WO2023234750A1

WO2023234750A1 - Variant polypeptide having xylanase activity

Info

Publication number: WO2023234750A1
Application number: PCT/KR2023/007642
Authority: WO
Inventors: 이수린; 최은정; 양태주
Original assignee: 씨제이제일제당 (주)
Priority date: 2022-06-03
Filing date: 2023-06-02
Publication date: 2023-12-07
Also published as: KR20230167903A

Abstract

The present application relates to a variant polypeptide having xylanase activity, and a use thereof.

Description

Variant polypeptide with xylanase activity

This application relates to variant polypeptides having xylanase activity and their uses.

Xylanase (EC 3.2.1.8) is a hydrolytic enzyme that randomly decomposes the β-1,4 backbone of xylan, a plant cell wall component. Xylanases are mainly used to decompose biomass in fields such as animal feed, baking, and pulp bleaching (Beg QK, Kapoor M, Mahajan L, Hoondal GS. Microbial xylanases and their industrial applications: a review . Appl Microbiol Biotechnol. 2001 Aug;56(3-4):326-38. doi: 10.1007/s002530100704. PMID: 11548999.)

In this way, for the convenience of use of xylanase used in various fields, resistance and activity under harsh conditions (high temperature, basic conditions) are required, but most xylanases are used under low pH conditions (4.0 ~ 6.0) and Due to low thermal stability, it is difficult to apply to various fields.

One object of the present application is to provide a variant polypeptide having xylanase activity.

Another object of the present application is to provide a composition containing the variant polypeptide.

Another object of the present application is to provide a use of the variant polypeptide or the composition for reaction with a xylan-containing material.

Another object of the present application is a xylan-containing material, comprising contacting the variant polypeptide, a host cell expressing the variant polypeptide, and/or a composition comprising the variant polypeptide with a xylan-containing material. disassembly method; and/or to provide a method for producing xylooligosaccharide and/or xylose.

Another object of the present application is a polynucleotide encoding the variant polypeptide; A nucleic acid structure containing the polynucleotide; A vector containing the polynucleotide or nucleic acid structure; and/or providing a host cell containing the polynucleotide, nucleic acid construct, or vector.

Another object of the present application is to provide a method for producing the variant polypeptide.

The variant polypeptide having xylanase activity of the present application can be usefully used in various industrial fields.

Figures 1 to 3 show the results of confirming the thermal stability of the variant polypeptide of the present application.

One aspect of the present application is a variant polypeptide having xylanase activity.

As one specific example, i) the variant polypeptide is a polypeptide having at least 70% but less than 100% sequence identity with SEQ ID NO: 1; and/or

ii) the variant polypeptide is a polypeptide encoded by a polynucleotide having 70% or more but less than 100% sequence identity with the sequence encoding the mature polypeptide of SEQ ID NO: 1; and/or

iii) the variant polypeptide is low stringency with (a) the mature polypeptide coding sequence of SEQ ID NO: 1, (b) its cDNA, or (c) the full-length complement of (a) or (b). is a polypeptide encoded by a polynucleotide that hybridizes under low stringency conditions, medium stringency conditions, medium stringency conditions, high stringency conditions, or very high stringency conditions; and/or

iv) the variant polypeptide is a functional fragment of i), ii) or iii) polypeptide having xylanase activity; and

The variant polypeptide contains a substitution of the amino acid at position 147 with another amino acid:

Here, the position number corresponds to the position of the polypeptide of SEQ ID NO: 1.

In one of the above embodiments, the amino acid at position 147 before the modification may be histidine.

As one of the above embodiments, the variant polypeptide may include substitution of amino acid 147 with arginine or lysine.

In any one of the above embodiments, the variant polypeptide may contain a substitution of any one or more of the amino acids corresponding to positions 46 and 93 of SEQ ID NO: 1.

In any one of the above embodiments, the amino acid at position 46 before the modification is glutamic acid (E); And/or amino acid 93 may be asparagine (N).

In any one of the above embodiments, the variant polypeptide may include any one or more of the following modifications:

Substitution of amino acid 46 to cysteine; and

Substitution of amino acid number 93 with tryptophan, where the position number corresponds to the position of the polypeptide of SEQ ID NO: 1.

In any one of the above embodiments, the variant polypeptide may include the following substitutions:

E46C;

N93W; or

E46C+N93W;

As one of the above embodiments, the variant polypeptide may contain a substitution of any one or more of the amino acids corresponding to numbers 28 and 52 of SEQ ID NO: 1.

In one of the above embodiments, amino acid number 28 or amino acid number 52 before the modification may be asparagine (N).

Substitution of amino acid 28 to alanine (A), glycine (G), or serine (S); and

Substitution of amino acid number 93 with proline (P), alanine (A) or glutamic acid (E), where the position number corresponds to the position of the polypeptide of SEQ ID NO: 1.

N28A/G/S;

N52P/A/E; or

N28A/G/S + N52P/A/E;

In any one of the above embodiments, the variant polypeptide may include a pair of amino acids forming a disulfide bridge.

In any one of the above embodiments, the amino acid pair forming the disulfide bridge may include substitution of amino acids corresponding to numbers 3 and 36 of SEQ ID NO: 1 with cysteine.

In one of the above embodiments, the variant polypeptide may include a modification in which amino acid pairs 3 and 36 form a disulfide bridge.

In one of the above embodiments, the variant polypeptide may have increased heat resistance and/or heat stability compared to the polypeptide consisting of the amino acid sequence of SEQ ID NO: 1.

Another aspect of the present application is a composition for reaction with a xylan-containing material containing the variant polypeptide of the present application and/or the variant polypeptide of the present application.

Another aspect of the present application is the use of the variant polypeptide and/or a composition comprising the variant polypeptide for reaction with a xylan-containing material.

Another aspect of the present application includes contacting a xylan-containing material with the variant polypeptide, a host cell expressing the variant polypeptide, and/or a composition comprising the variant polypeptide, and/or xylose and/ Or, it is a method of producing xylo-oligosaccharide.

Another aspect of the present application is a xylan-containing material, comprising treating the variant polypeptide, a host cell expressing the variant polypeptide, and/or a composition containing the variant polypeptide to a xylan-containing material. This is a method of disassembling.

Another aspect of the present application is a polynucleotide encoding the variant polypeptide.

Another aspect of the present application is a nucleic acid structure containing the polynucleotide.

Another aspect of the present application is a vector containing the polynucleotide or the nucleic acid structure.

Another aspect of the present application is a host cell containing the variant polypeptide, the polynucleotide, the nucleic acid construct, and/or the vector.

Another aspect of the present application is a method for producing a variant polypeptide, comprising culturing the host cell.

The specific details for carrying out the invention are as follows. Meanwhile, each description and embodiment disclosed in the present application may also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. Additionally, the scope of the present application cannot be considered limited by the specific description described below.

Additionally, those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments described herein. Additionally, such equivalents are intended to be incorporated into this application.

As used in the specification of this application and the appended claims, the singular articles “a”, “an”, and “the” include plural references unless the context clearly dictates otherwise. Unless the context clearly dictates otherwise, singular terms include plural terms and plural terms include the singular. In the specification and appended claims of this application, unless otherwise stated, the use of “or” may be used to mean “and/or.”

In this application, the term “about” may appear before a specific numeric value. As used in this application, the term “about” includes not only the exact number written after the term, but also a range that is approximately that number or close to that number. By considering the context in which the number is presented, one can determine whether it is close to or close to the specific number mentioned. As an example, the term “about” may refer to a range of -10% to +10% of a numeric value. As another example, the term “about” may refer to a range of -5% to +5% of a given numeric value. However, it is not limited to this.

In this application, the terms “first, second, third…” “i), ii), iii)…” or “(a), (b), (c), (d)…” refer to Used to distinguish similar configurations, these terms are not intended to be performed sequentially or in sequence. For example, when the term is used in connection with steps in a method, use, or analysis, the steps may be performed simultaneously, with no time interval, or may be performed in seconds, minutes, hours, days, or Alternatively, it may be performed several months apart.

In this application, the term “consisting essentially of” means that an unspecified component may be present if the characteristics of the subject matter claimed in the present application are not substantially affected by the presence of the unspecified component.

In this application, the term “consisting of” means that the proportion of a particular component(s) totals 100%. Ingredients or features that follow the term “consisting of” may be essential or obligatory. In some embodiments, in addition to the components or features listed below as “consisting of” any other optional or non-essential components may be excluded.

In this application, the term “comprising” means the presence of a feature, step, or component described below the term, and does not exclude the presence or addition of one or more features, steps, or components. Components or features described below as “including” in this application may be essential or mandatory, but in some embodiments, other optional or non-essential components or features may be further included.

In this application, the term “comprising” may, in some embodiments, be modified to refer to “consisting essentially of” or “consisting of.”

With respect to amino acid sequences in this application, a polypeptide “comprising” an amino acid sequence set forth in a specific SEQ ID NO, a polypeptide “consisting of” an amino acid sequence set forth in a specific SEQ ID NO, or a polypeptide “having” an amino acid sequence set forth in a specific SEQ ID NO, or Even if it is described as a protein, if it has the same or corresponding activity as a polypeptide consisting of the amino acid sequence of the corresponding sequence number, a protein with an amino acid sequence in which part of the sequence is deleted, modified, substituted, conservatively substituted, or added is also included in the present application. It is obvious that it can be used. For example, if the amino acid sequence has a sequence added to the N-terminus and/or C-terminus that does not change the function of the protein, a naturally occurring mutation, a silent mutation, or a conservative substitution. However, it is not limited to this.

In this application, the term “protein” or “polypeptide” refers to a polymer or oligomer of consecutive amino acid residues. In this application, “polypeptide,” “protein,” and “peptide” may be used interchangeably with “amino acid sequence.”

In some cases, the amino acid sequence that exhibits activity may be referred to as an “enzyme.” In this application, amino acid sequences are described in N-terminal to C-terminal orientation, unless otherwise indicated.

With respect to cells, nucleic acids, polypeptides, or vectors, the term "recombinant" in this application means that a cell, nucleic acid, polypeptide, or vector is modified by introduction of a heterologous nucleic acid or polypeptide or alteration of a natural nucleic acid or polypeptide; Or it means that the cell is derived from a cell so modified. Thus, for example, a recombinant cell may express genes not found within the native (non-recombinant) form of the cell, or may express native genes that are expressed or not expressed at all, or are otherwise abnormally expressed.

In this application, the term “isolated” refers to a substance that exists in an environment in which it does not occur naturally or in a form in which it does not exist naturally. This includes the substance (sequence, enzyme or nucleic acid) being at least substantially free from at least one other component with which it is naturally associated in nature and having the same substance as it is found in nature, e.g. the sequence, enzyme or nucleic acid. .

For example, the isolated sequences, enzymes or nucleic acids provided herein may be provided in a form substantially free of one or more contaminants.

Examples of isolated substances include i) any substance that is non-naturally occurring, ii) any substance from which one, more, or all naturally occurring components that are associated in nature have been removed. a substance (e.g. an enzyme, variant, nucleic acid, protein, peptide or cofactor), iii) any substance that has been artificially modified from a substance found in nature, or iv) any other naturally occurring component. It may include a substance that has been modified to change the amount of the substance compared to that of the substance (e.g., increasing the number of copies of a gene encoding a specific substance; modifying a promoter naturally linked to the gene encoding a specific substance to a more active promoter, etc.). However, it is not limited to this.

