WO2023233007A1

WO2023233007A1 - Sars-cov-2 vaccines and uses thereof

Info

Publication number: WO2023233007A1
Application number: PCT/EP2023/064847
Authority: WO
Inventors: Ralf Amann; Ferdinand Salomon; Melanie Müller; Alena REGUZOVA; Felix Pagallies
Original assignee: Eberhard Karls Universität Tübingen Medizinische Fakultät; Prime Vector Technologies Gmbh
Priority date: 2022-06-02
Filing date: 2023-06-02
Publication date: 2023-12-07

Abstract

The present disclosure relates to compositions and methods for activating, promoting, eliciting, and/or enhancing immune responses against SARS-CoV-2.

Description

SARS-COV-2 VACCINES AND USES THEREOF

BACKGROUND

The SARS-CoV-2 virus is an extremely infectious coronavirus first detected in late 2019 in China that quickly spread across borders resulting in the COVID-19 global pandemic that has caused in excess of 175 million human infections and nearly 4 million deaths as of June 2021. Particularly troublesome is that some infected individuals exhibit little or no symptoms of COVID-19 and can unknowingly spread the virus to others. RNA and adenoviral vector vaccines have shown great promise, but herd immunity has not been reached in most developed countries, and developing countries are still experiencing high case levels that overburden their medical facilities. Moreover, it is unknown how the vaccines currently available will behave against emerging strains of the SARS-CoV-2 virus. Thus, there is an urgent need for additional strategies to protect people against SARS-CoV-2.

SUMMARY OF THE INVENTION

The present invention is directed to compositions and methods for activating, promoting, eliciting, and/or enhancing immune responses against SARS-CoV-2 in a subject. More specifically, Orf virus (ORFV) vectors are described that comprise coding sequences of SARS- CoV-2 antigens. Administration of these vectors elicits cellular and humoral responses in the subject. Pharmaceutical compositions comprising these ORFV vectors and methods and compositions for making the vectors are also presented.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 is a plasmid map of pV-CoV-Spike-FL_TM.

FIG. 2 is a plasmid map of pD7-CoV_N.

FIG. 3 is map of the CoV-2 S-FL TM construct.

FIG. 4 is a restriction map of D170l -V-CoV2-Spike FL-TM-D7-CoV2-N (“Prime-2-

CoV”). FIG. 5 is a restriction map of D1701-V-CoV2-Spike_FL-TM-D7-CoV2-N

FIG. 6 is a restriction map of D1701-V-CoV2-Spike_FL-TM-D7-CoV2-N.

FIG. 7 shows western blots of Vero cells infected with Prime-2-CoV from passages 0 and 12, and stained with anti-Spike, anti-Nucleocapsid and anti-ORFV antibodies.

FIG. 8 shows FACS analysis of passages 0 and 12 of Vero cells infected with “Prime-2 - CoV” (V-CoV_Spike_FL-TM-D7-CoV_N denotes Prime-2-CoV).

FIGs. 9A and 9B are western blot analyses showing Spike (S) and Nucleocapsid (N) protein expression in Vero cells, respectively.

FIGs. 10A and 10B show endpoint titers of Sl-RBD-specific total IgG observed in mice treated with recombinant D1701-V-based ORF vectors encoding different Spike-protein constructs including the SI domain of the S protein (group 26), a soluble full length S protein (group 27), and a S protein having a transmembrane domain (monovalent: group 28; multivalent: group 31) in pooled sera of mice. Group 25 is a control (see Table 9). FIG. 10A shows Sl- RBD-specific total IgG observed in mice treated with recombinant D1701-V-based ORF vectors expressing different Spike-protein constructs 7 days after prime. FIG. 10B shows recombinant D1701-V-based ORF vectors expressing different Spike-protein constructs 21 days after prime.

FIGs. 11A and 1 IB show Sl-RBD-specific endpoint titer kinetics in pooled mouse sera from Day 14-42. FIG. 11 A shows Sl-RBD-specific endpoint titer kinetics at day 7 post-prime. FIG. 1 IB shows Sl-RBD-specific endpoint titer kinetics at day 21 post-prime. Shown are groups 30, 31, 32, and 33, which were vaccinated with Prime-2-CoV at doses of 3x 10⁷, 10⁷, 10⁶, and 10⁵ PFU, respectively.

FIGs. 12A and 12B show N-specific endpoint titer kinetics in pooled mouse sera from Dayl4-42. FIG. 12A shows N-specific endpoint titer kinetics at day 7 post-prime. FIG. 12B shows N-specific endpoint titer kinetics at day 21 post-prime. Shown are groups 30, 31, 32, and 33, which were vaccinated with Prime-2-CoV at doses of 3x10⁷, 10⁷, 10⁶, and 10⁵ PFU, respectively.

FIG. 13 is a comparison of pooled mouse sera after vaccination with monovalent V-CoV- Spike_FL-TM and multivalent Prime-2-CoV from day 14 - day 42. Shown are groups 28 and 31.

FIGs. 14A and 14B compare Sl-RBD-specific endpoint antibody titers in pooled mouse sera after single (group 29) and repeated vaccination (group 30) regimens using Prime-2-CoV. FIG. 14A shows Sl-RBD-specific endpoint antibody titers at day 21 post-prime. FIG. 14B shows Sl-RBD-specific endpoint antibody titers at day 28 post-prime.

FIGs. 15A and 15B compare N-specific endpoint antibody titers in pooled mouse sera after single (group 29) and repeated vaccination (group 30) regimen using Prime-2-CoV. FIG. 15A shows N-specific endpoint antibody titers at day 21 post-prime. FIG. 15B shows N-specific endpoint antibody titers at day 28 post-prime and 7 days post boost.

FIG. 16 shows the results from a surrogate virus neutralization assay indicating that Prime-2-CoV induces Spike-specific antibodies with neutralizing activity. Mouse sera were diluted 1 : 100 before performing this assay. Mean values are shown.

FIG. 17 shows the IgG2a/IgGl ratio in individual mice measured 28 days after prime or 7 days after boost immunization. A highly Thl biased immune response was observed.

FIGs. 18A and 18B show the evaluation of repeated ORFV D1701-V-based vaccine administration in mice. FIG. 18A shows the endpoint titer of SARS-CoV-2 RBD-specific IgG antibodies. FIG. 18B shows the endpoint titer of SARS-CoV-2 N-specific IgG antibodies.

FIG. 19 shows the mean Spike-specific CD4+ T cell responses determined by IFNy, TNFα, 1L2, and IL4 specific intracellular cytokine staining (ICS) 7 days after boost vaccination).

FIG. 20 shows the mean Spike-specific CD8+ T cell responses determined by IFNy, TNFα, 1L2, and IL4 specific ICS 7 days after boost vaccination.

FIG. 21 shows the mean N-specific CD4+ T cell responses determined by IFNy, IL2, and IL4 specific ICS 7 days after boost vaccination.

FIG. 22 shows the mean N-specific CD8+ T cell responses determined by IFNy, TNFα, IL2, and IL4 specific ICS 7 days after boost vaccination.

FIGs. 23A-23C show Sl-RBD and N-specific IgG endpoint titer kinetics in individual non-human primate (NHP) sera from Day 0 - 70 (Sl-RBD) or 49 (N). FIG. 23A shows Sl-RBD specific total IgG. FIG. 23B shows Spike trimer specific total IgG. FIG. 23C shows Nucleocapsid specific total IgG. Shown are groups 1, 2, 3, and 4, which were vaccinated with a Mock control, V-CoV Spike_FL-TM at doses of 3x10⁷ PFU and Prime-2-CoV at doses of 3x10⁷ and 10⁶ PFU, respectively.

FIG. 23 shows S-protein specific and N-Protein specific CD4+ and CD8+ T cell responses. FIGs. 24A-24E show that Prime-2-CoV activates, promotes, elicits, and/or enhances an immune response comprising polyfunctional CD4+ T cells. FIG. 24A shows the percentage of CD4+IFNy+ cells observed 1 week post boost. FIG. 24B shows the percentage of CD4+TNFα+ cells observed 1 week post boost. FIG. 24C shows the percentage of CD4+IL-2+ cells observed 1 week post boost. FIG. 24D shows the percentage of CD4+IFNy+/TNFα+/IL-2+ cells observed 1 week post boost. FIG. 24E shows the percentage of CD4+IFNy+/TNFα+ cells observed 1 week post boost.

FIGs. 26A-26C show neutralization assays performed individual sera of NHPs. FIG. 26A shows Prime-2-CoV induces S-specific antibodies with neutralizing activity on study day 35. FIG. 26B shows surrogate virus neutralization at day 56. NHP sera were diluted 1 :10 before performing the assay. FIG. 26C shows Prime-2-CoV induces S-specific antibodies with neutralizing activity on study day 35. Shown are mean values and SD.

FIGs. 27A-27C show that multivalent Prime-CoV-2 induces high SARS-CoV-2 specific IgG titers in NHPs. FIG. 27A shows IgG titers 14 days post prime. FIG. 27B shows IgG titers 21 days post prime. FIG. 27C shows IgG titers 7 days post boost.

FIGs. 28A and 28B show results of an ex-vivo IFNy ELISpot assay. FIG. 28A shows Nucleocapsid-specific T cell responses of individual NHPs. FIG. 28B shows Spike-specific T cell responses of individual NHPs. The responses were determined on study days 0, 7, 28, and 35.

FIGs. 29A-29E show that Prime-2-CoV activates, promotes, elicits, and/or enhances an immune response comprising polyfunctional CD8+ T cells. FIG. 29A shows the percentage of CD8+IFNy+ cells observed 1 week post boost. FIG. 29B shows the percentage of CD8+TNFα+ cells observed 1 week post boost. FIG. 29C shows the percentage of CD8+IL-2+ cells observed 1 week post boost. FIG. 29D shows the percentage of CD8+IFNy+/TNFα+/IL-2+ cells observed 1 week post boost. FIG. 29E shows the percentage of CD8+IFNy+/TNFα+ cells observed 1 week post boost.

FIG. 30 shows S-protein specific and N-Protein specific CD4+ and CD8+ T cell responses.

FIGs. 31A-31C show that optimizing production protocols can increase vaccine production. FIG. 31 A shows virus production differences after infection with different MOIs. FIG. 3 IB shows virus production at different pH. FIG. 31C shows virus production upon infection of cell cultures having different cell densities.

FIGs. 32A-32C show ORFV stability at different temperatures. ORFV stability is shown during incubation for two weeks at 4°C (FIG. 32A), room temperature (RT) (FIG. 32B), and 37°C (FIG. 32C).

DETAILED DESCRIPTION OF THE INVENTION

The present disclosure relates to vaccines comprising recombinant Orf virus strains that comprise a nucleic acid sequence encoding at least one SARS-CoV-2 antigen. Accordingly, methods and compositions for the treatment and prevention of SARS-CoV-2 are featured. These methods and compositions are based, at least in part, on the discovery that a recombinant Orf virus (ORFV) comprising a coding sequence of at least one SARS-CoV-2 antigen or fragment thereof elicits robust cellular and humoral responses against SARS-CoV-2 infection. In certain aspects, ORFV-based SARS-Co-V-2 vaccines are provided. Some aspects provide methods for activating, promoting, eliciting, and/or enhancing an immune response against SARS-CoV-2 comprising administering an ORFV encoding at least one SARS-CoV-2 antigen or fragment thereof to a subject having a SARS-CoV-2 infection or at risk of being exposed to the SARS- CoV-2 virus.

Definitions

Unless otherwise defined herein, scientific and technical terms used in this application shall have the meanings that are commonly understood by those of ordinary skill in the art. Generally, nomenclature used in connection with, and techniques of, chemistry, cell and tissue culture, molecular biology, cell and cancer biology, neurobiology, neurochemistry, virology, immunology, microbiology, pharmacology, genetics and protein and nucleic acid chemistry, described herein, are those well-known and commonly used in the art.

The methods and techniques of the present disclosure are generally performed, unless otherwise indicated, according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout this specification. See, e.g., “Principles of Neural Science”, McGraw-Hill Medical, New York, N.Y. (2000); Motulsky, “Intuitive Biostatistics”, Oxford University Press, Inc. (1995); Lodish et al., “Molecular Cell Biology, 4th ed.”, W. H. Freeman & Co., New York (2000); Griffiths et al., “Introduction to Genetic Analysis, 7th ed.”, W. H. Freeman & Co., N.Y. (1999); and Gilbert et al., “Developmental Biology, 6th ed.”, Sinauer Associates, Inc., Sunderland, MA (2000).

All of the above, and any other publications, patents, and published patent applications referred to in this application are specifically incorporated by reference herein. In case of conflict, the present specification, including its specific definitions, will control.

“Adjuvant” or “adjuvant therapy” broadly refers to an agent that affects an immunological or physiological response in a patient or subject (e.g., human). For example, an adjuvant might increase the presence of an antigen over time or in an area of interest, help absorb an antigen presenting cell antigen, activate macrophages and lymphocytes and/or support the production of cytokines. By modulating an immune response, an adjuvant might permit a smaller dose of an immune interacting agent to increase the effectiveness or safety of a particular dose of the immune interacting agent. For example, an adjuvant might prevent T cell exhaustion and thus increase the effectiveness or safety of a particular immune interacting agent.

“Administering” or “administration of’ a substance, a compound or an agent to a subject can be carried out using one of a variety of methods known to those skilled in the art. For example, a compound or an agent can be administered intravenously, arterially, intradermally, intramuscularly, intraperitoneally, and subcutaneously. A compound or agent can also appropriately be introduced by rechargeable or biodegradable polymeric devices or other devices, e.g., patches and pumps, or formulations, which provide for the extended, slow or controlled release of the compound or agent. Administering can also be performed, for example, once, a plurality of times, and/or over one or more extended periods.

Appropriate methods of administering a substance, a compound or an agent to a subject will also depend, for example, on the age and/or the physical condition of the subject and the chemical and biological properties of the compound or agent (e.g., solubility, digestibility, bioavailability, stability and toxicity).

The term “agent” is used herein to denote a chemical compound (such as an organic or inorganic compound, a mixture of chemical compounds), a biological macromolecule (such as a nucleic acid, an antibody, including parts thereof as well as humanized, chimeric and human antibodies and monoclonal antibodies, a protein or portion thereof, e.g., a peptide, a lipid, a carbohydrate), or an extract made from biological materials such as bacteria, plants, fungi, or animal (particularly mammalian) cells or tissues. Agents include, for example, agents whose structure is known, and those whose structure is not known.

By “ameliorate” is meant decrease, suppress, attenuate, diminish, arrest, or stabilize the development or progression of a disease or symptoms thereof.

An “effective amount” or a “effective dose” of a drug or agent is an amount of a drug or an agent that when administered to a subject will have the intended effect. The full effect does not necessarily occur by administration of one dose and may occur only after administration of a series of doses. Thus, an effective amount may be administered in one or more administrations. The precise effective amount needed for a subject may depend upon, for example, the subject’s size, health, and age. The skilled worker can readily determine the effective amount for a given situation by routine experimentation.

In this disclosure, "comprises," "comprising," "containing," and "having" and the like can have the meaning ascribed to them in U.S. Patent law and can mean " includes," "including," and the like; "consisting essentially of' or "consists essentially" likewise has the meaning ascribed in U.S. Patent law and the term is open-ended, allowing for the presence of more than that which is recited so long as basic or novel characteristics of that which is recited is not changed by the presence of more than that which is recited, but excludes prior art embodiments.

By “fragment” is meant a portion of a polypeptide or nucleic acid molecule. This portion contains, preferably, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the entire length of the reference nucleic acid molecule or polypeptide. A fragment may contain 10, 20, 10 30, 40, 50, 60, 70, 80, 90, or 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 nucleotides or amino acids.

A “patient,” “subject,” and “individual” are used interchangeably and can refer to either a human or a non-human animal. These terms include mammals, such as humans, primates, livestock animals (including bovines, porcines, etc.), companion animals (e.g., canines, felines, etc.) and rodents (e.g., mice and rats). In some embodiments, the subject is a human. In some embodiments, the subject experiences one or more symptoms caused by SARS-CoV-2 infection.

