WO2023230465A1 - Antisense oligonucleotides - Google Patents

Abstract

Provided herein include conditionally activatable antisense oligonucleotides (ASOs), compositions, and related methods and systems. The ASOs can be conditionally activated upon a complementary binding to a target nucleic acid through a single-stranded overhang in the ASO strand, thereby releasing the ASO to its active form. The activated ASO can exert a biological effect through the hybridization between the ASO and the target nucleic acid.

Description

ANTISENSE OLIGONUCLEOTIDES

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit under 35 U.S.C. §119(e) to U.S. Provisional Patent Application No. 63/344,796 filed on May 23, 2022, the content of which is incorporated herein by reference in its entirety for all purposes.

REFERENCE TO SEQUENCE LISTING

[0002] The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled 75EN-329798-WO-SeqList, created May 22, 2023, which is 668 kilobytes in size. The information in the electronic format of the Sequence Listing is incorporated herein by reference in its entirety.

BACKGROUND

Field

[0003] The present disclosure relates generally to the field of nucleic acids, for example, antisense oligonucleotides.

Description of the Related Art

[0004] Antisense compounds have been used to modulate target nucleic acids and can be uniquely useful in a number of therapeutic, diagnostic, and research applications. Chemically modified nucleosides have been used for incorporation into antisense compounds to enhance one or more properties, such as nuclease resistance, pharmacokinetics or affinity for a target RNA.

[0005] Despite the expansion of knowledge in the antisense technology, there still remains a need for antisense compounds with improved delivery and targeting efficacy and reduced toxicity.

SUMMARY

[0006] Disclosed herein includes an oligonucleotide, comprising: a single-stranded overhang comprising 1-16 linked nucleotides; a double-stranded stem region formed by a first region base-pairing with a second region, wherein the first region is linked to the single-stranded overhang and wherein the single-stranded overhang and the first region forms an antisense oligonucleotide (ASO) domain comprising a sequence complementary to a target nucleic acid; and a hairpin loop comprising unpaired nucleotides, wherein the singled-stranded overhang is capable of binding to the target nucleic acid to cause displacement of the first region from the second region. In some embodiments, the oligonucleotide does not have the single-stranded overhang and the hairpin loop is about 4-20 nucleotides in length, for example 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or a range between two of these values, nucleotides in length. In some embodiments, the oligonucleotide does not have the single-stranded overhang and the hairpin loop is, or is about, 16 nucleotides in length. Without being bound by any particular theory, it is believed that in the absence of the single-stranded overhang, the hairpin loop can serve as a toehold during strand displacement in some embodiments.

[0007] The oligonucleotide can be a single-stranded oligonucleotide. In some embodiments, the oligonucleotide comprises, from 5’ to 3’, the single-stranded overhang, the first region, the hairpin loop, and the second region, the first region is linked to the 3’ region of the single-stranded overhang. The first region is linked to the 5’ region of the hairpin loop and the second region is linked to the 3’ region of the hairpin loop. In some embodiments, the oligonucleotide comprises, from 3’ to 5’, the single-stranded overhang, the first region, the hairpin loop region, and the second region. The first region is linked to the 5’ region of the single-stranded overhang. The first region is linked to the 3’ region of the hairpin loop and the second region is linked to the 5’ of the hairpin loop.

[0008] The single-stranded overhang can be about 2-16, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or a range of any two of these values, nucleotides in length. In some embodiments, the single-stranded overhang is 6-12 nucleotides in length. In some embodiments, the single-stranded overhang is 4-20 nucleotides in length, optionally 6-16 nucleotides in length. The second region can be 4-20 nucleotides in length, optionally 6-16 nucleotides in length. The first region and the second region can be the same in length. The ASO domain can be about 8-35 nucleotides in length. The sequence complementary to the target nucleic acid can be 6-28 nucleotides in length. The hairpin loop can be, for example, 4-20 nucleotides in length, optionally 4- 16 nucleotides in length, and further optionally 4-8 nucleotides in length. In some embodiments, the hairpin loop is 4-8 nucleotides in length, optionally 4 nucleotides in length. The first region can be adjacent to the single-stranded overhang. The second region can be fully complementary to the first region. In some embodiments, second region does not have an overhang.

[0009] The single-stranded overhang can comprise at least one phosphorothioate internucleoside linkage. In some embodiments, all intemucleoside linkages in the single-stranded overhang are phosphorothioate internucleoside linkages. The single-stranded overhang can comprise at least one locked nucleic acid or analogue thereof. In some embodiments, about 10%- 50% of the nucleotides in the single- stranded overhang are locked nucleic acid or analogues thereof. The single-stranded overhang can comprise at least one deoxyribonucleotide. The first region can comprise at least one phosphorothioate internucleoside linkage. In some embodiments, about 50%- 100% of the nucleotides in the first region are connected via phosphorothioate intemucleoside linkages. The first region can comprise at least one phosphodiester internucleoside linkage. In some embodiments, the first region comprises one, two, three or four phosphodiester intemucleoside linkages. The first region can comprise at least one locked nucleic acid or analogue thereof. In some embodiments, the first region does not comprise a locked nucleic acid or analogue thereof. In some embodiments, about 50%-100% of the nucleotides in the first region are deoxyribonucleotides.

[0010] The hairpin loop can comprise at least one locked nucleic acid or analogue thereof, at least one deoxyribonucleotide, at least one ribonucleotide, or a combination thereof. In some embodiments, the hairpin loop comprises one, two, three or four ribonucleotides, optionally at least one of the ribonucleotides comprises a 2’-O- methylation. In some embodiments, the hairpin loop comprises one, two, three or four locked nucleic acid or analogues thereof. The hairpin loop can comprise one, two or three deoxyribonucleotides. In some embodiments, one to three nucleotides in the hairpin loop adjacent to the second region are ribonucleotides, optionally the ribonucleotides are modified nucleotides, optionally the modified ribonucleotides comprises 2’-O- methyl modification. In some embodiments, one to three nucleotides in the hairpin loop adjacent to the first region are locked nucleic acid or analogues thereof, deoxyribonucleotides, or a combination thereof. The hairpin loop can comprise at least one phosphorothioate intemucleoside linkage. In some embodiments, all intemucleoside linkages in the hairpin loop are phosphorothioate intemucleoside linkages. The hairpin loop can comprise a sequence complementary to the target nucleic acid, optionally the sequence complementary to the target nucleic acid is 2-4 nucleotides in length. In some embodiments, the hairpin loop does not comprise a sequence complementary to the target nucleic acid.

[0011] The second region can comprise at least one ribonucleotide. In some embodiments, all the nucleotides in the second region are ribonucleotides. The second region can comprise at least one phosphorothioate intemucleoside linkage. In some embodiments, the intemucleoside linkages between the one to three nucleotides at a terminus of the second region are phosphorothioate intemucleoside linkages. The second region can comprise a modified nucleotide, optionally the modified nucleotide is a 2’-O-methyl nucleotide. In some embodiments, at least 80%, at least 85%, at least 90%, at least 95%, or all of the nucleotides of the second region are chemically modified. The chemically modification can comprise 2’-O-methylation. The second region can comprise a delivery ligand. The 5’ terminus, the 3’ terminus, or both of the oligonucleotide can comprise a terminal moiety. The terminal moiety can comprise a ligand, a fluorophore, an exonuclease, a fatty acid, a Cy3, an inverted dT attached to a tri-ethylene glycol, or a combination thereof.

[0012] The target nucleic acid can a RNA. In some embodiments, the target RNA is an mRNA, an miRNA, a non-coding RNA, a viral RNA transcript, or a combination thereof. The single-stranded overhang is capable of binding to the target nucleic acid to form a toehold, thereby causing displacement of the first region from the second region and subsequent binding between the first region and the target nucleic acid. The binding between the first region and the target nucleic acid can initiate cleavage of the target nucleic acid by RNase H. In some embodiments, the second region does not bind to the target nucleic acid upon the displacement of the first region from the second region. In some embodiments, the ASO domain has reduced toxicity, increased stability, and/or specific binding to the target nucleic acid.

[0013] In some embodiments, the ASO domain comprises a sequence complementary to a nucleic acid sequence within a microtubule-associated protein tau (MAPT) transcript, optionally the MAP transcript is a transcript of MAPT gene having SEQ ID NO: 175. In some embodiments, the oligonucleotide has a sequence selected from the group consisting of SEQ ID NOs: 1-94 or a variant thereof having one, two or three mismatches in any one of SEQ ID NOs: 1-94. In some embodiments, the ASO domain comprises the nucleic acid sequence of any one of SEQ ID NOs: 162-171. In some embodiments, the ASO domain comprises the nucleic acid sequence ATTTCCAAATTCACTTTTAC (SEQ ID NO: 162). In some embodiments, the ASO domain comprises the nucleic acid sequence ATTtCcaaattcacTtTtAC (SEQ ID NO: 176) or ATtTCcaaattcactTTtAC (SEQ ID NO: 177), wherein each upper case letter is a beta-D-oxy-LNA nucleoside, and wherein each lower case letter is a DNA nucleoside.

[0014] Disclosed herein also includes a method of modulating a target nucleic acid, comprising: contacting a cell comprising a target nucleic acid with the oligonucleotide disclosed herein, wherein the single-stranded overhang binds to the target nucleic acid to cause displacement of the first region from the second region and binding of the first region to the target nucleic acid, thereby modulating the target nucleic acid. Contacting the cell with the oligonucleotide can be performed in vitro, in vivo, ex vivo, or a combination thereof. Contacting the cell with the oligonucleotide can occur in the body of a subject. The cell can be a disease cell, and optionally the cell is a cancer cell. The cell can be neuron or a neuronal cell.

[0015] Disclosed herein also includes a method of treating a disease or a condition, comprising administering the oligonucleotide disclosed herein to a subject in need thereof, wherein the single-stranded overhang binds to a target nucleic acid to cause displacement of the first region from the second region and binding of the first region to the target nucleic acid, thereby modulating the activity of the target nucleic acid or protein expression from the target nucleic acid in the subject to treat the disease or condition.

[0016] In some embodiments, the disease or condition is a central nervous system (CNS) disease or disorder, or cancer. The CNS disease or disorder can be a movement disorder, a memory disorder, addiction, attention deficit/hyperactivity disorder (ADHD), autism, bipolar disorder, depression, encephalitis, epilepsy/seizure, migraine, multiple sclerosis, a neurodegenerative disorder, a psychiatric disease, a neuroinflammatory disease, Alzheimer’s disease, Huntington's disease, Parkinson's disease, Tourette syndrome, dystonia, or a combination thereof. In some embodiments, the oligonucleotide is administered to a subject via a lipid-mediated delivery system, optionally via liposomes, nanoparticles, or micelles. In some embodiments, the oligonucleotide is administered to a subject via gymnotic delivery. In some embodiments, the oligonucleotide is administered to a subject in need thereof via a subcutaneous injection. In some embodiments, the oligonucleotide is administered to a subject in need thereof via an intravenous injection. The target nucleic acid can be a mRNA or a miRNA. In some embodiments, the target nucleic acid is MAPT mRNA. In some embodiments, the oligonucleotide is administered to the subject at a concentration about 0.1-10 nM, optionally about 1-1.0 nM.

[0017] Disclosed herein also includes an oligonucleotide complex, comprising: an antisense oligonucleotide (ASO) strand comprising a first single-stranded overhang and a first domain, and an adapter oligonucleotide strand comprising a second single-stranded overhang and a second domain, wherein the first domain base pairs with the second domain forming a double-stranded duplex structure and wherein the first single-stranded overhang in the ASO strand is capable of binding to a target nucleic acid to cause displacement of the first domain from the second domain, thereby releasing the ASO strand from the double- stranded duplex structure.

[0018] The first single-stranded overhang in the ASO strand can be about 2-15 nucleotides in length, optionally at least 8 nucleotides in length. The second single-stranded overhang in the adapter oligonucleotide strand can be about 2-15 nucleotides in length, optionally at least 8 nucleotides in length. The first domain and/or the second domain can be about 6-25 nucleotides in length. The adapter strand can be about 8-35 nucleotides in length. The ASO strand can be about 8-35 nucleotides in length.

[0019] The second single-stranded overhang can comprise at least one phosphorothioate internucleoside linkage. In some embodiments, all intemucleoside linkages in the second singlestranded overhang are phosphorothioate internucleoside linkages. The second domain can comprise at least one phosphorothioate internucleoside linkage. In some embodiments, the intemucleoside linkages between the one to three nucleotides adjacent to the 3’ and/or 5’ of the adapter oligonucleotide strand are phosphorothioate intemucleoside linkages. In some embodiments, the intemucleoside linkages between the three nucleotides adjacent to the terminus in the second domain are phosphorothioate intemucleoside linkages and the remaining intemucleoside linkages in the second domain are phosphodiester intemucleoside linkages. The adapter strand can comprise one or more modified nucleotides. The modified nucleotides can comprise 2’-O-methyl modification. In some embodiments, all the nucleotides in the adapter strand are 2’-O-methyl nucleotides. The adapter strand can comprise a delivery ligand. In some embodiments, the second single-stranded overhang in the adapter strand comprises a delivery ligand. In some embodiments, the 5’ terminus, the 3’ terminus, or both of the adapter strand comprises a terminal moiety. The terminal moiety can comprise a ligand, a fluorophore, an exonuclease, a fatty acid, a Cy3, an inverted dT attached to a tri-ethylene glycol, or a combination thereof.