In this application, the term “wild type” means naturally-occurring without artificial modification. When the term “wild type” is used in relation to a polypeptide, it means a naturally occurring polypeptide that does not have artificial mutations (substitutions, insertions, deletions, etc.) at one or more amino acid positions. Similarly, when the term “wild type” is used in reference to a polynucleotide, it means not having artificial modifications (substitutions, insertions, deletions) of one or more nucleotides. However, polynucleotides encoding wild-type polypeptides are not limited to native polynucleotides, and also include sequences encoding any wild-type polypeptides.

In this application, parent sequence or backbone refers to a reference sequence that becomes a variant polypeptide by introducing modifications. That is, the parent sequence is a starting sequence and may be a target for introducing mutations such as substitution, insertion, and/or deletion. The parent sequence may be naturally occurring or wild type, or may be a variant in which one or more substitutions, insertions, or deletions occur in the natural or wild type, or may be an artificially synthesized sequence. there is. If the parent sequence is an amino acid sequence showing activity, that is, an amino acid sequence of an enzyme, it may be referred to as a parent enzyme.

In this application, the term “reference sequence” refers to a sequence used to determine the position of an amino acid in any amino acid sequence. By aligning an arbitrary amino acid sequence with a reference sequence, the position of the amino acid corresponding to a specific position in the reference sequence can be determined within the arbitrary amino acid sequence.

In this application, with respect to an amino acid or nucleic acid sequence, the term "fragment" means a portion of the parent sequence. For example, it may be a polypeptide in which one or more amino acids from the parent sequence have been removed from the C or N terminus.

In this application, a “fragment” of an enzyme may refer to a “functional fragment.” “Functional fragment” may also be referred to as an active fragment, and refers to a polypeptide that is part of the parent enzyme and has the enzymatic activity of the parent enzyme. For example, a functional fragment of an enzyme may include the active site (catalytic site) of the enzyme.

Fragments of enzymes may include part of the full length of the parent enzyme. For example, amino acids of at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or less than 100% of the total length of the parent enzyme. It may include, but is not limited to.

In this application, “mutating/modifying” means changing or altering. This may be a change from what occurs naturally. In one example, an enzyme can be altered in a way that causes the enzyme to change from its parent or reference sequence.

In the present application, the modified enzyme may be an enzyme that does not exist in nature, that is, is non-naturally occurring.

As used herein, the term “modified” means changed, for example from its naturally occurring form. Modified enzymes of the present application include enzymes that do not occur naturally or naturally occurring variants. As an example, the modified enzyme of the present application is a modified enzyme not found in nature. As an example, the modified enzyme of the present application may not be generated spontaneously, but is not limited thereto.

In this application, when the term "modification" is used in relation to an amino acid/nucleic acid sequence, it refers to the substitution of an amino acid/nucleic acid residue of the parent sequence for a different amino acid/nucleic acid residue at one or more sites in the amino acid sequence. Deletion of an amino acid/nucleic acid residue (or series of amino acid/nucleic acid residues) of the parent sequence at one or more sites, insertion of an amino acid/nucleic acid residue (or series of amino acid/nucleic acid residues) of the parent sequence at one or more sites , truncation of the N-terminal and/or C-terminal amino acid sequences or 5' and/or 3' nucleic acid sequences, and any combination thereof.

As used herein, a “variant” or “modified polypeptide” of an enzyme refers to a protein in which one or more amino acids differ from the parent enzyme by conservative substitution and/or modification. do. “Variant” or “variant polypeptide” may be used interchangeably. The variant or variant polypeptide may be non-naturally occurring, but is not limited thereto.

The variant differs from the sequence of the parent enzyme by one or more modifications, such as amino acid substitutions, deletions and/or insertions.

Such variants can generally be identified by modifying one or more amino acids in the parent enzyme and evaluating the properties of the modified protein. That is, the ability of the variant may be increased, unchanged, or decreased compared to the parent enzyme.

Additionally, some variants may include variant polypeptides in which one or more parts, such as the N-terminal leader sequence or transmembrane domain, have been removed.

Other variants may include variants with portions removed from the N- and/or C-terminus of the mature protein.

The term "variant" or "variant polypeptide" may be used interchangeably with terms such as variant, modification, mutated protein, mutation, etc. (English expressions include modification, modified protein, mutant, mutein, divergent, variant, etc.). If the term is used in a modified sense, it is not limited thereto.

Variants may include deletions or additions of amino acids that have minimal effect on the properties and secondary structure of the polypeptide. For example, the polypeptide can be conjugated with a signal (or leader) sequence at the N-terminus of the protein that is involved in the transfer of the protein co-translationally or post-translationally. The polypeptide may also be conjugated with other sequences or linkers to enable identification, purification, or synthesis of the polypeptide.

In this application, the term “conservative substitution” means replacing one amino acid with another amino acid having similar structural and/or chemical properties. These amino acid substitutions may generally occur based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or amphipathic nature of the residues.

Throughout this application, the customary one- and three-letter codes for naturally occurring amino acids are used. Additionally, amino acids referred to by abbreviations in this application are described according to the IUPAC-IUB nomenclature.

Alanine Ala, A Arginine Arg, R

Asparagine Asn, N Aspartic acid Asp, D

Cysteine Cys, C Glutamic acid Glu, E

Glutamine Gln, Q Glycine Gly, G

Histidine His, H Isoleucine Ile, I

Leucine Leu, L Lysine Lys, K

Methionine Met, M Phenylalanine Phe, F

Proline Pro, P Serine Ser, S

Threonine Thr, T Tryptophan Trp, W

Tyrosine Tyr, Y Valine Val, V

Meanwhile, any amino acid can be written as Xaa or X.

Additionally, the generally accepted three-letter designation for naturally occurring amino acids as well as other amino acids such as Aib (2-Aminoisobutyric acid), Sar (N-methylglycine), α-methyl-glutamic acid, etc. Code may be used.

Amino acids can generally be classified based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or amphipathic nature of the residues. Thus, amino acid substitutions may generally occur based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or amphipathic nature of the residues.

For example, among amino acids with electrically charged side chains, positively charged (basic) amino acids include arginine, lysine, and histidine, and negatively charged (acidic) amino acids include glutamic acid and aspartic acid. Contains; Among amino acids with uncharged side chains, nonpolar amino acids include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, and proline, and are polar or hydrophilic ( Hydrophilic amino acids include serine, threonine, cysteine, tyrosine, asparagine, and glutamine, and among the non-polar amino acids, aromatic amino acids include phenylalanine, tryptophan, and tyrosine.

In this application, the term “gene” refers to a polynucleotide that encodes a polypeptide and a polynucleotide that includes regions before and after the coding region. In some embodiments, a gene may have sequences (introns) inserted between each coding region (exons).

In this application, the term “homology” or “identity” refers to the degree to which two given amino acid sequences or base sequences are related and may be expressed as a percentage. The terms homology and identity can often be used interchangeably.

The sequence homology or identity of a conserved polynucleotide or polypeptide is determined by standard alignment algorithms, and may be used with a default gap penalty established by the program used. Substantially homologous or identical sequences generally undergo moderate or high stringency conditions along the entire sequence or at least about 50%, 60%, 70%, 80%, or 90% of the full-length. It can hybridize under stringent conditions. It is obvious that hybridization also includes polynucleotides containing common codons or codons taking codon degeneracy into account.

Whether any two polynucleotide or polypeptide sequences have homology, similarity, or identity can be determined, for example, by Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: It can be determined using a known computer algorithm such as the "FASTA" program using default parameters as in 2444. Or, as performed in the Needleman program in the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later), It can be determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) (GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop , [ed.,] Academic Press, San Diego, 1994, and [CARILLO et al.] (1988) SIAM J Applied Math 48: 1073. For example, BLAST from the National Center for Biotechnology Information Database, or ClustalW can be used to determine homology, similarity, or identity, but is not limited to this.

Homology, similarity or identity of polynucleotides or polypeptides is defined in, for example, Smith and Waterman, Adv. Appl. Math (1981) 2:482, see, for example, Needleman et al. (1970), J Mol Biol. This can be determined by comparing sequence information using a GAP computer program such as 48:443. In summary, a GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly aligned symbols (i.e., nucleotides or amino acids). The default parameters for the GAP program are (1) the unitary matrix (containing values 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation , pp. 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: Weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) permutation matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or a gap opening penalty of 10 and a gap extension penalty of 0.5); and (3) no penalty for end gaps.

In addition, whether any two polynucleotide or polypeptide sequences have homology, similarity, or identity can be confirmed by comparing the sequences by Southern hybridization experiments under defined stringent conditions, and the appropriate hybridization conditions defined are within the scope of the relevant technology. , methods well known to those skilled in the art (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York), but is not limited thereto.

As used herein, the term “mature polypeptide” refers to a polypeptide in a form without a signal sequence or propeptide sequence. A mature protein/polypeptide/peptide may be a functional form of a protein/polypeptide/peptide. The mature polypeptide may be in its final form after translation or through post-translational modifications. Examples of post-translational modifications include, but are not limited to, N- or C-terminal modifications, glycosylation, phosphorylation, and leader sequence removal.

In this application, the term "nucleic acid construct" means a nucleic acid construct that contains one or more regulatory sequences and is artificially synthesized, engineered to contain a specific sequence in a way that does not exist in nature, or derived from nature. It refers to an isolated single- or double-stranded nucleic acid molecule.

As used herein, the term “expression” includes, but is not limited to, any step involved in the production of a polypeptide, such as transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

As used herein, the term “expression vector” refers to a linear or circular nucleic acid molecule containing a coding sequence and a regulatory sequence operably linked for expression thereof.

As used herein, the term “operably linked” refers to a configuration in which a control sequence is placed in an appropriate position so that the control sequence directs the expression of the coding sequence. Accordingly, “operably linked” means that a regulatory region of a functional domain with known or desired activity, such as a promoter, terminator, signal sequence, or enhancer region, controls the expression, secretion, or function of a target (gene or polypeptide). It includes being attached to or connected to the target so that it can be adjusted according to the desired activity.

In this application, the term “cDNA” refers to a DNA sequence that can be prepared through reverse transcription from a mature, spliced mRNA molecule obtainable from eukaryotic or prokaryotic cells. The cDNA sequence does not contain intron sequences that may be present in the corresponding genomic DNA. The initial primary RNA transcript is a precursor to mRNA before it is processed through a series of steps, including splicing, to emerge as the mature spliced mRNA.

In this application, the term “regulatory sequence” refers to a polynucleotide sequence required for the expression of a coding sequence. Each regulatory sequence may be native (identical in origin) or foreign (derived from a different gene) to the coding sequence. Examples of the regulatory sequences include a leader sequence, a polyadenylation sequence, a propeptide sequence, a promoter, a signal peptide sequence, an operator sequence, a sequence encoding a ribosome binding site, and a sequence that regulates transcription and translation termination. Includes sequence. The minimum unit of the regulatory sequence may include a promoter, transcription and translation termination sequences.

