WO2023239609A1 - Promotion de l'absorption de nutriments par le colon - Google Patents

Promotion de l'absorption de nutriments par le colon Download PDF

Info

Publication number
WO2023239609A1
WO2023239609A1 PCT/US2023/024322 US2023024322W WO2023239609A1 WO 2023239609 A1 WO2023239609 A1 WO 2023239609A1 US 2023024322 W US2023024322 W US 2023024322W WO 2023239609 A1 WO2023239609 A1 WO 2023239609A1
Authority
WO
WIPO (PCT)
Prior art keywords
satb2
cells
rule
colonic
substitute sheet
Prior art date
Application number
PCT/US2023/024322
Other languages
English (en)
Inventor
Qiao Joe ZHOU
Original Assignee
Cornell University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US17/935,492 external-priority patent/US20230392145A1/en
Application filed by Cornell University filed Critical Cornell University
Publication of WO2023239609A1 publication Critical patent/WO2023239609A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0679—Cells of the gastro-intestinal tract
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0679—Cells of the gastro-intestinal tract
    • C12N5/068—Stem cells; Progenitors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/998—Proteins not provided for elsewhere
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
    • C12N2506/23—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from cells of the gastro-intestinal tract
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells

Definitions

  • SBS Short Bowel Syndrome
  • TPN long-term total parenteral nutrition
  • Satb2 loss leads to stable conversion of colonic stem/progenitor cells into small intestine-like stem/progenitor cells and replacement of the colonic mucosa with those cells to provide a colonic mucosa that resembles the ileum.
  • Methods and compositions are described herein that can delete or modify at least one Satb2 allele or inhibit expression of a Satb2 gene within in vivo or in vitro cells.
  • At least one Satb2 allele can be inhibited or genetically modified in vivo by introduction of inhibitors and/or modifying agents through oral administration, direct injection, and other methods to thereby convert the starting cells into small intestine-like cells.
  • Delivery vehicles such as AAV (Adeno Associated Virus) and nanoparticles can be used to introduce the inhibitors and/or modifying agents to a patient or subject.
  • compositions are also described herein that can disable at least one Satb2 allele or inhibit expression of a Satb2 gene in one or more isolated starting cells of a subject, to thereby convert the starting cells into small intestine-like cells. They can then be administered to a patient or subject.
  • the Satb2 allele(s) can be deleted or inactivated by genomic modification using, for example, one or more CRISPR, TALENS, ZFN, or baseediting reagents.
  • Expression of the Satb2 gene can be inhibited by inhibitory nucleic acids such as antisense nucleic acids, siRNAs, small hairpin RNAs, expression systems that express such antisense nucleic acids, siRNAs, small hairpin RNAs, or combinations thereof.
  • the methods and compositions described herein can generate populations of engineered Satb2 cells, including .Sh//?2-null cells, and cells having reduced Satb2 expression.
  • populations of engineered Satb2 cells can be made in vivo.
  • the engineered Satb2 cells can be made in vitro and then administered to a subject, for example, into the abdomen, into intestinal tissues.
  • Such engineered Satb2 cells e.g., SATB2-null organoids or SATB2-null stem/progenitor cells
  • a scaffold for instance, a de- cellularized intestinal segment, or any biological or artificial scaffolds, to create transplantable gut segments.
  • Such small intestine-like cells and/or scaffolds that include the engineered Satb2 cells can be administered to a subject in need thereof.
  • Scaffold materials include but are not limited to fibrin, laminin, fibronectin, or combinations thereof, as well as gels made from partial or whole tissues (intestinal gel or other tissue gels). Scaffold materials may be supplemented with growth factors such WNT and EGF and others to enhance cell survival, proliferation, migration, and morphogenesis. Description of the Figures
  • FIGs. 1A-1M illustrate conversion of large intestine mucosa to one that resembles ileal small intestine in knockout Satb2 (Satb2 cK0 ) mice.
  • FIG. 1A is a schematic illustrating that SATB2 and F0XD2 were within the top 20 transcription factors enriched in both mouse and human, and the only common genes beside the posterior HOX genes between these two species.
  • FIG. IB shows a western blot and a graph quantifying mouse SATB2 protein levels in isolated epithelia of 4 different intestinal regions showed strong SATB2 expression in cecum and colon, weak expression in terminal ileum, and no expression in proximal ileum and jejunum.
  • N 3 mice. * P ⁇ 0.05, *** P ⁇ 0.001.
  • FIG. 1C shows that SATB2 is expressed in adult murine large intestine epithelial cells, including LGR5 + stem cells, but absent in small intestine epithelium.
  • ECAD E-cadherin.
  • FIG. ID shows a western blot of isolated crypts or whole glands showing that SATB2 protein expression was not present in the duodenum (crypts and glands) or ileal crypts but detectable in whole ileal glands.
  • N 4 mice.
  • FIG. 1C shows that SATB2 is expressed in adult murine large intestine epithelial cells, including LGR5 + stem cells, but absent in small intestine epithelium.
  • ECAD E-cadherin.
  • FIG. ID shows a western blot of isolated crypts or whole glands showing that SATB2 protein expression was not present in the duodenum (crypts and glands) or ileal crypts but detectable in whole
  • FIG. IF is a schematic diagram of the conditional knockout of SATB2 (Satb2 cKO ) using VillinCre-ER and floxed Satb2. After deletion of Exons 4 and 5, multiple stop codons are created in the downstream exon.
  • FIG. IF shows characteristic images of colon from 2-month-old mice 30 days after intestinal deletion of Satb2 (in Vil-Cre ER ;Satb2 f/f ; Satb2 cK0 mice) compared to characteristic images of colon from 2-month old mice that express wild type Satb2 (control).
  • FIG. 1G graphically illustrates the mucosal depth and Paneth cells per crypt observed in ileum control, colon control, and colon Satb2 cKO sections.
  • FIG. 1H graphically illustrates principal-component analysis (PCA) of RNA-seq data from intestinal epithelia of different tissues.
  • PCA principal-component analysis
  • FIG. 1D-1E show that RNA-seq of intestinal epithelia reveal a shift of the large intestine transcriptomes (cecum and colon) in Satb2 cK0 mice toward small intestine ileal transcriptomes by principal-component analysis (PCA) (FIG. ID) and gene set enrichment analysis (FIG. IE).
  • PCA principal-component analysis
  • FDR false discovery rate.
  • FIG. 1J shows immunofluorescence images illustrating the appearance of 0LFM4+ small intestine stem cells, LYZ1 + Paneth cells, and FABP6 + and FGF15 + ileal enterocytes in Satb2 cKO colon and concomitant disappearance of CA1 + and AQP4 + colonocytes.
  • FIG. IK shows immunofluorescently stained images of control and Satb2 cK0 proximal colon sections obtained 6 months after tamoxifen (TAM) treatment, illustrating persistence of ileal-like mucosa in the mutant colon.
  • TAM tamoxifen
  • FIG. IL shows histochemically stained images of control and Satb2 cK0 proximal and distal colon sections obtained 6 months after tamoxifen (TAM) treatment, illustrating absence of SATB2 and activation of FABP6 and RBP2 in both proximal and distal colon.
  • FIG. IM graphically illustrates SATB2, FABP6 and RBP2 expression in the control and Satb2 cKO proximal and distal colon sections shown in FIG. IL.
  • n 5 areas quantified. * P ⁇ 0.05, *** P ⁇ 0.001. Mean ⁇ S.D. Unpaired t-test.
  • FIGs. 2A-2E illustrate conversion of LGR5 + colonic stem cells to ileumlike stem cells after SATB2 loss.
  • FIG. 2A illustrates scRNA-seq and post hoc annotation, showing that a majority of cells in Satb2 cK0 colon clustered with ileum (t-distributed stochastic neighbor embedding (t-SNE) plots, 3,912 cells from ileum, 3,627 cells from control colon, and 4,370 cells from Satb2cKO colon).
  • the Satb2cKO colonic sample was harvested 30 days after tamoxifen (TAM) treatment.
  • FIG. 2B shows dot plots of 30 representative genes of the major intestinal cell lineages.
  • FIG. 2C graphically illustrates Uniform Manifold Approximation and Projection (UMAP) visualization of 594 LGR5 + stem cells at Gl/S phase. Satb2 cKO colonic stem cells cluster with ileal rather than colonic stem cells.
  • 2E shows images illustrating that SATB2 deletion from colonic stem cells in Lgr5 CreERGFP ;Satb2 f/f mice led to progressive conversion of colonic epithelium to ileum.
  • the deleted clones were marked by crypt GFP expression.
  • 7 days after tamoxifen (TAM) treatment SATB2 disappeared from the lower part of the glands, but 0LFM4 was activated only in some of the GFP + colonic stem cells, indicating incomplete reprogramming at this stage.
  • TAM tamoxifen
  • FIGs. 3A-3C illustrate rapid conversion of colonocytes to enterocytes after SATB2 loss.
  • FIG. 3A shows a time course study of colonic mucosa gene expression after a single dose of tamoxifen (TAM) in Satb2 cK0 mice illustrating rapid activation of FABP6 and down-regulation of CAI at day 2 and complete replacement of CA I 1 cells by FABP6 + cells by day 6. 0LFM4 and LYZ1 were not robustly activated until day 30.
  • FIG. 3B shows principal-component analysis (PCA) of time-course RNA-seq data illustrating rapid activation of pathways typical of enterocytes and downregulation of pathways characteristic of colonocytes.
  • FIG. 3C shows a heatmap representation of time-course RNA-seq data illustrating rapid activation of pathways typical of enterocytes and downregulation of pathways characteristic of colonocytes. Paneth and stem cell genes were only strongly activated at day 30.
  • FIGs. 4A-4D illustrate generation of bona fide nutrient-absorbing enterocytes in Satb2 cKO colon.
  • FIG. 4A illustrates scRNA profiles of Satb2 cK0 colonic enterocytes closely resemble ileal enterocytes. The heatmap was plotted using the top 100 differentially expressed genes (DEGs) between ileal enterocytes and control colonocytes. The bar graph shows the top five differential Gene Ontology pathways between ileal enterocytes and control colonocytes. Some of the nutrient transporters are highlighted in the heatmap.
  • FIG. 4C is a schematic of the assay for measuring glucose and taurocholic acid absorption and trans-epithelial transport into portal circulation. A segment of the ileum or colon was tied on both ends to create a pouch; radiolabeled chemicals were injected into the pouch to allow absorption and transport.
  • FIGs. 5A-5G illustrate that SATB2 confers colonic characteristics to adult ileum.
  • FIG. 5 A is a schematic diagram illustrating construction of a Satb2 transgenic mouse line (CAG Satb2GFP ). Co-expression of murine SATB2 (with a HA epitope tag) and GFP is activated in the adult intestine after tamoxifen (TAM) treatment of Vil-Cre ER ;CAG Satb2GFP (Sath2 0E ) mice.
  • FIG. 5B further illustrates construction of a Satb2 transgenic mouse line (CAG Satb2GFP ), showing immunostained ileal sections (30 days after TAM treatment of 2-month-old mice), confirming co-localization of the HA tag and GFP.
  • TAM tamoxifen
  • FIG. 5C shows a representative FACS plot of GFP and EPCAM in purification of GFP+ and GFP- ileal epithelial cells. Ectopic expression of Satb2 activated colonic genes and suppressed ileal genes.
  • FIG. 5F illustrates ectopic SATB2 activated the colonic marker CAI and suppressed OLFM4, LYZ1, and FABP6 in the ileum, in immunofluorescently stained ileum 30 days after TAM.
  • White lines delineate villi and crypts.
  • Dashed lines in magnified pictures outline crypts.
  • 5G also illustrates that ectopic SATB2 activated the colonic marker CAI and suppressed OLFM4, LYZ1, and FABP6 in the ileum, as graphically illustrated by quantified levels of CAU and FABP6 + cells among GFP+ or GFP- cells on the ileal villi.
  • the numbers of OLFM4+ stem cells and LYZ1+ Paneth cells were also quantified in GFP+ and GFP- crypts.
  • N 5 mice. Mean + SD. p value by paired t test.
  • FIGs. 6A-6J illustrate that SATB2 regulates enhancer dynamics and binding of intestinal transcription factors CDX2 and HNF4A.
  • FIG. 6A illustrates binding motifs of top transcription factors enriched in SATB2 ChlP-seq sites (MACS p ⁇ 1 x 10 -9 ) by HOMER in control colonic epithelium. Motifs were ranked by -logio (p value).
  • FIG. 6B shows a Venn diagram illustrating the overlaps among SATB2”, CDX2 , and HNF4A-bound regions. Shown are two biological replicates for each of the factors.
  • FIG. 6C illustrates that CDX2 and HNF4A antibodies can pull down SATB2 proteins from primary colonic tissues.
  • FIG. 6A-6C illustrate extensive genomic co-binding of SATB2 with CDX2 and HNF4A in colonic epithelium.
  • FIG. 6D shows Box-and- whisker plots representing relative gene expression changes. Genes adjacent to colonic enhancers (MAnorm p ⁇ 0.01, distance ⁇ 50 kb, 2,618 genes) were expressed at higher levels in control colon (p ⁇ 2 x 10 -16 ), whereas genes adjacent to ileal enhancers (MAnorm p ⁇ 0.01, distance ⁇ 50 kb, 2,837 genes) were expressed at higher levels in ileum and Satb2cKO colon (p ⁇ 2 x 10 16 ).
  • MAnorm p ⁇ 0.01, distance ⁇ 50 kb, 2,618 genes were expressed at higher levels in control colon (p ⁇ 2 x 10 -16 )
  • genes adjacent to ileal enhancers MAnorm p ⁇ 0.01, distance ⁇ 50 kb, 2,837 genes
  • FIG. 6E illustrates that SATB2 ChlP-seq signals were enriched at colon-specific enhancers compared with ileum-specific enhancers in control colon (p ⁇ 2 x 10“ 16 ). A plot is shown for a 20-kb window centered on each specific enhancer binding site.
  • FIG. 6F illustrates inactivation of colon-specific enhancers and activation of ileum-specific enhancers in Satb2 cKO colon.
  • FIG. 6G illustrates Genome Browser tracks of RNA-seq, histone modifications (CUT&RUN-seq), and transcription factor ChIP data at genomic loci of the colonic gene Carl and the ileal gene Bcl2115. Regions with significant enhancer and transcription factor binding changes among samples are highlighted.
  • FIG. 6H shows a FACS plot of cell fractions enriched for stem cells (EPCAM+GFP+) or differentiated cells (EPCAM+GFP”) isolated from LGR5 DTRGFP murine colon.
  • FIG. 61 illustrates a Pearson correlation of SATB2 binding signals in stem versus differentiated cells by CUT&RUN-seq shows concordant binding patterns.
  • FIG. 6J illustrates SATB2 CUT&RUN binding profiles in a 10-kb window centered on SATB2 peaks identified by ChlP-seq. Together, FIG. 6H-6J illustrate that SATB2 bound similar genomic loci in colonic LGR5+ stem cells as non- stem cells.
  • FIGs. 7A-7I illustrate colonic-to-ileal plasticity after SATB2 loss in human colonic organoids.
  • FIG. 7A shows that SATB2 is expressed in ECAD + epithelial cells of the human colon but not in ECAD + epithelial cells of the human ileum.
  • FIG. 7B is a diagram with images of the methods used for CRIS PR-mediated genomic deletion of SATB2 in cultured human colonic organoids followed by differentiation. Representative images of organoids shown at different stages.
  • FIG. 7D illustrates successful knockout of SATB2 expression in all five human organoid lines.
  • FIG. 7E shows representative images of SATB2 expression in one of the primary human organoid lines (#87) and its absence after CRISPR-mediated deletion.
  • sgRNA single guide RNA, sgRNAl.
  • FIG. 7F illustrates that RBP2, a marker of ileum, was detected in ileal human biopsy tissues.
  • FIG. 7G illustrates that RBP2, a marker of ileum, was not detected in the colonic epithelium of human biopsy tissues.
  • FIGs. 8A-8I illustrate identification of SATB2 as a transcription factor enriched in large intestine stem cells that regulates large intestine gene expression.
  • FIG. 8B shows primary human duodenal and colonic organoids were cultured in Matrigel under high-Wnt conditions that favor stem and progenitor proliferation. RNA-seq comparison of the human organoids identified the top 20 colonic enriched TFs.
  • FIG. 8C illustrates comparing the top 20 TFs enriched in both mouse and human, SATB2 and FOXD2 were the only common genes beside the posterior HOX genes.
  • FIG. 8D provides three guide RNAs (sgl, 2, 3) for CRIS PR-mediated disruption of murine Satb2. After Lentiviral delivery of guide RNA and CAS9 into murine colonic organoids and selection with puromycin (puromycin gene and CAS9 are co-expressed with the guide RNA), Western blot showed efficient deletion of SATB2 (85-95%), which was confirmed by immunostaining of SATB2 on control and SATB2 CRISPR organoids. *** P ⁇ 0.001. Mean ⁇ S.D. Unpaired t-test. E.
  • FIGs. 8F-I show RNA-seq of murine colonic organoids revealed significant transcriptomic changes in Satb2 CRISPR organoids (Satb2 KO), but not Foxd2 KO organoids.
  • F Principal component analysis. 229 genes were up- regulated and 86 genes down-regulated in SATB2 CRISPR organoids vs control colonic organoids (LFC > 2, Padj ⁇ 0.05) as shown in the heatmap (FIG. 8G) and the volcano plots
  • FIG. 8H illustrates the up- and down-regulated genes were enriched for small intestine and large intestine respectively (FIG. 81, tissue enrichment by Enrichr).
  • FIGs. 9A-9L illustrate colonic epithelium in Vil-Cre ER ;Satb2 f/ff (Satb2 cKO ) mice resembles that of ileal small intestine.
  • FIG 9A shows Western blot and quantification of SATB2 protein levels in isolated epithelia of 5 different intestinal regions showed strong SATB2 expression in cecum and colon, weak expression in terminal ileum, and no expression in proximal ileum and jejunum.
  • N 3 mice. * P ⁇ 0.05, *** P ⁇ 0.001. Mean ⁇ S.D. Unpaired t-test
  • FIG 9B shows a diagram of the conditional knockout of SATB2 using Villin Cre ER and floxed Satb2.
  • FIG 9C illustrates immunohistochemistry confirmed lack of SATB2 in Satb2 cKO colon 30 days after tamoxifen treatment.
  • FIG 9D shows wide-view H&E histology pictures of control and Satb2cKO proximal colon 2 months after TAM. The mutant colon was covered by villi-like glands. The rugae structures remained.
  • FIG 9E shows Alcian blue stain showed the number of mature goblet cells in Satb2cKO colon decreased significantly compared with control colon, reaching a level comparable to ileum.
  • N 3 mice. Mean ⁇ S.D. *** P ⁇ 0.001. Unpaired t-test.
  • FIG 9F shows there was no difference in the apoptosis rate, as assessed by activated caspase 3, among the 3 samples.
  • N 3 mice. Mean ⁇ S.D. Unpaired t- test.
  • G. 24-hour pulse-chase with Edu showed enhanced upward migration of epithelial cells in Satb2 cK0 colon versus control colon, at a rate comparable to that of ileum.
  • N 3 mice. Mean + S.D. ***P ⁇ 0.001. Tukey's multiple comparison test.
  • FIGs. 9H-K illustrate the transcriptome of Satb2 cK0 colonic epithelium resembles control ileum, as shown in the heatmap (FIG.
  • FIG 9H (LFC > 2, Padj ⁇ 0.05, RPKM cut > 0.5), volcano plots (FIG. 91), and GeneOntology biological processes enriched in ileum vs control colon (FIG. 9 J) and Satb2cKo colon vs control colon (FIG. 9K).
  • FIG 9L illustrates wide-view
  • FIGs. 10A-10G illustrate single cell RNA sequencing reveals stem cell conversion and rerouting of cell lineage differentiation in Satb2cKO colon to ileum.
  • FIG. 10 A shows dot plots of some of the lineagespecific marker genes that were used to allocate all the epithelial cell transcriptomes (11,909) from control ileum, colon, and Satb2cKo into nine broadly defined groups.
  • FIG. 10B illustrates quantitation of the lineage groups showed replacement of colonocytes by enterocytes and generation of Paneth cells in Satb2cKo colon, although a small number of colonocytes remain.
  • FIG. 10C shows scRNA profiles of Satb2cKo colonic cells shifted toward ileum, based on scoring each annotated cell type with curated ileal signature genes
  • FIGs. 10D-10G illustrate identification of intestinal stem cells from the scRNA profiles.
  • Lgr5 + and Lgr5 cells were extracted from the "Progenitor group" of the integrated Sc-Seq dataset (FIG. 10D).
  • Lgr5 + cells expressed higher levels of the stem cell marker genes Ascl2 and Axin2 (violin plots, FIG. 10D) and scored significantly higher than Lgr5" cells using a published list of small intestine stem cell genes (Munoz et al. 2012) (FIG. 10E).
  • y axis represents relative expression value.
  • the cell cycle status of the stem cell clusters was marked in FIG. 10F.
  • the top five differential GeneOntology biological processes enriched in LGR5 + stem cell populations of Satb2 cK0 colon vs control colon were plotted in FIG. 10G.
  • FIGs. 11A-11K illustrate characterization of SATB2 loss in colon and SATB2 gain in jejunum.
  • FIG. 11A illustrates when cultured in large intestine medium that contains extra Wnt3a, isolated crypts from ileum, control colon, and Satb2 cK0 colon all produced spheroids in Matrigel (lower panel).
  • FIG. 11A illustrates when cultured in large intestine medium that contains extra Wnt3a, isolated crypts from ileum, control colon, and Satb2 cK0 colon all produced spheroids in Matrigel (lower panel).
  • FIG. 11A illustrates time lapse images show the growth and branching morphogenesis of one representative ileal organoid and one Satb2 cK0 colonic organoid grown in small intestine medium over the course of 4 days.
  • FIG. 11C illustrates heatmap of the top 75 DEGs (average LogFC) among the three Lgr5 + stem cell single-cell transcriptomes. MHCII genes (highlighted in red) were among the most differentially expressed genes between ileal and Satb2 cKO stem cells.
  • FIG. 11C illustrates heatmap of the top 75 DEGs (average LogFC) among the three Lgr5 + stem cell single-cell transcriptomes.
  • MHCII genes were among the most differentially expressed genes between ileal and Satb2 cKO stem cells.
  • FIG. 11D illustrates principal component analysis (PCA) of RNA-seq data from primary epithelia and cultured organoids showed a closer resemblance between ileal and Satb2 cKO colonic transcriptomes after culturing in identical medium, suggesting environmental factors likely influenced differential gene expression between ileal mucosa and ileal-like mucosa in Satb2 cK0 colon.
  • FIG. HE illustrates Pearson correlation of ileal vs Satb2 cKO colonic transcrip tome from primary epithelia or cultured organoids (r, Pearson correlation coefficient).
  • FIG. 11F-11G illustrate querying our Sc-Seq data, mature enterocytes in Satb2 cK0 colon express a myriad of transporters for lipids, bile salts, vitamins, amino acids, and carbohydrates, similar to ileal enterocytes. Shown are dot plots of the transporters from the scRNA profiles of identified mature ileal enterocytes, mature Satb2 cKO colonic enterocytes, and mature colonic colonocytes (FIG. 11F). Scores were calculated using the selected genes (FIG. 11G).
  • FIG. 11H illustrates immunohistochemistry of HA-tag and GFP in jejunum showed that they were co-expressed in Satb2 cK0 adult mice4 weeks after TAM.
  • FIGs. 12A-12H illustrate SATB2 regulates enhancer dynamics and transcription factor binding in the colon to ileum plasticity.