[0020] In some embodiments, the ASO strand is incompatible with gymnosis. The ASO strand can be non-ionic or uncharged. The ASO strand can comprise a phosphorodiamidate morpholino oligomer. In some embodiments, the phosphorodiamidate morpholino oligomer is golodirsen, casimersen or eteplirsen. The ASO strand can be peptide nucleic acid. In some embodiments, the ASO strand does not comprise a locked nucleic acid (LNA), optionally the ASO strand does not comprise a LNA at the 3’- and/or 5’-terminus of the ASO strand. The first singlestranded overhang in the ASO strand can comprise a sequence complementary to the target nucleic acid. The ASO strand can comprise a sequence complementary to the target nucleic acid, optionally the sequence complementary to the target nucleic acid is about 8-35 nucleotides in length.

[0021] The target nucleic acid can be a RNA. The target RNA can be an mRNA, an miRNA, a non-coding RNA, a viral RNA transcript, or a combination thereof. . In some embodiments, the ASO domain comprises the nucleic acid sequence of any one of SEQ ID NOs: 162-171. In some embodiments, the first single-stranded overhang in the ASO strand comprises the nucleic acid sequence ATTTCCAAATTCACTTTTAC (SEQ ID NO: 162). In some embodiments, the ASO domain comprises the nucleic acid sequence ATTtCcaaattcacTtTtAC (SEQ ID NO: 176) or ATtTCcaaattcactTTtAC (SEQ ID NO: 177), wherein each upper case letter is a beta-D-oxy-LNA nucleoside, and wherein each lower case letter is a DNA nucleoside.

[0022] Disclosed herein also includes method of delivering an antisense oligonucleotide strand to a cell, comprising: contacting the cell with any one of the oligonucleotide complex disclosed herein, wherein the first single-stranded overhang in the antisense oligonucleotide strand binds to a target nucleotide in the cell to cause displacement of the first domain from the second domain, thereby releasing the antisense oligonucleotide strand from the double-stranded duplex structure. Contacting the cell with the oligonucleotide complex can be performed in vitro, in vivo, ex vivo, or a combination thereof. Contacting the cell with the oligonucleotide complex can occur in the body of a subject. The cell can be a disease cell, and optionally the cell is a cancer cell. The cell can be a neuron. In some embodiments, the oligonucleotide complex is administered to a subject via a lipid-mediated delivery system, optionally via liposomes, nanoparticles, or micelles. In some embodiments, the oligonucleotide is administered to a subject via gymnotic delivery. The antisense oligonucleotide strand can be uncharged or non-ionic, optionally the antisense oligonucleotide strand comprises morpholino or peptide nucleic acid. In some embodiments, the antisense oligonucleotide strand comprises a morpholino, optionally the morpholino is golodirsen, casimersen, or eteplirsen.

BRIEF DESCRIPTION OF THE DRAWINGS

[0023] FIG. 1 illustrates a schematic representation of a non-limiting exemplary stemloop oligonucleotide construct.

[0024] FIG. 2 illustrates various embodiments of a stem-loop oligonucleotide construct.

[0025] FIG. 3 illustrates a schematic representation of two non-limiting exemplary stem-loop oligonucleotide constructs with chemical modifications.

[0026] FIG. 4 is a schematic diagram showing the activation of a stem-loop oligonucleotide construct in targeted cells following the base-pairing of the single-stranded overhang to a target nucleic acid.

[0027] FIG. 5 illustrates a schematic representation of a non-limiting exemplary duplex oligonucleotide complex.

[0028] FIG. 6 illustrates a schematic representation of a non-limiting exemplary duplex oligonucleotide complex with chemical modifications.

[0029] FIG. 7 is a schematic diagram showing the activation of a duplex oligonucleotide complex in targeted cells following the base-pairing of the single-stranded overhang in the antisense oligonucleotide strand to a target nucleic acid.

[0030] FIG. 8 shows exemplary oligonucleotide modifications. This figure is reproduced from Dowdy F. S. Nature Biotechnology, 35, 222 229 (2017). [0031] FIG. 9 illustrates the naming convention for the sequences shown in the sequence tables.

[0032] FIG. 10A shows a graphic representation of relative luminescence data of exemplary stem-loop oligonucleotide constructs derived from control sequence 1 following activation in cells. FIG. 10B shows a graphic representation of target protein expression of exemplary stem-loop oligonucleotide constructs derived from control sequence 2 and control sequence 3.

[0033] FIG. 11 depicts the data from the quality control check of exemplary stem-loop oligonucleotide constructs.

[0034] FIG. 12 is a plot showing qPCT standard curves of ACTB and MAPT.

[0035] FIGS. 13-14 depict plots showing the antisense activity of exemplary stem-loop ASOs with a 5’ overhang (FIG. 13) and a 3’ overhang (FIG. 14) derived from control Sequence 1 (SEQ ID NO: 161 or 162).

[0036] FIGS. 15-16 depict plots showing the antisense activity of exemplary stem-loop ASOs with a 5’ overhang (FIG. 15) and a 3’ overhang (FIG. 16) derived from control Sequence 2 (SEQ ID NO: 163 or 164).

[0037] FIGS. 17-18 depict plots showing the antisense activity of exemplary stem-loop ASOs with a 5’ overhang (FIG. 17) and a 3’ overhang (FIG. 18) derived from control Sequence 3 (SEQ ID NO: 165 or 166).

[0038] FIG. 19 depicts plots showing the antisense activity of control sequences.

[0039] FIG. 20 depicts qPCT standard curves of ACTB and MAPT at day 7 (upper panel) and day 10 (lower panel).

[0040] FIGS. 21A-B depict bar charts representation of MAPT expression when treated with selected compounds at different doses 7 days (FIG. 21A) and 10 days (FIG. 21B) post transfection.

[0041] FIG. 22 depicts tables showing IC50 values for samples at day 7 and 10 post transfection.

[0042] FIGS. 23A-E depict plots showing dose response MAPT modulation results of each compound (FIG. 23A: Seql-Control 1; FIG. 23B: Seq2-Control 1; FIG. 23C: 1-5A-10-6; FIG. 23D: 1-5A-12-6; FIG. 23E: 1-5B-12-6) at day 7 and day 10 post transfection

[0043] FIGS. 24A-E depict scatter plots of LDH measurement assay in relative light units of exemplary ASO samples.

[0044] FIG. 25 depicts results and images from gel electrophoresis indicating annealing between Casimersen adapter strands and Casimersen morpholino oligonucleotides.

[0045] FIGS. 26A-D show images from gel electrophoresis of duplex casimersen ASOs mixed with casimersen targets at 25 °C and 37 °C (FIGS. 26A-B: duplex with 5’ adapter; FIG. 26B: duplex with 3’ adapter).

[0046] FIG. 27A depict results and images from gel electrophoresis indicating that golodirsen adapter strands and golodirsen PMOs are properly assembled to form duplex ASO constructs. FIG. 27B depicts results and images from gel electrophoresis indicating that eteplirsen adapter strands and eteplirsen PMOs are properly assembled to form duplex ASO constructs.

[0047] FIGS. 28A-B depict results and images from gel electrophoresis of duplex casimersen ASOs (FIG. 28 A: 5’ adapter; FIG. 28B: 3’ adapter) mixed with casimersen, golodirsen, and eteplirsen targets.

[0048] Throughout the drawings, reference numbers may be re-used to indicate correspondence between referenced elements. The drawings are provided to illustrate example embodiments described herein and are not intended to limit the scope of the disclosure.

DETAILED DESCRIPTION

[0049] In the following detailed description, reference is made to the accompanying drawings, which form a part hereof. In the drawings, similar symbols typically identify similar components, unless context dictates otherwise. The illustrative embodiments described in the detailed description, drawings, and claims are not meant to be limiting. Other embodiments may be utilized, and other changes may be made, without departing from the spirit or scope of the subject matter presented herein. It will be readily understood that the aspects of the present disclosure, as generally described herein, and illustrated in the Figures, can be arranged, substituted, combined, separated, and designed in a wide variety of different configurations, all of which are explicitly contemplated herein and made part of the disclosure herein.

[0050] All patents, published patent applications, other publications, and sequences from GenBank, and other databases referred to herein are incorporated by reference in their entirety with respect to the related technology.

[0051] Antisense therapy provides a selective, sequence-specific modulation of gene expression and exon splicing by single-stranded oligonucleotides. The functions of antisense oligonucleotides (ASOs) require suitable chemistry with desired properties including resistance to nuclease activity, avoidance of toxicity, protein binding for gymnotic delivery, and enhanced thermodynamic stability of binding. These properties place differing demands on backbone chemistry such as phosphorothioate backbone linkages and morpholino oligonucleotides which can have improved nuclease resistance and melting temperature but poor delivery. While some other backbone chemistries may be favorable for activity but can cause increased toxicity.

[0052] Disclosed herein include oligonucleotide constructs and complexes that can achieve enhanced sequence selectivity and potency with reduced cytotoxicity while improving delivery efficiency.

[0053] Disclosed herein includes a stem-loop oligonucleotide construct. The stem-loop oligonucleotide comprises a single-stranded overhang comprising 4-16 linked nucleotides; a double-stranded stem region formed by a first region base-pairing with a second region, wherein the first region is linked to the single-stranded overhang and wherein the single-stranded overhang and the first region forms an antisense oligonucleotide domain comprising a sequence complementary to a target nucleic acid; and a hairpin loop comprising unpaired nucleotides. The singled-stranded overhang is capable of binding to the target nucleic acid to cause displacement of the first region from the second region.

[0054] Disclosed herein also includes a method of modulating a target nucleic acid. The method comprises contacting a cell comprising a target nucleic acid with the stem-loop oligonucleotide described herein. The single-stranded overhang binds to the target nucleic acid to cause displacement of the first region from the second region and binding of the first region to the target nucleic acid, thereby modulating the target nucleic acid.

[0055] Disclosed herein also includes a method of treating a disease or a condition. The method comprises administering the stem -loop oligonucleotide disclosed herein to a subject in need thereof. The single- stranded overhang binds to a target nucleic acid to cause displacement of the first region from the second region and binding of the first region to the target nucleic acid, thereby modulating the activity of the target nucleic acid or protein expression from the target nucleic acid in the subject to treat the disease or condition.

[0056] Disclosed herein also include a duplex oligonucleotide complex for delivering an antisense oligonucleotide. The duplex oligonucleotide complex comprises an antisense oligonucleotide strand comprising a first single-stranded overhang and a first domain, and an adapter oligonucleotide strand comprising a second single-stranded overhang and a second domain. The first domain in the antisense oligonucleotide strand base-pairs with the second domain in the adapter oligonucleotide strand forming a double-stranded duplex structure. The first single-stranded overhang in the antisense oligonucleotide strand is capable of binding to a target nucleic acid to cause displacement of the first domain from the second domain, thereby releasing the antisense oligonucleotide strand from the double-stranded duplex structure.

[00571 Disclosed herein also includes a method of delivering an antisense oligonucleotide strand to a cell. The method comprises contacting the cell with the duplex oligonucleotide complex described herein, wherein the first single- stranded overhang in the antisense oligonucleotide strand binds to a target nucleotide in the cell to cause displacement of the first domain from the second domain, thereby releasing the antisense oligonucleotide strand from the double-stranded duplex structure.

Definitions

[0058] Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present disclosure belongs. See, e.g., Singleton et al., Dictionary of Microbiology and Molecular Biology 2nd ed., J. Wiley & Sons (New York, NY 1994); Sambrook et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press (Cold Spring Harbor, NY 1989). For purposes of the present disclosure, the following terms are defined below.

[0059] As used herein, the terms “antisense oligonucleotide” or “ASO” or “ASO domain” refer to an oligonucleotide that is at least partially complementary to a target nucleic acid molecule (e.g., mRNA) to which it hybridizes. In some embodiments, ASOs can modulate a target nucleic acid such as increasing or decreasing expression of a target nucleic acid. ASOs can alter mRNA expression through a variety of mechanisms, including ribonuclease H mediated decay of the pre-mRNA, direct steric blockage, and exon content modulation through splicing site binding on pre-mRNA.

[0060] As used herein, the term “nucleoside” refers to a molecule having a purine or pyrimidine base covalently linked to a ribose or deoxyribose sugar. Exemplary nucleosides include adenosine, guanosine, cytidine, uridine and thymidine.

[0061] The term “nucleotide” refers to a nucleoside having one or more phosphate groups joined in ester linkages to the sugar moiety. Exemplary nucleotides include nucleoside monophosphates, diphosphates and triphosphates.

[0062] The terms “polynucleotide” and “nucleic acid molecule” are used interchangeably herein and refer to a polymer of nucleotides joined together by a phosphodiester linkage between 5' and 3' carbon atoms.