The phrase “pharmaceutically acceptable” is art-recognized. In certain embodiments, the term includes compositions, excipients, adjuvants, polymers and other materials and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.

The terms “polynucleotide” and “nucleic acid molecule” are used herein interchangeably. They refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof. Polynucleotides may have any three-dimensional structure, and may perform any function, known or unknown. The following are non-limiting examples of polynucleotides: coding or non-coding regions of a gene or gene fragment, loci (locus) defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, synthetic polynucleotides, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. The sequence of nucleotides may be interrupted by non-nucleotide components. A polynucleotide may be further modified, such as by conjugation with a labeling component.

The term "polypeptide" refers to a polymer of amino acids and its equivalent and does not refer to a specific length of the product; thus, peptides, oligopeptides and proteins are included within the definition of a polypeptide. This term also does not refer to, or exclude modifications of the polypeptide, for example, glycosylations, acetylations, phosphorylations, and the like. Included within the definition are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, natural amino acids, etc.), polypeptides with substituted linkages as well as other modifications known in the art, both naturally and non- naturally occurring.

“Identity” as between nucleic acid sequences of two nucleic acid molecules can be determined as a percentage of identity using known computer algorithms such as the “FASTA” program, using for example, the default parameters as in Pearson et al. (1988) Proc. Natl. Acad. Sci. USA 85:2444 (other programs include the GCG program package (Devereux, J. et al., Nucleic Acids Research 12(I):387 (1984)), BLASTP, BLASTN, FASTA Atschul, S. F. et al., J Molec Biol 215:403 (1990); Guide to Huge Computers, Mrtin J. Bishop, ed., Academic Press, San Diego, 1994, and Carillo et al. (1988) SIAM J Applied Math 48:1073). For example, the BLAST function of the National Center for Biotechnology Information database can be used to determine identity. Other commercially or publicly available programs include, DNAStar “MegAlign” program (Madison, Wis.) and the University of Wisconsin Genetics Computer Group (UWG) “Gap” program (Madison Wis.)). Nucleic acid molecules useful in the methods of the invention include any nucleic acid molecule that encodes a polypeptide of the invention or a fragment thereof. Such nucleic acid molecules need not be 100% identical with an endogenous nucleic acid sequence, but will typically exhibit substantial identity. Polynucleotides having “substantial identity” to an endogenous sequence are typically capable of hybridizing with at least one strand of a double-stranded nucleic acid molecule. Nucleic acid molecules useful in the methods of the invention include any nucleic acid molecule that encodes a polypeptide of the invention or a fragment thereof. Such nucleic acid molecules need not be 100% identical with an endogenous nucleic acid sequence, but will typically exhibit substantial identity.

Polynucleotides having “substantial identity” to an endogenous sequence are typically capable of hybridizing with at least one strand of a double-stranded nucleic acid molecule. By "hybridize" is meant pair to form a double-stranded molecule between complementary polynucleotide sequences (e.g., a gene described herein), or portions thereof, under various conditions of stringency. (See, e.g., Wahl, G. M. and S. L. Berger (1987) Methods Enzymol. 152:399; Kimmel, A. R. (1987) Methods Enzymol. 152:507).

For example, stringent salt concentration will ordinarily be less than about 750 mM NaCl and 75 mM trisodium citrate, preferably less than about 500 mM NaCl and 50 mM trisodium citrate, and more preferably less than about 250 mM NaCl and 25 mM trisodium citrate. Low stringency hybridization can be obtained in the absence of organic solvent, e.g., formamide, while high stringency hybridization can be obtained in the presence of at least about 35% formamide, and more preferably at least about 50% formamide. Stringent temperature conditions will ordinarily include temperatures of at least about 30°C, more preferably of at least about 37°C, and most preferably of at least about 42°C. Varying additional parameters, such as hybridization time, the concentration of detergent, e.g., sodium dodecyl sulfate (SDS), and the inclusion or exclusion of carrier DNA, are well known to those skilled in the art. Various levels of stringency are accomplished by combining these various conditions as needed. In a preferred: embodiment, hybridization will occur at 30°C in 750 mM NaCl, 75 mM trisodium citrate, and 1% SDS. In a more preferred embodiment, hybridization will occur at 37°C in 500 mM NaCl, 50 mM trisodium citrate, 1% SDS, 35% formamide, and 100 pg/ml denatured salmon sperm DNA (ssDNA). In a most preferred embodiment, hybridization will occur at 42°C in 250 mM NaCl, 25 mM trisodium citrate, 1% SDS, 50% formamide, and 200 pg/ml ssDNA. Useful variations on these conditions will be readily apparent to those skilled in the art.

For most applications, washing steps that follow hybridization will also vary in stringency. Wash stringency conditions can be defined by salt concentration and by temperature. As above, wash stringency can be increased by decreasing salt concentration or by increasing temperature. For example, stringent salt concentration for the wash steps will preferably be less than about 30 mM NaCl and 3 mM trisodium citrate, and most preferably less than about 15 mM NaCl and 1.5 mM trisodium citrate. Stringent temperature conditions for the wash steps will ordinarily include a temperature of at least about 25°C, more preferably of at least about 42°C, and even more preferably of at least about 68°C. In a preferred embodiment, wash steps will occur at 25°C in 30 mM NaCl, 3 mM trisodium citrate, and 0.1% SDS. In a more preferred embodiment, wash steps will occur at 42°C in 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1% SDS. In a more preferred embodiment, wash steps will occur at 68°C in 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1% SDS. Additional variations on these conditions will be readily apparent to those skilled in the art. Hybridization techniques are well known to those skilled in the art and are described, for example, in Benton and Davis (Science 196:180, 1977); Grunstein and Hogness (Proc. Natl. Acad. Sci., USA 72:3961, 1975); Ausubel et al. (Current Protocols in Molecular Biology, Wiley Interscience, New York, 2001); Berger and Kimmel (Guide to Molecular Cloning Techniques, 1987, Academic Press, New York); and Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York.

By "substantially identical" is meant a polypeptide or nucleic acid molecule exhibiting at least 50% identity to a reference amino acid sequence (for example, any one of the amino acid sequences described herein) or nucleic acid sequence (for example, any one of the nucleic acid sequences described herein). Preferably, such a sequence is at least 60%, more preferably 80% or 85%, and more preferably 90%, 95%, or even 99% identical at the amino acid level or nucleic acid to the sequence used for comparison.

Sequence identity is typically measured using sequence analysis software (for example, Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705, BLAST, BESTFIT, GAP, or PILEUP/PRETTYBOX programs). Such software matches identical or similar sequences by assigning degrees of homology to various substitutions, deletions, and/or other modifications. Conservative substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid, asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine. In an exemplary approach to determining the degree of identity, a BLAST program may be used, with a probability score between e’³ and e^-100 indicating a closely related sequence.

“Strain” refers to a member of a viral species with a genetic signature such that it may be differentiated from closely-related members of the same viral species. The genetic signature may be the absence of all or part of at least one gene, the absence of all or part of at least on regulatory region (e.g., a promoter), the presence of at least one mutated gene, the presence at least one mutated regulatory region (e.g., a promoter), or a combination thereof. Genetic signatures between different strains may be identified by PCR amplification optionally followed by DNA sequencing of the genomic region(s) of interest or of the whole genome.

As used herein, the terms “treat,” treating,” “treatment,” and the like refer to reducing or ameliorating a disorder and/or symptoms associated therewith. It will be appreciated that, although not precluded, treating a disorder or condition does not require that the disorder, condition or symptoms associated therewith be completely eliminated.

“Treating” a condition or subject refers to taking steps to obtain beneficial or desired results, including clinical results. As used herein, and as well understood in the art, “treatment” is an approach for obtaining beneficial or desired results, including clinical results. Beneficial or desired clinical results can include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions, diminishment of extent of disease, stabilized (z.e., not worsening) state of disease, preventing spread of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable. “Treatment” can also mean prolonging survival as compared to expected survival if not receiving treatment.

As used herein, a therapeutic that “prevents” an infection, disorder, disease, or condition refers to a composition that, in a statistical sample, reduces the occurrence of the disorder or condition in the treated sample relative to an untreated control sample, or delays the onset or reduces the severity of one or more symptoms of the disorder or condition relative to the untreated control sample. The term "vaccine," as used herein, refers to an agent that upon administration to a mammal activates, promotes, elicits, and/or enhances an immune response such as a cellular immune response and/or a humoral response. A cellular immune response can include a T cell response, which generates certain cytokines that impair virus replication and/or other functions necessary for viral propagation. For example, the ORFV-based vaccines described herein activate both CD4+ T cells and CD8+ T cells. Induced CD4+ T cells are responsible for the synthesis of cytokines, such as IFNy, IL-2, and TNFα. CD8+ T cells may be cytotoxic T cells and also secrete cytokines such as IFNy and TNFα. Cytokines produced by these cells activate additional T cells and macrophages and recruit polymorphonuclear leukocytes to the site of infection. The vaccines contemplated herein can be monovalent, multivalent, or polyvalent.

Unless specifically stated or obvious from context, as used herein, the term “about” is understood as within a range of normal tolerance in the art, for example within 2 standard deviations of the mean. About can be understood as within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated value. Unless otherwise clear from context, all numerical values provided herein are modified by the term about.

Any compositions or methods provided herein can be combined with one or more of any of the other compositions and methods provided herein.

SARS-CoV-2 Vaccines

To address the urgent need of effective protection against SARS-CoV-2 in the ongoing COVID- 19 pandemic, monovalent and multivalent SARS-CoV-2 vaccines capable of activating, promoting, eliciting, and/or enhancing cellular and humoral immune responses against the virus are described herein. The disclosed vaccines utilize a recombinant Orf virus (ORFV) comprising a nucleic acid molecule that encodes a SARS-CoV-2 antigen. In some embodiments, the SARS- CoV-2 antigen can be an optimized spike (S) protein, the viral nucleocapsid (N) protein, or both to activate, promote, elicit, and/or enhance an immune response. In some embodiments, the ORFV vector is an ORFV D1701-V vector, which is suitable for repeated administration (e.g., booster vaccines and seasonal vaccines). Vaccines as described herein are effective in generating SARS-CoV-2 neutralizing antibodies as well as N- and S-specific T cell responses in mice and rhesus macaques. ORFV

The Orf virus (ORFV) is a parapoxvirus within the Poxviridae family and Chordopoxvirinae subfamily, which includes four species including the Bovine papular stomatitis virus (BPSV), Parapoxvirus of red deer in New Zealand (PVNZ), the Pseudocowpox virus (PCPV), and ORFV. ORFV is capable of infecting mammals, such as goats and sheep, often resulting a condition referred to as “sore mouth,” which can result in skin lesions, generally around the mouth. The virus is transmissible to humans and cause lesions on the hands.

Naturally occurring ORFVs comprise a genome of over 130,000 base pairs that encode approximately 130 genes. Modified ORFV are known in the art and have been studied as viral vectors for various applications. The attenuated strains DI 701 and D1701-V have been studied and modified to improve its function as a vector. For example, the ORFV strain D1701-V comprises properties that are favorable for the development of a vector platform technology because it is not associated with systemic spread and has very restricted host and tissue (z.e., skin) tropism, making the occurrence of pre-immunity against the virus in humans unlikely (Haig, D.M. (1997) Comp Immunol Microbiol Infect Dis, 20(3): 197-204; Buttner, M. and H.J. Rziha (2002) J Vet Med B Infect Dis Vet Public Health, 49(1 ):7-l 6; Rziha, H. et al. (2000) J Biotechnol, 83(1 -2): 137-45; Brun, A. et al. (2008) Vaccine, 26(51):6508-28). The lack of anti- ORFV neutralizing antibodies in infected animals is evidence of the virus’s lack of immunogenicity (Buddle, B.M. et al. (1984) Am J Vet Res, 45(2):263-6; Haig, D.M. and A. A. Mercer (1998) Orf. Vet Res, 29(3-4):311-26). Moreover, the highly specific virus/host interactions that result in short-term, weak immune responses against ORFV allow repeated vector administration (Fischer, T. et al. (2003) J Virol, 77(17):9312-23; Haig, D.M. and Mclnnes, C.J. (2002) Virus Research, 88(1):3-16; Kruse, N. and Weber, O. (2001) J Virol, 75(10):4699-704).

The ORFV D1701-V strain, obtained from the bovine kidney cell line BK-KL3A-adapted strain D1701-B, has several genomic rearrangements that confer improved growth in the African green monkey cell line Vero (Cottone, R. et al. (1998) Virus Research, 56(l):53-67; Rziha, H.J. et al. (2000) J Biotechnology, 83(1): 137-145). These genomic rearrangements include the deletion or inactivation of genes that are non-essential for the strain’s replication, and these loci are suitable for transgene expression (e.g., the deleted region D (D locus) (Rziha, H. J. et al. (2019) Viruses, 11(2): 127)). For example, genes encoding virulence factors can be targeted as insertion sites. The angiogenic factor VEGF-E, a predicted major virulence determinant responsible for the induction of bloody lesions in sheep (Rziha, H.J. et al. (2000)), can be used as insertion site to generate ORFV recombinants. An ORFV vector carrying a transgene can be used to initiate long-lasting immunity with a high protective efficacy against several viral diseases in different hosts (Fischer, T. et al. (2003) J Virol, 77(17):9312-9323; Henkel, M. et al. (2005) J. Virol, 79(1):314-325; Dory, D. et al. (2006) Vaccine, 24(37):6256-6263; Voigt, H. et al. (2007) Vaccine, 25(31):5915-5926;van Rooij, E.M.A. et al. (2010) Vaccine, 28(7): 1808- 1813; Rohde, J. et al. (2011) Vaccine, 29(49):9256-9264; Amann, R. et al. (2013) J Virol, 87(3): 1618-1630; Rohde, J., R. Amann, and H.-J. Rziha (2013) PloS One, 8(12): e83802- e83802). For example, D1701-V vectors expressing antigens of diverse pathogens including Pseudorabies virus, Rabies virus, Borna disease virus, Influenza A virus and Classical swine fever virus have been shown to induce excellent, long-term protective immunity in many different hosts without the need of an adjuvant (Haig, D.M. et al. (1997) Comp Immunol Microbiol Infect Dis, 20(3): 197-204; Buttner, M. and H.J. Rziha (2002) J Vet Med B Infect Dis Vet Public Health, 49(1):7-16; Fischer, T. et al., (2003) J Virol, 77(17): 9312-23; Henkel, M. et al. (2005) J Virol, 79(1):314-25; Dory, D. et al. (2006) Vaccine, 24(37-39):6256-63. Voigt, H. et al. (2007) Vaccine, 25(31 ):5915-26; van Rooij, E.M. et al. (2010) Vaccine, 28(7): 1808-13; Rohde, J. et al. (2011) Vaccine, 29(49):9256-64; Amann, R. et al. (2013) J Virol, 87(3): 1618- 30; Rohde, J. et al. (2013) PLoS One, 8( 12):e83802).

Animals reinfected by ORFV experience an activated, promoted, elicited, and/or enhanced inflammatory and typical antiviral T-helper type 1 adaptive immune response during the early stage of infection (Fleming, S.B. et al. (2015) Viruses, 7(3): 1505-39). Thus, histological analyses on infected tissue showed an infiltration of neutrophils, T cells, B cells and DCs, with CD4+ T cells being predominant in infected skin (Fleming, S.B. et al. (2015); Haig, D.M. and Mclnnes, C.J. (2002) Virus Research, 88(1 ):3-16). These results were confirmed by investigations on afferent and efferent lymph draining the site of infection, while analyses on cultured lymph cells from the afferent lymph and ORFV infected tissue suggested production of GM-CSF, IL-1, IL-2, IL-8, IFNy, and TNFα (Haig and Mclnnes (2002); Anderson, I.E. et al. (2001) Vet Immunol Immunopathol, 83(3-4): 161 -76; Buddle, B.M. and Pulford, H.D. (1984) Vet Microbiol, 9(6):515-22). The observed immune responses do not appear to impact immunologic memory due to a strong delayed-type hypersensitivity to ORFV, however, protective immunity against ORFV elicited by virus vaccines only lasts for approximately 6-8 months (Mayr, A. et al. (1981) Zentralbl Veterinarmed B, 28(7):535-52; Pye, D. (1990) Aust Vet J, 67(5): 182-6;

Nettleton, P.F. et al. (1996) Vet Rec, 138(8): 184-6). The ability to re-infect its host thus indicates potent intrinsic immune escape mechanisms mediated by ORFV encoded immunomodulators.

