSK547 RIP kinaseRIP kinase
001_B04001_B04 N-Oleoyl glycineN-Oleoyl glycine Akt; Cannabinoid Receptor; Endogenous MetaboliteAkt; Cannabinoid Receptor; Endogenous Metabolites
001_B05001_B05 YKL-5-124 (TFA)YKL-5-124 (TFA) CDKCDK
001_B06001_B06 GSK319347AGSK319347A IKKIKK
001_B07001_B07 SU3327SU3327 JNKJNK
001_B08001_B08 CMPD101CMPD101 PKC; ROCKPKC; ROCK
001_B09001_B09 CKI-7 (free base)CKI-7 (free base) Casein Kinase; CDK; Ribosomal S6 Kinase (RSK); SGKCasein Kinase; CDK; Ribosomal S6 Kinase (RSK); SGK
001_B10001_B10 AZD7507AZD7507 c-Fmsc-Fms
001_B11001_B11 NarciclasineNarciclasine ROCKROCK
001_C02001_C02 DaphnoretinDaphnoretin Influenza Virus; PKCInfluenza Virus; PKC
001_C03001_C03 MS4078MS4078 ALK; PROTACALK; PROTAC
001_C04001_C04 CDK12-IN-3CDK12-IN-3 CDKCDK
001_C05001_C05 WHI-P258WHI-P258 JNKJNK
001_C06001_C06 AZD4573AZD4573 CDKCDK
001_C07001_C07 SR-4835SR-4835 Apoptosis; CDKApoptosis; CDK
001_C08001_C08 TheliatinibTheliatinib EGFREGFR
001_C09001_C09 GSK 650394GSK 650394 Influenza Virus; SGKInfluenza Virus; SGK
001_C10001_C10 SY-1365SY-1365 CDKCDK
001_C11001_C11 VorolanibVorolanib PDGFR; VEGFRPDGFR; VEGFR
001_D02001_D02 Riviciclib hydrochlorideRiviciclib hydrochloride Apoptosis; CDKApoptosis; CDK
001_D03001_D03 PLX5622PLX5622 c-Fmsc-Fms
001_D04001_D04 IRAK4-IN-4IRAK4-IN-4 IRAKIRAK
001_D05001_D05 CurculigosideCurculigoside JAK; NF-κB; STATJAK; NF-κB; STAT
001_D06001_D06 α-Linolenic acidα-Linolenic acid Akt; PI3KAkt; PI3K
001_D07001_D07 MiransertibMiransertib Akt; ParasiteAkt; Parasite
001_D08001_D08 Nitidine (chloride)Nitidine (chloride) Apoptosis; ERK; FAK; NF-κB; p38 MAPK; Parasite; STAT; TopoisomeraseApoptosis; ERK; FAK; NF-κB; p38 MAPK; Parasite; STAT; Topoisomerase
001_D09001_D09 FangchinolineFangchinoline Apoptosis; Autophagy; FAK; HIVApoptosis; Autophagy; FAK; HIV
001_D10001_D10 3BDO3BDO Apoptosis; Autophagy; mTORApoptosis; Autophagy; mTOR
001_D11001_D11 ONO-7475ONO-7475 TAM Receptor; Trk ReceptorTAM Receptor; Trk Receptor
001_E02001_E02 CDK9-IN-7CDK9-IN-7 Apoptosis; CDKApoptosis; CDK
001_E03001_E03 AZ12601011AZ12601011 TGF-β ReceptorTGF-β Receptor
001_E04001_E04 TG101209TG101209 Apoptosis; Autophagy; FLT3; JAK; RETApoptosis; Autophagy; FLT3; JAK; RET
001_E05001_E05 Theaflavin 3,3'-digallateTheaflavin 3,3'-digallate Akt; ERK; MEK; NF-κBAkt; ERK; MEK; NF-κB
001_E06001_E06 Bisindolylmaleimide IBisindolylmaleimide I PKCPKC
001_E07001_E07 RIPK1-IN-7RIPK1-IN-7 RIP kinaseRIP kinase
001_E08001_E08 BMS-509744BMS-509744 ItkItk
001_E09001_E09 CHMFL-BMX-078CHMFL-BMX-078 BMX KinaseBMX Kinase
001_E10001_E10 G-5555G-5555 PAKP.A.K.
001_E11001_E11 SRPKIN-1SRPKIN-1 SRPKSRPK
001_F02001_F02 GMB-475GMB-475 Apoptosis; Bcr-Abl; PROTACApoptosis; Bcr-Abl; PROTAC
001_F03001_F03 Esculentoside HEsculentoside H JNK; NF-κBJNK; NF-κB
001_F04001_F04 Oroxin BOroxin B Apoptosis; Autophagy; PI3K; PTENApoptosis; Autophagy; PI3K; PTEN
001_F05001_F05 SIAIS178SIAIS178 Bcr-Abl; PROTACBcr-Abl; PROTAC
001_F06001_F06 GlumetinibGlumetinib c-Met/HGFRc-Met/HGFR
001_F07001_F07 KX1-004KX1-004 SrcSrc
001_F08001_F08 PeretinoinPeretinoin Autophagy; HCV; RAR/RXR; SPHKAutophagy; HCV; RAR/RXR; SPHK
001_F09001_F09 Voruciclib (hydrochloride)Voruciclib (hydrochloride) CDKCDK
001_F10001_F10 AZ304AZ304 Autophagy; RafAutophagy; Raf
001_F11001_F11 PRN1008PRN1008 BtkBtk
001_G02001_G02 AZD-7648AZD-7648 DNA-PKDNA-PK
001_G03001_G03 CG-806CG-806 Btk; FLT3Btk; FLT3