[0063] The term “RNA” or “RNA molecule” or “ribonucleic acid molecule” refers to a polymer of ribonucleotides. The term “DNA” or “DNA molecule” or deoxyribonucleic acid molecule” refers to a polymer of deoxyribonucleotides. DNA and RNA can be synthesized naturally (e.g., by DNA replication or transcription of DNA, respectively). RNA can be post-transcriptionally modified. DNA and RNA can also be chemically synthesized. DNA and RNA can be singlestranded or multi-stranded (e.g., double-stranded or triple-stranded). “mRNA” or “messenger RNA” is single-stranded RNA molecule that is complementary to one of the DNA strands of a gene. “miRNA” or “microRNA” is a small single-stranded non-coding RNA molecule that functions in RNA silencing and post-transcriptional regulation of gene expression.

[0064] The term “nucleotide analog” or “modified nucleotide” refers to a non-standard nucleotide comprising one or more modifications (e.g. chemical modifications), including non- naturally occurring ribonucleotides or deoxyribonucleotides. The term “nucleoside analog” or “modified nucleoside” refers to a non-standard nucleoside comprising one or more modification (e g chemical modification), including non-naturally occurring nucleosides other than cytidine, uridine, adenosine, guanosine, and thymidine. The modified nucleoside can be a modified nucleotide without a phosphate group. The chemical modifications can include replacement of one or more atoms or moieties with a different atom or a different moiety or functional group (e.g. methyl group or hydroxyl group).

[0065] The term “phosphorothioate linkage” (PS) as used herein, indicates a bond between nucleotides in which one of the nonbridging oxygens is replaced by a sulfur. In some embodiments, both nonbridging oxygens may be replaced by a sulfur (PS2). The term “phosphodiester linkage” as described herein indicates the normal sugar phosphate backbone linkage in DNA and RNA wherein a phosphate bridges the two sugars.

[0066] As used herein, the term “locked nucleic acids” (LNA) indicates a modified RNA nucleotide. The ribose moiety of an LNA nucleotide is modified with an extra bridge connecting the 2' and 4' carbons (a 2’-O, 4’-C methylene bridge). The bridge “locks” the ribose in the 3'-endo structural conformation and restricts the flexibility of the ribofuranose ring, thereby locking the structure into a rigid bicyclic formation. LNA nucleotides can be mixed with DNA or RNA bases in the oligonucleotide whenever desired. The incorporation of LNA into the nucleic acid complexes disclosed herein can increase the thermal stability (e.g. melting temperature), hybridization specificity of oligonucleotides as well as accuracies in allelic discrimination. LNA oligonucleotides display hybridization affinity toward complementary single-stranded RNA and complementary single- or double-stranded DNA. Additional information about LNA can be found, for example, at www.sigmaaldrich.com/technical-documents/articles/biology/locked-nucleic-acids-faq.html.

[0067] The term “morpholino” or “morpholino oligomer” refers to a synthetic antisense oligonucleotide, typically around 25 nucleotides in length, designed to bind and block the translation initiation complex of messenger RNA sequences. The molecular structure of a morpholino contains nucleic bases attached to a backbone of methylenemorpholine rings linked through phosphorodiamidate groups.

[0068] The term “gapmer” refers to a chimeric oligomeric compound comprising a DNA antisense oligonucleotide structure with RNA-like segments (or RNA-mimics) on both sides of the antisense sequence.

[0069] A single-stranded polynucleotide has a 5’ terminus or 5' end and a 3’ terminus or 3' end. The terms “5' end” “5’ terminus” and “3' end” “3’ terminus” of a single-stranded polynucleotide indicate the terminal residues of the single-stranded polynucleotide and are distinguished based on the nature of the free group on each extremity. The 5 '-terminus of a singlestranded polynucleotide designates the terminal residue of the single-stranded polynucleotide that has the fifth carbon in the sugar-ring of the deoxyribose or ribose at its terminus (5' terminus). The 3 '-terminus of a single-stranded polynucleotide designates the residue terminating at the hydroxyl group of the third carbon in the sugar-ring of the nucleotide or nucleoside at its terminus (3' terminus). The 5' terminus and 3' terminus in various cases can be modified chemically or biologically e.g. by the addition of functional groups or other compounds as will be understood by the skilled person.

[0070] As used herein, the terms “complementary binding” and “bind complementarily” mean that two single strands are base paired to each other to form nucleic acid duplex or doublestranded nucleic acid. The term “base pair” as used herein indicates formation of hydrogen bonds between base pairs on opposite complementary polynucleotide strands or sequences following the Watson-Crick base pairing rule. For example, in the canonical Watson-Crick DNA base pairing, adenine (A) forms a base pair with thymine (T) and guanine (G) forms a base pair with cytosine (C). In RNA base paring, adenine (A) forms a base pair with uracil (U) and guanine (G) forms a base pair with cytosine (C). A certain percentage of mismatches between the two single strands are allowed as long as a stable double- stranded duplex can be formed. In some embodiments, the two strands that bind complementarily can have a mismatches can be, about, be at most, or be at most bout 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, or 50%.

[0071] As used herein, the term “prophylaxis,” “prevent,” “preventing,” “prevention,” and grammatical variations thereof as used herein refers the preventive treatment of a subclinical disease-state in a subject, e.g., a mammal (including a human), for reducing the probability of the occurrence of a clinical disease-state. The method can partially or completely delay or preclude the onset or recurrence of a disorder or condition and/or one or more of its attendant symptoms or barring a subject from acquiring or reacquiring a disorder or condition or reducing a subject’s risk of acquiring or requiring a disorder or condition or one or more of its attendant symptoms. The subject is selected for preventative therapy based on factors that are known to increase risk of suffering a clinical disease state compared to the general population. “Prophylaxis” therapies can be divided into (a) primary prevention and (b) secondary prevention. Primary prevention is defined as treatment in a subject that has not yet presented with a clinical disease state, whereas secondary prevention is defined as preventing a second occurrence of the same or similar clinical disease state.

[0072] As used herein, “treatment” refers to a clinical intervention made in response to a disease, disorder or physiological condition manifested by a patient or to which a patient may be susceptible. The aim of treatment includes, but is not limited to, the alleviation or prevention of symptoms, slowing or stopping the progression or worsening of a disease, disorder, or condition and/or the remission of the disease, disorder or condition. "Treatments" refer to one or both of therapeutic treatment and prophylactic or preventative measures. Subjects in need of treatment include those already affected by a disease or disorder or undesired physiological condition as well as those in which the disease or disorder or undesired physiological condition is to be prevented. A treatment is considered “effective treatment,” if any one or all of the signs or symptoms of, as but one example, levels of functional target are altered in a beneficial manner (e.g., increased by at least 10%), or other clinically accepted symptoms or markers of disease (e.g., cancer) are improved or ameliorated. Efficacy can also be measured by failure of a subject to worsen as assessed by hospitalization or need for medical interventions (e.g., progression of the disease is halted or at least slowed). Methods of measuring these indicators are known to those of skill in the art and/or described herein. Treatment includes any treatment of a disease in subject and includes: (1) inhibiting the disease, e.g., arresting, or slowing the progression of symptoms; or (2) relieving the disease, e.g., causing regression of symptoms; and (3) preventing or reducing the likelihood of the development of symptoms.

[0073] As used herein, a “subject” refers to an animal for whom a diagnosis, treatment, or therapy is desired. I some embodiments, the subject is a mammal. “Mammal,” as used herein, refers to an individual belonging to the class Mammalia and includes, but not limited to, humans, domestic and farm animals, zoo animals, sports and pet animals. Non-limiting examples of mammals include mice; rats; rabbits; guinea pigs; dogs; cats; sheep; goats; cows; horses; primates, such as monkeys, chimpanzees and apes, and, in particular, humans. In some embodiments, the mammal is a primate. In some embodiments, the mammal is a human. In some embodiments, the mammal is not a human.

Stem-loop antisense oligonucleotide

[0074] Provided herein include a stem-loop oligonucleotide comprising an antisense oligonucleotide (ASO) domain linked to a protection domain together forming a hairpin or stemloop structure. The oligonucleotide herein described can be conditionally activated upon a complementary binding to a target nucleic acid (e.g., mRNA of a target gene) through a toehold or single-stranded overhang region in the ASO domain. The binding between the single-stranded overhang and the target nucleic acid can cause toehold-mediated displacement of the ASO domain from the protection domain and subsequent binding of the ASO domain (or a portion thereof) and the target nucleic acid, thereby modulating the target nucleic acid.

[0075] As used herein, a “stem loop” or a “hairpin” refers to a secondary structure formed by a single-stranded oligonucleotide when complementary bases in a first section of the single-stranded oligonucleotide hybridizes with bases in a second section of the same oligonucleotide (e.g., downstream or upstream of the first section) to form a stem structure having intramolecular base-pairing between complementary bases. The intramolecular base-pairing do not occur in the portion of the oligonucleotide that forms a hairpin loop structure adjacent to the stem structure.

[0076] In the absence of a target nucleic acid or a detectable amount of the target nucleic acid, the antisense oligonucleotide herein described remains in an inactivated state (OFF state) forming a hairpin or stem loop structure (see, for example, FIG. 1). A portion of the ASO domain and the protection domain are bound to each other through complementary binding forming a double-stranded stem. The double-stranded stem structure is able to block the antisense activity of the ASO domain and keep the ASO in the OFF state. The length of the double-stranded stem can vary in different embodiments. In some embodiments, the double-stranded stem can be 4-25 nucleotides in length. For example, the length of the double-stranded stem can be, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or a range of any two of these values, nucleotides. In some embodiments, the length of the double- stranded stem is about 6-12 (e.g., 6, 8, 10, or 12) nucleotides.

[0077] A stem-loop ASO herein described can comprise a single-stranded overhang comprising about 4-16 nucleosides linked together, a double-stranded stem region formed by a first region (a section in the ASO domain, also referred to as “a protected domain”) base-pairing with a second region (also referred to as “a protection domain”), and a hairpin loop comprising unpaired nucleotides. The hairpin loop connects the ASO domain to the protection domain. The singlestranded overhang together with the protected domain form the ASO domain comprising a sequence complementary to a target nucleic acid. The single- stranded overhang or toehold is capable of binding to the target nucleic acid, thereby initiating a toehold-mediated strand displacement of the protected domain from the protection domain and allowing the target nucleic acid to hybridize with the protected domain in the ASO domain. In some embodiments, the antisense oligonucleotide is single-stranded oligonucleotide. In some embodiments, the antisense oligonucleotide forms a single-stranded hairpin structure.

[0078] FIG. 1 illustrates a schematic representation of a non-limiting exemplary hairpin antisense oligonucleotide. The hairpin antisense oligonucleotide can comprise an ASO domain linked to a protection domain via a hairpin loop (anchor domain), in which the ASO domain comprises a toehold (or single-stranded overhang) and a section base-pairing with the protection domain. The toehold can be located at the 3’ or 5’ of the antisense oligonucleotide. Similarly, the protection domain can be located at the 5’ or 3’ of the antisense oligonucleotide. One or more nucleotides in the antisense oligonucleotide, including the toehold, the first region, the hairpin loop and the second region, can be RNA/DNA analogs comprising modified nucleotides.

[0079] In some embodiments, the oligonucleotide comprises, from 5’ to 3’, the singlestranded overhang, the first region (the protected domain), the hairpin loop, and the second region (the protection domain) (see, for example, FIG. 2). The first region is linked to the 3’ of the singlestranded overhang and to the 5’ of the hairpin loop. The second region is linked to the 3’ of the hairpin loop.

[0080] In some embodiments, the oligonucleotide comprises from, 3’ to 5’, the singlestranded overhang, the first region (the protected domain), the hairpin loop region, and the second region (the protection domain) (see, for example, FIG. 2). The first region is linked to the 5’ of the single-stranded overhang on one terminus and to the 3’ region of the hairpin loop on the other terminus. The second region is linked to the 5’ of the hairpin loop.

[0081] FIG. 3 illustrates a schematic representation of two non-limiting exemplary stem-loop antisense oligonucleotides with different chemical modifications. One exemplary implementation of the stem -loop ASO (Example 1) acts through RNase H mediated degradation. The first domain complementarily bound to the protection domain is a DNA domain protected within the duplex for reduced toxicity and non-specific binding and improved stability. The phosphorothioate backbone modifications are added in both regions in the stem to improve nuclease resistance. The phosphorothioate backbone modification in the middle of the protection domain can further prevent cleavage of the protection domain by RNase H. Another exemplary implementation of the stem-loop ASO (Example 2) acts through splicing modulation. Therefore, phosphorothioate backbone modification in the protected domain is not needed and DNA bases are not used in the protected domain.

[0082] In some embodiments, the stem-loop antisense oligonucleotides herein described can comprise a sequence selected from the sequences in Tables 1-11. For example, the stem-loop antisense oligonucleotides can have a sequence selected from the group consisting of SEQ ID NOs: 1-94 or a variant thereof having one, two or three mismatches in any one of SEQ ID NOs: 1-94. In some embodiments, the stem-loop antisense oligonucleotides can have a sequence selected from the group consisting of SEQ ID NOs: 1-68 or a variant thereof having one, two or three mismatches in any one of SEQ ID NOs: 1-68. In some embodiments, the stem-loop antisense oligonucleotides can have a sequence selected from the group consisting of SEQ ID NOs: 69-80 or a variant thereof having one, two or three mismatches in any one of SEQ ID NOs: 69-80. In some embodiments, the stem-loop antisense oligonucleotides can have a sequence selected from the group consisting of SEQ ID NOs: 81-94 or a variant thereof having one, two or three mismatches in any one of SEQ ID NOs: 81-94.