To describe the variants provided in this application, the following nomenclature is used.

In the present application, referring to a specific position of an amino acid sequence may include referring to an amino acid present or substituted at that position. Referring to amino acids at specific positions can be written in various ways. For example, “position 003” can be written as “position 3”, “amino acid 3”, and “amino acid 3”. Also, for example, if the amino acid at the 3rd position is arginine (R), it can be written as “R3” or “Arg3”.

Substitution of amino acids can be expressed by listing the amino acid before substitution, the position, and the amino acid to be replaced. The amino acids can be expressed using conventional one-letter and three-letter codes. For example, if serine, the amino acid at position 5 of a specific sequence, is replaced with cysteine, it can be written as “S5C” or “Ser5Cys.”

Any amino acid at a particular position may be designated “X”. For example, X6 refers to any amino acid at position 6. Additionally, when the amino acid to be substituted is denoted by For example, “V6X” indicates that V at position 6 is replaced by any amino acid other than V.

Different alterations can be expressed by simultaneously listing several types of amino acids using the symbols “/” or “,”. For example, if the amino acid (F) at position 20 is replaced with S or C, it can be written interchangeably as F20S/C or F20S,C. As another example, F/S20C means that the amino acid F or S at position 20 before substitution is replaced with C.

Multiple mutations can be written using “+”. For example, descriptions such as “R3C+T36C” mean that arginine, the amino acid at position 3, is replaced with cysteine, and threonine, the amino acid at position 8, is replaced with cysteine, respectively.

As used herein, the term “corresponding to” refers to an amino acid residue at a recited position in a protein or polypeptide, or to an amino acid residue that is similar, identical, or homologous to a recited residue in a protein or polypeptide. Identifying the amino acid at the corresponding position may be determining the specific amino acid in the sequence that refers to the specific sequence. As used herein, “corresponding region” generally refers to a similar or corresponding position in a related or reference protein.

In this application, SEQ ID NO: 1 can be used as a reference sequence to determine the position of an amino acid in any amino acid sequence.

That is, SEQ ID NO: 1 disclosed in the present application can be used to determine the corresponding amino acid residue in a polypeptide having any xylanase activity, and unless otherwise specified in the present application, the residue of a specific amino acid sequence is SEQ ID NO: Numbered based on 1.

For example, an arbitrary amino acid sequence can be aligned with SEQ ID NO: 1, and based on this, each amino acid residue in the amino acid sequence can be numbered with reference to the numerical position of the amino acid residue corresponding to the amino acid residue in SEQ ID NO: 1. . For example, sequence alignment algorithms such as those described in this application can identify the positions of amino acids or where modifications such as substitutions, insertions, or deletions occur compared to a query sequence (also referred to as a “reference sequence”).

These alignments include the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) and the Needle program in the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000). , Trends Genet. 16: 276-277), etc. can be used, but are not limited thereto.

Additionally, multiple sequence alignment can be used to identify corresponding amino acid residues in other xylanases. Examples of multiple sequence alignment programs known in the art include MUSCLE (multiple sequence comparison by log-expectation; version 3.5 or higher; Edgar, 2004, Nucleic Acids Research 32: 1792-1797), MAFFT (version 6.857 or higher; Katoh and Kuma, 2002) , Nucleic Acids Research 30: 3059-3066; Katoh et al., 2005, Nucleic Acids Research 33: 511-518; Katoh and Toh, 2007, Bioinformatics 23: 372-374; Katoh et al., 2009, Methods in Molecular Biology 537: 39-64; Katoh and Toh, 2010, Bioinformatics 26: 1899-1900) and EMBOSS EMMA (1.83 or higher; Thompson et al., 1994, Nucleic Acids Research 22: 4673-4680) using ClustalW, etc. There are, and the basic parameters of each of the above programs can be used, but are not limited thereto.

In addition, in cases where enzymes diverged from the mature polypeptide of SEQ ID NO: 1 cannot detect their relationship through conventional sequence-based comparison, other pairwise sequence comparison algorithms can be used (Lindahl and Elofsson, 2000, J. Mol. Biol. 295: 613-615). Higher sensitivity can be achieved in sequence-based searches by using search programs that utilize probabilistic representations of polypeptide families (profiles) to search databases. For example, the PSI-BLAST program can generate profiles through an iterative database search process and detect low-related homologs (Atschul et al., 1997, Nucleic Acids Res. 25: 3389-3402). Even greater sensitivity can be achieved if the family or superfamily for the polypeptide has more than one representation in the protein structure database. Programs such as GenTHREADER (Jones, 1999, J. Mol. Biol. 287: 797-815; McGuffin and Jones, 2003, Bioinformatics 19: 874-881) use neural networks to predict structural folding for a query sequence. It uses information from a variety of sources such as PSI-BLAST, secondary structure predictions, structural alignment profiles, and solvation potentials as input. Similarly, to align sequences of unknown structure with superfamily models present in the SCOP database, Gough et al., 2000, J. Mol. Biol. The method of 313:903-919 may be used. These alignments can in turn be used to create homology models for the polypeptides, and these models can be evaluated for accuracy using a variety of tools developed for that purpose.

For proteins of known structure, several tools and resources are available to search for and create structural alignments. For example, the SCOP superfamily of proteins has been structurally aligned, and this alignment is accessible and downloadable. The structures of two or more proteins can be arranged in various ways, such as distance alignment matrix (Holm and Sander, 1998, Proteins 33: 88-96) or combinatiorial extension (CE) Shindyalov and Bourne, 1998, Protein Engineering 11: 739-747. They can be sorted using an algorithm. Implementations of these algorithms can be further used to query structural databases with the target structure to discover possible structural homologs (Holm and Park, 2000, Bioinformatics 16: 566-567).

The above methods are examples and are not limited thereto.

Hereinafter, specific examples of the present application will be described in more detail as follows.

In this application, xylanase refers to an enzyme that catalyzes the endohydrolysis of the 1,4-beta-D-xylosidic bond in xylan. As an example, it may be an enzyme with an EC number of 3.2.1.8, but is not limited thereto.

In this application, xylanase activity can be measured and evaluated using methods known in the art, including the embodiments described in this application.

In this application, “Parent xylanase” refers to a xylanase to which modifications are made to produce a variant or variant polypeptide of the present application. Specifically, the parent xylanase, parent enzyme, or parent sequence may be a naturally occurring polypeptide or a wild-type polypeptide, may be a mature polypeptide thereof, and may include variants or functional fragments thereof, but may have xylanase activity. It is not limited thereto as long as it is a polypeptide that can be the parent of a variant.

The parent xylanase provided in the present application is not limited thereto, but may be the polypeptide of SEQ ID NO: 1. In addition, as long as it has xylanase activity, it is about 60%, 70%, and 75% similar to the polypeptide of SEQ ID NO: 1. 80%. It may be a polypeptide having a sequence identity of 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more, and if it has the same or corresponding activity as the polypeptide consisting of the amino acid sequence of SEQ ID NO: 1, it may be a polypeptide. It may be included in the scope of xylanase without limitation.

The parent xylanase of the variant provided in this application is Orpinomyces sp., Neocallimastix sp., Piromyces sp., Ruminococcus sp. It may be of origin. Specifically, Orpinomyces sp. It may be of origin.

Meanwhile, the above-described microorganism is an example of a microorganism from which the xylanase provided in the present application can be derived, and also includes those derived from microorganisms taxonomically homologous to the microorganism, regardless of the name of the microorganism.

The above-mentioned microorganisms can be obtained from known microorganism depositories such as ATCC, DSMZ, CBS, NRRL, KCTC, and KCCM.

In this application, sequences “derived from” a particular microorganism are not limited to those naturally produced or capable of being produced in that microorganism, and also include sequences encoded by genes produced and isolated from the microorganism containing that gene. do.

For example, Orpinomyces sp. Derived xylanase includes not only enzymes with xylanase activity naturally produced in microorganisms of the genus Orpinomyces, but also those produced by microorganisms of the genus Orpinomyces, and genetic modifications known in the art (e.g., sequences encoding the enzymes). It also includes those produced in other host cells through transformation.

In the present application, “variant polypeptide having xylanase activity” may be a variant of the parent xylanase.

In this application, the term “variant of the parent xylanase” or “xylanase variant” refers to a protein that differs in one or more amino acids from the amino acid sequence of the parent xylanase and has the activity of xylanase.

The terms “variant polypeptide having xylanase activity,” “variant of the parent xylanase,” and “xylanase variant” can be used interchangeably.

The variant provided in the present application may have xylanase activity and include modification of one or more amino acids in the parent xylanase sequence. The modification may be substitution of amino acids and/or formation of disulfide bonds.

In addition, i) the variant is a polypeptide having more than 70% but less than 100% sequence identity with SEQ ID NO: 1; and/or ii) the variant is a polypeptide encoded by a polynucleotide having at least 70% but less than 100% sequence identity with the sequence encoding the mature polypeptide of SEQ ID NO: 1; and/or iii) said variant has (a) the mature polypeptide coding sequence of SEQ ID NO: 1, (b) its cDNA, or (c) the full-length complement of (a) or (b). a polypeptide encoded by a polynucleotide that hybridizes under high stringency conditions, medium stringency conditions, medium stringency conditions, high stringency conditions, or very high stringency conditions; and/or iv) the variant may be a functional fragment of i), ii) or ii) polypeptide having xylanase activity.

Specifically, the variant provided in the present application may have xylanase activity and have one or more changed functions or characteristics compared to the parent xylanase, including modification of one or more amino acids in the parent xylanase sequence. there is.

In one embodiment, the variant provided in the present application has xylanase activity and has one or more changed functions or characteristics compared to the parent xylanase, including modification of one or more amino acids in the parent xylanase sequence. , may have one or more conservative substitutions.

The variant provided in this application is a variant of the parent xylanase and may be a polypeptide having xylanase activity.

As one specific example, the variant provided in the present application may include modification at a position corresponding to position 147 of SEQ ID NO: 1.

In the present application, the position number corresponds to the position of the polypeptide of SEQ ID NO: 1, and “corresponding” is as described above.

In one specific example, amino acid number 147 before modification of the variant provided in the present application may be histidine (H).

In one embodiment, the variant provided in the present application is G, A, V, L, I, M, F, W, P, S, T, C, Y of the amino acid corresponding to position 147 of SEQ ID NO: 1 , may include substitution with N, Q, D, E, K or R. Specifically, it may include substitution with D, E, K, or R, and more specifically, it may include substitution with K or R.

As one specific example, the variant provided in the present application may include substitution of the amino acid corresponding to position 147 of SEQ ID NO: 1 with an electrically charged amino acid.

As one specific example, the variant provided in the present application may include substitution of the amino acid corresponding to position 147 of SEQ ID NO: 1 with a basic amino acid.

In one embodiment, the variant provided in the present application may further include modifications at one or more positions corresponding to positions 46 and 93 of SEQ ID NO: 1.

As one specific example, the variant provided in the present application may include modification of amino acids corresponding to one or more of E46 and N93 of SEQ ID NO: 1.

In one specific example, amino acid 46 before modification of the variant provided in the present application is glutamic acid (E); And/or amino acid number 93 may be asparagine (N).

