WO2023240081A1 - Treatment, amelioration, and/or prevention of inflammatory and autoimmune diseases - Google Patents

Treatment, amelioration, and/or prevention of inflammatory and autoimmune diseases Download PDF

Info

Publication number
WO2023240081A1
WO2023240081A1 PCT/US2023/067995 US2023067995W WO2023240081A1 WO 2023240081 A1 WO2023240081 A1 WO 2023240081A1 US 2023067995 W US2023067995 W US 2023067995W WO 2023240081 A1 WO2023240081 A1 WO 2023240081A1
Authority
WO
WIPO (PCT)
Prior art keywords
group
compound
hydrogen
alkyl
groups
Prior art date
Application number
PCT/US2023/067995
Other languages
French (fr)
Inventor
Jason Crawford
Richard Flavell
Zheng Wei
Joonseok OH
Original Assignee
Yale University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yale University filed Critical Yale University
Publication of WO2023240081A1 publication Critical patent/WO2023240081A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19—Carboxylic acids, e.g. valproic acid
    • A61K31/195—Carboxylic acids, e.g. valproic acid having an amino group
    • A61K31/197—Carboxylic acids, e.g. valproic acid having an amino group the amino and the carboxyl groups being attached to the same acyclic carbon chain, e.g. gamma-aminobutyric acid [GABA], beta-alanine, epsilon-aminocaproic acid, pantothenic acid