[0083] The oligonucleotides herein described can be synthesized using standard methods for oligonucleotide synthesis well-known in the art including, for example, Oligonucleotide Synthesis by Herdewijin, Piet (2005) and Modified oligonucleotides: Synthesis and Strategy for Users, by Verma and Eckstein, Annul Rev. Biochem. (1998): 67:99-134, the contents of which are incorporated herein by reference in their entirety. The synthesized oligonucleotide can be allowed to form its secondary structure under a desirable physiological condition as will be apparent to a skilled artisan. The formed secondary structure can be tested using standard methods known in the art such as chemical mapping, NMR, or computational simulations. The oligonucleotides can be further modified, according to the test result, by introducing or removing chemical modifications, mismatches, and/or terminal moieties, as necessary, until the desired structure or activity is obtained.

Single-stranded overhang

[0084] The stem-loop ASO comprises a single-stranded overhang. The term “overhang” as used herein refers to a stretch of unpaired nucleotides that protrudes at one of the ends of a double-stranded polynucleotide (e.g., a double-stranded stem). An overhang can be on either the 3’ terminus of the strand (3’ overhang) or at the 5’ terminus of the strand (5’ overhang). The overhang of the antisense oligonucleotide is not complementary to the protection domain and is capable of binding to a target nucleic acid, thereby initiating a toehold mediated strand displacement and causing the displacement of the protected domain from the protection domain.

[0085] The length of the overhang can vary in different embodiments. In some embodiments, the length of the overhang can be 6-14 nucleotides. For example, the overhang in the stem-loop ASO can comprise 6, 7, 8, 9, 10, 11, 12, 13, 14 nucleotides in length. In some embodiments, the overhang of a stem-loop ASO is about 6-12 nucleotides (e.g., 6, 8, 10 or 12) in length. In some embodiments, the overhang of the stem-loop ASO is at least 8 nucleotides in length. In some embodiments, the overhang of the stem-loop ASO is about 8 nucleotides in length.

[0086] In some embodiments, the single-stranded overhang comprises one or more chemical modifications including backbone modification, ribose modification (in the sugar portion) and/or base modification. The overhang can comprise at least one phosphorothioate internucleoside linkage. For example, the percentage of phosphorothioate intemucleoside linkages in the overhang is about, at least, or at least about 50%, 60%, 70%, 80%, 90% or 95%, or a number or a range between any two of these values. In some embodiments, all internucleoside linkages in the singlestranded overhang are phosphorothioate internucleoside linkages. In some embodiments, the singlestranded overhang comprises at least one locked nucleic acid or analogue thereof. In some embodiments, about 10%-50% of the nucleotides in the single-stranded overhang are locked nucleic acid or analogues thereof. In some embodiments, the one or two nucleotides adjacent to a 3’ or 5’ terminus of the overhang are locked nucleic acid or analogue thereof.

[0087] The single-stranded overhang can comprise 2’-O-methyl nucleoside. For example, the single-stranded overhang can comprise one, two, three, four, five, six, seven or more 2’-O-methyl nucleosides. In some embodiments, the percentage of 2’-O-methyl nucleoside in the overhang can be, be about, be at least, be at least about, be at most, or be at most about 10%-70%. In some embodiments, the single-stranded overhang comprises at least one deoxyribonucleotide.

Double-stranded stem

[0088] The double-stranded stem in the stem-loop ASO comprises a first region (a protected domain), i.e., a section in the ASO domain located between the single-stranded overhang and the hairpin loop, complementarily bound to a second region (a protection domain). In some embodiments, the protected domain is perfectly complementary to the protection domain. In some embodiments, the complementarity is imperfect with one or more mismatches between the two domains. The protected domain is adjacent to the single-stranded overhang. The protected domain can be located at the 3’ or 5’ end of the single-stranded overhang. The protected domain can be directly linked to the single-stranded overhang and/or the hairpin loop. In some embodiments, the protection domain does not have an overhang.

[0089] The length of the double-stranded stem region can vary in different embodiments. In some embodiments, the double-stranded stem region is 4-20 nucleotides in length. The first region (the protected domain) and the second region (the protection domain) can be the same in length. In some embodiments, the protected domain is 4-20 nucleotides in length. For example, the protected domain can be 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 linked nucleosides in length. In some embodiments, the protected domain is about 6-16 (e.g., 6, 8, 10, 12, 14, or 16) nucleotides in length. In some embodiments, the protection domain is 4-20 nucleotides in length. For example, the protection domain can be 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 linked nucleosides in length. In some embodiments, the protection domain is about 6-16 (e.g., 6, 8, 10, 12, 14, or 16) nucleotides in length.

[0090] The protected domain of the double-stranded stem and the single-stranded overhang together form an ASO domain. The length of the ASO domain can vary in different embodiments. In some embodiments, the ASO domain is about 8-35 nucleotides in length. The ASO domain comprises a sequence complementary to a target nucleic acid having a about 6-28 nucleotides in length. One skilled in the art would recognize that some mismatches between the ASO domain and the target nucleic acid can be tolerated without eliminating the activity of the ASO. Accordingly, in some embodiments, the ASO domain can comprise up to about 20% mismatches, e.g., about, at most, or at most about 5%, 10%, 15%, or 20% mismatches. The ASO domain can comprises a sequence about, at least, or at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% complementary to a target nucleic acid or a portion thereof. In some embodiments, incorporation of nucleotide affinity modifications can allow for a greater number of mismatches compared to unmodified nucleotides. Therefore, certain oligonucleotide sequences can be more tolerant to mismatches than other oligonucleotide sequences. One of ordinary skill in the art can determine an appropriate number of mismatches between an ASO and a target nucleic acid, such as by determining melting temperature. In some embodiments, the protection domain does not comprises a sequence complementary to a target nucleic acid or is not capable of binding to a target nucleic acid.

[0091] In some embodiments, the ASO domain comprises a sequence complementary to a nucleic acid sequence within a microtubule-associated protein tau (MAPT) transcript. For example, in some embodiments, the ASO domain can comprise a sequence complementary to a nucleic acid sequence within a transcript of MAPT gene having SEQ ID NO: 175. In some embodiments, the ASO domain can hybridize to a nucleic acid sequence within a transcript of MAPT gene having SEQ ID NO: 175. In some embodiments, the ASO domain comprises a nucleotide sequence having at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%;, at least about 99%, or 100% complementarity to a region within a transcript of MAPT gene having SEQ ID NO: 175.

[0092] In some embodiments, the ASO domain comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 162, 164 and 166, or a variant having thereof having one, two or three mismatches in any one of SEQ ID NOs: 162, 164, and 166. In some embodiments, the ASO domain comprises a nucleic acid sequence of SEQ ID NO: 162.

[0093] In some embodiments, the ASO domain comprises a nucleic acid sequence ATTtCcaaattcacTtTtAC (SEQ ID NO: 176), wherein each upper case letter is a beta-D-oxy-LNA nucleoside, and wherein each lower case letter is a DNA nucleoside.

[0094] In some embodiments, the ASO domain comprises a nucleic acid sequence ATtTCcaaattcactTTtAC (SEQ ID NO: 177), wherein each upper case letter is a beta-D-oxy-LNA nucleoside, and wherein each lower case letter is a DNA nucleoside.

[0095] The double-stranded stem can comprise at least one chemical modifications including backbone modification, ribose modification (in the sugar portion) and/or base modification. The first region or the protected domain of the stem can comprise one or more chemical modifications. The protected domain can comprise at least one phosphorothioate internucleoside linkage. For example, the percentage of phosphorothioate intemucleoside linkages in the protected domain is about, at least, at least about, at most, or at most about 50%, 60%, 70%, 80 >, 90%, 95% or a number or a range between any two of these values. In some embodiments, all of the intemucleoside linkages in the protected domain are phosphorothioate internucleoside linkages. In some embodiments, the protected domain comprises at least one phosphodiester intemucleoside linkage. For example, the percentage of phosphodiester intemucleoside linkages in the protected domain is about, at least, at least about, at most, or at most about 5%, 10%, 20%>, 30%, 40%, 50% or a number or a range between any two of these values. In some embodiments, the protected domain comprises one, two, three, four, five, six, seven, eight, nigh, or ten phosphodiester intemucleoside linkages. In some embodiments, all intemucleoside linkages in the protected domain are phosphodiester intemucleoside linkages. In some embodiments, none of the intemucleoside linkage in the protected domain are phosphodiester intemucleoside linkages. In some embodiments, the protected domain can comprise at least one locked nucleic acid or analogue thereof. In some embodiments, about 10%>-30%> (e.g., 10%, 15%>, 20%, 25%>, or 30%) of the nucleotides in the protected domain are locked nucleic acid or analogues thereof. In some embodiments, the protected domain does not comprise any locked nucleic acid or analogue thereof. The protected domain can comprise 2’-O-methyl nucleoside. The number of 2’-O-methyl nucleosides in the protected domain can vary in different embodiments. For example, the percentage of 2’-O-methyl nucleosides in the protected domain can be about, at least, at least about, at most or at most about 10%-80%. In some embodiments, the protected domain does not comprise 2’-O-methyl nucleoside. In some embodiments, about 50%-100% of the nucleotides in the first region are deoxyribonucleotides. In some embodiments, all the nucleotides in the first region are deoxyribonucleotides.

[0096] The second region or the protection domain of the stem can comprise one or more chemical modifications. In some embodiments, at least 80%, at least 85%, at least 90%, at least 95%, or all of the nucleotides of the protection domain are chemically modified. The protection domain of the stem can comprise at least one phosphorothioate intemucleoside linkage. For example, the percentage of phosphorothioate internucleoside linkages in the protection domain is about, at least, at least about, at most, or at most about 5%, 10%, 20%, 30%, 40%, 50% or a number or a range between any two of these values. In some embodiments, the intemucleoside linkages between the one to three nucleotides at a terminus of the protection domain are phosphorothioate intemucleoside linkages. In some embodiments, the protection domain comprises at least one phosphodiester intemucleoside linkage. For example, the percentage of phosphodiester intemucleoside linkages in the protection domain is about, at least, at least about, at most, or at most about 50%, 60%, 70%, 80%, 90%, 95% or a number or a range between any two of these values. In some embodiments, all intemucleoside linkages in the protection domain are phosphodiester intemucleoside linkages except for the three nucleotides adjacent to the terminus of the protection domain. In some embodiments, the protection domain can comprise at least one locked nucleic acid or analogue thereof. For example, the percentage of locked nucleic acid in the protection domain is about, at most, or at most about 5%, 10%, 15% or 20%. In some embodiments, the protection domain does not comprise a locked nucleic acid. The lack of locked nucleic acids in the protection domain can attenuate cytotoxicity induced by locked nucleic acids. The protection domain can comprise 2’-O-methyl nucleoside. The number of 2’-O-methyl nucleosides in the protection domain can vary in different embodiments. For example, the percentage of 2’-O-methyl nucleosides in the protection domain can be about, at least, at least about 50%-99%. For example, the percentage of 2’-O-methyl nucleoside in a protection domain herein described can be, be about, be at least, be at least about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or a number or a range between any two of these values. In some embodiments, all the nucleosides in the protection domain are 2’-O-methyl nucleosides.

[0097] The protection domain can comprise a delivery ligand or a terminal moiety. The delivery ligand can be attached to the middle, the 5’ terminus, or 3’ terminus of the protection domain. The terminal moiety and/or delivery ligand can be any of the terminal moiety and/or delivery ligand described herein. In some embodiments, the terminal moiety is a 5 ’-palmitic acid or a 3’ palmitic acid.

Hairpin loop

[0098] The hairpin loop is linked to the ASO domain on one end and to the protection domain on the other end. In some embodiments, the hairpin loop is linked to the 3’ terminus of the ASO domain and the 5’ terminus of the protection domain. In some embodiments, the hairpin loop is linked to the 5’ terminus of the ASO domain and the 3’ terminus of the protection domain.

[0099] The length of the hairpin loop can vary in different embodiments. In some embodiments, the hairpin loop of the stem-loop ASO is about 4-20 nucleotides in length. For example, the hairpin loop can be 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or a range of any two of these values, nucleotides in length. In some embodiments, the hairpin loop is 4-16 nucleotides in length. In some embodiments, the hairpin loop is 4-8 nucleotides in length. In some embodiments, the hairpin loop is 8 nucleotides in length. The hairpin loop can comprise at least one phosphorothioate intemucleoside linkage. In some embodiments, all intemucleoside linkages in the hairpin are phosphorothioate intemucleoside linkages. The hairpin loop can comprise at least one locked nucleic acid or analogue thereof, at least one deoxyribonucleotide, at least one ribonucleotide, or a combination thereof. In some embodiments, the hairpin loop can comprise at least one locked nucleic acid or analogue thereof. For example, the hairpin loop can comprise one, two, three or four locked nucleic acids or analogues thereof. In some embodiments, the hairpin loop can comprise at least one ribonucleotides, such as at least one 2’-O-methyl ribonucleotide. For example, the hairpin loop can comprise one, two, three or four 2’-O-methyl nucleotides. In some embodiments, all the nucleotides in the hairpin loop are locked nucleic acids and/or 2’-O-methyl nucleotides. In some embodiments, the hairpin loop comprises one locked nucleic acid and three 2’- O-methyl nucleotides. In some embodiments, one to three nucleotides in the hairpin loop adjacent to the protection domain are ribonucleotides, optionally the ribonucleotides are modified nucleotides, optionally, the modified ribonucleotides comprises 2’-O-methyl modification. In some embodiments, one to three nucleotides (one, two or three) in the hairpin loop adjacent to the protected domain are locked nucleic acid or analogues thereof, deoxyribonucleotides, or a combination thereof. In some embodiments, the hairpin loop comprises one, two or three deoxy rib onucl eoti des .