  • FIGs. 12A-12B illustrate SATB2 genomic binding sites in colonic tissues were identified by ChlP-seq using both input and Satb2 cK0 colonic tissues as controls, yielding 25,576 peaks (peak call by MACS2, duplicate biological samples) (FIG. 12A). The genomic binding sites were predominantly localized to introns and intergenic regions (FIG. 12B).
  • FIGs. 12C-12D illustrate aligned genomic binding profiles of SATB2, CDX2 and HNF4a in control colon showed extensive co-localization.
  • FIG. 12E-12F illustrate enrichments of H3K4mel, H3k27ac and IgG controls determined by CUT&RUN in control colon was aligned with SATB2 binding sites (FIG. 12E) and quantified (FIG. 12F). Enhancers were partitioned into active and inactive based on H3K27ac enrichments.
  • FIG. 12G illustrates signals of histone marks, TFs, and AT AC around colon- and ileum-specific enhancers (identified by comparing the signal strength between all H3K4mel + enhancers in control colon and ileum) in controls and Satb2 cK0 colon (KO), indicating activation of ileal enhancers and inactivation of colonic enhancers in SATB2 mutant colon.
  • FIG. 12H shows Western blots and quantification of HNF4A and CDX2 co-IP from control and Satb2 cK0 colonic tissues.
  • FIGs. 13A-13J illustrate human colonic organoids became ileal-like after CRIS PR-mediated SATB2 deletion.
  • FIG. 13A illustrates a diagram of the experimental setup for human colonic organoid culture, CRISPR, and differentiation analysis. Representative images of organoids shown at different stages.
  • FIG. 13E illustrates heatmap of differential expressed genes (Padj ⁇ 0.1) between control and SATB2 knockout (SATB2 hK0 ) organoids. Some of the known colonic and small intestine genes are highlighted in red and green, respectively.
  • FIG. 13F illustrates RBP2, a marker of ileum, was detected in ileal but not colonic epithelium of human biopsy tissues. RBP2 was abundantly expressed in colonic organoids after SATB2 deletion, at levels comparable to that of control ileal organoids.
  • FIG. 13G illustrates SLC15A1 was detected in the brush border (white arrows) of human ileal epithelium and the luminal side of human ileal organoids.
  • FABP6 was detected in the cytoplasm of the ileal epithelium and organoids. Both markers were not detected in colonic epithelium.
  • FIG. 13H illustrates diagrams showing the chemical reactions mediated by dipeptide peptidase (OPP) and disaccharidase, two small intestinal digestive enzymes, and the corresponding assays to quantify their activities.
  • OPP dipeptide peptidase
  • FIG. 13J Staining of the colonic enriched goblet cell marker MUC2 in primary tissue sections and colonic control and STAB2 KO organoids.
  • FIGs. 14A-14I illustrate identification of SATB2 as a transcription factor enriched in large intestine stem cells that regulat.es large intestine gene expression.
  • FIG. 14B illustrates primary human duodenal and colonic organoids were cultured in Matrigel under high-Wnt conditions that favor stem and progenitor proliferation. RNA-seq comparison of the human organoids identified the top 20 colonic enriched TFs. N ⁇ 4 biological replicates.
  • FIG. 14A illustrates a comparison of published RNA-seq data of FACS - purified Lgr5-GFP stem cells (L°r5DTRGFP mice) from the duodenum and the colon identified the top 20 transcription factors
  • FIG. 141) illustrates three guide RNAs (sgl, 2, 3) for CRISPR- mediated disruption of murine Satb2.
  • guide RNA and CAS9 were Lenti viral delivery of guide RNA and CAS9 into murine colonic organoids and selection with puromycin (puromycin gene and CAS9 are co-expressed with the guide RNA)
  • Western blot showed efficient deletion of SATB2 (85-95%), which was confirmed by immunostaining of SATB2 on control and SATB2 CRISPR organoids.
  • FIG. 14E illustrates three guide RNAs used independently for CRISPR disruption of the Foxd2 gene in murine colonic organoids.
  • An assay based on T7 endonuclease cutting of PCR-amplified Foxd2 genomic region targeted by CRISPR was used to quantify the Foxd2 genomic disruption efficiency at 57-74%.
  • FIGs. 14F-14I. show that RNA-seq of murine colonic organoids revealed significant transcriptomic changes in Satb2 CRISPR organoids (Satb2 KO), but not Foxd2 KO organoids.
  • FIG. 14F illustrates principal component analysis.
  • FIGs. 15A-15M illustrate colonic epithelium in Vil-CreER;Sa/Z>2f/f (Satb2cKO) mice resembles that of ileal small intestine.
  • FIG. 15A illustrates Western blot and quantification of SATB2 protein levels in isolated epithelia of 4 different intestinal regions showed strong SATB2 expression in cecum and colon, weak expression in terminal ileum, and no expression in proximal ileum and jejunum.
  • N 3 mice. * P ⁇ 0.05, *** P ⁇ 0.001. Mean ⁇ S.D. Unpaired t-test.
  • FIG. 15A illustrate colonic epithelium in Vil-CreER;Sa/Z>2f/f (Satb2cKO) mice resembles that of ileal small intestine.
  • FIG. 15A illustrates Western blot and quantification of SATB2 protein levels in isolated epithelia of 4 different intestinal regions showed strong SATB2 expression in cecum and colon, weak expression in terminal ile
  • FIG. 15B illustrates Western blot using isolated crypts or whole glands showed SATB2 protein expression was not present in the duodenum (crypts and glands) or ileal crypts but detectable in whole ileal glands.
  • N 4 mice. Mean ⁇ S.D. Unpaired t-test.
  • FIG. 15C illustrates purification of EPCAM+GFP+ stern cells from LGR5CreERGFP mice and qRT-PCR showed
  • FIG. 15D illustrates a diagram of the conditional knockout of SATB2 using VillinCre-ER and floxed Safb2' . After deletion of Exons 4 and 5, multiple stop codons are created in the downstream exon.
  • FIG. 15E illustrates immunohistochemistry confirmed lack of SATB2 in Satb2cKO colon 30 days after tamoxifen treatment.
  • FIG. 15F illustrates a wide-view H&E histology pictures of control and Satb2cKO proximal colon 2 months after
  • FIG. 15G illustrates Alcian blue stain showed the number of mature goblet cells in Salb2cKO colon decreased significantly compared with control colon, reaching a level comparable to ileum.
  • N 3 mice. Mean ⁇ S.D. *** P ⁇ 0.001. Unpaired t-test.
  • FIG. 15G illustrates Alcian blue stain showed the number of mature goblet cells in Salb2cKO colon decreased significantly compared with control colon, reaching a level comparable to ileum.
  • N 3 mice. Mean ⁇ S.D. *** P ⁇ 0.001. Unpaired t-test.
  • FIG. 15H illustrates that there was no difference in the apoptosis rate, as assessed by activated caspase 3, among the 3 samples.
  • N 3 mice. Mean ⁇ S.
  • FIGs. 15J-15M provides a transcriptome of Satb2cKO colonic epithelium that resembles control ileum, as shown in the heatmap (FIG. 15J, (LFC > 2, Padj ⁇ 0.05, RPKM cut > 0.5), volcano plots (FIG. 15K), and GeneOntology biological processes enriched in ileum vs control colon (FIG. 15L) and Satb2cKO colon vs control colon (FIG. 15M).
  • FIGS. 16A-16C illustrate the ileal to colonic mucosal conversion in Satb2cKO mice is stable.
  • FIG. 16A illustrates a wide-view immunofluorescence images of controls and Satb2cKO proximal colon 6 months after TAM showing persistence of ileal-like mucosa in the mutant colon.
  • FIGs. 17A-17I illustrate single cell RNA sequencing reveals stem cell conversion and rerouting of cell lineage differentiation in Satb2cKO colon to ileum.
  • FIG. 17A illustrates dot plots of some of the lineage-specific marker genes that were used to allocate all the epithelial cell transcriptomes (1 1,909) from control ileum, colon, and Satb2cKO into nine broadly defined groups.
  • FIG. 17B illustrates quantitation of the lineage groups showed replacement of colonocytes by enterocytes and generation of Paneth cells in Satb2cKO colon, although a small number of colonocytes remain.
  • FIG. 17A-17I illustrate single cell RNA sequencing reveals stem cell conversion and rerouting of cell lineage differentiation in Satb2cKO colon to ileum.
  • FIG. 17A illustrates dot plots of some of the lineage-specific marker genes that were used to allocate all the epithelial cell transcriptomes (1 1,909) from control ileum, colon, and Satb2cKO into nine broadly defined groups
  • FIG. 17C illustrates scRNA profiles of Satb2cKO colonic cells shifted toward ileum, based on scoring each annotated cell type with curated ileal signature genes (ileal identity score). Violin plots of the distribution of ileal identity score. *** P ⁇ l x 10-12. Mann Whitney U-test.
  • FIGs. 17D-17G illustrate dentification of intestinal stem cells from the scRNA profiles. Lgr5+ and Lgr5- cells were extracted from the “Progenitor group” of the integrated Sc- Seq dataset (FIG. 17D). Lgr5+ cells expressed higher levels of the stern cell marker genes Ascl2 and Axin2 (violin plots, FIG.
  • FIG. 17D The top five differential GeneOntology biological processes enriched in LGR5+ stem cell populations of Satb2cKO colon vs control colon were plotted in FIG. 17G.
  • FIG. 17H illustrates 7 days after TAM treatment of Lgr5CreERGFP;Satb2f/f mice, epithelial renewal in the GFPmarked colonic glands were incomplete.
  • FIG. 171 provides RNA-seq profiles and GeneOntology analysis of clusters 6-9 in SATB2 timed deletion study.
  • FIGs. 17J and 17K illustrate GSEA analysis showed no significant enrichment of fetal gene set in colonic transcriptomes from day 1 to 6 after TAM treatment of Satb2cKO mice (FIG. 17J).
  • the fetal markers Ly6a and Anxal also showed limited or no up-regulation in colonic mucosa after Satb2 deletion (RNA-seq data).
  • FIGs. 18A-18M illustrate characterization of SATB2 loss in colon and SATB2 gain in jejunum.
  • FIG. ISA shows that when cultured in large intestine medium that contains extra Wnt3a, isolated crypts from ileum, control colon, and Satb2cKO colon all produced spheroids in Matrigel (lower panel). The same batch of control colonic crypts, when cultured in small intestine medium without Wnt3a, yielded only a few small spheroids whereas ileal and Satb2cKO colonic crypts produced many branching organoids (upper panel).
  • FIG. ISA shows that when cultured in large intestine medium that contains extra Wnt3a, isolated crypts from ileum, control colon, and Satb2cKO colon all produced spheroids in Matrigel (lower panel). The same batch of control colonic crypts, when cultured in small intestine medium without Wnt3a, yielded only a few small spher
  • FIG. 18B shows time lapse images show the growth and branching morphogenesis of one representative ileal organoid and one Satb2cKO colonic organoid grown in small intestine medium over the course of 4 days.
  • FIGs. 18C and 18D show a heatmap of the top 75 DEGs (a verage LogFC) among the three Lgr5+ stem cell singlecell transcrip tomes.
  • MHCII genes (highlighted in FIG. 18C and shown separately in FIG. 18D) were among the most differentially expressed genes between ileal and Satb2cKO stem cells.
  • FIG. 18E shows images of Matrigel cultures of ileum, control colon, and Satb2cKO colon in WF.NR medium followed by differentiation.
  • FIGs. 18H and 181 show' querying the scRNA data, mature enterocytes in Satb2cKO colon express a myriad of transporters for lipids, bile salts, vitamins, amino acids, and carbohydrates, similar to ileal enterocytes. Shown tire dot plots of the transporters from the scRNA profiles of identified mature ileal enterocytes, mature Satb2cKO colonic enterocytes, and mature colonic colonocytes (FIG. 18H).
  • FIG. 18J illustrates immunohistochemistry of HA-tag and GFP in jejunum showed that they were co-expressed in Satb2cKO adult mice4 weeks after TAM.
  • the expression of SATB2/GFP is mosaic, with about 79% jejunal glands marked by GFP.
  • FIG. 18K shows qRT-PCR of Satb2 mRNA from FACS-purified GFP+ and GFP- cells from duodenum, jejunum, and ileum of Satb2OE mice showed the levels of ectopic Satb2 expression in GFP+ cells were comparable to that of control colon.
  • N 4 mice. Mean ⁇ S.D. *** p ⁇ 0.001, unpaired t-test.
  • FIG. 18M show qRT-PCR of a basket of signature genes for the large and small intestine showed that SATB2 strongly suppressed small intestine genes in all small intestinal regions whereas the activation of colonic genes was much weaker in jejunum and minimal in duodenum, compared with ileum.
  • N 4 mice. Mean ⁇ S.D. * P ⁇ 0.05, ** P ⁇ 0.01, *** P ⁇ 0.001. Unpaired t-test.
  • FIGs. 19A-19P show SATB2 regulates enhancer dynamics and transcription factor binding in the colon to ileum plasticity.
  • FIGs. 19A and FIG. 19B show SATB2 genomic binding sites in colonic tissues were identified by ChlP-seq using both input and Satb2cKO colonic tissues as controls, yielding 25,576 peaks (peak call by MACS2, duplicate biological samples) (FIG. 19A). The genomic binding sites were predominantly localized to introns and intergenic regions (FIG. 19B).
  • FIGs. 19C and FIG. 19D show aligned genomic binding profiles of SATB2, CDX2 and HNF4a in control colon showed extensive co-localization.
  • FIG. 19F show enrichments of H3K4mel, H3k27ac and IgG controls determined by CUT&RUN in control colon was aligned with SATB2 binding sites (FIG. 19E) and quantified (FIG. 19F). Enhancers were partitioned into active and inactive based on H3K27ac enrichments.
  • FIG. 19G and FIG. 19H show signals of histone marks, TFs, and AT AC around colon- and ileum-specific enhancers (identified by comparing the signal strength between all H3K4mel+ enhancers in control colon and ileum) in controls and Satb2cKO colon (KO), indicating activation of ileal enhancers and inactivation of colonic enhancers in SATB2 mutant colon.
  • FIG. 19H The two independent replicates of CDX2 binding profiles are shown in FIG. 19H.
  • FIG. 191 shows box-and- whisker plots of HNF4A and CDX2 genomic binding signals in colon showing significant decreases of both TFs on colonic enhancers and increases on ileal enhancers after SATB2 loss.
  • FIG. 19J shows AT AC profiles of colonic and ileal enhancers in developing murine midgut and hindgut EPCAM+ epithelial cells showed that ileal enhancers had low ATAC signals in hindgut and thus were not active enhancers. Similarly, colonic enhancers were not active in developing ileum.
  • FIGs. 191 shows box-and- whisker plots of HNF4A and CDX2 genomic binding signals in colon showing significant decreases of both TFs on colonic enhancers and increases on ileal enhancers after SATB2 loss.
  • FIG. 19J shows AT AC profiles of colonic and ileal enhancers in developing murine midgut and hindgut EP
  • FIG. 19K and 19L show PCA and heatmap representation of RNA-seq data showed Eed deletion alone (EedcKO) did not lead to colonic to ileal transcriptomic conversion whereas Eed removal in SATB2-null colon (double deletion; EedcKOSatb2cKO) also did not enhance transcriptomic shift further toward ileum.
  • FIG. 19M shows Western blots and quantification of HNF4A and CDX2 co-IP from control and Satb2cKC) colonic tissues, n ⁇ 3 samples. Mean + S.D. ** P ⁇ 0.01, *** P ⁇ 0.001. Unpaired t-test. FIGs.
  • FIG. 19N and 190 show CDX2 levels decreased whereas HNF4A levels increased after SATB2 loss (Normalized counts from Bulk RNA-Seq).
  • FIG. 19P shows SATB2 CUT&RUN profiles centered on SATB2 Chip peaks showed high concordance, indicating that these two methods identified similar binding events.
  • the profiles from stem cells and differentiated cells were also similar, indicating similar binding patterns in stem and differentiated cells .
  • FIGs. 20A-20J illustrate human colonic organoids became ileal-like after CRIS PR-mediated S ATB2 deletion.
  • FIG. 20A illustrates a diagram of the experimental setup for human colonic organoid culture, CRISPR, and differentiation analysis. Representative images of organoids shown at different stages.
  • FIG. 20 E illustrates a heatmap of differential expressed genes (Padj ⁇ 0.1) between control and SATB2 knockout (S ATB2hKO) organoids. Some of the known colonic and small intestine genes are highlighted in red and green, respectively.
  • FIG. 20F illustrates that RBP2, a marker of ileum, was detected in ileal but not colonic epithelium of human biopsy tissues.
  • FIG. 20G illustrates SLC15A1 was detected in the brush border (white arrows) of human ileal epithelium and the luminal side of human ileal organoids.
  • FABP6 was detected in the cytoplasm of the ileal epithelium and organoids. Both markers were not detected in colonic epithelium.
  • FIG. 20H illustrates diagrams showing the chemical reactions mediated by dipeptide peptidase (DPP) and disaccharidase, two small intestinal digestive enzymes, and the corresponding assays to quantify their activities.
  • FIG. 20J illustrates staining of the colonic enriched goblet cell marker MUC2 in primary tissue sections and colonic control and STAB2 KO organoids.
  • FIG. 21 Partial Satb2 deletion in colon ameliorates Short Bowel disease in mice.
  • SBR short bowel resection.
  • Colon-targeted Satb2 genetic deletion was performed on adult mice (average 8 weeks old) of the genotype Villin- CreER;Satb2f/f or control Villin-CreER;Satb2f/+. Deletion (dosing) was initiated by intraperitoneal injection of 0.5mg Tamoxifen on day 9 and day 10 post SBR.
  • engineered SATB2-null organoids and/or SATB2-null stem cells can stably convert into small intestine-like tissues useful for replacing colonic mucosa with tissues that function as small intestine.
  • SATB2 (Special AT-rich sequence-binding Protein 2) is a conserved colon-enriched chromatin factor. Genetic deletion of Satb2 from adult mouse intestine revealed a striking phenotype: the colonic epithelium undergoes a homeotic-like transformation to resemble that of small intestine, with the appearance of villi-like structures, Paneth cells, and enterocytes expressing abundant nutrient transporters. Colonic transcriptome also shifts in adult Satb2-null mice towards ileum and the Satb2-null colon can absorb nutrients. These results show that SATB2 plays a crucial role in maintaining large intestine gene expression, differentiation, and function while suppressing the small intestine fate. Therefore, SATB2 is a “master regulator” of colonic identity.
  • Colonic SATB2 expression has been noted and used as a diagnostic marker for colorectal cancers. However, the normal function of SATB2 in mature colon has previously not been identified. Experiments described herein show that SATB2 is a “master regulator” of colonic identity. Moreover, the work described herein shows that deletion of SATB2 in murine and human colonic cell types can convert those cell types into small intestinal type cells.
  • the SATB2 gene in humans resides on chromosome 2 (location 2q33.1; NC_000002.12 (199269500..199471266, complement; NC_060926.1 (199753552..199955035, complement)).
  • a sequence for the human SATB2 protein is available from the NCBI database as accession no. NP_001165980.1, and shown below as SEQ ID NO: 1.
  • a cDNA encoding the SEQ ID NO:1 SATB2 protein is available from the NCBI database as accession no. NM_001172509.2, and shown below as
  • a cDNA encoding the SEQ ID NO:3 human SATB2 protein is available from the NCBI database as accession no. NM_015265.4.
  • a cDNA encoding the SEQ ID NO:4 human SATB2 protein is available from the NCBI database as accession no. NM_001172517.1.
  • a cDNA encoding the SEQ ID NO:5 human SATB2 protein is available from the NCBI database as accession no. XM_005246396.4.
  • isoforms and variants of the SATB2 proteins and nucleic acids can be present in populations of subjects. Any such isoforms and variants can also be engineered pursuant to the methods described herein.
  • Such isoforms and variants of the S ATB2 proteins and nucleic acids can have sequences with between 55-100% sequence identity to a reference sequence, for example to any of the SATB2 sequences described herein.
  • the isoforms and variants of the SATB2 proteins and nucleic acids can have at least 55% sequence identity, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97% sequence, at least 98%, at least 99% identity to any of the sequences described herein.
  • the sequence comparisons can be over a specified comparison window. Optimal alignment may be ascertained or conducted, for example, using the homology alignment algorithm of Needleman and Wunsch, J. Mol. Biol. 48:443-53 (1970).
  • loss of Satb2 in intestinal cells can transform the colonic epithelium into ileal small intestine, with the appearance of villi-like structures, Paneth cells, and enterocytes expressing abundant nutrient transporters.
  • the colonic transcriptome also shifts towards the ileum so that the Satb2-null colon can absorb nutrients.
  • methods are described herein for engineering cells to generate Satb2-null cells and organoids.
  • a variety of cell types can serve as starting cells to be engineered to generate Satb2-null cells and organoids.
  • starting cells examples include colonic organoids, colonic stem cells, embryonic stem cells (ESCs), induced pluripotent stem cells (iPSCs), or combinations thereof.
  • the cells can be autologous or allogeneic to a subject who maybe in need of treatment for an intestinal disease or condition. For example, in some cases a small biopsy of a subject’s colon can be obtained by colonoscopy, colonic stem and/or progenitor cells can be isolated from such a sample (or another sample or source), and the stem and/or progenitor cells can be modified as described herein.
  • CRISPR clustered regularly interspaced short palindromic repeats
  • cre-lox methods cre-lox methods
  • TALEN-associated methods base editing methods
  • base editing methods insertion mutagenesis, and other methods for in vitro mutagenesis.
  • Non-limiting examples of methods of introducing a modification into the genome of a cell can include use of microinjection, viral delivery, recombinase technologies, homologous recombination, cre-lox, CRISPR, TALENS, CRISPR, base-editing, and/or ZFN methods, see, e.g., Clark and Whitelaw Nature Reviews Genetics 4:825-833 (2003); which is incorporated by reference herein in its entirety. Such methods can reduce the expression or functioning of gene products of the SATB2.
  • CRISPR clustered regularly interspaced short palindromic repeats
  • Cas-guide RNA systems can be used to create one or more modifications in genomic alleles encoding SATB2.
  • nucleases such as zinc finger nucleases (ZFNs), transcription activator like effector nucleases (TALENs), and/or meganucleases with a guide nucleic acid that allows the nuclease to target the genomic Satb2 site(s).
  • the starting cells can in some cases be modified by microinjection or transfection with one or more expression cassettes or expression vectors that can express the components of the gene editing machineries.
  • a targeting vector can be used to introduce a deletion or modification of one or more genomic Satb2 site(s).
  • a "targeting vector” is a vector generally has a 5' flanking region and a 3' flanking region homologous to segments of the gene of interest.
  • the 5' flanking region and a 3' flanking region can surround a DNA sequence comprising a modification and/or a donor (foreign) DNA sequence to be inserted into the gene.
  • the donor or foreign DNA sequence may encode a selectable marker.
  • the targeting vector does not comprise a selectable marker, but such a selectable marker can facilitate identification and selection of cells with desirable mutations.
  • selectable markers include antibiotics resistance genes such as chloramphenicol resistance, gentamycin resistance, kanamycin resistance, spectinomycin resistance (SpecR), neomycin resistance gene (NEO), and/or the hygromycin 0-phosphotransferase genes.