In one embodiment, the variant provided in the present application is G, A, V, L, I, M, F, W, P, S, T, C, Y of the amino acid corresponding to position 46 of SEQ ID NO: 1. , N, Q, D, K, R or H, and may specifically include substitution with S, T, C, Y, N or Q, and more specifically substitution with Q or C. may include.

In one embodiment, the variant provided in the present application is G, A, V, L, I, M, F, W, P, S, T, C, Y of the amino acid corresponding to position 93 of SEQ ID NO: 1. , Q, D, E, K, R or H, and specifically may include substitution with G, A, V, L, I, M, F, W, Y or H, More specifically, it may include substitution with W.

As one specific example, the variant provided in the present application may include substitution of the amino acid corresponding to position 46 of SEQ ID NO: 1 with a polar amino acid.

As one specific example, the variant provided in the present application may include substitution of the amino acid corresponding to position 93 of SEQ ID NO: 1 with a nonpolar or aromatic amino acid.

As one specific example, the variant provided in the present application may include one or more substitutions among E46C and N93W in SEQ ID NO: 1.

In one embodiment, the variants provided in this application may include the following substitutions:

E46C;

N93W; and

E46C + N93W.

In any one of the above-described embodiments, the variant provided in the present application may further include modifications at one or more positions corresponding to positions 28 and 52 of SEQ ID NO: 1.

In one embodiment, the variant provided in the present application is G, A, V, L, I, M, F, W, P, S, T, C, Y of the amino acid corresponding to position 28 of SEQ ID NO: 1 , Q, D, E, K, R or H, specifically G, A, V, L, I, M, F, W, P, S, T, C, Y or Q It may include substitution with, and more specifically, it may include substitution with A, G or S.

In one embodiment, the variant provided in the present application is G, A, V, L, I, M, F, W, P, S, T, C, Y of the amino acid corresponding to position 52 of SEQ ID NO: 1. , Q, D, E, K, R or H, specifically G, A, V, L, I, M, F, W, P, D, E, K, R or H It may include substitution with, and more specifically, it may include substitution with P, A or E.

As one specific example, the variant provided in the present application may include substitution of the amino acid corresponding to position 28 of SEQ ID NO: 1 with a hydrophobic or polar amino acid.

As one specific example, the variant provided in the present application may include substitution of the amino acid corresponding to position 52 of SEQ ID NO: 1 with a hydrophobic or acidic amino acid.

As one specific example, the variant provided in the present application may include one or more substitutions among N28A/G/S and N52P/A/E of SEQ ID NO: 1.

N28A/G/S;

N52P/A/E; or

N28A/G/S + N52P/A/E.

N28G;

N52P; or

N28G + N52P.

In any one of the above-described embodiments, the variant provided in the present application may include a pair of amino acids forming a disulfide bridge.

In any one of the above-described embodiments, the amino acid pair forming the disulfide bridge in the present application is at two or more positions among positions 3, 5, 20, 34, 36, and 41 of SEQ ID NO: 1. It may include substitution of the corresponding amino acid with cysteine.

In any one of the above-described embodiments, the variant provided in the present application may include two or more substitutions among R3C, S5C, F20C, S34C, T36C, and A41C of SEQ ID NO: 1.

In one embodiment, the variant provided in the present application may include one or more substitutions selected from the following:

R3C+T36C;

S5C+S34C;

F20C+A41C;

R3C+T36C+S5C+S34C;

R3C+T36C+F20C+A41C;

S5C+S34C+F20C+A41C;

R3C+T36C+S5C+S34C+F20C+A41C.

In any one of the above-described embodiments, the variant may include, but is not limited to, any one or more of the following substitutions i) to vi): i) substitution of amino acid number 3 with cysteine; ii) substitution of amino acid 5 to cysteine; iii) substitution of amino acid 20 with cysteine; iv) substitution of amino acid 34 to cysteine; v) substitution of amino acid 36 to cysteine; and vi) substitution of amino acid 41 with cysteine.

In any one of the above-described embodiments, the variant provided in the present application has amino acid pairs 3 and 36; Amino acid pair 5 and 34; And/or the amino acid pair 20 and 41 may be substituted with cysteine, so that the amino acid pair forms a disulfide bridge.

As one specific example, the variant provided in the present application may include modifications at positions 3 and 36 of SEQ ID NO: 1.

In any one of the above-described embodiments, the variant provided in the present application may include modifications of amino acids corresponding to R3 and T36 of SEQ ID NO: 1.

In any one of the above-described embodiments, the amino acid corresponding to position 3 of SEQ ID NO: 1 before modification provided in the present application is arginine (R); and/or the amino acid corresponding to position 36 may be threonine (T).

In any one of the above-described embodiments, the variant provided in the present application is G, A, V, L, I, M, F, W, P, S of the amino acid corresponding to position 3 of SEQ ID NO: 1 , T, C, Y, N, Q, D, E, K, or H, and may specifically include substitution with S, T, C, Y, N, or Q. Specifically, it may include substitution with C.

In any one of the above-described embodiments, the variant provided in the present application is G, A, V, L, I, M, F, W, P, S of the amino acid corresponding to position 36 of SEQ ID NO: 1 , C, Y, N, Q, D, E, K, R, or H, and may specifically include substitution with S, C, Y, N, or Q, and more specifically, It may include substitution with C.

In any one of the above-described embodiments, the variant provided in the present application may include substitution of the amino acid corresponding to position 3 of SEQ ID NO: 1 with a polar amino acid.

In any one of the above-described embodiments, the variant provided in the present application may include substitution of the amino acid corresponding to position 36 of SEQ ID NO: 1 with a polar amino acid.

In any one of the above-described embodiments, the variant provided in the present application may include the R3C and T36C substitutions of SEQ ID NO: 1.

In any one of the above-described embodiments, the variant provided in the present application includes substitution of amino acids corresponding to positions 3 and 36 of SEQ ID NO: 1 with cysteine, and between the two substituted amino acids It may be forming a disulfide bridge.

As one specific example, the variant provided in the present application may include modifications at positions 5 and 34 of SEQ ID NO: 1.

In any one of the above-described embodiments, the variant provided in the present application may include modifications of amino acids corresponding to S5 and S34 of SEQ ID NO: 1.

In any one of the above-described embodiments, the amino acid corresponding to position 5 of SEQ ID NO: 1 before modification provided in the present application is serine (S); and/or the amino acid corresponding to position 34 may be serine (S).

In any one of the above-described embodiments, the variant provided in the present application is G, A, V, L, I, M, F, W, P, T of the amino acid corresponding to position 5 of SEQ ID NO: 1 , C, Y, N, Q, D, E, K, R, or H, and may specifically include substitution with T, C, Y, N, or Q, and more specifically, It may include substitution with C.

In any one of the above-described embodiments, the variant provided in the present application is G, A, V, L, I, M, F, W, P, T of the amino acid corresponding to position 34 of SEQ ID NO: 1 , C, Y, N, Q, D, E, K, R, or H, and may specifically include substitution with T, C, Y, N, or Q, and more specifically, It may include substitution with C.

In any one of the above-described embodiments, the variant provided in the present application may include substitution of the amino acid corresponding to position 5 of SEQ ID NO: 1 with a polar amino acid.

In any one of the above-described embodiments, the variant provided in the present application may include substitution of the amino acid corresponding to position 34 of SEQ ID NO: 1 with a polar amino acid.

In any one of the above-described embodiments, the variant provided in the present application may include the S5C and S34C substitutions of SEQ ID NO: 1.

In any one of the above-described embodiments, the variant provided in the present application includes substitution of amino acids corresponding to positions 5 and 34 of SEQ ID NO: 1 with cysteine, and between the two substituted amino acids It may be forming a disulfide bridge.

As one specific example, the variant provided in the present application may include modifications at positions 20 and 41 of SEQ ID NO: 1.

In any one of the above-described embodiments, the variant provided in the present application may include modifications of amino acids corresponding to F20 and A41 of SEQ ID NO: 1.

In any one of the above-described embodiments, the amino acid corresponding to position 20 of SEQ ID NO: 1 before modification provided in the present application is phenylalanine (F); and/or the amino acid corresponding to position 41 may be alanine (A).

In any one of the above-described embodiments, the variant provided in the present application is G, A, V, L, I, M, W, P, S, T of the amino acid corresponding to position 20 of SEQ ID NO: 1 , C, Y, N, Q, D, E, K, R, or H, and may specifically include substitution with S, T, C, Y, N, or Q. Specifically, it may include substitution with C.

In any one of the above-described embodiments, the variant provided in the present application has G, V, L, I, M, F, W, P, S, T of the amino acid corresponding to position 41 of SEQ ID NO: 1. , C, Y, N, Q, D, E, K, R, or H, specifically with S, T, C, Y, N, or Q, and more specifically with C. can do.

In any one of the above-described embodiments, the variant provided in the present application may include substitution of the amino acid corresponding to position 20 of SEQ ID NO: 1 with a polar amino acid.

In any one of the above-described embodiments, the variant provided in the present application may include substitution of the amino acid corresponding to position 41 of SEQ ID NO: 1 with a polar amino acid.

In any one of the above-described embodiments, the variant provided in the present application may include the F20C and A41C substitutions of SEQ ID NO: 1.

In any one of the above-described embodiments, the variant provided in the present application includes substitution of amino acids corresponding to positions 20 and 41 of SEQ ID NO: 1 with cysteine, and between the two substituted amino acids It may be forming a disulfide bridge.

In one embodiment, the variants provided by this application include all possible combinations of the above-described modifications.