[0100] The hairpin loop can comprise a sequence complementary to a target nucleic acid. For example, the hairpin loop can comprise one, two, three or four nucleotides complementary to a portion in the target nucleic acid. In some embodiments, the hairpin loop does not comprise a sequence complementary to a target nucleic acid.

Activation of a stem-loop ASO

[0101] The stem-loop antisense oligonucleotide described herein can be conditionally activated to switch from an inactivated state or configuration to an activated state or configuration to act on (e g., degrade or modulate) a specific target nuclei acid having a sequence complementarity to a sequence in the single-stranded overhang of the ASO.

[0102] In the inactivated configuration (hairpin structure), the stem region in the ASO blocks the antisense activity of the ASO domain, keeping it in the switched off state. In the event that a target nucleic acid complementary to the single-stranded overhang is present, such as upon cellular uptake of the ASO, the target nucleic acid can activate the ASO by inducing separation of the ASO domain from the protection via toehold mediated strand displacement (FIG. 4). The displacement can start from the toehold formed at the 3’ or 5’ terminus of the oligonucleotide through a complementary binding between the target nucleic acid and the single-stranded overhang. The toehold-mediated strand displacement can dissociate the protected domain in the ASO domain from the protection domain to result in a potent, functional ASO strand and switch on the antisense activity of the antisense oligonucleotide. After the release of the ASO domain, the anchor domain (hairpin) can stabilize the base-pairing between the target nucleic acid and the ASO domain and prevents the protection domain from reforming into a hairpin. Following the degradation of the target nucleic acid, the antisense oligonucleotide can reform its original hairpin conformation until the engagement with a next target nucleic acid in another cycle of activity (FIG. 4).

[0103] As used herein, the term “antisense activity” refers to any detectable and/or measurable activity attributable to the hybridization of an antisense oligonucleotide to its target nucleic acid. Such detection and or measuring can be direct or indirect. For example, in some embodiments, antisense activity is assessed by detecting and/or measuring the amount of target protein. In some embodiments, antisense activity is assessed by detecting and/or measuring the amount of target nucleic acids and/or cleaved target nucleic acids and/or alternatively spliced target nucleic acids. [0104] The activated ASO can modulate protein expression of a target nucleic acid through several different mechanisms as will be recognized by a person skilled in the art. For example, in some embodiments, the activated ASO exerts an antisense effect/activity through RNase H mediated degradation, in which the ASO and the target RNA form ASO-RNA heteroduplexes that can be degraded by RNases in the cytoplasm. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA-like ASO can elicit RNase H, resulting in cleavage of the RNA target. In some embodiments, the activated ASO acts through RNase H-independent mechanisms such as steric blockage or splice modulation or splice switching based mechanism. Steric blocking ASOs can inhibit or activate translation through the binding to regulatory elements, e.g., upstream open reading frames. Activated ASOs can also induce the skipping of pseudoexons or block RNA-splicing factors from recognizing cryptic splice sites. ASOs can also sterically block the union of RNA-binding factors to repeat expansion regions of pathogenic mRNAs.

Duplex oligonucleotide complex

[0105] Provided herein also includes a duplex oligonucleotide complex for the delivery of an antisense oligonucleotide. The duplex oligonucleotide complex comprises an antisense oligonucleotide (ASO) strand and an adapter oligonucleotide strand. The ASO strand comprises a first single-stranded overhang and a first domain and the adapter oligonucleotide strand comprises a second single- stranded overhang and a second domain. The first domain of the ASO strand base pairs with the second domain of the adapter oligonucleotide strand to form a double-stranded duplex structure. The first single-stranded overhang of the ASO strand is capable of binding to a target nucleic acid to cause toehold-mediated displacement of the first region from the second region, thereby releasing the ASO strand from the double-stranded duplex structure. One or more nucleotides in the ASO strand and/or in the adapter strand can be RNA/DNA analogs comprising modified nucleotides.

[0106] As used herein, a “duplex” or “nucleic acid duplex” refers to a secondary structure formed by two single-stranded polynucleotides bound to each other through complementary binding. The nucleic acid duplex can form a helical structure, such as a doublestranded nucleic acid molecule, which is maintained largely by non-covalent bonding of base pairs between the two single-stranded polynucleotides and by base stacking interactions.

[0107] FIG. 5 illustrates a schematic representation of a non-limiting exemplary duplex oligonucleotide complex. In the absence of a target nucleic acid or a detectable amount of the target nucleic acid, the duplex oligonucleotide complex herein described remains in an activated (OFF state) (see, for example, FIG. 5). A portion of the ASO strand and a portion of the adapter strand are bound to each other through complementary binding forming a duplex structure. The doublestranded duplex structure is able to block the antisense activity of the ASO strand and keep the ASO in the OFF state. The length of the double-stranded duplex region can vary in different embodiments. In some embodiments, the duplex region can be about 6-25 nucleotides in length. For example, the length of the duplex region can be 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or a range of any two of these values, nucleotides. In some embodiments, the length of the duplex region is about 10-20 (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) nucleotides.

[0108] The ASO strand and the adapter strand each comprises a single-stranded overhang or toehold at 5’ or 3’ terminus of the strand. For example the overhang in the ASO strand can be located at the 3’ or 5’ of the ASO strand. Similarly, the overhang in the adapter strand can be located at the 3’ or 5’ of the adapter strand. The overhang in the ASO strand and the overhang in the adapter strand can have a same length or a different length. The length of the overhang can vary in different embodiments. For example, the overhang in the ASO strand can be about 2-15 nucleotides in length. In some embodiments, the overhang in the ASO strand is at least 8 nucleotides in length. Alternatively or in addition, the overhang in the adapter strand can be about 2-15 nucleotide in length, optionally the overhang in the adapter strand can be at least 8 nucleotides in length.

[0109] The overhang in the ASO strand is capable of binding to a target nucleic acid, thereby initiating a toehold-mediated strand displacement of the first domain of the ASO strand from the second domain of the adapter strand. The displacement of the first domain from the second domain results in the release of the ASO strand from the double-stranded duplex structure, therefore the ASO strand no longer binds to the adapter strand, allowing the ASO strand to fully hybridize with the target nucleic acid.

ASO strand

[0110] The ASO strand comprises a single-stranded overhang (a first overhang) and a domain (a first domain) complementarily binding to a domain in the adapter domain (a second domain). The length of the ASO strand can vary in different embodiments. In some embodiments, the ASO strand is about 8-35 nucleotides in length. In some embodiments, the ASO strand is about 15-25 nucleotides in length.

[0111] The single-stranded overhang can be on either the 3’ terminus of the ASO strand (3’ overhang) or at the 5’ terminus of the strand (5’ overhang). The length of the first overhang can be about 2-15 nucleotides in length. For example, the first overhang can be about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or a range of any two of these values, nucleotides in length. In some embodiments, the first overhang is at least 8 nucleotides in length. In some embodiments, the overhang of the ASO strand is about 8 nucleotides in length. The length of the first domain can vary in different embodiments. In some embodiments, the first domain can be about 6-25 nucleotides in length. For example, the length of the first domain can be 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,

18, 19, 20, 21, 22, 23, 24, 25 or a range of any two of these values, nucleotides. In some embodiments, the length of the first domain is about 10-20 (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18,

19, or 20) nucleotides.

[0112] The ASO strand comprises a sequence complementary to a target nucleic acid. The sequence complementary to a target nucleic acid can be about 6-28 nucleotides in length One skilled in the art would recognize that some mismatches between the ASO strand and the target nucleic acid can be tolerated without eliminating the activity of the ASO. Accordingly, in some embodiments, the ASO strand can comprise up to about 20% mismatches, e.g., about, at most, or at most about 5%, 10%, 15%, or 20% mismatches. The ASO strand can comprises a sequence about, at least, or at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% complementary to a target nucleic acid or a portion thereof. In some embodiments, incorporation of nucleotide affinity modifications can allow for a greater number of mismatches compared to unmodified nucleotides. One of ordinary skill in the art can determine an appropriate number of mismatches between an ASO strand and a target nucleic acid, such as by determining melting temperature.

[0113] In some embodiments, the ASO strand comprises one or more chemical modifications including backbone modification, ribose modification (in the sugar portion) and/or base modification. In some embodiments, the ASO strand alone is incompatible with gymnosis delivery. Gymnosis is a process of the delivery of antisense oligonucleotides to cells in the absence of any delivery carrier or vehicle or molecular conjugation. In some embodiments, the use of an adapter strand and the resulting duplex complex can allow an effective gymnotic delivery of an ASO strand that is otherwise incompatible with gymnosis. In some embodiments, the duplex oligonucleotide complex described herein can reduce the ASO dose required for the gymnosis process to take place.

[0114] In some embodiments, the ASO strand alone is incompatible with lipid-based nucleic acid transfection approaches. Standard lipid-based nucleic acid transfection carriers rely on ionic interaction with a charged backbone and are not effective when the ASO is non-ionic or uncharged. In some embodiments, the ASO strand is hydrophobic, non-ionic or uncharged, and the duplex oligonucleotide complex described herein allows delivery of the ASO strand via a lipid- based delivery system such as lipid nanoparticles or liposomes.

[0115] In some embodiments, the ASO strand is neutral, hydrophobic, non-ionic or uncharged. In some embodiments, the ASO strand does not comprise a charged phosphate linkage and/or ribose sugar backbone. For example, in some embodiments, the ASO strand does not comprise a phosphodiester backbone linkage, a phosphorothioate backbone linkage or both. The phosphodiester backbone linkage can be substituted with a neutral backbone linkage such as a phosphorodiamidate linkage or a peptide bond.

[0116] In some embodiments, the ASO strand comprises a morpholino oligomer. A morpholino, also known as morpholino oligomer or as a phosphorodiamidate morpholino oligomer (PMO) is a type of oligomer molecule with a molecular structure containing DNA bases attached to a backbone of methylenemorpholine rings linked through phosphorodiamidate groups. Morpholinos block access of other molecules to small (about 25 bases) specific sequences of the base-pairing surfaces of ribonucleic acid. In some embodiments, antisense oligonucleotides comprising morpholinos do not trigger the degradation of their target RNA molecules. Instead, morpholinos can bind to complementary RNA sequence and sterically inhibit molecules that may otherwise interact with the RNA. Morpholinos can modulate gene expression by blocking mRNA translation or by modifying pre-mRNA splicing (e.g., by targeting the oligo to a splice junction or regulatory site, sterically blocking binding of snRNPs or other splice factors), or blocking other functional sites on RNA depending on the morpholino’ s base sequence. Morpholinos can also be used to block microRNA maturation and microRNA targets, block ribozyme activity and induce frameshifts. Exemplary PMOs include, but are not limited to, golodirsen, casimersen, eteplirsen and viltolarsen.

[0117] In some embodiments, the ASO strand is a peptide nuclei acid. Peptide nucleic acids (PNAs) are oligonucleotide analogues in which the sugar-phosphate backbone is replaced by a pseudopeptide skeleton. PNAs can bind DNA and RNA with high specificity and selectivity, thus forming PNA-RNA and PNA-DNA hybrids more stable than the corresponding nucleic acid complexes. PNAs are also resistant to degradation by nucleases or proteases and stable over a range of pH values.

[0118] In some embodiments, the ASO strand does not comprise a locked nucleic acid. In some embodiments, the ASO strand does not comprise a locked nucleic acid at the 3’ and/or 5’ terminus of the ASO strand.

Adapter strand

[0119] The adapter strand comprises a single-stranded overhang (a second overhang) and a domain (a second domain) complementarily binding to a domain in the ASO strand (a first domain). The length of the adapter strand can vary in different embodiments. In some embodiments, the adapter strand is about 8-35 nucleotides in length. In some embodiments, the adapter strand is about 15-25 nucleotides in length.

[0120] The single-stranded overhang can be on either the 3’ terminus of the adapter strand (3’ overhang) or at the 5’ terminus of the strand (5’ overhang). The length of the overhang can be about 2-15 nucleotides in length. For example, the overhang can be about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or a range of any two of these values, nucleotides in length. In some embodiments, the overhang is at least 8 nucleotides in length. In some embodiments, the overhang of the adapter strand is about 8 nucleotides in length. The single-stranded overhang in the adapter strand is not capable of binding to a target nucleic acid or does not comprise a sequence complementary to a target nucleic acid.