  • antibiotics resistance genes such as chloramphenicol resistance, gentamycin resistance, kanamycin resistance, spectinomycin resistance (SpecR), neomycin resistance gene (NEO), and/or the hygromycin 0-phosphotransferase genes.
  • the 5' flanking region and the 3' flanking region can be homologous to regions within the gene, or to regions flanking the gene to be deleted, modified, or replaced with the unrelated DNA sequence.
  • the targeting vector is contacted with the native (endogenous) gene of interest within the cell under conditions that favor homologous recombination.
  • the cell can be contacted with the targeting vector under conditions that result in transformation of the cell(s) with the targeting vector.
  • a typical targeting vector contains nucleic acid fragments of not less than about 0.1 kb nor more than about 10.0 kb from one or both the 5' and the 3' ends of the genomic locus which encodes the gene to be modified (e.g. the genomic Satb2 site(s)). In some cases nucleic acid fragments from both the 5' and the 3' ends of the Satb2 genomic locus are used. These two fragments are separated by an intervening fragment of nucleic acid which encodes the modification to be introduced.
  • the resulting construct recombines homologously with the chromosome at the Satb2 locus, it results in the introduction of the modification, e.g., a deletion of a portion of the genomic Satb2 site(s), replacement of the genomic Satb2 promoter or coding region site(s), or the insertion of nonconserved codon or a stop codon.
  • the modification e.g., a deletion of a portion of the genomic Satb2 site(s), replacement of the genomic Satb2 promoter or coding region site(s), or the insertion of nonconserved codon or a stop codon.
  • a Cas nuclease/ CRISPR system can be used to create a modification in genomic Satb2 that reduces the expression or functioning of the Satb2 gene products.
  • Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) systems are useful for, e.g. RNA- programmable genome editing (see e.g., Marraffini and Sontheimer. Nature Reviews Genetics 11: 181-190 (2010); Sorek et al. Nature Reviews Microbiology 2008 6: 181-6; Karginov and Hannon. Mol Cell 2010 1 :7- 19; Hale et al. Mol Cell 2010:45:292-302; Jinek et al.
  • a CRISPR guide RNA can be used that can target a Cas enzyme to the desired location in the genome, where it generates a double strand break. This technique is described, for example, by Mali et al. (Science 2013 339:823-6), which is incorporated by reference herein in its entirety. Kits for the design and use of CRISPR-mediated genome editing are commercially available, e.g. the PRECISION X CAS9 SMART NUCLEASETM System (Cat No. CAS900A-1) from System Biosciences, Mountain View, CA.
  • CRISPR/Cas systems are useful, for example, for RNA-programmable genome editing (see e.g., Marraffini and Sontheimer. Nature Reviews Genetics 11: 181-190 (2010); Sorek et al. Nature Reviews Microbiology 2008 6: 181-6; Karginov and Hannon. Mol Cell 2010 1 :7-19; Hale et al. Mol Cell 2010:45:292- 302; Jinek et al. Science 2012 337:815-820; Bikard and Marraffini Curr Opin Immunol 2012 24:15-20; Bikard et al. Cell Host & Microbe 2012 12: 177-186; all of which are incorporated by reference herein in their entireties).
  • a CRISPR guide RNA can be used that can target a Cas enzyme to the desired location in the genome, where it can cleave the genomic DNA for generation of a genomic modification. This technique is described, for example, by Mali et al. Science 2013 339:823-6; which is incorporated by reference herein in its entirety. Kits for the design and use of CRISPR-mediated genome editing are commercially available, e.g. the PRECISION X CAS9 SMART NUCLEASETM System (Cat No. CAS900A-1) from System Biosciences, Mountain View, CA. Several guide RNAs were evaluated for knock-out of human Satb2, including guide RNAs that included one of the following sequences:
  • CTTTTGTGTCGTGGAGCAGT SEQ ID NO: 8
  • the first guide (SEQ ID NO:6) provided the highest modification frequency.
  • cre-lox recombination system of bacteriophage Pl , described by Abremski et al. 1983. Cell 32:1301 (1983), Sternberg et al., Cold Spring Harbor Symposia on Quantitative Biology, Vol. XLV 297 (1981) and others, can be used to promote recombination and alteration of the SATB2 genomic site(s).
  • the cre-lox system utilizes the ere recombinase isolated from bacteriophage Pl in conjunction with the DNA sequences that the recombinase recognizes (termed lox sites).
  • genomic mutations so incorporated can alter one or more amino acids in the encoded SATB2gene products.
  • genomic sites can be modified so that at least one amino acid of a polypeptide for SATB2 is deleted or mutated to alter its activity.
  • a conserved amino acid or a conserved domain can be modified to improve or reduce of the activity of the SATB2.
  • a conserved amino acid or several amino acids in a conserved domain of the SATB2 can be replaced with one or more amino acids having physical and/or chemical properties that are different from the conserved amino acid(s).
  • conserved amino acid(s) can be deleted or replaced by amino acid(s) of another class, where the classes are identified in the following table.
  • the guide RNAs and nuclease can be introduced via one or more vehicles such as by one or more expression vectors (e.g., viral vectors), virus like particles, ribonucleoproteins (RNPs), via nanoparticles, liposomes, or a combination thereof.
  • the vehicles can include components or agents that can target particular cell types (e.g., antibodies that recognize cell-surface markers), facilitate cell penetration, reduce degradation, or a combination thereof.
  • Such genomic modifications can reduce the expression or functioning of Satb2 gene products by at least 10%, or at least 15%, or at least 20%, or at least 25%, or at least 30%, or at least 35%, or at least 40%, or at least 45%, or at least 50% compared to the unmodified Saib2 gene product expression or functioning.
  • the engineered SATB2-null organoids or cells can also be seeded onto a scaffold, for instance, one or more de-cellularized intestinal segments, biological scaffolds, artificial scaffolds, or combinations thereof to create transplantable gut segments.
  • Such methods can include formation of self-assembled cell sheets, which are rolled into tubes; natural polymeric scaffolds (e.g. collagen, elastin, fibrin); synthetic polymeric scaffolds (e.g. polyglycolide (PGA), polylactic acid (PLA), polycaprolactone (PCL)); and decellularized scaffolds, in which similar tissue (allogenic, xenogenic) is stripped of cells and reseeded with a subject’s own cells.
  • natural polymeric scaffolds e.g. collagen, elastin, fibrin
  • synthetic polymeric scaffolds e.g. polyglycolide (PGA), polylactic acid (PLA), polycaprolactone (PCL)
  • decellularized scaffolds in which similar tissue (allogenic, xenogenic) is stripped of cells and reseeded with a subject’s own cells.
  • the use of collagen as a scaffold material has been overlooked due to the weak mechanical properties of standard collagen gel, but it can be used to grow various cell types and the density of collagen can be increased to
  • Plastic compression of collagen involve placing a collagen gel on a nylon (hydrophilic) membrane and paper blot. By loading the gel from above, the water is forced from the gel, which aligns the collagen fibers and makes the collagen denser. Such plastic compression provides a dense collagen sheet, which can be rolled to form a tube. Another method wraps a nylon membrane and paper towels around a collagen gel, followed by suspension to allow water extraction. Another method involves slowly rotating a standard collagen gel to expel water and thus form a thin-walled, densified collagen tube. Other methods are described in WO/2020/208094.
  • a range of SATB2 null cells can be seeded into scaffold tubes. For example, about 1 xlO 5 cells to about 1 xlO 10 cells per tube can be incubated with scaffold tubes.
  • the cell-seeded scaffolds can be perfused with media to support the growth and attachment of the cells.
  • Satb2 can be inhibited, for example by use of an inhibitory nucleic acid that specifically recognizes and binds to a nucleic acid that encodes the SATB2 protein. Such binding can inhibit the expression or translation of the Satb2 nucleic acid so that little or no SATB2 protein is generated.
  • An inhibitory nucleic acid can have at least one segment that will hybridize to a Satb2 nucleic acid under intracellular or stringent conditions.
  • the inhibitory nucleic acid can reduce expression of a nucleic acid encoding SATB2.
  • a nucleic acid may hybridize to a Satb2 genomic DNA, a messenger RNA, or a combination thereof.
  • An inhibitory nucleic acid may be incorporated into a plasmid vector or viral DNA. It may be single stranded or double stranded, circular or linear.
  • An inhibitory nucleic acid is a polymer of ribose nucleotides or deoxyribose nucleotides having more than 13 nucleotides in length.
  • An inhibitory nucleic acid may include naturally occurring nucleotides; synthetic, modified, or pseudo-nucleotides such as phosphorothiolates; as well as nucleotides having a detectable label such as P 32 , biotin or digoxigenin.
  • An inhibitory nucleic acid can reduce the expression and/or activity of a Satb2 nucleic acid.
  • Such an inhibitory nucleic acid may be completely complementary to a segment of an endogenous Satb2 nucleic acid (e.g., an RNA).
  • An inhibitory nucleic acid can hybridize to a Satb2 nucleic acid under intracellular conditions or under stringent hybridization conditions and is sufficiently complementary to inhibit expression of the endogenous Satb2 nucleic acid.
  • Intracellular conditions refer to conditions such as temperature, pH and salt concentrations typically found inside a cell, e.g. an animal or mammalian cell.
  • an animal or mammalian cell is a stem cell or an intestinal progenitor cell.
  • Another example of such an animal or mammalian cell is a more differentiated cell derived from a stem cell or progenitor cell.
  • stringent hybridization conditions are selected to be about 5 °C lower than the thermal melting point (T m ) for the specific sequence at a defined ionic strength and pH.
  • stringent conditions encompass temperatures in the range of about 1 °C to about 20 °C lower than the thermal melting point of the selected sequence, depending upon the desired degree of stringency as otherwise qualified herein.
  • Inhibitory oligonucleotides that comprise, for example, 2, 3, 4, or 5 or more stretches of contiguous nucleotides that are precisely complementary to a Satb2 coding sequence that can be separated by a stretch of contiguous nucleotides that are not complementary to the adjacent coding sequences, and that can inhibit the function of a Satb2 nucleic acid.
  • each stretch of contiguous nucleotides is at least 4, 5, 6, 7, or 8 or more nucleotides in length.
  • Non-complementary intervening sequences may be 1, 2, 3, or 4 nucleotides in length.
  • One skilled in the art can easily use the calculated melting point of an inhibitory nucleic acid hybridized to a sense nucleic acid to estimate the degree of mismatching that will be tolerated for inhibiting expression of a particular target nucleic acid.
  • Inhibitory nucleic acids of the invention include, for example, a short hairpin RNA, a small interfering RNA, a ribozyme or an antisense nucleic acid molecule.
  • the inhibitory nucleic acid molecule may be single or double stranded (e.g. a small interfering RNA (siRNA)) and may function in an enzymedependent manner or by steric blocking.
  • Inhibitory nucleic acid molecules that function in an enzyme-dependent manner include forms dependent on RNase H activity to degrade target mRNA. These include single-stranded DNA, RNA, and phosphorothioate molecules, as well as the double-stranded RNAi/siRNA system that involves target mRNA recognition through sense-antisense strand pairing followed by degradation of the target mRNA by the RNA-induced silencing complex.
  • Steric blocking inhibitory nucleic acids which are RNase-H independent, interfere with gene expression or other mRNA-dependent cellular processes by binding to a target mRNA and getting in the way of other processes.
  • Steric blocking inhibitory nucleic acids include 2'-0 alkyl (usually in chimeras with RNase-H dependent antisense), peptide nucleic acid (PNA), locked nucleic acid (LNA) and morpholino antisense.
  • Small interfering RNAs may be used to specifically reduce translation of SATB2 such that translation of the encoded SATB2 is reduced.
  • SiRNAs mediate post-transcriptional gene silencing in a sequence-specific manner. See, for example, website at invitrogen.com/site/us/en/home/Products- and-Services/ Applications/ rnai.html. Once incorporated into an RNA-induced silencing complex, siRNA mediate cleavage of the homologous endogenous mRNA transcript by guiding the complex to the homologous mRNA transcript, which is then cleaved by the complex.
  • the siRNA may be homologous and/or complementary to any region of the Satb2 transcript.
  • the region of homology may be 100 nucleotides or less in length, 50 nucleotides or less in length, 40 nucleotides or less in length, 30 nucleotides or less in length, 25 nucleotides or less in length, and in some cases about 21 to 23 nucleotides in length.
  • SiRNA is typically double stranded and may have two-nucleotide 3’ overhangs, for example, 3’ overhanging UU dinucleotides.
  • Methods for designing siRNAs are known to those skilled in the art. See, for example, Elbashir et al. Nature 411: 494-498 (2001); Harborth et al. Antisense Nucleic Acid Drug Dev. 13: 83-106 (2003).
  • the pSuppressorNeo vector for expressing hairpin siRNA can be used to generate siRNA for inhibiting expression of Salb2.
  • the construction of the siRNA expression plasmid involves the selection of the target region of the mRNA, which can be a trial-and-error process.
  • Elbashir et al. have provided guidelines that appear to work -80% of the time.
  • Elbashir, S.M., et al. Analysis of gene function in somatic mammalian cells using small interfering RNAs. Methods, 2002. 26(2): p. 199-213.
  • a target region may be selected preferably 50 to 100 nucleotides downstream of the start codon.
  • the 5' and 3' untranslated regions and regions close to the start codon should be avoided as these may be richer in regulatory protein binding sites.
  • siRNA can begin with AA, have 3' UU overhangs for both the sense and antisense siRNA strands, and have an approximate 50 % G/C content.
  • An example of a sequence for a synthetic siRNA is 5'-AA(N19)UU, where N is any nucleotide in the mRNA sequence and should be approximately 50% G-C content.
  • the selected sequence(s) can be compared to others in the human genome database to minimize homology to other known coding sequences (e.g., by Blast search, for example, through the NCBI website).
  • SiRNAs may be chemically synthesized, created by in vitro transcription, or expressed from an siRNA expression vector or a PCR expression cassette. See, e.g., website at invitrogen.com/site/us/en/home/Products-and- Services/Applications/rnai.html.
  • the insert encoding the siRNA may be expressed as an RNA transcript that folds into an siRNA hairpin.
  • the RNA transcript may include a sense siRNA sequence that is linked to its reverse complementary antisense siRNA sequence by a spacer sequence that forms the loop of the hairpin as well as a string of U’s at the 3’ end.
  • the loop of the hairpin may be of any appropriate lengths, for example, 3 to 30 nucleotides in length, preferably, 3 to 23 nucleotides in length, and may be of various nucleotide sequences including, AUG, CCC, UUCG, CCACC, CTCGAG, AAGCUU, CCACACC and UUCAAGAGA.
  • SiRNAs also may be produced in vivo by cleavage of double-stranded RNA introduced directly or via a transgene or virus. Amplification by an RNA-dependent RNA polymerase may occur in some organisms.
  • an inhibitory nucleic acid such as a short hairpin RNA siRNA or an antisense oligonucleotide may be prepared using methods such as by expression from an expression vector or expression cassette that includes the sequence of the inhibitory nucleic acid. Alternatively, it may be prepared by chemical synthesis using naturally occurring nucleotides, modified nucleotides or any combinations thereof.
  • the inhibitory nucleic acids are made from modified nucleotides or non-phosphodiester bonds, for example, that are designed to increase biological stability of the inhibitory nucleic acid or to increase intracellular stability of the duplex formed between the inhibitory nucleic acid and the target Satb2 nucleic acid.
  • An inhibitory nucleic acid may be prepared using available methods, for example, by expression from an expression vector encoding a complementarity sequence of the Satb2 nucleic acid. Alternatively, it may be prepared by chemical synthesis using naturally occurring nucleotides, modified nucleotides or any mixture of combination thereof.
  • the Satb2 nucleic acids are made from modified nucleotides or non-phosphodiester bonds, for example, that are designed to increase biological stability of the nucleic acids or to increase intracellular stability of the duplex formed between the inhibitory nucleic acids and other (e.g., endogenous) nucleic acids.
  • the Satb2 inhibitory nucleic acids can be peptide nucleic acids that have peptide bonds rather than phosphodiester bonds.
  • Naturally occurring nucleotides that can be employed in the Satb2 inhibitory nucleic acids include the ribose or deoxyribose nucleotides adenosine, guanine, cytosine, thymine and uracil.
  • modified nucleotides that can be employed in the Satb2 nucleic acids include 5 -fluorouracil, 5- bromouracil, 5 -chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4- acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5- carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1- methylguanine, 1 -methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2- methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7- methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2- thiouracil, beta-D-mannosylqueos
  • inhibitory nucleic acids of the Satb2 described herein may include modified nucleotides, as well as natural nucleotides such as combinations of ribose and deoxyribose nucleotides.
  • the inhibitory nucleic acids and may be of same length as wild type Satb2 described herein.
  • the inhibitory nucleic acids of the Satb2 described herein can also be longer and include other useful sequences. In some embodiments, the inhibitory nucleic acids of the Satb2 are somewhat shorter.
  • inhibitory nucleic acids of the Satb2 can include a segment that has a nucleic acid sequence that can be missing up to 5 nucleotides, or missing up to 10 nucleotides, or missing up to 20 nucleotides, or missing up to 30 nucleotides, or missing up to 50 nucleotides, or missing up to 100 nucleotides from the 5’ or 3’ end.
  • the inhibitory nucleic acids can be introduced via one or more vehicles such as via expression vectors (e.g., viral vectors), via virus like particles, via ribonucleoproteins (RNPs), via nanoparticles, via liposomes, or a combination thereof.
  • the vehicles can include components or agents that can target particular cell types, facilitate cell penetration, reduce degradation, or a combination thereof.
  • subjects can be administered compositions that include genomic editing components such as expression cassettes or expression vectors that can express the machinery for intracellular editing of one or both endogenous Satb2 alleles.
  • genomic editing components such as expression cassettes or expression vectors that can express the machinery for intracellular editing of one or both endogenous Satb2 alleles.
  • cells can be modified in vitro and then administered to a subject either as a population of Satb2-null cells, as a tubular scaffold/implant that is populated by the Satb2-null cells, or a combination thereof.
  • cells can be contacted and/or treated with any of the mutating agents (e.g., CRISPR guide RNAs, ribonucleoprotein complexes, cre- lox systems) described herein for targeting and modifying Satb2 to produce Satb2-nu ⁇ cells.
  • mutating agents e.g., CRISPR guide RNAs, ribonucleoprotein complexes, cre- lox systems
  • This method can be performed in vitro or in vivo.
  • the cells to be modified can be autologous or allogeneic to the subject to be treated.
  • the cells to be modified can, for example, be colonic organoids, colonic stem cells, embryonic stem cells (ESCs), induced pluripotent stem cells (iPSCs), or combinations thereof.
  • ESCs embryonic stem cells
  • iPSCs induced pluripotent stem cells
  • cells can be obtained from a subject, and these cells can be contacted and/or treated with any of mutating agents (e.g., guide RNAs, ribonucleoprotein complexes, cre-lox systems) described herein for SATB2 to generate modified cells.
  • the modified cells can be expanded in culture to form a population of modified cells and the population of cells can be administered to a subject, e.g. a mammal such as a human.
  • the amount or number of cells administered can vary but amounts in the range of about 10 6 to about 10 9 cells can be used.
  • the cells are generally delivered in a physiological solution such as saline or buffered saline.
  • the cells can also be delivered in a device or a vehicle so that a population of liposomes, exosomes or microvesicles.
  • Modified Satb2-null cells generated as described herein can be employed for regeneration and engraftment in a human patient or other subjects in need of such treatment.
  • the cells are administered in a manner that permits them to graft and reconstitute or regenerate within a subject or recipient. Scaffolds and implants that are populated with Satb2-null cells can also be administered.
  • Cells and/or scaffolds are administered to patients at various time points, for example, as therapy for a subject having or suspected of having an intestinal disease or condition.
  • diseases and/or conditions that may be treated with the methods, cells and/or scaffolds described herein include short bowel disease, congenital short bowel syndrome, irritable bowel syndrome, digestive failure, intestinal injury, intestinal atresia, intussusception, meconium ileus, midgut volvulus, omphalocele, reduced nutritional absorption, fistula, Crohn’s disease, necrotizing enterocolitis ulcerative colitis, or colorectal cancer.
  • Administration of cells should improve intestinal functions and health of the patient, increase nutrient absorption, and reduce their risk of infections and other pathophysiologies associated with malnutrition.
  • Expanded Satb2-null cells can thus in some cases be administered to by systemic injection.
  • the cells can be administered intravascularly.
  • the cells can be administered parenterally by injection into a blood vessel or into a convenient cavity.
  • the Sotb2-nu ⁇ cells can first be tested in a suitable animal model (e.g., a mouse, rat or other animal as described herein).
  • a suitable animal model e.g., a mouse, rat or other animal as described herein.
  • the expanded Satb2-null cells can be assessed for their ability to survive and maintain their phenotype in vivo.