For example, the variant may include a modification of an amino acid at a position selected from the following in combination with the modifications described above:

147 + 28

147 + 52

147 + 46

147 + 93

147 + 3

147 + 36

147 + 28 + 52

147 + 28 + 46

147 + 28 + 93

147 + 28 + 3

147 + 28 + 36

147 + 52 + 46

147 + 52 + 93

147 + 52 + 3

147 + 52 + 36

147 + 46 + 93

147 + 46 + 3

147 + 46 + 36

147 + 93 + 3

147 + 93 + 36

147 + 3 + 36

147 + 28 + 52 + 46

147 + 28 + 52 + 93

147 + 28 + 52 + 3

147 + 28 + 52 + 36

147 + 28 + 46 + 93

147 + 28 + 46 + 3

147 + 28 + 46 + 36

147 + 28 + 93 + 3

147 + 28 + 93 + 36

147 + 28 + 3 + 36

147 + 52 + 46 + 93

147 + 52 + 46 + 3

147 + 52 + 46 + 36

147 + 52 + 93 + 3

147 + 52 + 93 + 36

147 + 52 + 3 + 36

147 + 46 + 93 + 3

147 + 46 + 93 + 36

147 + 46 + 3 + 36

147 + 93 + 3 + 36

147 + 28 + 52 + 46 + 93

147 + 28 + 52 + 46 + 3

147 + 28 + 52 + 46 + 36

147 + 28 + 52 + 93 + 3

147 + 28 + 52 + 93 + 36

147 + 28 + 52 + 3 + 36

147 + 28 + 46 + 93 + 3

147 + 28 + 46 + 93 + 36

147 + 28 + 46 + 3 + 36

147 + 28 + 93 + 3 + 36

147 + 52 + 46 + 93 + 3

147 + 52 + 46 + 93 + 36

147 + 52 + 46 + 3 + 36

147 + 52 + 93 + 3 + 36

147 + 46 + 93 + 3 + 36

147 + 28 + 52 + 46 + 93 + 3

147 + 28 + 52 + 46 + 93 + 36

147 + 28 + 52 + 46 + 3 + 36

147 + 28 + 52 + 93 + 3 + 36

147 + 28 + 46 + 93 + 3 + 36

147 + 52 + 46 + 93 + 3 + 36

147 + 28 + 52 + 46 + 93 + 3 + 36

As another example, the variant may include, but is not limited to, one or more modifications selected from the following:

H147K/R+N28A/G/S

H147K/R+N52P/A/E

H147K/R+E46C

H147K/R+N93W

H147K/R+R3C

H147K/R+T36C

H147K/R + N28A/G/S + N52P/A/E

H147K/R + N28A/G/S + E46C

H147K/R + N28A/G/S + N93W

H147K/R + N28A/G/S + R3C

H147K/R + N28A/G/S + T36C

H147K/R + N52P/A/E + E46C

H147K/R + N52P/A/E + N93W

H147K/R + N52P/A/E + R3C

H147K/R + N52P/A/E + T36C

H147K/R + E46C + N93W

H147K/R + E46C + R3C

H147K/R + E46C + T36C

H147K/R + N93W + R3C

H147K/R + N93W + T36C

H147K/R + R3C + T36C

H147K/R + N28A/G/S + N52P/A/E + E46C

H147K/R + N28A/G/S + N52P/A/E + N93W

H147K/R + N28A/G/S + N52P/A/E + R3C

H147K/R + N28A/G/S + N52P/A/E + T36C

H147K/R + N28A/G/S + E46C + N93W

H147K/R + N28A/G/S + E46C + R3C

H147K/R + N28A/G/S + E46C + T36C

H147K/R + N28A/G/S + N93W + R3C

H147K/R + N28A/G/S + N93W + T36C

H147K/R + N28A/G/S + R3C + T36C

H147K/R + N52P/A/E + E46C + N93W

H147K/R + N52P/A/E + E46C + R3C

H147K/R + N52P/A/E + E46C + T36C

H147K/R + N52P/A/E + N93W + R3C

H147K/R + N52P/A/E + N93W + T36C

H147K/R + N52P/A/E + R3C + T36C

H147K/R + E46C + N93W + R3C

H147K/R + E46C + N93W + T36C

H147K/R + E46C + R3C + T36C

H147K/R + N93W + R3C + T36C

H147K/R + N28A/G/S + N52P/A/E + E46C + N93W

H147K/R + N28A/G/S + N52P/A/E + E46C + R3C

H147K/R + N28A/G/S + N52P/A/E + E46C + T36C

H147K/R + N28A/G/S + N52P/A/E + N93W + R3C

H147K/R + N28A/G/S + N52P/A/E + N93W + T36C

H147K/R + N28A/G/S + N52P/A/E + R3C + T36C

H147K/R + N28A/G/S + E46C + N93W + R3C

H147K/R + N28A/G/S + E46C + N93W + T36C

H147K/R + N28A/G/S + E46C + R3C + T36C

H147K/R + N28A/G/S + N93W + R3C + T36C

H147K/R + N52P/A/E + E46C + N93W + R3C

H147K/R + N52P/A/E + E46C + N93W + T36C

H147K/R + N52P/A/E + E46C + R3C + T36C

H147K/R + N52P/A/E + N93W + R3C + T36C

H147K/R + E46C + N93W + R3C + T36C

H147K/R + N28A/G/S + N52P/A/E + E46C + N93W + R3C

H147K/R + N28A/G/S + N52P/A/E + E46C + N93W + T36C

H147K/R + N28A/G/S + N52P/A/E + E46C + R3C + T36C

H147K/R + N28A/G/S + N52P/A/E + N93W + R3C + T36C

H147K/R + N28A/G/S + E46C + N93W + R3C + T36C

H147K/R + N52P/A/E + E46C + N93W + R3C + T36C

H147K/R + N28A/G/S + N52P/A/E + E46C + N93W + R3C + T36C

Specifically, the variant containing the H147K substitution of SEQ ID NO: 1 is SEQ ID NO: 3, the variant containing the H147R substitution of SEQ ID NO: 1 is SEQ ID NO: 5, and the variant containing the R3C + T36C + N28G + N52P + H147R substitution is SEQ ID NO: 5. SEQ ID NO: 7, the variant containing the substitution R3C + T36C + N28G + N52P + H147K is SEQ ID NO: 9, the variant containing the substitution R3C + T36C + N28A + N52P + H147R is SEQ ID NO: 11, R3C + T36C + N28A The variant containing the substitution + N52P + H147K is SEQ ID NO: 13, the variant containing the substitution R3C + T36C + N52P + N93W + H147R is SEQ ID NO: 15, and the variant containing the substitution R3C + T36C + N52P + N93W + H147K is SEQ ID NO: 15. It may be represented by SEQ ID NO: 17.

In one embodiment, the variant provided in the present application is a parent xylanase; The mature polypeptide or functional fragment thereof and at least about 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, 93 It may have a sequence identity of % or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more and less than 100%.

In one embodiment, the variant provided in the present application is about 60% or more, for example, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more of SEQ ID NO: 1. , may have a sequence identity of 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more and less than 100%. .

In one embodiment, the variant provided in the present application is about 60% or more, for example, 65% or more, 70% or more, 75% or more, 80% or more, Sequences that are at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% and less than 100% It may be a polypeptide encoded by a polynucleotide having identity.

In one embodiment, the variant provided in the present application is (a) the mature polypeptide coding sequence of SEQ ID NO: 1, (b) its cDNA, or (c) the full-length complementary sequence of (a) or (b). -length complement) and a polynucleotide that hybridizes under low stringency conditions, medium stringency conditions, medium stringency conditions, high stringency conditions, or very high stringency conditions.

In one embodiment, the variant provided in the present application is a functional fragment of SEQ ID NO: 1 and about 60% or more, for example, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, Having a sequence identity of 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more and less than 100%. You can.

In one embodiment, the variant provided in the present application is about 60% or more, for example, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more of the nucleotide sequence represented by SEQ ID NO: 2. % or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more and less than 100% of the nucleic acid bases It may be a polypeptide encoded by a polynucleotide having sequence identity.

As one specific example, the variant provided in the present application may be any one of the polypeptides of SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, and 17.

In one embodiment, the variant provided in the present application is any one of the amino acid sequences of SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, and 17, at positions 147, 46, 93, and 28. The amino acid at one or more positions among amino acids 52, 3, and 36 is fixed, and is at least about 60%, for example, at least 65%, 70% of the amino acid sequence of SEQ ID NO, mature polypeptide or functional fragment thereof. % or more, 75% or more, 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more , it may be a polypeptide having more than 99% or 100% sequence identity.

Variants provided in the present application have at least one characteristic or property of the polypeptide that can be selected or detected compared to other xylanases, e.g., wild-type xylanase, parent xylanase, other xylanase variants, etc. It may have changed.

The above properties or properties include oxidative stability, substrate specificity, catalytic activity, thermal stability, alkali stability, pH activity profile, resistance to proteolysis, Km, k _cat , k _cat /Km ratio, protein folding, induction of immune response, Ability to bind to a ligand, ability to bind to a receptor, ability to be secreted, ability to display on the surface of cells, ability to form oligomers, ability to send signals, ability to promote cell proliferation, ability to inhibit cell proliferation, cell These include, but are not limited to, the ability to induce apoptosis, the ability to be modified by phosphorylation or glycosylation, and/or the ability to treat disease.

In one embodiment, the variant provided in this application may have increased heat resistance and/or heat stability compared to the parent sequence.

In this application, “enzymatic activity” refers to at least one catalytic activity. Specifically, it may be the conversion efficiency of the enzyme, mainly expressed as k _cat /Km, but is not limited thereto.

k _cat refers to the catalytic constant of conversion to a product in unit time by one enzyme when the enzyme is completely saturated with the substrate, and is also called the turnover number. Km is the substrate concentration when the reaction rate is half of the maximum value (Vmax).

Examples of ways to express enzyme activity include specific activity (umol of converted substrate x mg ^-1 x min ^-1 ) or volumetric activity (umol of converted substrate x mL ^-1 x min ^-1 ). .

However, defining enzyme activity is not limited to the above, and is defined by Irwin H. Segel, Enzyme kinetics, John Wiley & Sons, 1979; A. G. Marangoni, Enzyme kinetics, Wiley-Interscience, 2003; A. Fersht, Enzyme structure and mechanisms, John Wiley & Sons, 1981; Structure and Mechanism in Protein Science: A guide to enzyme catalysis and protein folding, Alan Fersht, W.H. Freeman, 1999; Based on what is known in Fundamentals of Enzyme Kinetics, Athel Cornish-Bowden, Wiley-Blackwell 2012 and Voet ef al., "Biochemie" [Biochemistry], 1992, VCH-Verlag, Chapter 13, pages 331-332 with respect to enzymatic activity, etc. Can be defined and evaluated.

In one embodiment, the variants provided in the present application are about 100%, about 110%, about 120%, about 130%, about 140%, about 150%, about 160%, about 170%, and about 180% compared to the parent enzyme. %, about 190%, or about 200% or more.

In another embodiment, the variant provided in the present application is about 99%, about 95%, about 90%, about 80%, about 70%, about 60%, about 50%, about 40%, or There may be reduced enzyme activity of about 20% or less.

In this application, the term “specific activity” refers to the activity of the enzyme per unit weight of protein and can be expressed as unit/mg. Protein quantification can be done using, for example, SDS-PAGE or Bradford assay.

Enzyme stability means that enzyme activity is preserved during storage or reaction time. To measure this change in stability, the initial enzyme activity is measured and compared at time zero (100%) and after a certain period of time (x%) under specified conditions to determine the level at which enzyme activity is lost or enzyme stability. It can be expressed.

Factors that affect enzyme activity include, for example, pH, heat, and the presence of other substances (e.g., oxidizing agents, chelating agents).

In this application, the term “pH stability” refers to the ability of a protein to function in a specific pH range. In one embodiment, the variant provided in the present application may be active at about pH 4.0 to about pH 12.0, but is not limited thereto.

If a protein maintains its function in a specific pH range, it can be defined as having “pH stability,” and depending on the pH range, it can be defined as having “acid resistance,” “alkali resistance,” etc.

In this application, the term “thermal stability” refers to the ability of a protein to function in a specific temperature range. In one embodiment, the variant provided in the present application may be active in the range from about 20°C to about 120°C, and may specifically be active in the range from about 60°C to about 100°C, but is not limited thereto. .

In this application, the term “thermal tolerance” refers to the ability of a protein to function after exposure to a certain temperature, for example, high heat or extremely low temperature. For example, a thermostable protein may not function at the temperature it is exposed to, but may become functional again when returned to the optimal temperature environment.

Increased stability may include maintaining high enzyme activity compared to other enzymes, e.g., the wild-type enzyme, the parent enzyme, and/or other variants; This includes increasing the range of pH, temperature and/or time over which the protein maintains its function.