Recent analyses on the mode of action revealed D1701-V to target professional APCs for heterologous transgene expression and activation of distinct immune cells including T cells, B cells, and NK cells (Muller, M., Weiterentwicklung des Orf-Virus Stamms D1701-V zur Verwendung als therapeutische Vektor-Vakzine, in Interfaculty Institute of Cell Biology, Department of Immunology. 2019, Dissertation Eberhard Karls Universitat Tubingen: Tubingen). D1701-V’s favorable properties has led to the vector being developed as a platform technology to deliver heterologous microbial antigens to the immune system.

Thus, one aspect of the present disclosure provides an ORFV comprising a nucleic acid molecule encoding at least one SARS-CoV-2 antigen. The ORFV can be an unmodified or a modified ORFV. In some embodiments, an ORFV may be modified at one or more genomic loci. For example, certain loci in the ORFV genome may be absent or used as insertion sites in a modified ORFV or comprise changes in the nucleic acid molecule relative to an unmodified ORFV.

The ORFV may be an attenuated strain. ORFV strain D1701 is an attenuated strain that has been studied in the context of viral delivery of transgenes to cells. The nucleic acid sequence of the ORFV strain D1701 genome is known (GenBank Accession Number HM133903.1). In some embodiments, the ORFV has a genome comprising the nucleic acid molecule of the ORFV strain D1701. The ORFV of the present invention may have a genome comprising a nucleic acid sequence that has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even greater sequence identity to the genome sequence of ORFV strain DI 701.

In some embodiments, the recombinant ORFV is a ORFV strain D1701-V or a modified ORFV strain D1701-V. In some embodiments, the ORFV strain comprises at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity (e.g., at least 99.5% sequence identity, at least 99.6% sequence identity, at least 99.7% sequence identity, at least 99.8% sequence identity, at least 99.9% sequence identity to the nucleotide sequence (e.g., genomic sequence disregarding the presence of transgenes (e.g., the transgenes encoding SARS-CoV-2 antigens)) of the ORFV- D1701-V.

Inserting transgenes into particular genomic loci of the ORFV can effectively impair or render nonfunctional the ORFV gene or genes at that loci. For example, a transgene can be inserted into the genomic locus comprising the vascular endothelial growth factor (VEGF) gene, which is associated with the virus’s pathogenicity. Inserting a transgene into a pathogenic gene (e.g., VEGF) or locus reduces or eliminates expression of the encoded virulence factor and further reduces the likelihood of an adverse event caused by ORFV infection in a subject. Using genomic loci as insertion sites for nucleic acid molecules encoding at least one SARS-CoV-2 antigen allows the production of mono-, multi-, and polyvalent ORFV vaccines. Thus, in some embodiments, the ORFV genome comprises one or more transgenes encoding a SARS-CoV-2 antigen, two SARS-CoV-2 antigens, or even three or more SARS-CoV-2 antigens.

Other loci in the ORFV genome can be used as an insertion site. In some embodiments, the Del2 loci is used as an insertion site. In some embodiments, the Del 12, Dell 19, and/or Del 126 loci are used as insertion sites.

In some embodiments, the ORFV vectors of the present disclosure further comprise a transcription regulatory element (e.g., a promoter, an enhancer, a transcription termination sequence. In some embodiments, the ORFV vectors of the present disclosure further comprise a translation regulatory element.

The ORFV genome comprises multiple endogenous promoters (e.g., the early promoters, ePl, eP2, and P7 and late promoter PF1; Table 1). Constructs can be designed to insert a desired transgene into the ORFV genome such that the transgene’s expression is driven by an endogenous ORFV promoter. For example, an ORFV can be modified such that transgene expression is improved by using at least one of the strong early promoters ePl, eP2, P7, the late promoter PF1, or the vegf promoter. In some embodiments, ORFV constructs can be designed to have a heterologous promoter (e.g., CMV promoter) drive expression of a transgene.

Table 1: Promoters

Antigens

As used herein, the term “antigen” or “antigenic polypeptide” refers to any natural or synthetic immunogenic substance, such as a protein, peptide, or hapten. An antigen may be a SARS-CoV-2 antigen, or a fragment thereof, against which immune responses are desired. In some embodiments a full-length a SARS-CoV-2 polypeptide or a fragment thereof is an antigen that is capable of activating, promoting, eliciting, and/or enhancing an immune reaction in the subject exposed to the antigen. Provided herein are ORFVs that comprise the coding sequence for at least one SARS-CoV-2 polypeptide. An ORFV can comprise a coding sequence of a fragment of an SARS-CoV-2 protein, such as a subunit of a polypeptide or a particularly immunogenic fragment or epitope of the antigenic polypeptide. A fragment of an antigenic polypeptide may be suitable, especially if multiple coding sequences for SARS-CoV-2 polypeptides are added to an ORFV genome. For example, an ORFV may comprise a single coding sequence for a Spike (S) protein or more than one coding sequence S protein. In some embodiments, an ORFV comprises a single coding sequence for a Nucleocapsid (N) protein or more than one coding sequence for an N protein. An ORFV can comprise coding sequences for different SARS-CoV-2 proteins. For example, an ORFV can comprise a coding sequence for an S protein and an N protein.

The nucleic acid sequence encoding a SARS-CoV-2 antigen can be any nucleic acid sequence in the SARS-CoV-2 genome that, once expressed, activates, promotes, elicits, and/or enhances an immune reaction in the subject that was administered the ORFV vector composition. The SARS-CoV-2 antigen can be the S protein or a fragment thereof. In some embodiments, the SARS-CoV-2 antigen is an S protein having a transmembrane domain. In some embodiments, the SARS-CoV-2 antigen is a full-length S protein. A fragment of the SARS-CoV-2 antigen be a subunit, or fragment thereof, of the S protein. S protein comprises two subunits, S1 and S2. In some embodiments, the pharmaceutical composition comprises an ORFV vector having a nucleic acid molecule that encodes the SI subunit, the S2 subunit, or both subunits. The SARS-CoV-2 antigen can be a fragment of the S protein; for example, a fragment of the SI or S2 subunit. The SI subunit comprises the receptor binding domain (RBD), which is responsible for the S protein binding to the ACE2 receptor, thereby mediating entry of the virus into ACE2 receptor expressing cells. Thus, in some embodiments, an ORFV comprising a nucleic acid molecule encoding the SI subunit will promote in a subject that received the pharmaceutical composition the generation of anti-Sl antibodies that block the interaction between the SARS-CoV-2 virus and the ACE2 receptor.

The ORFV can comprise a nucleic acid molecule that encodes the N protein or a fragment thereof. The N protein is a positively charged RNA binding protein that is involved in genome packaging and self-assembly of oligomer. Two N-proteins may dimerize via interactions between their C-terminal domains (Yang et al. (2021) Front. Chem., 8:art. 624765). In some embodiments, an ORFV vector having a nucleic acid molecule encoding the N protein or a fragment thereof will promote the generation of anti-N antibodies that block the interaction or dimerization of N-proteins.

The sequences of the N and S proteins are known and subtle differences in the nucleic acid and amino acid sequences have been observed, and additional differences will likely emerge, between different strains of the SARS-CoV-2 virus. In some embodiments, the nucleic acid molecules encoding the S and N proteins comprise the nucleic acid sequences shown in Table 2 (SEQ ID NOs: 5 and 8, respectively) or a fragment thereof. In some embodiments, the S protein comprises the amino acid sequence of SEQ ID NO: 6 or 7 or a fragment thereof. SEQ ID NO:6 discloses an amino acid sequence that comprises a D614G mutation and a proline stabilization dipeptide motif (K986P and V987P) relative to SEQ ID NO:7. SEQ ID NO:6 also comprises a furin cleavage site mutation (z.e., GSAS (SEQ ID NO: 11 : instead of wildtype RRAR (SEQ ID NO: 12)

Table 2: SARS-CoV-2 Polypeptide SEQUENCES

The nucleic acid molecule encoding the S protein can comprise a nucleic acid sequence that is about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% identical to SEQ ID NO: 5 or a fragment thereof.

The S protein can comprise an amino acid sequence that is about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% identical to SEQ ID NO:6.

In some embodiments, the S protein comprises an amino acid sequence that is about SEQ ID NO:3 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% identical to SEQ ID NO:7.

The nucleic acid molecule encoding the N protein can comprise a nucleic acid sequence that is about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% identical to SEQ ID NO:8.

The N protein can comprise an amino acid sequence that is about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% identical to SEQ ID NO:9.

In some embodiments, the N protein comprises an amino acid sequence that is about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% identical to SEQ ID NO: 10.

Production of Recombinant ORFV vectors

Methods of producing recombinant vectors are known in the art, and any such method can be used to produce the ORFV vectors disclosed herein. In certain aspects, provided herein are transfer plasmids, or nucleic acid vectors, that are used to integrate a polynucleotide of interest into an ORFV vector. Integration into an ORFV vector may be driven by cellular processes, such as homologous recombination or non-homologous end-joining (NHEJ). The integration may also be initiated and/or facilitated by an exogenously introduced nuclease.

In preferred embodiments, the transfer plasmids comprise at least one SARS-CoV-2 antigen-encoding nucleic acid. In some embodiments, the SARS-CoV-2 nucleic acid is destined for integration into a locus of an ORFV vector genome.

The at least one SARS-CoV-2 nucleic acid (either forward or reverse orientation) is flanked by a ORFV vector 5’ homology arm and/or an ORFV vector 3’ homology arm, wherein the homology arm comprises a nucleic acid sequence that is at least, about, or no more than 70%,

71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%,

87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%,

99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% identical to the target ORFV locus.

For example, SEQ ID NOs:13 and 14 below show a partial sequence of the S protein

(CoV2-Spike_FL-TM) inserted into the VEGF locus of the ORFV genome and a partial sequence of the N protein (“CoV2-N) inserted into Del2 locus of the ORFV genome. The lowercase letters represent ORFV genomic sequence and the uppercase letters represent the

SARS-CoV-2 antigen sequence. Uppercase and italized letters represent primers used to generate the SARS-CoV-2 insert comprising homology arms to the ORFV insertion site. The intervening lowercase letters between the SARS-CoV-2 sequence and the primer sequence are the homology arms.