001_G04001_G04 PF-06700841 (P-Tosylate)PF-06700841 (P-Tosylate) JAKJAK
001_G05001_G05 SU1498SU1498 VEGFRVEGFR
001_G06001_G06 TomivosertibTomivosertib MNK; PD-1/PD-L1MNK; PD-1/PD-L1
001_G07001_G07 EvobrutinibEvobrutinib BtkBtk
001_G08001_G08 CanertinibCanertinib EGFREGFR
001_G09001_G09 ALW-II-41-27ALW-II-41-27 Ephrin ReceptorEphrin Receptor
001_G10001_G10 MidostaurinMidostaurin PKCPKC
001_G11001_G11 R112R112 SykSyk
001_H02001_H02 A-674563 (hydrochloride)A-674563 (hydrochloride) AktAkt
001_H03001_H03 SK1-IN-1SK1-IN-1 SPHKSPHK
001_H04001_H04 Tyrosine kinase inhibitorTyrosine kinase inhibitor c-Met/HGFRc-Met/HGFR
001_H05001_H05 PralsetinibPralsetinib RETRET
001_H06001_H06 CHIR-99021 (monohydrochloride)CHIR-99021 (monohydrochloride) Autophagy; GSK-3; Wnt; β-cateninAutophagy; GSK-3; Wnt; β-catenin
001_H07001_H07 LY294002LY294002 Apoptosis; Autophagy; Casein Kinase; DNA-PK; PI3KApoptosis; Autophagy; Casein Kinase; DNA-PK; PI3K
001_H08001_H08 BMS-986142BMS-986142 BtkBtk
001_H09001_H09 MRX-2843MRX-2843 FLT3FLT3
001_H10001_H10 BQR-695BQR-695 Parasite; PI4KParasite; PI4K
001_H11001_H11 CP-466722CP-466722 ATM/ATRATM/ATR
002_A02002_A02 YS-49YS-49 Adrenergic Receptor; Akt; Angiotensin Receptor; PI3KAdrenergic Receptor; Akt; Angiotensin Receptor; PI3K
002_A03002_A03 Bucladesine (calcium)Bucladesine (calcium) Apoptosis; Phosphodiesterase (PDE); PKAApoptosis; Phosphodiesterase (PDE); PKA
002_A04002_A04 PD 407824PD 407824 Checkpoint Kinase (Chk); Wee1Checkpoint Kinase (Chk); Wee1
002_A05002_A05 GSK1904529AGSK1904529A Apoptosis; IGF-1R; Insulin ReceptorApoptosis; IGF-1R; Insulin Receptor
002_A06002_A06 IPI-3063IPI-3063 PI3KPI3K
002_A07002_A07 Mps1-IN-3Mps1-IN-3 Mps1Mps1
002_A08002_A08 trans-Zeatintrans-Zeatin Endogenous Metabolite; ERK; MEKEndogenous Metabolites; ERK; MEK
002_A09002_A09 SPP-86SPP-86 RETRET
002_A10002_A10 SophocarpineSophocarpine Akt; Apoptosis; Autophagy; Influenza Virus; PI3KAkt; Apoptosis; Autophagy; Influenza Virus; PI3K
002_A11002_A11 Go 6983Go 6983 PKCPKC
002_B02002_B02 HarmineHarmine 5-HT Receptor; DYRK5-HT Receptor; DYRK
002_B03002_B03 LDN-192960 (hydrochloride)LDN-192960 (hydrochloride) DYRK; Haspin KinaseDYRK; Haspin Kinase
002_B04002_B04 PD0166285PD0166285 Apoptosis; Wee1Apoptosis; Wee1
002_B05002_B05 Tyrphostin AG1433Tyrphostin AG1433 PDGFR; VEGFRPDGFR; VEGFR
002_B06002_B06 AZ7550 MesylateAZ7550 Mesylate Drug Metabolite; EGFR; IGF-1RDrug Metabolite; EGFR; IGF-1R
002_B07002_B07 ALK2-IN-2ALK2-IN-2 TGF-β ReceptorTGF-β Receptor
002_B08002_B08 5'-Fluoroindirubinoxime5'-Fluoroindirubinoxime FLT3FLT3
002_B09002_B09 Tyk2-IN-8Tyk2-IN-8 JAKJAK
002_B10002_B10 GSK-626616GSK-626616 DYRKDYRK
002_B11002_B11 GSK-25GSK-25 Ribosomal S6 Kinase (RSK); ROCKRibosomal S6 Kinase (RSK); ROCK
002_C02002_C02 (R)​-​CR8 (trihydrochloride)(R)​-​CR8 (trihydrochloride) Apoptosis; CDKApoptosis; CDK
002_C03002_C03 JNJ-7706621JNJ-7706621 Apoptosis; Aurora Kinase; CDKApoptosis; Aurora Kinase; CDK
002_C04002_C04 Selumetinib (sulfate)Selumetinib (sulfate) Apoptosis; MEKApoptosis; MEK
002_C05002_C05 GW788388GW788388 TGF-β ReceptorTGF-β Receptor
002_C06002_C06 Rheb inhibitor NR1Rheb inhibitor NR1 mTORmTOR
002_C07002_C07 FostamatinibFostamatinib SykSyk
002_C08002_C08 Sodium dichloroacetateSodium dichloroacetate Apoptosis; NKCC; PDHK; Reactive Oxygen SpeciesApoptosis; NKCC; PDHK; Reactive Oxygen Species
002_C09002_C09 Tyrphostin AG30Tyrphostin AG30 EGFREGFR