[0121] The length of the second domain can vary in different embodiments. In some embodiments, the second domain can be about 6-25 nucleotides in length. For example, the length of the second domain can be 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or a range of any two of these values, nucleotides. In some embodiments, the length of the second domain is about 10-20 (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) nucleotides.

[0122] The adapter strand can comprise at least one chemical modifications including backbone modification, ribose modification (in the sugar portion) and/or base modification. The single-stranded overhang in the adapter strand can comprise one or more chemical modifications. The single-stranded overhang in the adapter strand can comprise at least one phosphorothioate internucleoside linkage. For example, the percentage of phosphorothioate intemucleoside linkages in the overhang is about, at least, at least about, at most, or at most about 50%, 60%, 70%, 80%, 90%, 95% or a number or a range between any two of these values. In some embodiments, all of the internucleoside linkages in the overhang are phosphorothioate internucleoside linkages. The overhang can comprise at least one 2’-O-methyl nucleotide. For example, the percentage of 2’-O- methyl nucleotides in the overhang is about, at least, at least about, at most, or at most about 50%, 60%, 70%, 80%, 90%, 95% or a number or a range between any two of these values. In some embodiments, all of the nucleotides in the overhang are 2’-O-methyl nucleotides. In some embodiments, the single-stranded overhang does not comprise a locked nucleic acid

[0123] The second domain of the adapter strand can comprise one or more chemical modifications. The second domain of the adapter strand can comprise at least one phosphorothioate internucleoside linkage. The at least one phosphorothioate internucleoside linkage can be between the one to three nucleotides adjacent to the terminus of the adapter strand. In some embodiments, the second domain does not comprise a phosphorothioate internucleoside linkage. In some embodiments, about, at least, or at least about 50%, 60%, 70%, 80%, 90%, 95% internucleoside linkages in the second domain are phosphodiester internucleoside linkages. In some embodiments, all of the internucleoside linkages in the second domain are phosphodiester internucleoside linkages. In some embodiments, all internucleoside linkages in the second domain are phosphodiester intemucleoside linkages except for the intemucleoside linkages between the two or three terminal nucleotides. In some embodiments, the intemucleoside linkages between the one to three nucleotides adjacent to the 3’ and/or 5’ of the adapter oligonucleotide strand are phosphorothioate intemucleoside linkages.

[0124] The second domain can comprise at least one 2’-O-methyl nucleotide. For example, the percentage of 2’-O-methyl nucleotides in the second domain is about, at least, at least about, at most, or at most about 50%, 60%, 70%, 80%, 90%, 95% or a number or a range between any two of these values. In some embodiments, all of the nucleotides in the second domain are 2’- O-methyl nucleotides. In some embodiments, the second domain does not comprise a locked nucleic acid. In some embodiments, about, at least, at least about, at most, or at most about 50%, 60%, 70%, 80%, 90%, 95% nucleotides in the adapter strand are 2’-O-methyl nucleotides. In some embodiments, all the nucleotides in the adapter strand are 2’-O-methyl nucleotides.

[0125] The adapter strand can comprise a delivery ligand or a terminal moiety. The delivery ligand can be attached to the middle, the 5’ terminus, and/or 3’ terminus of the adapter strand. In some embodiments, the second single-stranded overhang in the adapter strand comprises a delivery ligand. The terminal moiety and/or delivery ligand can be any of the terminal moiety and/or delivery ligand described herein. For example, the terminal moiety can comprise a ligand, a fluorophore, an exonuclease, a fatty acid, a Cy3, an inverted dT attached to a tri-ethylene glycol, or a combination thereof. In some embodiments, the terminal moiety is a 5 ’-palmitic acid or a 3’ palmitic acid.

[0126] In some embodiments, an adapter strand is designed to deliver a morpholino ASO such as golodirsen morpholino, casimersen morpholino or eteplirsen morpholino. In some embodiments, an adapter strand can have a nucleotide sequence of SEQ ID NO: 144, 146, 150, 152, 156 or 158 or a variant thereof having one, two or three mismatches in any one of SEQ ID NOs: 144, 146, 150, 152, 156 or 158.

Activation of a duplex oligonucleotide

[0127] The duplex oligonucleotide complex described herein can be conditionally activated to switch from an inactivated state or configuration to an activated state or configuration to act on a specific target nuclei acid having a sequence complementarity to a sequence in the ASO strand.

[0128] In the inactivated configuration (duplex structure), the duplex structure blocks the antisense activity of the ASO strand, keeping it in the switched off state. In the event that a target nucleic acid complementary to the single-stranded overhang of the ASO strand is present, such as upon cellular uptake of the duplex oligo complex, the target nucleic acid can activate the ASO by inducing separation of the ASO strand from the adapter strand via toehold mediated strand displacement (FIG. 7). The displacement can start from the toehold formed at the 3’ or 5’ terminus of the ASO strand through a complementary binding between the target nucleic acid and the singlestranded overhang The toehold-mediated strand displacement can dissociate the first domain of the ASO strand from the second domain of the adapter strand to result in a potent, functional ASO strand and switch on the antisense activity of the ASO strand. After the ASO strand fully hybridizes with the target nucleic acid, the adapter strand can be released and degraded by endogenous mechanism.

[0129] The activated ASO can modulate protein expression of a target nucleic acid through several different mechanisms. In some embodiments wherein the ASO strand comprises morpholinos or peptide nucleic acids, the activated ASO can act through RNase H-independent mechanisms such as steric blockers or splice-switching oligonucleotides for exon-skipping.

Modulation of a target nucleic acid

[0130] Upon activation, the antisense oligonucleotides herein described can inhibit a target nucleic acid in target cells, therefore resulting in a reduction or loss of expression of the target nucleic acid in the target cells. The target cells are cells associated or related to a disease or disorder. The term “associated to” “related to” as used herein refers to a relation between the cells and the disease or condition such that the occurrence of a disease or condition is accompanied by the occurrence of the target cells, which includes but is not limited to a cause-effect relation and sign/symptoms-disease relation. The target cells used herein typically have a detectable amount of a target nucleic acid.

[0131] In some embodiments, the expression of a target nucleic acid in target cells is inhibited about, at least, at least about, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or a number or a range between any of these values.

[0132] As used herein, inhibition of gene expression refers to the absence or observable decrease in the level of protein and/or mRNA product from a target gene in target cells. The degree of inhibition can be evaluated by examination of the expression level of the target gene as demonstrated in the examples.

[0133] In some embodiments, gene expression and/or the inhibition of target gene expression can be determined by use of a reporter or drug resistance gene whose protein product is easily assayed. Exemplary reporter genes include, but no limiting to, acetohydroxyacid synthase (AHAS), alkaline phosphatase (AP), beta galactosidase (LacZ), beta glucoronidase (GUS), chloramphenicol acetyltransferase (CAT), green fluorescent protein (GFP), horseradish peroxidase (HRP), luciferase (Luc), nopaline synthase (NOS), octopine synthase (OCS), and derivatives thereof. Multiple selectable markers are available that confer resistance to ampicillin, bleomycin, chloramphenicol, gentarnycin, hygromycin, kanamycin, lincomycin, methotrexate, phosphinothricin, puromycin, and tetracyclin. Quantitation of the amount of gene expression allows one to determine a degree of inhibition as compared to cells not treated with the antisense oligonucleotide or treated with a negative or positive control. Various biochemical techniques may be employed as will be apparent to a skilled artisan such as RNA solution hybridization, nuclease protection, Northern hybridization, reverse transcription, gene expression monitoring with a microarray, antibody binding, enzyme linked immunosorbent assay (ELISA), Western blotting, radioimmunoassay (RIA), other immunoassays, and fluorescence activated cell analysis (FACS).

[0134] In some embodiments, the antisense oligonucleotides disclosed herein exhibit improved switching performance and reduced off-target effects. The antisense oligonucleotides disclosed herein can have a reduced unwanted antisense activity when the antisense oligonucleotides are in an inactivated state (switched off) and an enhanced antisense activity when the antisense oligonucleotides are activated upon detection of a target nucleic acid.

[0135] In some embodiments, the expression of a target nucleic acid in non-target cells (e g cells not having a target nucleic acid) is inhibited about, at most, or at most about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, or a number or a range between any of these values. Non-target cells can comprise cells of the subject other than target cells. Therefore, in some embodiments, non-target cells typically do not have a detectable amount of a target nucleic acid.

[0136] In some embodiments, the antisense oligonucleotides herein described have an enhanced potency, thus capable of evoking an antisense activity at low concentrations. Nonspecific, off-target effects and toxicity (e.g. undesired proinflammatory responses) can be minimized by using low concentrations of the nucleic acid complexes. In some embodiments, the antisense oligonucleotides herein described have reduced off-target interactions with cellular proteins, reduced non-specific degradation of long pre-mRNA transcripts, reduced non-specific degradation of mRNA and other non-specific, non-selective protein binding and base-pairing interactions, thus leading to reduced toxicity compared to other antisense compounds such as compounds in gapmer or mixmer configurations, while maintaining or improving potency and duration of activity. In some embodiments, the binding efficiency between the antisense oligonucleotide and the target nucleic acid can be increased by reducing unintended protein binding or binding to non-target oligonucleotides. Without being bound to any theory, it is believed that the stem-loop structure of the antisense oligonucleotides herein described can greatly reduce non-specific protein binding compared to single-stranded gapmers and mixmers. The toehold mediated strand displacement renders the binding with a target nucleic acid highly sequence-specific compared to single-stranded base-pairing and can be as fast or faster kinetically compared with binding of single-stranded antisense oligonucleotides (e.g., gapmers or mixmers). The single- stranded overhang in the antisense oligonucleotides herein described can induce sufficient uptake (e.g., gymnotic uptake), and the partial duplex construct can reduce non-specific protein binding, have longer duration of activity and increased stability in endo-lysosomal stability depot, and can also allow nuclear localization by avoiding nuclear export.

[0137] In some embodiments, the antisense oligonucleotides described herein are characterized by comparable or improved potency and decreased toxicity as compared to gapmers and mixmers. For example, the cytotoxicity of the antisense oligonucleotides can be reduced by about, at least, or at least about 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99%.

[0138] The concentration of the antisense oligonucleotides disclosed herein can vary in different embodiments. In some embodiments, the antisense oligonucleotides disclosed herein can be provided at a concentration of, about, at most, or at most about, 0.001 nM, 0.01 nM, 0.02 nM, 0.03 nM, 0.04 nM, 0.05 nM, 0.06 nM, 0.07 nM, 0.08 nM, 0.09 nM, 0.1 nM, 0.2 nM, 0.3 nM, 0.4 nM, 0.5 nM, 0.6 nM, 0.7 nM, 0.8 nM, 0.9 nM, 1.0 nM, 1.5 nM, 2.0 nM, 2.5 nM, 3.0 nM, 3.5 nM, 4.0 nM, 4.5 nM, 5.0 nM, 5.5 nM, 6.0 nM, 6.5 nM, 7.0 nM, 7.5 nM, 8.0 nM, 8.5 nM, 9.0 nM, 9.5 nM, 10 nM, 11 nM, 12 nM, 13 nM, 14 nM, 15 nM, 16 nM, 17 nM, 18 nM, 19 nM, 20 nM, 30 nM, 40 nM, 50 nM, or a number or a range between any two of these values. For example, the antisense oligonucleotides disclosed herein can be provided at a concentration between about 0.1-10 nM, preferably between about 1-10 nM.

[0139] The antisense oligonucleotides herein described can allow lasting and consistently potent inhibition effects at low concentrations. For example, the nucleic acid complex can remain active for an extended period of time such as at least 12 hours, at least 24 hours, at least 36 hours, at least 48 hours, at least 60 hours, at least 72 hours, at least 84 hours, or at least 96 hours. In some embodiments, the antisense oligonucleotides can remain active for up to 30 days, up to 60 days, or up to 90 days.

Target nucleic acid

[0140] The antisense oligonucleotides herein describe comprise a sequence complementary to a target nucleic acid (e.g., RNA) in order to direct target-specific antisense activity. In some embodiments, the target RNA is a cellular RNA transcript. The target RNA can be an mRNA, an miRNA, a non-coding RNA, a viral RNA transcript, or a combination thereof.

[0141] As used herein, a “target RNA” refers to a RNA whose expression is to be selectively inhibited or silenced through antisense mechanism. A target RNA can be a target gene comprising any cellular gene or gene fragment whose expression or activity is associated with a disease, a disorder or a condition. A target RNA can also be a foreign or exogenous RNA or RNA fragment whose expression or activity is associated with a disease, a disorder or a certain condition (e.g. a viral RNA transcript or a pro-viral gene).

[0142] In some embodiments, the target RNA can comprise an oncogene, a cytokinin gene, an idiotype protein gene (Id protein gene), a prion gene, a gene that expresses a protein that induces angiogenesis, an adhesion molecule, a cell surface receptor, a gene of a protein involved in a metastasizing and/or invasive process, a gene of a proteinase, a gene of a protein that regulates apoptosis and the cell cycle, a gene that expresses the EGF receptor, a multi-drug resistance 1 gene (MDR1), a gene of a human papilloma virus, a hepatitis C virus, or a human immunodeficiency virus, a gene involved in cardiac hypertrophy, or a fragment thereof.