Definitions

  • This invention contains one or more sequences in a computer readable format in an accompanying text file titled "047162-7336WOl.xml,” which was created on June 6, 2022 and is 4.6 KB in size, the contents of which are incorporated herein by reference in their entirety.
  • Laccase domain-containing 1 (LACC1) protein is an enzyme highly expressed in inflammatory macrophages and serves a central regulatory role in multiple inflammatory diseases, such as in inflammatory bowel diseases (IBDs), arthritis, and clearance of microbial infection.
  • FIGs. 1 A-1H show that LACC1 is an endogenous isocyanic acid synthase, converting L-Cit to L-Om and HNCO.
  • FIG. 1 A shows a schematic pipeline used for in vitro enzymatic evaluation of mLACCl.
  • FIG. IB is a volcano plot showing the fold change (FC) (substrate with mLACCl versus substrate with heat inactivated mLACCl) and false discovery' rate
  • FIG. 1C shows abundance of L-Om in enzymatic assays validating the substrate of mLACCl.
  • FIG. ID shows the Michaelis-Menten curves of mLACCl, hLACCl, hLACCl I254V, hLACCl C284R, and hLACCl K38E.
  • FIG. IE shows abundance of HNCO in enzymatic assays, as assessed by the 2-aminobenzoate-HNCO carbamoylation assay.
  • FIG. 1G shows major biochemical transformation mediated by LACC1.
  • FIGs. 2A-2G show that LACC1 inhibits proinflammatory cytokine signaling and protects from S. Typhimurium infection.
  • FIG. 2A shows ELISA measurements of TNFa, IL6 and IL 12b secreted by BMDMs in the presence or absence of immunostimulant (LPS + IFNy), exogenously supplied LACC1 product L-Om (1, 5 mM), and/or the conjugate base of LACC1 product HNCO, NaOCN (100 pM, 1 mM).
  • FIG. 2D shows Colony-Forming Units (CFUs) in fecal pellets were measured at day 4 after infection.
  • FIG. 2E, FIG. 2F, and FIG. 2G show CFUs in the caecum, spleen and liver, respectively, were measured at day 6 after infection.
  • Statistical significance two-tailed t-test) compared to control (Ctrl): *P ⁇ 0.05; **P ⁇ 0.01; ns, not significant.
  • FIGs. 3A-3B shows that LACC1 bridges arginine metabolism with polyamine synthesis in Ml macrophages.
  • FIG. 3A shows LC-QQQ-MS intensity of 13 C-0m, 13 C-Put, 13 C-Spd and 13 C-Spm in Ml BMDMs from WT and Laccl ⁇ mice.
  • FIGs. 4A-4L show that NOS2 is important for the antibacterial function of LACC1.
  • FIG. 4A is an illustration of the NOS2-LACCl-ODCl signaling axis.
  • FIG. 4D shows CFUs in fecal pellets were measured at day 4 after infection.
  • FIG. 4E, FIG. 4F, and FIG. 4G show CFUs in the caecum, spleen and liver, respectively, were measured at day 6 after infection.
  • FIG. 4H, FIG. 41, FIG. 4J show ELISA measurements of TNFa, IL6 and IL 12b, respectively, secreted by BMDMs stimulated by LPS and IFNy with or without 1 mM DFMO treatment.
  • FIG. 4K shows CFUs of intracellular S. Typhimurium in Ml BMDMs.
  • FIG. 4L shows the results of an LDH assay in S.
  • FIGs. 5A-5J show in vitro biochemical analysis of isolated LACC1 variants.
  • FIG. 5A illustrates that ICP-MS assays showed the enrichment of Zn 64 and Zn 66 isotopes in recombinant mLACCl relative to vector control.
  • FIG. 5B illustrates that a quantitative ICP- MS assay for Zn showed the average ZmmLACCl ratio as 0.94, suggesting a 1:1 ratio in the isolated enzyme.
  • FIG. 5C-FIG. 5D show volcano plots from UPLC-QTOF-MS experiments showing the fold change (FC) (substrate with mLACCl versus substrate with heat inactivated mLACCl) and false discovery rate (FDR) values collected in positive ion mode (FIG.
  • FC fold change
  • FDR false discovery rate
  • FIG. 5C shows rates of L-Om production in enzymatic assays at different pH conditions.
  • FIG. 5F shows rates of L-Om production in enzymatic assays with the supplementation of EDTA or TPEN in the reaction buffer.
  • FIG. 5G shows the standard curve used for quantifying L-Om in enzymatic assays.
  • FIG. 5H shows the standard curve used for quantifying 2-aminobenzoate- HNCO carbamoylation products in enzymatic assays.
  • FIG. 5E shows rates of L-Om production in enzymatic assays at different pH conditions.
  • FIG. 5F shows rates of L-Om production in enzymatic assays with the supplementation of EDTA or TPEN in the reaction buffer.
  • FIG. 5G shows the standard curve used for quantifying L-Om in enzymatic assays.
  • FIG. 5H shows the standard curve used for quantifying 2-aminobenzoate- HNCO carbamoylation products in
  • FIG. 51 shows the LC-MS trace of 1- fluoro-2,4-dinitrophenyl-5-L-alanine amide (FDAA, Marfey’s reagent)-coupled L-Om in enzymatic assays, supporting the stereoconfiguration.
  • FIGs. 7A-7K depict how Lacc 1 C284R/C284R shows an intermediate defect in antibacterial protection against S. Typhimurium infection.
  • FIG. 7B shows CFUs in fecal pellets measured at day 4 after infection.
  • FIG. 7C, FIG. 7D, and FIG. 7E show CFUs in the caecum, spleen and liver, respectively, measured at day 6 after infection.
  • FIG. 7H show ELISA measurements of TNFa, IL6 and IL12b secreted by BMDMs in the presence or absence (NT, non-treatment) of immunostimulant (LPS + IFNy).
  • FIG. 7I-FIG. 7K show ELISA measurements of TNFa, IL6 and IL12b secreted by BMDMs in the presence or absence (NT) of immunostimulant (LPS + IFNy), exogenously supplied LACC1 product L-Om (100 M, 1 mM, 5 mM, 10 mM), and/or the conjugate base of LACC 1 product HNCO, NaOCN (10 M, 100 pM, 500 pM, 1 mM).
  • FIG. 8 shows body weight of each mouse in the absence of S. Typhimurium infection was monitored daily with or without 1% L-Om administration in drinking water, showing no significant change in body weight.
  • Statistical significance two-tailed t-test compared to control (Ctrl): ns, not significant.
  • FIGs. 9A-9E show that LACC1 bridges L-Arg metabolism with poly amine synthesis in Ml macrophages.
  • FIG. 9A-FIG. 9B show MS intensity of SAM and dcSAM, respectively, in Ml BMDMs from WT and LaccT'' mice. LaccT 2 ' BMDMs show an elevated but non statistically significant level of dcSAM.
  • FIG. 9C-FIG. 9E show UPLC-QTOF-MS intensity of 13 C-labeled metabolites in L-Arg metabolism and polyamine synthesis with 13 C-Arg feeding (FIG. 9C), 13 C-Cit feeding (FIG. 9D) and 13 C-ArgSuc feeding (FIG. 9E), respectively.
  • FIGs. 10A-10E show irreversible inhibition of ODC1 phenocopied exacerbated S. Typhimurium induced cell death from LaccT 2 ' inflammatory BMDMs.
  • FIG. 10A, 10B, and 10C are ELISA measurements of TNFa, IL6, and IL12b, respectively, secreted by BMDMs stimulated by LPS and IFNy with or without 1 mM DFMO and/or 500 pM putrescine (Put)
  • FIG. 10D shows CFUs of intracellular S. Typhimurium in inflammatory BMDMs.
  • FIGs. 11A-1 IB show a summary of the enzymatic functions of LACC1 in Ml macrophages.
  • FIG. 11A shows LACCl’s newly described role in bridging L-Arg and polyamine metabolism in inflammatory macrophages. The carbons are highlighted with consistency to the present l,2,3,4,5- 13 C5-L-Cit (red) and 6- 13 Ci-L-Cit (blue) feeding studies in Ml BMDMs. Carbons in spermidine and spermine highlighted in green derive from dcSAM.
  • FIG. 1 IB shows the involvement of LACC1 (a.k.a., FAMIN) in the purine nucleotide cycle as a purine nucleoside enzyme.
  • ADSL adenylosuccinate lyase
  • ADSS adenylosuccinate synthase
  • AMP adenosine monophosphate
  • AMPD AMP deaminase
  • GDP guanosine diphosphate
  • GMP guanosine monophosphate
  • GTP guanosine triphosphate
  • IMP inosine monophosphate
  • XMP xanthosine monophosphate.
  • FIG. 12 shows that wildtype mL ACC 1 and hLACCl convert l,2,3,4,5-13C5-L-Cit into l,2,3,4,5-13C5-L-Om when expressed recombinantly in E. coli BL21(DE3) relative to a pET28a negative control (Vector).
  • the culture extracts were coupled with l-fluoro-2,4- dinitrophenyl-5-L-alanine amide and the derivatization products (L-Om) were analyzed by UPLC-QTOF-MS.
  • isoforms 1, 2, 3, and 4 were assessed in addition to the polymorphic variants I254V and C284R in an isoform 2 background.
  • mLACCCl the V254I and C284R variants were compared to a wildtype background.
  • SUBSTITUTE SHEET (RULE 26) not just about 0.1% to about 5%, but also the individual values (e.g., 1%, 2%, 3%, and 4%) and the sub-ranges (e.g.. 0.1% to 0.5%, 1.1% to 2.2%, 3.3% to 4.4%) within the indicated range.
  • the statement "about X to Y” has the same meaning as “about X to about Y,” unless indicated otherwise.
  • the statement “about X, Y, or about Z” has the same meaning as “about X, about Y, or about Z,” unless indicated otherwise.
  • the acts can be carried out in any order, except when a temporal or operational sequence is explicitly recited. Furthermore, specified acts can be carried out concurrently unless explicit claim language recites that they be carried out separately. For example, a claimed act of doing X and a claimed act of doing Y can be conducted simultaneously within a single operation, and the resulting process will fall within the literal scope of the claimed process.
  • substantially refers to a majority of, or mostly, as in at least about 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, 99.99%, or at least about 99.999% or more, or 100%.
  • substantially free of 1 can mean having none or having a trivial amount of, such that the amount of material present does not affect the material properties of the composition including the material, such that the composition is about 0 wt% to about 5 wt% of the material, or about 0 wt% to about 1 wt%, or about 5 wt% or less, or less than, equal to, or greater than about 4.5 wt%, 4, 3.5, 3, 2.5, 2, 1.5, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, 0.1, 0.01, or about 0.001 wt% or less.
  • the term “substantially free of 1 as used herein can mean having none or having a trivial amount of, such that the amount of material present does not affect the material properties of the composition including the material, such that the composition is about 0 wt% to about 5 wt% of the material, or about 0 wt% to about 1 wt%, or about 5 wt% or less,
  • SUBSTITUTE SHEET (RULE 26) "substantially free of 1 can mean having a trivial amount of, such that a composition is about 0 wt% to about 5 wt% of the material, or about 0 wt% to about 1 wt%, or about 5 wt% or less, or less than, equal to, or greater than about 4.5 wt%, 4, 3.5, 3, 2.5, 2, 1.5, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, 0.1, 0.01, or about 0.001 wt% or less, or about 0 wt%.
  • organic group refers to any carbon-containing functional group. Examples can include an oxygen-containing group such as an alkoxy group, aryloxy group, aralkyloxy group, oxo(carbonyl) group; a carboxyl group including a carboxylic acid, carboxylate, and a carboxylate ester; a sulfur-containing group such as an alkyl and aryl sulfide group; and other heteroatom-containing groups.
  • Non-limiting examples of organic groups include OR, OOR, OC(O)N(R)2, CN, CF3, OCF3, R, C(O), methylenedioxy, ethylenedioxy, N(R) 2 , SR, SOR, SO2R, SO 2 N(R) 2 , SO3R, C(O)R, C(O)C(O)R, C(O)CH 2 C(O)R, C(S)R, C(O)OR, OC(O)R, C(O)N(R) 2 , OC(O)N(R) 2 , C(S)N(R) 2 , (CH 2 )O- 2 N(R)C(O)R, (CH 2 )O- 2 N(R)N(R) 2 , N(R)N(R)C(O)R, N(R)N(R)C(O)OR, N(R)N(R)CON(R) 2 , N(R)SO 2 R, N(R)SO
  • substituted as used herein in conjunction with a molecule or an organic group as defined herein refers to the state in which one or more hydrogen atoms contained therein are replaced by one or more non-hydrogen atoms.
  • functional group or “substituent” as used herein refers to a group that can be or is substituted onto a molecule or onto an organic group.
  • substituents or functional groups include, but are not limited to, a halogen (e.g, F, Cl, Br, and I); an oxygen atom in groups such as hydroxy groups, alkoxy groups, aryloxy groups, aralkyloxy groups, oxo(carbonyl) groups, carboxyl groups including carboxylic acids, carboxylates, and carboxylate esters; a sulfur atom in groups such as thiol groups, alkyl and aryl sulfide groups, sulfoxide groups, sulfone groups, sulfonyl groups, and sulfonamide groups; a nitrogen atom in groups such as amines, hydroxyamines, nitriles, nitro groups, N-oxides, hydrazides, azides, and enamines; and other heteroatoms in various other groups.
  • a halogen e.g, F, Cl, Br, and I
  • an oxygen atom in groups such as hydroxy groups, alkoxy
  • Non-limiting examples of substituents that can be bonded to a substituted carbon (or other) atom include F, Cl, Br, I, OR, OC(O)N(R) 2 , CN, NO, NO 2 , ONO 2 , azido, CF3, OCF3, R, O (oxo), S (thiono), C(O), S(O), methylenedioxy, ethylenedioxy, N(R) 2 , SR, SOR, SO 2 R, SO 2 N(R) 2 , SO3R, C(O)R, C(O)C(O)R, C(O)CH 2 C(O)R, C(S)R, C(O)OR, OC(O)R, C(O)N(R) 2 , OC(O)N(R) 2 , C(S)N(R) 2 , (CH 2 )O-
  • alkyl refers to straight chain and branched alkyl groups and cycloalkyl groups having from 1 to 40 carbon atoms, 1 to about 20 carbon atoms, 1 to 12 carbons or, in some embodiments, from 1 to 8 carbon atoms.
  • straight chain alkyl groups include those with from 1 to 8 carbon atoms such as methyl, ethyl, n-propyl, n- butyl, n-pentyl, n-hexyl, n-heptyl, and n-octyl groups.
  • branched alkyd groups include, but are not limited to, isopropyl, iso-butyl, sec-butyl, t-butyl, neopentyl, isopentyl, and 2,2-dimethylpropyl groups.
  • alkyl encompasses n-alkyl, isoalkyl, and anteisoalkyl groups as well as other branched chain forms of alkyl.
  • Representative substituted alkyl groups can be substituted one or more times with any of the groups listed herein, for example, amino, hydroxy, cyano, carboxy, nitro, thio, alkoxy, and halogen groups.
  • alkenyl refers to straight and branched chain and cyclic alkyl groups as defined herein, except that at least one double bond exists between two carbon atoms.
  • alkenyl groups have from 2 to 40 carbon atoms, or 2 to about 20 carbon atoms, or 2 to 12 carbon atoms or, in some embodiments, from 2 to 8 carbon atoms.
  • alkynyl refers to straight and branched chain alkyl groups, except that at least one triple bond exists between two carbon atoms.
  • acyl refers to a group containing a carbonyl moiety wherein the group is bonded via the carbonyl carbon atom.
  • the carbonyl carbon atom is bonded to a
  • SUBSTITUTE SHEET (RULE 26) hydrogen forming a "formyl" group or is bonded to another carbon atom, which can be part of an alkyl, aryl, aralkyl cycloalkyl, cycloalkylalkyl, heterocyclyl, heterocyclylalkyl, heteroaryl, heteroarylalkyl group or the like.
  • An acyl group can include 0 to about 12, 0 to about 20, or 0 to about 40 additional carbon atoms bonded to the carbonyl group.
  • An acyl group can include double or triple bonds within the meaning herein.
  • An acryloyl group is an example of an acyl group.
  • An acyl group can also include heteroatoms within the meaning herein.
  • a nicotinoyl group (pyridyl-3-carbonyl) is an example of an acyl group within the meaning herein.
  • Other examples include acetyl, benzoyl, phenylacetyl, pyridylacetyl, cinnamoyl, and acryloyl groups and the like.
  • the group containing the carbon atom that is bonded to the carbonyl carbon atom contains a halogen
  • the group is termed a "haloacyl” group.
  • An example is a trifluoroacety l group.
  • cycloalky l refers to cyclic alkyd groups such as, but not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl groups.
  • the cycloalky l group can have 3 to about 8-12 ring members, whereas in other embodiments the number of ring carbon atoms range from 3 to 4, 5, 6, or 7.
  • Cycloalkyl groups further include polycyclic cycloalkyl groups such as, but not limited to, norbomyl, adamantyl, bomyl, camphenyl, isocamphenyl, and carenyl groups, and fused rings such as, but not limited to, decalinyl, and the like. Cycloalkyl groups also include rings that are substituted with straight or branched chain alkyl groups as defined herein.
  • Representative substituted cycloalkyl groups can be mono-substituted or substituted more than once, such as, but not limited to, 2,2-, 2,3-, 2,4- 2,5- or 2,6-disubstituted cyclohexyl groups or mono-, di- or tri-substituted norbomyl or cycloheptyl groups, which can be substituted with, for example, amino, hydroxy, cyano, carboxy, nitro, thio, alkoxy, and halogen groups.
  • cycloalkenyl alone or in combination denotes a cyclic alkenyl group.
  • aryl refers to cyclic aromatic hydrocarbon groups that do not contain heteroatoms in the ring.
  • aryl groups include, but are not limited to, phenyl, azulenyl, heptalenyl, biphenyl, indacenyl, fluorenyl, phenanthrenyl, triphenylenyl, pyrenyl, naphthacenyl, chrysenyl, biphenylenyl, anthracenyl, and naphthyl groups.
  • aryl groups contain about 6 to about 14 carbons in the ring portions of the groups.
  • Aryl groups can be unsubstituted or substituted, as defined herein.
  • Representative substituted ary l groups can be mono-substituted or substituted more than once, such as, but not limited to, a phenyl group substituted at any one or more of 2-, 3-, 4-, 5-, or 6-positions of the phenyl ring, or a naphthyl group substituted at any one or more of 2- to 8-positions thereof.
  • aralkyl refers to alkyl groups as defined herein in which a hydrogen or carbon bond of an alky l group is replaced with a bond to an aryl group as defined herein.
  • Representative aralkyl groups include benzyl and phenylethyl groups and fused (cycloalkylaryl)alkyl groups such as 4-ethyl-indanyl.
  • Aralkenyl groups are alkenyl groups as defined herein in which a hydrogen or carbon bond of an alkyl group is replaced with a bond to an aryl group as defined herein.
  • heterocyclyl refers to aromatic and non-aromatic ring compounds containing three or more ring members, of which one or more is a heteroatom such as, but not limited to, N, 0, and S.
  • a heterocyclyl can be a cycloheteroalkyl, or a heteroaryl, or if polycyclic, any combination thereof.
  • heterocyclyl groups include 3 to about 20 ring members, whereas other such groups have 3 to about 15 ring members.
  • a heterocyclyl group designated as a C2-heterocyclyl can be a 5-ring with two carbon atoms and three heteroatoms, a 6-ring with two carbon atoms and four heteroatoms and so forth.
  • a C4-heterocyclyl can be a 5-ring with one heteroatom, a 6-ring with two heteroatoms, and so forth. The number of carbon atoms plus the number of heteroatoms equals the total number of ring atoms.
  • a heterocyclyl ring can also include one or more double bonds.
  • a heteroaryl ring is an embodiment of a heterocyclyl group.
  • the phrase "heterocyclyl group" includes fused ring species including those that include fused aromatic and non-aromatic groups. For example, a dioxolanyl ring and a benzdioxolanyl ring system (methylenedioxyphenyl ring system) are both heterocyclyl groups within the meaning herein.
  • the phrase also includes polycyclic ring systems containing a heteroatom such as, but not limited to, quinuclidyl. Heterocyclyl groups can be unsubstituted, or can be substituted as discussed herein.
  • Heterocyclyl groups include, but are not limited to, pyrrolidinyl, piperidinyl, piperazinyl, morpholinyl, pyrrolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, thiazolyl, pyridinyl, thiophenyl, benzothiophenyl, benzofuranyl, dihydrobenzofuranyl, indolyl, dihydroindolyl, azaindolyl, indazolyl, benzimidazolyl, azabenzimidazolyl, benzoxazolyl, benzothiazolyl, benzothiadiazolyl, imidazopyridinyl, isoxazolopyridinyl, thianaphthalenyl, purinyl, xanthinyl, adeninyl, guaninyl, quinolinyl, isoquino
  • SUBSTITUTE SHEET (RULE 26) as, but not limited to, piperidinyl or quinolinyl groups, which are 2-, 3-, 4-, 5-, or 6- substituted, or disubstituted with groups such as those listed herein.
  • heteroaryl refers to aromatic ring compounds containing 5 or more ring members, of which, one or more is a heteroatom such as, but not limited to, N, 0, and S; for instance, heteroaryl rings can have 5 to about 8-12 ring members.
  • a heteroaryl group is a variety of a heterocyclyl group that possesses an aromatic electronic structure.
  • a heteroaryl group designated as a C2-heteroaryl can be a 5-ring with two carbon atoms and three heteroatoms, a 6-ring with two carbon atoms and four heteroatoms and so forth.
  • a C4-heteroaryl can be a 5-ring with one heteroatom, a 6-ring with two heteroatoms, and so forth.
  • a heterocyclyl ring designated Cx-y can be any ring containing 'x' members up to 'y' members, including all intermediate integers between 'x' and 'y ' and that contains one or more heteroatoms, as defined herein. In a ring designated Cx-y, all non-heteroatom members are carbon. Heterocyclyl rings designated Cx-y can also be polycyclic ring systems, such as bicyclic or tricyclic ring systems.
  • Heteroaryl groups include, but are not limited to, groups such as pyrrolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, thiazolyl, pyridinyl, thiophenyl, benzothiophenyl, benzofuranyl, indolyl, azaindolyl, indazolyl, benzimidazolyl, azabenzimidazolyl, benzoxazolyl, benzothiazolyl, benzothiadiazolyl, imidazopyridinyl, isoxazolopyridinyl, thianaphthalenyl, purinyl, xanthinyl, adeninyl, guaninyl, quinolinyl, isoquinolinyl, tetrahydroquinolinyl, quinoxalinyl, and quinazolinyl groups. Heteroaryl groups can be
  • aryl and heteroaryl groups include but are not limited to phenyl, biphenyl, indenyl, naphthyl (1 -naphthyl, 2-naphthyl), N-hydroxytetrazolyl, N- hydroxytnazolyl, N-hydroxyimidazolyl, anthracenyl (1-anthracenyl, 2-anthracenyl, 3- anthracenyl), thiophenyl (2 -thienyl, 3-thienyl), furyl (2 -furyl, 3-furyl) , indolyl, oxadiazolyl, isoxazolyl, quinazolinyl, fluorenyl, xanthenyl, isoindanyl, benzhydryl, acridinyl, thiazolyl, pyrrolyl (2-pyrrolyl), pyrazolyl (3-pyrazolyl), imidazolyl (1 -imid
  • heterocyclylalkyl refers to alkyl groups as defined herein in which a hydrogen or carbon bond of an alkyl group as defined herein is replaced with a bond to a heterocyclyl group as defined herein.
  • Representative heterocyclyl alkyl groups include, but are not limited to, furan-2-yl methyl, furan-3-yl methyl, pyridine-3-yl methyl, tetrahydrofuran-2-yl ethyl, and indol-2-yl propyl.
  • heteroarylalkyl refers to alkyd groups as defined herein in which a hydrogen or carbon bond of an alkyl group is replaced with a bond to a heteroaryl group as defined herein.
  • alkoxy refers to an oxygen atom connected to an alkyl group, including a cycloalkyl group, as are defined herein.
  • linear alkoxy groups include but are not limited to methoxy, ethoxy, propoxy, butoxy, pentyloxy, hexyloxy, and
  • SUBSTITUTE SHEET (RULE 26) the like.
  • branched alkoxy include but are not limited to isopropoxy, sec-butoxy, tert-butoxy, isopentyloxy, isohexyloxy, and the like.
  • cyclic alkoxy include but are not limited to cyclopropyloxy, cyclobutyloxy, cyclopentyloxy, cyclohexyloxy, and the like.
  • An alkoxy group can include about 1 to about 12, about 1 to about 20, or about 1 to about 40 carbon atoms bonded to the oxygen atom, and can further include double or triple bonds, and can also include heteroatoms.
  • an allyloxy group or a methoxyethoxy group is also an alkoxy group within the meaning herein, as is a methylenedi oxy group in a context where two adjacent atoms of a structure are substituted therewith.
  • amine refers to primary, secondary, and tertiary amines having, e.g, the formula N(group)s wherein each group can independently be H or non-H, such as alkyl, aryl, and the like.
  • Amines include but are not limited to R-NH2, for example, alkylamines, arylamines, alkylarylamines; R2NH wherein each R is independently selected, such as dialkylamines, diarylamines, aralkylamines, heterocyclylamines and the like; and R3N wherein each R is independently selected, such as trialkylamines, dialkylarylamines, alkyldiarylamines, triarylamines, and the like.
  • the term "amine” also includes ammonium ions as used herein.
  • amino group refers to a substituent of the form -NH2, - NHR, -NR2, -NR 3 + , wherein each R is independently selected, and protonated forms of each, except for -NR3 + , which cannot be protonated. Accordingly, any compound substituted with an ammo group can be viewed as an amine.
  • An “amino group” within the meaning herein can be a primary, secondary', tertiary, or quaternary amino group.
  • alkylamino includes a monoalkylamino, dialkylammo, and trialkylamino group.
  • halo means, unless otherwise stated, a fluorine, chlorine, bromine, or iodine atom.
  • haloalkyl group includes mono-halo alkyl groups, polyhalo alkyl groups wherein all halo atoms can be the same or different, and per-halo alky l groups, wherein all hydrogen atoms are replaced by halogen atoms, such as fluoro.
  • haloalkyl include trifluoromethyl, 1,1 -dichloroethyl, 1,2-di chloroethyl, l,3-dibromo-3,3- difluoropropyl, perfluorobutyl, and the like.
  • epoxy-functional or "epoxy-substituted” as used herein refers to a functional group in which an oxygen atom, the epoxy substituent, is directly attached to two adjacent carbon atoms of a carbon chain or ring system. Examples of epoxy-substituted
  • SUBSTITUTE SHEET (RULE 26) functional groups include, but are not limited to, 2,3 -epoxy propyl, 3 ,4-epox buty 1, 4,5- epoxypentyl, 2,3-epoxypropoxy, epoxypropoxypropyl, 2-glycidoxyethyl, 3-glycidoxypropyl, 4-glycidoxybutyl, 2’(giycidoxycarbonyl)propyl, 3-(3,4-epoxycylohexyl)propyl, 2-(3 ,4- epoxy cyclohexyl)ethyl, 2-(2,3-epoxycylopentyl)ethyl, 2-(4-methyl-3,4- epoxycyclohexyl propyl, 2-(3,4-epoxy-3-methylcylohexyl)-2-methylethyl, and 5,6- epoxy hexyl.
  • monovalent refers to a substituent connecting via a single bond to a substituted molecule.
  • a substituent is monovalent, such as, for example, F or Cl, it is bonded to the atom it is substituting by a single bond.
  • hydrocarbon or “hydrocarbyl” as used herein refers to a molecule or functional group that includes carbon and hydrogen atoms.
  • the term can also refer to a molecule or functional group that normally includes both carbon and hydrogen atoms but wherein all the hydrogen atoms are substituted with other functional groups.
  • hydrocarbyl refers to a functional group derived from a straight chain, branched, or cyclic hydrocarbon, and can be alkyl, alkenyl, alkynyl, aryl, cycloalkyl, acyl, or any combination thereof. Hydrocarbyl groups can be shown as (Ca- Cb)hydrocarbyl, wherein a and b are integers and mean having any of a to b number of carbon atoms.
  • (Ci-Ci)hydrocarbyl means the hydrocarbyl group can be methyl (Ci), ethyl (C2), propyl (C3), or butyl (C4), and (Co-Cb)hydrocarbyl means in certain embodiments there is no hydrocarbyl group.
  • solvent refers to a liquid that can dissolve a solid, liquid, or gas.
  • solvents are silicones, organic compounds, water, alcohols, ionic liquids, and supercritical fluids.
  • X 1 , X 2 , and X 3 are independently selected from noble gases” would include the scenario where, for example, X 1 , X 2 , and X 3 are all the same, where X 1 , X 2 , and X 3 are all different, where X 1 and X 2 are the same but X 3 is different, and other analogous permutations.
  • room temperature refers to a temperature of about 15 °C to 28 °C.
  • standard temperature and pressure refers to 20 °C and 101 kPa.
  • composition refers to a mixture of at least one compound described herein with a pharmaceutically acceptable carrier.
  • the pharmaceutical composition facilitates administration of the compound to a patient or subject. Multiple techniques of administering a compound exist in the art including, but not limited to, intravenous, oral, aerosol, parenteral, ophthalmic, pulmonary and topical administration.
  • a “disease” is a state of health of an animal wherein the animal cannot maintain homeostasis, and wherein if the disease is not ameliorated then the animal's health continues to deteriorate.
  • a disorder in an animal is a state of health in which the animal is able to maintain homeostasis, but in which the animal's state of health is less favorable than it would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the animal's state of health.
  • the terms "effective amount,” “pharmaceutically effective amount” and “therapeutically effective amount” refer to a nontoxic but sufficient amount of an agent to provide the desired biological result. That result may be reduction and/or alleviation of the signs, symptoms, or causes of a disease, or any other desired alteration of a biological system. An appropriate therapeutic amount in any individual case may be determined by one of ordinary skill in the art using routine experimentation.
  • the term “efficacy” refers to the maximal effect (Emax) achieved within an assay.
  • the term "pharmaceutically acceptable” refers to a material, such as a carrier or diluent, which does not abrogate the biological activity or properties of the compound, and is relatively non-toxic, z.e., the material may be administered to an individual without causing undesirable biological effects or interacting in a deleterious manner with any of the components of the composition in which it is contained.
  • pharmaceutically acceptable salt refers to a salt of the administered compounds prepared from pharmaceutically acceptable non-toxic acids or bases, including inorganic acids or bases, organic acids or bases, solvates, hydrates, or clathrates thereof.
  • Suitable pharmaceutically acceptable acid addition salts may be prepared from an inorganic acid or from an organic acid.
  • inorganic acids include hydrochloric, hydrobromic, hydriodic, nitric, carbonic, sulfuric (including sulfate and hydrogen sulfate), and phosphoric acids (including hydrogen phosphate and dihydrogen phosphate).
  • organic acids may be selected from aliphatic, cycloaliphatic, aromatic, araliphatic, heterocyclic, carboxylic and sulfonic classes of organic acids, examples of which include formic, acetic, propionic, succinic, glycolic, gluconic, lactic, malic, tartaric, citric, ascorbic, glucuronic, maleic, malonic, saccharin, fumaric, pyruvic, aspartic, glutamic, benzoic, anthranilic, 4-hydroxybenzoic, phenylacetic, mandelic, embonic (pamoic), methanesulfonic, ethanesulfonic, benzenesulfonic, pantothenic, trifluoromethanesulfonic, 2- hydroxyethanesulfonic, p-toluenesulfonic, sulfanilic, cyclohexylaminosulf
  • Suitable pharmaceutically acceptable base addition salts of compounds described herein include, for example, ammonium salts, metallic salts including alkali metal, alkaline earth metal and transition metal salts such as, for example, calcium, magnesium, potassium, sodium and zinc salts.
  • Pharmaceutically acceptable base addition salts also include organic salts made from basic amines such as, for example, N,N'-dibenzylethylene-diamine, chloroprocaine, choline, diethanolamine, ethylenediamine, meglumine (N-methylglucamine) and procaine. All of these salts may be prepared from the corresponding compound by reacting, for example, the appropriate acid or base with the compound.
  • the term "pharmaceutically acceptable earner” or “pharmaceutically acceptable excipient” means a pharmaceutically acceptable material, composition or carrier, such as a liquid or solid filler, stabilizer, dispersing agent, suspending agent, diluent, excipient, thickening agent, solvent or encapsulating material, involved in carrying or transporting a compound described herein within or to the patient such that it may perform its intended function.
  • a pharmaceutically acceptable material, composition or carrier such as a liquid or solid filler, stabilizer, dispersing agent, suspending agent, diluent, excipient, thickening agent, solvent or encapsulating material, involved in carrying or transporting a compound described herein within or to the patient such that it may perform its intended function.
  • Such constructs are carried or transported from one organ, or portion of the body, to another organ, or portion of the body.
  • Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation, including the compound(s) described herein, and not in
  • materials that may serve as pharmaceutically acceptable carriers include: sugars, such as lactose, glucose and sucrose; starches, such as com starch and potato starch; cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients, such as cocoa butter and suppository waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, com oil and soybean oil; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents, such as magnesium hydroxide and aluminum hydroxide; surface active agents; alginic acid; pyrogen-free water; isotonic s
  • pharmaceutically acceptable carrier also includes any and all coatings, antibacterial and antifungal agents, and absorption delaying agents, and the like that are compatible with the activity of the compound(s) described herein, and are physiologically acceptable to the patient. Supplementary active compounds may also be incorporated into the compositions.
  • pharmaceutically acceptable carrier may further include a pharmaceutically acceptable salt of the compound(s) described herein.
  • patient refers to any animal, or cells thereof whether in vitro or in situ, amenable to the methods described herein.
  • the patient, subject or individual is a human.
  • the term “potency” refers to the dose needed to produce half the maximal response (ED50).
  • a “therapeutic” treatment is a treatment administered to a subject who exhibits signs of pathology, for the purpose of diminishing or eliminating those signs.
  • treatment is defined as the application or administration of a therapeutic agent, i.e., a compound or compounds as described herein (alone or in combination with another pharmaceutical agent), to a patient, or application or administration of a therapeutic agent to an isolated tissue or cell line from a patient (e.g, for diagnosis or ex vivo applications), who has a condition contemplated herein or a symptom of a condition contemplated herein, with the purpose to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve or affect a condition contemplated herein, or the symptoms of a condition contemplated herein.
  • Such treatments may be specifically tailored or modified, based on knowledge obtained from the field of pharmacogenomics.
  • R 1 and R 2 combine with the N atom to which they are bound so as to form a 5 or 6-membered heterocycle
  • R 3 and R 4 combine with the N atom to which they are bound so as to form a 5 or 6-membered heterocycle
  • R 5 is selected from the group consisting of hydrogen, 1-10 amino acids, C1-20 alkyl, and R c ; each occurrence of R a , R b , and R c is independently selected from the group consisting of hydrogen, C1-10 alkyl, C2-10 alkenyl, C2-10 alkynyl, Ce-io aryl, and C5-10 heteroaryl, and combinations thereof; each occurrence of R 1 and R" is independently selected from the group consisting of hydrogen, C1-10 alkyd, C 2 -io alkenyl, C 2 -io alkynyl, Ce-io aryl, C5-10 heteroaryl, halogen, OH, CN, Ci-10 alkoxy, and combinations thereof.
  • a compound of Formula lb is provided:
  • R 1 and R 2 or R 3 and R 4 join together to form a tetrahydrothiadiazine-2-thione of Formula Ila or lib:
  • amino acids can be any combination of amino acids Ala, Arg, Asn, Asp, Cys, Glu, Gin, Gly, His, He, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Vai.
  • Formula I refers to a compound of Formula la, a compound of Formula lb, and/or mixtures thereof in any proportion.
  • Formula II refers to a compound of Formula Ila, a compound of Formula lib, and/or mixtures thereof in any proportion.
  • Formula II is a hydrochloride salt.
  • the compound of Formula I or Formula II is a salt of an acidic amino acid, such as an Asp or Glu salt.
  • R 1 , R 2 , R 3 , R 4 , and R 5 are hydrogen.
  • the compound of Formula I has the structure:
  • SUBSTITUTE SHEET (RULE 26)
  • the compounds described herein can possess one or more stereocenters, and each stereocenter can exist independently in either the (R) or ( ⁇ S) configuration.
  • compounds described herein are present in optically active or racemic forms. It is to be understood that the compounds described herein encompass racemic, optically - active, regioisomeric and stereoisomeric forms, or combinations thereof that possess the therapeutically useful properties described herein. Preparation of optically active forms is achieved in any suitable manner, including by way of non-limiting example, by resolution of the racemic form with recrystallization techniques, synthesis from optically-active starting materials, chiral synthesis, or chromatographic separation using a chiral stationary phase.
  • a mixture of one or more isomer is utilized as the therapeutic compound described herein.
  • compounds described herein contain one or more chiral centers. These compounds are prepared by any means, including stereoselective synthesis, enantioselective synthesis and/or separation of a mixture of enantiomers and/ or diastereomers. Resolution of compounds and isomers thereof is achieved by any means including, by way of non-limiting example, chemical processes, enzymatic processes, fractional crystallization, distillation, and chromatography.
  • the methods and formulations described herein include the use of N-oxides (if appropriate), crystalline forms (also known as polymorphs), solvates, amorphous phases, and/or pharmaceutically acceptable salts of compounds having the structure of any compound(s) described herein, as well as metabolites and active metabolites of these compounds having the same type of activity.
  • Solvates include water, ether (e.g, tetrahydrofuran, methyl tert-butyl ether) or alcohol (e.g, ethanol) solvates, acetates and the like.
  • the compounds described herein exist in solvated forms with pharmaceutically acceptable solvents such as water, and ethanol. In other embodiments, the compounds described herein exist in unsolvated form.
  • the compound(s) described herein can exist as tautomers. All tautomers are included within the scope of the compounds presented herein.
  • prodrugs refers to an agent that is converted into the parent drug in vivo.
  • a prodrug upon in vivo administration, a prodrug is chemically converted to the biologically, pharmaceutically or therapeutically active form of the compound.
  • a prodrug is enzymatically metabolized by one or more steps or processes to the biologically, pharmaceutically or therapeutically active form of the compound.
  • sites on, for example, the aromatic ring portion of compound(s) described herein are susceptible to various metabolic reactions. Incorporation of appropriate substituents on the aromatic ring structures may reduce, minimize or eliminate this metabolic pathway. In certain embodiments, the appropriate substituent to decrease or eliminate the susceptibility of the aromatic ring to metabolic reactions is, by way of example only, a deuterium, a halogen, or an alkyl group.
  • Compounds described herein also include isotopically -labeled compounds wherein one or more atoms is replaced by an atom having the same atomic number, but an atomic mass or mass number different from the atomic mass or mass number usually found in nature.
  • isotopes suitable for inclusion in the compounds described herein include and are not limited to 2 H, 3 H, n C, 13 C, 14 C, 36 C1, 18 F, 123 1, 125 I, 13 N, 15 N, 15 O, 17 0, 18 0, 32 P, and 35 S.
  • isotopically -labeled compounds are useful in drug and/or substrate tissue distribution studies.
  • substitution with heavier isotopes such as deuterium affords greater metabolic stability (for example, increased in vivo half-life or reduced dosage requirements).
  • substitution with positron emitting isotopes, such as n C, 18 F, 15 O and 13 N is useful in Positron Emission Topography (PET) studies for examining substrate receptor occupancy.
  • Isotopically-labeled compounds are prepared by any suitable method or by processes using an appropriate isotopically-labeled reagent in place of the non-labeled reagent otherwise employed.
  • the compounds described herein are labeled by other means, including, but not limited to, the use of chromophores or fluorescent moieties, bioluminescent labels, or chemiluminescent labels.
  • reactive functional groups such as hydroxyl, amino, imino, thio or carboxy groups
  • Protecting groups are used to block some or all of the reactive moieties and prevent such groups from participating in chemical reactions until the protective group is removed.
  • each protective group is removable by a different means.
  • Protective groups that are cleaved under totally disparate reaction conditions fulfill the requirement of differential removal.
  • protective groups are removed by acid, base, reducing conditions (such as, for example, hydrogenolysis), and/or oxidative conditions.
  • reducing conditions such as, for example, hydrogenolysis
  • oxidative conditions such as, for example, hydrogenolysis
  • Groups such as trityl, dimethoxytrityl, acetal and t-butyldimethylsilyl are acid labile and are used to protect carboxy and hydroxy reactive moieties in the presence of amino groups protected with Cbz groups, which are removable by hydrogenolysis, and Fmoc groups, which are base labile.
  • Carboxylic acid and hydroxy reactive moieties are blocked with base labile groups such as, but not limited to, methyl, ethyl, and acetyl, in the presence of amines that are blocked with acid labile groups, such as t-butyl carbamate, or with carbamates that are both acid and base stable but hydrolytically removable.
  • base labile groups such as, but not limited to, methyl, ethyl, and acetyl
  • carboxylic acid and hydroxy reactive moieties are blocked with hydrolytically removable protective groups such as the benzyl group, while amine groups capable of hydrogen bonding with acids are blocked with base labile groups such as Fmoc.
  • Carboxylic acid reactive moieties are protected by conversion to simple ester compounds as exemplified herein, which include conversion to alkyl esters, or are blocked with oxidatively-removable protective groups such as 2,4-dimethoxybenzyl, while coexisting amino groups are blocked with fluoride labile silyl carbamates.
  • Allyl blocking groups are useful in the presence of acid- and base- protecting groups since the former are stable and are subsequently removed by metal or pi-acid catalysts.
  • an allyl-blocked carboxylic acid is deprotected with a palladium-catalyzed reaction in the presence of acid labile t-butyl carbamate or base-labile acetate amine protecting groups.
  • Yet another form of protecting group is a resin to which a compound or intermediate is attached. As long as the residue is attached to the resin, that functional group is blocked and does not react. Once released from the resin, the functional group is available to react.
  • blocking/protecting groups may be selected from:
  • compositions containing the compound(s) described herein include a pharmaceutical composition comprising at least one compound as described herein and at least one pharmaceutically acceptable carrier.
  • the composition is formulated for an administration route such as oral or parenteral, for example, transdermal, transmucosal (e.g, sublingual, lingual, (trans)buccal, (trans)urethral, vaginal (e.g., trans- and perivaginally), (intra)nasal and (trans)rectal, intravesical, intrapulmonary, intraduodenal, intragastrical, intrathecal, subcutaneous, intramuscular, intradermal, intra-arterial, intravenous, intrabronchial, inhalation, and topical administration.
  • the disclosure includes a method of treating, ameliorating, and/or preventing an inflammatory disease, inflammatory disorder, or inflammation in a subject using the compounds of Formula I or Formula II.
  • inflammatory diseases or disorders include arthritis juvenile arthritis, spondylitis, leprosy, Crohn's disease, ulcerative colitis, inflammatory bowel syndrome, and/or Rh factor arthritis.
  • SUBSTITUTE SHEET (RULE 26) ameliorating, and/or preventing an inflammatory disease, inflammatory disorder, or inflammation includes administering to the subject a therapeutically effective amount of a compound of Formula I or Formula II.
  • the disclosure also includes a method of improving the efficacy of antibacterial agents or improving the ability of a subject to fight off a bacterial infection.
  • the method includes administering to the subject a therapeutically effective amount of a compound of Formula I or Formula II.
  • the compounds of Formula I or Formula II are optionally administered with an additional agent that is useful for treating, ameliorating, or preventing an inflammatory disease, inflammatory disorder, or inflammation in a subject.
  • additional agents include steroids and/or NSAIDs (non-steroidal anti-inflammatory drugs).
  • steroids include corticosteroids such as triamcinolone, cortisone, prednisone, methylprednisolone, and the like.
  • Non-liming examples of NSAIDs include aspirin, celecoxib, diclofenac, diflunisal, etodolac, fenoprofen, flurbiprofen, ibuprofen, naproxen, and the like.
  • the additional anti-inflammatory agents can be administered sequentially or concurrently with the compounds of Formula I or Formula II.
  • the compounds of Formula I or Formula II are optionally administered with an additional agent that is an antibacterial agent.
  • an antibacterial agent can be used, including but not limited to penicillins, tetracyclines, cephalosporins, quinolones, lincomycins, macrolides, sulfonamides, glycopeptides, aminoglycosides, carbapenems, and the like.
  • LACC1 laccase domain-containing 1 protein
  • LACC1 serves a central regulatory role in a variety of inflammatory diseases and is expressed predominantly in myeloid cells.
  • LACC1 also known as C13orf31 or FAMIN, is robustly activated by lipopolysaccharide (LPS) or poly-I:C in mouse bone marrow derived macrophages (BMDMs). Consistent with LACC1 activity in inflammatory Ml macrophages, its expression is induced by macrophage colonystimulating factor (M-CSF) in an AKT-mTOR-dependent manner during human monocytemacrophage differentiation.
  • LPS lipopolysaccharide
  • BMDMs mouse bone marrow derived macrophages
  • Frame-shift mutations and single-nucleotide polymorphisms K38E, 1254 and C284R in LACC1 identified in genome-wide association studies (GWAS) are correlated with early-onset Crohn’s disease (CD), ankylosing spondylitis, systemic juvenile idiopathic arthritis (JIA), and a high-risk state for leprosy (Mycobacterium leprae infections).
  • Mouse models deficient in LACC1 showed exacerbated arthritis, psoriasis, T cell transfer colitis (Rag2' /_ background), and intestinal bacterial infection (Citrobacter rodentium and Salmonella enterica serovar Typhimurium).
  • a Laccl''' mouse model was generated and the metabolites extracted from its isolated inflammatory Ml BMDM cells (FIG. 1 A).
  • the LACC1 substrates can accumulate in these cells.
  • the metabolite extract was incubated with mLACCl (1 h; 37°C) in phosphate buffered saline supplemented with Zn 2+ and then analyzed by ultra-performance liquid chromatography quadrupole time-of- flight mass spectrometry (UPLC-QTOF-MS).
  • UPLC-QTOF-MS ultra-performance liquid chromatography quadrupole time-of- flight mass spectrometry
  • L-Om was the most upregulated metabolite among significant hits (FDR ⁇ 0.05) under these conditions (positive ion mode, FIG. IB; negative ion mode, FIG. 5D).
  • L- Om is a product of L-Arg metabolism, which is the major metabolism classification between
  • SUBSTITUTE SHEET (RULE 26) classical and alternatively activated macrophages.
  • L-Arg is metabolized to NO and L-Cit viaNOS2.
  • IL-4 stimulated anti-inflammatory macrophages
  • L-Arg is metabolized to L-Om and urea via arginase.
  • wBMDMs were first culturedfrom WT and LaccL' ⁇ mice and stimulated with lipopolysaccharide (LPS) and interferon-y (IFNy) for 16 hours.
  • LPS lipopolysaccharide
  • IFNy interferon-y
  • cytokines such as TNFa, IL6 and IL12b were upregulated ⁇ n Laccl" BMDMs (FIG. 2A, FIG. 7I-FIG. 7K), further supporting the anti-inflammatory function of LACC1.
  • LPS lipopolysaccharide
  • IFNy interferon-y
  • Laccl C284R/C284R mice showed an intermediate phenotype with exacerbated bacterial infection and more severe bacterial burden (FIG. 7A-FIG. 7E), which was consistent with the Laccl J ⁇ mouse studies and the C284R mutant biochemical studies. Moreover, inflammamtory BMDMs from the Laccl C284R/C284R mice showed an intermediate elevation of TNFa, IL6 and IL12b upon LPS and IFNy stimulation (FIG. 7F-
  • L-Om is decarboxylated by ornithine decarboxylase 1 (ODC1) to produce putrescine for polyamine synthesis. Odel expression is upregulated during bacterial infections.
  • ODC1 ornithine decarboxylase 1
  • L-Met L-methionine
  • AdoMetDC AdoMet decarboxylase
  • dcSAM is then used as an aminopropyl group donor by spermidine synthase (SRM) to convert putrescine into spermidine and spermine synthase (SMS) to convert spermidine into spermine (FIG. 11A).
  • SRM spermidine synthase
  • SMS spermine synthase
  • FIG. 11A To examine the impact of the enzymatic function of LACC1 on poly amine synthesis in BMDMs, BMDMs from WT and /.occ7" mice supplemented with l,2,3,4,5- 13 Cs labeled L- Cit during Ml differentiation were first cultured.
  • LACC1 function can be dependent upon NOS2 as the latter provides the substrate for the former (FIG. 4A).
  • NosZ ⁇ mice were bred with LaccT mice to generate Nos2-Laccl double knockout mice and measured their performance in vivo relative to controls in the S. Typhimurium infection model. It was observed that NOS2 protected mice from 5. Typhimurium infection based on body weight loss, survival, and bacterial burden in feces and invaded organs as anticipated (FIGs. 4B-4G), consistent with