002_C10002_C10 Naquotinib (mesylate)Naquotinib (mesylate) EGFREGFR
002_C11002_C11 Polyphyllin IPolyphyllin I Akt; Apoptosis; Autophagy; JNK; mTOR; PDK-1Akt; Apoptosis; Autophagy; JNK; mTOR; PDK-1
002_D02002_D02 5-Iodo-indirubin-3'-monoxime5-Iodo-indirubin-3'-monoxime CDK; GSK-3CDK; GSK-3
002_D03002_D03 NVP-QAV-572NVP-QAV-572 PI3KPI3K
002_D04002_D04 HemateinHematein Akt; Apoptosis; Casein Kinase; WntAkt; Apoptosis; Casein Kinase; Wnt
002_D05002_D05 Btk inhibitor 2Btk inhibitor 2 BtkBtk
002_D06002_D06 CHIR-99021CHIR-99021 Autophagy; GSK-3; Wnt; β-cateninAutophagy; GSK-3; Wnt; β-catenin
002_D07002_D07 Pentagamavunon-1Pentagamavunon-1 Apoptosis; COX; NF-κB; VEGFRApoptosis; COX; NF-κB; VEGFR
002_D08002_D08 MKC3946MKC3946 IRE1IRE1
002_D09002_D09 Metformin (hydrochloride)Metformin (hydrochloride) AMPK; Autophagy; MitophagyAMPK; Autophagy; Mitophagy
002_D10002_D10 Cromolyn (sodium)Cromolyn (sodium) Calcium Channel; GSK-3Calcium Channel; GSK-3
002_D11002_D11 HMN-214HMN-214 Polo-like Kinase (PLK)Polo-like Kinase (PLK)
002_E02002_E02 InfigratinibInfigratinib FGFRFGFR
002_E03002_E03 MLN120BMLN120B IKKIKK
002_E04002_E04 (E)-Necrosulfonamide(E)-Necrosulfonamide Mixed Lineage KinaseMixed Lineage Kinase
002_E05002_E05 PD318088PD318088 MEKMEK
002_E06002_E06 RociletinibRociletinib EGFREGFR
002_E07002_E07 OglufanideOglufanide Endogenous Metabolite; HCV; VEGFREndogenous Metabolites; HCV; VEGFR
002_E08002_E08 OlmutinibOlmutinib EGFREGFR
002_E09002_E09 BikininBikinin GSK-3GSK-3
002_E10002_E10 AT7867 (dihydrochloride)AT7867 (dihydrochloride) Akt; PKA; Ribosomal S6 Kinase (RSK)Akt; PKA; Ribosomal S6 Kinase (RSK)
002_E11002_E11 Rigosertib (sodium)Rigosertib (sodium) Apoptosis; PI3K; Polo-like Kinase (PLK)Apoptosis; PI3K; Polo-like Kinase (PLK)
002_F02002_F02 PI-3065PI-3065 PI3KPI3K
002_F03002_F03 SU14813 (maleate)SU14813 (maleate) c-Kit; PDGFR; VEGFRc-Kit; PDGFR; VEGFR
002_F04002_F04 TCS7010TCS7010 Apoptosis; Aurora KinaseApoptosis; Aurora Kinase
002_F05002_F05 ZM-447439ZM-447439 Apoptosis; Aurora KinaseApoptosis; Aurora Kinase
002_F06002_F06 SB 202190SB 202190 Apoptosis; Autophagy; Ferroptosis; p38 MAPKApoptosis; Autophagy; Feroptosis; p38 MAPK
002_F07002_F07 CC-115CC-115 DNA-PK; mTORDNA-PK; mTOR
002_F08002_F08 AMG319AMG319 PI3KPI3K
002_F09002_F09 Cediranib (maleate)Cediranib (maleate) Autophagy; PDGFR; VEGFRAutophagy; PDGFR; VEGFR
002_F10002_F10 TG003TG003 CDKCDK
002_F11002_F11 Ro 5126766Ro 5126766 MEK; RafMEK; Raf
002_G02002_G02 TAS-301TAS-301 PKCPKC
002_G03002_G03 CH5183284CH5183284 FGFRFGFR
002_G04002_G04 BinimetinibBinimetinib Autophagy; MEKAutophagy; MEK
002_G05002_G05 Dovitinib (lactate)Dovitinib (lactate) c-Kit; FGFR; FLT3; PDGFR; VEGFRc-Kit; FGFR; FLT3; PDGFR; VEGFR
002_G06002_G06 BI-78D3BI-78D3 JNKJNK
002_G07002_G07 Tyrphostin A9Tyrphostin A9 Influenza Virus; VEGFRInfluenza Virus; VEGFR
002_G08002_G08 GW 441756GW 441756 Apoptosis; Trk ReceptorApoptosis; Trk Receptor
002_G09002_G09 Src Inhibitor 1Src Inhibitor 1 SrcSrc
002_G10002_G10 NMS-1286937NMS-1286937 Apoptosis; Polo-like Kinase (PLK)Apoptosis; Polo-like Kinase (PLK)
002_G11002_G11 GSK1838705AGSK1838705A ALK; IGF-1R; Insulin ReceptorALK; IGF-1R; Insulin Receptor
002_H02002_H02 Pim1/AKK1-IN-1Pim1/AKK1-IN-1 PimPim
002_H03002_H03 1-Naphthyl PP1 (hydrochloride)1-Naphthyl PP1 (hydrochloride) SrcSrc
002_H04002_H04 Torin 2Torin 2 Apoptosis; Autophagy; DNA-PK; mTORApoptosis; Autophagy; DNA-PK; mTOR