SEQ ID NO: 13: cccgggctgcacgaacttcctgcacgtggacctgaagcccgacaacgtgctcatcttcgacagcgcgcgcgcgctcagcgtgactg cggccggtgcgacttttcgcttcgaagagcccgtgcgcgcggcgctgaacgacttcgacttcgcgcgcgtggccaccatcgagaacc gcaagatcgcgggcagcgtccgcgtgccgcagaactggtactacgacttccacttcttcgcgcacacgctgctgcgcgcgtacccgc acatcgccgcggaggacccgggcttccacgcgctgctctcggagctcacggtctcgtgctcgcgcgggacctgcgaccgcttccggc tgcgcgtgtcctcgccgcaccccatcgagcacctcgcgcggctggtgcgccgcgacgtcttctcccgctggataaatgccgccgcgg acgcccccgacgccgcactctcctgagcccacgcccgcggcgccgggctcgctgtacgacgtcttcctcgcgcgcttcctgcgccag ctggccgcgcgcgcggcgccggcctcggccgcctgcgccgtgcgcgtgggtgcggtgcgcggccgcctgcggaactgcgagctg gtggtgctgaaccgctgccacgcggacgctgccggcgcgctcgcgctggcctccgcggcgctggcggaaacgctggcggagctgc cgcgcgcggacaggctcgccgtcgcgcgcgagctgggcgtggacccagagcacccggagctgacgccggaccccgcctgcgc gggcgagagcgcgcttgcgcagaacatcgacatccagacgctggacctgggcgactgcggcgaccccaaaggccgccgactgc gcgtggcgctggtgaacagcggccacgcggccgcaaactgcgcgctcgcgcgcgtagcgaccgcgctgacgcgccgcgtgccc gcaagccggcacggcctcgcggagggcggcacgccgccgtggacgctgctgctggcggtggccgcggtgacGGTGCTCA GCGTGGTGGCGGTTTcgctgctgcggcgcgcgctgcgggtgcgctaccaattcgcgcggccggccgcgctgcgcgcgta gccgcgcaaaatgtaaatataacgcccatcccgggataagctaaatataAT GTT CGT GTT OCT GGTGCT GOT GC CCCTGGTGTCTAGCCAGTGTGTGAACCTGACCACCAGAACACAGCTGCCTCCAGCCTACA CCAACAGCTTCACCAGAGGCGTGTACTACCCCGACAAGGTGTTCAGATCCAGCGTGCTGC ACTCTACCCAGGACCTGTTCCTGCCTTTCTTCAGCAACGTGACCTGGTTCCACGCCATCCA CGTGTCCGGCACCAATGGCACCAAGAGATTCGACAACCCCGTGCTGCCCTTCAACGACGG GGTGTACTTTGCCAGCACCGAGAAGTCCAACATCATCAGAGGCTGGATCTTCGGCACCAC ACTGGACAGCAAGACCCAGAGCCTGCTGATCGTGAACAACGCCACCAACGTGGTCATCAA AGTGTGCGAGTTCCAGTTCTGCAACGACCCCTTCCTGGGCGTCTACTACCACAAGAACAAC AAGAGCTGGATGGAAAGCGAGTTCCGGGTGTACAGCAGCGCCAACAACTGCACCTTCGAG TACGTGTCCCAGCCTTTCCTGATGGACCTGGAAGGCAAGCAGGGCAACTTCAAGAACCTG CGCGAGTTCGTGTTTAAGAACATCGACGGCTACTTCAAGATCTACAGCAAGCACACCCCTA TCAACCTCGTGCGGGATCTGCCTCAGGGCTTCTCTGCTCTGGAACCCCTGGTGGATCTGC CCATCGGCATCAACATCACCCGGTTTCAGACACTGCTGGCCCTGCACAGAAGCTACCTGA CACCTGGCGATAGCAGCTCTGGATGGACAGCTGGCGCCGCTGCCTACTATGTTGGCTACC TGCAGCCTCGGACCTTCCTGCTGAAGTACAACGAGAACGGCACCATCACCGACGCCGTGG ATTGTGCCCTTGATCCTCTGAGCGAGACAAAGTGCACCCTGAAGTCCTTCACCGTGGAAAA GGGCATCTACCAGACCAGCAACTTCCGGGTGCAGCCCACCGAATCCATCGTGCGGTTCCC CAATATCACCAATCTGTGCCCCTTCGGCGAGGTGTTCAATGCCACCAGATTCGCCTCTGTG TACGCCTGGAACCGGAAGCGGATCAGCAATTGCGTGGCCGACTACTCCGTGCTGTACAAC TCCGCCAGCTTCAGCACCTTCAAGTGCTACGGCGTGTCCCCTACCAAGCTGAACGACCTG TGCTTCACAAACGTGTACGCCGACAGCTTCGTGATCCGGGGAGATGAAGTGCGGCAGATT GCCCCTGGACAGACAGGCAAGATCGCCGACTACAACTACAAGCTGCCCGACGACTTCACC GGCTGTGTGATTGCCTGGAACAGCAACAACCTGGACTCCAAAGTCGGCGGCAACTACAAT TACCTGTACCGGCTGTTTCGGAAGTCCAATCTGAAGCCCTTCGAGCGGGACATCTCCACC GAGATCTATCAGGCCGGCAGCACCCCTTGTAACGGCGTGGAAGGCTTCAACTGCTACTTC CCACTGCAGTCCTACGGCTTTCAGCCCACAAATGGCGTGGGCTACCAGCCTTACAGAGTG GTGGTGCTGAGCTTCGAGCTGCTGCATGCTCCTGCCACAGTGTGCGGCCCTAAGAAAAGC ACCAATCTCGTGAAGAACAAATGCGTGAACTTCAACTTCAACGGCCTGACCGGCACCGGC GTGCTGACAGAGAGCAACAAGAAGTTCCTGCCATTCCAGCAGTTCGGCCGGGACATTGCC GATACCACAGACGCCGTTAGAGATCCCCAGACACTGGAAATCCTGGACATCACCCCTTGC AGCTTCGGCGGAGTGTCTGTGATCACCCCTGGCACCAACACCAGCAATCAGGTGGCAGTG CTGTACCAGGGCGTGAACTGTACAGAGGTGCCAGTGGCCATTCACGCCGATCAGCTGACC CCTACTTGGCGGGTGTACTCCACAGGCAGCAATGTGTTTCAGACCAGAGCCGGCTGTCTG ATCGGAGCCGAGCACGTGAACAATAGCTACGAGTGCGACATCCCCATCGGCGCTGGCATC TGTGCCAGCTACCAGACACAGACAAACAGCCCTGGCAGCGCCTCTTCTGTGGCCAGCCAG AGCATCATTGCCTACACAATGTCTCTGGGCGCCGAGAACAGCGTGGCCTACTCCAACAAC TCTATCGCTATCCCCACCAACTTCACCATCAGCGTGACCACAGAGATCCTGCCTGTGTCCA TGACCAAGACCAGCGTGGACTGCACCATGTACATCTGCGGCGATTCCACCGAGTGCTCCA ACCTGCTGCTGCAGTACGGCAGCTTCTGCACCCAGCTGAATAGAGCCCTGACAGGGATCG CCGTGGAACAGGACAAGAACACCCAAGAGGTGTTCGCCCAAGTGAAGCAGATCTACAAGA CCCCTCCTATCAAGGACTTCGGCGGCTTCAATTTCAGCCAGATTCTGCCCGATCCTAGCAA GCCCAGCAAGCGGAGCTTCATCGAGGACCTGCTGTTCAACAAAGTGACACTGGCCGACGC CGGCTTCATCAAGCAGTATGGCGATTGTCTGGGCGATATTGCCGCCAGGGATCTGATCTG CGCCCAGAAGTTTAACGGACTGACAGTGCTGCCTCCTCTGCTGACCGATGAGATGATCGC CCAGTACACATCTGCCCTGCTGGCCGGCACAATCACAAGCGGCTGGACATTTGGAGCTGG CGCTGCCCTGCAGATCCCCTTTGCTATGCAGATGGCCTACCGGTTCAACGGCATCGGAGT GACCCAGAATGTGCTGTACGAGAACCAGAAGCTGATCGCCAACCAGTTCAACAGCGCCAT CGGCAAGATCCAGGACAGCCTGAGCAGCACAGCAAGCGCCCTGGGAAAGCTGCAGGACG TGGTCAACCAGAATGCCCAGGCACTGAACACCCTGGTCAAGCAGCTGTCTAGCAACTTCG GCGCCATCAGCTCTGTGCTGAATGACATCCTGTCCAGACTGGACCCTCCTGAGGCCGAGG TGCAGATCGACAGACTGATCACAGGCAGACTGCAGAGCCTCCAGACATACGTGACCCAGC AGCTGATCAGAGCCGCCGAGATTAGAGCCTCTGCCAATCTGGCCGCCACCAAGATGTCTG AGTGTGTGCTGGGCCAGAGCAAGAGAGTGGACTTTTGCGGCAAGGGCTACCACCTGATGA GCTTCCCTCAGTCTGCTCCTCACGGCGTGGTGTTTCTGCACGTGACCTACGTGCCCGCTC AAGAGAAGAATTTCACCACCGCTCCAGCCATCTGCCACGACGGCAAAGCCCACTTTCCTA GAGAAGGCGTGTTCGTGTCCAACGGCACCCATTGGTTCGTGACACAGCGGAACTTCTACG AGCCCCAGATCATCACCACCGACAACACCTTCGTGTCTGGCAACTGCGACGTCGTGATCG GCATTGTGAACAATACCGTGTACGACCCTCTGCAGCCCGAGCTGGACAGCTTCAAAGAGG AACTGGACAAGTACTTTAAGAACCACACAAGCCCCGACGTGGACCTGGGCGATATCTCTG GCATCAATGCCAGCGTGGTCAACATCCAGAAAGAGATCGACCGGCTGAACGAGGTGGCCA AGAACCTGAACGAGAGCCTGATCGACCTGCAAGAGCTGGGGAAGTACGAGCAGTACATCA AGTGGCCCTGGTACATCTGGCTGGGCTTTATCGCCGGACTGATCGCCATCGTGATGGTCA CAATCATGCTGTGCTGCATGACCAGCTGCTGTAGCTGCCTGAAGGGCTGTTGTAGCTGTG GCAGCTGCTGCAAGTTCGACGAGGACGATTCTGAGCCCGTGCTGAAGGGCGTGAAGCTG CACT ACACCT GAT GAT GATTTTT GT GGAT CCACTAGTGaattcatcgtcgacttcgagagcttagaatgcgtc cccacggaagaggcaaacgtaacgatgcaactcatgggagcgtcggtctccggtggtaacgggatgcaacatctgagcttcgtaga gcataagaaatgcgattgtaaaccaccactcacgaccacgccaccgacgACCACAAGGCCGCCCAGAAGACGC CGCTagaactttttatggaccgcatatccaaacgatgatgcgatcaggtcatgcggaaggaggctccacggagcaaagtgaaaa aggaccgcctagagtcgagacccctccctcccgcctcgggcaaacccacagccgccgcaaacaccacacccgccgacctaccat gcacccctcgccgcgccggctgctcggcgcgctcgcgctgctggcgctgggcttcgctcggcgcgctcttcgccccgcggcgccgct cgtgccggccgccttcctggaggtggggcacgtgcgcgcgaacccgtccgcctcggtgacctgcctcacggtgggcggcgacggg cggcacatggcggcggtcgcgcacggcggcgggacgctctcgccggtgtacccgctggccgccggcatgcacgcgaccttctcctc cgcgcgcaagggcgcgctgctgctgaacgtcgcgaccgtgactgtgtacgacgtgcgcgcgctcgcccccgagttcgagctcgtctg catcgcggtggtcggcggctacaactcggccgcggccgccacgcggcccgcggccgagtggcaccgccagctggagctgcgcc gctcggagctgtgacccctccctccccggtctccctctgtctttgtaatcggccttagagattagacatcatcctccacgcctctttgtccgc cgcccttcttcgcggacggatgaaccaattaattaattatttttgtcgctcgcccgctcactccggcaagggaacgagtgacgttaactct ctcaccctcacgcacaagaacaagaaccgctcactcaccgggcaagggaacacggttaaggtcaactcactcgcgagaacaagt tgaccctcactctagagaacgaggaacgggcaacaagcaaccgtcaactcacttaccacgagaacaagttgaccgccactcaaa gggaacagagaacagtaaccgttctcgctcgctcggaacaatagaacaagttaacgtcaactcgctcgctcggtgtaagagaacaa cagaacaagcaactgttgaccactcaacccccggagaagagaacaagagagcagtcaactcacccactcagtcttggatgagag gaggacgagttaacgagtactcgcacgcagagtgagagagtgaggacataataatagttaacgagttaatactcactcgctcactca gagtgagagagaaccagtgagcgagttaaccgcgcacacgagcgagagaacagtgaactgctcgcgcgctcgctcggtagcagt cggcctttcttaaaacggttcgtaaaacttttcccgagacagttcaccctccaaaacttttaaaactaaactcggaggtggcctgccctcc actctccgtaaaacttttgtaaaactgtcggaggtcggtcgacttcgcaactcgtccgcgaaaacttttcgtgggcagtgtctgcctctctc ag g ctcctcg catcactttc

SEQ ID NO: 14 cgagagcggccagggcatgatcggcgacaacgcgggcatgccgcggctcgtgtgcacgcgctcggcgtacaacggcggcgacg tcgtcgtgcggtccacgcggagcagagcggacaagaccgtggtcgcgccctgccagggcatggtgctgctgctgagccccttctgc gccttcgacatcacgccggtggagagcggctccgcgatattcgcggaggtcatcgtcaccgcgcccagcatggaccacgtcgaggc ggtcaccggcacgggcgaggcgcccgtgcggatattcaactcgcaccacccgctctggccgcgacacggctcgaacgtctgcttcg cgctgcggttgctgcgagacgcgcgcacgggcgagcgcgtggtcgagcagatgttcatagacgggcgctggcacaccgtgctgag gacgtcctgcgGCAACAAGGTCTGCGTGCCTGCCGACctcgtgggccagacgaacctcgaggaggtgcccttctg cgacgtgacgcccgagatcatgcgccgcgcgctggcgatcgacccgccgtacgaggccgtggcgcacccgcaccgctgcgtgta cggcgccatggacgtccggtgcgcgaacgagtaccttgtgtactgcaccttcaagacggagccggcgcgatatccggatttttgtgcg gccgctttttatggatccaaaaattgaaatttaaataagcttaaattataATGAGCGACAACGGGCCCCAGAACCAGC GGAATGCCCCTAGAATCACATTCGGCGGACCCAGCGATAGCACCGGCAGCAATCAGAATG GCGAGAGAAGCGGCGCCAGAAGCAAGCAGAGAAGGCCTCAAGGCCTGCCTAACAACACC GCCAGCTGGTTCACAGCCCTGACACAGCACGGCAAAGAGGACCTGAAGTTCCCTAGAGGA CAGGGCGTGCCCATCAACACCAACAGCAGCCCCGATGACCAGATCGGCTACTACAGAAGG GCCACCAGAAGAATCAGAGGCGGCGACGGCAAGATGAAGGATCTGAGCCCCAGATGGTA CTTCTACTACCTCGGCACAGGACCCGAAGCCGGACTTCCTTATGGCGCCAACAAGGACGG CATCATCTGGGTTGCAACAGAAGGCGCCCTGAACACCCCTAAGGACCACATCGGCACCAG AAATCCCGCCAACAATGCCGCCATTGTGCTGCAGTTGCCTCAGGGCACAACACTGCCCAA GGGCTTTTACGCCGAGGGCTCTAGAGGCGGATCTCAGGCCAGCAGCAGAAGCAGCTCCA GATCCAGAAACAGCTCCCGGAATAGCACCCCTGGCTCCAGCAGAGGAACAAGCCCTGCTA GAATGGCCGGCAACGGCGGAGATGCTGCTCTGGCACTTCTCCTGCTGGACCGGCTGAAT CAGCTGGAAAGCAAGATGAGCGGCAAGGGACAGCAGCAGCAGGGCCAGACCGTGACAAA GAAATCTGCCGCCGAGGCCAGCAAGAAGCCCAGACAGAAAAGAACCGCCACCAAGGCCT ACAACGTGACCCAGGCCTTTGGCAGAAGAGGCCCTGAGCAGACCCAGGGCAATTTCGGC GATCAAGAGCTGATCAGACAGGGCACCGACTACAAGCACTGGCCTCAGATCGCCCAGTTT GCCCCATCTGCCAGCGCCTTTTTCGGCATGAGCCGGATCGGCATGGAAGTGACACCTAGC GGCACCTGGCTGACATACACAGGCGCCATCAAGCTGGACGACAAGGACCCCAACTTCAAG GACCAAGTGATCCTGCTGAACAAGCACATCGACGCCTACAAGACATTCCCTCCAACCGAG CCTAAGAAGGACAAGAAGAAGAAGGCCGACGAGACACAGGCCCTGCCTCAGCGGCAAAA GAAACAGCAGACAGTGACCCTGCTGCCAGCCGCCGATCTCGACGATTTTTCCAAGCAGCT GCAGCAGAGCATGAGCAGCGCCGATTCTACACAGGCTTTTTTGTActagtatcgatacgcgtatgcatg cgatcgctttttatttaattaacctaggggccggcctttttattacggccaaaccgccggttcgctccagcgaagctgcacatggacctcg aggtggactaacggtgcgtgagcgccgtccacgtgaaggcgttcctgcaggacgcctgtagcgcccgcaaggcgcggacgccact ctactttgcggGGCATGGCTCCAACCATCCAGATCGCCGgccaaaaaacccagtaccgcgccctcagcatgtgtc gtcgccgatgtccaggaagtgctgcatgcagacagcgcgctgagggcgctcaccgcgctgacagcggtcgtggtgtgcgcaatcgc catcgcgctcgagcgcgaggcggaggccgacgccgtggaccttatccttataaaattttcaatgatatgctagtttttatgcaaccttcctt ggaaaattcggcattcaaaaatgaaataaaacggcgtttagcacgcatattattaataccgaccaccatagcaggcgtccgcagctg ccagaagaaagtcccttctgcgggctccatgtcatttcaacggggcaaccggagcatccggccggcgatgtccgaggcgttgcaga atgatttcagctacaacccgcgaccgcctccgccgagcgcagaagagattgacttcttctgcgtggacatgcgcaaagtactgatgga aatcgaggct

In some embodiments, the ORFV vector homology arm is between 10-5000 base pairs, between 50-3000 base pairs, between 100-1500 base pairs, or any integer between 10-10,000 base pairs in length. In some embodiments, the ORFV vector homology arm is between 100- 1500 base pairs in length. In some embodiments, the ORFV homology arm is at least 30 base pairs in length. In preferred embodiments, the ORFV vector homology arm is sufficient in length to mediate homology-dependent integration into the target locus in the ORFV vector genome.

In some embodiments, the at least one SARS-CoV-2 nucleic acid flanked by the ORFV homology arm(s) is in an orientation for integration in the ORFV genome in a forward orientation. In some embodiments, the at least one SARS-CoV-2 nucleic acid is in an orientation for integration in the ORFV genome in a reverse orientation.

The 5' and 3' homology arms may be any sequence that is homologous with the target sequence in the ORFV vector genome. Furthermore, the 5' and 3' homology arms may be noncoding or coding nucleotide sequences. In some embodiments, the 5' and/or 3' homology arms can be homologous to a sequence immediately upstream and/or downstream of the integration or DNA cleavage site in the ORFV vector genome. Alternatively, the 5' and/or 3' homology arms can be homologous to a sequence that is distant from the integration or DNA cleavage site, such as at least, about, or no more than 1, 2, 5, 10, 15, 20, 25, 30, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600, 625, 650, 675, 700, 725, 750, 775, 800, 825, 850, 875, 900, 925, 950, 975, 1000, 1025, 1050, 1075, 1100, 1125, 1150, 1175, 1200, 1225, 1250, 1275, 1300, 1325, 1350, 1375, 1400, 1425, 1450, 1475, 1500, 1525, 1550, 1575, 1600, 1625, 1650, 1675, 1700, 1725, 1750, 1775, 1800, 1825, 1850, 1875, 1900, 1925, 1950, 1975, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3100, 3200, 3300, 3400, 3500, 3600, 3700, 3800, 3900, 4000, 4100, 4200, 4300, 4400, 4500, 4600, 4700, 4800, 4900, 5000, or more base pairs away from the integration or DNA cleavage site, or partially or completely overlapping with the DNA cleavage site (e.g., can be a DNA break induced by an exogenously- introduced nuclease). In some embodiments, the 3' homology arm of the nucleotide sequence is proximal to an ITR.

The transfer plasmid may comprise nucleic acid sequences necessary for replication and/or maintaining the vector, e.g., replication origin, selection marker (e.g., antibiotic resistance gene (, e.g., a marker that helps selecting or screening for successful integration, such as an ampicillin resitance gene), etc. In some embodiments, the transfer plasmid comprises at least one nucleic acid sequence (i.e., a SARS-CoV-2 nucleic acid) destined for integration into a target genome (i.e., an ORFV vector genome).