  • Cells can also be assessed to ascertain whether they populate a substantial percentage of the colon in vivo, or to determine an appropriate number of cells to be administered.
  • Cell compositions can be administered to immunodeficient animals (such as nude mice, or animals rendered immunodeficient chemically or by irradiation).
  • Satb2-null cells can be introduced by injection, catheter, implantable device, or the like.
  • a population of expanded cells can be administered in any physiologically acceptable excipient or carrier that does not adversely affect the cells.
  • Satb2-nul cells can be supplied in the form of a pharmaceutical composition.
  • a pharmaceutical composition can include an isotonic excipient prepared under sufficiently sterile conditions for human administration.
  • Cell Therapy Stem Cell Transplantation, Gene Therapy, and Cellular Immunotherapy, by G. Morstyn & W. Sheridan eds, Cambridge University Press, 1996; and Hematopoietic Stem Cell Therapy, E. D. Ball, J. Lister & P. Law, Churchill Livingstone, 2000.
  • the choice of the cellular excipient and any accompanying constituents of the composition that includes a population of expanded cells can be adapted to optimize administration by the route and/or device employed.
  • a composition that includes a population of Satb2 -null cells can also include or be accompanied by one or more other ingredients that facilitate engraftment or functional mobilization of the expanded cells.
  • the Satb2-nuU cells generated by the methods described herein can include some percentage of non-intestinal, non-stem cells or non-progenitor cells.
  • a population of expanded cells for use in compositions and for administration to subjects can contain endothelial cells. The presence of such endothelial cells has no adverse effects, and in some cases can actually be helpful.
  • a population of Satb2-null cells for use in compositions and for administration to subjects can have less than about 20% .Sh/ZU-expressing cells, less than 15% .S’ ⁇ 7/Z?2-expressing cells, less than 10% .Sh/ZU-expressing cells, less than about 5% .SL/ZU-expressing cells, less than about 3% .S’ at b2 -expressing cells, less than about 2% .S'w/ZU-expressing cells, or less than about 1 % Satb2- expressing cells of the total cells in the cell population.
  • the number of cells administered to a subject or a patient can vary.
  • subjects with different diseases and/or conditions can need different amounts of Satb2-null cells.
  • number of Satb2-null cells in the cell compositions described herein can be packaged for ready administration to a subject or patient.
  • the cells can be packaged to contain at least 1 million cells, or at least 5 million cells, at least 10 million cells, or at least 25 million cells, at least 50 million cells, or at least 70 million cells, at least 100 million cells, or at least 200 million cells, at least 300 million cells, at least 400 million cells, at least 500 million cells, or at least 600 million cells, at least 700 million cells, at least 800 million cells, at least 1000 million cells, or at least 2000 million cells, at least 5000 million cells, at least 7000 million cells, at least 10,000 million cells, or at least 30,000 million cells, at least 50,000 million cells, or at least 100,000 million cells.
  • Treatment may include administering the cells and/or cell-scaffold alone or the treatment can include administering Satb2 modifying/mutating agents (e.g., guide RNAs or ribonucleoprotein complexes) described herein for modifying Satb2, with or without the Satb2-null cells.
  • Satb2 modifying/mutating agents e.g., guide RNAs or ribonucleoprotein complexes
  • Such agents can be administered separately from or with the modified cells/scaffold.
  • the modified cells may be administered prior to, during, or after administering any of the mutating agents (e.g., guide RNAs or ribonucleoprotein complexes) described herein for engineering Satb2 alleles.
  • Mutating/modifying agents that can be administered to a subject can include expression vectors and/or targeting vectors for modifying endogenous Satb2 alleles.
  • the expression vectors and/or targeting vectors can encode and express nucleases (e.g., cas nucleases), guide RNAs, donor DNAs, and/or any other components for genomic editing.
  • mutating agents can be administered via a viral vector.
  • Suitable viral vectors include, for example, retroviral vectors, herpes simplex virus (HSV)-based vectors, parvovirus-based vectors, e.g., adeno-associated virus (AAV)-based vectors, AAV-adeno viral chimeric vectors, and adenovirusbased vectors.
  • HSV herpes simplex virus
  • AAV adeno-associated virus
  • AAV-adeno viral chimeric vectors e.g., AAV-adeno viral chimeric vectors
  • adenovirusbased vectors e.g., adeno-associated virus (AAV)-based vectors.
  • gene modifying vector e.g., a viral gene modifying vector
  • a “gene transfer vector” is any molecule or composition that has the ability to carry a heterologous nucleic acid sequence into a suitable host cell where synthesis of the encoded gene product, nucleic acid or protein Lakes place.
  • a gene transfer vector is a nucleic acid molecule that has been engineered, using recombinant DNA techniques, to include nucleic acid sequences for the genomic engineering components.
  • the gene transfer vector can be comprised of DNA. Examples of suitable DNA-based gene transfer vectors include plasmids and viral vectors.
  • the gene transfer vector can be integrated into the host cell genome or can be present in the host cell in the form of an episome.
  • the AAV vector is generated using an AAV that infects humans (e.g., AAV2).
  • the AAV vector is generated using an AAV that infects non-human animals (e.g., rodents) or primates (e.g., chimpanzees).
  • the AAV vector may comprise expression control sequences, such as promoters, enhancers, polyadenylation signals, transcription terminators, internal ribosome entry sites (IRES), and the like, that provide for the expression of the genomic editing components in a host cell.
  • expression control sequences such as promoters, enhancers, polyadenylation signals, transcription terminators, internal ribosome entry sites (IRES), and the like, that provide for the expression of the genomic editing components in a host cell.
  • Exemplary expression control sequences are available and described in, for example, Goeddel, Gene Expression Technology: Methods in Enzymology, Vol. 185, Academic Press, San Diego, CA. (1990).
  • promoters including constitutive, inducible, and repressible promoters, from a variety of different sources are well known in the art.
  • Representative sources of promoters include for example, virus, mammal, insect, plant, yeast, and bacteria, and suitable promoters from these sources are readily available, or can be made synthetically, based on sequences publicly available, for example, from depositories such as the ATCC as well as other commercial or individual sources.
  • Promoters can be unidirectional (i.e., initiate transcription in one direction) or bi-directional (i.e., initiate transcription in either a 3’ or 5’ direction).
  • Non-limiting examples of promoters include, for example, the T7 bacterial expression system, pBAD (araA) bacterial expression system, the cytomegalovirus (CMV) promoter, the SV40 promoter, and the RSV promoter.
  • Inducible promoters include, for example, the Tet system (U.S. Patent Nos. 5,464,758 and 5,814,618), the Ecdysone inducible system (No et al., Proc. Natl. Acad.
  • AAV vectors are produced using well characterized plasmids.
  • human embryonic kidney 293T cells are transfected with one of the transgene specific plasmids and another plasmid containing the adenovirus helper and AAV rep and cap genes (specific to AAVrh.10, 8 or 9 as required).
  • the cells are harvested and the vector is released from the cells by five freeze/thaw cycles.
  • Subsequent centrifugation and benzonase treatment removes cellular debris and unencapsidated DNA.
  • lodixanol gradients and ion exchange columns may be used to further purify each AAV vector.
  • the purified vector is concentrated by a size exclusion centrifuge spin column to the required concentration.
  • the buffer is exchanged to create the final vector products formulated (for example) in lx phosphate buffered saline.
  • the viral titers may be measured by TaqMan® real-time PCR and the viral purity may be assessed by SDS-PAGE.
  • a "cell” refers to any type of cell isolated from a prokaryotic, eukaryotic, or archaeon organism, including bacteria, archaea, fungi, protists, plants, and animals, including cells from tissues, organs, and biopsies, as well as recombinant cells, cells from cell lines cultured in vitro, and cellular fragments, cell components, or organelles comprising nucleic acids.
  • the term also encompasses artificial cells, such as nanoparticles, liposomes, polymersomes, or microcapsules encapsulating nucleic acids.
  • the methods described herein can be performed, for example, on a sample comprising a single cell or a population of cells.
  • the term also includes genetically modified cells.
  • a “coding region” or a sequence which "encodes” a selected polypeptide or a selected RNA is a nucleic acid molecule which is transcribed (in the case of DNA templates) into RNA and/or translated (in the case of mRNA) into a polypeptide in vivo when placed under the control of appropriate regulatory sequences (or “control elements”).
  • the boundaries of the coding sequence can be determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxy) terminus.
  • a coding sequence can include, but is not limited to, ncRNAs, tracrRNAs, ncRNAs modified to include heterologous sequences, cDNA from viral, prokaryotic or eukaryotic ncRNA, mRNA, viral or prokaryotic DNA, and even synthetic DNA sequences.
  • a transcription termination sequence may be located 3' to the coding sequence.
  • control elements include, but are not limited to, transcription promoters, transcription enhancer elements, transcription termination signals, polyadenylation sequences (located 3' to the translation stop codon), sequences for optimization of initiation of translation (located 5’ to the coding sequence), and translation termination sequences.
  • “Operably linked” refers to an arrangement of elements wherein the components so described are configured so as to perform their usual function.
  • a given promoter operably linked to a coding region is capable of effecting the expression of the encoded sequence when the proper polymerases are present.
  • the promoter need not be contiguous with the coding region, so long as it functions to direct the expression thereof.
  • intervening untranslated yet transcribed sequences can be present between the promoter sequence and the coding region and the promoter sequence can still be considered “operably linked" to the coding region.
  • Encoded by refers to a nucleic acid sequence that codes for a polypeptide or RNA.
  • a polypeptide sequence or a portion thereof is encoded by the nucleic acid sequence.
  • the RNA sequence or a portion thereof contains a nucleotide sequence that is encoded by a DNA (or other nucleic acid) sequence.
  • isolated refers to material that is free to varying degrees from components which normally accompany it as found in its native state.
  • Isolate denotes a degree of separation from original source or surroundings.
  • Purify denotes a degree of separation that is higher than isolation.
  • a “purified” or “biologically pure” protein is sufficiently free of other materials such that any impurities do not materially affect the biological properties of the protein, DNA, or RNA or cause other adverse consequences.
  • a nucleic acid or peptide can be purified if it is substantially free of cellular material, viral material, or culture medium when obtained from nature or when produced by recombinant DNA techniques, or free from chemical precursors or other chemicals when chemically synthesized. Purity and homogeneity are typically determined using analytical chemistry techniques, for example, polyacrylamide gel electrophoresis or high-performance liquid chromatography. The term "purified" can denote that a nucleic acid or protein gives rise to essentially one band in an electrophoretic gel. For a protein that can be subjected to modifications, for example, phosphorylation or glycosylation, different modifications may give rise to different isolated proteins, which can be separately purified.
  • substantially purified generally refers to isolation of a substance (nucleic acid, compound, polynucleotide, protein, polypeptide, peptide composition) such that the substance comprises the majority percent of the sample in which it resides.
  • a substantially purified component comprises 50%, preferably 80%-85%, more preferably 90-95% of the sample.
  • Techniques for purifying polynucleotides and polypeptides of interest are well-known in the art and include, for example, ion-exchange chromatography, affinity chromatography and sedimentation according to density.
  • a “vector” is capable of transferring nucleic acid sequences to target cells (e.g., viral vectors, non-viral vectors, particulate carriers, and liposomes).
  • target cells e.g., viral vectors, non-viral vectors, particulate carriers, and liposomes.
  • vector construct e.g., viral vectors, non-viral vectors, particulate carriers, and liposomes.
  • expression vector e transfer vector
  • the term includes cloning and expression vehicles, as well as viral vectors. “Expression” refers to detectable production of a gene product by a cell.
  • the gene product may be a transcription product (i.e., RNA), which may be referred to as "gene expression”, or the gene product may be a translation product of the transcription product (i.e., a protein), depending on the context.
  • RNA a transcription product
  • gene product may be a translation product of the transcription product (i.e., a protein), depending on the context.
  • “Mammalian cell” refers to any cell derived from a mammalian subject suitable for transfection with vector systems comprising, as described herein.
  • the cell may be xenogeneic, autologous, or allogeneic.
  • the cell can be a primary cell obtained directly from a mammalian subject.
  • the cell may also be a cell derived from the culture and expansion of a cell obtained from a mammalian subject. Immortalized cells are also included within this definition.
  • the cell has been genetically engineered to express a recombinant protein and/or nucleic acid.
  • subject includes animals, including both vertebrates and invertebrates, including, without limitation, invertebrates such as arthropods, mollusks, annelids, and cnidarians; and vertebrates such as amphibians, including frogs, salamanders, and caecillians; reptiles, including lizards, snakes, turtles, crocodiles, and alligators; fish; mammals, including human and nonhuman mammals such as non-human primates, including chimpanzees and other apes and monkey species; laboratory animals such as mice, rats, rabbits, hamsters, guinea pigs, and chinchillas; domestic animals such as dogs and cats; farm animals such as sheep, goats, pigs, horses and cows; and birds such as domestic, wild and game birds, including chickens, turkeys and other gallinaceous birds, ducks, geese, and the like.
  • vertebrates including, without limitation, invertebra
  • the disclosed methods find use in experimental animals, in veterinary application, and in the development of animal models for disease, including, but not limited to, rodents including mice, rats, and hamsters; primates, and transgenic animals.
  • rodents including mice, rats, and hamsters; primates, and transgenic animals.
  • the subject is a human.
  • Gene transfer refers to methods or systems for reliably inserting DNA or RNA of interest into a host cell. Such methods can result in transient expression of non-integrated transferred DNA, extrachromosomal replication and expression of transferred replicons (e.g., episomes), or integration of transferred genetic material into the genomic DNA of host cells.
  • Gene delivery expression vectors include, but are not limited to, vectors derived from bacterial plasmid vectors, viral vectors, non-viral vectors, alphaviruses, pox viruses and vaccinia viruses.
  • a polynucleotide or nucleic acid "derived from” a designated sequence refers to a polynucleotide or nucleic acid that includes a contiguous sequence of approximately at least about 6 nucleotides, preferably at least about 8 nucleotides, more preferably at least about 10-12 nucleotides, and even more preferably at least about 15-20 nucleotides corresponding, i.e., identical or complementary to, a region of the designated nucleotide sequence.
  • the derived polynucleotide will not necessarily be derived physically from the nucleotide sequence of interest, but may be generated in any manner, including, but not limited to, chemical synthesis, replication, reverse transcription or transcription, which is based on the information provided by the sequence of bases in the region(s) from which the polynucleotide is derived. As such, it may represent either a sense or an antisense orientation of the original polynucleotide.
  • hybridize and “hybridization” refer to the formation of complexes between nucleotide sequences which are sufficiently complementary to form complexes via Watson-Crick base pairing.
  • homologous region refers to a region of a nucleic acid with homology to another nucleic acid region. Thus, whether a "homologous region” is present in a nucleic acid molecule is determined with reference to another nucleic acid region in the same or a different molecule. Further, since a nucleic acid is often double-stranded, the term “homologous, region,” as used herein, refers to the ability of nucleic acid molecules to hybridize to each other. For example, a single-stranded nucleic acid molecule can have two homologous regions which are capable of hybridizing to each other. Thus, the term “homologous region” includes nucleic acid segments with complementary sequences.
  • Homologous regions may vary in length but will typically be between 4 and 500 nucleotides (e.g., from about 4 to about 40, from about 40 to about 80, from about 80 to about 120, from about 120 to about 160, from about 160 to about 200, from about 200 to about 240, from about 240 to about 280, from about 280 to about 320, from about 320 to about 360, from about 360 to about 400, from about 400 to about 440, etc.).
  • nucleotides e.g., from about 4 to about 40, from about 40 to about 80, from about 80 to about 120, from about 120 to about 160, from about 160 to about 200, from about 200 to about 240, from about 240 to about 280, from about 280 to about 320, from about 320 to about 360, from about 360 to about 400, from about 400 to about 440, etc.
  • complementary refers to polynucleotides that are able to form base pairs with one another. Base pairs are typically formed by hydrogen bonds between nucleotide units in an antiparallel orientation between polynucleotide strands. Complementary polynucleotide strands can base pair in a Watson-Crick manner (e.g., A to T, A to U, C to G), or in any other manner that allows for the formation of duplexes. As persons skilled in the art are aware, when using RNA as opposed to DNA, uracil (U) rather than thymine (T) is the base that is considered to be complementary to adenosine.
  • uracil when uracil is denoted in the context of the present invention, the ability to substitute a thymine is implied, unless otherwise stated.
  • “Complementarity” may exist between two RNA strands, two DNA strands, or between an RNA strand and a DNA strand. It is generally understood that two or more polynucleotides may be “complementary” and able to form a duplex despite having less than perfect or less than 100% complementarity. Two sequences are "perfectly complementary” or "100% complementary” if at least a contiguous portion of each polynucleotide sequence, comprising a region of complementarity, perfectly base pairs with the other polynucleotide without any mismatches or interruptions within such region.
  • Two or more sequences are considered “perfectly complementary” or “100% complementary” even if either or both polynucleotides contain additional non-complementary sequences as long as the contiguous region of complementarity within each polynucleotide is able to perfectly hybridize with the other.
  • "Less than perfect” complementarity refers to situations where less than all of the contiguous nucleotides within such region of complementarity are able to base pair with each other. Determining the percentage of complementarity between two polynucleotide sequences is a matter of ordinary skill in the art.
  • a CRISPR system refers collectively to transcripts and other elements involved in the expression of or directing the activity of CRISPR- associated (“Cas") genes, including sequences encoding a Cas gene, and a CRISPR array nucleic acid sequence including a leader sequence and at least one repeat sequence.
  • one or more elements of a CRISPR system are derived from a type I, type II, or type III CRISPR system.
  • Casl and Cas2 are found in all three types of CRISPR-Cas systems, and they are involved in spacer acquisition. In the I-E system of E. coli, Casl and Cas2 form a complex where a Cas2 dimer bridges two Casl dimers.
  • Cas2 performs a non-enzymatic scaffolding role, binding double-stranded fragments of invading DNA, while Casl binds the single-stranded flanks of the DNA and catalyzes their integration into CRISPR arrays.
  • one or more elements of a CRISPR system are derived from a particular organism comprising an endogenous CRISPR system, such as Streptococcus pyogenes.
  • a CRISPR system can be characterized by elements that promote the formation of a CRISPR complex at the site of a target sequence (also referred to as a protospacer in the context of an endogenous CRISPR system).
  • donor polynucleotide or “donor DNA” refers to a nucleic acid or polynucleotide that provides a nucleotide sequence of an intended edit to be integrated into the genome at a target locus by HDR or recombineering.
  • a “target site” or “target sequence” is the nucleic acid sequence recognized (i.e., sufficiently complementary for hybridization) by a guide RNA (gRNA) or a homology arm of a donor polynucleotide (donor DNA).
  • the target site may be allele-specific (e.g., a major or minor allele).
  • a target site can be a genomic site that is intended to be modified such as by insertion of one or more nucleotides, replacement of one or more nucleotides, deletion of one or more nucleotides, or a combination thereof.
  • the disclosure provides protospacers that are adjacent to short (3 - 5 bp) DNA sequences termed protospacer adjacent motifs (PAM).
  • PAMs are important for type I and type II systems during acquisition.
  • type I and type II systems protospacers are excised at positions adjacent to a PAM sequence, with the other end of the spacer is cut using a ruler mechanism, thus maintaining the regularity of the spacer size in the CRISPR array.
  • the conservation of the PAM sequence differs between CRISPR-Cas systems and may be evolutionarily linked to Casl and the leader sequence.