002_H05002_H05 Imatinib (Mesylate)Imatinib (Mesylate) Autophagy; Bcr-Abl; c-Kit; PDGFRAutophagy; Bcr-Abl; c-Kit; PDGFR
002_H06002_H06 PP2PP2 SrcSrc
002_H07002_H07 PF-04217903 (methanesulfonate)PF-04217903 (methanesulfonate) c-Met/HGFRc-Met/HGFR
002_H08002_H08 FlumatinibFlumatinib Bcr-Abl; c-Kit; PDGFRBcr-Abl; c-Kit; PDGFR
002_H09002_H09 Pazopanib (Hydrochloride)Pazopanib (Hydrochloride) Autophagy; c-Fms; c-Kit; FGFR; PDGFR; VEGFRAutophagy; c-Fms; c-Kit; FGFR; PDGFR; VEGFR
002_H10002_H10 BentamapimodBentamapimod JNKJNK
002_H11002_H11 RefametinibRefametinib MEKMEK
5 dpf 형질전환 제브라피쉬는 ① 대조군과 ② MTZ 처리 후, 배아 배지에서 회복시킨 그룹, ③ 250 nM tacrine이 포함된 배아 배지에서 회복시킨 그룹, ④ 키나아제 저해제가 포함된 배아 배지에서 회복시킨 그룹 총 4 그룹으로 분리하였다. 대조군은 배아 배지에서 유지되었고, 나머지 세 실험군은 2 mM MTZ를 18시간 동안 처리 후, 배아 배지로 옮겨 2일 동안 회복기를 주었다. 세 실험군 중 두 실험군은 회복기 2일째에 250 nM tacrine이 포함된 배아 배지, 키나아제 저해제가 포함된 배아 배지로 옮겨 각각 유지되었다. 각각의 배지로 옮긴 후, 1일째에 4 그룹 모두 운동성을 측정하였다 (도 4). MTZ가 처리된 그룹에서 나타난 운동성 감소 현상을 유의하게 회복시키는 키나아제 저해제를 선별하였다. 총 160종의 키나아제 저해제 중에서 통계적으로 유의하게 운동성을 회복시키는 17종을 확인하였다 (도 5). 상기 운동성 회복 효과를 나타내는 17종 키나아제 저해제는 아래 표 2과 같다.5 dpf transgenic zebrafish were divided into 4 groups: ① control group, ② group recovered in embryo medium after MTZ treatment, ③ group recovered in embryo medium containing 250 nM tacrine, and ④ group recovered in embryo medium containing kinase inhibitor. Separated into groups. The control group was maintained in embryo medium, and the remaining three experimental groups were treated with 2mM MTZ for 18 hours and then transferred to embryo medium and given a recovery period for 2 days. Two of the three experimental groups were maintained on the second day of the recovery period by being transferred to embryo medium containing 250 nM tacrine and embryo medium containing a kinase inhibitor, respectively. After transferring to each medium, the motility of all four groups was measured on day 1 (Figure 4). Kinase inhibitors that significantly restored the decrease in motility observed in the MTZ-treated group were selected. Among a total of 160 types of kinase inhibitors, 17 types were identified that statistically significantly restored motility (Figure 5). The 17 types of kinase inhibitors that exhibit the motility recovery effect are listed in Table 2 below.
Well IDWell ID Product NameProduct Name TargetTarget
001_B6001_B6 GSK319347AGSK319347A IKKIKK
001_C4001_C4 CDK12-IN-3CDK12-IN-3 CDKCDK
001_D4001_D4 IRAK4-IN-4IRAK4-IN-4 IRAKIRAK
001_D6001_D6 α-Linolenic acidα-Linolenic acid Akt; PI3KAkt; PI3K
001_D9001_D9 FangchinolineFangchinoline Apoptosis; Autophagy; FAK; HIVApoptosis; Autophagy; FAK; HIV
001_D10001_D10 3BDO3BDO Apoptosis; Autophagy; mTORApoptosis; Autophagy; mTOR
001_D11001_D11 ONO-7475ONO-7475 TAM Receptor; Trk ReceptorTAM Receptor; Trk Receptor
001_E3001_E3 AZ12601011AZ12601011 TGF-β ReceptorTGF-β Receptor
001_E4001_E4 TG101209TG101209 Apoptosis; Autophagy; FLT3; JAK; RETApoptosis; Autophagy; FLT3; JAK; RET
001_E5001_E5
Theaflavin 3,3'-digallateTheaflavin 3,3'-digallate Akt; ERK; MEK; NF-κBAkt; ERK; MEK; NF-κB
001_E11001_E11 SRPKIN-1SRPKIN-1 SRPKSRPK
001_F2001_F2 GMB-475GMB-475 Apoptosis; Bcr-Abl; PROTACApoptosis; Bcr-Abl; PROTAC
001_F10001_F10 AZ304AZ304 Autophagy; RafAutophagy; Raf
002_A2002_A2 YS-49YS-49 Akt; PI3KAkt; PI3K
002_A6002_A6 IPI-3063IPI-3063 PI3KPI3K
002_B6002_B6 AZ7550 MesylateAZ7550 Mesylate EGFR; IGF-1REGFR; IGF-1R
002_B8002_B8 5'-Fluoroindirubinoxime5'-Fluoroindirubinoxime FLT3FLT3