In certain embodiments, the at least one SARS-CoV-2 nucleic acid is not operably linked to a promoter. The SARS-CoV-2 nucleic acid is intended to be expressed, and the expression may be driven by an ORFV endogenous promoter near the site of integration. In some embodiments, the at least one SARS-CoV-2 nucleic acid is operably linked to a promoter. In some embodiments, the at least one SARS-CoV-2 nucleic acid is operably linked to a promoter, and the promoter is selected from: (a) a promoter heterologous to the nucleic acid to which it is operably linked; (b) a promoter that facilitates the tissue-specific expression of the nucleic acid; (c) a promoter that facilitates the constitutive expression of the nucleic acid; (d) an inducible promoter; (e) an immediate early promoter of an animal DNA virus; and (f) an immediate early promoter of a virus. Pharmaceutical Compositions

Pharmaceutical compositions are provided herein that comprise a recombinant ORFV comprising a nucleic acid molecule encoding at least one SARS-CoV-2 antigen.

The pharmaceutical composition disclosed herein comprises between about 1x10⁵ and about 1x10¹⁰ viral particles or plaque forming units (PFUs). For example, the pharmaceutical composition can comprise about 1x10⁵, 2x10⁵, 3x10⁵, 4x10⁵, 5x10⁵, 6x10⁵, 7x10⁵, 8x10⁵, 9x10⁵, 1x10⁶, 2x10⁶, 3x10⁶, 4x10⁶, 5x10⁶, 6x10⁶, 7x10⁶, 8x10⁶, 9x10⁶, 1x10⁷, 2x10⁷, 3x10⁷, 4x10⁷, 5x10⁷, 6x10⁷, 7x10⁷, 8x10⁷, 9x10⁷, 1x10⁸, 2x10⁸, 3x10⁸, 4x10⁸, 5x10⁸, 6x10⁸, 7x10⁸, 8x10⁸, 9x10⁸, 1x10⁹, 2x10⁹, 3x10⁹, 4x10⁹, 5x10⁹, 6x10⁹, 7x10⁹, 8x10⁹, 9x10⁹, or 1x10¹⁰ viral particles or PFUs.

In some embodiments, the pharmaceutical composition comprises at least about 1x10⁵, 2x10⁵, 3x10⁵, 4x10⁵, 5x10⁵, 6x10⁵, 7x10⁵, 8x10⁵, 9x10⁵, 1x10⁶, 2x10⁶, 3x10⁶, 4x10⁶, 5x10⁶, 6x10⁶, 7x10⁶, 8x10⁶, 9x10⁶, 1x10⁷, 2x10⁷, 3x10⁷, 4x10⁷, 5x10⁷, 6x10⁷, 7x10⁷, 8x10⁷, 9x10⁷, 1x10⁸, 2x10⁸, 3x10⁸, 4x10⁸, 5x10⁸, 6x10⁸, 7x10⁸, 8x10⁸, 9x10⁸, 1x10⁹, 2x10⁹, 3x10⁹, 4x10⁹, 5x10⁹, 6x10⁹, 7x10⁹, 8x10⁹, 9x10⁹, or 1x10¹⁰ viral particles or PFUs.

In some aspects, the pharmaceutical compositions disclosed herein are formulated for administration to a subject (e.g., a human subject). The pharmaceutical compositions can be combined with additional active and/or inactive materials in order to produce a final product, which may be in a single dosage unit or in a multi-dose format. In some embodiments, the pharmaceutical composition is combined with an adjuvant such as an immuno-adjuvant. Immuno-adjuvants are often used with vaccines because they can increase or enhance the induction, magnitude, and/or durability of an antigen-specific immune response. Immuno- adjuvants are well known, and examples of adjuvants include, but are not limited to Freund’s adjuvant, Corneybacterium parvum, the Bacillus Calmette-Guerin (BCG) vaccine, CpG oligonucleotides, Poly(I:C), and certain cytokines.

In some embodiments, the pharmaceutical composition does not comprise an adjuvant. The ORFV vector itself can activate, promote, elicit, and/or enhance an innate immune response, including the production of cytokines (e.g., interferons, inflammatory cytokines) which have antiviral function, in a subject that receives the pharmaceutical composition

The pharmaceutical composition can comprise an excipient. Non-limiting examples of suitable excipients include a buffering agent, a preservative, and a stabilizer. In some embodiments, the excipient is a buffering agent. Non-limiting examples of suitable buffering agents include sodium citrate, magnesium carbonate, magnesium bicarbonate, calcium carbonate, and calcium bicarbonate.

In some embodiments, the excipient comprises a preservative. Non-limiting examples of suitable preservatives include antioxidants, such as alpha-tocopherol and ascorbate, and antimicrobials, such as parabens, chlorobutanol, and phenol.

The pharmaceutical composition may be contained in any appropriate amount in any suitable carrier substance, and is generally present in an amount of 1-95% by weight of the total weight of the composition. The composition may be provided in a dosage form that is suitable for intravenous, arterial, intradermal, intramuscular, intraperitoneal, subcutaneous, sublingual, oral (by ingestion), intranasal (by inhalation), and transdermally parenteral (e.g, subcutaneously, intravenously, intramuscularly, intrathecal ly, or intraperitoneally) administration route. The pharmaceutical compositions may be formulated according to conventional pharmaceutical practice (see, e.g., Remington: The Science and Practice of Pharmacy (20th ed.), ed. A. R. Gennaro, Lippincott Williams & Wilkins, 2000 and Encyclopedia of Pharmaceutical Technology, eds. J. Swarbrick and Boylan, J. C. 1988-1999, Marcel Dekker, New York).

The pharmaceutical composition may be administered parenterally by injection, infusion, or implantation (subcutaneous, intravenous, intramuscular, intraperitoneal, or the like) in dosage forms, formulations, or via suitable delivery devices or implants containing conventional, non- toxic pharmaceutically acceptable carriers and adjuvants. The formulation and preparation of such compositions are well known to those skilled in the art of pharmaceutical formulation. Formulations can be found in Remington: The Science and Practice of Pharmacy, supra.

As used herein "pharmaceutically acceptable carriers or diluents" are well known to those skilled in the art. Parenteral vehicles (for subcutaneous, intravenous, intraarterial, or intramuscular injection) include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's and fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers such as those based on Ringer's dextrose, and the like. Examples are sterile liquids such as water and oils, with or without the addition of a surfactant and other pharmaceutically acceptable adjuvants. In general, water, saline, aqueous dextrose and related sugar solutions, and glycols such as propylene glycols or polyethylene glycol are preferred liquid carriers, particularly for injectable solutions. In some embodiments, pharmaceutically acceptable carriers for liquid formulations may be aqueous or non-aqueous solutions, suspensions, emulsions or oils. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.

In some embodiments, a dose of an ORFV vector disclosed herein is about 1x10⁶ to about 1x10⁹ particles or plaque forming units (PFUs). For example, a dose of an ORFV vector described herein can be between about 1x10⁶ and 1x10⁹, between about 1x10⁶ and 9x10⁸, between about 1x10⁶ and 8x10⁸, between about 1x10⁶ and 7x10⁸, between about 1x10⁶ and 6x10⁸, between about 1x10⁶ and 5x10⁸, between about 1x10⁶ and 4x10⁸, between about 1x10⁶ and 3x10⁸, between about 1x10⁶ and 2x10⁸, between about 1x10⁶ and 1x10⁸, between about 1x10⁶ and 9x10⁷, between about 1x10⁶ and 8x10⁷, between about 1x10⁶ and 7x10⁷, between about 1x10⁶ and 6x10⁷, between about 1x10⁶ and 5x10⁷, between about 1x10⁶ and 4x10⁷, between about 1x10⁶ and 3x10⁷, between about 1x10⁶ and 2x10⁷, between about 1x10⁶ and 1x10⁷, between about 1x10⁶ and 9x10⁶, between about 1x10⁶ and 8x10⁶, between about 1x10⁶ and 7x10⁶, between about 1x10⁶ and 6x10⁶, between about 1x10⁶ and 5x10⁶, between about 1x10⁶ and 4x10⁶, between about 1x10⁶ and 3x10⁶, or between about 1x10⁶ and 2x10⁶ viral particles or PFUs. In some embodiments, a dose of an ORFV vector described herein can be between about 2x10⁶ and 1x10⁹, between about 3x10⁶ and 1x10⁹, between about 4x10⁶ and 1x10⁹, between about 5x10⁶ and 1x10⁹, between about 6x10⁶ and 1x10⁹, between about 7x10⁶ and 1x10⁹, between about 8x10⁶ and 1x10⁹, between about 9x10⁶ and 1x10⁹, between about 1x10⁷ and 1x10⁹, between about 2x10⁷ and 1x10⁹, between about 3x10⁷ and 1x10⁹, between about 4x10⁷ and 1x10⁹, between about 5x10⁷ and 1x10⁹, between about 6x10⁷ and 1x10⁹, between about 7x10⁷ and 1x10⁹, between about 8x10⁷ and 1x10⁹, between about 9x10⁷ and 1x10⁹, between about 1x10⁸ and 1x10⁹, between about 2x10⁸ and 1x10⁹, between about 3x10⁸ and 1x10⁹, between about 4x10⁸ and 1x10⁹, between about 5x10⁸ and 1x10⁹, between about 6x10⁸ and 1x10⁹, between about 7x10⁸ and 1x10⁹, between about 8x10⁸ and 1x10⁹, or between about 9x10⁸ and 1x10⁹ viral particles or PFUs.

The pharmaceutical composition can be a vaccine, which can include material for a single immunization, or may include material for multiple immunizations (i.e., a ‘multidose’ kit). The inclusion of a preservative is preferred in multidose arrangements. The vaccine can be administered in a dosage volume of about 0.5 mL, although smaller doses can be administered to children. In certain instances, and under the direction of a physician or other medical personnel, the vaccine can be administered in a higher dose, e.g., about 1 ml. The vaccine can be administered as a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more dose regimen. Sometimes, the vaccine is administered as a 1, 2, 3, or 4 dose regimen. Sometimes the vaccine is administered as a 1 dose regimen. Sometimes the vaccine is administered as a 2 dose regimen. In some embodiments, initial dose in a 2 dose regimen is referred to as a primary (or prime) dose, while the second dose is referred to as a booster.

The administration of the first dose and second dose can be separated by about 0 days, 1 day, 2 days, 5 days, 7 days, 14 days, 21 days, 30 days, 2 months, 4 months, 6 months, 9 months, 1 year, 1.5 years, 2 years, 3 years, 4 years, or more.

The vaccine described herein can be administered every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more years. Sometimes, the vaccine described herein is administered every 2, 3, 4, 5, 6, 7, or more years. Sometimes, the vaccine described herein is administered every 4, 5, 6, 7, or more years. Sometimes, the vaccine described herein is administered once.

The dosage examples are not limiting and are only used to exemplify particular dosing regiments for administering a vaccine described herein. The effective amount for use in humans can be determined from animal models. For example, a dose for humans can be formulated to achieve circulating, liver, topical and/or gastrointestinal concentrations that have been found to be effective in animals. Based on animal data, and other types of similar data, those skilled in the art can determine the effective amounts of a vaccine composition appropriate for humans.

Methods

In some aspects, the present disclosure provides methods for activating an immune response in a subject using an ORFV comprising a nucleic acid molecule encoding a SARS- CoV-2 antigen described herein. In some embodiments, the present disclosure provides methods immune response in a subject using an ORFV comprising a nucleic acid molecule encoding a SARS-CoV-2 antigen described herein. In some embodiments, the present disclosure provides methods for eliciting or enhancing an immune response in a subject using an ORFV vector comprising a nucleic acid molecule encoding a SARS-CoV-2 antigen described herein. In some embodiments, the activating, promoting, eliciting, and/or enhancing of an immune response comprises increasing a cell-mediated immune response. In some embodiments, the activating, promoting, increasing, and/or enhancing of an immune response comprises increasing T cell activity. In some embodiments, the activating, promoting, increasing, and/or enhancing of an immune response comprises increasing CD4+ and/or CD8+ T cell activity. The CD4+ and/or CD8+ cells can be heterogeneous due to differences in cytokine production. For example, CD4+ and/or CD8+ cells may express IFNy, TNFα, IL-2, IL-4, or a combination thereof (e.g., IFNy and TNFα).The activating, promoting, eliciting, and/or enhancing of an immune response can comprise increasing a humoral immune response, such as increasing anti-SARS-CoV-2 antigen IgG titers in a subject.

The ORFV vectors described herein are useful in a variety of applications including, but not limited to, therapeutic methods, such as the ameliorating symptoms of CO VID-19. These therapeutic methods comprise administering to a subject in need an effective amount of an ORFV that comprises a nucleic acid molecule encoding a SARS-CoV-2 antigen. In some embodiments, a method of preventing serious illness caused by SARS-CoV-2 infection comprises administering to a subject in need thereof an effective amount of a vaccine comprising an ORFV that comprises a nucleic acid molecule encoding a SARS-CoV-2 antigen.

In certain embodiments, the subject is a human. In certain embodiments, the subject has a SARS-CoV-2 infection, or lingering symptoms of a COVID-19 infection (sometimes referred to as “long COVID”). COVID-19 symptoms include, but are not limited to, fever and/or chills, cough, shortness of breath and/or difficulty breathing, fatigue, muscle and/or body aches, headache, a loss of taste and/or smell, sore throat, congestion and/or runny nose, nausea and/or vomiting, diarrhea, persistent pain and/or pressure in the chest, confusion, an inability to wake or stay awake, and, depending on skin tone, pale, gray, or blue-colored skin, lips, or nail beds.

As demonstrated herein, expression of at least one SARS-CoV-2 antigen using an ORFV- vector can increase the amount antibodies in a subject that specifically bind to the at least one SARS-CoV-2 antigen. In some embodiments, expression of at least one SARS-CoV-2 antigen using an ORFV-vector can prevent the onset of symptoms in a subject infected with a SARS- CoV-2 virus. In some embodiments, expression of at least one SARS-CoV-2 antigen using an ORFV-vector can reduce or eliminate at least one symptom in a subject having or suspected of having COVID-19. In some embodiments of the methods presented herein, the agent (e.g., an ORFV vector comprising a nucleic acid molecule encoding a SARS-CoV-2 antigen) is administered in a single dose. In some embodiments, the agent is administered in more than one dose (“a boost” or “booster” administration). A boost is administered after a first, or prime, administration. For example, a boost may be administered between 1 week and 3 months after the prime administration. In some embodiments, the boost is administered annually. The boost can comprise different SARS-CoV-2 antigens or have nucleic acid sequences that encode different amino acid sequences of the SARS-CoV-2 antigen that is encoded in the therapeutic agent administered in the prime administration.

Kits

The ORFV vectors described herein can be provided in kit form together with instructions for administration. Typically, the kit would include the desired ORFV encoding a Spike (S) and/or Nucleocapsid (N) polypeptide or fragment thereof in a container, in unit dosage form and instructions for administration. Additional agents, for example, antiviralagents, cytokines, and the like can also be included in the kit. Other kit components that can also be desirable include, for example, a sterile syringe, booster dosages, and desired excipients. The kits can contain adjuvants, reagents, and buffers necessary for the preparing and delivery of the vaccines.

The kits can also include a carrier, package, or container that is compartmentalized to receive one or more containers such as vials, tubes, and the like, each of the container(s) comprising one of the separate elements, such as the peptides and adjuvants, to be used in a method described herein. Suitable containers include, for example, bottles, vials, syringes, and test tubes. The containers can be formed from a variety of materials such as glass or plastic.

Examples

Example 1: Materials and Methods

Generation and Characterization of recombinants

To generate the ORFV recombinants used in this work, transgenes synthesized by and obtained from Twist Biosciences (San Francisco, CA) were cloned into transfer plasmids. Stable integration of transgenes into the ORFV genome was accomplished by homologous recombination between the transfer plasmid and the genomic DNA of the parental virus following transfection by nucleofection and subsequent infection of Vero cells.