  • a regulatory element is operably linked to one or more elements of a CRISPR system so as to drive expression of the one or more elements of the CRISPR system.
  • CRISPRs Clustered Regularly Interspaced Short Palindromic Repeats
  • SPIDRs Sacer Interspersed Direct Repeats
  • the CRISPR locus comprises a distinct class of interspersed short sequence repeats (SSRs) that were recognized in E. coli (Ishino et al, I. BacterioL, 169:5429-5433 (1987); and Nakata et al., J.
  • the CRISPR loci typically differ from other SSRs by the structure of the repeats, which have been termed short regularly spaced repeats (SRSRs) (Janssen et al, OMICS J. Integ. Biol., 6:23-33 (2002); and Mojica et al, Mol. Microbiol., 36:244-246 (2000)).
  • SRSRs short regularly spaced repeats
  • the repeats are short elements that occur in clusters that are regularly spaced by unique intervening sequences with a substantially constant length (Mojica et al., (2000), supra). Although the repeat sequences are highly conserved between strains, the number of interspersed repeats and the sequences of the spacer regions typically differ from strain to strain (van Embden et al., J. BacterioL, 182:2393-2401 (2000)). CRISPR loci have been identified in more than 40 prokaryotes (See e.g., Jansen et al, Mol.
  • an enzyme coding sequence encoding a CRISPR enzyme is codon optimized for expression in particular cells, such as eukaryotic cells.
  • the eukaryotic cells may be those of or derived from a particular organism, such as a mammal, including but not limited to human, mouse, rat, rabbit, dog, or non-human primate.
  • codon optimization refers to a process of modifying a nucleic acid sequence for enhanced expression in the host cells of interest by replacing at least one codon (e.g.
  • Codon bias differences in codon usage between organisms
  • mRNA messenger RNA
  • tRNA transfer RNA
  • genes can be tailored for optimal gene expression in a given organism based on codon optimization.
  • Codon usage tables are readily available, for example, at the "Codon Usage Database", and these tables can be adapted in a number of ways. See Nakamura, Y., et al. "Codon usage tabulated from the international DNA sequence databases: status for the year 2000" Nucl. Acids Res. 28:292 (2000).
  • Computer algorithms for codon optimizing a particular sequence for expression in a particular host cell are also available, such as Gene Forge (Aptagen;
  • one or more codons e.g. 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or more, or all codons
  • one or more codons in a sequence encoding a CRISPR enzyme correspond to the most frequently used codon for a particular amino acid.
  • a guide RNA is a single-stranded ribonucleic acid, although in some cases it may form some double-stranded regions by folding onto itself.
  • the guide RNA is about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more nucleic acid residues in length.
  • the guide RNA is from about 10 to about 30 nucleic acid residues in length.
  • the guide RNA is about 20 nucleic acid residues in length.
  • the length of the guide RNA can be at least about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41,
  • the guide RNA is from 5 to 50, 10 to 50, 15 to 50, 20 to 50, 25 to 50, 30 to 50, 35 to 50, 40 to 50, 45 to 50, 5 to 75, 10 to 75, 15 to 75, 20 to 75, 25 to 75, 30 to 75, 35 to 75, 40 to 75, 45 to 75, 50 to 75, 55 to 75, 60 to 75, 65 to 75, 70 to 75, 5 to 100, 10 to 100, 15 to 100, 20 to 100, 25 to 100, 30 to 100, 35 to 100, 40 to 100, 45 to 100, 50 to 100, 55 to 100, 60 to 100, 65 to 100, 70 to 75, 5 to 100, 10 to 100, 15 to 100, 20 to 100, 25 to 100, 30 to 100, 35 to 100, 40 to 100, 45 to 100, 50 to 100, 55 to 100, 60 to 100, 65 to 100, 70 to 100, 75 to 100, 80 to 100, 85 to 100, 90 to 100, 95 to 100, or more nucleotides or residues in length.
  • the guide RNA is from 5 to 50
  • administering comprises transducing, transfecting, electroporating, translocating, fusing, phagocytosing, shooting or ballistic methods, etc., i.e., any means by which a nucleic acid can be transported across a cell membrane.
  • the Satb21oxp/loxp (Satb2f/f) strain (Dobreva et al., 2006) was a gift from Dr. Jeff Macklis of Harvard University.
  • the Vil-CreERT2 strain el Marjou et al.,b2004 was a gift from Sylvie Robine (Institute Pasteur).
  • GEO Gene Expression Omnibus
  • ScRNA-Seq GSE148693.
  • ChlP-Seq GSE167287.
  • CUT&RUN GSE180029 and GSE167289.
  • Bulk RNA-Seq GSE148692, GSE167284, GSE180023, GSE167281, GSE167282, GSE167283.
  • GSE167285, GSE16728 and GSE180013) The following public GEO datasets were also analyzed: GSE115541, GSE71713 and GSE130822 (Banerjee et al., 2018; Jadhav et. al., 2016; Murata et al., 2020).
  • Mouse primary intestinal organoid culture was performed as previously described (Sugimoto and Sato, 2017). Organoid derivation was performed on ice or at 4 °C unless specified. Briefly, intestinal tissues were cut into approximately 0.5 cm size pieces and incubated in 2.5 mM EDTA for 45 minutes (mins) (small intestine) or in 10 mM EDTA for 60 mins (large intestine) . After vigorous pipetting with 1 % BSA pre-coated 10 rnL serological pipettes, epithelium cell clumps were collected by centrifugation at 300 g for 5 minutes. Crypts were further isolated by filtering through a 70mm cell strainer.
  • ENR small intestine
  • WENR large intestine
  • WME William's medium E
  • ADF advanced DMEM/F-12
  • EGF epithelial growth factor
  • Human organoids were generated from biopsy samples collected at Weill Cornell Medicine or obtained from the In Vivo Amnn-i and Human Studies Core at University of Michigan Center for Gastrointestinal Research. To generate organoids, human colon or ileum biopsy samples were cut into pieces (approximate 1 mm in size) and washed with cold DPBS by pipetting 2-3 times. Samples were treated with collagenase type IV (Worthington, 2 mg/ml in F12K medium) at 37 °C for 30 mins with pipetting every 10 mins. Digestion was terminated by adding F12K. with 10% FBS, followed by filtration with a 100 mm cell strainer (VWR).
  • collagenase type IV Waorthington, 2 mg/ml in F12K medium
  • HCM human 3D Organoid Culture Medium
  • HDM Human 3D Organoid Differentiation Medium
  • the knock -in construct modified from pR26CAG/GFP Dest (Addgene #74281) (Chu et al., 2016), carries a CAG promoter followed by a Neomycin- transcription stop cassette flanked by Loxp sites, HA epitope-tagged murine Satb2, an IRES element, and GFP.
  • Donor DNA consists of a 1 ,083kb left arm and a 4,34 Ibp right arm.
  • the construct was targeted to the ROSA26 locus by pro-nuclear injection paired with purified CASS protein (purchased from IDT) and a validated gRNA targeting ROSA26 (ACUCCAGUCUUUCUAGAAGA; SEQ ID NO:10).
  • transgenic progenies were genotyped for cassette integration into the genomic locus of ROSA26.
  • a total of 5 double transgenic lines were established by crossing with the Vil-CreERT2 mouse line.
  • Transgene expression in adult mice was analyzed by immunohistochemistry for GFP, the HA epitope tag, and SATB2 after tamoxifen (TAM) injection at 2 months of age. This analysis yielded very similar results from all 5 transgenic lines.
  • Satb2 and Foxd2 sgRNAs were designed with either Broad Institute online software or the Synthego CRISPR design tool and cloned into a LentiCRISPRv2 vector (Addgene plasmid #52961) (Sanjana et al., 2014).
  • the lentiviruses were packaged with second-generation helper plasmids by transfection with lipofectamine 3000 (Thermo Fisher Scientific, L3OOOO15) and titrated by counting puromycin resistant clones in HEK293T cells 5 days after infection.
  • single cell suspensions of 105 murine or human colonic organoids were mixed with 20 pl of 10 8 TCID ml of virus in 200 pl medium (either WENR for murine or HCM for human) in one well of a non-tissue culture treated 24 well plate and centrifuged at 1,100 g at 37° C for 30 mins to facilitate infection. After centrifugation, 200 ml of culture medium was added and the plate was further incubated for 4 hours at 37 °C. Cells were then resuspended, pelleted, and embedded in MatrigelTM. Puromycin selection (1.0 - 2.5 pg/ml) was initiated 4 days post infection and lasted for 4 days.
  • colonic organoids were seeded into new Matrigel drops and cultured in differentiation medium (DEM) (WENR medium without WRN conditioned medium and with the addition of 1 pg/ml RSpondin and 10 pML-161,982). Three days after differentiation, the organoids were either directly lysed in RLT buffer (QIAGEN) for RNA exaction, or incubated with cell recovery solution on ice, to remove Matrigel, for immunofluorescence and immunoblotting analyses.
  • DEM differentiation medium
  • RLT buffer QIAGEN
  • the CRISPR-mediated deletion efficiency of Satb2 was analyzed with immunofluorescence and immunoblotting, using a rabbit monoclonal anti-Satb2 antibody.
  • Foxd2 multiple commercially available antibodies were tested, but none was found suitable for immunofluorescence or Western Blot. Instead, the disruption efficiency at the Foxd2 genomic locus was evaluated, using a DNA mismatch detection assay with T7 endonucleasel (NEB).
  • NEB DNA mismatch detection assay with T7 endonucleasel
  • Genomic DNA was extracted with an E.Z.N.A tissue DNA kit (OMEGA). Foxd2 target regions were PCR amplified with Phusion High-Fidelity DNA polymerase (NEB) plus Kapa Hifi GC buffer (ThermoFisher), according to the manufacturer’s protocol.
  • PCR products were pre-amplified with forward primer: GGCATAAGCTTTGACTTCCAGTAAC (SEQ ID NO:11) and reverse primer: GTGATGAGGGCGATGTACGAATAA (SEQ ID NO: 12), at high annealing temperature (68 °C) for 10 cycles, followed by 60 °C for 30 cycles.
  • the heteroduplexed PCR products from Foxd2 CRISPR KO and homogeneous PCR products from the control group were incubated individually or mixed at a 1:1 ratio with T7 endonuclease 1 at 37 °C for 15 mins. The reaction was stopped by adding ImM EDTA (final concentration) and purified with the ZYMO DNA purification Kit. DNA fragment concentration was visualized by agarose gel electrophoresis and quantified with an Agilent TapeStation (A.02.02).
  • the gene modification percentage was calculated using the following formula:
  • RNA-seq was performed as previously described with the exception of mapping to the mouse reference genome mmlO instead of mm9 (Banerjee et al., 2018). Briefly, reads alignment was performed by STAR package (Dobin et al., 2013). The raw count tables were generated by featureCounts (Liao et al., 2014). The DEseq2 package was used for differential expression analysis (Love et al., 2014). The Limma package (Ritchie et al., 2015) was used to remove donor-donor variance and batch-effect. Differentially expressed genes were generally determined using parameters of adjusted p value ⁇ 0.05 and LFC > 2 or ⁇ - 2 unless specified.
  • the heatmaps were plotted using the R package, pheatmap.
  • GO enrichment analysis and GSEA analysis were conducted with the clusterProfiler package (Yu et al., 2012)(Wu, 2021) and GSEA desktop software (Subramanian et al., 2005).
  • Satb2 cK0 mice were injected once with tamoxifen at 2mg per 25 g body weight. The proximal 1/3 of the colon was collected at days 1, 2, 4, and 6 postinjection. Non-injected Satb2 cKO mice (day 0) and injected Satb2 f/f littermates served as controls.
  • RNA-seq epithelial cells were isolated by three subsequent incubations with lOmM EDTA and ImM DL-Dithiothreitol (DTT) in cold DMEM (GIBCO) for 10 min on a rotator, vigorous shaking, and collection of supernatants.
  • the likelihood Ratio Test (LRT) was used to identify Differentially Expressed Genes (DEGs) across time-points with the threshold adjusted p value ⁇ 0.01.
  • AT AC experiments were performed following the Omni- AT AC protocol (Buenrostro et al., 2015) as previously described (Banerjee et al., 2018). Briefly, 50K intestinal epithelial cells were purified by FACS and pelleted by centrifugation at 500 g at 4° C for 5 mins. Nuclei were exacted in ATAC- Resuspension Buffer (RSB, 10 mM Tris-HCl pH 7.4, 10 mM NaCl, 3 mM MgCh) with 0.1% NP40, 0.1% Tween-20, and 0.01% Digitonin.
  • RBSB ATAC- Resuspension Buffer
  • DNA was fragmented by Nextera Tn5 Transposase (Illumina, 2003419) and immediately purified with a MiniElute PCR Purification Kit (QIAGEN).
  • NEBNext 2x MasterMix New England Biolabs was used to pre- Amplify for 5 cycles and determine the required number of additional cycles by qPCR amplification.
  • the final libraries were size selected (200bp to 800bp, including index) with AMPure XP beads (Beckman), purified, and loaded for sequencing.
  • the purified libraries were sequenced by Novogene on Illumina HiSeq- 2000, to obtain paired-end 150bp reads.
  • Alignment BAM files for the ATAC-seq were generated with the mmlO reference genome using nf-core pipelines. Narrow peaks were called using standard MACS2 (Feng et al., 2012).
  • ATAC- seq peak files that had regions of less than Ikb from transcriptional start site (TSS) were removed using bedtools (Quinlan and Hall, 2010). Biological replicates were concatenated and sorted, and peaks merged within a maximum distance of 500 bp.
  • Live Epcam + , CD45”, and CD31“ epithelial cells sorted by SONY MA900 in FACS buffer, were washed with 0.4% BSA in PBS and processed with 10X genomics single cell droplet sample preparation workflow at the Genomics Core facility at Weill Cornell Medicine.
  • TruSeq Read 1 (read 1 primer sequence) was added during GEM incubation.
  • a sample index and TruSeq Read 2 (read 2 primer sequence) were added via end-repair, A-tailing, adaptor ligation, and PCR.
  • the final libraries were assessed by an Agilent Technology 2100 Bioanalyzer and sequenced on an Illumina NovaSeq sequencer. scRNA-seq analysis with Seurat Sequencing data from the Illumina NovaSeq were aligned to mouse mmlO in CellRanger 3.1.0.
  • Seurat version 3.2.0 was used to perform quality control, count normalization, and clustering on the single cell transcriptomic data using standard methods as follows: unique molecular identifiers (UMIs) which barcode each individual mRNA molecule within a cell during reverse transcription were used to remove PCR duplicates. Cells expressing fewer than 300, or greater than 5,000 genes were removed to exclude non-cells or cell aggregates. Cells expressing greater than 18 percent mitochondrial related genes were also removed.
  • UMIs unique molecular identifiers
  • the objects of wild-type (WT) ileum, colon and Satb2 cK0 colon were merged (hereafter named “the combined object”) and the CellCycleS coring function was used to calculate a cell cycle score and assign a cell cycle status for each cell.
  • Normalization of the combined object was conducted by SCTransform method in Seurat with regression out of confounding sources including mitochondrial mapping percentage and cell cycle scores (S score and G2M score).
  • RunPCA function was implemented with default parameters.
  • KNN K-nearest neighbor
  • the FinderClusters function with default parameters a resolution of 1.5 implements modularity optimization technique to iteratively group cells together in order to cluster the cells.
  • Nonlinear dimensional reduction techniques FIt-SNE and UMAP were used to visualize the results.
  • the SelectlntegrationFeatures function was used to select the genes that were taken as input in the anchors identification procedure by the PrepS CTIntegration and the FindlntegrationAnchors functions using the merged control colon and ileum object as reference and the knockout object as query.
  • the integration of the KO and WT objects were implemented by the IntegratedData function with the anchors identified previously. Dimension reduction, clustering and visualization were performed using the same methods mentioned above.
  • the MHC genes were among the most differentially expressed between small intestine and colon. Their expression is strongly influenced by the microbiome and they do not constitute an intrinsic feature of the ileum.
  • MHCII genes were removed from the gene lists. The gene lists were then applied as inputs in the AddModuleScore function with default parameters, which calculates module scores for feature expression programs on single cell level.
  • the combined object for the progenitor group was first identified as a subset and divided into two groups based on detection of Lgr5 gene expression.
  • the stem cell gene list was taken as input for the AddModuleScore with default parameters to calculate stem cell signature score between these two groups.
  • the combined object was subset for the Lgr5 positive “Progenitor” in the G1 or S cell cycle.
  • the subset went through the standard analysis procedure as mentioned above for normalization, clustering and visualization with the first 20 PCs and a resolution of 0.8. Four clusters were identified, and their makers were found by the FindAllMarkers function. According to the markers, cluster 1 appeared to be
  • TFs Transcription Factors
  • HNF4A Transcription Factors
  • CDX2 ChIP for Transcription Factors
  • Lysates were spun down at 20,000 g at 4 °C to remove insoluble fractions, then diluted in RIPA buffer with protease inhibitor in a final 2 mL volume. Diluted lysates were incubated with anti-transcription factor antibodies at 4 °C overnight and were additionally incubated with 30 pl protein A/G magnetic beads (Thermo Fisher Scientific, 88803) for 90 mins the next day. This was followed by 6 washes with cold RIPA buffer beads. Cross-links were reversed overnight by incubating at 65 °C in 1% SDS and 0.1 M NaHCOa- Any remaining proteins were digested by Proteinase K (Thermo Fisher Scientific, 26160) for 1 hour at 37 °C. DNA was purified with a MinElute purification kit (QIAGEN, 28004). Libraries were prepared using the ThruPLEX DNA-Seq Kit (Takara bio, R400428 and R400427).
  • Cut & Run was performed by the Center for Epigenetics Research (CER) in Memorial Sloan Kettering Cancer Center. Briefly, single cell suspensions were collected as described in the single cell RNA sequencing section. Dead cells were removed using a Dead Cell Removal Kit (Miltenyi Biotec). Cells (10 5 ) were attached to Concanavalin A conjugated magnetic beads, permeabilized, and incubated with histone enhancer maker antibodies at room temperature for 20 mins. pAG-MNase (1: 1000) was added in digitonin buffer (5% digitonin, 60 mM HEPES, 0.5 M sodium chloride, 1.5 mM spermidine hydrochloride, protease inhibitor, pH 7.5) to bind with antibodies.
  • CER Center for Epigenetics Research
  • CER Center for Epigenetics Research
  • Dead cells were removed using a Dead Cell Removal Kit (Miltenyi Biotec). Cells (10 5 ) were attached to Concanavalin A conjugated magnetic beads, permeabilized, and incubated with
  • ChlP-Seq (macs2) (Feng et al., 2012) peak caller (v2.2.7) with parameters callpeak -f BAMPE -g mm -p 0.0000000001, and was controlled by KO/input.
  • Heatmaps of ChlP-Seq were created by quantile normalized bigWigs using computeMatrix, plotHeatmap, and plotProfile from deeptools.
  • the annotatePeaks function in HOMER was used to annotate the peaks.
  • peak sites were mapped to TSS (transcription start site), TTS (transcription termination site), Exon (Coding), 5’ UTR Exon, 3’ UTR Exon, Intronic, or Intergenic, which are common annotations defined by HOMER.
  • a promoter region was defined as a region within ⁇ 2 Kb from the TSS.
  • Enriched motifs were identified within 200 bp regions centered on SATB2 ChlP-seq peak summits using findMotifsGenome.pl with options ‘-length -len “8,10,12”’ and ‘- size 200’ on the repeat-masked mouse genome (mmlOr) from HOMER.
  • Intestinal tissues were processed as described by Ariyachet et al. (2016). Organoids were removed from Matrigel with Cell Recovery Solution (Corning 354253), fixed with 4% paraformaldehyde in PBS on ice for 30 mins, and then processed with the same procedure as the intestinal tissues. Immunohistochemistry was performed using a standard procedure, incubating with primary antibodies at 4 °C overnight, followed with secondary antibodies at room temperature for 45 mins. A Click-iTTM EDU Cell Proliferation Kit with Alexa Fluor® 555 (C10338) was used to evaluate proliferation. The images were captured using either a confocal microscope (710 Meta) or a Nikon fluorescence microscope.
  • a monoclonal rabbit anti-SATB2 antibody was used to bind SATB2 protein, followed by an incubation with a secondary anti-Rabbit Peroxidase (HRP). Protein bands were visualized using enhanced chemiluminescent substrate (Pico from Thermo fisher) and recorded by a Li-COR C-Digit or li-COR odyssey clx blot scanner. The relative signal intensity was quantified by ImageJ (vl.51 (100)).
  • samples were processed through heat mediated antigen retrieval in Citric Acid buffer (pH 6.0) except for the samples that stained for monoclonal anti-SATB2 antibodies, which were processed in Tris-EDTA (pH 9.0).
  • Samples were then stained with primary rabbit antibodies, followed by Goat anti-Rabbit HRP polymer (Vector Laboratories, MP-7451) incubation, and finally, developed with AP (Magenta color, Vector Laboratories, MP-7724) or DAB (Brown color, Vector Laboratories, SK-4103) HRP Substrate.
  • AP Magnenta color, Vector Laboratories, MP-7724
  • DAB Brownn color, Vector Laboratories, SK-4103 HRP Substrate.
  • the images of swiss rolled colon were taken by a confocal digital slide scanner in MSKCC image core and processed by Caseviewer (v2.4).
  • An Alcian Blue Stain Kit (Vector Laboratories, H-3501) was used
  • EDTA stripped colonic grand epithelium cells from control and Satb2 cK0 mice were cross-linked with DSP (Thermo Fisher Scientific, PG82081) at room temperature for 45 minutes. Pellets of epithelial cells were incubated with RIPA buffer and sonicated at 15% amplification for 20 seconds. After 10 minutes (maximum speed down), supernatants were incubated with anti-CDX2 and anti- HNF4A antibodies overnight in a cold room with a rotation speed of 10 RPM. After adding 30 pl protein A/G magnetic beads for 90 minutes on the next day, the protein and beads complex was pulled down by a magnetic slander. Next, six cold RIPA buffer washes were performed. Then cross-links were cleaved by 50 mM DTT with boiling for 5 mins. Immunoblots were used to visualize the interaction between target proteins.
  • mice 14 C-Taurocholic acid and 3 H-Glucose were purchased from American Radiolabeled Chemicals, Inc. To perform the absorption study, mice were fasted overnight for about 16 hours. Following deep anesthetization, a 2cm section of the distal ileum or proximal colon was cleaned of luminal content by repeated flushing with saline and was tied on both ends with sutures to create a sealed pouch. Two microcuries (pCi) 3 H-glucose and 0.6 pCi 14 C-Taurocholic acid dissolved in 100 pl 10% dextrose solution were injected into the pouch. After 5 or 20 mins, blood was collected from the hepatic portal vein with a 27-gauge needle.
  • differentiated human organoids were transferred to BSA-pre-coated 1.5 mL Eppendorf tubes and washed three times in PBS.
  • For the disaccharidase enzyme activity assay 5 mg of an organoid pellet was incubated with 100 pL of 56 mM sucrose in PBS or PBS only at 37 °C for 45 mins. Aliquots of the supernatant were sampled for glucose detection using the Glucose Colorimetric Assay Kit (Cayman), according to the manufacturer’s protocol. Briefly, the samples were diluted with PBS in a 1: 1 and 1:2 ratio to ensure glucose concentration levels in the standard range (0-25 mg/dl). The enzyme and samples mixtures were incubated at 37 °C for 10 mins.