행동 기반 분석을 통해 선별된 17종에 대해서는 이미징 기반 분석을 통해 추가적으로 유효성 검증을 진행하였다. 위 4 그룹에서 동일한 방법으로 MTZ와 tacrine, 키나아제 저해제를 처리 후, 4일째에 희소돌기아교세포의 사멸 및 재생을 관찰하였다. 그 결과, MTZ에 의해 희소돌기아교세포의 사멸이 유발되었으며, 17종 중에서 4종의 약물이 통계적으로 유의하게 희소돌기아교세포의 재생을 촉진하는 것으로 확인되었다 (도 6). 신경세포의 재생을 촉진하는 4종 키나아제 저해제는 아래 표 3와 같다.For the 17 species selected through behavior-based analysis, additional validation was performed through imaging-based analysis. In the above 4 groups, death and regeneration of oligodendrocytes were observed on the 4th day after treatment with MTZ, tacrine, and a kinase inhibitor in the same manner. As a result, MTZ induced the death of oligodendrocytes, and 4 out of 17 drugs were found to promote the regeneration of oligodendrocytes in a statistically significant manner (FIG. 6). Four types of kinase inhibitors that promote nerve cell regeneration are listed in Table 3 below.
Well IDWell ID Product NameProduct Name TargetTarget
001_D10001_D10 3BDO3BDO Apoptosis; Autophagy; mTORApoptosis; Autophagy; mTOR
001_D11001_D11 ONO-7475ONO-7475 TAM Receptor; Trk ReceptorTAM Receptor; Trk Receptor
001_E3001_E3 AZ12601011AZ12601011 TGF-β ReceptorTGF-β Receptor
001_E5001_E5
Theaflavin 3,3'-digallateTheaflavin 3,3'-digallate Akt; ERK; MEK; NF-κBAkt; ERK; MEK; NF-κB
위 제브라피쉬 기반 유효성 평가 시스템을 통한 2차 검증을 통하여 총 4종의 유효물질 3BDO, ONO-7475, AZ12601011, Theaflavin 3,3'-digallate을 도출하였으며, 각 약물의 타겟은 도 5와 같다.Through secondary verification using the above zebrafish-based effectiveness evaluation system, a total of four active substances 3BDO, ONO-7475, AZ12601011, and Theaflavin 3,3'-digallate were derived, and the targets of each drug are shown in Figure 5.
본 연구진의 결과와 보고된 연구 결과를 바탕으로, 4종의 키나아제 저해제가 탈수초성 질환 개선 또는 치료를 위한 용도로 사용될 수 있음을 제시한다.Based on the results of this research team and the reported research results, we suggest that four types of kinase inhibitors can be used to improve or treat demyelinating diseases.
이상과 같이 실시예들이 비록 한정된 도면에 의해 설명되었으나, 해당 기술분야에서 통상의 지식을 가진 자라면 상기를 기초로 다양한 기술적 수정 및 변형을 적용할 수 있다. 예를 들어, 설명된 기술들이 설명된 방법과 다른 순서로 수행되거나, 및/또는 설명된 시스템, 구조, 장치, 회로 등의 구성요소들이 설명된 방법과 다른 형태로 결합 또는 조합되거나, 다른 구성요소 또는 균등물에 의하여 대치되거나 치환되더라도 적절한 결과가 달성될 수 있다.Although the embodiments have been described with limited drawings as described above, those skilled in the art can apply various technical modifications and variations based on the above. For example, the described techniques are performed in a different order than the described method, and/or components of the described system, structure, device, circuit, etc. are combined or combined in a different form than the described method, or other components are used. Alternatively, appropriate results may be achieved even if substituted or substituted by an equivalent.
그러므로, 다른 구현들, 다른 실시예들 및 특허청구범위와 균등한 것들도 후술하는 청구범위의 범위에 속한다.Therefore, other implementations, other embodiments, and equivalents of the claims also fall within the scope of the following claims.
본 발명은 4종 키나아제 저제제의 탈수초성 질환 예방 및 치료 효과를 제브라피쉬 질병 모델에서 확인하고, 이를 탈수초성 질환 예방 및 치료 용도에 제공하는 것으로서, 치료제가 없는 희귀질환의 치료제로 널리 이용될 것으로 기대된다.The present invention confirms the effectiveness of four types of kinase inhibitors in preventing and treating demyelinating diseases in a zebrafish disease model and provides them for the prevention and treatment of demyelinating diseases, and is expected to be widely used as a treatment for rare diseases for which there is no cure. It is expected.