Reduced stability may include maintaining lower enzyme activity compared to other enzymes, e.g., the wild-type enzyme, the parent enzyme, and/or other variants; This includes reducing the range of pH, temperature and/or time over which the protein maintains its function.

In this application, the term “substrate specificity” refers to the ability of an enzyme to identify the substrate and molecules that compete with the substrate. Substrate specificity can be determined by measuring the activity of the enzyme toward different substrates. In one specific example, the change in substrate specificity may be a change in the direction of increasing specificity for a substrate that can produce the desired product. In another embodiment, the change in substrate specificity may be a change in the direction of decreasing specificity for a substrate that can produce the desired product.

The changed characteristics of the variant provided in this application may be improved activity or activity suitable for application to various industrial fields including feed, baking, pulp bleaching, etc.

The polynucleotide encoding the variant of the present application may include the coding sequence of the variant described above. The polynucleotide may undergo various modifications to the coding region within the scope of not changing the amino acid sequence of the polypeptide due to codon degeneracy or in consideration of the preferred codon in the organism in which the polypeptide is to be expressed. .

In addition, the polynucleotide of the present application is a probe that can be prepared from a known genetic sequence, for example, a sequence encoding the variant of the present application by hybridizing under stringent conditions with a complementary sequence for all or part of the base sequence. It can be included without limitation.

The “stringent condition” refers to conditions that enable specific hybridization between polynucleotides. These conditions are described in, e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology. , John Wiley & Sons, Inc., New York).

For example, among polynucleotides with high homology or identity, 40% or more, specifically 90% or more, more specifically 95% or more, 96% or more, 97% or more, 98% or more, more specifically 99% or more. Conditions in which polynucleotides with homology or identity are hybridized and polynucleotides with less homology or identity do not hybridize, or washing conditions of normal southern hybridization, such as 60°C, 1ХSSC, 0.1% SDS. , specifically 60°C, 0.1ХSSC, 0.1% SDS, more specifically at a salt concentration and temperature equivalent to 68°C, 0.1ХSSC, 0.1% SDS, to list the conditions for washing once, specifically 2 to 3 times. You can.

Hybridization requires that two nucleic acids have complementary sequences, although mismatches between bases may be possible depending on the stringency of hybridization. The term “complementary” is used to describe the relationship between nucleotide bases that are capable of hybridizing to each other. For example, with respect to DNA, adenosine is complementary to thymine and cytosine is complementary to guanine. Accordingly, the polynucleotides of the present application may also include substantially similar nucleic acid sequences as well as isolated nucleic acid fragments that are complementary to the entire sequence.

Specifically, polynucleotides having homology or identity can be detected using hybridization conditions including a hybridization step at a Tm value of 55° C. and using the conditions described above. Additionally, the Tm value may be 60°C, 63°C, or 65°C, but is not limited thereto and may be appropriately adjusted by a person skilled in the art depending on the purpose.

The appropriate stringency to hybridize a polynucleotide depends on the length of the polynucleotide and the degree of complementarity, variables that are well known in the art (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8).

For example, “high stringency” occurs about 5 to 10° C. below the Tm of the probe; “Medium stringency” occurs approximately 10 to 20° C. below the Tm of the probe; “Low stringency” may occur, but is not limited to, approximately 20 to 25° C. below the Tm.

As an example, “low stringency conditions” are 5 Prehybridization and hybridization at 42°C, at 200 micrograms/ml of sperm DNA and 25% formamide. The carrier material can be finally washed 2 to 3 times for 15 minutes each using 2

As an example, “medium stringency conditions” are 5 Prehybridization and hybridization at 42°C, at 200 micrograms/ml of sperm DNA and 35% formamide. The carrier material may be finally washed 2 to 3 times for 15 minutes each using 2 "For probes at least 100 nucleotides long, in 5X SSPE, 0.3% SDS, sheared and denatured salmon sperm DNA at 200 micrograms/ml and 35% formamide, according to standard Southern blotting procedures, for 12-24 hours. This may be prehybridization and hybridization at 42°C. The carrier material can be finally washed 2 to 3 times for 15 minutes each using 1 to 2

As an example, “high stringency conditions” are 5 Prehybridization and hybridization at 42°C, in 200 micrograms/ml of salmon sperm DNA and 35% formamide. The carrier material can be finally washed 2 to 3 times for 15 minutes each using 2

The nucleic acid construct provided in the present application includes a polynucleotide encoding a variant provided in the present application, operably linked to one or more regulatory sequences that direct the expression of the coding sequence in an appropriate host cell under conditions suitable for the regulatory sequence. do.

Polynucleotides can be manipulated in a variety of ways to allow expression of variants. Depending on the expression vector, it may be desirable or necessary to manipulate the polynucleotide prior to inserting it into the vector. Such manipulation may use methods known in the art.

The "vector" provided in this application contains the base sequence of a polynucleotide encoding the variant operably linked to a suitable expression control region (or expression control sequence) so that the variant of the present application can be expressed in a suitable host. refers to a DNA product. The expression control region may include a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating termination of transcription and translation. After transformation into a suitable host cell, the vector can replicate or function independently of the host genome and can be integrated into the genome itself.

Vectors that can be used in this application are not particularly limited, and any vector known in the art can be used. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors, and pBR, pUC, and pBluescriptII series can be used as plasmid vectors. , pGEM-based, pTZ-based, pCL-based, pET-based, etc. can be used. Specifically, pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, and pCC1BAC vectors can be used.

For example, a polynucleotide encoding the variant provided in this application can be inserted into a chromosome through a vector for intracellular chromosome insertion. Insertion of the polynucleotide into the chromosome may be accomplished by any method known in the art, for example, homologous recombination, but is not limited thereto. A selection marker may be additionally included to confirm whether the chromosome has been inserted. A selection marker is used to select cells transformed with a vector, that is, to confirm the insertion of a target nucleic acid molecule, and to impart selectable phenotypes such as drug resistance, auxotrophy, resistance to cytotoxic agents, or expression of surface polypeptides. Markers that do so may be used. In an environment treated with a selective agent, only cells expressing the selection marker survive or show other expression traits, so transformed cells can be selected.

Host cells of the present application may be included without limitation as long as they are capable of expressing the variant of the present application.

The host cell of the present application may include the above-described variant, a polynucleotide encoding the variant, and a nucleic acid construct and/or vector containing the same.

The nucleic acid construct or vector may be integrated into the chromosome as previously described, or may be maintained as a self-replicating extrachromosomal vector.

Host cells of the present application include any progeny of the parent cell that are not identical to the parent cell due to mutations that occur during replication.

The host cell can be any cell useful for the recombinant production of variants, such as a prokaryotic cell or a eukaryotic cell.

The prokaryotic host cell can be any Gram-positive or Gram-negative bacterium.

Gram-positive bacteria include, but are not limited to, Bacillus, Clostridium, Enterococcus, Geobacillus, Lactobacillus, Lactococcus, Oceanobacillus, Staphylococcus, Streptococcus, and Streptomyces.

Gram-negative bacteria include Campylobacter, Escherichia coli, Flavobacterium, Fusobacterium, Helicobacter, Iliobacter, Neisseria, Pseudomonas, Salmonella, and Vibrio (e.g., Vibrio natriegens). ) and Ureaplasma, but are not limited to these.

In one embodiment, the bacterial host cell may be a host cell of the genus Bacillus, specifically Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Including, but not limited to, Bacillus firmus, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus pumilus, Bacillus stearothermophilus, Bacillus subtilis and Bacillus thuringiensis cells. No.

In one embodiment, the bacterial host cell may be a host cell of the Streptococcus genus, specifically Streptococcus equisimilis, Streptococcus pyogenes, and Streptococcus uberis. and Streptococcus equi subspecies Zooepidemicus cells.

In one embodiment, the bacterial host cell may be a host cell of the Streptomyces genus, specifically, Streptomyces achromogenes, Streptomyces avermitilis, and Streptomyces. Including, but not limited to, Coelicola, Streptomyces griseus and Streptomyces lividans cells.

In one embodiment, the bacterial host cell may be a host cell of the genus Corynebacterium, Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium stationis, Corynebacterium singulare ( Corynebacterium singulare), Corynebacterium halotolerans, Corynebacterium striatum, Corynebacterium ammoniagenes, Corynebacterium pollutisoli , Corynebacterium imitans, Corynebacterium testudinoris, or Corynebacterium flavescens, but is not limited thereto.

As one specific example, the host cell may be a microorganism of the Escherichia genus, such as Escherichia coli, (Escherichia coli), Escherichia albertii, Escherichia fergusonii ), Escherichia hermannii, Escherichia vulneris, or Escherichia blattae, but is not limited thereto.

The host cell may be eukaryotic, such as a mammalian, insect, plant, or fungal cell.

The host cell may be a fungal cell. In this application, “fungi” includes Ascomycetes, Basidiomycota, Mycomycota, and Zygomycota, as well as Oomycetes and all incomplete fungi.

The fungal host cell may be a yeast cell. “Yeast” in this application refers to ascosporogenous yeast (Endomycetales), basidiosporogenous yeast, and yeast belonging to Fungi imperfecti (Blastomycetes). Includes. However, this classification may change, and the classification may be defined as described in Biology and Activities of Yeast (Skinner, Passmore, and Davenport, editors, Soc. App. Bacteriol. Symposium Series No. 9, 1980) .

Yeast host cells include Candida, Hansenula, Kluyveromyces, Pichia, Komagataella, Saccharomyces, and Schizosaccharomyces ( Schizosaccharomyces or Yarrowia cells, such as Kluyveromyces lactis, Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces cerevisiae Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis, Saccharomyces It may be a Saccharomyces oviformis, Komagataella phaffii or Yarrowia lipolytica cell.

The fungal host cell may be a filamentous fungal cell. “Filamentous fungi” include all filamentous forms of the subphyla Mycocetes and Oomycetes (as defined above (Hawksworth et al., 1995)). Filamentous fungi are generally characterized by hyphal walls composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth is by hyphal elongation, and carbon catabolism is absolutely aerobic. In contrast, vegetative growth by yeasts, such as Saccharomyces cerevisiae, is by budding of single-celled thallus, and carbon catabolism may be fermentative.

Filamentous fungal host cells include Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, and Coprinus ( Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Mycelioptora, Neocallimastix (Neocallimastix), Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus ), Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes or Trichoderma cells It can be.

For example, filamentous fungal host cells include Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, and Aspergillus japonicus. ), Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis curry Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis subrupa subrufa), Ceriporiopsis subvermispora, Chrysosporium inops, Chrysosporium keratinophilum, Chrysosporium lucknowense , Chrysosporium merdarium, Chrysosporium pannicola, Chrysosporium queenslandicum, Chrysosporium tropicum, Chrysosporium Chrysosporium zonatum, Coprinus cinereus, Coriolus hirsutus, Fusarium bactridioides, Fusarium cerealis, Fusa Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium saroke Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, Fusa Fusarium venenatum, Humicola insolens, Humicola lanuginosa, Mucor miehei, Mycelioptora thermophila, Neurospora crassa, Penny Penicillium purpurogenum, Phanerochaete chrysosporium, Phlebia radiata, Pleurotus eryngii, Thiellabia terrestris ( Thielavia terrestris), Trametes villosa, Trametes versicolor, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachii Atum (Trichoderma longibrachiatum), Trichoderma risei or Trichoderma viride (Trichoderma viride) cells. However, it is not limited to this.