Generation of Transfer Plasmids

The following sequences for Prime-2-CoV were chosen

• CoV2-Spike_FL-TM = The Full-Length, TransMembrane Spike Protein of SARS-CoV-2 (NCBI Reference Sequence: YP 009724390.1). The Spike protein has the following modifications: o AA exchange D614G: This represents the sequence of the prevalent SARS-CoV-2 strain o Furin-Cleavage Site Mutation GSAS (WT- Furin Cleavage Site: RRAR): Stabilizes the trimerization state by inhibiting the cleavage of subunit S 1 and S2 of the Spike protein. o Proline Stabilization (K986P and V987P): This stabilizes the trimerization state. o D7 = insertion locus Del2 with Promoter P7 o CoV2-N = The Nucleocapsid Protein of SARS-CoV-2 (NCBI Reference Sequence: YP_009724397.2)

DNA inserts as well as plasmid vectors were digested using the same restriction enzymes, and fragments of interest were purified and ligated. Subsequently, bacteria were transformed with the ligated plasmids, and colonies were selected to produce the transfer plasmids. For validation, control digests using restriction enzymes was followed by agarose gel electrophoreses, while DN A sequencing using insert specific primers confirmed correct insertion of the transgenes into the plasmid vector. The following transfer plasmids were generated: pV- CoV-Spike-FL-TM and pD7-CoV_N (FIGs. 1 and 2). The S-FL TM construct is shown in FIG. 3. Forward and reverse primers are shown along with the length of the expected PCR amplicon.

Sequencing

Viral DNA was isolated, and PCRs spanning the nucleic acid sequence encoding the Spike or the N protein and the flanking regions of the viral genome were conducted. 50-80 ng of the PCR products were mixed with 5 μM primers in a 10 μl reaction volume. Sequencing was performed by GATC Biotech (Ebersberg, Germany). Transfection of ORFV infected Vero Cells

The generation of recombinant ORFVs followed two steps in which Vero cells were transfected with transfer plasmids prior to infection with ORFV. Transfection was achieved using an electroporation-based transfection method referred to as “nucleofection.” Due to homologous sequences on the transfer plasmid and the ORFV genome, inserts were integrated into the ORFV genome via homologous recombination. For this purpose, Vero cells were detached using trypsin, re-suspended in 5 ml NF stop solution and counted. For each transfection batch, 2.5 x 10⁶ cells were transferred into a 15 ml Eppendorf cup and centrifuged at 63 ref for 10 min. The cell pellet was re-suspended in 100 pl transfection solution (transfection supplement and CLB transfection buffer of the Amaxa transfection kit mixed in a ratio of 1 :4.5), supplemented with 2 pg plasmid DNA, and transferred into a transfection cuvette. For transfection, the CLB Transfection Device was used. Subsequently, nucleofected cells were resuspended in NF stop solution and transferred into a T25 cell culture flask containing 6 ml prewarmed Vero cell medium using a Pasteur pipette. Cells were immediately infected with parental virus (MOI 1) for 4 hours at 37°C and 5% CO₂, washed using 6 ml pre-warmed PBS and incubated in fresh Vero cell medium for 72 h at 37°C and 5% CO₂. When virus plaques or a cytopathic effect (CPE) were observed, cells were frozen at -80°C and then thawed and 37°C in a water bath to disrupt the cells and release viral progeny. The freeze-thaw cycle was performed three times.

Selection of ORFV Recombinants

Homologous recombination is an event occurring in a ratio of approximately 1 : 10,000 of the insert of the transfer plasmid to the target region in the ORFV genome. To select for this rare event and to separate the recombinant ORFVs from parental viruses, a fluorescence activated cell sorting (FACS) based assay was used. 3 x 10⁵ Vero cells were seeded in a 6-well plate containing 3 ml Vero cell medium. Transfection lysate was used for infection in serial dilutions and took place for 20-24 h at 37°C and 5% CO₂. To ensure an optimal selection process, cells with a low infection rate of approximately 1-5% were harvested and centrifuged for 5 min at 400 ref. Subsequently, cells were stained using an anti-ORFV, Alexa Fluor 488 or 647 labeled inhouse antibody 1:100 diluted in PBE for 30 min, washed thrice with 1 ml PBE and eventually re- suspended in 500 pl PBE. Single cell FACS sorting was performed into a 96-well plate containing 10⁴ Vero cells per well in 150 pl Vero cell medium using the SH800S Cell Sorter (Sony). After 72 h of incubation at 37°C and 5% CO₂, wells showing single virus plaques of recombinant ORFV were picked for further propagations and analyses.

Selection of ORFV Recombinants by Limiting Dilutions

Further selection and purification of recombinant viruses after FACS based sorting was carried out by limiting dilutions. 2 x 10⁶ Vero cells in 25 ml of Vero cell medium were split into a 12-well pipetting reservoir, in which the first and the rest of wells contained either 3 ml or 2 ml of the cell solution, respectively. The first well was supplemented with 50-100 pl of virus lysate and diluted 1 :3 each from the first to the last well. 150 pl of each dilution were transferred into the corresponding wells of a 96-well plate and incubated at 37°C and 5% CO₂ for 72 h. After 72 h, wells containing single virus plaques were selected for further processing by fluorescence microscopy. Locations of transgene insertion are shown in the restriction maps depicted in FIGs. 4-6.

Determination of Genetic Stability by Serial Passages

To investigate the genetic stability of coding sites, twelve serial passages of Prime-2-CoV were performed. For this, 5 x 10⁵ Vero cells were seeded in 6-well plates containing 3 ml Vero cell medium. At first, virus lysates showing one single plaque in a limiting dilution were used for infection in serial dilutions and took place for 2 h at 37°C and 5% CO₂. Cells were washed twice with PBS and were subsequently incubated in 3 ml Vero cell medium for 72 h at 37°C and 5% CO₂. PCR typing and FACS analysis using specific primers, as well as anti-Spike, anti- Nucleocapsid, and anti-ORFV antibodies were performed from each passage, respectively. Next, cells were frozen at -80°C, thawed at RT, and 50 μl of virus lysates were used to infect freshly seeded Vero cells as described above.

Isolation of viral DNA from infected Vero cells

For the isolation of viral DNA from cell culture, the Master Pure DNA Purification Kit (Epicenter Biotechnologies, Biozym) was used. Depending on the volume of cell culture, 200 pl (12/24 well plates), 75 μl (48/96 well plates), or 50 μl (384 well plates) of harvested cell lysates were re-suspended in 1 ml PBS and centrifuged for 3 min at 5000 x g. The cell pellet was dissolved in Tissue and Cell Lysis Solution (200 μl, 100 μl, or 50 μl, respectively), supplemented with Proteinase K (0.6 μl, 0.3 μl, or 0.15 μl, respectively) and vortexed for 10 s. After an incubation for 15 min at 65°C on a shaker, samples were put on ice for 2 min and supplemented with 50 pl precipitation reagent (MPC solution). Following a centrifugation at 21,000 x g for 10 min at 4°C, the supernatant was mixed with 170 μl isopropanol by inversion and centrifuged for 2 min at 21,000 x g. The pellet was washed with 170 μl 70% EtOH (v/v) and centrifuged for 2 min at 21,000 x g. Finally, the dry DNA pellet was re-suspended in 25 μl H₂O and DNA yield determined by NanoDrop.

The correct insertion of genes in newly generated ORFV recombinants was validated by primer-mediated amplification of specific sequences using the polymerase chain reaction (PCR). Thus, insert-specific as well as parental gene specific PCRs were performed and complemented using genomic locus specific PCRs. For each reaction, 5 pl of polymerase mix (2 x OptiTaq Polymerase Master Mix or 2 x AmpliTaq Gold Polymerase Master Mix), 1-2 μl of a 30 ng primer mix and 1 μl DNA were supplemented with H₂O to a total volume of 10 pl. The PCR was carried out in the Supercycler (Kyratec). An initial denaturation step (98°C, 2 min) was followed by 35-40 cycles of denaturation (96°C, 15 s), primer hybridization (primer-specific temperature) and elongation (72°C, 30-150 s, respectively). After a final elongation (72°C, 2 min), the samples were stored at 4°C until analysis.

Table 3: Primers used, their 5‘-3‘ sequence and the resulting amplicon size

Table 4: Primer mixes used for PCR analyses

Table 5: Thermocycler conditions used

Western Blot

2.5 x 10⁵ Vero cells were seeded in 3 ml medium and infected with Prime-2-CoV for 72 h at 37°C and 5% CO₂. Attached cells were treated with 200 pl Ripa buffer for 15 min at 4°C. The lysate was transferred to a fresh 1.5 ml Eppendorf cup, centrifuged for 5 min at 21,000 x g, and frozen at -20°C. BCA assay was performed according to manufacturer’s instructions (Pierce™ BCA™ Protein-Assay, Cat. No.: 23227). For analyses, 20 μg of protein samples were supplemented with 1 x NuPAGE LDS sample buffer and 1 x NuPAGE sample reducing agent for denaturing conditions, vortexed, and incubated for 5 min at 95°C. Polyacrylamide gels were prepared by overlaying 10 ml resolving gel with 2.5 ml stacking gel, 15 μl of samples were loaded, and electrophoresis was performed in WB running buffer at 150 V for approximately 90 min. Subsequently, the western blot was assembled and samples were blotted onto nitrocellulose membranes at 25 V and 1 A for 35 min in 1 x NuPAGE transfer buffer containing 20% methanol.

During staining procedures, each of the following steps was linked by three consecutive washing steps using 10 ml TBS-T at RT for 5 min on a roller. First, non-specific antibody binding was prevented by incubating the membrane with 5% BSA in TBS-T for 30 min at RT on a roller. Next, the primary antibody was applied in 5% BSA in TBS-T over night at 4°C prior to incubation with the secondary antibody in 5% milk powder in TBS-T at RT for 2 h. After a final washing step, the membrane was developed according to manufacturers’ instructions using the AceGlow chemiluminescence substrate. If necessary, membranes were stripped and stained with other antibodies using the Restore Western Blot Stripping Buffer according to manufacturers’ instructions.

Flow Cytometry

The viability and infection rates, as well as the expression of surface and intracellular molecules, were analyzed using the BD LSRFortessa flow cytometry system (BD Biosciences). The preparation of samples and staining of cells with fluorescence-labeled antibodies was carried out in 96-well U-bottom plates, while centrifugation occurred at 4°C and 400 x g for 5 min. For the determination of infection rates, cells were washed twice in 200 pl PFEA, and were re- suspended in 50 pl PFEA or optionally fixed for FACS analyses.

Extracellular Antibody Staining

For the analysis of surface molecule expression, cells were washed twice with 200 μl PFEA, re-suspended in 50 μl of freshly prepared antibody mix in PFEA and incubated for 30 min at 4°C in the dark. Fixation of Cells

For storage exceeding 4 h, cells were fixed by washing them twice with 200 μl PFEA, resuspended in 50 μl PFEA + 1% formaldehyde, and stored at 4°C in the dark. Analysis of samples was carried out within 10 days.

Evaluation of parapoxvirus vector D1701-V based Sars-CoV-2 vaccines in mice

Intended husbandry system

Animals were kept in groups of two to five subjects in individually ventilated cages. Aspen wood chips were used as bedding. Each cage was equipped with a plastic house and nesting material. Controlled animal husbandry was carried out with species-appropriate, freely accessible animal food (complete food for small rodents) and drinking water, and a regular day- night cycle.

Hygiene monitoring

The laboratory animals have the status of barrier of origin at the supplier Charles River. The serological, bacteriological, parasitological, and mycological check of the livestock was carried out on a regular basis. The room was operated using the clean-out procedure. The humidity was ambient for the duration of the study. The animals were kept behind a dry barrier with limited movement of people with protective clothing.

Animal Welfare The study was conducted under experimental license number IM 1/20G and all procedures are covered under this license.

i.m. - intramuscularly in the anterior tibialis

Throughout the Examples and the figures, references to experiment groups refer to one or more of the groups identified in Table 9 unless expressly stated otherwise.

Pre-Treatment/Acclimatization 14 days after acclimatization and adaptation of the mice to their new environment, their tails were marked with barcodes for identification.

Randomization, Housing and Grouping Mice were randomly allocated to treatment groups and housed in groups of five per cage.

Physical Examination, Test Article Preparation and Administration

On day 0, all animals were physically examined by a veterinarian and suitability for enrollment was confirmed. Before vaccination, the vaccine stock solution was thawed and diluted at room temperature in PBS to the final titer in 50 μl. Diluted vaccine was drawn up into 0.5 ml syringes with 27 G cannulas. On day 0 or on day 0 and 21, i.m. vaccination with the respective test or control articles was performed in the quadriceps with 50 μl volume. The immunizations were carried out on the same side of the animal.

General Health Observations

After immunization, the animals were checked once a day for seven consecutive days. Subsequently, the animals are checked every 2-3 days. During the inspection, the health status of the animals was assessed using a score sheet. From a total score of 3, the investigators must be informed immediately; they decide whether a veterinarian must be consulted and, if necessary, whether treatment should take place. From a total score of 9, in case of a weight loss > 20 % (related to the initial weight, corrected by the expected weight gain of same-aged, same-sex animals of the same line during the observation period) as well as in case of two scores of 3 points according to the score sheet, the animals are immediately killed painlessly (cervical dislocation under isoflurane anesthesia).

Blood Samples

Blood samples for SARS-CoV-2 serology were collected on days 14, 21, 28, 35, 42, and 120. A maximum 100 μl of blood was taken by retro-orbital bleeding under isoflurane anesthesia using a capillary with an outer diameter of 0.8 mm. Serum was separated according to routine procedures and stored frozen (-20°C to -80°C) in aliquots until analysis.

Splenocyte Samples

Splenocytes samples for SARS-CoV-2 cellular responses were collected on day 28. Five animals from each group were euthanized in a manner appropriate to animal welfare by cervical dislocation under isoflurane anesthesia. Spleens were removed and splenocytes were isolated by standard procedure and analyzed immediately.

Antibody Titers

SARS-CoV-2 Spike- and Nucleoprotein-specific antibody titers in immunized mice were evaluated using COVID-19 N-Protein and S-Protein (Sl-RBD) C0VID19 human IgG antibody ELISA kits (Catalog #: lEQ-CoVN-IgG and lEQ-CoVSIRBD-IgG respectively, RayBiotech) according manufacturer’s instructions. Biotinylated anti-human IgG antibody and HRP- streptavidin from the kit were replaced by HRP-conjugated anti-mouse IgG or IgM secondary antibodies (Abeam). Binding antibodies endpoint titers for individual animals or for pooled samples of all animals from one group were calculated. For that, the log10 absorbance units (OD) were plotted against log10 sample dilution. A regression analysis of the linear part of this curve allowed calculation of the endpoint titer with an OD higher than the average OD in PBS immunized mice plus 5 times the standard deviation of the OD at the same dilution. The OD = 0.1 was used as a limit of detection.

Virus Neutralization

SARS-CoV-2 virus neutralization was assessed by using the Surrogate Virus Neutralization Kit (Catalog#: KPTX02, ProteoGenix) according to manufacturer’s instructions.

Pseudovirus neutralization assay was performed as follows. 1.5x10⁵ HEK193 cells expressing ACE2 were seeded in each well of a 96-well plate in 100 pl DMEM supplemented with 10% FCS, 1% Pen-Strep, 1% MEM, 1% pyruvate and 1% L-Glutamine (medium). Serum was inactivated for 30 min at 56°C and serum dilutions were generated in duplicates. Upon pseudovirus dilution (1 :20 in medium), 75 μl of diluted pseudovirus (VSV expressing SARS- CoV-2 S protein) was added to each well and incubated for 1 h at 37°C and 5% CO₂. Adjacently, 100 μl of virus/serum mix was added to the seeded cells for infection for 16 h at 37°C and 5% CO₂. GFP+ spots were counted upon removal of the media using the ELISpot reader.