Claims (4)

  1. 3BDO, ONO-7475, AZ12601011, 및 Theaflavin 3,3'-digallate으로 이루어진 군으로부터 선택되는 1종 이상의 키나아제 저해제를 유효성분으로 포함하는 탈수초성 질환 예방 또는 치료용 약학적 조성물.A pharmaceutical composition for preventing or treating demyelinating diseases, comprising as an active ingredient one or more kinase inhibitors selected from the group consisting of 3BDO, ONO-7475, AZ12601011, and Theaflavin 3,3'-digallate.
  2. 제1항에 있어서,According to paragraph 1,
    상기 조성물은 운동성을 회복시키는 것인, 약학적 조성물.A pharmaceutical composition that restores mobility.
  3. 제1항에 있어서,According to paragraph 1,
    상기 희소돌기아교세포의 재생을 촉진하는 것인, 약학적 조성물.A pharmaceutical composition that promotes regeneration of the oligodendrocytes.
  4. 제1항에 있어서,According to paragraph 1,
    상기 조성물은 키나아제 저해제를 10 nM~10 μM 농도로 포함하는 것인, 약학적 조성물.A pharmaceutical composition comprising a kinase inhibitor at a concentration of 10 nM to 10 μM.
PCT/KR2023/008064 2022-06-13 2023-06-12 Pharmaceutical composition for preventing or treating demyelinating disease, comprising kinase inhibitor as active ingredient WO2023243971A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020220071541A KR20230171226A (en) 2022-06-13 2022-06-13 Pharmaceutical composition comprising kinase inhibitor as an active ingredient for preventing or treatment of demyelinating disease
KR10-2022-0071541 2022-06-13