  • the absorbance (510 nm) was measured with a plate reader (SpectraMax M2). Glucose concentration was determined by comparison to a glucose standard curve.
  • Gly-Pro-p-nitroanilide hydrochloride (Sigma, G0513) in PBS was added to an organoid pellet at a final concentration of 1.5 mM.
  • the organoid tubes were incubated at 37 °C in a tissue culture incubator with the lip open for 30 mins and were mixed every 10 mins.
  • the supernatants were collected and absorbance was measured at 410 nm with a plate reader (SpectraMax M2). Released nitroanilide concentration was determined by comparison to a 4-nitroanilide (Sigma, 185310) standard curve (0 - 200 pg/ml). The concentration was finally normalized to a total cell lysate protein amount of 1 mg.
  • Example 2 SATB2 is enriched and required in colonic epithelium
  • RNA- seq RNA sequencing data of purified murine LGR5 + intestinal stem cells (ISCs) from the duodenum and colon for colon-enriched transcription factors (TFs; Jadhav et al., 2016; Murata et al., 2020).
  • duodenal and colonic organoids from human biopsy samples were cultured under high-WNT conditions (WNT3A- EGF-Noggin-Rspondinl (WENR) medium), which favors intestinal stem cell growth (VanDussen et al., 2019), and RNA-seq was used to identify transcription factors (TFs) enriched in human colonic organoids.
  • FIG. 1A Besides posterior Hox genes, two transcription factors, SATB2 and FOXD2, were enriched in murine and human colon (FIG. 1A). Immunoblots and immunohisto-chemistry (FIG. IB, 1C) revealed prominent SATB2 expression in adult mouse cecal and colonic epithelia, including in LGR5 + intestinal stem cells at the crypt base.
  • CRISPR clustered regularly interspaced short palindromic repeats
  • Cas9 Cas9
  • guide RNAs were used to disrupt Satb2 or Foxd2 in murine colonic organoids.
  • guide RNAs were evaluated for knock-out of Satb2, including guide RNAs that included one of the following sequences:
  • CTTTTGTGTCGTGGAGCAGT SEQ ID NO: 8
  • the first guide (SEQ ID NO:6) provided the highest modification frequency.
  • Satb2 loss significantly altered the mRNA profile, reducing colonic genes and increasing small intestine genes, indicating a requirement for Satb2 in maintaining adult colonic identity.
  • Satb2 deletion efficiencies of 55%- 95% were obtained in independent experiments (FIG. 1E-1F).
  • Example 3 Replacement of colonic mucosa with ileum-like mucosa in adult mice after SATB2 loss
  • SATB2 is a homeodomain-containing chromatin factor expressed in developing craniofacial tissues and cortical neurons (Alcamo et al., 2008; Britanova et al., 2006, 2008; Dobreva et al., 2006). Human SATB2 mutations cause craniofacial anomalies and cognitive impairment (Zarate and Fish, 2017). SATB2 is also expressed in the fetal and adult murine and human hindgut and may be used as a diagnostic marker for colorectal cancer (Munera and Wells, 2017; Perez Montiel et al., 2015), but its intestinal functions are largely unknown.
  • FIG. 1B-1C Immunoblots and immunohistochemistry revealed prominent SATB2 expression in adult mouse cecal and colonic epithelia, including in LGR5 + intestinal stem cells at the crypt base. Ileal villus cells showed weak nuclear SATB2 staining, but the small intestine was otherwise devoid of SATB2 (FIG. IB). Immunoblotting confirmed lack of SATB2 expression in ileal crypts (FIG. ID). qRT-PCR of LGR5 + intestinal stem cells isolated by fluorescence-activated cell sorting (FACS) from different gut segments of Lgr5 CreERGFP reporter mice showed high-level Satb2 mRNA in colonic but not in small intestine intestinal stem cells.
  • FACS fluorescence-activated cell sorting
  • Satb2 was deleted in the intestinal mucosa within 2-month old Satb2 ⁇ mice by crossing with the Villin- Cre ER(T2> strain (FIG. IE), leading to nearly complete absence of SATB2.
  • TAM Villin- Cre ER
  • Satb2 cKO the colonic mucosa of Vil- Cre ER ;Satb2 ⁇ mice (hereafter referred to as Satb2 cKO ) was remodeled significantly, with the characteristic flat epithelium replaced by villus structures (mucosal depth, 208 ⁇ 24 pm versus 92 + 18 pm in Satb2 f/f controls) and the presence of Paneth cells at the crypt base (FIG.
  • Immunohistochemistry revealed loss of colonic markers such as CAI and AQP4 and gain of ileal markers such as 0LFM4 (stem cells), FABP6, and FGF15 (enterocytes) and the Paneth cell product Lysozyme 1 (LYZ1) (FIG. 1J).
  • colonic intestinal stem cells may have converted into ileumlike intestinal stem cells.
  • three different approaches were used: single-cell transcriptome profiling of LGR5 + stem cells, organoid cultures, and Satb2 deletion from LGR5 + intestinal stem cells.
  • First epithelial cells were profiled using single-cell RNA-seq (scRNA- seq), where the epithelial cells were FACS-purified Epithelial Cell Adhesion Molecule (EPCAM) + CD45- CD31“ cells obtained thirty days after tamoxifen (TAM) treatment.
  • EPM Epithelial Cell Adhesion Molecule
  • TAM tamoxifen
  • Transcriptomes from 3,912 control ileal, 3,627 control colonic, and 4,370 Satb2 cK0 colonic cells were integrated and partitioned into seven populations, including goblet, enterocyte, colonocyte, Paneth, tuft, and enteroendocrine (EE) cells, annotated with lineage-specific markers (Haber et al., 2017; FIG. 2A).
  • FIG. 2A A majority of differentiated cells from the Satb2 cK0 colon clustered with ileal cells (FIG. 2A) and expressed canonical ileal markers (FIG. 2B).
  • Lgr5 + stem cells within the “progenitor” groups expressed high levels of the ISC markers Ascl2 and Axin2 and scored significantly higher than Lgr5 ⁇ progenitors on a stem cell scorecard (Munoz et al., 2012) (Wilcoxon rank-sum Lest continuity correction p ⁇ 2.2e -16 ). Focusing on intestinal stem cell subsets at the Gl/S cell cycle phase (control ileum, 209 cells; control colon, 230 cells; mutant colon, 155 cells), which have been proposed as basal stem cells (Biton et ah, 2018), Satb2 cKO colonic cells clustered with ileal and not with colonic intestinal stem cells (FIG. 2C). Compared with control colon, the ileum-like intestinal stem cells in Satb2 cK0 colon were enriched for Gene Ontology pathways of antimicrobial and innate immune responses and depleted of sulfur and phospholipid metabolism pathways.
  • control colonic crypts yielded only few non-branching spheroids (0.015 ⁇ 0.013 structures per crypt), and most of these could not be passaged, whereas control ileal (0.25 ⁇ 0.06 primary and 1.4 ⁇ 0.6 secondary structures per crypt) and Satb2-null colonic crypts (0.19 ⁇ 0.03 primary and 1.8 ⁇ 0.5 secondary structures per crypt) formed branching organoids that could be propagated (FIG. 2D)
  • SATB2 is expressed in stem and differentiated colonic cells
  • FIG. 3B shows a heatmap representation of time-course RNA-seq data illustrating rapid activation of pathways typical of enterocytes and downregulation of pathways characteristic of colonocytes.
  • Paneth and stem cell genes were only strongly activated at day 30. involved in nutrient absorption and transport by day 4.
  • Clusters 2 and 3 include genes involved in metabolism and absorption, which were strongly activated as early as by day 4 or day 6.
  • Clusters 4 and 5 relate to colon-specific pathways in immune modulation and glycosylation that were downregulated after just a few days (FIG. 3C). Significant activation of Defensin genes and 01fm4 was only achieved at day 30 (cluster 1, FIG. 3C).
  • gene set enrichment analysis revealed no enrichment of fetal signature genes (Fordham et al., 2013) in Satb2 cKO colonic transcriptomes between day 1 and 6. Examination of two fetal markers showed a modest and transient increase in Ly6a (Seal) but not Anxal. Significant fetal gene activation was thus not associated with colonic-to-ileal transformation.
  • Satb2 cKO colonic cells retained colonic identity, including 9.2% of mature absorptive cells and 3.8% of goblet cells.
  • MHC major histocompatibility complex
  • small intestine but not colon intestinal stem cells
  • MHC class II genes were high in ileal and low in control colonic and ileum-like Satb2 cK0 colonic intestinal stem cells.
  • ileal and Satb2 cKO colonic organoids were cultured in identical WENR medium for one passage, differentiated the organoids, and performed RNA-seq.
  • Example 7 Generation of bona fide nutrient-absorbing enterocytes in the ileum-like colon
  • Ileal enterocytes absorb nutrients as well as bile salts and vitamins.
  • Ileal and Satb2 cK0 colonic enterocytes expressed many transporters for lipids, carbohydrates, amino acids, bile salts, and vitamins that were absent or low in colonocytes (FIG. 4A).
  • Satb2 cKO colonic enterocytes were enriched for functional pathways in nutrient absorption and digestion and, notably, in genes relating to microvillus organization (FIG. 4A). Enterocytes are well known to sprout longer microvilli than colonocytes to increase their absorptive surface. Electron microscopy revealed substantially longer microvilli in Satb2 cK0 colonic enterocytes than in control colonocytes, comparable with those of ileal enterocytes (FIG. 4B).
  • Example 8 SATB2 confers colonic characteristics on the mature ileum
  • CAG SATB2 ' GFP was generated in which CRE excision of a stop cassette activated hemagglutinin (HA) epitope-tagged SATB2 and GFP (FIG. 5A).
  • ileal GFP + cells LFC > 1.5, Padj ⁇ 0.1
  • these genes were enriched for colonic and ileal tissue signatures, respectively (FIG. 5E).
  • the downregulated genes were large numbers of enterocyte nutrient transporters and Defensins characteristic of Paneth cells.
  • Colonic epithelium absorbs electrocytes and synthesizes many glycoproteins, including specific mucins for anti-microbial defense.
  • GFP + ileal cells expressed an array of key electrolyte transporters and principal glycosylation enzymes. Thus, they acquired molecular machineries for colonic functions.
  • immunohistochemistry 30 days after TAM administration showed suppression of the ileal marker FABP6 and activation of the colonic marker CAI (FIG. 5F-5G).
  • OLFM4 and LYZ1 also disappeared from GFP + crypts (FIG. 5G), consistent with the transcriptomics data.
  • Satb2 0E ileum qRT-PCR analysis indicated that jejunal and duodenal GFP + cells downregulated small intestine genes but failed to activate most colonic genes, with the duodenum being the least responsive.
  • SATB2 is therefore sufficient to confer colon-like characteristics on the adult ileum.
  • H3K4mel transcriptional start site [TSS]- distal regions
  • Tissue-specific enhancers were identified by MAnorm.
  • Assay for Transposase Accessible Chromatin with high-throughput sequencing(ATAC-seq) was employed to further chart the chromatin landscapes in these tissues.
  • Analysis of all H3K4mel + enhancers defined 7,375 colon-specific and 5,784 ileum-specific sites (MAnorm, p ⁇ 0.01), with nearby genes ( ⁇ 50 kb) enriched for colonic or ileal expression, respectively (FIG. 6D). In normal colon, a majority of SATB2 binding (59.5%) occurred within H3K27ac + active enhancers (FIG. 6E), and 67% of SATB2/CDX2/HNF4A co-bound sites overlapped with active enhancers.
  • the colon-specific enhancers had high levels of H3K4mel and H3K27ac, strong AT AC signals, and robust binding by CDX2 and HNF4A, all hallmarks of active enhancers (FIG. 6F-6G). These enhancers were deactivated in the Satb2 cKO colon. The Satb2 cK0 colon also displayed low levels of H3K4mel, H3K27ac, open chromatin, and CDX2 or HNF4A occupancy. These results indicate that SATB2 has a role in maintaining active colonic enhancers.
  • ileum-specific enhancers in normal colon retained low but detectable signals of ATAC, H3K4mel, H3K27ac, CDX2, and HNF4A; after SATB2 loss, each of these signals was enhanced significantly (FIG. 6F- 6G).
  • ileal enhancers are not constitutively silent at baseline in mature colon but retain weak enhancer features. These “primed” enhancers likely provide the chromatin substrate for ileal gene activation and tissue fate plasticity.
  • CDX2 and HNF4A function primarily as transcriptional activators (Verzi et al., 2011, 2013).
  • HNF4A increased by 1-fold.
  • the two transcription factors associate with each other in normal and Satb2 cK0 colon (FIG. 6C), and their co-binding switched from colonic to ileal enhancers after SATB2 loss (FIG. 6F-6G), correlating closely with downregulation of colonic and activation of ileal genes (FIG. 6D).
  • FIG. 6J illustrates SATB2 CUT&RUN binding profiles in a 10-kb window centered on SATB2 peaks identified by ChlP-seq.
  • FIG. 6H-6J illustrate that SATB2 bound similar genomic loci in colonic LGR5+ stem cells as non-stem cells.
  • SATB2 binds the same genomic sites in stem cells as in differentiated cells, indicating that SATB2 can “prime” the stem cells for a differentiation path to colonic progenies.
  • Example 10 Human colonic organoids adopt ileal characteristics after SATB2 loss
  • FIG. 7A shows representative images of SATB2 expression in one of the primary human organoid lines (#87) and its absence after CRISPR-mediated deletion using sgRNAl.
  • FIG. 7F-7G illustrates that RBP2, a marker of ileum, was detected in ileal human biopsy tissues.
  • FIG. 7G illustrates that RBP2 was not detected in the colonic epithelium of human biopsy tissues. Instead, RBP2 was abundantly expressed in colonic organoids after SATB2 deletion, at levels comparable to that of control ileal organoids (FIG. 7G).
  • FIG. 7H shows that ileal makers SLC15A1 and FABP6 were activated in colonic organoids after SATB2 loss and that such markers are localized to the luminal epithelial side and the cytoplasm, respectively.
  • human colon markers CEACAM1 and MUC2 were downregulated in the SATB2 hK0 colonic organoids.
  • SATB2 tissue-restricted chromatin factor
  • results provided herein also reveal a surprising degree of inherent plasticity between adult ileal and colonic mucosa, likely enabled by the presence of primed ileal enhancers in the colon and vice versa.
  • the ileal enhancers activated by Satb2 loss are not decommissioned developmental enhancers, and they are not overtly subject to PRC2 regulation.
  • the knock-in construct modified from pR26CAG/GFP Dest (Addgene #74281), carries a GAG promoter followed by a Neomycin-transcription stop cassette flanked by Loxp sites, HA epitope-tagged murine Satb2, an IRES element, and GFP.
  • Donor DNA consists of a l,O83kb left arm and a 4,341 bp right arm.
  • the construct was targeted to the ROSA26 locus by pro-nuclear injection paired with purified CAS9 protein (purchased from IDT) and a validated gRNA targeting ROSA26 (ACUCCAGUCUUUCUAGAAGA; SEQ ID NO: 13).
  • transgenic progenies were genotyped for cassette integration into the genomic locus of ROSA26.
  • a total of 5 double transgenic lines were established by crossing with the Vil-Cre ERT2 mouse line.
  • Transgene expression in adult mice was analyzed by immunohistochemistry for GFP, the HA epitope tag, and SATB2 after TAM injection at 2 months of age. This analysis yielded very similar results from all 5 transgenic lines.
  • Intestinal organoid culture was performed as previously described (Sugimoto and Sato, 2017). Briefly, mouse intestinal crypts were isolated by incubating small intestine in 2.5 mM EDTA for 30 minutes (mins) or large intestine in 10 mM EDTA for 60 minutes. 50-200 Crypts per 25 pl MatrigelTM droplet were cultured in either ENR (small intestine) or WENR (large intestine) medium in humidified chambers containing 5% CO2 at 37°C. The formation efficiency of primary organoids was determined by dividing the number of organoids at Day 5 by the initial Crypt numbers.
  • Human organoids were generated from biopsy samples collected at Weill Cornell Medicine or obtained from the In Vivo Animal and Human Studies Core at University of Michigan Center for Gastrointestinal Research. To generate organoids, human colon or ileum biopsy samples were cut into about 1 mm piece and washed with cold DPBS by pipetting 2-3 times. Samples were treated with collagenase type IV (Worthington, 2 mg/ml in F12K medium) at 37°C for 30 minutes with pipetting every 10 minutes. Digestion was terminated by adding F12K with 10% FBS, followed by filtration with a 100 pm cell strainer (Falcon).
  • HCM human 3D Organoid Culture Medium
  • MatrigelTM MatrigelTM with a 1:5 volume ratio and embedded with 10-20 crypts per 10 pl droplet.
  • Human organoids were expanded in HCM and differentiated in Human 3D Organoid Differentiation Medium (HDM) for 72 hours.
  • Satb2 and Foxd2 sgRNAs were designed with either Broad Institute online software or the Synthego CRISPR design tool and cloned into a LentiCRISPRv2 vector (Addgene plasmid #52961 ).
  • the lentiviruses were packaged with second-generation helper plasmids by transfection with lipofectamine 3000 (Thermo Fisher Scientific, L3OOOO15) and titrated by counting puromycin resistant clones in HEK293T cells 5 days after infection.
  • single cell suspensions of 10 5 murine or human colonic organoids were mixed with 20 pL of 10 8 TCIDso/ml of virus in 200 pl medium (either WENR for murine or HCM for human) in one well of a non-tissue culture treated 24 well plate, and centrifuged at 1,100 g at 37°C for 30 minutes to facilitate infection. After centrifugation, 200 of culture medium was added and the plate was further incubated for 4 hours at 37 °C. Cells were then resuspended, pelleted, and embedded in MatrigelTM. Puromycin selection (1.0 - 2.5 pg/ml) was initiated 4 days post infection and lasted for 4 days.
  • colonic organoids were seeded into new Matrigel drops and cultured in differentiation medium (WENR medium without WRN conditioned medium and with the addition of 1 pg/ml RS pondin and 10 pM L-161982). 3 days after differentiation, the organoids were either directly lysed in RLT buffer (Qiagen) for RNA exaction, or incubated with cell recovery solution on ice, to remove Matrigel, for immunofluorescence and immunoblotting analyses.
  • differentiation medium WENR medium without WRN conditioned medium and with the addition of 1 pg/ml RS pondin and 10 pM L-161982.
  • the CRISPR-mediated deletion efficiency of Satb2 was analyzed with immunofluorescence and immunoblotting, using a rabbit monoclonal anti-Satb2 antibody.
  • Foxd2 multiple commercially available antibodies were tested, but none was found suitable for immunofluorescence or Western Blot. Instead, the disruption efficiency at the Foxd2 genomic locus was evaluated, using a DNA mismatch detection assay with T7 endonucleasel (NEB).
  • NEB DNA mismatch detection assay with T7 endonucleasel
  • Genomic DNA was extracted with an E.Z.N.A tissue DNA kit (OMEGA). Foxd2 target regions were PCR amplified with Phusion High-Fidelity DNA polymerase (NEB) plus Kapa Hifi GC buffer (ThermoFisher), according to the manufacturer's protocol.
  • PCR products were pre-amplified with forward primer: GGCATAAGCTTTGACTTCCAGTAAC (SEQ ID NO: 14) and reverse primer: GTGATGAGGGCGATGTACGAATAA (SEQ ID NO: 15), at high annealing temperature (68°C) for 10 cycles, followed by 60°C for 30 cycles.
  • the heteroduplexed PCR products from Foxd2 CRISPR KO and homogeneous PCR products from the control group were incubated individually or mixed at a 1 : 1 ratio with T7 endonuclease 1 at 37 °C for 15 minutes. The reaction was stopped by adding 1 mM EDTA (final concentration) and purified with the ZYMO DNA purification Kit.
  • DNA fragment concentration was visualized by agarose gel electrophoresis and quantified with an Agilent Bioanalyzer.
  • the gene modification percentage was calculated using the following formula: % gene modification ⁇ 100 x (1 - (1- fraction cleaved) 1/2).
  • % gene modification 200 x (1 - (1- fraction cleaved) 1/2).
  • ATAC-Resuspension Buffer 10 mM Tris-HCI pH 7.4, 10 mM NaCl, 3 mM MgC12
  • RBS ATAC-Resuspension Buffer
  • DNA was fragmented by Nextera Tn5 Transposase (Illumina) and immediately purified with a MiniElute PCR Purification Kit (Qiagen).
  • NEBNext 2x MasterMix was used to pre- Amplify for 5 cycles and determine the required number of additional cycles by qPCR amplification.
  • the final libraries were size selected (200 bp to 800 bp, including index) with AMpure beads, purified, and loaded for sequencing.
  • the purified libraries were sequenced by Novagene on Illumina HiSeq- 2000, to obtain paired-end 150 bp reads.
  • Alignment BAM files for the ATAC- seq were generated with the mmlO reference genome using nf-core pipelines. Narrow peaks were called using standard MACS2.
  • ATAC-seq peak files that had regions of less than 1 kb from transcriptional start site (TSS) were removed using bedtool. Biological replicates were concatenated and sorted, and peaks merged within a maximum distance of 500 bp.
  • Live Epcam + , CD45", and CD31" epithelial cells sorted by SONY MA900 in FACS buffer, were washed with 0.4% BSA in PBS and processed with 10X genomics single cell droplet sample preparation workflow at the Genomics Core facility at Weill Cornell Medicine.
  • the objects of wild-type (WT) ileum, colon and Satb2 cK0 colon were merged (hereafter named "the combined object") and the CellCycleS coring function was used to calculate a cell cycle score and assign a cell cycle status for each cell.
  • Normalization of the combined object was conducted by SCTransform method in Seurat with regression out of confounding sources including mitochondrial mapping percentage and cell cycle scores (S score and G2M score).
  • RunPCA function was implemented with default parameters.
  • KNN K-nearest neighbor
  • the FinderClusters function with default parameters a resolution of 1.5 implements modularity optimization technique to iteratively group cells together in order to cluster the cells.
  • Non-linear dimensional reduction techniques Flt-SNE and UMAP were used to visualize the results.
  • the SelectlntegrationFeatures function was used to select the genes that were taken as input in the anchors identification procedure by the PrepSCTlntegration and the FindlntegrationAnchors functions using the merged control colon and ileum object as reference and the knockout object as query.
  • the integration of the KO and WT objects were implemented by the Integrated Data function with the anchors identified previously. Dimension reduction, clustering and visualization were performed using the same methods mentioned above.
  • the MHC genes were among the most differentially expressed between small intestine and colon. Their expression is strongly influenced by the microbiome and they do not constitute an intrinsic feature of the ileum.
  • MHCII genes were removed from the gene lists. The gene lists were then applied as inputs in the AddModuleScore function with default parameters, which calculates module scores for feature expression programs on single cell level.
  • the combined object for the progenitor group subset was divided into two groups based on the detection of Lgr5 gene expression.
  • the stem cell gene list was taken as input for the AddModuleScore with default parameters to calculate stem cell signature score between these two groups.
  • the combined object was subset for the Lgr5 positive "Progenitor" in the G1 or S cell cycle.