The method for producing a variant of the present application may include culturing host cells.

In this application, the term “culturing” means growing the host cells under appropriately controlled environmental conditions. The culture process of the present application can be carried out according to appropriate media and culture conditions known in the art. This culture process can be easily adjusted and used by a person skilled in the art depending on the strain selected. Specifically, the culture may be batch, continuous, or fed-batch, but is not limited thereto.

In this application, the term "medium" refers to a material that is mainly mixed with nutrients necessary for cultivating the host cells, and supplies nutrients and growth factors, including water, which are essential for survival and development. Specifically, the medium and other culture conditions used for cultivating the host cells of the present application can be any medium used for cultivating conventional host cells without particular limitation, but the host cells of the present application can be cultured with an appropriate carbon source, nitrogen source, It can be cultured under aerobic conditions in a normal medium containing phosphorus, inorganic compounds, amino acids and/or vitamins, etc. while controlling temperature, pH, etc.

In the present application, the carbon source includes carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; Sugar alcohols such as mannitol, sorbitol, etc., organic acids such as pyruvic acid, lactic acid, citric acid, etc.; Amino acids such as glutamic acid, methionine, lysine, etc. may be included. Additionally, natural organic nutrient sources such as starch hydrolyzate, molasses, blackstrap molasses, rice bran, cassava, bagasse and corn steep liquor can be used, specifically glucose and sterilized pre-treated molasses (i.e. converted to reducing sugars). Carbohydrates such as molasses) can be used, and various other carbon sources in an appropriate amount can be used without limitation. These carbon sources may be used alone or in combination of two or more types, but are not limited thereto.

The nitrogen source includes inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate; Organic nitrogen sources such as amino acids such as glutamic acid, methionine, and glutamine, peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolyzate, fish or its decomposition products, defatted soybean cake or its decomposition products, etc. can be used These nitrogen sources may be used individually or in combination of two or more types, but are not limited thereto.

The agent may include monopotassium phosphate, dipotassium phosphate, or a corresponding sodium-containing salt. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, and calcium carbonate, and may also include amino acids, vitamins, and/or appropriate precursors. These components or precursors can be added to the medium batchwise or continuously. However, it is not limited to this.

Additionally, during culturing of the host cells, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. can be added to the medium in an appropriate manner to adjust the pH of the medium. Additionally, during culturing, foam generation can be suppressed by using an antifoaming agent such as fatty acid polyglycol ester. In addition, to maintain the aerobic state of the medium, oxygen or oxygen-containing gas can be injected into the medium, or to maintain the anaerobic and microaerobic state, nitrogen, hydrogen, or carbon dioxide gas can be injected without gas injection, and is limited thereto. That is not the case.

The temperature of the medium may be 20°C to 55°C, specifically 25°C to 40°C, but is not limited thereto. The culturing period may continue until the desired production amount of useful substances is obtained, and may specifically be 24 hours to 196 hours, but is not limited thereto.

In one embodiment, the method for producing a variant polypeptide having xylanase activity of the present application may further include the step of recovering the variant polypeptide having xylanase activity of the present application expressed in the culturing step. there is.

In another embodiment, the mutant expressed in the culturing step can be recovered using methods known in the art to which the present invention pertains. For example, variants can be recovered from nutrient media by routine procedures including, but not limited to, collection, centrifugation, filtration, extraction, spray-drying, evaporation, or precipitation.

The recovery method may be to collect variants using a suitable method known in the art according to the host cell culture method of the present application, for example, batch, continuous, or fed-batch culture method. For example, centrifugation, filtration, crystallization, treatment with protein precipitants (salting out), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity. Various chromatographies such as chromatography, HPLC, and combinations of these methods can be used, and variants can be recovered from medium or host cells using suitable methods known in the art.

In another embodiment, variants expressed by host cells during the culture step may not be recovered. In this embodiment, the host cell expressing the variant itself can be used as the source of the variant.

The composition of the present application can be used to decompose xylan-containing materials.

The compositions of the present application can be used to convert xylan-containing materials to xylose and/or xylo-oligosaccharides.

The composition of the present application may further include other components in addition to the variants provided in the present application. A person skilled in the art can appropriately select the components added to the composition of the present application.

In one embodiment, the composition of the present application may further include any component suitable for application in converting xylan-containing materials to xylose and/or xylo-oligosaccharide.

In one embodiment, the composition of the present application may further include any components suitable for application to various industrial fields such as animal feed, baking, biomass saccharification, and pulp bleaching.

Examples of substances that can be added include stabilizers, surfactants, builders, chelating agents, dispersants, enzymes, enzyme stabilizers, catalysts, activators, carriers, mixtures, lubricants, disintegrants, excipients, solubilizers, suspending agents, Includes, but is not limited to, colorants, flavorings, buffers, preservatives, analgesics, solubilizers, isotonic agents, stabilizers, diluents, lubricants, preservatives, etc.

In one embodiment, the composition provided in the present application may further include naturally occurring substances or non-naturally occurring substances in addition to the variants provided in the present application.

In one embodiment, the composition provided in the present application may further include additional enzymes commonly used in various industrial fields, including animal feed, baking, biomass saccharification, pulp bleaching, etc., in addition to the variants provided in the present application. You can.

For example, the additional enzymes include beta-amylase, cellulase (beta-glucosidase, cellobiohydrolase and endoglucanase), glucoamylase, hemicellulase (endo-xylanase, β-xylosidase) , α-L-arabinofuranosidase, α-D-glucuronidase, feruloyl esterase, coumaroyl esterase, α-galactosidase, β-gal. Lactosidase, β-mannanase or β-mannosidase), isoamylase, isomerase, lipase, phytase, protease, pullulanase and/or alpha-amylase, which are useful in commercial processes. It may further include one or more enzymes selected from the group consisting of external enzymes.

The xylanase variant of the present application or the composition comprising the xylanase variant of the present application can be used to degrade any xylan-containing material.

In the present application, xylan-containing material is any material that can be degraded by xylanase. For example, the xylan-containing material may be hemicellulose. Specifically, the xylan-containing material may be a material selected from xylan, glucuronoxylan, arabinoxylan, glucomannan, and xyloglucan. For example, the xylan-containing material may be xylan, but is not limited thereto.

In one embodiment, the present application provides a method for decomposing (or disintegrating) xylan-containing materials. This may also be referred to as solubilization of xylan and/or solubilization of pentosan.

In a further embodiment of the present application, the method relates to degradation (e.g., degradation) of a polymer derived from xylan degradation.

Decomposition products (e.g., glucose) can be used as feedstock for any fermentation process, such as in the production of biofuels (e.g., bioethanol) or as other products, such as biochemicals (e.g., biobased isoprene). can be used in the production of

Xylan can be degraded using the variant of the present application, a host cell expressing the same, and a composition containing the variant and/or the host cell. In the step of hydrolyzing xylan, cofactors, coenzymes, etc. in addition to the variants of the present application may be added. The step of hydrolyzing the substrate can be performed under optimal pH and temperature conditions, and a person skilled in the art can select appropriate conditions.

The xylanase variants of the present application may be used in any of the following applications:

a) Additives in animal feed ingredients; and/or

b) Feed supplements for animals; and/or

c) Decomposition of grain-based substances (for example, these may be whole grains or parts of grains).

In one embodiment, the xylanase variant of the present application can be used as a feed raw material.

In one embodiment, the xylan-containing material may be a feed raw material or feed ingredient.

The feed composition of the present application may refer to any natural or artificial diet, meal, etc., or a component of the meal, for animals to eat, ingest, and digest, or suitable therefor, and may be used in various forms known in the art. Manufacturable.

In one embodiment, the xylanase variant of the present application can be used in a food composition or its production.

In one embodiment, the xylan-containing material may be a grain-based material (including whole grains or partial grains or malted grains, such as malted barley).

In one embodiment, the xylan-containing material may be grain flour (e.g., wheat, oat, rye, or barley flour).

In one embodiment, the xylan-containing material may be barley malt or saccharification liquor, or malted barley, or a combination thereof.

As an example, the food composition may be a fermented beverage including beer and wine. As another example, the food composition may be a bakery product including loaves, rolls, buns, pizza, pretzels, tortillas, cakes, cookies, biscuits, and crackers. However, it is not limited to this.

The xylanase variant of the present application can be used for wheat gluten-starch separation.

After the initial separation of wheat bran and wheat germ from the endosperm, fractionation of wheat endosperm flour into starch and gluten fractions can be exploited to obtain high quality A-starch and by-products B-starch and activated gluten.

In a method for separating grain flour (e.g., wheat flour) into starch and gluten fractions, the method includes mixing grain flour (e.g., wheat flour), water, and xylanase variants. Flour, water and xylanase variants can be mixed simultaneously or sequentially. In some embodiments, grain flour (e.g., wheat flour) and water may be mixed prior to mixing with the xylanase variant.

The xylanase variants of the present application can be applied to wheat gluten-starch separation to produce higher A-starch yields and/or better quality gluten (e.g., better quality active gluten).

In another embodiment, the xylanase variants of the present application can be used for the degradation of grain-based materials and as part of a biofuel (e.g., bioethanol) production process.

As an example, the xylanase variants of the present application can improve the production of biofuels (e.g., bioethanol) and the utilization of grain-based materials in the biofuel industry.

As an example, biofuel and xylanase variants may be used including steps of liquefaction, saccharification, fermentation, co-saccharification, and mixing before or during fermentation, after fermentation, or in combinations thereof.

When applying the xylanase variant of the present application to a biofuel production process, more dry matter saccharification liquor can be used in the process; obtain higher solids content in the final syrup; better heat transfer; energy requirements are further reduced; Evaporator adhesion contamination is reduced; cleaning costs are reduced; final fuel yield increases; By-product quality is improved; It is easier to separate the solid and liquid parts of the residue after distillation; Alternatively, a combination of the aforementioned advantages can be obtained.

The xylanase variants of the present application can be used for pulp bleaching.

For example, while the colored lignin in the pulp is linked to crystalline cellulose through xylan, treatment with xylanase variants can promote pulp bleaching by decomposing the xylan and releasing the colored lignin.

실시예Example

Hereinafter, the present application will be described in more detail through examples and experimental examples. However, these examples and experimental examples are for illustrative purposes only and the scope of the present application is not limited to these examples and experimental examples.

실시예 1: 변이체의 제조Example 1: Preparation of variants

1-1. Template production

Orpinomyces sp. The xylanase variant (hereinafter referred to as Op It was used as a template.

1-2. 점변이체 제작1-2. Production of point variants

A site was selected to create a single mutation in Op Xyn, and variants were created through site saturation mutagenesis (SSM) using the following primers.