Publications (1)

Publication Number Publication Date
WO2023243971A1 true WO2023243971A1 (en) 2023-12-21

Family

ID=89191439

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/008064 WO2023243971A1 (en) 2022-06-13 2023-06-12 Pharmaceutical composition for preventing or treating demyelinating disease, comprising kinase inhibitor as active ingredient

Country Status (2)

Country Link
KR (1) KR20230171226A (en)
WO (1) WO2023243971A1 (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20120011042A (en) * 2009-04-15 2012-02-06 샌포드-번햄 메디칼 리서치 인스티튜트 Naphthalene-based inhibitors of anti-apoptotic proteins
KR20210044212A (en) * 2018-07-12 2021-04-22 더 리젠츠 오브 더 유니버시티 오브 미시간 Compositions and methods of metal-containing formulations capable of modulating the immune response
KR20210054741A (en) * 2019-11-06 2021-05-14 건국대학교 산학협력단 Compositons for differentiating oligodendrocytes containing gintonin and compositions for preventing or treating demyelinating diseases
KR20210063443A (en) * 2012-10-09 2021-06-01 바이오젠 엠에이 인코포레이티드 Combination therapies and uses for treatment of demyelinating disorders
KR20210138783A (en) * 2014-05-22 2021-11-19 뉴욕 스템 셀 파운데이션, 인코포레이티드 Functional oligodendrocytes derived from pluripotent stem cells and methods of making and using the same

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20120011042A (en) * 2009-04-15 2012-02-06 샌포드-번햄 메디칼 리서치 인스티튜트 Naphthalene-based inhibitors of anti-apoptotic proteins
KR20210063443A (en) * 2012-10-09 2021-06-01 바이오젠 엠에이 인코포레이티드 Combination therapies and uses for treatment of demyelinating disorders
KR20210138783A (en) * 2014-05-22 2021-11-19 뉴욕 스템 셀 파운데이션, 인코포레이티드 Functional oligodendrocytes derived from pluripotent stem cells and methods of making and using the same
KR20210044212A (en) * 2018-07-12 2021-04-22 더 리젠츠 오브 더 유니버시티 오브 미시간 Compositions and methods of metal-containing formulations capable of modulating the immune response
KR20210054741A (en) * 2019-11-06 2021-05-14 건국대학교 산학협력단 Compositons for differentiating oligodendrocytes containing gintonin and compositions for preventing or treating demyelinating diseases