[0143] In some embodiments, a target RNA can comprise a gene encoding for a protein involved in apoptosis. Exemplary target RNA genes include, but are not limited to, bcl-2, p53, caspases, cytotoxic cytokines such as TNF-a or Fas ligand, and a number of other genes known in the art as capable of mediating apoptosis.

[01441 Iⁿ some embodiments, a target RNA comprises a gene involved in cell growth. Exemplary target RNA genes include, but not limited to, oncogenes (e.g., genes encoding for ABLI, BCLI, BCL2, BCL6, CBFA2, CBL, CSFIR, ERBA, ERBB, EBRB2, ETSI, ETSI, ETV6, FGR, FOS, FYN, HCR, HRAS, JUN, KRAS, LCK, LYN, MDM2, MLL, MYB, MYC, MYCLI, MYCN, NRAS, PIM I, PML, RET, SRC, TALI, TCL3, and YES), as well as genes encoding for tumor suppressor proteins (e g., APC, BRCA1, BRCA2, MADH4, MCC, NF I, NF2, RB I, TP53, and WTI).

[0145] In some embodiments, a target RNA can comprise a human major histocompatibility complex (MHC) gene or a fragment thereof. Exemplary MHC genes include MHC class I genes such as genes in the HLA-A, HLA-B or HLA-C subregions for class I cc chain genes, or [L-microglobulinand and MHC class II genes such as any of the genes of the DP, DQ and DR subregions of class II a chain and chain genes (i.e. DPa, DP0, DQa, DQ0, DRa, and DR0).

[0146] In some embodiments, the target RNA can comprise a gene encoding for a pathogen-associated protein. Pathogen associated protein include, but are not limited to, a viral protein involved in immunosuppression of the host, replication of the pathogen, transmission of the pathogen, or maintenance of the infection, or a host protein which facilitates entry of the pathogen into the host, drug metabolism by the pathogen or host, replication or integration of the pathogen's genome, establishment or spread of infection in the host, or assembly of the next generation of pathogen. In some embodiments, the pathogen can be a virus, such as a herpesvirus (e.g., herpes simplex, varicella-zoster virus, Epstein-Barr virus, cytomegalovirus (CMV)), hepatitis C, HIV, JC virus), a bacteria or a yeast.

[0147] In some embodiments, the target RNA comprises a gene associated with a disease or a condition of the central nervous system (CNS). Exemplary genes associated with a CNS disease or a condition include, but are not limited to, APP, MAPT, SOD1, BACE1, CASP3, TGM2, NFE2L3, TARDBP, ADRB1, CAMK2A, CBLN1, CDK5R1, GABRA1, MAPK10, NOS1, NPTX2, NRGN, NTS, PDCD2, PDE4D, PENK, SYT1, TTR, FUS, LRDD, CYBA, ATF3, ATF6, CASP2, CASP1, CASP7, CASP8, CASP9, HRK, C1QBP, BNIP3, MAPK8, MAPK14, Rael, GSK3B, P2RX7, TRPM2, PARG, CD38, STEAP4, BMP2, GJA1, TYROBP, CTGF, ANXA2, RHOA, DU0X1, RTP801, RTP801L, N0X4, N0X1, N0X2 (gp91pho, CYBB), N0X5, DU0X2, N0X01, N0X02 (p47phox, NCF1), N0XA1, N0XA2 (p67phox, NCF2), p53 (TP53), HTRA2, KEAP1, SHC1, ZNHIT1, LGALS3, HI95, SOX9, ASPP1, ASPP2, CTSD, CAPNS1, FAS and FASLG, NOGO and NOGO-R; TLR1, TLR2, TLR3, TLR4, TLR6, TLR7, TLR8, TLR9, ILlbR, MYD88, TICAM, TIRAP, HSP47, and others apparent to a person skilled in the art.

[01481 Iⁿ some embodiments, the target nucleic acid comprises a gene associated with a genetic disorder such as a mutated dystrophin gene DMD gene). In some embodiments, the target nucleic acid comprises a transcript of a gene selected from the group consisting of SMN1, SMN2, SCN1A, SCN8A, and CLN7. In some embodiments, the target nucleic acid comprises a MAPT gene or a MAPT mRNA.

Chemical modification

[0149] The antisense oligonucleotides herein described can comprise non-standard, modified nucleotides (nucleotide analog) or non-standard, modified nucleosides (nucleoside analog).

[0150] The modifications are introduced to alter certain chemical properties of the nucleotide/nucleoside such as to increase thermodynamic stability, to increase resistance to nuclease degradation (e g. exonuclease resistant), and/or to increase binding specificity and minimize off- target effects. For example, thermodynamic stability can be determined based on measurement of melting temperature T_m. A higher T_mcan be associated with a more thermodynamically stable chemical entity. The modification can comprise phosphonate modification, ribose modification (in the sugar portion), and/or base modification. FIG. 8 shows exemplary oligonucleotide modifications.

[0151] In some embodiments, the modified nucleotide can comprise modifications to the sugar portion of the nucleotides. For example, the 2’ OH-group of a nucleotide can be replaced by a group selected from H, OR, R, F, Cl, Br, I, SH, SR, NH2, NHR, NR2, COOR, or OR, wherein R is substituted or unsubstituted Ci-Ce alkyl, alkenyl, alkynyl, aryl, etc. In some embodiments, the 2’ OH-group of a nucleotide or nucleoside is replaced by 2’ O-methyl group and the modified nucleotide or nucleoside is a 2’-O-methyl nucleotide or 2’-O-methyl nucleoside (2’-0Me). The 2’- O-methyl nucleotide or 2’ -O-methyl nucleoside can be 2'-O-methyladenosine, 2'-O- methylguanosine, 2'-O-methyluridine, or 2'-O-methylcytidine. In some embodiments, the 2’ OH- group of a nucleotide is replaced by fluorine (F), and the modified nucleotide or nucleoside is a 2’-F nucleotide or 2’-F nucleoside (2’ -deoxy-2’ -fluoro or 2’-F).The 2’-F nucleotide or 2’-F nucleoside can be 2'-F-adenosine, 2'-F -guanosine, 2'-F -uridine, or 2'-F-cytidine.

[0152] In some embodiments, the modified nucleotide can comprise a modification in the phosphate group of the nucleotide, e.g. by substituting one or more of the oxygens of the phosphate group with sulfur or a methyl group. In some embodiments, one or more of the nonbridging oxygens of the phosphate group of a nucleotide is replaced by a sulfur. In some embodiments, the antisense oligonucleotide herein described comprise one or more non-standard internucleoside linkage that is not a phosphodiester linkage. In some embodiments, the antisense oligonucleotide herein described comprise one or more phosphorothioate internucleoside linkages. In some embodiments, the introduction of one or more phosphorothioate linkage in the antisense oligonucleotide can endow the modified nucleotides with increased resistance to nucleases (e.g. endonucleases and/or exonucleases).

[0153] In some embodiments, the modified nucleotide can comprise modifications to or substitution of the base portion of a nucleotide. For example, uridine and cytidine residues can be substituted with pseudouridine, 2-thiouridine, N6-methyladenosine, 5 -methy cytidine or other base analogs of uridine and cytidine residues. Adenosine can comprise modifications to Hoogsteen (e g. 7-triazolo-8-aza-7-deazaadenosines) and/or Watson-Crick face of adenosine (e.g. N2-alkyl-2- aminopurines). Examples of adenosine analogs also include Hoogsteen or Watson-Crick face- localized N-ethylpiperidine triazole-modified adenosine analogs, N-ethylpiperidine 7-EAA triazole (e.g. 7-EAA, 7-ethynyl-8-aza-7-deazaadenosine) and other adenosine analogs identifiable to a person skilled in the art. Cytosine may be substituted with any suitable cytosine analogs identifiable to a person skilled in the art. For example, cytosine can be substituted with 6’- phenylpyrrolocytosine (PhpC) which has shown comparable base pairing fidelity, thermal stability and high fluorescence.

[0154] In some embodiments, the antisense oligonucleotide herein described can comprise one or more locked nucleic acids or analogs thereof. Exemplary locked nucleic acid analogs include, for example, their corresponding locked analog phosphoramidites and other derivatives apparent to a skilled artisan.

[0155] In some embodiments, the antisense oligonucleotide herein described can comprise other chemically modified nucleotide or nucleoside with 2’-4’ bridging modifications. A 2’ -4’ bridging modification refers to the introduction of a bridge connecting the and 4' carbons of a nucleotide. The bridge can be a 2’-O, 4’-C methylene bridge (e.g. in LNA). The bridge can also be a 2’-O, 4’-C ethylene bridge (e.g. in ethyl en-bridged nucleic acids (ENA)) or any other chemical linkage identifiable to a person skilled in the art.

[0156] In some embodiments, the introduction of LNA, analogues thereof, or other chemically modified nucleotides with 2’-4’ bridging modifications in the ASO herein described can enhance hybridization stability as well as mismatch discrimination. For example, an antisense oligonucleotide comprising LNA, analogues thereof, or other chemically modified nucleotides with 2’ -4’ bridging modifications can have an enhanced sensitivity to distinguish between matched and mismatched target nucleic acid strand.

[0157] In some embodiments, the antisense oligonucleotide described herein does not comprise a locked nucleic acid. The lack of locked nucleic acids in the antisense oligonucleotide can attenuate cytotoxicity induced by locked nucleic acids.

[0158] In some embodiments, the antisense oligonucleotide can comprise a chemical moiety linked to the 3’ and/or 5’ terminus of the strand. The terminal moiety can include one or more any suitable terminal linkers or modifications. For example, the terminal moiety can include a linker to link the oligonucleotide with another molecule or a particular surface (biotins, amino- modifiers, alkynes, thiol modifiers, azide, N-Hydroxysuccinimide, and cholesterol), a dye (e.g. fluorophore or a dark quencher), a fluorine modified ribose, a space (e g. C3 spacer, Spacer 9, Spacer 18, dSpacer, tri-ethylene glycol spacer, hexa-ethylene glycol spacer), moi eties and chemical modification involved in click chemistry (e.g. alkyne and azide moieties), and any linkers or terminal modifications that can be used to attach the 3' and 5' end to other chemical moieties such as antibodies, gold or other metallic nanoparticles, polymeric nanoparticles, dendrimer nanoparticles, small molecules, single chain or branched fatty acids, peptides, proteins, aptamers, and other nucleic acid strands and nucleic acid nanostructures. The terminal moiety can serve as a label capable of detection or a blocker to protect a single-stranded nucleic acid from nuclease degradation. Additional linkers and terminal modification that can be attached to the terminus of the sensor nucleic acid strand are described in www.idtdna.com/pages/products/custom-dna-rna/oligo- modifications and www.glenresearch.com/browse/labels-and-modifiers, the contents of which are incorporated herein by reference in their entirety.

[0159] Additional modifications to the nucleotides and/or nucleosides can also be introduced to the antisense oligonucleotide herein described, such as modifications described in Hammond et al. (EMB0 Molecular Medicine 13:el3243), the content of which is incorporated by reference in its entirety.

Pharmaceutical compositions and methods of administration

Compositions

[0160] Also provided herein include pharmaceutical compositions comprising the oligonucleotide as herein described, in combination with one or more compatible and pharmaceutically acceptable carriers.

[0161] The oligonucleotide herein described can be suitably formulated and introduced into cell environment by any means that allows for a sufficient portion of the constructs to enter the cells to induce gene silencing, if it occurs.

[0162] The oligonucleotide can be admixed, encapsulated, conjugated, or associated with other molecules, molecule structures, mixtures of compounds or agent, or other formulations for assistance in uptake, distribution, and/or absorption during delivery.

[0163] The phrase “pharmaceutically acceptable” is employed herein to refer to those agents, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.

[0164] The term “pharmaceutically acceptable excipient” as used herein refers to any suitable substance that provides a pharmaceutically acceptable carrier, additive or diluent for administration of a compound(s) of interest to a subject. Pharmaceutically acceptable excipient can encompass substances referred to as pharmaceutically acceptable diluents, pharmaceutically acceptable additives, and pharmaceutically acceptable carriers.

[0165] The phrase “pharmaceutically acceptable carrier” as used herein means a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid fdler, diluent, excipient, solvent or encapsulating material, involved in carrying or transporting the subject chemical from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject. Some examples of materials which can serve as pharmaceutically-acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as com starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth: (5) malt; (6) gelatin; (7) talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) phosphate buffer solutions; and (21) other non-toxic compatible substances employed in pharmaceutical formulations.

[0166] In some embodiments, pharmaceutically acceptable carrier comprise a pharmaceutical acceptable salt. As used herein, a “pharmaceutical acceptable salt” includes a salt of an acid form of one of the components of the compositions herein described. These include organic or inorganic acid salts of the amines. Preferred acid salts are the hydrochlorides, acetates, salicylates, nitrates and phosphates. Other suitable pharmaceutically acceptable salts are well known to those skilled in the art and include basic salts of a variety of inorganic and organic acids.