  • the subset went through the standard analysis procedure as mentioned above for normalization, clustering and visualization with the first 20 PCs and a resolution of 0.8. Four clusters were identified, and their makers were found by the FindAIIMarkers function. According to the markers, cluster 1 appeared to be Goblet progenitors and thus was removed.
  • TFs Transcription Factors
  • HNF4A Transcription Factors
  • CDX2 ChIP for Transcription Factors
  • sarkosyl lysis buffer 0.25% sarkosyl, 1 mM DTT and protease inhibitor in RIPA buffer (0.1% SDS, 1% Triton X-100, 10 mM Tris HCI, 1 mM EDTA, 0.1% sodium deoxycholate, 0.3 M sodium chloride, PH 7.5)
  • sonicated at 15% amplification by a tip sonicator Qsonica, 0125
  • Lysates were spun down at 20,000g at 4°C to remove insoluble fractions, then diluted in RIP A buffer with protease inhibitor in a final 2 ml volume. Diluted lysates were incubated with TFs antibodies at 4°C overnight and were additionally incubated with 30 pl protein A/G magnetic beads (Thermo Fisher Scientific, 88803) for 90 minutes the next day. This was followed by 6 washes with cold RIPA buffer beads. Cross-links were reversed overnight by incubating at 65°C in 1% SDS and 0.1 M NaHCO3. Any remaining proteins were digested by Proteinase K (Thermo Fisher Scientific, 26160) for 1 hour at 37°C. DNA was purified with a MinElute purification kit (Qiagen, 28004). Libraries were prepared using the ThruPLEX DNA-Seq Kit (Takara bio, R400428 and R400427).
  • Cut & Run was performed by the Center for Epigenetics Research (GER) in Memorial Sloan Kettering Cancer Center. Briefly. Single cell suspensions were collected as described in the single cell RNA sequencing section. Dead cells were removed using a Dead Cell Removal Kit (Miltenyi Biotec). 105 cells were attached to Concanavalin A conjugated magnetic beads, permeabilized, and incubated with histone enhancer maker antibodies at RT for 20 minutes. pAG- MNase (1:1000) was added in digitonin buffer (5% digitonin, 60 rnM HEPES, 0.5 M sodium chloride, 1.5 mM spermidine hydrochloride, protease inhibitor, PH 7.5) to bind with antibodies.
  • GER Epigenetics Research
  • ChlP-Seq (macs2) (Feng et al., 2012) peak caller (v2.2.7) with parameters callpeak-f BAMPE -g mm -p 0.0000000001, and was controlled by KO/input.
  • Heat maps of ChlP-Seq were created by quantile normalized bigWigs using computeMatrix, plotHeatmap, and plotProfile from deeptools.
  • MAnorm (Shao et al., 2012), software designed for quantitative comparisons of ChlP-Seq datasets, was applied to compare ChlP-Seq signal intensities between samples.
  • the window size was 1 kb, which matched the average width of the identified ChlP-Seq peaks.
  • Tissue specific peaks were defined using the following criteria: (1) defined as 'unique' by the MAnorm algorithm, (2) P value ⁇ 0.01, (3) raw counts of unique reads> 10. Peaks common to two samples were defined using the following criteria: (1) defined as 'common' by the MAnorm algorithm and (2) raw read counts of both samples> 10.
  • the annotatePeaks function in HOMER was used to annotate the peaks.
  • peak sites were mapped to TSS (transcription start site), TTS (transcription termination site), Exon (Coding), 5' UTR Exon, 3' UTR Exon, Intronic, or Intergenic, which are common annotations defined by HOMER.
  • a promoter region was defined as a region within ⁇ 2 Kb from the TSS.
  • Intestinal tissues were processed as previously described.(Ariyachet et al., 2016) Organoids were removed from Matrigel with Cell Recovery Solution (Corning 354253), fixed with 4% paraformaldehyde in PBS on ice for 30 minutes, and then processed with the same procedure as the intestinal tissues. Immunohistochemistry was performed using a standard procedure, incubating with primary antibodies at 4°C overnight, followed with secondary antibodies at room temperature for 45 minutes. A Click-iTTM EDU Cell Proliferation Kit with Alexa Fluor® 555 (Cl 0338) was used to evaluate proliferation. The images were captured using either a confocal microscope (710 Meta) or a Nikon fluorescence microscope.
  • a monoclonal rabbit anti-SATB2 antibody was used to bind SATB2 protein, followed by an incubation with a secondary anti-Rabbit Peroxidase (HRP). Protein bands were visualized using enhanced chemiluminescent substrate (Pico from Thermo fisher) and recorded by a Li-COR C-Digit blot scanner.
  • HRP secondary anti-Rabbit Peroxidase
  • samples were processed through heat mediated antigen retrieval in Citric Acid buffer (PH 6.0). Samples were then stained with primary rabbit antibodies, followed by Goat anti-Rabbit HRP polymer (Vector Laboratories, MP-7451) incubation, and finally, developed with AP (Magenta color, Vector Laboratories, MP-7724) HRP Substrate. An Alcian Blue Stain Kit (Vector Laboratories, H-3501) was used to stain goblet cells. Quantitative Analysis of Histological Staining and Fluorescence in ImageJ All sections were evaluated by multiple people, including a clinical pathologist.
  • hematoxylin and specific antibody staining were separated into 3 different panels with the function of color deconvolution for PAS (AP development).
  • epithelial area was overlaid on the AP signal channel image.
  • EDTA stripped colonic grand epithelium cells from control and Satb2 cK0 mice were cross-linked with DSP (Thermo Fisher Scientific, PG82081) at RT for 45 minutes. Pellets of epithelial cells were incubated with RIPA buffer and sonicated at 15% amplification for 20 seconds. After 10 minutes (maximum speed down), supernatants were incubated with anti-CDX2 and anti-HNF4A overnight in a cold room with a rotation speed of 10 RPM. After adding 30 pl protein A/G magnetic beads for 90 minutes on the next day, the protein and beads complex was pulled down by a magnetic stander. Next, 6 cold RIPA buffer washes were performed. Then cross-links were cleaved by 50 mM DTT boiling for 5 minutes. Immunoblots were used to visualize the interaction between target proteins.
  • Frozen tissues were homogenized in dFEO (50 mg of tissue in 500 ( l of di bO) with a Dounce homogenizer. Following homogenization, the glass tubes were placed in a heat block for 10 minutes at 100°C, vortexed, and cooled to room temperature. The homogenized samples were centrifuged at 16,000g for 5 minutes. Supernatants were collected. 500 pl of supernatant per sample was added to scintillation vials containing the scintillation cocktail for counting.
  • differentiated human organoids were transferred to BSA-pre-coated 1.5 ml Eppendorf tubes and washed three times in PBS.
  • For the disaccharidase enzyme activity assay 5 mg of an organoid pellet was incubated with 100 pl of 56 mM sucrose in PBS or PBS only at 37°C for 45 minutes. Aliquots of the supernatant were sampled for glucose detection using the Glucose Colorimetric Assay Kit (Cayman), according to the manufacturer's protocol. Briefly, the samples were diluted with PBS in a 1: 1 and 1:2 ratio to ensure glucose concentration levels in the standard range (0-25 mg/dl). The enzyme and samples mixtures were incubated at 37°C for 10 minutes.
  • the absorbance (510 nm) was measured with a plate reader (SpectraMax M2). Glucose concentration was determined by comparison to a glucose standard curve.
  • Gly-Pro-p-nitroanilide hydrochloride (Sigma, G0513) in PBS was added to an organoid pellet at a final concentration of 1.5 mM.
  • the organoid tubes were incubated at 37 °C in a tissue culture incubator with the lip open for 30 minutes and were mixed every 10 minutes.
  • the supernatants were collected and absorbance was measured at 410 nm with a plate reader (SpectraMax M2). Released nitroanilide concentration was determined by comparison to a 4-nitroanilide (Sigma, 185310) standard curve (0 - 200 pg/ml). The concentration was finally normalized to a total cell lysate protein amount of 1 mg.
  • RNA-seq data of purified LGR5 + stem cells from the duodenum and the colon was interrogated for transcription factors (TFs) enriched in colonic stem cells (FIG. 8A) (Jadhav et al., 2016; Murata et al., 2020).
  • TFs transcription factors
  • FIG. 8B Primary duodenal and colonic organoids from human biopsy samples were cultured under high Wnt conditions, which favor stem cell growth (VanDussen et al., 2019), and used RNA-seq to identify TF transcripts enriched in human colonic organoids
  • Example 13 Replacement of colonic mucosa by ileal-like mucosa in adult mice after SATB2 loss
  • SATB2 is a homeodomain-containing chromatin factor expressed in developing craniofacial tissues and cortical neurons (Alcamo et al., 2008; Britanova et al., 2008; Britanova et al., 2006; Dobreva et al., 2006).
  • Human SATB2 mutations produce a syndrome characterized by craniofacial anomalies and cognitive impairment (Zarate and Fish, 2017).
  • SATB2 is also expressed in fetal and adult murine and human hindgut and may he used as a diagnostic marker for colorectal cancer (Munera and Wells, 2017; Perez Montiel et al., 2015), but its intestinal functions are largely unknown.
  • Satb2 was deleted in 2- month old Satb ⁇ mice using the Villinl -Cre ER(T2> strain specifically in intestinal mucosa (FIG. 9B), leading to near complete absence of SATB2 (FIG. 9C).
  • TAM Tamoxifen
  • the large intestine mucosae of Vil- Cre I K ;Suib2A mice (referred thereafter as Satb2 cK0 ) were significantly remodeled, with the characteristic flat epithelium replaced by villus structures (mucosal depth 208 ⁇ 24 pm vs.
  • EdU 5-ethynyl-2-deoxyuridine
  • RNA-seq analysis revealed little difference between SATB2-null and control jejunum or ileum, whereas the mutant cecal and colonic transcrip tomes resemble that of normal ileum.
  • 362 ileal enriched genes control ileal vs colonic transcriptome, Log2 fold change (LFC) >2, adjusted P value (Padj) ⁇ 0.05
  • 309 85.4%) were up-regulated in SATB2 mutant colon whereas 238 out of 302 colon-enriched genes (78.8%) were down-regulated (FIG. 9H).
  • Example 14 Conversion of LGR5+ colonic stem cells to ileal-like stem cells
  • epithelial cells FACS -purified EPCAM + CD45 CD3" cells
  • scRNA-seq single-cell RNA sequencing
  • Lgr5 + stem cells were identified from the "progenitor" groups (FIG. 10D).
  • the Lgr5 + cells expressed high levels of the ISC markers Ascl2 and Axin2 and scored significantly higher than Lgr5 ⁇ progenitors using a stem-cell scorecard (Munoz et al., 2012) (Wilcoxon rank sum test continuity correction p- value ⁇ 2.2e -16 ) (FIG. 10D and FIG. 10E).
  • ISCs derived from the large and small intestines differ in their ability to form organoids in 3D Matrigel cultures.
  • colonic crypts fail to generate organoids in medium lacking WNT3A (Sato et al., 2011 ).
  • Crypts isolated from control ileum, control colon and Satb2 cK0 colon all produced spheroids in culture media containing high WNT3A (FIG. 11A).
  • control colonic crypts yielded only few non-branching spheroids (0.015 ⁇ 0.013 structures per crypt) and most of these could not be passaged.
  • both control ileal (0.25 ⁇ 0.06 primary and 1.4 ⁇ 0.6 secondary structures per crypt) and Satb2-null colonic crypts (0.19 + 0.03 primary and 1.8 ⁇ 0.5 secondary structures per crypt) formed branching organoids that could be perpetuated (FIG. 11A and FIG. 11B).
  • Example 15 Environmental factors influence gene expression of the ileal- like epithelium in the SATB2-null colon
  • MHCII major histocompatibility complex class II
  • Example 16 Generation of bona fide nutrient-absorbing enterocytes in the ileal-like colon
  • Ileal enterocytes absorb nutrients as well as bile salts and vitamins.
  • the data revealed a general replacement of colonocytes by ileal enterocytes in Satb2 cK0 colon.
  • the singlecell transcriptomes of ileal and Satb2 cKO colonic enterocytes were comapred. Both populations expressed a large number of transporters for lipids, carbohydrates, amino acids, bile salts and vitamins that were absent or low in colonocytes (FIG. 11F and FIG. 11G).
  • Satb2 cK0 colonic enterocytes were enriched for expression of functional pathways in nutrient absorption and digestion, and interestingly, also in genes relating to "microvillus organization".
  • Enterocytes are well known to sport longer microvilli than colonocytes as a means to increase their absorptive surface. Using electron microscopy, it was determined that Satb2 cKO colonic enterocyte microvilli were substantially longer than colonocyte microvilli, and comparable to those of ileal enterocytes.
  • Example 17 SATB2 confers colonic characteristics on the mature ileum
  • RNA-seq of FAGS-purified GFP + cells from the ileum showed Satb2 mRNA levels comparable to the colon.
  • 225 genes were down-regulated and 131 genes were up-regulated in GFP + cells (LFC >1.5, Padj ⁇ 0.1); these genes were enriched for colonic and ileal tissue signatures, respectively.
  • the down- regulated genes were large numbers of enterocyte nutrient transporters and Defensins characteristic of Paneth cells.
  • colonic epithelium The primary function of colonic epithelium is to absorb electrocytes, some of which generate osmotic gradients to enable water uptake; additionally, colon synthesizes many glycoproteins, including specific MUCINs for antimicrobial defense.
  • GFP + ileal cells expressed an array of key transporters for electrocytes and principal enzymes involved in protein glycosylation. Thus, they acquired the molecular machineries to perform colonic functions.
  • immunohistochemistry 30 days after TAM showed suppression of ileal marker FABP6 and activation of colonic marker CAI.
  • OLFM4 and LYZ1 also disappeared from GFP + crypts, consistent with the transcriptomic data.
  • SATB2 a close homolog expressed primarily in thymocytes, binds both DNA and nuclear matrix and regulates transcription partly by modulating genomic binding of TFs and chromatin remodeling complexes (Cai et al., 2003; Skowronska- Krawczyk et al., 2014; Yasui et al., 2002).
  • CDX2 and HNF4A genomic binding sites were found to co-localize extensively with SATB2, with 54.1% (13,843 out of 25,576) of SATB2 peaks co-bound by both TFs (FIGs. 12C-12D).
  • CDX2 and HNF4A antibodies co-precipitated SATB2 from colonic tissue, suggesting interactions of SATB2 with CDX2/HNF4A at its genomic binding sites.
  • CUT&RUN Cleavage Under Targets & Release Using Nuclease
  • H3K4mel histone H3K27 acetyltransferase
  • H3K27ac active enhancers in control ileum, colon, and SATB2 cK0 colon epithelia. Peaks were called with MACS2 using duplicate samples.
  • Enhancers H3K4mel, TSS-distal regions were identified by MAnorm. Assay for Transposase- Accessible Chromatin (ATAC-seq) was employed to further chart the chromatin landscapes in these tissues. Analysis of all H3K4mel + enhancers defined 7,375 colon-specific and 5,784 ileum-specific sites (MAnorm; P ⁇ 0.01), with the nearby genes ( ⁇ 50 kb) enriched for colonic or ileal expression, respectively. In the normal colon, a majority of SATB2 binding (59.5%) occurred within H3K27ac + active enhancers (FIGs. 12E-12F).
  • the colon-specific enhancers had high levels of H3K4mel and H3K27ac, strong AT AC signals, and robust binding by CDX2 and HNF4A, all hallmarks of active enhancers (FIG. 12G). These enhancers were de-activated in Satb2 cK0 colon and displayed low levels of H3K4mel, H3K27ac, open chromatin, and CDX2 or HNF4A occupancy, indicating a role for SATB2 in maintaining active colonic enhancers.
  • ileal-specific enhancers in normal colon retained low but detectable signals of ATAC, H3K4mel, H3K27ac, CDX2 and HNF4A; after SATB2 loss they acquired high levels of H3K4mel and H3K27ac, strong ATAC signals, and robust CDX2 and HNF4A binding (FIG. 12G).
  • Ileal enhancers are not permanently inactivated at the baseline in mature colon, but retain weak enhancer features and provide the chromatin substrate for ileal gene activation and tissue fate plasticity.
  • RNA-seq analysis of the 5 isogenic control (CAS9 alone) and SATB2 knockout (SATB2hKo) organoid lines showed significant suppression of colonic genes and activation of small intestinal genes (FIG. 13E).
  • Digestive enzyme activities of the small intestine disaccharidase and dipeptidyl peptidase were also significantly elevated in SATB2 hK0 colonic organoids (FIG. 13H).
  • CEACAM1 and MUC2 highly expressed in human colon but substantially less in ileum, were down-regulated (FIGs. 13I-13J).
  • metaplasia Stable formation of ectopic tissues, known as metaplasia, is relatively rare, but does occur in several human organs such as the lung, esophagus and bladder, and is reported in animal studies (Giroux and Rustgi, 2017; Slack, 2007). Different mechanisms could account for metaplasia without necessarily involving stem cell plasticity.
  • inactive enhancers In embryonic stem cells and developing tissues, a subset of inactive enhancers, some decorated with the repressive histone mark H3K27me3, exist in a "poised” or “primed” state, ready for timely activation (Creyghton et al., 2010; Rada-Iglesias et al., 2011).
  • Adult intestine enhancers lack H3K27me3 (Saxena et al., 2017; Zentner et al., 2011), but enhancers used during fetal development retain hypomethylated DNA and traces of the active histone mark H3K4mel (Jadhav et al., 2019).
  • ileal enhancers in the mature colon are not permanently inactivated but carry features of weak enhancers and are readily activated in the absence of SATB2. They thus could be considered as existing in a primed state, providing a chromatin substrate for ileal gene activation and tissue fate plasticity in mature intestine.
  • the digestive tract is one of the most ancient and conserved organs across multicellular organisms.
  • a distinct large intestine, separated from the small intestine by an ileocaecal valve, is however only well recognized in tetrapods (Schultz et al., 1989). Colon-like structures are postulated to exist in lower vertebrates but there are uncertainties (Brugman, 2016).
  • the SATB2 gene is highly conserved across animal phyla.
  • FIG. 21 shows that a partial Satb2 deletion in colon ameliorates Short Bowel disease in mice SBR: removal of 80% of small bowel of mice.
  • Genetic Satb2 deletion Satb2 was removed from -30% of colon, i.e., at least 30%, e.g., at least 50%, of colon was converted to small intestine in this model.
  • a method comprising deleting or inactivating least one Satb2 allele or inhibiting expression of a Satb2 gene in one or more starting cells of a subject, to thereby convert the starting cells into small intestine-like cells.
  • deleting or inactivating at least one Satb2 allele comprises administering genomic modifying agents to the subject that target one or both Satb2 alleles in the subject.
  • genomic modifying agents comprise expression vectors and/or targeting vectors for modifying endogenous Satb2 alleles.
  • the expression vectors and/or targeting vectors can encode and express nucleases (e.g., cas nucleases), guide RNAs, donor DNAs, and/or any other components for genomic editing.
  • nucleases e.g., cas nucleases
  • guide RNAs e.g., guide RNAs
  • donor DNAs e.g., donor DNAs, and/or any other components for genomic editing.
  • deleting or inactivating least one Satb2 allele comprises one or more of Cre/lox- mediated, floxing (flox/flox) -mediated, CRISPR-mediated, TALENS- mediated, ZFN-mediated knockout, base-editing-mediated, knockout, or knockdown of at least one Satb2 allele in one or more starting cells.
  • the method of any one of statements 1-2, or 8-11, comprising isolating one or more cells from the subject and incubating the cells with one or more CRISPR, TALENS, Cre/lox, ZFN, or base-editing, reagents to generate a modified population of cells comprising cells having one or more modified Satb2 allele sequences.
  • the method of statement 12 wherein the one or more CRISPR, TALENS, ZFN, or base-editing reagents comprises one or more guide RNAs or a vector that can express one or more guide RNAs, where the one or more guide RNAs can specifically bind to a Satb2 genomic site.
  • any one of statements 6, 8, 13, or 15, wherein one or more of the guide RNAs comprises an RNA sequence corresponding to SEQ ID NO:6.
  • the method of statement 18, wherein the population of small intestinelike cells is administered intravenously to the subject.
  • the method of statement 18 or 19, wherein the population of small intestine-like cells is administered to the abdomen of the subject.
  • any one of claims 1-24 further comprising administering one or more CRISPR, TALENS, Cre/lox, ZFN, or base-editing-mediated reagents to the subject’s intestines.
  • the method of statement 25 wherein the one or more CRISPR, TALENS, ZFN, or base-editing reagents comprises one or more guide RNAs or a vector that can express one or more guide RNAs, where the one or more of the guide RNAs can specifically bind to a Satb2 genomic site.
  • the method of statement 26 or 27 wherein one or more of the guide RNAs can specifically bind to a Salb2 genomic site and guide a cas nuclease to efficiently cleave and/or modify the Satb2 genomic site.
  • the method of statement 1, wherein inhibiting expression of the Satb2 gene comprises contacting a nucleic acid encoding a SATB2 protein with at least 95% sequence identity to any one of SEQ ID NOs:l, 3, 4, or 5 with a small hairpin RNA, an siRNA, or a vector that can express a small hairpin RNA or an siRNA.
  • a method comprising administering to a subject one or more agents that delete or modify at least one Satb2 allele or administering to a subject one or more reagents that inhibit expression of a Satb2 gene in one or more intestinal cells of a subject, to thereby convert the intestinal cells into small intestine-like cells.
  • the method of statement 33 wherein the one or more agents that delete at least one Satb2 allele in the one or more intestinal cells of a subject comprise one or more CRISPR, TALENS, ZFN, or base-editing reagents.
  • the method of statement 34 wherein the CRISPR, TALENS, ZFN, or base-editing reagents comprise one or more guide RNAs or a vector that can express one or more guide RNAs, where the one or more of the guide RNAs can specifically bind to a Satb2 genomic site.
  • the method of statement 38, wherein one or more reagents that inhibit expression of a Satb2 gene in one or more intestinal cells of a subject is a small hairpin RNA, an siRNA, or a vector that can express a small hairpin RNA or an siRNA.
  • Ill 40 The method of statement 39, wherein the small hairpin RNA, the siRNA, or a combination thereof binds to an RNA with at least 95% sequence identity or complementarity to a segment of SEQ ID NO:2.
  • intestinal disease or condition is short bowel disease, congenital short bowel syndrome, intestinal injury, intestinal atresia, intussusception, meconium ileus, midgut volvulus, omphalocele, irritable bowel syndrome, digestive failure, reduced nutritional absorption, fistula, Crohn’s disease, necrotizing enterocolitis ulcerative colitis, or colorectal cancer.
  • a reference to “a nucleic acid” or “a protein” or “a cell” includes a plurality of such nucleic acids, proteins, or cells (for example, a solution or dried preparation of nucleic acids or expression cassettes, a solution of proteins, or a population of cells), and so forth.
  • the term “or” is used to refer to a nonexclusive or, such that “A or B” includes “A but not B,” “B but not A,” and “A and B,” unless otherwise indicated.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Cell Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Toxicology (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