  • LACC1 contributes to anti-inflammatory and antibacterial functions through the L-Om-polyamine immunometabolism signaling axis (FIG. 5).
  • the RCS-like cytotoxin and carbamoylation reagent HNCO likely contributes as an antimicrobial and signaling molecule, but the present evaluation of activities with exogenous OCN supplementation could be masked by the overall effects of cellular ROS, RNS, and RCS in these inflammatory macrophage phenotypes.
  • LACC1 SUBSTITUTE SHEET ( RULE 26) macrophages. While other enzymatic activities of LACC1 may contribute, the present results support a molecular mechanism in which LACC1 is a central immunometabolic regulator in L-Arg macrophage metabolism, and they reveal the missing mechanistic connection between proinflammatory NOS2 signaling and subsequent anti-inflammatory polyamine-mediated cytokine suppression, antioxidant activity, and autophagy stimulation (FIG. 1 IB).
  • polyamines such as spermidine have been reported to: 1) have a role in decreasing oxidative damage, although the mechanism is unclear; 2) stimulate autophagy in mammalian cells; and 3) alleviate experimental autoimmune encephalomyelitis through inducing inhibitory macrophages.
  • M2 anti-inflammatory macrophages poly amine biosynthesis modulates mitochondrial metabolism through eIF5A hypusination, maintaining the TCA cycle and the electron transport chain (ETC) mtegnty.
  • ETC electron transport chain
  • LACC1 serves as an unprecedented endogenous mammalian HNCO synthase, an activity observed for antimicrobial myeloperoxidase only with specific exogenous environmental metabolites from high-fat diet and chronic exposure to cyanide, mimicking exposure to pollution and smoking. While other activities of LACC1 -mediated L- Om and HNCO production in cells cannot be ruled out, the present molecular studies support an alternative immunometabolic proposal for LACC1 in autophagy regulation through its contribution to polyamine synthesis in addition to its reported interaction with autophagyinducing proteins, RACK1 and AMPK. These findings suggest that L-Om could serve as a novel nutraceutical to ameliorate LACC1 -associated immunological and autoimmune dysfunctions.
  • the methods described herein include administering to the subject a therapeutically effective amount of at least one compound described herein, which is optionally formulated in a pharmaceutical composition.
  • a therapeutically effective amount of at least one compound described herein present in a pharmaceutical composition is the only therapeutically active compound in a pharmaceutical composition.
  • the method further comprises administering to the subject an additional therapeutic agent that treats an inflammatory disease.
  • administering the compound(s) described herein to the subject allows for administering a lower dose of the additional therapeutic agent as compared to the dose of the additional therapeutic agent alone that is required to achieve similar results in treating an inflammatory disease in the subject.
  • the compound(s) described herein enhance(s) the activity of the additional therapeutic
  • the compound(s) described herein and the therapeutic agent are co-administered to the subject. In other embodiments, the compound(s) described herein and the therapeutic agent are coformulated and co-administered to the subject.
  • the subject is a mammal. In other embodiments, the mammal is a human.
  • the compounds useful within the methods described herein can be used in combination with one or more additional therapeutic agents useful for treating, ameliorating, and/or preventing an inflammatory disease.
  • additional therapeutic agents may comprise compounds that are commercially available or synthetically accessible to those skilled in the art. These additional therapeutic agents are known to treat or reduce the symptoms of an inflammatory disease.
  • a synergistic effect is observed when a compound as described herein is administered with one or more additional therapeutic agents or compounds.
  • a synergistic effect may be calculated, for example, using suitable methods such as, for example, the Sigmoid-Emax equation (Holford & Scheiner, 1981, Clin. Pharmacokinet. 6:429-453), the equation of Loewe additivity (Loewe & Muischnek, 1926, Arch. Exp. Pathol Pharmacol. 114:313-326) and the median-effect equation (Chou & Talalay, 1984, Adv. Enzyme Regul. 22:27-55).
  • Each equation referred to above may be applied to experimental data to generate a corresponding graph to aid in assessing the effects of the drug combination.
  • the corresponding graphs associated with the equations referred to above are the concentration-effect curve, isobologram curve and combination index curve, respectively.
  • the regimen of administration may affect what constitutes an effective amount.
  • the therapeutic formulations may be administered to the subject either prior to or after the onset of an inflammatory disease. Further, several divided dosages, as well as staggered dosages may be administered daily or sequentially, or the dose may be continuously infused, or maybe a bolus injection. Further, the dosages of the therapeutic formulations may be proportionally increased or decreased as indicated by the exigencies of the therapeutic or prophylactic situation.
  • compositions described herein may be carried out using known procedures, at dosages and for periods of time effective to treat an inflammatory disease in the patient.
  • An effective amount of the therapeutic compound necessary to achieve a therapeutic effect may vary according to factors such as the state of the disease or disorder in the patient; the age, sex, and weight of the patient; and the ability of the therapeutic compound to treat an inflammatory disease in the patient.
  • Dosage regimens may be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation.
  • a nonlimiting example of an effective dose range for a therapeutic compound described herein is from about 1 and 5,000 mg/kg of body weight/per day.
  • One of ordinary skill in the art would be able to study the relevant factors and make the determination regarding the effective amount of the therapeutic compound without undue experimentation.
  • Actual dosage levels of the active ingredients in the pharmaceutical compositions described herein may be varied so as to obtain an amount of the active ingredient that is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient.
  • the selected dosage level depends upon a variety of factors including the activity of the particular compound employed, the time of administration, the rate of excretion of the compound, the duration of the treatment, other drugs, compounds or materials used in combination with the compound, the age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well, known in the medical arts.
  • a medical doctor e.g, physician or veterinarian, having ordinary skill in the art may readily determine and prescribe the effective amount of the pharmaceutical composition required.
  • physician or veterinarian could start doses of the compounds described herein employed in the pharmaceutical composition at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved.
  • Dosage unit form refers to physically discrete units suited as unitary dosages for the patients to be treated; each unit containing a predetermined quantity of therapeutic compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical vehicle.
  • SUBSTITUTE SHEET (RULE 26)
  • the dosage unit forms of the compound(s) described herein are dictated by and directly dependent on (a) the unique characteristics of the therapeutic compound and the particular therapeutic effect to be achieved, and (b) the limitations inherent in the art of compounding/formulating such a therapeutic compound.
  • compositions described herein are formulated using one or more pharmaceutically acceptable excipients or carriers.
  • pharmaceutical compositions described herein comprise a therapeutically effective amount of a compound described herein and a pharmaceutically acceptable carrier.
  • the carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils.
  • the proper fluidity may be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • Prevention of the action of microorganisms may be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like.
  • isotonic agents for example, sugars, sodium chloride, or polyalcohols such as mannitol and sorbitol, in the composition.
  • Prolonged absorption of the injectable compositions may be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate or gelatin.
  • compositions described herein are administered to the patient in dosages that range from one to five times per day or more. In other embodiments, the compositions described herein are administered to the patient in range of dosages that include, but are not limited to, once every day, every two, days, every three days to once a week, and once every two weeks. It is readily apparent to one skilled in the art that the frequency of administration of the various combination compositions described herein varies from individual to individual depending on many factors including, but not limited to, age, disease or disorder to be treated, gender, overall health, and other factors. Thus, administration of the compounds and compositions described herein should not be construed to be limited to any particular dosage regime and the precise dosage and composition to be administered to any patient is determined by the attending physician taking all other factors about the patient into account.
  • the compound(s) described herein for administration may be in the range of from about 1 pg to about 10,000 mg, about 20 pg to about 9,500 mg, about 40 pg to about 9,000 mg, about 75 pg to about 8,500 mg, about 150 pg to about 7,500 mg, about 200 pg to about
  • SUBSTITUTE SHEET (RULE 26) 7,000 mg, about 350 pg to about 6,000 mg, about 500 ig to about 5,000 mg, about 750 pig to about 4,000 mg, about 1 mg to about 3,000 mg, about 10 mg to about 2,500 mg, about 20 mg to about 2,000 mg, about 25 mg to about 1,500 mg, about 30 mg to about 1,000 mg, about 40 mg to about 900 mg, about 50 mg to about 800 mg, about 60 mg to about 750 mg, about 70 mg to about 600 mg, about 80 mg to about 500 mg, and any and all whole or partial increments therebetween.
  • the dose of a compound described herein is from about 1 mg and about 2,500 mg. In some embodiments, a dose of a compound described herein used in compositions described herein is less than about 10,000 mg, or less than about 8,000 mg, or less than about 6,000 mg, or less than about 5,000 mg, or less than about 3,000 mg, or less than about 2,000 mg, or less than about 1,000 mg, or less than about 500 mg, or less than about 200 mg, or less than about 50 mg.
  • a dose of a second compound as described herein is less than about 1,000 mg, or less than about 800 mg, or less than about 600 mg, or less than about 500 mg, or less than about 400 mg, or less than about 300 mg, or less than about 200 mg, or less than about 100 mg, or less than about 50 mg, or less than about 40 mg, or less than about 30 mg, or less than about 25 mg, or less than about 20 mg, or less than about 15 mg, or less than about 10 mg, or less than about 5 mg, or less than about 2 mg, or less than about 1 mg, or less than about 0.5 mg, and any and all whole or partial increments thereof.
  • a composition as described herein is a packaged pharmaceutical composition comprising a container holding a therapeutically effective amount of a compound described herein, alone or in combination with a second pharmaceutical agent; and instructions for using the compound to treat, prevent, or reduce one or more symptoms of an inflammatory disease in a patient.
  • Formulations may be employed in admixtures with conventional excipients, i.e., pharmaceutically acceptable organic or inorganic carrier substances suitable for oral, parenteral, nasal, intravenous, subcutaneous, enteral, or any other suitable mode of administration, known to the art.
  • the pharmaceutical preparations may be sterilized and if desired mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure buffers, coloring, flavoring and/or aromatic substances and the like. They may also be combined where desired with other active agents, e.g., other analgesic agents.
  • compositions described herein include oral, nasal, rectal, intravaginal, parenteral, buccal, sublingual or topical.
  • routes of administration of any of the compositions described herein include oral, nasal, rectal, intravaginal, parenteral, buccal, sublingual or topical.
  • the compounds for use in any of the compositions described herein include oral, nasal, rectal, intravaginal, parenteral, buccal, sublingual or topical.
  • compositions described herein can be formulated for administration by any suitable route, such as for oral or parenteral, for example, transdermal, transmucosal (e.g, sublingual, lingual, (trans)buccal, (trans)urethral, vaginal (e.g, trans- and perivaginally), (intra)nasal and (trans)rectal), intravesical, intrapulmonary, intraduodenal, intragastrical, intrathecal, subcutaneous, intramuscular, intradermal, intra-arterial, intravenous, intrabronchial, inhalation, and topical administration.
  • transdermal e.g, sublingual, lingual, (trans)buccal, (trans)urethral
  • vaginal e.g, trans- and perivaginally
  • compositions and dosage forms include, for example, tablets, capsules, caplets, pills, gel caps, troches, dispersions, suspensions, solutions, syrups, granules, beads, transdermal patches, gels, powders, pellets, magmas, lozenges, creams, pastes, plasters, lotions, discs, suppositories, liquid sprays for nasal or oral administration, dry powder or aerosolized formulations for inhalation, compositions and formulations for intravesical administration and the like. It should be understood that the formulations and compositions described herein are not limited to the particular formulations and compositions that are described herein.
  • compositions intended for oral use may be prepared according to any method known in the art and such compositions may contain one or more agents selected from the group consisting of inert, non-toxic pharmaceutically excipients that are suitable for the manufacture of tablets.
  • excipients include, for example an inert diluent such as lactose; granulating and disintegrating agents such as cornstarch; binding agents such as starch; and lubricating agents such as magnesium stearate.
  • the tablets may be uncoated or they may be coated by known techniques for elegance or to delay the release of the active ingredients.
  • Formulations for oral use may also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert diluent.
  • the compound(s) described herein can be in the form of tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g., polyvinylpyrrolidone, hydroxypropylcellulose or hydroxypropyl methylcellulose); fillers (e.g., cornstarch, lactose, microcrystalline cellulose or calcium phosphate); lubricants (e.g., magnesium stearate, talc, or silica); disintegrates (e.g., sodium starch glycollate); or wetting agents (e.g., sodium lauryl sulphate).
  • the tablets may be coated using suitable methods and coating materials such as OPADRYTM film coating systems available from Colorcon, West Point, Pa. (e.g., OPADRYTM OY Type, OYC Type, Organic Enteric OY-P Type, Aqueous Enteric OY-A Type, OY-PM Type and
  • Liquid preparation for oral administration may be in the form of solutions, syrups or suspensions.
  • the liquid preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, methyl cellulose or hydrogenated edible fats); emulsifying agent (e.g, lecithin or acacia); non-aqueous vehicles (e.g, almond oil, oily esters or ethyl alcohol); and preservatives (e.g, methyl or propyl p-hydroxy benzoates or sorbic acid).
  • suspending agents e.g., sorbitol syrup, methyl cellulose or hydrogenated edible fats
  • emulsifying agent e.g, lecithin or acacia
  • non-aqueous vehicles e.g, almond oil, oily esters or ethyl alcohol
  • preservatives e.g, methyl or propyl p-hydroxy benzoates or sorbic acid
  • compositions as described herein can be prepared, packaged, or sold in a formulation suitable for oral or buccal administration.
  • a tablet that includes a compound as described herein can, for example, be made by compressing or molding the active ingredient, optionally with one or more additional ingredients.
  • Compressed tablets may be prepared by compressing, in a suitable device, the active ingredient in a free-flowing form such as a powder or granular preparation, optionally mixed with one or more of a binder, a lubricant, an excipient, a surface active agent, and a dispersing agent.
  • Molded tablets may be made by molding, in a suitable device, a mixture of the active ingredient, a pharmaceutically acceptable carrier, and at least sufficient liquid to moisten the mixture.
  • compositions used in the manufacture of tablets include, but are not limited to, inert diluents, granulating and disintegrating agents, dispersing agents, surface-active agents, disintegrating agents, binding agents, and lubricating agents.
  • Suitable dispersing agents include, but are not limited to, potato starch, sodium starch gly collate, poloxamer 407, or poloxamer 188.
  • One or more dispersing agents can each be individually present in the composition in an amount of about 0.01% w/w to about 90% w/w relative to weight of the dosage form.
  • One or more dispersing agents can each be individually present in the composition in an amount of at least, greater than, or less than about 0.01%, 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90% w/w relative to weight of the dosage form.
  • surfactants include cationic, anionic, or non-ionic surfactants, or combinations thereof.
  • Suitable surfactants include, but are not limited to, behentrimonium chloride, benzalkonium chloride, benzethonium chloride, benzododecinium bromide, carbethopendecinium bromide, cetalkonium chloride, cetrimonium bromide, cetrimonium chloride, cetylpyndine chloride, didecyldimethylammonium chloride, dimethyldioctadecylammonium bromide, dimethyldioctadecylammomum chloride, domiphen bromide, lauryl methyl gluceth-10 hydroxypropyl dimonium chloride, tetramethylammonium hydroxide, thonzonium bromide, stearalkonium chloride, octenidine dihydrochloride, olaflur,
  • SUBSTITUTE SHEET (RULE 26) N-oleyl-l,3-propanediamine, 2-acrylamido-2-methylpropane sulfonic acid, alkylbenzene sulfonates, ammonium lauryl sulfate, ammonium perfluorononanoate, docusate, disodium cocoamphodiacetate, magnesium laureth sulfate, perfluorobutanesulfonic acid, perfluorononanoic acid, perfluorooctanesulfonic acid, perfluorooctanoic acid, potassium lauryl sulfate, sodium alkyl sulfate, sodium dodecyl sulfate, sodium laurate, sodium laureth sulfate, sodium lauroyl sarcosinate, sodium myreth sulfate, sodium nonanoyloxybenzenesulfonate, sodium pareth sulfate, sodium stearate,
  • One or more surfactants can each be individually present in the composition in an amount of about 0.01% w/w to about 90% w/w relative to weight of the dosage form.
  • One or more surfactants can each be individually present in the composition in an amount of at least, greater than, or less than about 0.01%, 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90% w/w relative to weight of the dosage form.
  • Suitable diluents include, but are not limited to, calcium carbonate, magnesium carbonate, magnesium oxide, sodium carbonate, lactose, microcrystalline cellulose, calcium phosphate, calcium hydrogen phosphate, and sodium phosphate, Cellactose ® 80 (75 % a- lactose monohydrate and 25 % cellulose powder), mannitol, pre-gelatinized starch, starch, sucrose, sodium chloride, talc, anhydrous lactose, and granulated lactose.
  • One or more diluents can each be individually present in the composition in an amount of about 0.01% w/w to about 90% w/w relative to weight of the dosage form.
  • One or more diluents can each be individually present in the composition in an amount of at least, greater than, or less than about 0.01%, 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%,
  • SUBSTITUTE SHEET ( RULE 26) 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90% w/w relative to weight of the dosage form.
  • Suitable granulating and disintegrating agents include, but are not limited to, sucrose, copovidone, com starch, microcrystalline cellulose, methyl cellulose, sodium starch gly collate, pregelatinized starch, povidone, sodium carboxy methyl cellulose, sodium alginate, citric acid, croscarmellose sodium, cellulose, carboxymethylcellulose calcium, colloidal silicone dioxide, crosspovidone and alginic acid.
  • One or more granulating or disintegrating agents can each be individually present in the composition in an amount of about 0.01% w/w to about 90% w/w relative to weight of the dosage form.
  • One or more granulating or disintegrating agents can each be individually present in the composition in an amount of at least, greater than, or less than about 0.01%, 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90% w/w relative to weight of the dosage form.
  • Suitable binding agents include, but are not limited to, gelatin, acacia, pre-gelatinized maize starch, polyvinylpyrrolidone, anhydrous lactose, lactose monohydrate, hydroxypropyl methylcellulose, methylcellulose, povidone, polyacrylamides, sucrose, dextrose, maltose, gelatin, polyethylene glycol.
  • One or more binding agents can each be individually present in the composition in an amount of about 0.01% w/w to about 90% w/w relative to weight of the dosage form.
  • One or more binding agents can each be individually present in the composition in an amount of at least, greater than, or less than about 0.01%, 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90% w/w relative to weight of the dosage form.
  • Suitable lubricating agents include, but are not limited to, magnesium stearate, calcium stearate, hydrogenated castor oil, glyceryl monostearate, glyceryl behenate, mineral oil, polyethylene glycol, poloxamer 407, poloxamer 188, sodium laureth sulfate, sodium benzoate, stearic acid, sodium stearyl fumarate, silica, and talc.
  • One or more lubricating agents can each be individually present in the composition in an amount of about 0.01% w/w to about 90% w/w relative to weight of the dosage form.
  • One or more lubricating agents can each be individually present in the composition in an amount of at least, greater than, or less than about 0.01%, 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90% w/w relative to weight of the dosage form.
  • Tablets can be non-coated or they may be coated using known methods to achieve delayed disintegration in the gastrointestinal tract of a subject, thereby providing sustained
  • SUBSTITUTE SHEET (RULE 26) release and absorption of the active ingredient.
  • a material such as glyceryl monostearate or glyceryl distearate may be used to coat tablets.
  • tablets may be coated using methods described in U.S. Patent Nos. 4,256,108; 4,160,452; and 4,265,874 to form osmotically controlled release tablets.
  • Tablets may further comprise a sweetening agent, a flavoring agent, a coloring agent, a preservative, or some combination of these in order to provide for pharmaceutically elegant and palatable preparation.
  • Tablets can also be enterically coated such that the coating begins to dissolve at a certain pH, such as at about pH 5.0 to about pH 7.5, thereby releasing a compound as described herein.
  • the coating can contain, for example, EUDRAGIT ® L, S, FS, and/or E polymers with acidic or alkaline groups to allow release of a compound as described herein in a particular location, including in any desired section(s) of the intestine.
  • the coating can also contain, for example, EUDRAGIT ® RL and/or RS polymers with cationic or neutral groups to allow for time controlled release of a compound as described herein by pH-independent swelling.
  • the compounds as described herein may be formulated for injection or infusion, for example, intravenous, intramuscular or subcutaneous injection or infusion, or for administration in a bolus dose and/or continuous infusion.
  • Suspensions, solutions or emulsions in an oily or aqueous vehicle, optionally containing other formulatory agents such as suspending, stabilizing and/or dispersing agents may be used.
  • Sterile injectable forms of the compositions described herein may be aqueous or oleaginous suspension. These suspensions may be formulated according to techniques known in the art using suitable dispersing or wetting agents and suspending agents.
  • the sterile injectable preparation may also be a sterile injectable solution or suspension in anon- toxic parenterally-acceptable diluent or solvent, for example as a solution in 1, 3-butanediol.
  • acceptable vehicles and solvents that may be employed are water, Ringer's solution and isotonic sodium chloride solution.
  • Sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose, any bland fixed oil may be employed including synthetic mono- or di-glycerides.
  • Fatty acids such as oleic acid and its glyceride derivatives are useful in the preparation of injectables, as are natural pharmaceutically acceptable oils, such as olive oil or castor oil, especially in their polyoxyethylated versions.
  • oils such as olive oil or castor oil, especially in their polyoxyethylated versions.
  • These oil solutions or suspensions may also contain a long-chain
  • SUBSTITUTE SHEET ( RULE 26) alcohol diluent or dispersant, such as such as lauryl, stearyl, or oleyl alcohols, or similar alcohol.
  • Additional dosage forms suitable for use with the compound(s) and compositions described herein include dosage forms as described in U.S. Patents Nos. 6,340,475; 6,488,962; 6,451,808; 5,972,389; 5,582,837; and 5,007,790. Additional dosage forms suitable for use with the compound(s) and compositions described herein also include dosage forms as described in U.S. Patent Applications Nos. 20030147952; 20030104062; 20030104053; 20030044466; 20030039688; and 20020051820. Additional dosage forms suitable for use with the compound(s) and compositions described herein also include dosage forms as described in PCT Applications Nos.
  • the formulations described herein can be, but are not limited to, short-term, rapid-offset, as well as controlled, for example, sustained release, delayed release and pulsatile release formulations.
  • sustained release is used in its conventional sense to refer to a drug formulation that provides for gradual release of a drug over an extended period of time, and that may, although not necessarily, result in substantially constant blood levels of a drug over an extended time period.
  • the period of time may be as long as a month or more and should be a release which is longer that the same amount of agent administered in bolus form.
  • the compounds may be formulated with a suitable polymer or hydrophobic material which provides sustained release properties to the compounds.
  • the compounds for use with the method(s) described herein may be administered in the form of microparticles, for example, by injection or in the form of wafers or discs by implantation.
  • the dosage forms to be used can be provided as slow or controlled- release of one or more active ingredients therein using, for example, hydropropylmethyl cellulose, other polymer matrices, gels, permeable membranes, osmotic systems, multilayer coatings, microparticles, liposomes, or microspheres or a combination thereof to provide the desired release profile in varying proportions.
  • Suitable controlled-release formulations include hydropropylmethyl cellulose, other polymer matrices, gels, permeable membranes, osmotic systems, multilayer coatings, microparticles, liposomes, or microspheres or a combination thereof to provide the desired release profile in varying proportions.
  • SUBSTITUTE SHEET (RULE 26) known to those of ordinary skill in the art, including those descnbed herein, can be readily selected for use with the pharmaceutical compositions described herein.
  • single unit dosage forms suitable for oral administration such as tablets, capsules, gelcaps, and caplets, that are adapted for controlled-release are encompassed by the compositions and dosage forms described herein.
  • controlled-release pharmaceutical products have a common goal of improving drug therapy over that achieved by their non-controlled counterparts.
  • the use of an optimally designed controlled-release preparation in medical treatment is characterized by a minimum of drug substance being employed to cure or control the condition in a minimum amount of time.
  • Advantages of controlled-release formulations include extended activity of the drug, reduced dosage frequency, and increased patient compliance.
  • controlled-release formulations can be used to affect the time of onset of action or other characteristics, such as blood level of the drug, and thus can affect the occurrence of side effects.
  • controlled-release formulations are designed to initially release an amount of drug that promptly produces the desired therapeutic effect, and gradually and continually release of other amounts of drug to maintain this level of therapeutic effect over an extended period of time.
  • the drug In order to maintain this constant level of drug in the body, the drug must be released from the dosage form at a rate that will replace the amount of drug being metabolized and excreted from the body.
  • Controlled-release of an active ingredient can be stimulated by various inducers, for example pH, temperature, enzymes, water, or other physiological conditions or compounds.
  • controlled-release component is defined herein as a compound or compounds, including, but not limited to, polymers, polymer matrices, gels, permeable membranes, liposomes, or microspheres or a combination thereof that facilitates the controlled-release of the active ingredient.
  • the compound(s) described herein are administered to a patient, alone or in combination with another pharmaceutical agent, using a sustained release formulation.
  • the compound(s) described herein are administered to a patient, alone or in combination with another pharmaceutical agent, using a sustained release formulation.
  • delayed release is used herein in its conventional sense to refer to a drug formulation that provides for an initial release of the drug after some delay following drug administration and that mat, although not necessarily, includes a delay of from about 10 minutes up to about 12 hours.
  • SUBSTITUTE SHEET (RULE 26)
  • pulsatile release is used herein in its conventional sense to refer to a drug formulation that provides release of the drug in such a way as to produce pulsed plasma profdes of the drug after drug administration.
  • immediate release is used in its conventional sense to refer to a drug formulation that provides for release of the drug immediately after drug administration.
  • short-term refers to any period of time up to and including about 8 hours, about 7 hours, about 6 hours, about 5 hours, about 4 hours, about 3 hours, about 2 hours, about 1 hour, about 40 minutes, about 20 minutes, or about 10 minutes and any or all whole or partial increments thereof after drug administration after drug administration.
  • rapid-offset refers to any period of time up to and including about 8 hours, about 7 hours, about 6 hours, about 5 hours, about 4 hours, about 3 hours, about 2 hours, about 1 hour, about 40 minutes, about 20 minutes, or about 10 minutes, and any and all whole or partial increments thereof after drug administration.
  • the therapeutically effective amount or dose of a compound described herein depends on the age, sex and weight of the patient, the cunent medical condition of the patient and the progression of an inflammatory disease in the patient being treated. The skilled artisan is able to determine appropriate dosages depending on these and other factors.
  • a suitable dose of a compound described herein can be in the range of from about 0.01 mg to about 5,000 mg per day, such as from about 0. 1 mg to about 1,000 mg, for example, from about 1 mg to about 500 mg, such as about 5 mg to about 250 mg per day.
  • the dose may be administered in a single dosage or in multiple dosages, for example from 1 to 4 or more times per day. When multiple dosages are used, the amount of each dosage may be the same or different. For example, a dose of 1 mg per day may be administered as two 0.5 mg doses, with about a 12-hour interval between doses.
  • the amount of compound dosed per day may be administered, in non-limiting examples, every day, every other day, every 2 days, every 3 days, every 4 days, or every 5 days.
  • a 5 mg per day dose may be initiated on Monday with a first subsequent 5 mg per day dose administered on Wednesday, a second subsequent 5 mg per day dose administered on Friday, and so on.
  • the administration of the compound(s) described herein is optionally given continuously; alternatively, the dose of drug being administered is temporarily reduced or temporarily
  • SUBSTITUTE SHEET (RULE 26) suspended for a certain length of time (i.e., a "drug holiday").
  • the length of the drug holiday optionally varies between 2 days and 1 year, including by way of example only, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 12 days, 15 days, 20 days, 28 days, 35 days, 50 days, 70 days, 100 days, 120 days, 150 days, 180 days, 200 days, 250 days, 280 days, 300 days, 320 days, 350 days, or 365 days.
  • the dose reduction during a drug holiday includes from 10%-100%, including, by way of example only, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%.
  • a maintenance dose is administered if necessary. Subsequently, the dosage or the frequency of administration, or both, is reduced to a level at which the improved disease is retained.
  • patients require intermittent treatment on a long-term basis upon any recurrence of symptoms and/or infection.
  • unit dosage form refers to physically discrete units suitable as unitary dosage for patients undergoing treatment, with each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect, optionally in association with a suitable pharmaceutical carrier.
  • the unit dosage form may be for a single daily dose or one of multiple daily doses (e.g, about 1 to 4 or more times per day). When multiple daily doses are used, the unit dosage form may be the same or different for each dose.
  • Toxicity and therapeutic efficacy of such therapeutic regimens are optionally determined in cell cultures or experimental animals, including, but not limited to, the determination of the LDso (the dose lethal to 50% of the population) and the EDso (the dose therapeutically effective in 50% of the population).
  • the dose ratio between the toxic and therapeutic effects is the therapeutic index, which is expressed as the ratio between LDso and EDso.
  • the data obtained from cell culture assays and animal studies are optionally used in formulating a range of dosage for use in human.
  • the dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with minimal toxicity.
  • the dosage optionally varies within this range depending upon the dosage form employed and the route of administration utilized.
  • LACC1 LACC1 K38E, human LACC1 1254V and human LACC1 C284R were generated using the Q5 Site-Directed Mutagenesis Kit (New England BioLabs, E0554S).
  • coll BL21(DE3) cells were transformed with the expression plasmids and grown aerobically at 37°C and 250 revolutions per minute (rpm) in ampicillin-supplemented (100 pg/mL) Luria Bertani (LB) medium. Expression was induced at an ODeoo of 0.5-0.6 with 0.3 mM isopropyl p-D-1- thiogalactopyranoside (IPTG) for 4 h at 30°C. Cells were harvested by centrifugation (6000 x g, 4 °C, 20 min) and cell pellets were washed twice with PBS.
  • IPTG isopropyl p-D-1- thiogalactopyranoside
  • Cells were then resuspended in 5 mL of column buffer on ice containing 20 mM Tris-HCl, 200 mM NaCl, 1 mM EDTA, pH 7.5, and complete Mini EDTA-free protease inhibitor cocktail (1 tablet per 50 mL buffer, Roche, 11873580001).
  • the cells were lysed by sonication on ice and cleared by centrifugation at 35,000 x g for 30 minutes.
  • the protein-containing supernatant was loaded onto a pre-equilibrated amylose resin column (New England BioLabs, E8021S). The column was washed with 20 column volumes of column buffer.
  • the protein was eluted with 10 column volumes of column buffer supplemented with 10 mM maltose.
  • the eluted fractions were pooled and concentrated using centrifugal filters (Millipore, UFC503096) for use in further assays.
  • E. coli BL21(DE3) expressing recombinant mouse and human Laccl proteins were cultured in 5 mL LB medium containing 10 mM l,2,3,4,5- 13 C5-L-Cit. Expression was induced at an optical density (ODeoo) of 0.5-0.6 with 0.5 mM isopropyl p-D- 1 -thiogalactopyranoside and cultured at 16° C for 48 hours. The culture extract was coupled with l-fluoro-2,4-dinitrophenyl- 5-L-alanine amide according to the manufacturer’s protocol.
  • Derivatized samples were analyzed by UPLC- QTOF-MS (Phenomenex Kinetex C18 column (100 A) 5 pm (250 x 4.6 mm 2 ); flow rate, 0.7 mL min -1 ; mobile phase composition, 10-100% acetonitrile in water containing 0.1% formic acid for 30 min).
  • I.acci BMDMs were cultured as mentioned below and stimulated with 20 ng/mL LPS (Sigma, L4391) and 50 ng/mL IFNy (BioLegend, 575302) for 16 hours. Cells were washed with ice- cold PBS twice and extracted with ice-cold MeOH. The extraction mixture was centrifuged and the supernatant was dried using N2 gas flow.
  • Laccl ⁇ ' BMDM cell pellet extract was incubated with 10 pM mLACCl in 100 pL PBS buffer supplemented with 1 pM ZnSCL in triplicate for 1 h at 37°C and quenched by 200 pL ice-cold acetonitrile (AcCN).
  • the reaction mixture was centrifuged at 20,000 x g for 10 min and the supernatant was analyzed using an Agilent iFunnel 6550 quadrupole time of flight (Q-TOF) MS instrument fitted with an electrospray ionization (ESI) source coupled to an Agilent 1290 Infinity HPLC system with an Xbridge BEH Amide XP HILIC 2.5 pm, 2.1 mm x 100 mm column (Waters, 186006091). The column was maintained at 25°C during analysis.
  • the mobile phase A was 20 mM ammonium acetate/0.1% formic acid pH 3.5.
  • the mobile phase B was 100% acetonitrile.
  • the flow rate was 0.22 mL/min.
  • the gradient elution was as follows: 0 min: 85% B; 0.5 min: 85% B; 9 min: 35% B; 11 min: 2% B; 12 min: 85% B; 25 min: 85% B.
  • the data were acquired in positive and negative ion mode (FIG. 5D) with a full scan range of 50-1700 m/z, respectively.
  • the metabolomics data were processed with Mass Profiler Professional Software 14.0 (Agilent) and presented as a volcano plot showing fold change (FC) versus false discovery rate (FDR) values.
  • HNCO HNCO
  • 6- 13 Ci-labelled L-Cit 1 mg was incubated with 10 pM mLACCl in D2O (200 pL) for 1 hour.
  • the reaction mixture was then subjected to 13 C NMR on 4 h intervals to detect cyanate, the conjugate base of HNCO, with reference to its central 13 C chemical shift value of 128.64 ppm. Spectrum shown was on the 2 nd interval at 5 h incubation time.
  • the negative control was prepared as described above without mLACCl, and the chemical standard used was 1
  • the enzymatic assay was performed as mentioned above. In some conditions as noted, KH2PO4 or Na2HPO4 was used for pH adjustment while 10 pM EDTA or 10 pM TPEN was added for metal chelation. The reaction mixture was quenched with 200 pL MeOH. Then, the mixture was centrifuged and coupled with l-fluoro-2,4- dinitrophenyl-5-L-alanine amide, FDAA (Thermo, 48895) per the manufacturer’s protocol.
  • the samples were analy zed by UPLC-QTOF-MS (Phenomenex Kinetex C18 (100 A) 5 pm (250 x 4.6 mm 2 ) column; flow rate, 0.7 mL/min; mobile phase composition, 10-100% acetonitrile in water containing 0.1% formic acid for 30 min).
  • the enzymatic assay was performed in triplicate as mentioned above at different concentrations of L-Cit (5 pM, 10 pM, 25 pM, 50 pM, 100 pM, 200 pM and 500 pM) over time (60 min, 120 min, 300 min, and 600 min). The velocity was calculated, and the Michaelis-Menten curves were plotted for the measurement of Km and feat using Prism 9 (GraphPad).
  • SUBSTITUTE SHEET ( RULE 26) GTTAAGGCCATCGCGGACATGGG, (SEQ ID NO: 2)) were used collectively to target exon 3 and exon 7, respectively.
  • an sgRNA (GAAGACGATGGGTATACAGTCGG, SEQ ID NO: 3) and an oligo donor (CCTACCGGAGTGAGCAACCCCACATGCCTTTTTCACAGGATCTGCGAAGACGAT GGGTATACgGTCGGCGCCAAGAGCAGTGATTGTGACTCCTCTCTGAT TTGTGACGATCCCATCGTAAGA, SEQ ID NO: 4) were used collectively for homologous recombination.
  • BMDMs were generated from progenitor cells isolated from femurs and tibias of mice and maintained in DMEM medium (Gibco, 11965118) with 10% FBS (Sigma, F8192-500M1), 1% penicillin/ streptomycin (Gibco, 15070063) and 50 ng/mL M-CSF (R&D, 416-ML-010) for 6 days.
  • Cells were reseeded and stimulated with 20 ng/mL LPS (Sigma, L4391) and 50 ng/mL IFNy (BioLegend, 575302) in triplicate for 16 hours.
  • 1 mM DFMO (Cayman, 16889) was supplemented during Ml differentiation to inhibit ODC1.
  • culture supernatants were collected for TNFa, IL6 and IL12b ELISA assays (R&D, DY410-05, DY406-05, DY499-05) according to the manufacturer’s protocols.
  • SUBSTITUTE SHEET (RULE 26) return it to log phase growth and increase virulence.
  • bacterial CFUs were calculated with an infection dose of 1 x 10 3 CFUs per mouse.
  • faecal pellets were resuspended in PBS at 50 mg/mL and vortexed for 20 min.
  • Bacteria containing supernatants were clarified by centrifugation at 50 x g for 10 min. Serial dilutions were conducted, and bacteria were plated in triplicate on LB streptomycin (100 pg/mL) plates. For caecal, liver and spleen CFU enumeration, organs were isolated, weighed, and added to 2 ml of PBS. Tissue was dissociated with Gentl eMacs C Tubes (Miltenyi Biotech) per the manufacturer’s instructions. CFUs were calculated using similar methodology as above.
  • BMDMs S'. Typhimurium infection in BMDMs.
  • the BMDM culture medium was replaced with antibiotic-free medium.
  • Medium was then removed and replaced with medium containing 100 pg/mL gentamycin to kill extracellular bacteria for 1 h (z.e., the gentamycin protection assay).
  • Medium was replaced with fresh medium including 25 pg/mL gentamycin.
  • BMDMs were generated as mentioned above, reseeded at a density of 1 x 10 6 cells/mL in phenol red-free DMEM medium (Gibco, 21063029) with 10% FBS (Sigma, F8192-500M1), 1% penicillin/streptomycin (Gibco, 15070063), and 1 mM
  • the clarified supernatant was transferred to an LC-MS vial and analyzed by an Agilent iFunnel 6550 QTOF-MS instrument fitted with an ESI source or an Agilent 6490 ESI-QQQ-MS/MS instrument coupled to an Agilent 1290 Infinity HPLC system with an Xbndge BEH Amide XP HILIC 2.5 pm, 2.1 mm x 100 mm column (Waters, 186006091). The column was maintained at 25°C during the analysis.
  • the mobile phase A was 20 mM ammonium acetate/0.1% formic acid pH 3.5.
  • the mobile phase B was 100% acetonitrile.
  • the flow rate was 0.4 mL/min.
  • the gradient elution was as follows: 0 min: 95% B; 0.5 min: 95% B; 3 min: 70% B; 6 mm: 40% B; 6.5 mm: 0% B; 9.5 mm: 0% B; 10 mm: 95% B; 15 mm: 95% B.
  • MassHunter Qualitative Analysis B.07.00 (Agilent) was used to perform peak picking, peak alignment, and peak intensity integration.
  • Embodiment 1 provides a method of treating, ameliorating, and/or preventing an inflammatory disease, inflammatory disorder, and/or inflammation in a subject, the method comprising administering to the subject a therapeutically effective amount of a compound of Formula la, or a salt, solvate, or N-oxide thereof:
  • R 1 and R 2 combine with the N atom to which they are bound so as to form a 5 or 6-membered heterocycle
  • R 3 and R 4 combine with the N atom to which they are bound so as to form a 5 or 6-membered heterocycle
  • R 5 is selected from the group consisting of hydrogen, 1-10 amino acids, C1-20 alkyl, and R c ; each occurrence of R a , R b , and R c is independently selected from the group consisting of hydrogen, C1-10 alkyl, C2-10 alkenyl, C2-10 alkynyl, Ce-io aryl, and C5-10 heteroaryl, and combinations thereof; each occurrence of R 1 and R" is independently selected from the group consisting of hydrogen, C1-10 alkyd, C 2 -io alkenyl, C 2 -io alkynyl, Ce-io aryl, C5-10 heteroaryl, halogen, OH, CN, Ci-10 alkoxy, and combinations thereof.
  • Embodiment 2 provides the method of embodiment 1, wherein the inflammatory disease or disorder is selected from the group consisting of arthritis juvenile arthritis, spondylitis, leprosy, Crohn's disease, ulcerative colitis, inflammatory bowel syndrome, and Rh factor arthritis.
  • Embodiment 3 provides the method of any one of embodiments 1-2, wherein the compound is formulated as a pharmaceutically acceptable composition further including at least one pharmaceutically acceptable carrier.
  • Embodiment 4 provides the method of any one of embodiments 1-3, wherein R 1 , R 2 , R 3 , R 4 , and R 5 are hydrogen.
  • Embodiment 5 provides the method of any one of embodiments 1-4, wherein the compound of Formula la is a hydrochloride salt.
  • Embodiment 6 provides the method of any one of embodiments 1-5, wherein the subject is a mammal.
  • Embodiment 7 provides the method of any one of embodiments 1-6, wherein the mammal is a human.
  • Embodiment 8 provides the method of any one of embodiments 1-7, wherein the subject is administered at least one additional agent for treating, ameliorating, or preventing the inflammatory disease, inflammatory disorder, or inflammation in the subject.
  • Embodiment 9 provides the method of any one of embodiments 1-8, wherein the compound is administered by a route selected from the group consisting of oral, transdermal, transmucosal, intravesical, intrapulmonary, intraduodenal, intragastrical, intrathecal, subcutaneous, intramuscular, intradermal, intra-arterial, intravenous, intrabronchial, inhalation, and topical administration.
  • Embodiment 10 provides the method of any one of embodiments 1-9, wherein the route is oral administration.
  • Embodiment 11 provides method of improving efficacy of an antibacterial agent in a subject and/or improving ability of a subject to fight off a bacterial infection, the method comprising administering to the subject a therapeutically effective amount of a compound of Formula la, or a salt, solvate, or N-oxide thereof: Formula la wherein:
  • R 1 and R 2 combine with the N atom to which they are bound so as to form a 5 or 6-membered heterocycle
  • R 3 and R 4 combine with the N atom to which they are bound so as to form a 5 or 6-membered heterocycle
  • R 5 is selected from the group consisting of hydrogen, 1-10 amino acids, C1-20 alkyl, and
  • each occurrence of R a , R b , and R c is independently selected from the group consisting of hydrogen, C1-10 alkyl, C2-10 alkenyl, C2-10 alkynyl, Ce-io aryl, and C5-10 heteroaryl, and combinations thereof; each occurrence of R' and R" is independently selected from the group consisting of hydrogen, C1-10 alkyl, C2-10 alkenyl, C2-10 alkynyl, Ce-io aryl, C5-10 heteroaryl, halogen, OH, CN, C1-10 alkoxy, and combinations thereof.
  • Embodiment 12 provides the method of embodiment 11, wherein the compound is formulated as a pharmaceutically effective composition further including at least one pharmaceutically acceptable carrier.
  • Embodiment 13 provides the method of any one of embodiments 11-12, wherein R 1 , R 2 , R 3 , R 4 , and R 5 are hydrogen.
  • Embodiment 14 provides the method of any one of embodiments 11-13, wherein the compound of Formula la is a hydrochloride salt.
  • Embodiment 15 provides the method of any one of embodiments 11-14, wherein the subject is a mammal.
  • Embodiment 16 provides the method of any one of embodiments 11-15, wherein the mammal is a human.
  • Embodiment 17 provides the method of any one of embodiments 11-16, wherein the compound is administered with at least one antibacterial agent.
  • Embodiment 18 provides the method of any one of embodiments 11-17, wherein the compound is administered by a route selected from the group consisting of oral, transdermal, transmucosal, intravesical, intrapulmonary, intraduodenal, intragastrical, intrathecal, subcutaneous, intramuscular, intradermal, intra-arterial, intravenous, intrabronchial, inhalation, and topical administration.
  • Embodiment 19 provides the method of any one of embodiments 11-18, wherein the route is oral administration.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Provided herein are methods of treating, ameliorating, and/or preventing inflammatory diseases or disorders by administering to an afflicted subject a composition comprising ornithine, or a derivative thereof. Also provided are methods of improving the efficacy of antibacterial agents or improving the ability of a subject to fight off a bacterial infection by administering to a subject a composition comprising ornithine, or a derivative thereof.