Intracellular Cytokine Staining

The induction of SARS-CoV-2 Spike- and Nucleoprotein-specific cellular responses was determined using intracellular cytokine staining (ICS). 2 x 10⁶ splenocytes were restimulated ex vivo for 1 h at 37°C using SARS-CoV-2 full-length Spike or N peptide libraries (JPT Peptide Technologies GmbH, Berlin, Germany) at 0.5 μg/mL per peptide, 0.1% DMSO, or phorbol myristate acetate (PMA)-ionomycin (BD Biosciences). 1 pg/mL of anti-mouse CD28 and CD49d antibodies (Biolegend) were added as co-stimulation. After 1 h GolgiStop and GolgiPlug (BD Bioscience) were added for 12 hours to the splenocytes to inhibit the secretion of intracellular cytokines. Following this, splenocytes were washed twice in PBS and stained with ZombieAqua (BioLegend) solution at room temperature for 30 min. After an additional washing step in FACS buffer (PBS with 0.5% BSA) cells were surface stained for CD3, CD4 and CD8 (BioLegend) and incubated for 30 min at 4 °C in FACS buffer. Splenocytes were then washed in FACS buffer and fixed using Cytofix/Cytoperm (BD Biosciences) according to the manufacturer’s instructions and then washed in Cytoperm buffer (BD Biosciences) and stained for IFNy, TNFα, and IL-2 for 30 min at 4 °C. The cells were then washed with Cytoperm buffer (BD Biosciences), resuspended in FACS buffer, and acquired on a BD Fortessa flow cytometer (BD Biosciences). Flow cytometry data were analyzed using FlowJo software (vl 0.6.2, Tree Star, Inc., Ashland). Antigen-specific T cells were identified by gating on size (FSC vs SSC), doublet negative (FSC- H vs FSC-A), CD3+, CD8+/CD4+. Cytokine positive responses are presented after subtraction of the background response detected in the corresponding unstimulated sample (0.1% DMSO) of each individual mouse sample. Polyfunctional T-cells analysis was performed by applying FlowJo Boolean combination gating.

Evaluation of parapoxvirus vector D1701-V based Sars-CoV-2 vaccines in rhesus macaques Non-human primate (NHP) studies were conducted by the Biomedical Primate Research Centre (BPRC), Lange Kleiweg 161, 2288 GJ Rijswijk, The Netherlands.

Design

The general design of a clinical trial using Protocol 1 (see Table 10) is shown in Table 12. Table 12: Clinical Trial Design for Protocol 1 (Table 10)

Blood sampling was performed every 7th day and each day after challenge. V- CoV_Spike-FL-TM-D7-CoV_N (referred to herein as “as Prime-2-CoV”) was determined to be the lead vaccine candidate.

PBMCs and plasma, and whole blood

Blood samples were collected by BPRC from femoral vein in the groin using aseptic techniques (Becton Dickinson, Vacutainer blood collection systems). For peripheral blood mononuclear cells (PBMCs) and plasma sample preparation, blood was collected into collection tubes containing EDTA as an anti-coagulant. Blood samples were centrifuged for 10 min at 1000 x g to separate plasma from cells. Plasma samples were aliquoted and stored at -80 °C. For PBMC isolation, the remaining blood cell fraction was diluted with an equal volume of RPMI- 1640 cell culture medium and centrifuged by density gradient. Cells at the interface were collected and washed twice in RPMI-1640 medium prior cryopreservation in serum-free freezing medium Bambanker (Nippon Genetics). Cryoampules were stored at -80 °C.

SUBSTITUTE SHEET (RULE 26) IFNy ELISpot

Rhesus macaque PBMCs were tested using NHP IFNy ELISpot assay kit (Mabtech) according to manufacturer’s instructions. Cryopreserved PBMCs were thawed in pre-warmed A1M-V media (Thermo Fisher Scientific), 2.0 x 10⁵ cells were stimulated ex vivo with 1 μg/mL of the SARS-CoV-2 full-length Spike or N peptide libraries (JPT) for 20 h at 37°C. Tests were performed in duplicates, and 0.1% DMSO was included as an unstimulated control. Spots counted using a CTL ImmunoSpot S6 Universal Analyzer (CTL). Background in unstimulated wells was subtracted and normalized to 1 spot forming cells SFC per 10⁶ PBMCs.

Antibody Titers

SARS-CoV-2 Spike- and Nucleoprotein-specific antibody titers in immunized rhesus macaques were evaluated using COVID-19 N-Protein and S-Protein (Sl-RBD) COVID19 human IgG antibody ELISA kits (Catalog #: lEQ-CoVN-IgG and lEQ-CoVSIRBD-IgG respectively, RayBiotech) according to manufacturer’s instructions. Biotinylated anti-human IgG antibody and HRP-streptavidin from the kit were replaced by goat anti-monkey IgG H&L (HRP) secondary antibodies (Abeam). Binding antibody endpoint titers for individual animals were determined as follows: the log10 absorbance units (OD) were plotted against log10 sample dilution. A regression analysis of the linear part of the curve allowed calculation of the endpoint titer with an OD higher than the average OD in mock immunized animals plus 5 times the standard deviation of the OD at the same dilution. The OD = 0.1 was used as a limit of detection.

Virus Neutralization

SARS-CoV-2 virus neutralization was assessed using the Surrogate Virus Neutralization Kit (Catalog#: KPTX02, ProteoGenix) according to manufacturer’s instructions. Sera samples were inactivated for 30 min at 56 °C.

Example !: Characterization of D1701-V-CoV2-Spike_FL-TM-D7-CoV2-N (Prime-2-CoV)

The final candidate Prime-2-CoV was de-risked for 12 passages and analyzed for genomic stability. Passage 0 (P0), Passage 3 (P3), Passage 6 (P6) and Passage 12 (Pl 2) represent different intermediate stages during passaging. pV-CoV_Spike_FL-TM and pD7-CoV_N represent positive controls, and pV12-Cherry and pD12-GFP were negative controls. The desired length of the fragments was observed, which demonstrated the genomic stability of the inserted antigens during passaging (FIG. 7).

Subsequently, Vero cells were infected for 24 hours with Prime-2-CoV from Passages 0 and 12 and stained with anti-Spike, anti-Nucleocapsid, and anti-ORFV Ab, respectively. Expression of both S and N proteins after the 12th passage was observed (FIG. 8). Additionally, S and N protein expression was shown using western blot analysis (FIGs. 9A and 9B).

Example 3: Evaluation of humoral and cellular responses in mice to Sars-CoV-2 virus S and N protein after single and repeated vaccination with Prime-2-CoV

General health and site reactions

No signs of adverse events were observed after vaccination on Day 0 or Day 21. No major weight loss related to initial weight was observed. No injection site reactions in terms of swellings after either test article administration were observed, except for one mouse in group 28, which developed an abscess two weeks after prime immunization. Table 13 provides a summary of these results.

Humoral responses to Spike and Nucleocapsid protein after vaccination

The following sections show results of the performed study highlighting (i) S protein construct selection, (ii) dose dependency of immune responses towards S and N protein induced by D1701-V vectored vaccines, (iii) immunogenicity of monovalent and multivalent vaccine prototypes, (iv) use of single and repeated vaccination regimen, and (v) neutralizing activity of Spike-specific antibodies.

• Comparison of different Spike constructs

Recombinant D1701-V vectored vaccines were generated expressing different S protein constructs including the SI domain of the S protein (group 26), a soluble full length S protein (group 27), and a S protein having a transmembrane domain (monovalent: group 28; multivalent: group 31) (see Table 9). Pooled and individual mouse sera were analyzed by determination of S 1 -RBD-specific IgG titers via ELISA (FIGs. 10A and 10B). These results indicate the full- length S protein (group 28 and 31) having a transmembrane domain elicits the strongest humoral immune responses measured in SI -RBD-specific IgG titers by ELISA.

• Dose Escalation

To study dose dependency of D1701-V-based vaccine prototypes, Prime-2-CoV was administered in mice at doses of 3x10⁷ (group 30), 10⁷ (group 31), 10⁶ (group 32) and 10⁵ (group 33) PFU. Results indicate dose dependency as SI -RBD-specific IgG titers increase proportionally to administered doses (FIGs. HA, 1 1B, 12A, 12B).

• Comparison of a monovalent and multivalent vaccine prototype

The impact of additional antigens expressed by D1701 -V recombinants was investigated. Monovalent V-CoV-Spike_FL-TM and multivalent Prime-2-CoV were used to immunize mice in a prime/boost regime and subsequently to determine SI -RBD-specific IgG responses (FIG. 13).

The results indicate that the monovalent and multivalent vaccine elicited comparable Sl- RBD-specific IgG titers and thus, comparable humoral immune responses despite the N protein being simultaneously expressed by Prime-2-CoV.

• Comparison of single and repeated vaccination regimen

Effects of single vs. repeated administration of Prime-2-CoV was analyzed by determination of Sl-RBD- and N-specific IgG titers in mice. Results shown in FIGs. 14A, 14B, 15 A, and 15B indicate a single administration to result in high antigen specific IgG titers, whereas repeated immunization strongly increased humoral immune responses.

• Virus neutralization

Surrogate virus neutralization assays were performed to demonstrate neutralizing capacity of antibodies induced by single or repeated administration of D1701-V vectored vaccine prototypes. The strongest inhibition in mice vaccinated with multivalent Prime-2-CoV at a dosage of 3x10⁷ PFU (FIG. 16).

• IgG isotype determination

Humoral immune response bias was assessed by determining the ratio of IgG2a/IgGl isotypes in mouse sera 28 days after prime immunization (group 29) and 7 days after boost immunization (remaining groups). The results demonstrate that Prime-2-CoV elicits highly Thl biased humoral immune responses (FIG. 17).

Example 4: Effect of repeated D1701-V vectored vaccine administration

As described above, ORFV D1701-V is known to elicit only short-term immune responses against itself and thus no sufficient anti-vector immunity that may decrease or limit efficacy of repeated administration of ORFV D1701-V vectored vaccines in the same individuals. Therefore, mice were immunized twice on day 0 and 21 with an ORFV D1701-V based mock virus control prior to Prime-2-CoV immunization in a prime/boost regimen after a 6 week interval time. Sl-RBD- and N-specific IgG titers were comparable to those in the group of mice that received only Prime-2-CoV vaccination (FIGs. 18A and 18B).

Example 5: Cellular immune response to Spike and Nucleocapsid protein post-vaccination

The results of cellular immune responses towards the S and N protein induced by D1701- V vectored vaccines are shown in FIGs. 19-22. Using intracellular cytokine staining (ICS), the cytokine expression of S and N specific CD4+ and CD8+ T cells was determined 7 days after the boost immunization of mice. Robust T cell responses against both antigens were observed. Strong S- and N-specific CD4+ responses increase the amount of SARS-CoV-2-specific antibodies (FIG. 23). The S- and N-specific CD4+ and CD8+T cell responses to SARS-CoV-2 after vaccination involved polyfunctional T cells (FIGs. 23, 24A-24E). The strong CD8+ T cell responses facilitate elimination of infected human cells and limit spread of the virus

Example 6: Evaluation of parapoxvirus vector D1701-V based Sars-CoV-2 vaccines in rhesus macaques

The following sections discuss studies highlighting the humoral immune responses against the S and N protein induced by multivalent Prime-2-CoV and monovalent V- CoV_Spike_FL-TM in NHPs. The strongest immune responses against both the S and N protein elicited by Prime-2-CoV vaccination were observed at a doses of 3 x 10⁷ PFU (FIGs. 25A-25C).

Virus neutralization

To demonstrate neutralizing activity of induced humoral immune responses, three different neutralization assays were performed including a pseudovirus, surrogate virus (sVNT) and real SARS-CoV-2 neutralization using individual sera of NHPs. The results shown in FIGs. 26A-26C indicate that multivalent Prime-2-CoV elicits humoral immune responses with highest neutralizing activity against SARS-CoV-2. Importantly, the multivalent Prime-2-CoV induced antibodies with increased neutralizing activity compared to the monovalent vaccine administered at the same doses. Neutralizing activity was enhanced by factors of 1.5, 1.1, and 2.6 depending on the performed assay, respectively. Notably, compared to the WHO standard, research reagent 20/130 (National Institute for Biological Standards and Control, United Kingdom), titers induced by Prime-2-CoV were increased approximately 4.9-fold. Vaccination resulted in increased endpoint titers of IgG antibodies at day 14 and day 21 post-prime and day 7 post-boost (FIGs. 27A-27C). The multivalent Prime-2-CoV induced 1.4-fold and 1.8-fold higher Spike-specific IgG titers in NHPs than the monovalent candidate after prime and boost immunization, respectively.

Cellular responses to the Spike and Nucleocapsid protein after vaccination

Cellular immune responses towards the S and N protein induced by D1701-V vectored vaccines were determined on study days 0, 7, 28 and 35. Using IFNy ELISpot, the cytokine expression of S- and N-specific T cells was determined. The V-CoV_Spike_FL-TM and Prime- 2-CoV2 vaccines showed increased responses relative to controls (FIGs. 28A and 28B). Multiple concentrations of Prime-2-CoV were able to generate S- and N-specific T cell responses (FIGs. 29A-29E and 30)

Example 7: Technical and Logistical Advantages of ORFV SARS-CoV-2 vaccines

In addition to their ability to activate, promote, elicit, and/or enhance immune responses that are effective against the SARS-CoV-2 virus, studies were performed to characterize other attributes of the vaccine that figure prominently into determining if a vaccine is suitable for commercial development and widespread distribution. Low multiplicity of infection (MOI) (z.e., MOI < 1) produced the ORFV vector vaccine at significant titers (FIG. 31 A). This allows for effective upscaling of production such that billions of doses can be prepared in a single, large scale run using cell culture. Thus, ORFV vector vaccines produced at this rate would outcompete mRNA and adenoviral vector-based vaccine manufacturing.

Additional parameters can be optimized to further improve vaccine production. For example, ORFV titers are pH-dependent (FIG. 3 IB), and optimizing cell density of the cultures to be infected can also increase production levels (FIG. 31C).

An advantage ORFV vector vaccines have over other vaccines currently on the market, especially RNA vaccines, is that the ORF vector vaccines are stable at elevated temperatures relative to other vaccines. FIGs. 32A-32C show that ORFV vector vaccines are stable several days at temperatures ranging from 4°C-37 °C.

As demonstrated herein, SARS-CoV-2 vaccine prototypes were generated successfully and were shown to be safe for use in mice and NHPs after repeated vaccination when administered intramuscularly. Successive passaging of sequenced Prime-2-CoV demonstrated genomic stability and robust expression of encoded antigens as analyzed by PCR typing, western blot, and FACS analysis. Comparing different S protein constructs including the SI domain, a full-length soluble and membrane bound S protein resulted in superior humoral responses towards the full-length S protein having a transmembrane domain and was thus chosen to be encoded by the lead vaccine candidate, Prime-2-CoV. Prime-2-CoV induced robust and specific humoral and cellular immune responses against both the S and N protein in mice and NHPs, while anti-S and anti-N antibodies showed high neutralizing activity in various neutralization assays with the strongest responses at a dosage of 3x10⁷ PFU. Importantly, multivalent Prime-2 - CoV induced higher immune responses than the monovalent vaccine candidate that expressed the S protein. Encoding the N protein as a known and potent inducer of cellular immune responses towards SARS-CoV-2 may therefore not only be a second antigen for the induction of a broader immune response and thus, a more sustainable approach against also mutated variants of SARS- CoV-2, but also favor the stimulation of long-term immunity.

Example 8: Dose finding study in humans

An open-label, first-in-human phase la, open-label, dose-finding study is performed in healthy adults to evaluate the safety and immunogenicity of a booster vaccination of Prime-2- CoV Beta in healthy participants. The participants have received full vaccination, including booster vaccination (i.e., having received at least 3 doses) with an authorized messenger ribonucleic acid (mRNA)-based COVID-19 vaccine.

The anti-COVID-19 recombinant vaccine candidate (“Prime-2-CoV_Beta vaccine”) is used based on the ORFV vector platform. Prime-2-CoV_Beta encodes the following 2 genes of SARS-CoV-2:

• The structural S protein which is responsible for entry of the virus and a main target for virus neutralizing protective immune responses. Moreover, it induces antiviral systemic immunoglobulin G (IgG), local IgA, and lung-resident T-cell responses. The receptor- binding domain (RBD) is localized in the center of the SI subunit. RBD is found to induce robust SARS-CoV-2 neutralizing response. The S2 subunit of the S protein represents an immunogenic protein and seems to be required to elicit full protection. The following mutations have been introduced into the S protein: D614G (change from an aspartate to a glycine residue at position 614, the most dominant form of SARS-CoV-2 worldwide), K986P and V987P (change from lysine or valine respectively to proline, proline stabilization), and AA682-685: RRAR to GSAS (furin cleavage site deletion with R = arginine, A = alanine, G = glycine, S = serine). These mutations have been introduced to stabilize the S protein. In addition, the following mutations to the RBD site have been introduced, as they represent the most critical mutations of the SARS-CoV-2JBeta VoC: K417N, E484K, and N501 Y.