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
OLIVER CRESPO; STACEY C. KANG; RICHARD DANEMAN; TAMSIN M. LINDSTROM; PEGGY P. HO; RAYMOND A. SOBEL; LAWRENCE STEINMAN; WILLIAM H. : "Tyrosine Kinase Inhibitors Ameliorate Autoimmune Encephalomyelitis in a Mouse Model of Multiple Sclerosis", JOURNAL OF CLINICAL IMMUNOLOGY, KLUWER ACADEMIC PUBLISHERS-PLENUM PUBLISHERS, NE, vol. 31, no. 6, 17 August 2011 (2011-08-17), Ne , pages 1010 - 1020, XP019983573, ISSN: 1573-2592, DOI: 10.1007/s10875-011-9579-6 *
ROTSTEIN DALIA L, SAWICKA KATHERINE, BHARATHA ADITYA, MONTALBAN XAVIER, LIPTON JEFFREY H: "CNS demyelination after initiating the tyrosine kinase inhibitor imatinib: A report of two cases", MULTIPLE SCLEROSIS JOURNAL, SAGE, US, vol. 26, no. 9, 1 August 2020 (2020-08-01), US , pages 1121 - 1124, XP093117326, ISSN: 1352-4585, DOI: 10.1177/1352458519892914 *

Also Published As

Publication number Publication date
KR20230171226A (en) 2023-12-20

Similar Documents

Publication Publication Date Title
Trainor Craniofacial birth defects: The role of neural crest cells in the etiology and pathogenesis of Treacher Collins syndrome and the potential for prevention
Kim et al. Changes in the excitability of neocortical neurons in a mouse model of amyotrophic lateral sclerosis are not specific to corticospinal neurons and are modulated by advancing disease
Smidt et al. Homeobox gene Pitx3 and its role in the development of dopamine neurons of the substantia nigra
Keshavan et al. New drug developments in psychosis: challenges, opportunities and strategies
US20100178277A1 (en) Methods and compositions for stimulating cells
Tyson et al. GABAergic interneuron transplants to study development and treat disease
JP2021000104A (en) Midbrain dopamine (da) neurons for engraftment
Suksuphew et al. Neural stem cells could serve as a therapeutic material for age-related neurodegenerative diseases
Ding et al. Redundant roles of PRDM family members in zebrafish craniofacial development
Cao et al. Mulberrin attenuates 1-methyl-4-phenyl-1, 2, 3, 6-tetrahydropyridine (MPTP)-induced Parkinson’s disease by promoting Wnt/β-catenin signaling pathway
Vugler et al. A role for the outer retina in development of the intrinsic pupillary light reflex in mice
Zhou et al. Effect of the sonic hedgehog receptor smoothened on the survival and function of dopaminergic neurons
Smith et al. Seizures, not hippocampal neuronal death, provoke neurogenesis in a mouse rapid electrical amygdala kindling model of seizures
Liu et al. Application of induced pluripotent stem cells to understand neurobiological basis of bipolar disorder and schizophrenia
WO2018160028A1 (en) Medium composition for neuron differentiation and method for differentiating somatic cells into neurons using same medium composition
WO2023243971A1 (en) Pharmaceutical composition for preventing or treating demyelinating disease, comprising kinase inhibitor as active ingredient
Zhang et al. Interference of sympathetic overactivation restores limbal stem/progenitor cells function and accelerates corneal epithelial wound healing in diabetic mice
Gu et al. Molecular mechanisms involved in the regulation of neurodevelopment by miR-124
Dong et al. The pathophysiology of trigeminal neuralgia: a molecular review
Liu et al. Selective deletion of zinc transporter 3 in amacrine cells promotes retinal ganglion cell survival and optic nerve regeneration after injury
Edmar Zanoteli et al. Spinal muscular atrophy: from animal model to clinical trial
Meng et al. Combined rosiglitazone and forskolin have neuroprotective effects in SD rats after spinal cord injury
Fan et al. Retracted: Inhibition of SNK‐SPAR signaling pathway promotes the restoration of motor function in a rat model of ischemic stroke
Heroux et al. Prefrontal Nmda-receptor antagonism disrupts encoding or consolidation but not retrieval of incidental context learning
Reymann et al. Subthalamic nucleus modulates social and anxogenic-like behaviors

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23824187

Country of ref document: EP

Kind code of ref document: A1