Description

TITLE
Treatment, Amelioration, and/or Prevention of Inflammatory and Autoimmune Diseases
CROSS-REFERENCE TO RELATED APPLICATION
This application claims priority to U.S. Provisional Patent Application Serial No. 63/349,394 entitled "TREATMENT, AMELIORATION, AND/OR PREVENTION OF INFLAMMATORY AND AUTOIMMUNE DISEASES," filed June 6, 2022, the disclosure of which is incorporated herein by reference in its entirety.
INCORPORATION-BY-REFERENCE OF MATERIAL SUBMITTED ELECTRONICALLY
This invention contains one or more sequences in a computer readable format in an accompanying text file titled "047162-7336WOl.xml," which was created on June 6, 2022 and is 4.6 KB in size, the contents of which are incorporated herein by reference in their entirety.
BACKGROUND
The mammalian immune system employs various pattern recognition receptors (PRRs) to recognize invaders and host damage and transmits this information to downstream immunometabolic signaling outcomes. Laccase domain-containing 1 (LACC1) protein is an enzyme highly expressed in inflammatory macrophages and serves a central regulatory role in multiple inflammatory diseases, such as in inflammatory bowel diseases (IBDs), arthritis, and clearance of microbial infection.
There is a pressing need to provide new safe and effective treatments for inflammatory disorders such as arthritis and IBS. The present invention addresses this need.
BRIEF DESCRIPTION OF THE FIGURES
The drawings illustrate generally, by way of example, but not by way of limitation, various embodiments of the present application.
FIGs. 1 A-1H show that LACC1 is an endogenous isocyanic acid synthase, converting L-Cit to L-Om and HNCO. FIG. 1 A shows a schematic pipeline used for in vitro enzymatic evaluation of mLACCl. FIG. IB is a volcano plot showing the fold change (FC) (substrate with mLACCl versus substrate with heat inactivated mLACCl) and false discovery' rate
- 1 -
SUBSTITUTE SHEET ( RULE 26) (FDR) values in positive ion mode. FIG. 1C shows abundance of L-Om in enzymatic assays validating the substrate of mLACCl. FIG. ID shows the Michaelis-Menten curves of mLACCl, hLACCl, hLACCl I254V, hLACCl C284R, and hLACCl K38E. FIG. IE shows abundance of HNCO in enzymatic assays, as assessed by the 2-aminobenzoate-HNCO carbamoylation assay. FIG. IF is a summary of kinetic parameters of mLACCl, hLACCl, hLACCl K38E, hLACCl I254V, and hLACCl C284R. FIG. 1G shows major biochemical transformation mediated by LACC1. FIG. 1H shows direct detection of isocyanic acid (HNCO) through 13C-NMR spectroscopy. The mean and SEM (error bars) are derived from three biological replicates (n = 3). Statistical significance (two-tailed t-test) compared to control (Ctrl): *P<0.05; **P<0.01; ***P<0.001; nd, not detectable.
FIGs. 2A-2G show that LACC1 inhibits proinflammatory cytokine signaling and protects from S. Typhimurium infection. FIG. 2A shows ELISA measurements of TNFa, IL6 and IL 12b secreted by BMDMs in the presence or absence of immunostimulant (LPS + IFNy), exogenously supplied LACC1 product L-Om (1, 5 mM), and/or the conjugate base of LACC1 product HNCO, NaOCN (100 pM, 1 mM). FIG. 2B shows the body weight of each mouse was monitored daily after S. Typhimurium infection with or without 1% L-Om administration, and the body weight loss was depicted as the percentage (%) compared to the initial body weight (n = 10). FIG. 2C shows mouse survival curves (n = 10). FIG. 2D shows Colony-Forming Units (CFUs) in fecal pellets were measured at day 4 after infection. FIG. 2E, FIG. 2F, and FIG. 2G show CFUs in the caecum, spleen and liver, respectively, were measured at day 6 after infection. The mean and SEM (error bars) are derived from three (FIG. 2A) or ten (FIG. 2B-2G) biological replicates (n = 3 or n = 10). Statistical significance (two-tailed t-test) compared to control (Ctrl): *P<0.05; **P<0.01; ns, not significant.
FIGs. 3A-3B shows that LACC1 bridges arginine metabolism with polyamine synthesis in Ml macrophages. FIG. 3A shows LC-QQQ-MS intensity of 13C-0m, 13C-Put, 13C-Spd and 13C-Spm in Ml BMDMs from WT and Laccl^ mice. FIG. 3B shows key metabolism pathways in Ml BMDMs, highlighting LACCl’s novel and central role in L-Arg and polyamine metabolism. The mean and SEM (error bars) are derived from three biological replicates (n = 3). Statistical significance (two-tailed t-test) compared to control (Ctrl): *P<0.05; **P<0.01.
FIGs. 4A-4L show that NOS2 is important for the antibacterial function of LACC1. FIG. 4A is an illustration of the NOS2-LACCl-ODCl signaling axis. FIG. 4B shows body weight of each mouse was monitored daily after S'. Typhimurium infection (n = 10). FIG. 4C
- 2 -
SUBSTITUTE SHEET ( RULE 26) shows mouse survival curves (n = 10). FIG. 4D shows CFUs in fecal pellets were measured at day 4 after infection. FIG. 4E, FIG. 4F, and FIG. 4G show CFUs in the caecum, spleen and liver, respectively, were measured at day 6 after infection. FIG. 4H, FIG. 41, FIG. 4J show ELISA measurements of TNFa, IL6 and IL 12b, respectively, secreted by BMDMs stimulated by LPS and IFNy with or without 1 mM DFMO treatment. FIG. 4K shows CFUs of intracellular S. Typhimurium in Ml BMDMs. FIG. 4L shows the results of an LDH assay in S. Typhimurium infected Ml BMDMs. The mean and SEM (error bars) are derived from three (FIG. 4H-4L) or ten (FIG. 4B-4G) biological replicates (n = 3 or n = 10). Statistical significance (two-tailed t-test) compared to control (Ctrl): *P<0.05; **P<0.01; ns, not significant.
FIGs. 5A-5J show in vitro biochemical analysis of isolated LACC1 variants. FIG. 5A illustrates that ICP-MS assays showed the enrichment of Zn64 and Zn66 isotopes in recombinant mLACCl relative to vector control. FIG. 5B illustrates that a quantitative ICP- MS assay for Zn showed the average ZmmLACCl ratio as 0.94, suggesting a 1:1 ratio in the isolated enzyme. FIG. 5C-FIG. 5D show volcano plots from UPLC-QTOF-MS experiments showing the fold change (FC) (substrate with mLACCl versus substrate with heat inactivated mLACCl) and false discovery rate (FDR) values collected in positive ion mode (FIG. 5C) and negative ion mode for the specific detection of ribose-1 -phosphate (FIG. 5D). FIG. 5E shows rates of L-Om production in enzymatic assays at different pH conditions. FIG. 5F shows rates of L-Om production in enzymatic assays with the supplementation of EDTA or TPEN in the reaction buffer. FIG. 5G shows the standard curve used for quantifying L-Om in enzymatic assays. FIG. 5H shows the standard curve used for quantifying 2-aminobenzoate- HNCO carbamoylation products in enzymatic assays. FIG. 51 shows the LC-MS trace of 1- fluoro-2,4-dinitrophenyl-5-L-alanine amide (FDAA, Marfey’s reagent)-coupled L-Om in enzymatic assays, supporting the stereoconfiguration. FIG. J shows the expanded view 13C- NMR spectroscopic data of LACC1 reaction using 6-13Ci-L-Cit as substrate, showing L-Om and HNCO as major products. The mean and SEM (error bars) are derived from three biological replicates (n = 3). Statistical significance (two-tailed t-test) compared to control (Ctrl): *P<0,05; **P<0.01; ***P<0.001; and, not detectable.
FIGs. 6A-6E show velocity plots of isolated enzyme reactions at different concentrations of L-Cit (5 pM, 10 pM, 25 pM, 50 pM, 100 pM, 200 pM and 500 pM) in enz me kinetic analysis of WT mLACCl (FIG. 6A) and hLACCl (FIG. 6B) and the polymorphic human enzyme variants: K38E (FIG. 6C), I254V (FIG. 6D) and C284R (FIG. 6E). The mean and SEM (error bars) are derived from three biological replicates (n = 3).
- 3 -
SUBSTITUTE SHEET ( RULE 26) FIGs. 7A-7K depict how Lacc 1C284R/C284R shows an intermediate defect in antibacterial protection against S. Typhimurium infection. FIG. 7A shows body weight of each mouse was monitored daily after S. Typhimurium infection (n = 10). FIG. 7B shows CFUs in fecal pellets measured at day 4 after infection. FIG. 7C, FIG. 7D, and FIG. 7E show CFUs in the caecum, spleen and liver, respectively, measured at day 6 after infection. FIG. 7F-FIG. 7H show ELISA measurements of TNFa, IL6 and IL12b secreted by BMDMs in the presence or absence (NT, non-treatment) of immunostimulant (LPS + IFNy). FIG. 7I-FIG. 7K show ELISA measurements of TNFa, IL6 and IL12b secreted by BMDMs in the presence or absence (NT) of immunostimulant (LPS + IFNy), exogenously supplied LACC1 product L-Om (100 M, 1 mM, 5 mM, 10 mM), and/or the conjugate base of LACC 1 product HNCO, NaOCN (10 M, 100 pM, 500 pM, 1 mM). The mean and SEM (error bars) are derived from three (FIG. 7 A- FIG. 7E) or ten (FIG. 7F-FIG. 7K) biological replicates (n = 3 or n = 10). Statistical significance (two-tailed t-test) compared to control (Ctrl): *P<0.05; **P<0.01; ns, not significant.
FIG. 8 shows body weight of each mouse in the absence of S. Typhimurium infection was monitored daily with or without 1% L-Om administration in drinking water, showing no significant change in body weight. The mean and SEM (error bars) are derived from ten biological replicates (n = 10). Statistical significance (two-tailed t-test) compared to control (Ctrl): ns, not significant.
FIGs. 9A-9E show that LACC1 bridges L-Arg metabolism with poly amine synthesis in Ml macrophages. FIG. 9A-FIG. 9B show MS intensity of SAM and dcSAM, respectively, in Ml BMDMs from WT and LaccT'' mice. LaccT2' BMDMs show an elevated but non statistically significant level of dcSAM. FIG. 9C-FIG. 9E show UPLC-QTOF-MS intensity of 13C-labeled metabolites in L-Arg metabolism and polyamine synthesis with 13C-Arg feeding (FIG. 9C), 13C-Cit feeding (FIG. 9D) and 13C-ArgSuc feeding (FIG. 9E), respectively. These data complement LC-QQQ-MS experimental measurements shown in FIG. 3A. The mean and SEM (error bars) are derived from three biological replicates (n = 3). Statistical significance (two-tailed t-test) compared to control (Ctrl): *P<0.05; **P<0.01; ***P<0.001; ns, not significant.
FIGs. 10A-10E show irreversible inhibition of ODC1 phenocopied exacerbated S. Typhimurium induced cell death from LaccT2' inflammatory BMDMs. FIG. 10A, 10B, and 10C are ELISA measurements of TNFa, IL6, and IL12b, respectively, secreted by BMDMs stimulated by LPS and IFNy with or without 1 mM DFMO and/or 500 pM putrescine (Put)
- 4 -
SUBSTITUTE SHEET ( RULE 26) treatment. FIG. 10D shows CFUs of intracellular S. Typhimurium in inflammatory BMDMs. FIG. 10E shows an LDH assay in S. Typhimurium infected inflammatory BMDMs. The mean and SEM (error bars) are derived from three biological replicates (n = 3). Statistical significance (two-tailed t-test) compared to control (Ctrl): *P<0.05; **P<0.01; ns. not significant.
FIGs. 11A-1 IB show a summary of the enzymatic functions of LACC1 in Ml macrophages. FIG. 11A shows LACCl’s newly described role in bridging L-Arg and polyamine metabolism in inflammatory macrophages. The carbons are highlighted with consistency to the present l,2,3,4,5-13C5-L-Cit (red) and 6-13Ci-L-Cit (blue) feeding studies in Ml BMDMs. Carbons in spermidine and spermine highlighted in green derive from dcSAM. FIG. 1 IB shows the involvement of LACC1 (a.k.a., FAMIN) in the purine nucleotide cycle as a purine nucleoside enzyme. ADSL, adenylosuccinate lyase; ADSS, adenylosuccinate synthase; AMP, adenosine monophosphate; AMPD, AMP deaminase; GDP, guanosine diphosphate; GMP, guanosine monophosphate; GTP, guanosine triphosphate; IMP, inosine monophosphate; XMP, xanthosine monophosphate.
FIG. 12 shows that wildtype mL ACC 1 and hLACCl convert l,2,3,4,5-13C5-L-Cit into l,2,3,4,5-13C5-L-Om when expressed recombinantly in E. coli BL21(DE3) relative to a pET28a negative control (Vector). The culture extracts were coupled with l-fluoro-2,4- dinitrophenyl-5-L-alanine amide and the derivatization products (L-Om) were analyzed by UPLC-QTOF-MS. For hLACCl, isoforms 1, 2, 3, and 4 were assessed in addition to the polymorphic variants I254V and C284R in an isoform 2 background. For mLACCCl, the V254I and C284R variants were compared to a wildtype background.
DETAILED DESCRIPTION
Reference will now be made in detail to certain embodiments of the disclosed subject matter, examples of which are illustrated in part in the accompanying drawings. While the disclosed subject matter will be described in conjunction with the enumerated claims, it will be understood that the exemplified subject matter is not intended to limit the claims to the disclosed subject matter.
Throughout this document, values expressed in a range format should be interpreted in a flexible manner to include not only the numerical values explicitly recited as the limits of the range, but also to include all the individual numerical values or sub-ranges encompassed within that range as if each numerical value and sub-range is explicitly recited. For example, a range of "about 0.1% to about 5%" or "about 0.1% to 5%" should be interpreted to include
- 5 -
SUBSTITUTE SHEET ( RULE 26) not just about 0.1% to about 5%, but also the individual values (e.g., 1%, 2%, 3%, and 4%) and the sub-ranges (e.g.. 0.1% to 0.5%, 1.1% to 2.2%, 3.3% to 4.4%) within the indicated range. The statement "about X to Y" has the same meaning as "about X to about Y," unless indicated otherwise. Likewise, the statement "about X, Y, or about Z" has the same meaning as "about X, about Y, or about Z," unless indicated otherwise.
In this document, the terms "a," "an," or "the" are used to include one or more than one unless the context clearly dictates otherwise. The term "or" is used to refer to a nonexclusive "or" unless otherwise indicated. The statement "at least one of A and B" or "at least one of A or B" has the same meaning as "A, B, or A and B." In addition, it is to be understood that the phraseology or terminology employed herein, and not otherwise defined, is for the purpose of description only and not of limitation. Any use of section headings is intended to aid reading of the document and is not to be interpreted as limiting; information that is relevant to a section heading may occur within or outside of that particular section. All publications, patents, and patent documents referred to in this document are incorporated by reference herein in their entirety, as though individually incorporated by reference.
In the methods described herein, the acts can be carried out in any order, except when a temporal or operational sequence is explicitly recited. Furthermore, specified acts can be carried out concurrently unless explicit claim language recites that they be carried out separately. For example, a claimed act of doing X and a claimed act of doing Y can be conducted simultaneously within a single operation, and the resulting process will fall within the literal scope of the claimed process.
Definitions
The term "about" as used herein can allow for a degree of variability in a value or range, for example, within 10%, within 5%, or within 1% of a stated value or of a stated limit of a range, and includes the exact stated value or range.
The term "substantially" as used herein refers to a majority of, or mostly, as in at least about 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, 99.99%, or at least about 99.999% or more, or 100%. The term "substantially free of1 as used herein can mean having none or having a trivial amount of, such that the amount of material present does not affect the material properties of the composition including the material, such that the composition is about 0 wt% to about 5 wt% of the material, or about 0 wt% to about 1 wt%, or about 5 wt% or less, or less than, equal to, or greater than about 4.5 wt%, 4, 3.5, 3, 2.5, 2, 1.5, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, 0.1, 0.01, or about 0.001 wt% or less. The term
- 6 -
SUBSTITUTE SHEET ( RULE 26) "substantially free of1 can mean having a trivial amount of, such that a composition is about 0 wt% to about 5 wt% of the material, or about 0 wt% to about 1 wt%, or about 5 wt% or less, or less than, equal to, or greater than about 4.5 wt%, 4, 3.5, 3, 2.5, 2, 1.5, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, 0.1, 0.01, or about 0.001 wt% or less, or about 0 wt%.
The term "organic group" as used herein refers to any carbon-containing functional group. Examples can include an oxygen-containing group such as an alkoxy group, aryloxy group, aralkyloxy group, oxo(carbonyl) group; a carboxyl group including a carboxylic acid, carboxylate, and a carboxylate ester; a sulfur-containing group such as an alkyl and aryl sulfide group; and other heteroatom-containing groups. Non-limiting examples of organic groups include OR, OOR, OC(O)N(R)2, CN, CF3, OCF3, R, C(O), methylenedioxy, ethylenedioxy, N(R)2, SR, SOR, SO2R, SO2N(R)2, SO3R, C(O)R, C(O)C(O)R, C(O)CH2C(O)R, C(S)R, C(O)OR, OC(O)R, C(O)N(R)2, OC(O)N(R)2, C(S)N(R)2, (CH2)O- 2N(R)C(O)R, (CH2)O-2N(R)N(R)2, N(R)N(R)C(O)R, N(R)N(R)C(O)OR, N(R)N(R)CON(R)2, N(R)SO2R, N(R)SO2N(R)2, N(R)C(O)OR, N(R)C(O)R, N(R)C(S)R, N(R)C(O)N(R)2, N(R)C(S)N(R)2, N(COR)COR, N(OR)R, C(=NH)N(R)2, C(O)N(OR)R, C(=NOR)R, and substituted or unsubstituted (Ci-Cioo)hydrocarbyl, wherein R can be hydrogen (in examples that include other carbon atoms) or a carbon-based moiety, and wherein the carbon-based moiety can be substituted or unsubstituted.
The term "substituted" as used herein in conjunction with a molecule or an organic group as defined herein refers to the state in which one or more hydrogen atoms contained therein are replaced by one or more non-hydrogen atoms. The term "functional group" or "substituent" as used herein refers to a group that can be or is substituted onto a molecule or onto an organic group. Examples of substituents or functional groups include, but are not limited to, a halogen (e.g, F, Cl, Br, and I); an oxygen atom in groups such as hydroxy groups, alkoxy groups, aryloxy groups, aralkyloxy groups, oxo(carbonyl) groups, carboxyl groups including carboxylic acids, carboxylates, and carboxylate esters; a sulfur atom in groups such as thiol groups, alkyl and aryl sulfide groups, sulfoxide groups, sulfone groups, sulfonyl groups, and sulfonamide groups; a nitrogen atom in groups such as amines, hydroxyamines, nitriles, nitro groups, N-oxides, hydrazides, azides, and enamines; and other heteroatoms in various other groups. Non-limiting examples of substituents that can be bonded to a substituted carbon (or other) atom include F, Cl, Br, I, OR, OC(O)N(R)2, CN, NO, NO2, ONO2, azido, CF3, OCF3, R, O (oxo), S (thiono), C(O), S(O), methylenedioxy, ethylenedioxy, N(R)2, SR, SOR, SO2R, SO2N(R)2, SO3R, C(O)R, C(O)C(O)R, C(O)CH2C(O)R, C(S)R, C(O)OR, OC(O)R, C(O)N(R)2, OC(O)N(R)2, C(S)N(R)2, (CH2)O-
- 7 -
SUBSTITUTE SHEET ( RULE 26) 2N(R)C(O)R, (CH2)O-2N(R)N(R)2, N(R)N(R)C(O)R, N(R)N(R)C(O)OR, N(R)N(R)C0N(R)2, N(R)SO2R, N(R)SO2N(R)2, N(R)C(O)OR, N(R)C(O)R, N(R)C(S)R, N(R)C(0)N(R)2, N(R)C(S)N(R)2, N(COR)COR, N(OR)R, C(=NH)N(R)2, C(O)N(OR)R, and C(=NOR)R, wherein R can be hydrogen or a carbon-based moiety; for example, R can be hydrogen, (Ci- Cioo)hydrocarbyl, alkyl, acyl, cycloalkyd, aryl, aralkyl, heterocyclyl, heteroaryl, or heteroarylalkyl; or wherein two R groups bonded to a nitrogen atom or to adjacent nitrogen atoms can together with the nitrogen atom or atoms form a heterocyclyl.
The term "alkyl" as used herein refers to straight chain and branched alkyl groups and cycloalkyl groups having from 1 to 40 carbon atoms, 1 to about 20 carbon atoms, 1 to 12 carbons or, in some embodiments, from 1 to 8 carbon atoms. Examples of straight chain alkyl groups include those with from 1 to 8 carbon atoms such as methyl, ethyl, n-propyl, n- butyl, n-pentyl, n-hexyl, n-heptyl, and n-octyl groups. Examples of branched alkyd groups include, but are not limited to, isopropyl, iso-butyl, sec-butyl, t-butyl, neopentyl, isopentyl, and 2,2-dimethylpropyl groups. As used herein, the term "alkyl" encompasses n-alkyl, isoalkyl, and anteisoalkyl groups as well as other branched chain forms of alkyl. Representative substituted alkyl groups can be substituted one or more times with any of the groups listed herein, for example, amino, hydroxy, cyano, carboxy, nitro, thio, alkoxy, and halogen groups.
The term "alkenyl" as used herein refers to straight and branched chain and cyclic alkyl groups as defined herein, except that at least one double bond exists between two carbon atoms. Thus, alkenyl groups have from 2 to 40 carbon atoms, or 2 to about 20 carbon atoms, or 2 to 12 carbon atoms or, in some embodiments, from 2 to 8 carbon atoms. Examples include, but are not limited to vinyl, -CH=C=CCH2, -CH=CH(CH3), - CH=C(CH3)2, -C(CH3)=CH2, -C(CH3)=CH(CH3), -C(CH2CH3)=CH2, cyclohexenyl, cyclopentenyl, cyclohexadienyl, butadienyl, pentadienyl, and hexadienyl among others.
The term "alkynyl" as used herein refers to straight and branched chain alkyl groups, except that at least one triple bond exists between two carbon atoms. Thus, alkynyl groups have from 2 to 40 carbon atoms, 2 to about 20 carbon atoms, or from 2 to 12 carbons or, in some embodiments, from 2 to 8 carbon atoms. Examples include, but are not limited to - C =CH. -C =C(CH,). -C =C(CH2CHfi. -CH2OCH, -CH2OC(CH3), and -CH2C^C(CH2CH3) among others.
The term "acyl" as used herein refers to a group containing a carbonyl moiety wherein the group is bonded via the carbonyl carbon atom. The carbonyl carbon atom is bonded to a
- 8 -
SUBSTITUTE SHEET ( RULE 26) hydrogen forming a "formyl" group or is bonded to another carbon atom, which can be part of an alkyl, aryl, aralkyl cycloalkyl, cycloalkylalkyl, heterocyclyl, heterocyclylalkyl, heteroaryl, heteroarylalkyl group or the like. An acyl group can include 0 to about 12, 0 to about 20, or 0 to about 40 additional carbon atoms bonded to the carbonyl group. An acyl group can include double or triple bonds within the meaning herein. An acryloyl group is an example of an acyl group. An acyl group can also include heteroatoms within the meaning herein. A nicotinoyl group (pyridyl-3-carbonyl) is an example of an acyl group within the meaning herein. Other examples include acetyl, benzoyl, phenylacetyl, pyridylacetyl, cinnamoyl, and acryloyl groups and the like. When the group containing the carbon atom that is bonded to the carbonyl carbon atom contains a halogen, the group is termed a "haloacyl" group. An example is a trifluoroacety l group.
The term "cycloalky l" as used herein refers to cyclic alkyd groups such as, but not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl groups. In some embodiments, the cycloalky l group can have 3 to about 8-12 ring members, whereas in other embodiments the number of ring carbon atoms range from 3 to 4, 5, 6, or 7. Cycloalkyl groups further include polycyclic cycloalkyl groups such as, but not limited to, norbomyl, adamantyl, bomyl, camphenyl, isocamphenyl, and carenyl groups, and fused rings such as, but not limited to, decalinyl, and the like. Cycloalkyl groups also include rings that are substituted with straight or branched chain alkyl groups as defined herein. Representative substituted cycloalkyl groups can be mono-substituted or substituted more than once, such as, but not limited to, 2,2-, 2,3-, 2,4- 2,5- or 2,6-disubstituted cyclohexyl groups or mono-, di- or tri-substituted norbomyl or cycloheptyl groups, which can be substituted with, for example, amino, hydroxy, cyano, carboxy, nitro, thio, alkoxy, and halogen groups. The term "cycloalkenyl" alone or in combination denotes a cyclic alkenyl group.
The term "aryl" as used herein refers to cyclic aromatic hydrocarbon groups that do not contain heteroatoms in the ring. Thus aryl groups include, but are not limited to, phenyl, azulenyl, heptalenyl, biphenyl, indacenyl, fluorenyl, phenanthrenyl, triphenylenyl, pyrenyl, naphthacenyl, chrysenyl, biphenylenyl, anthracenyl, and naphthyl groups. In some embodiments, aryl groups contain about 6 to about 14 carbons in the ring portions of the groups. Aryl groups can be unsubstituted or substituted, as defined herein. Representative substituted ary l groups can be mono-substituted or substituted more than once, such as, but not limited to, a phenyl group substituted at any one or more of 2-, 3-, 4-, 5-, or 6-positions of the phenyl ring, or a naphthyl group substituted at any one or more of 2- to 8-positions thereof.
- 9 -
SUBSTITUTE SHEET ( RULE 26) The term "aralkyl" as used herein refers to alkyl groups as defined herein in which a hydrogen or carbon bond of an alky l group is replaced with a bond to an aryl group as defined herein. Representative aralkyl groups include benzyl and phenylethyl groups and fused (cycloalkylaryl)alkyl groups such as 4-ethyl-indanyl. Aralkenyl groups are alkenyl groups as defined herein in which a hydrogen or carbon bond of an alkyl group is replaced with a bond to an aryl group as defined herein.
The term "heterocyclyl" as used herein refers to aromatic and non-aromatic ring compounds containing three or more ring members, of which one or more is a heteroatom such as, but not limited to, N, 0, and S. Thus, a heterocyclyl can be a cycloheteroalkyl, or a heteroaryl, or if polycyclic, any combination thereof. In some embodiments, heterocyclyl groups include 3 to about 20 ring members, whereas other such groups have 3 to about 15 ring members. The term heterocyclyl includes rings where a CH2 group in the ring is replaced by one or more C=O groups, such as found in cyclic ketones, lactones, and lactams. Examples of heterocyclyl groups containing a C=O group include, but are not limited to, 0- propiolactam, y-butyrolactam, 8-valerolactam, and s-caprolactam, as well as the corresponding lactones. A heterocyclyl group designated as a C2-heterocyclyl can be a 5-ring with two carbon atoms and three heteroatoms, a 6-ring with two carbon atoms and four heteroatoms and so forth. Likewise a C4-heterocyclyl can be a 5-ring with one heteroatom, a 6-ring with two heteroatoms, and so forth. The number of carbon atoms plus the number of heteroatoms equals the total number of ring atoms. A heterocyclyl ring can also include one or more double bonds. A heteroaryl ring is an embodiment of a heterocyclyl group. The phrase "heterocyclyl group" includes fused ring species including those that include fused aromatic and non-aromatic groups. For example, a dioxolanyl ring and a benzdioxolanyl ring system (methylenedioxyphenyl ring system) are both heterocyclyl groups within the meaning herein. The phrase also includes polycyclic ring systems containing a heteroatom such as, but not limited to, quinuclidyl. Heterocyclyl groups can be unsubstituted, or can be substituted as discussed herein. Heterocyclyl groups include, but are not limited to, pyrrolidinyl, piperidinyl, piperazinyl, morpholinyl, pyrrolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, thiazolyl, pyridinyl, thiophenyl, benzothiophenyl, benzofuranyl, dihydrobenzofuranyl, indolyl, dihydroindolyl, azaindolyl, indazolyl, benzimidazolyl, azabenzimidazolyl, benzoxazolyl, benzothiazolyl, benzothiadiazolyl, imidazopyridinyl, isoxazolopyridinyl, thianaphthalenyl, purinyl, xanthinyl, adeninyl, guaninyl, quinolinyl, isoquinolinyl, tetrahydroquinolinyl, quinoxalinyl, and quinazolinyl groups. Representative substituted heterocyclyl groups can be mono-substituted or substituted more than once, such
- 10 -
SUBSTITUTE SHEET ( RULE 26) as, but not limited to, piperidinyl or quinolinyl groups, which are 2-, 3-, 4-, 5-, or 6- substituted, or disubstituted with groups such as those listed herein.
The term "heteroaryl" as used herein refers to aromatic ring compounds containing 5 or more ring members, of which, one or more is a heteroatom such as, but not limited to, N, 0, and S; for instance, heteroaryl rings can have 5 to about 8-12 ring members. A heteroaryl group is a variety of a heterocyclyl group that possesses an aromatic electronic structure. A heteroaryl group designated as a C2-heteroaryl can be a 5-ring with two carbon atoms and three heteroatoms, a 6-ring with two carbon atoms and four heteroatoms and so forth. Likewise a C4-heteroaryl can be a 5-ring with one heteroatom, a 6-ring with two heteroatoms, and so forth. The number of carbon atoms plus the number of heteroatoms sums up to equal the total number of ring atoms. A heterocyclyl ring designated Cx-y can be any ring containing 'x' members up to 'y' members, including all intermediate integers between 'x' and 'y ' and that contains one or more heteroatoms, as defined herein. In a ring designated Cx-y, all non-heteroatom members are carbon. Heterocyclyl rings designated Cx-y can also be polycyclic ring systems, such as bicyclic or tricyclic ring systems. Heteroaryl groups include, but are not limited to, groups such as pyrrolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, thiazolyl, pyridinyl, thiophenyl, benzothiophenyl, benzofuranyl, indolyl, azaindolyl, indazolyl, benzimidazolyl, azabenzimidazolyl, benzoxazolyl, benzothiazolyl, benzothiadiazolyl, imidazopyridinyl, isoxazolopyridinyl, thianaphthalenyl, purinyl, xanthinyl, adeninyl, guaninyl, quinolinyl, isoquinolinyl, tetrahydroquinolinyl, quinoxalinyl, and quinazolinyl groups. Heteroaryl groups can be unsubstituted, or can be substituted with groups as is discussed herein. Representative substituted heteroaryl groups can be substituted one or more times with groups such as those listed herein.
Additional examples of aryl and heteroaryl groups include but are not limited to phenyl, biphenyl, indenyl, naphthyl (1 -naphthyl, 2-naphthyl), N-hydroxytetrazolyl, N- hydroxytnazolyl, N-hydroxyimidazolyl, anthracenyl (1-anthracenyl, 2-anthracenyl, 3- anthracenyl), thiophenyl (2 -thienyl, 3-thienyl), furyl (2 -furyl, 3-furyl) , indolyl, oxadiazolyl, isoxazolyl, quinazolinyl, fluorenyl, xanthenyl, isoindanyl, benzhydryl, acridinyl, thiazolyl, pyrrolyl (2-pyrrolyl), pyrazolyl (3-pyrazolyl), imidazolyl (1 -imidazolyl, 2-imidazolyl, 4-imidazolyl, 5-imidazolyl), triazolyl (1,2,3-triazol-l-yl, l,2,3-triazol-2-yl l,2,3-triazol-4-yl, 1 ,2,4-triazol-3-yl), oxazolyl (2-oxazolyl, 4-oxazolyl, 5-oxazolyl), thiazolyl (2 -thiazolyl, 4- thiazolyl, 5-thiazolyl), pyridyl (2-pyndyl, 3-pyridyl, 4-pyridyl), pyrimidinyl (2-pyrimidinyl, 4-pyrimidinyl, 5 -pyrimidinyl, 6-pyrimidinyl), pyrazinyl, pyridazinyl (3- pyridazinyl, 4- pyridazinyl, 5 -pyridazinyl), quinolyl (2-quinolyl, 3-quinolyl, 4-quinolyl, 5-quinolyl, 6-
- 11 -
SUBSTITUTE SHEET ( RULE 26) quinolyl, 7-quinolyl, 8-quinolyl), isoquinolyl (1 -isoquinolyl, 3-isoquinolyl, 4-isoquinolyl, 5- isoquinolyl, 6-isoquinolyl, 7-isoquinolyl, 8-isoquinolyl), benzo[b]furanyl (2-benzo[b] furanyl, 3-benzo[b]furanyl, 4-benzo[b]furanyl, 5-benzo[b]furanyl, 6-benzo[b]furanyl, 7- benzo[b] furanyl), 2,3-dihydro-benzo[b]furanyl (2-(2,3-dihydro-benzo[b]furanyl), 3-(2,3- dihydro-benzo[b] furanyl), 4-(2,3-dihydro-benzo[b]furanyl), 5-(2,3-dihydro-benzo[b]furanyl),
6-(2,3-dihydro-benzo[b]furanyl), 7-(2,3-dihydro-benzo[b]furanyl), benzo[b]thiophenyl (2- benzo[b]thiophenyl, 3-benzo[b]thiophenyl, 4-benzo[b]thiophenyl, 5-benzo[b]thiophenyl, 6- benzo[b]thiophenyl, 7-benzo[b]thiophenyl), 2,3-dihydro-benzo[b]thiophenyl, (2-(2,3- dihydro-benzo[b]thiophenyl), 3-(2,3-dihydro-benzo[b]thiophenyl), 4-(2,3-dihydro- benzo[b]thiophenyl), 5-(2,3-dihydro-benzo[b]thiophenyl), 6-(2,3-dihydro- benzo[b]thiophenyl), 7-(2,3-dihydro-benzo[b]thiophenyl), indolyl (1-indolyl, 2-indolyl,
3-indolyl, 4-indolyl, 5-indolyl, 6-indolyl, 7-indolyl), indazole (1-indazolyl, 3-indazolyl,
4-indazolyl, 5-indazolyl, 6-indazolyl, 7-indazolyl), benzimidazolyl (1 -benzimidazolyl, 2-benzimidazolyl, 4-benzimidazolyl, 5 -benzimidazolyl, 6-benzimidazolyl, 7-benzimidazolyl, 8-benzimidazolyl), benzoxazolyl (1-benzoxazolyl, 2-benzoxazolyl), benzothiazolyl (1- benzothiazolyl, 2-benzothiazolyl, 4-benzothiazolyl, 5 -benzothiazolyl, 6-benzothiazolyl,
7-benzothiazolyl), carbazolyl (1-carbazolyl, 2-carbazolyl, 3-carbazolyl, 4-carbazolyl), 5H-dibenz[b,f| azepine (5H-dibenz[b,f| azepin- 1-yl, 5H-dibenz[b,f|azepine-2-yl, 5H-dibenz[b,f|azepine-3-yl, 5H-dibenz[b,f|azepine-4-yl, 5H-dibenz[b,f|azepine-5-yl),
10,1 l-dihydro-5H-dibenz[b,f| azepine (10,1 l-dihydro-5H-dibenz[b,f|azepine-l-yl,
10,1 l-dihydro-5H-dibenz[b,f|azepine-2-yl, 10,1 l-dihydro-5H-dibenz[b,f]azepine-3-yl,
10,1 l-dihydro-5H-dibenz[b,f|azepine-4-yl, 10,1 l-dihydro-5H-dibenz[b,f|azepine-5-yl), and the like.
The term "heterocyclylalkyl" as used herein refers to alkyl groups as defined herein in which a hydrogen or carbon bond of an alkyl group as defined herein is replaced with a bond to a heterocyclyl group as defined herein. Representative heterocyclyl alkyl groups include, but are not limited to, furan-2-yl methyl, furan-3-yl methyl, pyridine-3-yl methyl, tetrahydrofuran-2-yl ethyl, and indol-2-yl propyl.
The term "heteroarylalkyl" as used herein refers to alkyd groups as defined herein in which a hydrogen or carbon bond of an alkyl group is replaced with a bond to a heteroaryl group as defined herein.
The term "alkoxy" as used herein refers to an oxygen atom connected to an alkyl group, including a cycloalkyl group, as are defined herein. Examples of linear alkoxy groups include but are not limited to methoxy, ethoxy, propoxy, butoxy, pentyloxy, hexyloxy, and
- 12 -