• The structural N protein represents another potential target antigen for SARS-CoV-2 and is not expressed at the surface of infected cells. Furthermore, the N protein elicits a long- lasting T-cell response. A multi-antigenic COVID-19 vaccine concept is considered by the inventors to improve the quality of the humoral immune response. Induced CD4 T-cell help are considered to be specific to the N or the S protein, affinity maturation and Ig class switch to a more favorable isotype of RBD-specific antibodies which are known to efficiently neutralize SARS-CoV-2. High T-cell helper titers may contribute to broaden the antibody repertoire for potentially enhanced cross-protections against emerging variants. In addition, N-specific CD8 cells are considered by the inventors to also contribute to strengthen the protection against severe disease.

Thereby, a multivalent vaccine concept was designed according to the invention that expresses two antigens (S protein, N protein) simultaneously from a single recombinant ORFV vector allowing broadening the specific immunity and reducing potential immune evasion of SARS-CoV-2,

Vaccination sequence and dosing schedule

Participants are followed up through 6 months post-booster vaccination. A total of 72 participants are vaccinated in 6 cohorts of 12 participants each. Dose ranging of Prime-2- CoV Beta are done by dose escalation with doses ranging from 3x10⁴ plaque forming units (PFUs) up to 6x10⁷ PFUs (see “

Dose cohorts ' below). Cohorts 1 to 6 include a safety lead with 1 sentinel participant. This sentinel participant stays at the center for the first 4 hours and is followed up for at least an additional 44 hours after Prime-2-CoV_Beta booster vaccination. One day after vaccination and at the end of the 48-hour observation period, center personnel contacts the participant to obtain information on solicited and unsolicited AEs and other safety issues. If no safety issues occurred within the on-site monitoring period as assessed by the investigator and solicited at Days 2 and 3, the next 2 participants (Participant 2 and 3) in that dose cohort is vaccinated with an interval of at least 4 hours between vaccinations. After an additional 48-hour observation period and upon no safety issues identified in these 2 participants (during the on-site monitoring or phone visits), an additional 4 participants is vaccinated with at least 30 minutes between vaccinations. After a further 48-hour observation period, and upon no safety problems noted in these 4 participants (during the on-site monitoring or phone visits), the remaining participants in the dosing group are vaccinated with an interval of at least 30 minutes between vaccinations. Each participant is observed for at least 4 hours at the study center after Prime-2-CoV_Beta booster vaccination.

After the last participant of each of the Cohorts 1 to 5 has completed 7 days of follow up after the Prime-2-CoV_Beta booster vaccination, all safety data available including full cardiac assessments and complete safety laboratory are reviewed.

Investigational products, dose cohort, and number of participants

Prime-2-CoV_Beta, dose ranging from 3x10⁴ to 6x10⁷ PFU, 1 intramuscular injection (1.0 mL each) into the deltoid muscle on Day 1. Solution of at least 3 x 10⁵ PFUs (low dose) or at least 6 x 10⁷ PFUs (high dose) in (1% (w/v) Exbumin [a recombinant human serum albumin] and 5% (w/v) sucrose is provided in 20 mM Tris pH 7.4, and 180 mM sodium chloride.

The minimal anticipated biological effect level (MABEL) approach is used to select the starting dose to ensure safety of the participants (EMA Guideline on strategies to identify and mitigate risks for first-in-human and early clinical trials with investigational medicinal products. EMEA/CHMP/SWP/28367/07 Rev. 1).

In mice, initial pharmacological responses (i.e., an immune response) were observed with 2 doses of about 5x10⁴ PFU/animal given 3 weeks apart. A starting dose in the low range of pharmacological activity is anticipated. An escalation by factor 10 per dose is justified by the excellent tolerability profile and very low physiological reactions in the various species and doses tested. The highest intended human dose of 6x10⁷ PFU, administered as total dose/animal, was tolerated well without local or adverse reactions in all species tested following a single administration. Dose cohorts

Single booster dose as follows:

Depending on safety and immunogenicity data obtained in an informal analysis after all participants have completed Day 15. Further cohorts are considered to be opened.

Immunogenicity assessments

Serum samples are obtained for immunogenicity testing.

The following serological and cellular immunogenicity assays are performed:

• IgG enzyme-linked immunosorbent assay to SARS-CoV-2 S1-, RBD-, N-protein;

• Neutralization assay using SARS-CoV-2 Wuhan wildtype strain;

• Neutralization assay using the following VoCs: SARS-CoV-2 Beta, SARS-CoV-2_Delta, SARS-CoV-2_Omicron;

• Neutralization assay to evaluate neutralizing antibody responses against the ORFV vector; and

• SARS-CoV-2 S and N protein-specific T-cells isolated from human peripheral blood mononuclear cells (PBMCs) will be assessed by enzyme-linked immuno-spot assay.

In addition, exploratory analyses to measure the immune response to Prime-2-CoV_Beta and immune response to the ORFV vector backbone are performed.

Analysis of the primary and secondary endpoints

The primary endpoint is safety including the proportion of participants with serious and non-serious AEs and local and systemic solicited AEs (solicited systemic AEs (first 7 days after Prime-2-CoV Beta booster vaccination): fever, fatigue, headache, chills, vomiting, nausea, diarrhea, new or worsened muscle pain, new or worsened joint pain; unsolicited TEAEs throughout the study).

The secondary immunogenicity endpoints are based on RBD-specific antibodies (IgG antibody titer versus SARS-CoV-2 RBD; geometric mean titers (GMT) of RBD-specific IgG antibodies; GMFR of RBD-specific IgG antibodies from Baseline) and neutralizing antibodies (level of neutralizing antibody titers versus SARS-CoV-2 (Wuhan wild type) at each post- booster vaccination assessment; geometric mean fold rise (GMFR) of neutralizing antibodies (versus Wuhan wild type) from Baseline to each post-booster vaccination assessment).

Titer values < lower limit of quantification (LLOQ) are converted for antibody analyses to 0.5 x LLOQ, and values > upper limit of quantification (ULOQ) to ULOQ.

Absolute values of serological immunogenicity assays are determined. Additionally, GMT with 95% confidence interval (CI) are provided. For each cohort, serological immunogenicity assays are determined.

GMT and 2-sided 95% CI are calculated by exponentiating the mean logarithm of the titers and the corresponding Cis (based on Student's t distribution).

Advantages of the ORFV-based COVID-19 vaccine candidate - Prime-2-CoV_Beta

Viral vector-based vaccines of the invention have the potential to elicit strong cellular and humoral immune responses. Within the genus Parapoxvirus of the Poxviridae, the Orf virus (ORFV) strain D1701-VrV comprises various properties particularly favorable properties for the development of a vector platform technology and facilitates various vaccination approaches:

• The intrinsic, ORFV vector-mediated effect of activating and stimulating innate immune mechanisms resulting in the induction of strong adaptive immune response obviates the need for adjuvants. • Induction of robust cellular and humoral immune responses, in the absence of adjuvants, that mediate full protection against challenge infection as shown in several animal experiments in > 10 different species.

• Development of an immunological memory that provides long-lasting protection against infections.

• The viral platform, in contrast to other viral vector, is considered to allow repeated vaccinations. This will allow for adapting the vaccine to emerging strains/variants, such as SARS-CoV-2 Variant of Concern (VoC). In addition, there is (almost) no prevalence of immunity to wildtype strain ORFV in the population.

• Fully attenuated; completely avirulent even in immunocompromised primary host (sheep); no integration into the host genome possible, since poxvirus per se replicate in the cytoplasm and do not enter the nucleus; biological safety level category 1.

• Promising thermal stability at 4 °C and a formulation supporting lyophilization offering technical and logistical advantages.

• Large capacity to stably insert transgenes into ORFV genome: Due to the size of poxviral vectors including ORFV (approximately 150 kbp), the generation of polyvalent vaccines with up to 5 different, stably integrated transgenes of up to 10 kbp in total is feasible.

• The vector used itself is not capable of replication in vivo and is assigned to biological safety level 1

Incorporation by Reference

All publications patent applications mentioned herein are hereby incorporated by reference in their entirety as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference. In case of conflict, the present application, including any definitions herein, will control. Equivalents

Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.

Claims

What is claimed is:

1. A recombinant Orf virus (ORFV) comprising a nucleic acid sequence encoding at least one SARS-CoV-2 antigen.

2. The recombinant ORFV of claim 1, wherein the ORFV genome is modified in at least one locus.

3. The recombinant ORFV of claim 1 or 2, wherein the ORFV is an attenuated strain.

4. The recombinant ORFV of any one of claims 1-3, wherein the ORFV is an ORFV strain D-1701.

5. The recombinant ORFV of any one of claims 1-3, wherein the nucleic acid sequence of the recombinant ORFV genome is at least about 80% identical to an ORFV strain D-1701.

6. The recombinant ORFV of any one of claims 1-3, wherein the ORFV is an ORFV strain D-1701V.

7. The recombinant ORFV of any one of claims 1-3, wherein the nucleic acid sequence of the recombinant ORFV genome is about 80% identical to an ORFV strain D-1701 V.

8. The recombinant ORFV of any one of claims 1-3, further comprising at least one endogenous promoter operably linked to the at least one nucleic acid sequence encoding the at least one SARS-CoV-2 antigen.

9. The recombinant ORFV of any one of claims 1-8, further comprising at least one regulatory element operably linked to the at least one nucleic acid sequence encoding the at least one SARS-CoV-2 antigen.

10. The recombinant ORFV of claim 9, wherien the at least one regulatory element is an endogenous ORFV promoter.

11. The recombinant ORFV of claim 9, wherein the at least one regulatory element is an heterologous ORFV promoter.

12. The recombinant ORFV of any one of claims 1-11, wherein the at least one SARS antigen is a Spike protein or fragment thereof.

13. The recombinant ORFV of claim 12, wherein the Spike protein or fragment thereof comprises an amino acid sequence that is at least 80% identical to SEQ ID NO:6 or 7 or a fragment thereof.

14. The recombinant ORFV of claim 12, wherein the Spike protein or fragment thereof comprises the amino acid sequence of SEQ ID NO:6 or 7 or a fragment thereof.

15. The recombinant ORFV of claim 12, wherein the Spike protein comprises a D614G mutation relative to the amino acid sequence of SEQ ID NO:7.

16. The recombinant ORFV of claim 12, wherein the Spike protein comprises an altered furin-cleavage site.

17. The recombinant ORFV of claim 16, wherein the altered furin-cleavage site comprises the amino acid sequence GSAS.

18. The recombinant ORFV of claim 12, wherein the altered furin cleavage site comprises the amino acid sequence RRAR.

19. The recombinant ORFV of claim 12-14, wherein the SARS-CoV-2 antigen or fragment thereof is an S 1 subunit.

20. The recombinant ORFV of claim 12-14, wherein the SARS-CoV-2 antigen or fragment thereof is an S2 subunit.

21. The recombinant ORFV of any one of claims 12-20, wherein the Spike protein is inserted into the VEGF locus in the ORFV genome.

22. The recombinant ORFV of any one of claims 12-20, wherein the Spike protein is inserted into the Del2 locus of the ORFV genome.

23. The recombinant ORFV of any one of claims 12-22, wherein the nucleic acid sequence encoding the Spike protein or fragment thereof is at least 70% identical to SEQ ID NO: 5.

24. The recombinant ORFV of any one of claims 1-11, wherein the at least one SARS-CoV-2 antigen is a Nucleocapsid protein.

25. The recombinant ORFV of claim 24, wherein the Nucleocapsid protein or fragment thereof comprises an amino acid sequence that is at least 80% identical to SEQ ID NO:9 or 10 or a fragment thereof.

26. The recombinant ORFV of claim 24 or 25, wherein the Nucleocapsid protein or fragment thereof comprises the amino acid sequence of SEQ ID NO:9 or 10 or a fragment thereof.

27. The recombinant ORFV of any one of claims 24-26, wherein the Nucleocapsid protein is inserted into the VEGF locus in the ORFV genome.

28. The recombinant ORFV of any one of claims 24-26, wherein the Nucleocapsid protein is inserted into the DeI2 locus of the ORFV genome.

29. A transfer plasmid comprising a nucleic acid sequence encoding a SARS-CoV-2 antigen or a fragment thereof flanked by nucleic acid sequences that are homologous to nucleic acid sequences in an ORFV genome.

30. The transfer plasmid of claim 29, wherein the homologous nucleic acid sequences are homologous to nucleic acid sequences in the VEGF coding sequence in the ORFV genome.

31. The transfer plasmid of claim 30, wherein the homologous nucleic acid sequences are homologous to nucleic acid sequences in the Del2 coding sequence of the ORFV genome.

32. The transfer plasmid of any one of claims 29-31 , further comprising a nucleic acid sequence encoding a selectable marker.

33. The transfer plasmid of claim 32, wherein the selectable marker is an antibiotic resistance gene.

34. The transfer plasmid of claim 33, wherein the antibiotic resistance gene is an ampicillin resistance gene.

35. A pharmaceutical composition comprising the recombinant ORFV of any one of claims 1-36 and an excipient.

36. The pharmaceutical composition of claim 35, further comprising an adjuvant.

37. The pharmaceutical composition of claim 36, wherein the adjuvant is Freund’s adjuvant, Corneybacterium parvum, CpG oligonucleotides, Poly(I:C), and/or a cytokines.

38. The pharmaceutical composition of claim 37, wherein the cytokine is an interferon and/or an interleukin.

39. A vaccine comprising the recombinant ORFV of any one of claims 1-28.

40. A vaccine comprising the pharmaceutical composition of any one of claims 35-38.

41. A method of activating, promoting, eliciting, and/or enhancing an immune reaction against a SARS-CoV-2 virus in a subject, the method comprising administering the recombinant ORFV of any one of claims 1-28 to the subject.

42. A method of activating, promoting, eliciting, and/or enhancing an immune reaction against a SARS-CoV-2 virus in a subject infected or at risk of being infected with a SARS-CoV- 2 virus, the method comprising administering the pharmaceutical composition of any one of claims 35-38 to the subject.

43. A method of activating, promoting, eliciting, and/or enhancing an immune reaction against a SARS-CoV-2 virus in a subject infected or at risk of being infected with a SARS-CoV- 2 virus, the method comprising administering the vaccine of claims 39-40 to the subject.

44. A method of ameliorating symptoms associated with or caused by a SARS-CoV-2 infection, the method comprising administering the recombinant ORFV of any one of claims 1- 28 to the subject.

45. A method of ameliorating symptoms associated with or caused by a SARS-CoV-2 infection, the method comprising administering the pharmaceutical composition of any one of claims 35-38 to the subject.

46. The method of any one of claims 41-45, wherein administering comprises intravenous, arterial, intradermal, intramuscular, intraperitoneal, subcutaneous, sublingual, oral, or intranasal, administration.

47. The method of any one of claims 41-46, wherein the immune response comprises a cellular immune response.

48. The method of claim 47, wherein the cellular immune response comprises an increase in CD4+ T cells, CD8+ T cells, or a combination thereof.

49. The method of claim 48, wherein the CD4+ T cells and/or the CD8+ T cells express IFNy, TNFα, IL-2, and/or IL-4.

50. The method of claim 49, wherein the CD4+ T cells and/or the CD8+ T cells express IFNy and TNFα.

51. The method of any one of claims 41-46, wherein the immune response comprises a humoral immune response.

52. The method of claim 51 , wherein the humoral immune response comprises an increase in anti-SARS-CoV-2 IgG titers.

53. The method of any one of claims 41-52, further comprising administering a boost to the subject, wherein the boost comprises the same agent as the first administration or a different agent as the first administration.