L'invention concerne des procédés et des compositions qui peuvent modifier, inhiber et/ou supprimer au moins un allèle Satb2 ou inhiber l'expression d'un gène Satb2 dans des cellules in vivo ou in vitro.
PCT/US2023/024322 2022-06-06 2023-06-02 Promotion de l'absorption de nutriments par le colon WO2023239609A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US202263349436P 2022-06-06 2022-06-06
US63/349,436 2022-06-06
US17/935,492 2022-09-26
US17/935,492 US20230392145A1 (en) 2022-06-06 2022-09-26 Promoting nutrient absorption through the colon

Publications (1)

Publication Number Publication Date
WO2023239609A1 true WO2023239609A1 (fr) 2023-12-14

Family

ID=87060647

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2023/024322 WO2023239609A1 (fr) 2022-06-06 2023-06-02 Promotion de l'absorption de nutriments par le colon

Country Status (1)

Country Link
WO (1) WO2023239609A1 (fr)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5464758A (en) 1993-06-14 1995-11-07 Gossen; Manfred Tight control of gene expression in eucaryotic cells by tetracycline-responsive promoters
US5814618A (en) 1993-06-14 1998-09-29 Basf Aktiengesellschaft Methods for regulating gene expression
US7112715B2 (en) 2000-10-03 2006-09-26 Gie-Cerbm, Centre Europeen De Recherche En Biologie Et En Medecine (Gie) Transgenic mouse for targeted recombination mediated by modified Cre-ER
WO2016120853A1 (fr) * 2015-01-30 2016-08-04 Glax Llc Compositions et méthodes pour la surveillance, le diagnostic, le pronostic, la détection et le traitement du cancer
WO2020208094A1 (fr) 2019-04-09 2020-10-15 Cambridge Enterprise Limited Structure d'échafaudage tubulaire équivalente à un tissu, et procédés de production de celle-ci

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5464758A (en) 1993-06-14 1995-11-07 Gossen; Manfred Tight control of gene expression in eucaryotic cells by tetracycline-responsive promoters
US5814618A (en) 1993-06-14 1998-09-29 Basf Aktiengesellschaft Methods for regulating gene expression
US7112715B2 (en) 2000-10-03 2006-09-26 Gie-Cerbm, Centre Europeen De Recherche En Biologie Et En Medecine (Gie) Transgenic mouse for targeted recombination mediated by modified Cre-ER
WO2016120853A1 (fr) * 2015-01-30 2016-08-04 Glax Llc Compositions et méthodes pour la surveillance, le diagnostic, le pronostic, la détection et le traitement du cancer
WO2020208094A1 (fr) 2019-04-09 2020-10-15 Cambridge Enterprise Limited Structure d'échafaudage tubulaire équivalente à un tissu, et procédés de production de celle-ci

Non-Patent Citations (119)

* Cited by examiner, † Cited by third party
Title
"gene", Database accession no. NC_000002.12
"NCBI", Database accession no. XP_005246453.1
ABREMSKI ET AL., CELL, vol. 32, 1983, pages 1301
ARIYACHET ET AL., CELL STEM CELL, vol. 18, 2016, pages 410
AUSUBEL ET AL.: "Current Protocols in Molecular Biology", 1994, GREENE PUBLISHING ASSOCIATES AND JOHN WILEY & SONS
BANERJEE ET AL., GENES DEV., vol. 32, 2018, pages 1430
BARKER ET AL., NATURE, vol. 449, 2007, pages 1003
BEUMERCLEVERS, NAT. REV. MOL. CELL BIOL., vol. 22, 2021, pages 39
BIKARD ET AL., CELL HOST & MICROBE, vol. 12, 2012, pages 177 - 186
BIKARDMARRAFFINI, CURR OPIN IMMUNOL, vol. 24, 2012, pages 15 - 20
BITON ET AL., CELL, vol. 175, 2018, pages 1307
BLANPAINFUCHS, SCIENCE, vol. 344, 2014, pages 1242281
BRITANOVA ET AL., AM. J. HUM. GENET., vol. 79, 2006, pages 668
BRITANOVA ET AL., NEURON, vol. 57, 2008, pages 378
BRUGMAN, DEV. COMP. IMMUNOL., vol. 64, 2016, pages 82
CAI ET AL., NAT. GENET., vol. 34, 2003, pages 42
CAS, no. 900A-1
CHEN ET AL., NAT. GENET., vol. 51, 2019, pages 777
CLARKWHITELAW, NATURE REVIEWS GENETICS, vol. 4, 2003, pages 825 - 833
CLEVERSWATT, ANNU. REV. BIOCHEM., vol. 87, 2018, pages 1015
CREYGHTON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 107, 2010, pages 21931
DAVISON ET AL., GENOME RES., vol. 27, 2017, pages 1195
DOBREVA ET AL., CELL, vol. 125, 2006, pages 971
DONATI ET AL., NAT. CELL BIOL, vol. 19, 2017, pages 603
ELBASHIR ET AL., NATURE, vol. 411, 2001, pages 494 - 498
ELBASHIR, S.M. ET AL.: "Analysis of gene function in somatic mammalian cells using small interfering RNAs", METHODS, vol. 26, no. 2, 2002, pages 199 - 213, XP002251055, DOI: 10.1016/S1046-2023(02)00023-3
EMBDEN ET AL., J. BACTERIOL., vol. 182, 2000, pages 2393 - 2401
FENG ET AL., NAT. PROTOC., vol. 7, 2012, pages 1728
FUHRICH ET AL., ANAL. QUANT. CYTOPATHOL. HISTPATHOL., vol. 35, 2013, pages 210
GAO ET AL., DEV. CELL., vol. 16, 2009, pages 588
GEHARTCLEVERS, NAT. REV. GASTROENTEROL. HEPATOL., vol. 16, 2019, pages 19
GIROUXRUSTGI, NAT. REV. CANCER, vol. 17, 2017, pages 594
GOEDDEL: "Gene Expression Technology: Methods in Enzymology", vol. 185, 1990, ACADEMIC PRESS
GRAINGER ET AL., PLOS ONE, vol. 8, 2013, pages e54757
GROENEN ET AL., MOL. MICROBIOL., vol. 10, 1993, pages 1057 - 1065
GU WEI ET AL: "SATB2 preserves colon stem cell identity and mediates ileum-colon conversion via enhancer remodeling", CELL STEM CELL, ELSEVIER, CELL PRESS, AMSTERDAM, NL, vol. 29, no. 1, 27 September 2021 (2021-09-27), pages 101, XP086915473, ISSN: 1934-5909, [retrieved on 20210927], DOI: 10.1016/J.STEM.2021.09.004 *
HABER ET AL., NATURE, vol. 551, 2017, pages 333
HARBORTH ET AL., ANTISENSE NUCLEIC ACID DRUG DEV., vol. 13, 2003, pages 83 - 106
HEINZ ET AL., MOL. CELL, vol. 38, 2010, pages 576
HOE ET AL., EMERG. INFECT. DIS., vol. 5, 1999, pages 254 - 263
INDRA ET AL., NUC. ACID. RES, vol. 27, 1999, pages 4324
ISHINO ET AL., J. BACTERIOL, vol. 169, 1987, pages 5429 - 5433
JADHAV ET AL., MOL. CELL, vol. 74, 2019, pages 542
JANSEN ET AL., MOL. MICROBIOL., vol. 43, 2002, pages 1565 - 1575
JANSSEN ET AL., OMICS J. INTEG. BIOL., vol. 6, 2002, pages 23 - 33
JENSEN, ANAT. REC. (HOBOKEN), vol. 296, 2013, pages 378
JINEK ET AL., SCIENCE, vol. 337, 2012, pages 815 - 820
KARGINOVHANNON, MOL CELL, vol. 45, 2010, pages 292 - 302
KRAMERFUSSENEGGER, METHODS MOL. BIOL.,, vol. 308, 2005, pages 123
LANGMEADSALZBERG, NAT. METHODS, vol. 9, 2012, pages 357
LEUSHACKE ET AL., NAT. CELL BIOL., vol. 19, 2017, pages 774
LI ET AL., BIOINFORMATICS, vol. 25, 2009, pages 2078
MALI ET AL., SCIENCE, vol. 339, 2013, pages 823 - 6
MARRAFFINISONTHEIMER, NATURE REVIEWS GENETICS, vol. 11, 2010, pages 181 - 190
MASEPOHL ET AL., BIOCHIM. BIOPHYS. ACTA, vol. 1307, 1996, pages 26 - 30
MCDONALD ET AL., NAT. REV. GASTROENTEROL. HEPATOL, vol. 12, 2015, pages 50
MINACAPELLI ET AL., AM. J. PHYSIOL. GASTROINTEST. LIVER PHYSIOL., vol. 312, 2017, pages G615
MOJICA ET AL., MOL. MICROBIOL, vol. 17, 1995, pages 85 - 93
MOJICA ET AL., MOL. MICROBIOL., vol. 36, 2000, pages 244 - 246
MÚNERA JORGE O ET AL: "Differentiation of Human Pluripotent Stem Cells into Colonic Organoids via Transient Activation of BMP Signaling", CELL STEM CELL, ELSEVIER, CELL PRESS, AMSTERDAM, NL, vol. 21, no. 1, 22 June 2017 (2017-06-22), pages 51, XP085122148, ISSN: 1934-5909, DOI: 10.1016/J.STEM.2017.05.020 *
MUNERAWELLS, METHODS MOL. BIOL., vol. 1597, 2017, pages 167
MUNOZ ET AL., EMBO J., vol. 31, 2012, pages 3079
MURATA ET AL., CELL STEM CELL, vol. 26, 2020, pages 377
MUTCH ET AL., BIOCHEM. BIOPHYS. RES. COMMUN., vol. 294, 2002, pages 470
NAKAMURA, Y. ET AL.: "Codon usage tabulated from the international DNA sequence databases: status for the year 2000", NUCL. ACIDS RES, vol. 28, 2000, pages 292, XP002941557, DOI: 10.1093/nar/28.1.292
NAKATA ET AL., J. BACTERIOL, vol. 171, 1989, pages 3553 - 3556
NEEDLEMANWUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 - 53
NI HENGLI ET AL: "SATB2 Defect Promotes Colitis and Colitis-associated Colorectal Cancer by Impairing Cl-/HCO3- Exchange and Homeostasis of Gut Microbiota", JOURNAL OF CROHN'S AND COLITIS, vol. 15, no. 12, 18 December 2021 (2021-12-18), NL, pages 2088 - 2102, XP093080527, ISSN: 1873-9946, Retrieved from the Internet <URL:https://watermark.silverchair.com/jjab094.pdf?token=AQECAHi208BE49Ooan9kkhW_Ercy7Dm3ZL_9Cf3qfKAc485ysgAAA3YwggNyBgkqhkiG9w0BBwagggNjMIIDXwIBADCCA1gGCSqGSIb3DQEHATAeBglghkgBZQMEAS4wEQQMG3KIe7DB6ez_748bAgEQgIIDKcA49woTTOfjokJsV7jGkFjyJ4pkgrWpPv3bg-J4AvViuqOWusilaLwgSg_aKXgsggUR8CdFQ5v7ifx1_CsrzTYQvJeY> DOI: 10.1093/ecco-jcc/jjab094 *
NICHOLSDAVENPORT, HUM. GENET., 2020
NO ET AL., PROC. NATL. ACAD. SCI., vol. 93, 1996, pages 3346
NUC. ACID. RES., vol. 28, 2000, pages e99
NUSSE ET AL., NATURE, vol. 557, 2018, pages 322
OWEN ET AL., NAT. COMMUN., vol. 9, 2018, pages 4261
PAGE ET AL., CELL STEM. CELL, vol. 13, 2013, pages 471
PEREZ MONTIEL ET AL., ANN. DIAGN. PATHOL., vol. 19, 2015, pages 249
QUANTE ET AL., CANCER CELL, vol. 21, 2012, pages 36
RADA-IGLESIAS ET AL., NATURE, vol. 470, 2011, pages 279
RAMIREZ ET AL., NUCLEIC ACIDS RES., vol. 42, 2014, pages 187
RITCHIE ET AL., NUCLEIC ACIDS RES., vol. 43, 2015, pages e47
SAMBROOK ET AL.: "Molecular Cloning, a Laboratory Manual", 2001, COLD SPRING HARBOR PRESS
SANTOS ET AL., TRENDS CELL BIOL., vol. 28, 2018, pages 1062
SATO ET AL., GASTROENTEROLOGY, vol. 141, 2011, pages 1762
SATO ET AL., NATURE, vol. 459, 2009, pages 262
SAXENA ET AL., GENES DEV, vol. 31, 2017, pages 2391
SAXENA ET AL., GENES DEV., vol. 31, 2017, pages 2391
SCHULTZ ET AL.: "The Gastrointestinal system", 1989, OXFORD UNIVERSITY PRESS
SHAO ET AL., GENOME BIOL., vol. 13, 2012, pages R16
SKENE ET AL., NAT. PROTOC., vol. 13, 2018, pages 1006
SKOWRONSKA-KRAWCZYK ET AL., NATURE, vol. 514, 2014, pages 257
SLACK, NAT. REV. MOL. CELL BIOL., vol. 8, 2007, pages 369
SOREK ET AL., NATURE REVIEWS MICROBIOLOGY, vol. 6, 2008, pages 181 - 6
SPITZFURLONG: "13", NAT. REV. GENET., 2012, pages 613
STERGACHIS ET AL., CELL, vol. 154, 2013, pages 888
STERNBERG ET AL., COLD SPRING HARBOR SYMPOSIA ON QUANTITATIVE BIOLOGY, vol. 297, 1981
SUGIMOTO ET AL., CELL STEM CELL, vol. 22, 2018, pages 171
SUGIMOTOSATO, METHODS MOL. BIOL, vol. 1612, 2017, pages 97
SZEMES ET AL., NEUROCHEM. RES, vol. 31, 2006, pages 237
TARASOV ET AL., BIOINFORMATICS, vol. 31, 2015, pages 2032
TATA ET AL., NATURE, vol. 503, 2013, pages 218
TETTEH ET AL., TRENDS CELL BIOL., vol. 25, 2015, pages 100
THAISS ET AL., CELL, vol. 167, 2016, pages 1495
THOMPSON ET AL., DEV. BIOL., vol. 435, 2018, pages 97
UMESAKI ET AL., MICROBIOL. LMMUNOL., vol. 39, 1995, pages 555
VAN ES ET AL., NAT. CELL BIOL., vol. 14, 2012, pages 1099
VANDUSSEN ET AL., STEM CELL RES., vol. 37, 2019, pages 101430
VERZI ET AL., MOL. CELL BIOL., vol. 31, 2011, pages 2026
VERZI ET AL., MOL. CELL BIOL., vol. 33, 2013, pages 281
WANG ET AL., CELL, vol. 145, 2011, pages 1023
WANG ET AL., CELL, vol. 179, 2019, pages 1144
WEI JYH-DING ET AL: "SATB2 participates in regulation of menadione-induced apoptotic insults to osteoblasts : ROLES OF SATB2 IN OSTEOBLAST APOPTOSIS", JOURNAL OF ORTHOPAEDIC RESEARCH, vol. 30, no. 7, 3 January 2012 (2012-01-03), US, pages 1058 - 1066, XP093080550, ISSN: 0736-0266, Retrieved from the Internet <URL:https://api.wiley.com/onlinelibrary/tdm/v1/articles/10.1002%2Fjor.22046> DOI: 10.1002/jor.22046 *
WELLSSPENCE, DEVELOPMENT, vol. 141, 2014, pages 752
XU MU ET AL: "LncRNA SATB2-AS1 inhibits tumor metastasis and affects the tumor immune cell microenvironment in colorectal cancer by regulating SATB2", MOLECULAR CANCER, vol. 18, no. 1, 6 September 2019 (2019-09-06), XP093080531, Retrieved from the Internet <URL:http://link.springer.com/article/10.1186/s12943-019-1063-6/fulltext.html> DOI: 10.1186/s12943-019-1063-6 *
YASUI ET AL., NATURE, vol. 419, 2002, pages 641
YU ET AL., OMICS, vol. 16, 2012, pages 284
YU WEI ET AL: "SATB2/[beta]-catenin/TCF-LEF pathway induces cellular transformation by generating cancer stem cells in colorectal cancer", SCIENTIFIC REPORTS, vol. 7, no. 1, 9 September 2017 (2017-09-09), XP055879831, Retrieved from the Internet <URL:https://www.nature.com/articles/s41598-017-05458-y.pdf> DOI: 10.1038/s41598-017-05458-y *
ZARATEFISH, AM. J. MED. GENET. A, vol. 173, 2017, pages 327
ZARETMANGO, CURR. OPIN. GENET. DEV., vol. 37, 2016, pages 76
ZENTNER ET AL., GENOME RES., vol. 21, 2011, pages 1273
ZHANG QIONG ET AL: "Loss of Satb2 in the Cortex and Hippocampus Leads to Abnormal Behaviors in Mice", FRONTIERS IN MOLECULAR NEUROSCIENCE, vol. 12, 12 February 2019 (2019-02-12), XP093080547, DOI: 10.3389/fnmol.2019.00033 *

Similar Documents

Publication Publication Date Title
Pepe-Mooney et al. Single-cell analysis of the liver epithelium reveals dynamic heterogeneity and an essential role for YAP in homeostasis and regeneration
de Reuver et al. ADAR1 interaction with Z-RNA promotes editing of endogenous double-stranded RNA and prevents MDA5-dependent immune activation
Tran et al. Differential toxicity of nuclear RNA foci versus dipeptide repeat proteins in a Drosophila model of C9ORF72 FTD/ALS
Chivukula et al. An essential mesenchymal function for miR-143/145 in intestinal epithelial regeneration
WO2018161009A1 (fr) Criblage crispr direct in vivo à médiation par aav dans le glioblastome
KR102138131B1 (ko) 뇌 종양 동물 모델 및 이의 제조 방법
US20220389393A1 (en) Compositions and methods for editing of the cdkl5 gene
US20170191057A1 (en) Rna editing biomarkers for diagnosis, pharmacological screening and prognostication in cancer
JP2022078058A (ja) ゲノム編集方法
Goga et al. miR-802 regulates Paneth cell function and enterocyte differentiation in the mouse small intestine
Liu et al. Large-scale multiplexed mosaic CRISPR perturbation in the whole organism
Miki et al. TERT promoter C228T mutation in neural progenitors confers growth advantage following telomere shortening in vivo
Dai et al. Crosstalk between microglia and neural stem cells influences the relapse of glioblastoma in GBM immunological microenvironment
Alexanian et al. Chromatin remodeling drives immune-fibroblast crosstalk in heart failure pathogenesis
Saw et al. The fusion partner specifies the oncogenic potential of NUP98 fusion proteins
US20230392145A1 (en) Promoting nutrient absorption through the colon
US20210155959A1 (en) Compositions and methods for somatic cell reprogramming and modulating imprinting
WO2023239609A1 (fr) Promotion de l&#39;absorption de nutriments par le colon
US20230035298A1 (en) Cultures of and methods of manufacturing squamous cell carcinoma cells
JP2022543589A (ja) Ｋｌｆ誘導心筋再生
CN113832234A (zh) 细粒棘球绦虫原头节源和囊液源外泌体非编码rna表达谱分析方法及非编码rna序列
Wu et al. Epigenetically silencing gluconeogenic enzyme PCK1 by EZH2 promotes renal tubulointerstitial fibrosis
WO2018169900A1 (fr) Marquage, isolement et analyse de l&#39;arn de populations cellulaires rares
Keane Molecular and genetic studies of DLG2 in neuroblastoma and colorectal cancer
Castro Neurogenetic Function of Host Cell Factor-1

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23735902

Country of ref document: EP

Kind code of ref document: A1