SUBSTITUTE SHEET ( RULE 26) the like. Examples of branched alkoxy include but are not limited to isopropoxy, sec-butoxy, tert-butoxy, isopentyloxy, isohexyloxy, and the like. Examples of cyclic alkoxy include but are not limited to cyclopropyloxy, cyclobutyloxy, cyclopentyloxy, cyclohexyloxy, and the like. An alkoxy group can include about 1 to about 12, about 1 to about 20, or about 1 to about 40 carbon atoms bonded to the oxygen atom, and can further include double or triple bonds, and can also include heteroatoms. For example, an allyloxy group or a methoxyethoxy group is also an alkoxy group within the meaning herein, as is a methylenedi oxy group in a context where two adjacent atoms of a structure are substituted therewith.
The term "amine" as used herein refers to primary, secondary, and tertiary amines having, e.g, the formula N(group)s wherein each group can independently be H or non-H, such as alkyl, aryl, and the like. Amines include but are not limited to R-NH2, for example, alkylamines, arylamines, alkylarylamines; R2NH wherein each R is independently selected, such as dialkylamines, diarylamines, aralkylamines, heterocyclylamines and the like; and R3N wherein each R is independently selected, such as trialkylamines, dialkylarylamines, alkyldiarylamines, triarylamines, and the like. The term "amine" also includes ammonium ions as used herein.
The term "amino group" as used herein refers to a substituent of the form -NH2, - NHR, -NR2, -NR3 +, wherein each R is independently selected, and protonated forms of each, except for -NR3+, which cannot be protonated. Accordingly, any compound substituted with an ammo group can be viewed as an amine. An "amino group" within the meaning herein can be a primary, secondary', tertiary, or quaternary amino group. An "alkylamino" group includes a monoalkylamino, dialkylammo, and trialkylamino group.
The terms "halo," "halogen," or "halide" group, as used herein, by themselves or as part of another substituent, mean, unless otherwise stated, a fluorine, chlorine, bromine, or iodine atom.
The term "haloalkyl" group, as used herein, includes mono-halo alkyl groups, polyhalo alkyl groups wherein all halo atoms can be the same or different, and per-halo alky l groups, wherein all hydrogen atoms are replaced by halogen atoms, such as fluoro. Examples of haloalkyl include trifluoromethyl, 1,1 -dichloroethyl, 1,2-di chloroethyl, l,3-dibromo-3,3- difluoropropyl, perfluorobutyl, and the like.
The terms "epoxy-functional" or "epoxy-substituted" as used herein refers to a functional group in which an oxygen atom, the epoxy substituent, is directly attached to two adjacent carbon atoms of a carbon chain or ring system. Examples of epoxy-substituted
- 13 -
SUBSTITUTE SHEET ( RULE 26) functional groups include, but are not limited to, 2,3 -epoxy propyl, 3 ,4-epox buty 1, 4,5- epoxypentyl, 2,3-epoxypropoxy, epoxypropoxypropyl, 2-glycidoxyethyl, 3-glycidoxypropyl, 4-glycidoxybutyl, 2’(giycidoxycarbonyl)propyl, 3-(3,4-epoxycylohexyl)propyl, 2-(3 ,4- epoxy cyclohexyl)ethyl, 2-(2,3-epoxycylopentyl)ethyl, 2-(4-methyl-3,4- epoxycyclohexyl propyl, 2-(3,4-epoxy-3-methylcylohexyl)-2-methylethyl, and 5,6- epoxy hexyl.
The term "monovalent" as used herein refers to a substituent connecting via a single bond to a substituted molecule. When a substituent is monovalent, such as, for example, F or Cl, it is bonded to the atom it is substituting by a single bond.
The term "hydrocarbon" or "hydrocarbyl" as used herein refers to a molecule or functional group that includes carbon and hydrogen atoms. The term can also refer to a molecule or functional group that normally includes both carbon and hydrogen atoms but wherein all the hydrogen atoms are substituted with other functional groups.
As used herein, the term "hydrocarbyl" refers to a functional group derived from a straight chain, branched, or cyclic hydrocarbon, and can be alkyl, alkenyl, alkynyl, aryl, cycloalkyl, acyl, or any combination thereof. Hydrocarbyl groups can be shown as (Ca- Cb)hydrocarbyl, wherein a and b are integers and mean having any of a to b number of carbon atoms. For example, (Ci-Ci)hydrocarbyl means the hydrocarbyl group can be methyl (Ci), ethyl (C2), propyl (C3), or butyl (C4), and (Co-Cb)hydrocarbyl means in certain embodiments there is no hydrocarbyl group.
The term "solvent" as used herein refers to a liquid that can dissolve a solid, liquid, or gas. Non-limiting examples of solvents are silicones, organic compounds, water, alcohols, ionic liquids, and supercritical fluids.
The term "independently selected from" as used herein refers to referenced groups being the same, different, or a mixture thereof, unless the context clearly indicates otherwise. Thus, under this definition, the phrase "X1, X2, and X3 are independently selected from noble gases" would include the scenario where, for example, X1, X2, and X3 are all the same, where X1, X2, and X3 are all different, where X1 and X2 are the same but X3 is different, and other analogous permutations.
The term "room temperature" as used herein refers to a temperature of about 15 °C to 28 °C.
The term "standard temperature and pressure" as used herein refers to 20 °C and 101 kPa.
- 14 -
SUBSTITUTE SHEET ( RULE 26) As used herein, the term "composition" or "pharmaceutical composition" refers to a mixture of at least one compound described herein with a pharmaceutically acceptable carrier. The pharmaceutical composition facilitates administration of the compound to a patient or subject. Multiple techniques of administering a compound exist in the art including, but not limited to, intravenous, oral, aerosol, parenteral, ophthalmic, pulmonary and topical administration.
A "disease" is a state of health of an animal wherein the animal cannot maintain homeostasis, and wherein if the disease is not ameliorated then the animal's health continues to deteriorate.
In contrast, a "disorder" in an animal is a state of health in which the animal is able to maintain homeostasis, but in which the animal's state of health is less favorable than it would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the animal's state of health.
As used herein, the terms "effective amount," "pharmaceutically effective amount" and "therapeutically effective amount" refer to a nontoxic but sufficient amount of an agent to provide the desired biological result. That result may be reduction and/or alleviation of the signs, symptoms, or causes of a disease, or any other desired alteration of a biological system. An appropriate therapeutic amount in any individual case may be determined by one of ordinary skill in the art using routine experimentation.
As used herein, the term "efficacy" refers to the maximal effect (Emax) achieved within an assay.
As used herein, the term "pharmaceutically acceptable" refers to a material, such as a carrier or diluent, which does not abrogate the biological activity or properties of the compound, and is relatively non-toxic, z.e., the material may be administered to an individual without causing undesirable biological effects or interacting in a deleterious manner with any of the components of the composition in which it is contained.
As used herein, the language "pharmaceutically acceptable salt" refers to a salt of the administered compounds prepared from pharmaceutically acceptable non-toxic acids or bases, including inorganic acids or bases, organic acids or bases, solvates, hydrates, or clathrates thereof.
Suitable pharmaceutically acceptable acid addition salts may be prepared from an inorganic acid or from an organic acid. Examples of inorganic acids include hydrochloric, hydrobromic, hydriodic, nitric, carbonic, sulfuric (including sulfate and hydrogen sulfate), and phosphoric acids (including hydrogen phosphate and dihydrogen phosphate).
- 15 -
SUBSTITUTE SHEET ( RULE 26) Appropriate organic acids may be selected from aliphatic, cycloaliphatic, aromatic, araliphatic, heterocyclic, carboxylic and sulfonic classes of organic acids, examples of which include formic, acetic, propionic, succinic, glycolic, gluconic, lactic, malic, tartaric, citric, ascorbic, glucuronic, maleic, malonic, saccharin, fumaric, pyruvic, aspartic, glutamic, benzoic, anthranilic, 4-hydroxybenzoic, phenylacetic, mandelic, embonic (pamoic), methanesulfonic, ethanesulfonic, benzenesulfonic, pantothenic, trifluoromethanesulfonic, 2- hydroxyethanesulfonic, p-toluenesulfonic, sulfanilic, cyclohexylaminosulfonic, stearic, alginic, P-hydroxybutyric, salicylic, galactaric and galacturonic acid.
Suitable pharmaceutically acceptable base addition salts of compounds described herein include, for example, ammonium salts, metallic salts including alkali metal, alkaline earth metal and transition metal salts such as, for example, calcium, magnesium, potassium, sodium and zinc salts. Pharmaceutically acceptable base addition salts also include organic salts made from basic amines such as, for example, N,N'-dibenzylethylene-diamine, chloroprocaine, choline, diethanolamine, ethylenediamine, meglumine (N-methylglucamine) and procaine. All of these salts may be prepared from the corresponding compound by reacting, for example, the appropriate acid or base with the compound.
As used herein, the term "pharmaceutically acceptable earner" or "pharmaceutically acceptable excipient" means a pharmaceutically acceptable material, composition or carrier, such as a liquid or solid filler, stabilizer, dispersing agent, suspending agent, diluent, excipient, thickening agent, solvent or encapsulating material, involved in carrying or transporting a compound described herein within or to the patient such that it may perform its intended function. Typically, such constructs are carried or transported from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation, including the compound(s) described herein, and not injurious to the patient. Some examples of materials that may serve as pharmaceutically acceptable carriers include: sugars, such as lactose, glucose and sucrose; starches, such as com starch and potato starch; cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients, such as cocoa butter and suppository waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, com oil and soybean oil; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents, such as magnesium hydroxide and aluminum hydroxide; surface active agents; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; phosphate buffer
- 16 -
SUBSTITUTE SHEET ( RULE 26) solutions; and other non-toxic compatible substances employed in pharmaceutical formulations. As used herein, "pharmaceutically acceptable carrier" also includes any and all coatings, antibacterial and antifungal agents, and absorption delaying agents, and the like that are compatible with the activity of the compound(s) described herein, and are physiologically acceptable to the patient. Supplementary active compounds may also be incorporated into the compositions. The "pharmaceutically acceptable carrier" may further include a pharmaceutically acceptable salt of the compound(s) described herein. Other additional ingredients that may be included in the pharmaceutical compositions used with the methods or compounds described herein are known in the art and described, for example in Remington's Pharmaceutical Sciences (Genaro, Ed., Mack Publishing Co., 1985, Easton, PA), which is incorporated herein by reference.
The terms "patient," "subject," or "individual" are used interchangeably herein, and refer to any animal, or cells thereof whether in vitro or in situ, amenable to the methods described herein. In a non-limiting embodiment, the patient, subject or individual is a human.
As used herein, the term "potency" refers to the dose needed to produce half the maximal response (ED50).
A "therapeutic" treatment is a treatment administered to a subject who exhibits signs of pathology, for the purpose of diminishing or eliminating those signs.
As used herein, the term "treatment" or "treating" is defined as the application or administration of a therapeutic agent, i.e., a compound or compounds as described herein (alone or in combination with another pharmaceutical agent), to a patient, or application or administration of a therapeutic agent to an isolated tissue or cell line from a patient (e.g, for diagnosis or ex vivo applications), who has a condition contemplated herein or a symptom of a condition contemplated herein, with the purpose to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve or affect a condition contemplated herein, or the symptoms of a condition contemplated herein. Such treatments may be specifically tailored or modified, based on knowledge obtained from the field of pharmacogenomics.
Preparation of Compounds
Compounds of Formula la, Formula lb, Formula Ila, Formula lib or otherwise described herein can be prepared using the synthetic method known by those skilled in the art. The following examples illustrate non-limiting embodiments of the compound(s) described herein and their preparation.
- 17 -
SUBSTITUTE SHEET ( RULE 26)
Figure imgf000020_0001
Formula la
Provided herein is a compound Formula la or pharmaceutically acceptable salts, solvates, or N-oxides thereof. In the compound of Formula la,
R1 and R2 are each independently selected from the group consisting of hydrogen, 1- 10 amino acids, C1-20 alkyl, -C(=O)Ra, -C(=O)ORa, -CH(R)OC(=O)Ra, -CH2R', - CH(aryl)CH2C(=O)Ra, -CH2N(R')C(=O)Ra, -C(=NH)CH3, and =C(R')(R’); or
R1 and R2 combine with the N atom to which they are bound so as to form a 5 or 6-membered heterocycle;
R3 and R4 are each independently selected from the group consisting of hydrogen, 1- 10 ammo acids, C1-20 alkyl, -C(=O)Rb, -C(=O)ORb, -CH(R")OC(=O)Rb, -CH2R", - CH(Ar)CH2C(=O)CH3, -CH2N(R")C(=O)Rb, -C(=NH)CH3, and =C(R")(R"); or
R3 and R4 combine with the N atom to which they are bound so as to form a 5 or 6-membered heterocycle;
R5 is selected from the group consisting of hydrogen, 1-10 amino acids, C1-20 alkyl, and Rc; each occurrence of Ra, Rb, and Rc is independently selected from the group consisting of hydrogen, C1-10 alkyl, C2-10 alkenyl, C2-10 alkynyl, Ce-io aryl, and C5-10 heteroaryl, and combinations thereof; each occurrence of R1 and R" is independently selected from the group consisting of hydrogen, C1-10 alkyd, C2-io alkenyl, C2-io alkynyl, Ce-io aryl, C5-10 heteroaryl, halogen, OH, CN, Ci-10 alkoxy, and combinations thereof.
In various embodiments, a compound of Formula lb is provided:
Figure imgf000020_0002
Formula lb
In one embodiment, R1 and R2 or R3 and R4 join together to form a tetrahydrothiadiazine-2-thione of Formula Ila or lib:
- 18 -
SUBSTITUTE SHEET ( RULE 26)
Figure imgf000021_0001
(lib), where N* is a nitrogen atom from the compound of Formula la or lb (a nitrogen present in the ornithine moiety), and X is the remainder of the ornithine moiety as defined herein.
As used herein, the term "1-10 amino acids" refers to attachment of 1, 2, 3, 4, 5, 6, 7,
8, 9, or 10 amino acids via amide bonds. The amino acids can be any combination of amino acids Ala, Arg, Asn, Asp, Cys, Glu, Gin, Gly, His, He, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Vai.
As used herein, the term Formula I refers to a compound of Formula la, a compound of Formula lb, and/or mixtures thereof in any proportion.
As used herein, the term Formula II refers to a compound of Formula Ila, a compound of Formula lib, and/or mixtures thereof in any proportion.
Compounds of Formula I or Formula II can be any of the organic or inorganic acid addition salts described herein. In various embodiments, the compound of Formula I or
Formula II is a hydrochloride salt. In various embodiments, the compound of Formula I or Formula II is a salt of an acidic amino acid, such as an Asp or Glu salt. In various embodiments, R1, R2, R3, R4, and R5 are hydrogen.
In various embodiments, the compound of Formula I has the structure:
Figure imgf000021_0003
Compounds of Formula I or Formula II can be in zwitterionic form, or a pharmaceutically acceptable salt thereof, for example,
Figure imgf000021_0002
SUBSTITUTE SHEET ( RULE 26) The compounds described herein can possess one or more stereocenters, and each stereocenter can exist independently in either the (R) or (<S) configuration. In certain embodiments, compounds described herein are present in optically active or racemic forms. It is to be understood that the compounds described herein encompass racemic, optically - active, regioisomeric and stereoisomeric forms, or combinations thereof that possess the therapeutically useful properties described herein. Preparation of optically active forms is achieved in any suitable manner, including by way of non-limiting example, by resolution of the racemic form with recrystallization techniques, synthesis from optically-active starting materials, chiral synthesis, or chromatographic separation using a chiral stationary phase. In certain embodiments, a mixture of one or more isomer is utilized as the therapeutic compound described herein. In other embodiments, compounds described herein contain one or more chiral centers. These compounds are prepared by any means, including stereoselective synthesis, enantioselective synthesis and/or separation of a mixture of enantiomers and/ or diastereomers. Resolution of compounds and isomers thereof is achieved by any means including, by way of non-limiting example, chemical processes, enzymatic processes, fractional crystallization, distillation, and chromatography.
The methods and formulations described herein include the use of N-oxides (if appropriate), crystalline forms (also known as polymorphs), solvates, amorphous phases, and/or pharmaceutically acceptable salts of compounds having the structure of any compound(s) described herein, as well as metabolites and active metabolites of these compounds having the same type of activity. Solvates include water, ether (e.g, tetrahydrofuran, methyl tert-butyl ether) or alcohol (e.g, ethanol) solvates, acetates and the like. In certain embodiments, the compounds described herein exist in solvated forms with pharmaceutically acceptable solvents such as water, and ethanol. In other embodiments, the compounds described herein exist in unsolvated form.
In certain embodiments, the compound(s) described herein can exist as tautomers. All tautomers are included within the scope of the compounds presented herein.
In certain embodiments, compounds described herein are prepared as prodrugs. A "prodrug" refers to an agent that is converted into the parent drug in vivo. In certain embodiments, upon in vivo administration, a prodrug is chemically converted to the biologically, pharmaceutically or therapeutically active form of the compound. In other embodiments, a prodrug is enzymatically metabolized by one or more steps or processes to the biologically, pharmaceutically or therapeutically active form of the compound.
- 20 -
SUBSTITUTE SHEET ( RULE 26) In certain embodiments, sites on, for example, the aromatic ring portion of compound(s) described herein are susceptible to various metabolic reactions. Incorporation of appropriate substituents on the aromatic ring structures may reduce, minimize or eliminate this metabolic pathway. In certain embodiments, the appropriate substituent to decrease or eliminate the susceptibility of the aromatic ring to metabolic reactions is, by way of example only, a deuterium, a halogen, or an alkyl group.
Compounds described herein also include isotopically -labeled compounds wherein one or more atoms is replaced by an atom having the same atomic number, but an atomic mass or mass number different from the atomic mass or mass number usually found in nature. Examples of isotopes suitable for inclusion in the compounds described herein include and are not limited to 2H, 3H, nC, 13C, 14C, 36C1, 18F, 1231, 125I, 13N, 15N, 15O, 170, 180, 32P, and 35S. In certain embodiments, isotopically -labeled compounds are useful in drug and/or substrate tissue distribution studies. In other embodiments, substitution with heavier isotopes such as deuterium affords greater metabolic stability (for example, increased in vivo half-life or reduced dosage requirements). In yet other embodiments, substitution with positron emitting isotopes, such as nC, 18F, 15O and 13N, is useful in Positron Emission Topography (PET) studies for examining substrate receptor occupancy. Isotopically-labeled compounds are prepared by any suitable method or by processes using an appropriate isotopically-labeled reagent in place of the non-labeled reagent otherwise employed.
In certain embodiments, the compounds described herein are labeled by other means, including, but not limited to, the use of chromophores or fluorescent moieties, bioluminescent labels, or chemiluminescent labels.
The compounds described herein, and other related compounds having different substituents are synthesized using techniques and materials described herein and as described, for example, in Fieser & Fieser's Reagents for Organic Synthesis, Volumes 1-17 (John Wiley and Sons, 1991); Rodd's Chemistry of Carbon Compounds, Volumes 1-5 and Suppiementals (Elsevier Science Publishers, 1989); Organic Reactions, Volumes 1-40 (John Wiley and Sons, 1991), Larock's Comprehensive Organic Transformations (VCH Publishers Inc., 1989), March, Advanced Organic Chemistry 4th Ed., (Wiley 1992); Carey & Sundberg, Advanced Organic Chemistry 4th Ed., Vols. A and B (Plenum 2000,2001), and Green & Wuts, Protective Groups in Organic Synthesis 3rd Ed., (Wiley 1999) (all of which are incorporated by reference for such disclosure). General methods for the preparation of compound as described herein are modified by the use of appropriate reagents and conditions, for the introduction of the various moieties found in the formula as provided herein.
- 21 -
SUBSTITUTE SHEET ( RULE 26) Compounds described herein are synthesized using any suitable procedures starting from compounds that are available from commercial sources, or are prepared using procedures described herein.
In certain embodiments, reactive functional groups, such as hydroxyl, amino, imino, thio or carboxy groups, are protected in order to avoid their unwanted participation in reactions. Protecting groups are used to block some or all of the reactive moieties and prevent such groups from participating in chemical reactions until the protective group is removed. In other embodiments, each protective group is removable by a different means. Protective groups that are cleaved under totally disparate reaction conditions fulfill the requirement of differential removal.
In certain embodiments, protective groups are removed by acid, base, reducing conditions (such as, for example, hydrogenolysis), and/or oxidative conditions. Groups such as trityl, dimethoxytrityl, acetal and t-butyldimethylsilyl are acid labile and are used to protect carboxy and hydroxy reactive moieties in the presence of amino groups protected with Cbz groups, which are removable by hydrogenolysis, and Fmoc groups, which are base labile. Carboxylic acid and hydroxy reactive moieties are blocked with base labile groups such as, but not limited to, methyl, ethyl, and acetyl, in the presence of amines that are blocked with acid labile groups, such as t-butyl carbamate, or with carbamates that are both acid and base stable but hydrolytically removable.
In certain embodiments, carboxylic acid and hydroxy reactive moieties are blocked with hydrolytically removable protective groups such as the benzyl group, while amine groups capable of hydrogen bonding with acids are blocked with base labile groups such as Fmoc. Carboxylic acid reactive moieties are protected by conversion to simple ester compounds as exemplified herein, which include conversion to alkyl esters, or are blocked with oxidatively-removable protective groups such as 2,4-dimethoxybenzyl, while coexisting amino groups are blocked with fluoride labile silyl carbamates.
Allyl blocking groups are useful in the presence of acid- and base- protecting groups since the former are stable and are subsequently removed by metal or pi-acid catalysts. For example, an allyl-blocked carboxylic acid is deprotected with a palladium-catalyzed reaction in the presence of acid labile t-butyl carbamate or base-labile acetate amine protecting groups. Yet another form of protecting group is a resin to which a compound or intermediate is attached. As long as the residue is attached to the resin, that functional group is blocked and does not react. Once released from the resin, the functional group is available to react.
Typically blocking/protecting groups may be selected from:
- 22 -
SUBSTITUTE SHEET ( RULE 26)
Figure imgf000025_0001
Other protecting groups, plus a detailed description of techniques applicable to the creation of protecting groups and their removal are described in Greene & Wuts, Protective Groups in Organic Synthesis, 3rd Ed., John Wiley & Sons, New York, NY, 1999, and Kocienski, Protective Groups, Thieme Verlag, New York, NY, 1994, which are incorporated herein by reference for such disclosure.
Compositions
The compositions containing the compound(s) described herein include a pharmaceutical composition comprising at least one compound as described herein and at least one pharmaceutically acceptable carrier. In certain embodiments, the composition is formulated for an administration route such as oral or parenteral, for example, transdermal, transmucosal (e.g, sublingual, lingual, (trans)buccal, (trans)urethral, vaginal (e.g., trans- and perivaginally), (intra)nasal and (trans)rectal, intravesical, intrapulmonary, intraduodenal, intragastrical, intrathecal, subcutaneous, intramuscular, intradermal, intra-arterial, intravenous, intrabronchial, inhalation, and topical administration.
Methods
The disclosure includes a method of treating, ameliorating, and/or preventing an inflammatory disease, inflammatory disorder, or inflammation in a subject using the compounds of Formula I or Formula II. Non-limiting examples of inflammatory diseases or disorders include arthritis juvenile arthritis, spondylitis, leprosy, Crohn's disease, ulcerative colitis, inflammatory bowel syndrome, and/or Rh factor arthritis. The method of treating,
- 23 -
SUBSTITUTE SHEET ( RULE 26) ameliorating, and/or preventing an inflammatory disease, inflammatory disorder, or inflammation includes administering to the subject a therapeutically effective amount of a compound of Formula I or Formula II.
The disclosure also includes a method of improving the efficacy of antibacterial agents or improving the ability of a subject to fight off a bacterial infection. In certain embodiments, the method includes administering to the subject a therapeutically effective amount of a compound of Formula I or Formula II.
The compounds of Formula I or Formula II are optionally administered with an additional agent that is useful for treating, ameliorating, or preventing an inflammatory disease, inflammatory disorder, or inflammation in a subject. Such additional agents include steroids and/or NSAIDs (non-steroidal anti-inflammatory drugs). Non-limiting examples of steroids include corticosteroids such as triamcinolone, cortisone, prednisone, methylprednisolone, and the like. Non-liming examples of NSAIDs include aspirin, celecoxib, diclofenac, diflunisal, etodolac, fenoprofen, flurbiprofen, ibuprofen, naproxen, and the like. The additional anti-inflammatory agents can be administered sequentially or concurrently with the compounds of Formula I or Formula II.
The compounds of Formula I or Formula II are optionally administered with an additional agent that is an antibacterial agent. Any antibacterial agent can be used, including but not limited to penicillins, tetracyclines, cephalosporins, quinolones, lincomycins, macrolides, sulfonamides, glycopeptides, aminoglycosides, carbapenems, and the like.
The laccase domain-containing 1 protein (LACC1) serves a central regulatory role in a variety of inflammatory diseases and is expressed predominantly in myeloid cells. LACC1, also known as C13orf31 or FAMIN, is robustly activated by lipopolysaccharide (LPS) or poly-I:C in mouse bone marrow derived macrophages (BMDMs). Consistent with LACC1 activity in inflammatory Ml macrophages, its expression is induced by macrophage colonystimulating factor (M-CSF) in an AKT-mTOR-dependent manner during human monocytemacrophage differentiation. Frame-shift mutations and single-nucleotide polymorphisms K38E, 1254 and C284R in LACC1 identified in genome-wide association studies (GWAS) are correlated with early-onset Crohn’s disease (CD), ankylosing spondylitis, systemic juvenile idiopathic arthritis (JIA), and a high-risk state for leprosy (Mycobacterium leprae infections). Mouse models deficient in LACC1 showed exacerbated arthritis, psoriasis, T cell transfer colitis (Rag2'/_ background), and intestinal bacterial infection (Citrobacter rodentium and Salmonella enterica serovar Typhimurium).
- 24 -
SUBSTITUTE SHEET ( RULE 26) Mouse LACC1 (mLACCl) deficient animals exhibited elevated proinflammatory cytokines and worsened intestinal bacterial clearance, supporting both anti-inflammatory and antibacterial functions. Yet how such an enzyme could mediate such broad effects was unclear. Recently, human LACC1 (hLACCl) was shown to interact with a family of autophagy-associated proteins, including autophagy inducers RACK1 and AMPK, and Laccl deficiency reduced autophagic flux in primary human macrophages, defining a novel form of genetically inherited JIA associated with impaired autophagy in macrophages.
This is consistent with enhanced expression of autophagy proteins in wildtype (WT) relative to Laccl'1' mouse BMDMs and partial restoration of LACC1 -mediated bacterial clearance in the presence of the autophagy inducer rapamycin. While LACC1 was reported to participate in several purine nucleotide metabolic reactions in mouse BMDMs, these biochemical activities do not explain the autophagy phenotype. Overall, these findings support LACC1 as an important regulator of macrophage immunometabolic function, but the major catalytic roles required for LACC1 function in inflammatory macrophages remained unknown.
To establish the biochemical function of LACC1, in vitro biochemical assays were first conducted using isolated recombinant mLACCl. Mouse and human LACC1 amino acid sequences predict a multi-copper polyphenol oxidoreductase laccase-like domain (pfam02578). To first establish the metal composition of the enzyme, isolated mLACCl was analyzed versus vector control using inductively coupled plasma mass spectrometry (ICP- MS) (FIG. 5A-5B). However, specific enrichment of Zn (0.94 metal: enzyme ratio) was observed, whereas there was no enrichment of Cu or other transition metals, suggesting that LACC1 is rather a Zn-dependent metalloenzyme. To establish a physiologically-relevant substrate mixture for LACC1, a Laccl''' mouse model was generated and the metabolites extracted from its isolated inflammatory Ml BMDM cells (FIG. 1 A). In certain non-limiting embodiments, the LACC1 substrates can accumulate in these cells. The metabolite extract was incubated with mLACCl (1 h; 37°C) in phosphate buffered saline supplemented with Zn2+ and then analyzed by ultra-performance liquid chromatography quadrupole time-of- flight mass spectrometry (UPLC-QTOF-MS). The metabolomics data were processed and presented as a volcano plot showing fold change (FC) versus false discovery rate (FDR) values. Intriguingly, L-Om was the most upregulated metabolite among significant hits (FDR <0.05) under these conditions (positive ion mode, FIG. IB; negative ion mode, FIG. 5D). L- Om is a product of L-Arg metabolism, which is the major metabolism classification between
- 25 -
SUBSTITUTE SHEET ( RULE 26) classical and alternatively activated macrophages. In inflammatory macrophages, L-Arg is metabolized to NO and L-Cit viaNOS2. By contrast, in IL-4 stimulated anti-inflammatory macrophages, L-Arg is metabolized to L-Om and urea via arginase.
To validate the enzymatic transformation observed, assays were performed using L- Arg, L-argininosuccinate (L-ArgSuc), or L-Cit and found that L-Cit was the only viable substrate (FIG. 1C). The stereoconfiguration of product L-Om was confirmed via Marfey’s analysis (FIG. 51). To assess the catalytic efficiencies and roles of putative hLACCl disease polymorphisms, enzyme kinetic analysis of isolated WT mLACCl and hLACCl and the polymorphic human enzyme variants: K38E, I254V and C284R were also conducted. Michaelis-Menten kinetics were established using varying L-Cit substrate concentrations and measuring L-Om product concentrations over time by liquid chromatography triple quadrupole mass spectrometry (LC-QQQ-MS) (pH 7.4, FIG. ID; pH rate profiling, FIG. 5E; FIG. 6A-FIG. 6E). mLACCl and hLACCl showed comparable binding (Km) and catalytic turnover (fcat) values (FIG. IF), supporting a conserved biochemical activity between mice and humans.
Disease associated human polymorphisms I254V and C284R exhibited a significant reduction in turnover (feat) and overall catalytic efficiency (WKm), providing a catalytic mechanistic contribution to their associated immunopathologies (see below). However, disease-correlative mutant K38E showed improved catalytic efficiency and binding (Km), which would accelerate the timing of the response in inflammatory macrophages (z.e., LACC1 response would occur sooner with accumulating NOS2-derived L-Cit in this variant versus wildtype). Finally, consistent with the present metal analysis, presence of metal- (ethylenediaminetetraacetic acid, EDTA) or Zn2+-specific (N,N,N',N'-tetrakis (2- pyridylmethyl) ethane- 1,2-diamine, TPEN) chelators in the reaction buffer significantly inhibited LACC1 activity (FIG. 5F).