명칭designation	변이서열mutation sequence	Primer (5'→ 3')Primer (5'→ 3')
SSMSSM	H147XH147X	TTCCAGATGGAT NNK ACTGGCCCGACCATCAACGGTTCCAGATGGAT NNK ACTGGCCCGACCATCAACGG

Specifically, the xylanase mutant was produced through PCR using a template (Template, Example 1-1), primer, and PCR premix (iNtRON, cat no. 25185). PCR used an Eppendorf Mastercycler Nexus GX2, and the reaction conditions were as follows. Initial denaturation - 94°C, 2min.

Denaturation - 94℃, 20sec

Annealing - 50℃, 10sec

Extension - 72℃, 10min (30 cycles from denaturation to elongation)

Final Extension - 72℃, 5min

The created mutant was ligated using the In-Fusion HD cloning kit (Takara, Cat. No. 639650), then transformed into the E. coli Dh5α strain and sequenced to check for sequence mutations.

실시예 2. 변이체 선정 및 내열성 평가Example 2. Variant selection and heat resistance evaluation

The E. coli Dh5α strain transformed with the mutant prepared in Example 1 and the Op The colonies obtained here were inoculated one by one into a 96-well plate containing 0.4ml LB medium, cultured for 24 hours at 37°C and 750rpm, and then centrifuged at 4000rpm for 15 minutes to recover the supernatant (Eppendorf Centrifuge 5810R). This supernatant was heat-treated in a 70°C waterbath for 5 minutes, and the residual titer was analyzed using a xylanase titer assay scaled down to 1/5 in a 96-well plate.

The method for measuring xylanase titer is as follows. Mix 4 ㎕ of 1M pH 6.5 phosphate buffer with 96 ㎕ of 1% xylan from beechwood (Megazyme, P- The reaction proceeded for several minutes. The reaction was stopped by mixing 300 ㎕ of DNS solution into the reaction solution, boiled for 7 minutes to develop color, and then cooled in ice water. The absorbance at 550 nm of a solution mixed with 500 ㎕ distilled water was measured, and the titer was measured using a standard curve made with xylose (Sigma-Aldrich, X1500).

The DNS solution recipe is as follows. Accurately weigh 6.3 g of 3,5-dinitrosalicylic acid (samchun, D1267) in a beaker containing 500 ml of distilled water and 21 g of sodium hydroxide (Sodium Hydroxide, Daejung, 7571) at 50°C. -4400) was added, 182 g of potassium sodium tartrate tetrahydrate (Daejung, 6618-4400) was added to 300 ml of water, then 5 g of phenol (Sigma-Aldrich, P1037) was added, and sodium sulfite anhydrous, Daejung, 7634-4405) was added and stirred until dissolved, then cooled. Distilled water was added to the solution to make it 1000 ml and then filtered. It was stored in a brown bottle for more than 7 days and then used.

Based on the Op After culturing the mutants obtained in this way, the enzyme was purified to check for noise. As a result, 4 sequences (H147R/K/S/V) were confirmed on 96 well. After purifying each of them, thermal stability evaluation was performed (70°C, 5 minutes, 10 minutes). As a result, it was confirmed that the thermal stability of H147R and H147K was improved.

시료sample	변이transition	HT Residual(%)HT Residual(%)
시료sample	변이transition	70℃5분70℃5 minutes	70℃10분70℃10 minutes
Op XynOpXyn	--	3.93.9	0.20.2
SSM (H147X)SSM (H147X)	H147RH147R	1919	7.47.4
	H147KH147K	16.416.4	2.82.8
	H147SH147S	2.92.9	0.30.3
	H147VH147V	2.12.1	0.20.2

실시예 3. 조합변이 제작 및 평가Example 3. Production and evaluation of combination mutations

Orpinomces sp. To improve the thermal stability of PC-2 xylanase, a combination mutation was created using H147R and H147K primers in a combination mutant strain in which a disulfide bond and a single mutation were introduced. Combination mutations were produced in the same manner as Example 2-1 using site-directed mutagenesis (SDM), and the primers used to introduce each mutation are as follows.

H147R ForwardH147R Forward	TTCCAGATGGAT CGT ACTGGCCCGACC TTCCAGATGGAT CGT ACTGGCCCGACC
H147R ReverseH147R Reverse	ATCCATCTGGAAGATCTTGTACTG ATCCATCTGGAAGATCTTGTACTG
H147K ForwardH147K Forward	TTCCAGATGGAT AAG ACTGGCCCGACC TTCCAGATGGAT AAG ACTGGCCCGACC
H147K ReverseH147K Reverse	ATCCATCTGGAAGATCTTGTACTG ATCCATCTGGAAGATCTTGTACTG
N93W ForwardN93W Forward	AGCGCAAGCGGT TGG AGCCGCAGCGCAAGCGGT TGG AGCCGC
N93W ReverseN93W Reverse	ACCGCTTGCGCTGGCAGTCTGACCGCTTGCGCTGGCAGTCTG
N52P ForwardN52P Forward	AGCGCAGCTGTC CCC CGGGGTAACAGCGCAGCTGTC CCC CGGGGTAAC
N52P ReverseN52P Reverse	GACAGCTGCGCTCCACTCGACAGCTGCGCTCCACTC
N28G ForwardN28G Forward	ATCTGGCTGGAT GGC ACCGGCGGATCTGGCTGGAT GGC ACCGGCGG
N28G ReverseN28G Reverse	ATCCAGCCAGATCTCGATCCAGCCAGATCTCG
N28A ForwardN28A Forward	ATCTGGCTGGAT GCT ACCGGCGGTAG ATCTGGCTGGAT GCT ACCGGCGGTAG
N28A ReverseN28A Reverse	ATCCAGCCAGATCTCGATCCAGCCAGATCTCG
R3C ForwardR3C Forward	GGCCAG TGT TTGAGCGTCGGGGCCAG TGT TTGAGCGTCGG
R3C ReverseR3C Reverse	GCTCAA ACA CTGGCCCATATGGGCTCAA ACA CTGGCCCATATGG
T36C ForwardT36C Forward	AAGGGA TGT ACCTTCAAGGCTGAGAAGGGA TGT ACCTTCAAGGCTGAG
T36C ReverseT36C Reverse	ACCCAG ACA CATGGAACCGCTACCACCCAG ACA CATGGAACCGCTACC

Purified enzyme was prepared in the same manner as described above, and then specific activity, thermal stability at 85°C, etc. were measured. As a result, it can be seen that the thermal stability improves as point mutations are added to existing variants with improved thermal stability compared to WT.

변이체 명칭variant name	Op Xyn AA 서열 기준 변이 내용Variation content based on Op Xyn AA sequence	Specific activitySpecific activity		잔류역가(%)Residual titer (%)
변이체 명칭variant name		U/mgU/mg	%%	85℃85℃ 10분10 minutes	85℃85℃ 30분30 minutes
Op XynOpXyn	--	3673.43673.4	100100	00	00
V1(Variant 1)V1(Variant 1)	R3C+T36C + N28G+N52PR3C+T36C + N28G+N52P	4890.94890.9	133.1133.1	2121	0.30.3
V1_H147RV1_H147R	Variant 1+H147RVariant 1+H147R	33813381	92.092.0	5252	6.36.3
V1_H147KV1_H147K	Variant 1+H147KVariant 1+H147K	4749.64749.6	129.3129.3	56.156.1	13.613.6
V2(Variant 2)V2(Variant 2)	R3C+T36C + N28A+N52PR3C+T36C + N28A+N52P	7173.67173.6	195.3195.3	35.135.1	0.10.1
V2_H147RV2_H147R	Variant 2+H147RVariant 2+H147R	4582.54582.5	124.7124.7	46.346.3	4.54.5
V2_H147KV2_H147K	Variant 2+H147KVariant 2+H147K	5240.25240.2	142.7142.7	55.255.2	17.517.5
V3(Variant 3)V3(Variant 3)	R3C+T36C + N52P+N93WR3C+T36C + N52P+N93W	6417.46417.4	174.7174.7	24.724.7	00
V3_H147RV3_H147R	Variant 3+H147RVariant 3+H147R	2594.42594.4	70.670.6	42.842.8	11.611.6
V3_H147KV3_H147K	Variant 3+H147KVariant 3+H147K	1476.41476.4	40.240.2	66.766.7	20.720.7

From the above description, a person skilled in the art to which this application belongs will be able to understand that this application can be implemented in other specific forms without changing its technical idea or essential features. In this regard, the embodiments described above should be understood in all respects as illustrative and not restrictive. The scope of the present application should be interpreted as including the meaning and scope of the patent claims described below rather than the detailed description above, and all changes or modified forms derived from the equivalent concept thereof are included in the scope of the present application.

Claims

A variant polypeptide having xylanase activity,

i) the variant polypeptide has sequence identity of more than 70% and less than 100% with SEQ ID NO: 1; and/or

ii) the variant polypeptide is a polypeptide encoded by a polynucleotide having 70% or more but less than 100% sequence identity with the sequence encoding the mature polypeptide of SEQ ID NO: 1; and/or

iii) the variant polypeptide is low stringency with (a) the mature polypeptide coding sequence of SEQ ID NO: 1, (b) its cDNA, or (c) the full-length complement of (a) or (b). is a polypeptide encoded by a polynucleotide that hybridizes under low stringency conditions, medium stringency conditions, medium stringency conditions, high stringency conditions, or very high stringency conditions; and/or

iv) the variant polypeptide is a functional fragment of i), ii) or iii) polypeptide having xylanase activity; and

The variant polypeptide includes a substitution of the amino acid at position 147 with another amino acid;

Here, the position number corresponds to the position of the polypeptide of SEQ ID NO: 1.
The variant polypeptide according to claim 1, wherein amino acid 147 of the variant polypeptide having xylanase activity before modification is histidine.
The variant polypeptide according to claim 1, wherein the variant polypeptide comprises a substitution of amino acid 147 with arginine or lysine.
The variant polypeptide according to claim 1, wherein the variant polypeptide further comprises a substitution of one or more of the amino acids corresponding to positions 28 and 52 of SEQ ID NO: 1.
The variant polypeptide according to claim 1, wherein the variant polypeptide further comprises a substitution of one or more amino acids at positions 46 and 93 of SEQ ID NO: 1 with another amino acid.
The variant polypeptide according to claim 1, wherein the variant polypeptide further comprises a pair of amino acids forming a disulfide bridge.
The variant polypeptide according to claim 6, wherein the amino acid pair includes substitution of amino acids corresponding to numbers 3 and 36 of SEQ ID NO: 1 with cysteine.
The variant polypeptide according to claim 1, wherein the variant polypeptide has increased heat resistance and/or heat stability compared to the polypeptide consisting of the amino acid sequence of SEQ ID NO: 1.
A xylan-containing material comprising contacting a composition comprising the variant polypeptide of any one of claims 1 to 8, a host cell expressing the variant polypeptide, and/or the variant polypeptide. Method for producing oligosaccharides or xylose.
Xylan, comprising treating the variant polypeptide of any one of claims 1 to 8, a host cell expressing the variant polypeptide, and/or a composition comprising the variant polypeptide to a xylan-containing material. How to decompose the contained substances.
A polynucleotide encoding the variant polypeptide of any one of claims 1 to 8.
A host cell comprising the variant polypeptide of any one of claims 1 to 8, and/or the polynucleotide of claim 13.
Comprising the step of culturing the host cells of claim 12,

Method for producing a variant polypeptide having xylanase activity.