While it was established that LACC1 cleaves L-Cit to L-Om, the second fragment of the reaction could not be identified under the conditions of the studies. To directly characterize the unidentified fragment, the mLACCl reaction with 6-13Ci-labelled L-Cit in D2O was analyzed by nuclear magnetic resonance (NMR) spectroscopy (FIG. 1H). Strikingly, it was established that LACC1 is a novel HNCO synthase, converting L-Cit to L- Om and the RCS-like molecule HNCO (FIG. 1G), which was confirmed using a standard of its conjugate base, sodium cyanate ( OCN) (FIG. 1H). Only three carbon peaks were observed for this fragment, which correspond to different protonation states of the product. To detect HNCO, a carbamoylation reagent associated with uraemic syndrome, by MS, 2-
- 26 -
SUBSTITUTE SHEET ( RULE 26) aminobenzoate-HNCO carbamoylation assays were conducted and the product measured by LC-QQQ-MS. End-point HNCO production under saturating substrate conditions was consistent wi th the present L-Om kinetic measurements, including a significant reduction of activity in the human I254V and C284R mutants (FIG. IE). Strikingly, these data suggest that LACC1 has a previously unrecognized role in L-Arg metabolism in inflammatory macrophages, bridging NOS2-derived L-Cit formation with L-Om, a precursor in polyamine signaling, and HNCO, an RCS-like cytotoxin.
To probe the molecular mechanism of LACC1 in inflammatory BMDMs and mice, wBMDMs were first culturedfrom WT and LaccL'~ mice and stimulated with lipopolysaccharide (LPS) and interferon-y (IFNy) for 16 hours. Key proinflammatory cytokines such as TNFa, IL6 and IL12b were upregulated \n Laccl" BMDMs (FIG. 2A, FIG. 7I-FIG. 7K), further supporting the anti-inflammatory function of LACC1. To test the function of LACC1 products on cytokine regulation, chemical complementation studies were conducted using exogenous L-Om and HNCO in Laccl’1’ BMDMs. Importantly, supplementation with L-Om, but not HNCO, could significantly complement Laccl cytokine suppression (FIG. 2A, FIG. 7I-FIG. 7K). To validate whether L-Om could complement Laccl antibacterial deficiency in vivo, Salmonella Typhimurium infection in WT and 7.occL ~ mice was performed with or without L-Om in the drinking water. In the absence of L-Om, the body weight loss of Laccl" mice was significantly higher than WT littermates (FIG. 2B). This phenotype was accompanied with worsened survival and severe bacterial burden in the feces, caecum, spleen and liver of Laccl~L mice compared to controls (FIGs. 2C-2G). These data are consistent with LACCL s antibacterial role. Strikingly, 1% L-Om in the drinking water significantly complemented Laccl deficiency in vivo (FIGs. 2B-2G). Indeed, this oral administration of L-Om significantly improved the effects of weight loss, survival, and bacterial burden. In the absence of S. Typhimurium infection, 1% L-Om in the drinking water did not perturb the body weight of WT or Laccl~'~ mice, supporting its immunological role during infection (FIG. 8). To further validate whether the function of LACC1 depends on its enz matic activity', LacclC284R/C284R mice were constructed and subjected to the same A. Ty phimurium infection experiment. LacclC284R/C284R mice showed an intermediate phenotype with exacerbated bacterial infection and more severe bacterial burden (FIG. 7A-FIG. 7E), which was consistent with the LacclJ~ mouse studies and the C284R mutant biochemical studies. Moreover, inflammamtory BMDMs from the LacclC284R/C284R mice showed an intermediate elevation of TNFa, IL6 and IL12b upon LPS and IFNy stimulation (FIG. 7F-
- 27 -
SUBSTITUTE SHEET ( RULE 26) FIG. 7H). These data suggest that the evaluated anti-inflammatory and antibacterial functions of LACC1 are primarily mediated by L-Om and that the human disease associated mutation reduces catalytic efficiency and confers a deficient antibacterial response in vivo.
In macrophages, L-Om is decarboxylated by ornithine decarboxylase 1 (ODC1) to produce putrescine for polyamine synthesis. Odel expression is upregulated during bacterial infections. During polyamine synthesis, L-methionine (L-Met) is converted into S-adenosyl- L-methionine (AdoMet or SAM), which is then decarboxylated by AdoMet decarboxylase (AdoMetDC) to produce decarboxylated AdoMet (dcAdoMet or dcSAM). dcSAM is then used as an aminopropyl group donor by spermidine synthase (SRM) to convert putrescine into spermidine and spermine synthase (SMS) to convert spermidine into spermine (FIG. 11A). To examine the impact of the enzymatic function of LACC1 on poly amine synthesis in BMDMs, BMDMs from WT and /.occ7" mice supplemented with l,2,3,4,5-13Cs labeled L- Cit during Ml differentiation were first cultured. Indeed, significantly reduced 13C-L-Om, 13C-putrescine (13C-Put), 13C-spermidine (13C-Spd), and 13C-spermine (13C-Spm) were observed in inflammatory BMDMs fromZacc7 /_ mice than those from WT mice (FIG. 3 A).
Additionally, there was a consistent inverse relationship with dcSAM production, but its enhancement in LaccT1' BMDMs was not statistically significant (FIG. 9A-FIG. 9B). Because L-Cit can also be recycled to L-Arg via ASS1 and ASL and ARG2 can directly convert L-Arg to L-Om in IL-4 activated macrophages, additional 13C-L-Arg, 13C-L-Cit, and 13C-L-ArgSuc isotope feeding experiments were performed in the presence or absence of a NOS2 inhibitor, 1400W, or an ARG2 inhibitor, CB-1158 (FIG. 9C-FIG. 9E). While the present data support that NOS2 is the major source of L-Cit, which can indeed be recycled to L-Arg, in inflammatory macrophages as anticipated, inactivation of LACC1 significantly reduces 13C-L- Arg-mediated polyamine labeling regardless of inhibitor and consistent with the present hypothesis. No significant LACC1 effects were observed in the 13C-L-ArgSuc feeding studies. These data support LACC1 as a contributor to L-Cit-mediated poly amine synthesis in inflammatory macrophages (FIG. 3B).
Because L-Cit is derived from NOS2 in inflammatory macrophages, in certain nonlimiting embodiments, LACC1 function can be dependent upon NOS2 as the latter provides the substrate for the former (FIG. 4A). To test this hypothesis, NosZ^ mice were bred with LaccT mice to generate Nos2-Laccl double knockout mice and measured their performance in vivo relative to controls in the S. Typhimurium infection model. It was observed that NOS2 protected mice from 5. Typhimurium infection based on body weight loss, survival, and bacterial burden in feces and invaded organs as anticipated (FIGs. 4B-4G), consistent with
- 28 -
SUBSTITUTE SHEET ( RULE 26) the diminished killing of S. Typhimurium by macrophages from Aos2/_ mice. However, the antibacterial function of LACC1 was abolished in Nos2 deficient mice relative to the double knockout mice (FIGs. 4B-4G). Consistent with the present biochemical model and BMDM results, these mouse model data suggest that the observed LACC1 function is dependent on NOS2.
To test whether the L-Om-polyamine axis is necessary for the anti-inflammatory and antibacterial function of LACC1, the enzymatic activity of ODC1 was blocked using the irreversible ODC1 inhibitor a-difluoromethylomithine (DFMO) in BMDMs (FIG. 4A). In contrast to cells treated with solvent vehicle, the secreted proinflammatory cytokines TNFo, IL6 and IL 12b in DFMO treated BMDMs remained unchanged between WT and Laccl^ BMDMs following LPS and IFNy stimulation, supporting that LACC1 can suppress proinflammatory cytokine production via the downstream polyamine pathway (FIGs. 4H-4J). DFMO treated inflammatory BMDMs were also infected with S. Typhimurium. Although the normalized intracellular bacterial CFUs/macrophage remained unchanged with DFMO treatment (FIG. 4K), the lactate dehydrogenase (LDH) activity assay showed that irreversible inhibition of ODC1 phenocopied exacerbated S. Typhimurium induced cell death from Laccl^' inflammatory BMDMs (FIG. 4L). This phenotype was not complemented using exogenous putrescine treatment, possibly due to dose related toxicity limiting the concentration of exogenous poly amine that could be employed (FIG. 10E).
These data suggest that intracellular LACC1 -mediated poly amine signaling protects macrophages from S. Typhimurium induced cell death, thereby enhancing antibacterial function. Thus, LACC1 contributes to anti-inflammatory and antibacterial functions through the L-Om-polyamine immunometabolism signaling axis (FIG. 5). The RCS-like cytotoxin and carbamoylation reagent HNCO likely contributes as an antimicrobial and signaling molecule, but the present evaluation of activities with exogenous OCN supplementation could be masked by the overall effects of cellular ROS, RNS, and RCS in these inflammatory macrophage phenotypes.
Taken together, these results can explain how loss of Laccl function in inflammatory macrophages leads to both augmented inflammatory signaling and cell death, which is consistent with both the immunopathologies and antibacterial roles associated with LACC1 in mouse models and in critical human diseases. The inflammation equilibrium of LACC1 is analogous to other immunometabolism pathways in macrophages, such as the proinflammatory succinate- and downstream anti-inflammatory and antimicrobial itaconate signaling axis that is the result of a rewired tricarboxylic acid (TCA) cycle in activated Ml
- 29 -
SUBSTITUTE SHEET ( RULE 26) macrophages. While other enzymatic activities of LACC1 may contribute, the present results support a molecular mechanism in which LACC1 is a central immunometabolic regulator in L-Arg macrophage metabolism, and they reveal the missing mechanistic connection between proinflammatory NOS2 signaling and subsequent anti-inflammatory polyamine-mediated cytokine suppression, antioxidant activity, and autophagy stimulation (FIG. 1 IB).
Indeed, polyamines such as spermidine have been reported to: 1) have a role in decreasing oxidative damage, although the mechanism is unclear; 2) stimulate autophagy in mammalian cells; and 3) alleviate experimental autoimmune encephalomyelitis through inducing inhibitory macrophages. In M2 anti-inflammatory macrophages, poly amine biosynthesis modulates mitochondrial metabolism through eIF5A hypusination, maintaining the TCA cycle and the electron transport chain (ETC) mtegnty. In addition to supporting polyamine metabolism, LACC1 serves as an unprecedented endogenous mammalian HNCO synthase, an activity observed for antimicrobial myeloperoxidase only with specific exogenous environmental metabolites from high-fat diet and chronic exposure to cyanide, mimicking exposure to pollution and smoking. While other activities of LACC1 -mediated L- Om and HNCO production in cells cannot be ruled out, the present molecular studies support an alternative immunometabolic proposal for LACC1 in autophagy regulation through its contribution to polyamine synthesis in addition to its reported interaction with autophagyinducing proteins, RACK1 and AMPK. These findings suggest that L-Om could serve as a novel nutraceutical to ameliorate LACC1 -associated immunological and autoimmune dysfunctions.
The methods described herein include administering to the subject a therapeutically effective amount of at least one compound described herein, which is optionally formulated in a pharmaceutical composition. In various embodiments, a therapeutically effective amount of at least one compound described herein present in a pharmaceutical composition is the only therapeutically active compound in a pharmaceutical composition. In certain embodiments, the method further comprises administering to the subject an additional therapeutic agent that treats an inflammatory disease.
In certain embodiments, administering the compound(s) described herein to the subject allows for administering a lower dose of the additional therapeutic agent as compared to the dose of the additional therapeutic agent alone that is required to achieve similar results in treating an inflammatory disease in the subject. For example, in certain embodiments, the compound(s) described herein enhance(s) the activity of the additional therapeutic
- 30 -
SUBSTITUTE SHEET ( RULE 26) compound, thereby allowing for a lower dose of the additional therapeutic compound to provide the same effect.
In certain embodiments, the compound(s) described herein and the therapeutic agent are co-administered to the subject. In other embodiments, the compound(s) described herein and the therapeutic agent are coformulated and co-administered to the subject.
In certain embodiments, the subject is a mammal. In other embodiments, the mammal is a human.
Combination Therapies
The compounds useful within the methods described herein can be used in combination with one or more additional therapeutic agents useful for treating, ameliorating, and/or preventing an inflammatory disease. These additional therapeutic agents may comprise compounds that are commercially available or synthetically accessible to those skilled in the art. These additional therapeutic agents are known to treat or reduce the symptoms of an inflammatory disease.
In various embodiments, a synergistic effect is observed when a compound as described herein is administered with one or more additional therapeutic agents or compounds. A synergistic effect may be calculated, for example, using suitable methods such as, for example, the Sigmoid-Emax equation (Holford & Scheiner, 1981, Clin. Pharmacokinet. 6:429-453), the equation of Loewe additivity (Loewe & Muischnek, 1926, Arch. Exp. Pathol Pharmacol. 114:313-326) and the median-effect equation (Chou & Talalay, 1984, Adv. Enzyme Regul. 22:27-55). Each equation referred to above may be applied to experimental data to generate a corresponding graph to aid in assessing the effects of the drug combination. The corresponding graphs associated with the equations referred to above are the concentration-effect curve, isobologram curve and combination index curve, respectively.
Administration/Dosage/Formulations
The regimen of administration may affect what constitutes an effective amount. The therapeutic formulations may be administered to the subject either prior to or after the onset of an inflammatory disease. Further, several divided dosages, as well as staggered dosages may be administered daily or sequentially, or the dose may be continuously infused, or maybe a bolus injection. Further, the dosages of the therapeutic formulations may be proportionally increased or decreased as indicated by the exigencies of the therapeutic or prophylactic situation.
- 31 -
SUBSTITUTE SHEET ( RULE 26) Administration of the compositions described herein to a patient, preferably a mammal, more preferably a human, may be carried out using known procedures, at dosages and for periods of time effective to treat an inflammatory disease in the patient. An effective amount of the therapeutic compound necessary to achieve a therapeutic effect may vary according to factors such as the state of the disease or disorder in the patient; the age, sex, and weight of the patient; and the ability of the therapeutic compound to treat an inflammatory disease in the patient. Dosage regimens may be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation. A nonlimiting example of an effective dose range for a therapeutic compound described herein is from about 1 and 5,000 mg/kg of body weight/per day. One of ordinary skill in the art would be able to study the relevant factors and make the determination regarding the effective amount of the therapeutic compound without undue experimentation.
Actual dosage levels of the active ingredients in the pharmaceutical compositions described herein may be varied so as to obtain an amount of the active ingredient that is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient.
In particular, the selected dosage level depends upon a variety of factors including the activity of the particular compound employed, the time of administration, the rate of excretion of the compound, the duration of the treatment, other drugs, compounds or materials used in combination with the compound, the age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well, known in the medical arts.
A medical doctor, e.g, physician or veterinarian, having ordinary skill in the art may readily determine and prescribe the effective amount of the pharmaceutical composition required. For example, the physician or veterinarian could start doses of the compounds described herein employed in the pharmaceutical composition at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved.
In particular embodiments, it is especially advantageous to formulate the compound in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the patients to be treated; each unit containing a predetermined quantity of therapeutic compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical vehicle.
- 32 -
SUBSTITUTE SHEET ( RULE 26) The dosage unit forms of the compound(s) described herein are dictated by and directly dependent on (a) the unique characteristics of the therapeutic compound and the particular therapeutic effect to be achieved, and (b) the limitations inherent in the art of compounding/formulating such a therapeutic compound.
In certain embodiments, the compositions described herein are formulated using one or more pharmaceutically acceptable excipients or carriers. In certain embodiments, the pharmaceutical compositions described herein comprise a therapeutically effective amount of a compound described herein and a pharmaceutically acceptable carrier.
The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity may be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms may be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it is preferable to include isotonic agents, for example, sugars, sodium chloride, or polyalcohols such as mannitol and sorbitol, in the composition. Prolonged absorption of the injectable compositions may be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate or gelatin.
In certain embodiments, the compositions described herein are administered to the patient in dosages that range from one to five times per day or more. In other embodiments, the compositions described herein are administered to the patient in range of dosages that include, but are not limited to, once every day, every two, days, every three days to once a week, and once every two weeks. It is readily apparent to one skilled in the art that the frequency of administration of the various combination compositions described herein varies from individual to individual depending on many factors including, but not limited to, age, disease or disorder to be treated, gender, overall health, and other factors. Thus, administration of the compounds and compositions described herein should not be construed to be limited to any particular dosage regime and the precise dosage and composition to be administered to any patient is determined by the attending physician taking all other factors about the patient into account.
The compound(s) described herein for administration may be in the range of from about 1 pg to about 10,000 mg, about 20 pg to about 9,500 mg, about 40 pg to about 9,000 mg, about 75 pg to about 8,500 mg, about 150 pg to about 7,500 mg, about 200 pg to about
- 33 -
SUBSTITUTE SHEET ( RULE 26) 7,000 mg, about 350 pg to about 6,000 mg, about 500 ig to about 5,000 mg, about 750 pig to about 4,000 mg, about 1 mg to about 3,000 mg, about 10 mg to about 2,500 mg, about 20 mg to about 2,000 mg, about 25 mg to about 1,500 mg, about 30 mg to about 1,000 mg, about 40 mg to about 900 mg, about 50 mg to about 800 mg, about 60 mg to about 750 mg, about 70 mg to about 600 mg, about 80 mg to about 500 mg, and any and all whole or partial increments therebetween.
In some embodiments, the dose of a compound described herein is from about 1 mg and about 2,500 mg. In some embodiments, a dose of a compound described herein used in compositions described herein is less than about 10,000 mg, or less than about 8,000 mg, or less than about 6,000 mg, or less than about 5,000 mg, or less than about 3,000 mg, or less than about 2,000 mg, or less than about 1,000 mg, or less than about 500 mg, or less than about 200 mg, or less than about 50 mg. Similarly, in some embodiments, a dose of a second compound as described herein is less than about 1,000 mg, or less than about 800 mg, or less than about 600 mg, or less than about 500 mg, or less than about 400 mg, or less than about 300 mg, or less than about 200 mg, or less than about 100 mg, or less than about 50 mg, or less than about 40 mg, or less than about 30 mg, or less than about 25 mg, or less than about 20 mg, or less than about 15 mg, or less than about 10 mg, or less than about 5 mg, or less than about 2 mg, or less than about 1 mg, or less than about 0.5 mg, and any and all whole or partial increments thereof.
In certain embodiments, a composition as described herein is a packaged pharmaceutical composition comprising a container holding a therapeutically effective amount of a compound described herein, alone or in combination with a second pharmaceutical agent; and instructions for using the compound to treat, prevent, or reduce one or more symptoms of an inflammatory disease in a patient.
Formulations may be employed in admixtures with conventional excipients, i.e., pharmaceutically acceptable organic or inorganic carrier substances suitable for oral, parenteral, nasal, intravenous, subcutaneous, enteral, or any other suitable mode of administration, known to the art. The pharmaceutical preparations may be sterilized and if desired mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure buffers, coloring, flavoring and/or aromatic substances and the like. They may also be combined where desired with other active agents, e.g., other analgesic agents.
Routes of administration of any of the compositions described herein include oral, nasal, rectal, intravaginal, parenteral, buccal, sublingual or topical. The compounds for use in
- 34 -
SUBSTITUTE SHEET ( RULE 26) the compositions described herein can be formulated for administration by any suitable route, such as for oral or parenteral, for example, transdermal, transmucosal (e.g, sublingual, lingual, (trans)buccal, (trans)urethral, vaginal (e.g, trans- and perivaginally), (intra)nasal and (trans)rectal), intravesical, intrapulmonary, intraduodenal, intragastrical, intrathecal, subcutaneous, intramuscular, intradermal, intra-arterial, intravenous, intrabronchial, inhalation, and topical administration.
Suitable compositions and dosage forms include, for example, tablets, capsules, caplets, pills, gel caps, troches, dispersions, suspensions, solutions, syrups, granules, beads, transdermal patches, gels, powders, pellets, magmas, lozenges, creams, pastes, plasters, lotions, discs, suppositories, liquid sprays for nasal or oral administration, dry powder or aerosolized formulations for inhalation, compositions and formulations for intravesical administration and the like. It should be understood that the formulations and compositions described herein are not limited to the particular formulations and compositions that are described herein.
Oral Administration
For oral application, particularly suitable are tablets, dragees, liquids, drops, suppositories, or capsules, caplets and gelcaps. The compositions intended for oral use may be prepared according to any method known in the art and such compositions may contain one or more agents selected from the group consisting of inert, non-toxic pharmaceutically excipients that are suitable for the manufacture of tablets. Such excipients include, for example an inert diluent such as lactose; granulating and disintegrating agents such as cornstarch; binding agents such as starch; and lubricating agents such as magnesium stearate. The tablets may be uncoated or they may be coated by known techniques for elegance or to delay the release of the active ingredients. Formulations for oral use may also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert diluent.
For oral administration, the compound(s) described herein can be in the form of tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g., polyvinylpyrrolidone, hydroxypropylcellulose or hydroxypropyl methylcellulose); fillers (e.g., cornstarch, lactose, microcrystalline cellulose or calcium phosphate); lubricants (e.g., magnesium stearate, talc, or silica); disintegrates (e.g., sodium starch glycollate); or wetting agents (e.g., sodium lauryl sulphate). If desired, the tablets may be coated using suitable methods and coating materials such as OPADRY™ film coating systems available from Colorcon, West Point, Pa. (e.g., OPADRY™ OY Type, OYC Type, Organic Enteric OY-P Type, Aqueous Enteric OY-A Type, OY-PM Type and
- 35 -
SUBSTITUTE SHEET ( RULE 26) OPADRY™ White, 32K18400). Liquid preparation for oral administration may be in the form of solutions, syrups or suspensions. The liquid preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, methyl cellulose or hydrogenated edible fats); emulsifying agent (e.g, lecithin or acacia); non-aqueous vehicles (e.g, almond oil, oily esters or ethyl alcohol); and preservatives (e.g, methyl or propyl p-hydroxy benzoates or sorbic acid).
Compositions as described herein can be prepared, packaged, or sold in a formulation suitable for oral or buccal administration. A tablet that includes a compound as described herein can, for example, be made by compressing or molding the active ingredient, optionally with one or more additional ingredients. Compressed tablets may be prepared by compressing, in a suitable device, the active ingredient in a free-flowing form such as a powder or granular preparation, optionally mixed with one or more of a binder, a lubricant, an excipient, a surface active agent, and a dispersing agent. Molded tablets may be made by molding, in a suitable device, a mixture of the active ingredient, a pharmaceutically acceptable carrier, and at least sufficient liquid to moisten the mixture. Pharmaceutically acceptable excipients used in the manufacture of tablets include, but are not limited to, inert diluents, granulating and disintegrating agents, dispersing agents, surface-active agents, disintegrating agents, binding agents, and lubricating agents.
Suitable dispersing agents include, but are not limited to, potato starch, sodium starch gly collate, poloxamer 407, or poloxamer 188. One or more dispersing agents can each be individually present in the composition in an amount of about 0.01% w/w to about 90% w/w relative to weight of the dosage form. One or more dispersing agents can each be individually present in the composition in an amount of at least, greater than, or less than about 0.01%, 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90% w/w relative to weight of the dosage form.
Surface-active agents (surfactants) include cationic, anionic, or non-ionic surfactants, or combinations thereof. Suitable surfactants include, but are not limited to, behentrimonium chloride, benzalkonium chloride, benzethonium chloride, benzododecinium bromide, carbethopendecinium bromide, cetalkonium chloride, cetrimonium bromide, cetrimonium chloride, cetylpyndine chloride, didecyldimethylammonium chloride, dimethyldioctadecylammonium bromide, dimethyldioctadecylammomum chloride, domiphen bromide, lauryl methyl gluceth-10 hydroxypropyl dimonium chloride, tetramethylammonium hydroxide, thonzonium bromide, stearalkonium chloride, octenidine dihydrochloride, olaflur,
- 36 -
SUBSTITUTE SHEET ( RULE 26) N-oleyl-l,3-propanediamine, 2-acrylamido-2-methylpropane sulfonic acid, alkylbenzene sulfonates, ammonium lauryl sulfate, ammonium perfluorononanoate, docusate, disodium cocoamphodiacetate, magnesium laureth sulfate, perfluorobutanesulfonic acid, perfluorononanoic acid, perfluorooctanesulfonic acid, perfluorooctanoic acid, potassium lauryl sulfate, sodium alkyl sulfate, sodium dodecyl sulfate, sodium laurate, sodium laureth sulfate, sodium lauroyl sarcosinate, sodium myreth sulfate, sodium nonanoyloxybenzenesulfonate, sodium pareth sulfate, sodium stearate, sodium sulfosuccinate esters, cetomacrogol 1000, cetostearyl alcohol, cetyl alcohol, cocamide diethanolamine, cocamide monoethanolamine, decyl glucoside, decyl polyglucose, glycerol monostearate, octylphenoxypolyethoxyethanol CA-630, isoceteth-20, lauryl glucoside, octylphenoxypolyethoxyethanol P-40, Nonoxynol-9, Nonoxynols, nonyl phenoxypolyethoxylethanol (NP-40), octaethylene glycol monododecyl ether, N-octyl beta- D-thioglucopyranoside, octyl glucoside, oleyl alcohol, PEG-10 sunflower glycerides, pentaethylene glycol monododecyl ether, polidocanol, poloxamer, poloxamer 407, polyethoxylated tallow amine, polyglycerol polyricinoleate, polysorbate, polysorbate 20, polysorbate 80, sorbitan, sorbitan monolaurate, sorbitan monostearate, sorbitan tristearate, stearyl alcohol, surfactin, Triton X-100, and Tween 80. One or more surfactants can each be individually present in the composition in an amount of about 0.01% w/w to about 90% w/w relative to weight of the dosage form. One or more surfactants can each be individually present in the composition in an amount of at least, greater than, or less than about 0.01%, 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90% w/w relative to weight of the dosage form.
Suitable diluents include, but are not limited to, calcium carbonate, magnesium carbonate, magnesium oxide, sodium carbonate, lactose, microcrystalline cellulose, calcium phosphate, calcium hydrogen phosphate, and sodium phosphate, Cellactose ® 80 (75 % a- lactose monohydrate and 25 % cellulose powder), mannitol, pre-gelatinized starch, starch, sucrose, sodium chloride, talc, anhydrous lactose, and granulated lactose. One or more diluents can each be individually present in the composition in an amount of about 0.01% w/w to about 90% w/w relative to weight of the dosage form. One or more diluents can each be individually present in the composition in an amount of at least, greater than, or less than about 0.01%, 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%,
- 37 -
SUBSTITUTE SHEET ( RULE 26) 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90% w/w relative to weight of the dosage form.
Suitable granulating and disintegrating agents include, but are not limited to, sucrose, copovidone, com starch, microcrystalline cellulose, methyl cellulose, sodium starch gly collate, pregelatinized starch, povidone, sodium carboxy methyl cellulose, sodium alginate, citric acid, croscarmellose sodium, cellulose, carboxymethylcellulose calcium, colloidal silicone dioxide, crosspovidone and alginic acid. One or more granulating or disintegrating agents can each be individually present in the composition in an amount of about 0.01% w/w to about 90% w/w relative to weight of the dosage form. One or more granulating or disintegrating agents can each be individually present in the composition in an amount of at least, greater than, or less than about 0.01%, 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90% w/w relative to weight of the dosage form.
Suitable binding agents include, but are not limited to, gelatin, acacia, pre-gelatinized maize starch, polyvinylpyrrolidone, anhydrous lactose, lactose monohydrate, hydroxypropyl methylcellulose, methylcellulose, povidone, polyacrylamides, sucrose, dextrose, maltose, gelatin, polyethylene glycol. One or more binding agents can each be individually present in the composition in an amount of about 0.01% w/w to about 90% w/w relative to weight of the dosage form. One or more binding agents can each be individually present in the composition in an amount of at least, greater than, or less than about 0.01%, 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90% w/w relative to weight of the dosage form.
Suitable lubricating agents include, but are not limited to, magnesium stearate, calcium stearate, hydrogenated castor oil, glyceryl monostearate, glyceryl behenate, mineral oil, polyethylene glycol, poloxamer 407, poloxamer 188, sodium laureth sulfate, sodium benzoate, stearic acid, sodium stearyl fumarate, silica, and talc. One or more lubricating agents can each be individually present in the composition in an amount of about 0.01% w/w to about 90% w/w relative to weight of the dosage form. One or more lubricating agents can each be individually present in the composition in an amount of at least, greater than, or less than about 0.01%, 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90% w/w relative to weight of the dosage form.
Tablets can be non-coated or they may be coated using known methods to achieve delayed disintegration in the gastrointestinal tract of a subject, thereby providing sustained
- 38 -
SUBSTITUTE SHEET ( RULE 26) release and absorption of the active ingredient. By way of example, a material such as glyceryl monostearate or glyceryl distearate may be used to coat tablets. Further by way of example, tablets may be coated using methods described in U.S. Patent Nos. 4,256,108; 4,160,452; and 4,265,874 to form osmotically controlled release tablets. Tablets may further comprise a sweetening agent, a flavoring agent, a coloring agent, a preservative, or some combination of these in order to provide for pharmaceutically elegant and palatable preparation.
Tablets can also be enterically coated such that the coating begins to dissolve at a certain pH, such as at about pH 5.0 to about pH 7.5, thereby releasing a compound as described herein. The coating can contain, for example, EUDRAGIT ® L, S, FS, and/or E polymers with acidic or alkaline groups to allow release of a compound as described herein in a particular location, including in any desired section(s) of the intestine. The coating can also contain, for example, EUDRAGIT ® RL and/or RS polymers with cationic or neutral groups to allow for time controlled release of a compound as described herein by pH-independent swelling.
Parenteral Administration
For parenteral administration, the compounds as described herein may be formulated for injection or infusion, for example, intravenous, intramuscular or subcutaneous injection or infusion, or for administration in a bolus dose and/or continuous infusion. Suspensions, solutions or emulsions in an oily or aqueous vehicle, optionally containing other formulatory agents such as suspending, stabilizing and/or dispersing agents may be used.
Sterile injectable forms of the compositions described herein may be aqueous or oleaginous suspension. These suspensions may be formulated according to techniques known in the art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may also be a sterile injectable solution or suspension in anon- toxic parenterally-acceptable diluent or solvent, for example as a solution in 1, 3-butanediol. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution and isotonic sodium chloride solution. Sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose, any bland fixed oil may be employed including synthetic mono- or di-glycerides. Fatty acids, such as oleic acid and its glyceride derivatives are useful in the preparation of injectables, as are natural pharmaceutically acceptable oils, such as olive oil or castor oil, especially in their polyoxyethylated versions. These oil solutions or suspensions may also contain a long-chain
- 39 -
SUBSTITUTE SHEET ( RULE 26) alcohol diluent or dispersant, such as such as lauryl, stearyl, or oleyl alcohols, or similar alcohol.
Additional Administration Forms
Additional dosage forms suitable for use with the compound(s) and compositions described herein include dosage forms as described in U.S. Patents Nos. 6,340,475; 6,488,962; 6,451,808; 5,972,389; 5,582,837; and 5,007,790. Additional dosage forms suitable for use with the compound(s) and compositions described herein also include dosage forms as described in U.S. Patent Applications Nos. 20030147952; 20030104062; 20030104053; 20030044466; 20030039688; and 20020051820. Additional dosage forms suitable for use with the compound(s) and compositions described herein also include dosage forms as described in PCT Applications Nos. WO 03/35041; WO 03/35040; WO 03/35029; WO 03/35177; WO 03/35039; WO 02/96404; WO 02/32416; WO 01/97783; WO 01/56544; WO 01/32217; WO 98/55107; WO 98/11879; WO 97/47285; WO 93/18755; and WO 90/11757.
Controlled Release Formulations and Drug Delivery Systems
In certain embodiments, the formulations described herein can be, but are not limited to, short-term, rapid-offset, as well as controlled, for example, sustained release, delayed release and pulsatile release formulations.
The term sustained release is used in its conventional sense to refer to a drug formulation that provides for gradual release of a drug over an extended period of time, and that may, although not necessarily, result in substantially constant blood levels of a drug over an extended time period. The period of time may be as long as a month or more and should be a release which is longer that the same amount of agent administered in bolus form.
For sustained release, the compounds may be formulated with a suitable polymer or hydrophobic material which provides sustained release properties to the compounds. As such, the compounds for use with the method(s) described herein may be administered in the form of microparticles, for example, by injection or in the form of wafers or discs by implantation.
In some cases, the dosage forms to be used can be provided as slow or controlled- release of one or more active ingredients therein using, for example, hydropropylmethyl cellulose, other polymer matrices, gels, permeable membranes, osmotic systems, multilayer coatings, microparticles, liposomes, or microspheres or a combination thereof to provide the desired release profile in varying proportions. Suitable controlled-release formulations
- 40 -
SUBSTITUTE SHEET ( RULE 26) known to those of ordinary skill in the art, including those descnbed herein, can be readily selected for use with the pharmaceutical compositions described herein. Thus, single unit dosage forms suitable for oral administration, such as tablets, capsules, gelcaps, and caplets, that are adapted for controlled-release are encompassed by the compositions and dosage forms described herein.
Most controlled-release pharmaceutical products have a common goal of improving drug therapy over that achieved by their non-controlled counterparts. Ideally, the use of an optimally designed controlled-release preparation in medical treatment is characterized by a minimum of drug substance being employed to cure or control the condition in a minimum amount of time. Advantages of controlled-release formulations include extended activity of the drug, reduced dosage frequency, and increased patient compliance. In addition, controlled-release formulations can be used to affect the time of onset of action or other characteristics, such as blood level of the drug, and thus can affect the occurrence of side effects.
Most controlled-release formulations are designed to initially release an amount of drug that promptly produces the desired therapeutic effect, and gradually and continually release of other amounts of drug to maintain this level of therapeutic effect over an extended period of time. In order to maintain this constant level of drug in the body, the drug must be released from the dosage form at a rate that will replace the amount of drug being metabolized and excreted from the body.
Controlled-release of an active ingredient can be stimulated by various inducers, for example pH, temperature, enzymes, water, or other physiological conditions or compounds. The term "controlled-release component" is defined herein as a compound or compounds, including, but not limited to, polymers, polymer matrices, gels, permeable membranes, liposomes, or microspheres or a combination thereof that facilitates the controlled-release of the active ingredient. In one embodiment, the compound(s) described herein are administered to a patient, alone or in combination with another pharmaceutical agent, using a sustained release formulation. In one embodiment, the compound(s) described herein are administered to a patient, alone or in combination with another pharmaceutical agent, using a sustained release formulation.
The term delayed release is used herein in its conventional sense to refer to a drug formulation that provides for an initial release of the drug after some delay following drug administration and that mat, although not necessarily, includes a delay of from about 10 minutes up to about 12 hours.
- 41 -
SUBSTITUTE SHEET ( RULE 26) The term pulsatile release is used herein in its conventional sense to refer to a drug formulation that provides release of the drug in such a way as to produce pulsed plasma profdes of the drug after drug administration.
The term immediate release is used in its conventional sense to refer to a drug formulation that provides for release of the drug immediately after drug administration.
As used herein, short-term refers to any period of time up to and including about 8 hours, about 7 hours, about 6 hours, about 5 hours, about 4 hours, about 3 hours, about 2 hours, about 1 hour, about 40 minutes, about 20 minutes, or about 10 minutes and any or all whole or partial increments thereof after drug administration after drug administration.
As used herein, rapid-offset refers to any period of time up to and including about 8 hours, about 7 hours, about 6 hours, about 5 hours, about 4 hours, about 3 hours, about 2 hours, about 1 hour, about 40 minutes, about 20 minutes, or about 10 minutes, and any and all whole or partial increments thereof after drug administration.
Dosing
The therapeutically effective amount or dose of a compound described herein depends on the age, sex and weight of the patient, the cunent medical condition of the patient and the progression of an inflammatory disease in the patient being treated. The skilled artisan is able to determine appropriate dosages depending on these and other factors.
A suitable dose of a compound described herein can be in the range of from about 0.01 mg to about 5,000 mg per day, such as from about 0. 1 mg to about 1,000 mg, for example, from about 1 mg to about 500 mg, such as about 5 mg to about 250 mg per day. The dose may be administered in a single dosage or in multiple dosages, for example from 1 to 4 or more times per day. When multiple dosages are used, the amount of each dosage may be the same or different. For example, a dose of 1 mg per day may be administered as two 0.5 mg doses, with about a 12-hour interval between doses.
It is understood that the amount of compound dosed per day may be administered, in non-limiting examples, every day, every other day, every 2 days, every 3 days, every 4 days, or every 5 days. For example, with every other day administration, a 5 mg per day dose may be initiated on Monday with a first subsequent 5 mg per day dose administered on Wednesday, a second subsequent 5 mg per day dose administered on Friday, and so on.
In the case wherein the patient's status does improve, upon the doctor's discretion the administration of the compound(s) described herein is optionally given continuously; alternatively, the dose of drug being administered is temporarily reduced or temporarily
- 42 -
SUBSTITUTE SHEET ( RULE 26) suspended for a certain length of time (i.e., a "drug holiday"). The length of the drug holiday optionally varies between 2 days and 1 year, including by way of example only, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 12 days, 15 days, 20 days, 28 days, 35 days, 50 days, 70 days, 100 days, 120 days, 150 days, 180 days, 200 days, 250 days, 280 days, 300 days, 320 days, 350 days, or 365 days. The dose reduction during a drug holiday includes from 10%-100%, including, by way of example only, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%.
Once improvement of the patient's conditions has occurred, a maintenance dose is administered if necessary. Subsequently, the dosage or the frequency of administration, or both, is reduced to a level at which the improved disease is retained. In certain embodiments, patients require intermittent treatment on a long-term basis upon any recurrence of symptoms and/or infection.
The compounds described herein can be formulated in unit dosage form. The term "unit dosage form" refers to physically discrete units suitable as unitary dosage for patients undergoing treatment, with each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect, optionally in association with a suitable pharmaceutical carrier. The unit dosage form may be for a single daily dose or one of multiple daily doses (e.g, about 1 to 4 or more times per day). When multiple daily doses are used, the unit dosage form may be the same or different for each dose.
Toxicity and therapeutic efficacy of such therapeutic regimens are optionally determined in cell cultures or experimental animals, including, but not limited to, the determination of the LDso (the dose lethal to 50% of the population) and the EDso (the dose therapeutically effective in 50% of the population). The dose ratio between the toxic and therapeutic effects is the therapeutic index, which is expressed as the ratio between LDso and EDso. The data obtained from cell culture assays and animal studies are optionally used in formulating a range of dosage for use in human. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with minimal toxicity. The dosage optionally varies within this range depending upon the dosage form employed and the route of administration utilized.
Examples
Various embodiments of the present application can be better understood by reference to the following Examples which are offered by way of illustration. The scope of the present application is not limited to the Examples given herein.
- 43 -
SUBSTITUTE SHEET ( RULE 26) Methods
Expression and purification of LACC1. mLACCl and hLACCl cDNA sequences were synthesized by GenScript, codon-optimized for prokaryotic expression, and cloned into a pMAL-C5x (New England BioLabs, N8108) vector. Plasmids for human LACC1 K38E, human LACC1 1254V and human LACC1 C284R were generated using the Q5 Site-Directed Mutagenesis Kit (New England BioLabs, E0554S). E. coll BL21(DE3) cells were transformed with the expression plasmids and grown aerobically at 37°C and 250 revolutions per minute (rpm) in ampicillin-supplemented (100 pg/mL) Luria Bertani (LB) medium. Expression was induced at an ODeoo of 0.5-0.6 with 0.3 mM isopropyl p-D-1- thiogalactopyranoside (IPTG) for 4 h at 30°C. Cells were harvested by centrifugation (6000 x g, 4 °C, 20 min) and cell pellets were washed twice with PBS. Cells were then resuspended in 5 mL of column buffer on ice containing 20 mM Tris-HCl, 200 mM NaCl, 1 mM EDTA, pH 7.5, and complete Mini EDTA-free protease inhibitor cocktail (1 tablet per 50 mL buffer, Roche, 11873580001). The cells were lysed by sonication on ice and cleared by centrifugation at 35,000 x g for 30 minutes. The protein-containing supernatant was loaded onto a pre-equilibrated amylose resin column (New England BioLabs, E8021S). The column was washed with 20 column volumes of column buffer. The protein was eluted with 10 column volumes of column buffer supplemented with 10 mM maltose. The eluted fractions were pooled and concentrated using centrifugal filters (Millipore, UFC503096) for use in further assays.
Measurement of cellular biochemistry in recombinant system. E. coli BL21(DE3) expressing recombinant mouse and human Laccl proteins were cultured in 5 mL LB medium containing 10 mM l,2,3,4,5-13C5-L-Cit. Expression was induced at an optical density (ODeoo) of 0.5-0.6 with 0.5 mM isopropyl p-D- 1 -thiogalactopyranoside and cultured at 16° C for 48 hours. The culture extract was coupled with l-fluoro-2,4-dinitrophenyl- 5-L-alanine amide according to the manufacturer’s protocol. Derivatized samples were analyzed by UPLC- QTOF-MS (Phenomenex Kinetex C18 column (100 A) 5 pm (250 x 4.6 mm2); flow rate, 0.7 mL min-1; mobile phase composition, 10-100% acetonitrile in water containing 0.1% formic acid for 30 min).
- 44 -
SUBSTITUTE SHEET ( RULE 26) ICP-MS. mLACCl was expressed and purified as mentioned above. 1 mg purified protein was digested with 10 mL 5% HNCh in a thermo digestion system, followed by the measurement of Mg, Ca, Fe, Mn, Co, Ni, Cu and Zn contents in triplicate by inductively coupled plasma mass spectrometry (ICP-MS, Perkin Elmer ICP-MS Elan DRC-e). In the averaged Zn65 quantification assay, 1 mL 10 pM purified mLACCl was mixed with 10 mL 5% HNCh and analyzed with Zn65 standards by ICP-MS.
In vitro enzyme screening. To prepare the BMDM cell pellet extract, I.acci" BMDMs were cultured as mentioned below and stimulated with 20 ng/mL LPS (Sigma, L4391) and 50 ng/mL IFNy (BioLegend, 575302) for 16 hours. Cells were washed with ice- cold PBS twice and extracted with ice-cold MeOH. The extraction mixture was centrifuged and the supernatant was dried using N2 gas flow. 1 mg Laccl^' BMDM cell pellet extract was incubated with 10 pM mLACCl in 100 pL PBS buffer supplemented with 1 pM ZnSCL in triplicate for 1 h at 37°C and quenched by 200 pL ice-cold acetonitrile (AcCN). The reaction mixture was centrifuged at 20,000 x g for 10 min and the supernatant was analyzed using an Agilent iFunnel 6550 quadrupole time of flight (Q-TOF) MS instrument fitted with an electrospray ionization (ESI) source coupled to an Agilent 1290 Infinity HPLC system with an Xbridge BEH Amide XP HILIC 2.5 pm, 2.1 mm x 100 mm column (Waters, 186006091). The column was maintained at 25°C during analysis. The mobile phase A was 20 mM ammonium acetate/0.1% formic acid pH 3.5. The mobile phase B was 100% acetonitrile. The flow rate was 0.22 mL/min. The gradient elution was as follows: 0 min: 85% B; 0.5 min: 85% B; 9 min: 35% B; 11 min: 2% B; 12 min: 85% B; 25 min: 85% B. The data were acquired in positive and negative ion mode (FIG. 5D) with a full scan range of 50-1700 m/z, respectively. The metabolomics data were processed with Mass Profiler Professional Software 14.0 (Agilent) and presented as a volcano plot showing fold change (FC) versus false discovery rate (FDR) values.
Measurement of HNCO. For the direct measurement of HNCO through NMR, 6- 13Ci-labelled L-Cit (1 mg) was incubated with 10 pM mLACCl in D2O (200 pL) for 1 hour. The reaction mixture was then subjected to 13C NMR on 4 h intervals to detect cyanate, the conjugate base of HNCO, with reference to its central 13C chemical shift value of 128.64 ppm. Spectrum shown was on the 2nd interval at 5 h incubation time. The negative control was prepared as described above without mLACCl, and the chemical standard used was 1
- 45 -
SUBSTITUTE SHEET ( RULE 26) rnM NaOCN in D2O, which showed identical 13C chemical shift values as the enzyme product. Some minor spontaneous carboxylate carbamoylation of substrate L-Cit and product L-Om was observed over extended incubation times. The measurement was performed using an Agilent 800 MHz NMR instrument equipped with a 13C-sensitivity enhanced salt-tolerant cold probe. For the indirect measurement of HNCO, an HNCO carbamoylation assay was used. The enzymatic assay was performed as mentioned above and quenched with 200 pL MeOH. The reaction mixture was incubated with 20 mM acetic acid and 50 mM 2- aminobenzoic acid at 42°C for 30 min. Then, the mixture was centrifuged and the supernatant was analyzed by UPLC-QTOF-MS (Phenomenex Kinetex Cl 8 (100 A) 5 pm (250 x 4.6 mm2) column; flow rate, 0.7 mL/min; mobile phase composition, 10-100% acetonitrile in water containing 0.1% formic acid for 30 min).
Measurement of L-Orn. The enzymatic assay was performed as mentioned above. In some conditions as noted, KH2PO4 or Na2HPO4 was used for pH adjustment while 10 pM EDTA or 10 pM TPEN was added for metal chelation. The reaction mixture was quenched with 200 pL MeOH. Then, the mixture was centrifuged and coupled with l-fluoro-2,4- dinitrophenyl-5-L-alanine amide, FDAA (Thermo, 48895) per the manufacturer’s protocol. The samples were analy zed by UPLC-QTOF-MS (Phenomenex Kinetex C18 (100 A) 5 pm (250 x 4.6 mm2) column; flow rate, 0.7 mL/min; mobile phase composition, 10-100% acetonitrile in water containing 0.1% formic acid for 30 min).
Measurement of enzymatic parameters. The enzymatic assay was performed in triplicate as mentioned above at different concentrations of L-Cit (5 pM, 10 pM, 25 pM, 50 pM, 100 pM, 200 pM and 500 pM) over time (60 min, 120 min, 300 min, and 600 min). The velocity was calculated, and the Michaelis-Menten curves were plotted for the measurement of Km and feat using Prism 9 (GraphPad).
Mouse studies. WT C57BL/6, Laccl~2~, LacclC284R/C284R
Figure imgf000048_0001
mice were used in this study. Nos2~2~ mice (002609-B6. l 29P2-AU.y2""'/"/7J. Jackson Laboratory) were a gift from accl mice were generated with CRISPR-Cas9 technology into C57/B6N embryos as previously described. To generate LaccT2' mice, two sgRNAs (AAACTGCCATGAGACCTTACTGG (SEQ ID: NO 1),
- 46 -
SUBSTITUTE SHEET ( RULE 26) GTTAAGGCCATCGCGGACATGGG, (SEQ ID NO: 2)) were used collectively to target exon 3 and exon 7, respectively. To generate LaCclC284R2C284R mice, an sgRNA (GAAGACGATGGGTATACAGTCGG, SEQ ID NO: 3) and an oligo donor (CCTACCGGAGTGAGCAACCCCACATGCCTTTTTCACAGGATCTGCGAAGACGAT GGGTATACgGTCGGCGCCAAGAGCAGTGATTGTGACTCCTCTCTGAT TTGTGACGATCCCATCGTAAGA, SEQ ID NO: 4) were used collectively for homologous recombination. Experimental littermates were generated from heterozygote x heterozygote breeding. Sample size (n = 10) was chosen in line with pervious experimental experience and consistent with the broader literature. 8-10-week-old male and female mice were used in equal quantities unless otherwise specified. All experiments were performed using co-housed mouse littermate controls. Isosexual male or female littermates were co-housed at 21-24°C and 40-60% humidity. A 12/12 h light/dark cycle was used. All mouse studies were performed in compliance with Yale Institutional Animal Care and Use Committee protocols. No formal blinding or randomization was conducted; however, control and treated groups were chosen arbitrarily for each experiment. Mouse weights and CFUs were measured in a blinded manner.
Cell culture studies. BMDMs were generated from progenitor cells isolated from femurs and tibias of mice and maintained in DMEM medium (Gibco, 11965118) with 10% FBS (Sigma, F8192-500M1), 1% penicillin/ streptomycin (Gibco, 15070063) and 50 ng/mL M-CSF (R&D, 416-ML-010) for 6 days. Cells were reseeded and stimulated with 20 ng/mL LPS (Sigma, L4391) and 50 ng/mL IFNy (BioLegend, 575302) in triplicate for 16 hours. In some experiments as indicated, 1 mM DFMO (Cayman, 16889) was supplemented during Ml differentiation to inhibit ODC1. After a 16-hour stimulation period, culture supernatants were collected for TNFa, IL6 and IL12b ELISA assays (R&D, DY410-05, DY406-05, DY499-05) according to the manufacturer’s protocols.
S. Typhimurium infection in vivo. As previously described, before infection, 8-10- week-old mice (n = 10) were restricted from food and water for 4 h followed by gavage of 20 mg streptomycin. After 20 h, mice were fasted again for 4 h and infected with streptomycin resistant S. Typhimurium (SL1344 strain, provided by J. Galan). S. Typhimurium was maintained as a glycerol stock at -80°C. Before infection, bacteria were propagated overnight (37°C, 250 rpm) in LB supplemented with 100 pg/ml streptomycin. The bacterial culture was subcultured for 4 h the next day in antibiotic-free LB supplemented with 0.3 M NaCl to
- 47 -
SUBSTITUTE SHEET ( RULE 26) return it to log phase growth and increase virulence. Using spectrophotometry, bacterial CFUs were calculated with an infection dose of 1 x 103 CFUs per mouse. To calculate faecal CFUs, faecal pellets were resuspended in PBS at 50 mg/mL and vortexed for 20 min.
Bacteria containing supernatants were clarified by centrifugation at 50 x g for 10 min. Serial dilutions were conducted, and bacteria were plated in triplicate on LB streptomycin (100 pg/mL) plates. For caecal, liver and spleen CFU enumeration, organs were isolated, weighed, and added to 2 ml of PBS. Tissue was dissociated with Gentl eMacs C Tubes (Miltenyi Biotech) per the manufacturer’s instructions. CFUs were calculated using similar methodology as above.
S'. Typhimurium infection in BMDMs. After a 16-hour stimulation period as mentioned above, the BMDM culture medium was replaced with antibiotic-free medium. BMDMs (1 x 106) were infected in triplicate with 1 x 107 CFUs of S. Typhimurium (SL1344 strain, provided by J. Galan, MOI = 10) and centrifugated at 800 x g at 37 °C for 10 min and returned to the incubator for an additional 20 min. Medium was then removed and replaced with medium containing 100 pg/mL gentamycin to kill extracellular bacteria for 1 h (z.e., the gentamycin protection assay). Medium was replaced with fresh medium including 25 pg/mL gentamycin. An hour later, supernatants were sampled for LDH activity with the Cy QUANT™ LDH Cytotoxicity Assay (Thermo, C20300) according to the manufacturer’s protocol. After an additional 3.5 -hour culture period in the incubator, cells were washed twice with PBS and lysed in a 1% Triton and 0.1% SDS buffer for 5 min under gentle agitation. Cell lysates were plated on streptomycin (100 pg/mL) containing LB plates and incubated overnight at 37°C, and then CFUs were enumerated.
13C-isotope labelling studies. BMDMs were generated as mentioned above, reseeded at a density of 1 x 106 cells/mL in phenol red-free DMEM medium (Gibco, 21063029) with 10% FBS (Sigma, F8192-500M1), 1% penicillin/streptomycin (Gibco, 15070063), and 1 mM
1.2.3.4.5.6-13Ce labeled L-Arg (Cambridge Isotope Laboratories, CLM-2265-H-0.05), 2 mM 1 ,2,3,4,5-13Cs labeled L-Cit (Cambridge Isotope Laboratories, CLM-8653-PK), or 1 pM
1.2.3.4.5.6-13Ce, 13N4 labeled L-ArgSuc (Cambridge Isotope Laboratories, CNLM-9007-CA- 0. IMG) and stimulated in triplicate with 20 ng/mL LPS (Sigma, L4391) and 50 ng/mL IFNy (BioLegend, 575302) for 16 hours. The cells were washed twice with 10 mL ice-cold PBS, scraped in 1 mL ice-cold PBS, transferred to 1.5 mL tubes and pelleted (1 min, 6,000 x g,
- 48 -
SUBSTITUTE SHEET ( RULE 26) 4°C). The cells were washed once with 500 pL ice-cold PBS. Cellular metabolites were extracted with 50 pL of ice-cold extraction solvent (40:40:20 vol/vol/vol acetonitrile: methanol: water, 0.5% formic acid). After a 5-min incubation on ice, the acid was neutralized using NH4HCO3. After centrifugation (15 min, 20,000 x g, 4°C), the clarified supernatant was transferred to an LC-MS vial and analyzed by an Agilent iFunnel 6550 QTOF-MS instrument fitted with an ESI source or an Agilent 6490 ESI-QQQ-MS/MS instrument coupled to an Agilent 1290 Infinity HPLC system with an Xbndge BEH Amide XP HILIC 2.5 pm, 2.1 mm x 100 mm column (Waters, 186006091). The column was maintained at 25°C during the analysis. The mobile phase A was 20 mM ammonium acetate/0.1% formic acid pH 3.5. The mobile phase B was 100% acetonitrile. The flow rate was 0.4 mL/min. The gradient elution was as follows: 0 min: 95% B; 0.5 min: 95% B; 3 min: 70% B; 6 mm: 40% B; 6.5 mm: 0% B; 9.5 mm: 0% B; 10 mm: 95% B; 15 mm: 95% B. MassHunter Qualitative Analysis B.07.00 (Agilent) was used to perform peak picking, peak alignment, and peak intensity integration.
The terms and expressions employed herein are used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the embodiments of the present application. Thus, it should be understood that although the present application describes specific embodiments and optional features, modification and variation of the compositions, methods, and concepts herein disclosed may be resorted to by those of ordinary skill in the art, and that such modifications and variations are considered to be within the scope of embodiments of the present application.
Enumerated Embodiments
The following enumerated embodiments are provided, the numbering of which is not to be construed as designating levels of importance:
Embodiment 1 provides a method of treating, ameliorating, and/or preventing an inflammatory disease, inflammatory disorder, and/or inflammation in a subject, the method comprising administering to the subject a therapeutically effective amount of a compound of Formula la, or a salt, solvate, or N-oxide thereof:
- 49 -
SUBSTITUTE SHEET ( RULE 26)
Figure imgf000052_0001
wherein:
R1 and R2 are each independently selected from the group consisting of hydrogen, 1-10 amino acids, C1-20 alkyl, -C(=O)Ra, -C(=O)ORa, -CH(R')OC(=O)Ra, -CH2R', - CH(aryl)CH2C(=O)Ra, -CH2N(R')C(=O)Ra, -C(=NH)CH3, and =C(R')(R'); or
R1 and R2 combine with the N atom to which they are bound so as to form a 5 or 6-membered heterocycle;
R3 and R4 are each independently selected from the group consisting of hydrogen, 1-10 ammo acids, C1.20 alkyl, -C(=O)Rb, -C(=O)ORb, -CH(R")OC(=O)Rb, -CH2R", - CH(Ar)CH2C(=O)CH3, -CH2N(R")C(=O)Rb, -C(=NH)CH3, and =C(R")(R"); or
R3 and R4 combine with the N atom to which they are bound so as to form a 5 or 6-membered heterocycle;
R5 is selected from the group consisting of hydrogen, 1-10 amino acids, C1-20 alkyl, and Rc; each occurrence of Ra, Rb, and Rc is independently selected from the group consisting of hydrogen, C1-10 alkyl, C2-10 alkenyl, C2-10 alkynyl, Ce-io aryl, and C5-10 heteroaryl, and combinations thereof; each occurrence of R1 and R" is independently selected from the group consisting of hydrogen, C1-10 alkyd, C2-io alkenyl, C2-io alkynyl, Ce-io aryl, C5-10 heteroaryl, halogen, OH, CN, Ci-10 alkoxy, and combinations thereof.
Embodiment 2 provides the method of embodiment 1, wherein the inflammatory disease or disorder is selected from the group consisting of arthritis juvenile arthritis, spondylitis, leprosy, Crohn's disease, ulcerative colitis, inflammatory bowel syndrome, and Rh factor arthritis.
Embodiment 3 provides the method of any one of embodiments 1-2, wherein the compound is formulated as a pharmaceutically acceptable composition further including at least one pharmaceutically acceptable carrier.
Embodiment 4 provides the method of any one of embodiments 1-3, wherein R1, R2, R3, R4, and R5 are hydrogen.
Embodiment 5 provides the method of any one of embodiments 1-4, wherein the compound of Formula la is a hydrochloride salt.
- 50 -
SUBSTITUTE SHEET ( RULE 26) Embodiment 6 provides the method of any one of embodiments 1-5, wherein the subject is a mammal.
Embodiment 7 provides the method of any one of embodiments 1-6, wherein the mammal is a human.
Embodiment 8 provides the method of any one of embodiments 1-7, wherein the subject is administered at least one additional agent for treating, ameliorating, or preventing the inflammatory disease, inflammatory disorder, or inflammation in the subject.
Embodiment 9 provides the method of any one of embodiments 1-8, wherein the compound is administered by a route selected from the group consisting of oral, transdermal, transmucosal, intravesical, intrapulmonary, intraduodenal, intragastrical, intrathecal, subcutaneous, intramuscular, intradermal, intra-arterial, intravenous, intrabronchial, inhalation, and topical administration.
Embodiment 10 provides the method of any one of embodiments 1-9, wherein the route is oral administration.
Embodiment 11 provides method of improving efficacy of an antibacterial agent in a subject and/or improving ability of a subject to fight off a bacterial infection, the method comprising administering to the subject a therapeutically effective amount of a compound of Formula la, or a salt, solvate, or N-oxide thereof:
Figure imgf000053_0001
Formula la wherein:
R1 and R2 are each independently selected from the group consisting of hydrogen, 1-10 ammo acids, C1-20 alkyl, -C(=O)Ra, -C(=O)ORa, -CH(R')OC(=O)Ra, -CH2R', - CH(aryl)CH2C(=O)Ra, -CH2N(R')C(=O)Ra, -C(=NH)CH3, and =C(R')(R'); or
R1 and R2 combine with the N atom to which they are bound so as to form a 5 or 6-membered heterocycle;
R3 and R4 are each independently selected from the group consisting of hydrogen, 1-10 amino acids, C1-20 alkyl, -C(=O)Rb, -C(=O)ORb, -CH(R")OC(=O)Rb, -CH2R", - CH(Ar)CH2C(=O)CH3, -CH2N(R")C(=O)Rb, -C(=NH)CH3, and =C(R")(R"); or
R3 and R4 combine with the N atom to which they are bound so as to form a 5 or 6-membered heterocycle;
- 51 -
SUBSTITUTE SHEET ( RULE 26) R5 is selected from the group consisting of hydrogen, 1-10 amino acids, C1-20 alkyl, and
Rc; each occurrence of Ra, Rb, and Rc is independently selected from the group consisting of hydrogen, C1-10 alkyl, C2-10 alkenyl, C2-10 alkynyl, Ce-io aryl, and C5-10 heteroaryl, and combinations thereof; each occurrence of R' and R" is independently selected from the group consisting of hydrogen, C1-10 alkyl, C2-10 alkenyl, C2-10 alkynyl, Ce-io aryl, C5-10 heteroaryl, halogen, OH, CN, C1-10 alkoxy, and combinations thereof.
Embodiment 12 provides the method of embodiment 11, wherein the compound is formulated as a pharmaceutically effective composition further including at least one pharmaceutically acceptable carrier.
Embodiment 13 provides the method of any one of embodiments 11-12, wherein R1, R2, R3, R4, and R5 are hydrogen.
Embodiment 14 provides the method of any one of embodiments 11-13, wherein the compound of Formula la is a hydrochloride salt.
Embodiment 15 provides the method of any one of embodiments 11-14, wherein the subject is a mammal.
Embodiment 16 provides the method of any one of embodiments 11-15, wherein the mammal is a human.
Embodiment 17 provides the method of any one of embodiments 11-16, wherein the compound is administered with at least one antibacterial agent.
Embodiment 18 provides the method of any one of embodiments 11-17, wherein the compound is administered by a route selected from the group consisting of oral, transdermal, transmucosal, intravesical, intrapulmonary, intraduodenal, intragastrical, intrathecal, subcutaneous, intramuscular, intradermal, intra-arterial, intravenous, intrabronchial, inhalation, and topical administration.
Embodiment 19 provides the method of any one of embodiments 11-18, wherein the route is oral administration.
- 52 -
SUBSTITUTE SHEET ( RULE 26)

Claims

CLAIMS What is claimed is:
1. A method of treating, ameliorating, and/or preventing an inflammatory disease, inflammatory disorder, and/or inflammation in a subject, the method comprising: administering to the subject a therapeutically effective amount of a compound of Formula la, or a salt, solvate, or N-oxide thereof:
Figure imgf000055_0001
Formula la wherein:
R1 and R2 are each independently selected from the group consisting of hydrogen, 1- 10 amino acids, C1-20 alkyl, -C(=O)Ra, -C(=O)ORa, -CH(R')OC(=O)Ra, -CH2R, - CH(aryl)CH2C(=O)Ra, -CH2N(R')C(=O)Ra, -C(=NH)CHs, and =C(R')(R'); or
R1 and R2 combine with the N atom to which they are bound so as to form a 5 or 6-membered heterocycle;
R3 and R4 are each independently selected from the group consisting of hydrogen, 1- 10 amino acids, C1-20 alkyl, -C(=O)Rb, -C(=O)ORb, -CH(R")OC(=O)Rb, -CH2R", - CH(Ar)CH2C(-O)CH3. -CH2N(R")C(=O)Rb, -C(=NH)CH3, and =C(R")(R"); or
R3 and R4 combine with the N atom to which they are bound so as to form a 5 or 6-membered heterocycle;
R5 is selected from the group consisting of hydrogen, 1-10 amino acids, C1-20 alkyl, and Rc; each occurrence of Ra, Rb, and Rc is independently selected from the group consisting of hydrogen, C1-10 alkyl, C2-10 alkenyl, C2-10 alkynyl, Ce-io aryl, and C5-10 heteroaryl, and combinations thereof; each occurrence of R1 and R" is independently selected from the group consisting of hydrogen, C1-10 alkyl, C2-io alkenyl, C2-10 alkynyl, Ce-io aryl, C5-10 heteroaryl, halogen, OH, CN, Ci-10 alkoxy, and combinations thereof.
2. The method of claim 1, wherein the inflammatory disease or disorder is selected from the group consisting of arthritis juvenile arthritis, spondylitis, leprosy, Crohn's disease, ulcerative colitis, inflammatory bowel syndrome, and Rh factor arthritis.
3. The method of claim 1, wherein the compound is formulated as a pharmaceutically acceptable composition further including at least one pharmaceutically acceptable carrier.
4 The method of claim 1, wherein R1, R2, R3, R4, and R5 are hydrogen.
5. The method of claim 1, wherein the compound of Formula la is a hydrochloride salt.
6. The method of claim 1, wherein the subject is a mammal.
7. The method of claim 6, wherein the mammal is a human.
8. The method of claim 1, wherein the subject is administered at least one additional agent for treating, ameliorating, and/or preventing the inflammatory disease, inflammatory disorder, or inflammation in the subject.
9. The method of claim 1, wherein the compound is administered by a route selected from the group consisting of oral, transdermal, transmucosal, intravesical, intrapulmonary, intraduodenal, intragastrical, intrathecal, subcutaneous, intramuscular, intradermal, intraarterial, intravenous, intrabronchial, inhalation, and topical administration.
10. The method of claim 9, wherein the route is oral administration.
11. A method of improving efficacy of an antibacterial agent in a subject and/or improving ability of a subject to fight off a bacterial infection, the method comprising: administering to the subject a therapeutically effective amount of a compound of Formula la, or a salt, solvate, or N-oxide thereof:
Figure imgf000056_0001
Formula la wherein:
R1 and R2 are each independently selected from the group consisting of hydrogen, 1- 10 amino acids, C1-20 alkyl, -C(=O)Ra, -C(=O)ORa, -CH(R')OC(=O)Ra, -CH2R, - CH(aryl)CH2C(=O)Ra, -CH2N(R')C(=O)Ra, -C(=NH)CH3, and =C(R')(R'); or
R1 and R2 combine with the N atom to which they are bound so as to form a 5 or 6-membered heterocycle;
R3 and R4 are each independently selected from the group consisting of hydrogen, 1- 10 amino acids, Ci-2o alkyl, -C(=O)Rb, -C(=O)ORb, -CH(R")OC(=O)Rb, -CH2R", - CH(Ar)CH2C(=O)CH3, -CH2N(R")C(=O)Rb, -C(=NH)CH3, and =C(R")(R"); or
R3 and R4 combine with the N atom to which they are bound so as to form a 5 or 6-membered heterocycle;
R5 is selected from the group consisting of hydrogen, 1-10 amino acids, C1-20 alkyl, and Rc; each occurrence of Ra, Rb, and Rc is independently selected from the group consisting of hydrogen, C1-10 alkyl, C2-10 alkenyl, C2-10 alkynyl, Ce-io aryl, and C5-10 heteroaryl, and combinations thereof; each occurrence of R1 and R" is independently selected from the group consisting of hydrogen, C1-10 alkyl, C2-10 alkenyl, C2-io alkynyl, Ce-io aryl, C5-10 heteroaryl, halogen, OH, CN, Ci-10 alkoxy, and combinations thereof.
12. The method of claim 11, wherein the compound is formulated as a pharmaceutically effective composition further including at least one pharmaceutically acceptable carrier.
13. The method of claim 11, wherein R1, R2, R3, R4, and R5 are hydrogen.
14. The method of claim 11, wherein the compound of Formula la is a hydrochloride salt.
15. The method of claim 11, wherein the subject is a mammal.
1 . The method of claim 15, wherein the mammal is a human.
17. The method of claim 11, wherein the compound is administered with at least one antibacterial agent.
18. The method of claim 11, wherein the compound is administered by a route selected from the group consisting of oral, transdermal, transmucosal, intravesical, intrapulmonary, intraduodenal, intragastrical, intrathecal, subcutaneous, intramuscular, intradermal, intraarterial, intravenous, intrabronchial, inhalation, and topical administration.
19. The method of claim 18, wherein the route is oral administration.
PCT/US2023/067995 2022-06-06 2023-06-06 Treatment, amelioration, and/or prevention of inflammatory and autoimmune diseases WO2023240081A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202263349394P 2022-06-06 2022-06-06
US63/349,394 2022-06-06

Publications (1)

Publication Number Publication Date
WO2023240081A1 true WO2023240081A1 (en) 2023-12-14

Family

ID=89119035

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2023/067995 WO2023240081A1 (en) 2022-06-06 2023-06-06 Treatment, amelioration, and/or prevention of inflammatory and autoimmune diseases

Country Status (1)

Country Link
WO (1) WO2023240081A1 (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7932288B2 (en) * 2005-10-04 2011-04-26 Kyowa Hakko Bio Co., Ltd. Composition for relieving subjective symptoms of fatigue
US8945540B2 (en) * 2008-05-09 2015-02-03 Exoxemis, Inc. Compositions for enhancing the antibacterial activity of myeloperoxidase and methods of use thereof
US11161802B2 (en) * 2009-04-03 2021-11-02 Ocera Therapeutics, Inc. L-ornithine phenyl acetate and methods of making thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7932288B2 (en) * 2005-10-04 2011-04-26 Kyowa Hakko Bio Co., Ltd. Composition for relieving subjective symptoms of fatigue
US8945540B2 (en) * 2008-05-09 2015-02-03 Exoxemis, Inc. Compositions for enhancing the antibacterial activity of myeloperoxidase and methods of use thereof
US11161802B2 (en) * 2009-04-03 2021-11-02 Ocera Therapeutics, Inc. L-ornithine phenyl acetate and methods of making thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
SANTOS L L, MORAND E F, YANG Y, HUTCHINSON P, HOLDSWORTH S R: "Suppression of adjuvant arthritis and synovial macrophage inducible nitric oxide by N-iminoethyl-l-ornithine, a nitric oxide synthase inhibitor", INFLAMMATION., PLENUM PRESS, NEW YORK, NY., US, vol. 21, no. 3, 1 June 1997 (1997-06-01), US , pages 299 - 312, XP093118309, ISSN: 0360-3997, DOI: 10.1023/A:1027397816209 *

Similar Documents

Publication Publication Date Title
US11191749B2 (en) Pharmaceutical compositions for combination therapy
KR100767317B1 (en) Treating muscle wasting with selective androgen receptor modulators
CA2711807A1 (en) Agonists for antimicrobial peptide systems
EP3548058A1 (en) Compositions comprising peptide wkdeagkplvk
US20220281826A1 (en) Acetyl-coa synthetase 2 (acss2) inhibitors and methods using same
CA2900413A1 (en) A method of treating obesity
Yang et al. Origin of the phagocytic respiratory burst and its role in gut epithelial phagocytosis in a basal chordate
WO2023240081A1 (en) Treatment, amelioration, and/or prevention of inflammatory and autoimmune diseases
JP5965397B2 (en) Adenovirus AD36E4ORF1 protein for prevention and treatment of non-alcoholic fatty liver disease
WO2014065572A1 (en) Pharmaceutical composition for preventing or treating cancer, containing enoblock as active ingredient
Peralta et al. Update on the biological relevance of lysine acetylation as a novel drug target in trypanosomatids
WO2020257753A1 (en) Phosphatidylserine decarboxylase inhibitors
WO2009063241A1 (en) 3-hydroxyanthranilic acid or salts thereof1 for treating cancer or infections
US20230346951A1 (en) Molecular degraders of extracellular proteins
CN113710660A (en) DOT1L degradation agent and application thereof
US20220315624A1 (en) Thiostrepton analogs and methods of making and using same
US20230399303A1 (en) Macrophage Migration Inhibitory Factor Inhibitors, and Methods of Making and Using Same
US20220202772A1 (en) Compositions and methods for inhibiting ribosome inactivating proteins
US20230271994A1 (en) Molecular degraders of extracellular proteins
US20230000888A1 (en) Nad-precursors and dietary restriction for treating age related medical conditions
CN112755172B (en) Compound for improving sperm quality and application thereof
WO2024010585A1 (en) Non-covalent inhibitors of the main protease of sars-cov-2 and methods of use
Dao et al. Gramine improves sepsis-induced myocardial dysfunction by binding to NF-κB p105 and inhibiting its ubiquitination
WO2023049796A1 (en) RelA/RSH INHIBITORS FOR THE TREATMENT OR PREVENTION OF MEDICAL BIOFILMS
WO2023172497A2 (en) Compounds, compositions, and methods for treating, ameliorating, and/or preventing cocaine use disorder

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23820582

Country of ref document: EP

Kind code of ref document: A1