[0167] In some embodiments, pharmaceutically acceptable salts to be used with the nucleic acid complex herein described include but are not limited to (1) salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine and spermidine; (2) acid addition salts formed with inorganic acids, for example hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid and the like; (3) salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p- toluenesulfonic acid, naphthalene disulfonic acid, polygalacturonic acid, and the like; and (4) salts formed from elemental anions such as chlorine, bromine, and iodine.

Delivery

[0168] Various delivery systems can be employed for delivering the nucleic acid complex herein described such as antibody conjugates, micelles, natural polysaccharides, peptides, synthetic cationic polymers, microparticles, lipid-based nanovectors among others.

[0169] Delivery systems and the related excipients used for delivery of the oligonucleotide herein described can vary in different embodiments. Delivery systems can be selected based on the mode of administration utilized, types of formulations, target sites, and types of diseases or disorders to be treated to facilitate tissue penetration, cellular uptake and to prevent extravasation and endosomal escape.

[0170] In some embodiments, the oligonucleotide can be formulated with one or more polymers to form a supramolecular complex containing the oligonucleotide and a multi-dimensional polymer network. The polymer can be linear or branched. The supramolecular complex can take any suitable form, and preferably, is in the form of particles.

[0171] The oligonucleotide can be delivered via a lipid-mediated delivery system. In some embodiments, the oligonucleotide can be encapsulated or associated with liposomes. For example, the oligonucleotide can be condensed with a polycationic condensing agent, suspended in a low-ionic strength aqueous medium and cationic liposomes formed of a cationic vesicle-forming lipid.

[0172] As used herein, the term “liposomes” refers to lipid vesicles having an outer lipid shell, typically formed on one or more lipid bilayers, encapsulating an aqueous interior. In some embodiments, the liposomes are cationic liposomes composed of between about 20-80 mole percent of a cationic vesicle-forming lipid, with the remaining neutral vesicle-forming lipids and/or other components. As used herein, “vesicle-forming lipid” refers to any amphipathic lipid having hydrophobic and polar head group moieties and which by itself can form spontaneously into bilayer vesicles in water (e.g. phospholipids). A preferred vesicle-forming lipid is a diacyl-chain lipid, such as a phospholipid, whose acyl chains are typically between about 14-22 carbon atoms in length, and have varying degrees of unsaturation.

[0173] A cationic vesicle-forming lipid is a vesicle-forming lipid whose polar head group with a net positive charge, at the operational pH, e.g., pH 4-9. Examples include phospholipids (e g., phosphatidylethanolamine), glycolipids (e g., cerebrosides and gangliosides having a cationic polar head-group), cholesterol amine and related cationic sterols (e.g., 1,2- diolelyloxy-3-(trimethylanuno) propane (DOTAP), N-[l-(2,3,-ditetradecyloxy)propyl]-N,N- dimethyl-N-hydroxyethylammonium bromide (DMRIE), N-[l-(2,3,-dioleyloxy)propyl]-N,N- dimethyl-N-hydroxy ethylammonium bromide (DORIE), N-[l-(2,3-dioleyloxy)propyl]-N,N,N- trimethylammonium chloride (DOTMA), 3P [N — (N',N '-dimethylaminoethane) carbamoyl] cholesterol (DC-Choi), and dimethyldioctadecylammonium (DDAB)).

[0174] A neutral vesicle-forming lipid is a vesicle-forming lipid having no net charge or including a small percentage of lipids having a negative charge in the polar head group. Examples of vesicle-forming lipids include phospholipids, such as phosphatidylcholine (PC), phosphatidyl ethanolamine (PE), phosphatidylinositol (PI), and sphingomyelin (SM), and cholesterol, cholesterol derivatives, and other uncharged sterols.

[0175] In some embodiments, the delivery systems used herein include, but are not limited to, nanoparticles (NPs), inorganic nanoparticles (e.g. silica NPs, gold NPs, Qdots, superparamagnetic iron oxide NPs, paramagnetic lanthanide ions) and other nanomaterials, nucleic acid lipid particles, polymeric nanoparticles, lipidoid nanoparticles (LNPs), chitosan and inulin nanoparticles, cyclodextrins nanoparticles, carbon nanotubes, liposomes, micellar structures, capsids, polymers (e.g. polyethylenimine, anionic polymers), polymer matrices, hydrogels, dendrimers (e.g. poly-propylenimine (PPI) and poly-amidoamine (PAMAM)), nucleic acid nanostructure, exosomes, and GalN Ac-conjugated melittin-like peptides (NAG-MLPs). In some embodiments, the oligonucleotide can be formulated in buffer solutions such as phosphate buffered saline solutions.

[0176] In some embodiments, the oligonucleotide herein described is delivered via lipidoid nanoparticles (LNPs). LNPs can comprise ionizable LNPs, cationic LNPs, and/or neutral LNPs. Ionizable LNPs are nearly uncharged during circulation but become protonated in a low pH environment, e.g., in the endosomes and lysosomes. Cationic LNPs exhibit a constitutive positive charge in blood circulation and in endosomes or lysosomes. Neutral LNPs are neutral, uncharged during circulation and in endosomes or lysosomes.

[0177] The oligonucleotide herein described can be provided naked or conjugated to a ligand. Naked antisense oligonucleotides refer to a system that contains no delivery system that is associated with the oligonucleotide either covalently or noncovalently. When delivered in naked form, the naked oligonucleotide can be locally injected to a target site such as specific organs that are relatively closed off and contain few nucleases (e.g. eye). In some embodiments, the oligonucleotide herein described is delivered via gymnosis.

[0178] In some embodiments, the oligonucleotide (e.g., antisense oligonucleotide) herein described can be attached to (e.g. fused or conjugated) a ligand to form ligand- oligonucleotide conjugates that can transport the oligonucleotide to desired tissues and cells by specific recognition and interactions between the ligand and the surface receptor of the cells or tissues. Common targeting ligands include carbohydrate, aptamers, antibodies or antibody fragments, peptides (e.g., cell-penetrating peptides, endosomolytic peptides), and small molecules (e.g., N-Acetylgalactosamine (GalNAc)), and others as will be apparent to a skilled artisan.

[0179] In some embodiments, the oligonucleotide (e.g., antisense oligonucleotide) is conjugated to an aptamer. The term “aptamers” as used here refers to oligonucleotide or peptide molecules that bind a specific target with high affinity and specificity. In particular, nucleic acid aptamers can comprise, for example, nucleic acid species that have been engineered through repeated rounds of in vitro selection or equivalently, SELEX (systematic evolution of ligands by exponential enrichment) to bind to various molecular targets such as small molecules, proteins, nucleic acids, and even cells, tissues and organisms. Peptide aptamers are peptides that are designed to specifically bind to and interfere with protein-protein interactions inside cells. In particular, peptide aptamers can be derived, for example, according to a selection strategy that is derived from the yeast two-hybrid (Y2H) system. Aptamers are useful in biotechnological and therapeutic applications as they offer molecular recognition properties that rival that of the antibodies.

[0180] In some embodiments, the oligonucleotide (e.g., antisense oligonucleotide) is conjugated to a small molecule. The term “small molecule” as used herein indicates an organic compound that is of synthetic or biological origin and that, although may include monomers and/or primary metabolites, is not a polymer. In some embodiments, small molecules can comprise molecules that are not protein or nucleic acids, which play a biological role that is endogenous (e.g., inhibition or activation of a target) or exogenous (e.g., cell signaling), which are used as a tool in molecular biology, or which are suitable as drugs in medicine. Small molecules can also have no relationship to natural biological molecules. Typically, small molecules have a molar mass lower than 1 kg/mol. Exemplary small molecules include secondary metabolites (e.g., actinomycin-D), certain antiviral drugs (such as amantadine and rimantadine), teratogens and carcinogens (such as phorbol 12-myristate 13-acetate), natural products (such as penicillin, morphine and paclitaxel) and additional molecules identifiable by a skilled artisan. In some embodiments, the nucleic acid complex herein described is conjugated to GalNAc.

[0181] Examples of ligands suitable for use in targeting the oligonucleotide to specific cell types include, but are not limited to, folate capable of binding to folate receptor of epithelial carcinomas and bone marrow stem cells, water soluble vitamins capable of binding to vitamin receptors of various cells, pyridoxyl phosphate capable of binding to CD4 of CD4⁺ lymphocytes, apolipoproteins capable of binding to LDL of liver hepatocytes and vascular endothelial cells, insulin capable of binding to insulin receptor, transferrin capable of binding to transferrin receptor of endothelial cells, galactose capable of binding to asialoglycoprotein receptor of liver hepatocytes, sialyl-Lewisx capable of binding to E, P selectin of activated endothelial cells, Mac-1 capable of binding to L selectin of neutrophils and leukocytes, VEGF capable of binding to Flk-1,2 of tumor epithelial cells, basic FGF capable of binding to FGF receptor of tumor epithelial cells, EFG capable of binding to EFG receptor of epithelial cells, VCAM-1 capable of binding to a+bi integrin of vascular endothelial cells, ICAM-1 capable of binding to aiTn integrin of vascular endothelial cells, PECAM-1/CD31 capable of binding to a_vb3 integrin of vascular endothelial cells and activated platelets, osteopontin capable of binding to a_vbi integrin and a_vbs integrin of endothelial cells and smooth muscle cells in atherosclerotic plaques, RGD sequences capable of binding to a_vb3 integrin of tumor endothelial cells and vascular smooth muscle cells, or HIV GP 120/41 or GP120 capable of binding to CD4 of CD4⁺ lymphocytes, and others identifiable to a skilled artisan.

[0182] In some embodiments, the delivery of the oligonucleotide (e.g., antisense oligonucleotide) herein described is such that at least 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the target cells incorporate the oligonucleotide. In some embodiments, about 0.1-10 nM oligonucleotide is delivered to the target cells.

Formulations

[0183] Any suitable pharmaceutical formulations can be employed. In some embodiments, the pharmaceutical compositions of the present disclosure may be specially formulated for administration in solid or liquid form, including those adapted for the following: (1) oral administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, boluses, powders, granules, pastes; (2) parenteral administration, for example, by subcutaneous, intramuscular or intravenous injection as, for example, a sterile solution or suspension: (3) topical application, for example, as a cream, ointment or spray applied to the skin; (4) intravaginally or intrarectally, for example, as a pessary, cream or foam; or (5) aerosol, for example, as an aqueous aerosol, liposomal preparation or solid particles containing the hydrogel composition. The pharmaceutical compositions can comprise one or more pharmaceutically- acceptable carriers.

[0184] Formulations useful in the methods of the present disclosure include those suitable for oral, nasal, topical (including buccal and sublingual), rectal, vaginal, aerosol and/or parenteral administration. The formulations may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy. The amount of active ingredient which can be combined with a carrier material to produce a single dosage form will vary depending upon the host being treated, the particular mode of administration. The amount of active ingredient, which can be combined with a carrier material to produce a single dosage form will generally be that amount of the RNAi constructs which produces a therapeutic effect. Generally, out of one hundred percent, this amount will range from about 1% to about 99% of active ingredient, preferably from about 5% to about 70%, most preferably from about 10% to about 30%.

[0185] Formulations suitable for oral administration may be in the form of capsules, cachets, pills, tablets, lozenges (using a flavored basis, usually sucrose and acacia or tragacanth), powders, granules, or as a solution or a suspension in an aqueous or non-aqueous liquid, or as an oil-in-water or water-in-oil liquid emulsion, or as an elixir or syrup, or as pastilles (using an inert base, such as gelatin and glycerin, or sucrose and acacia) and/or as mouth washes and the like, each containing a predetermined amount of a respiration uncoupling agent as an active ingredient. A nucleic acid complex composition may also be administered as a bolus, electuary or paste.

[0186] In solid dosage forms for oral administration (capsules, tablets, pills, dragees, powders, granules and the like), the active ingredient is mixed with one or more pharmaceutically- acceptable carriers, such as sodium citrate or dicalcium phosphate, and/or any of the following: (1) fillers or extenders, such as starches, lactose, sucrose, glucose, mannitol, and/or silicic acid; (2) binders, such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinyl pyrrolidone, sucrose and/or acacia; (3) humectants, such as glycerol; (4) disintegrating agents, such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate; (5) solution retarding agents, such as paraffin; (6) absorption accelerators, such as quaternary ammonium compounds; (7) wetting agents, such as, for example, acetyl alcohol and glycerol monostearate; (8) absorbents, such as kaolin and bentonite clay; (9) lubricants, such a talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof; and (10) coloring agents. In the case of capsules, tablets and pills, the pharmaceutical compositions may also comprise buffering agents. Solid compositions of a similar type may also be employed as fdlers in soft and hard-fdled gelatin capsules using such excipients as lactose or milk sugars, as well as high molecular weight polyethylene glycols and the like.

[0187] A tablet may be made by compression or molding, optionally with one or more accessory ingredients. Compressed tablets may be prepared using binder (for example, gelatin or hydroxypropylmethyl cellulose), lubricant, inert diluent, preservative, disintegrant (for example, sodium starch glycolate or cross-linked sodium carboxymethyl cellulose), surface-active or dispersing agent. Molded tablets may be made by molding in a suitable machine a mixture of the powdered peptide or peptidomimetic moistened with an inert liquid diluent.

[0188] Actual dosage levels of the active ingredients in the pharmaceutical compositions of the present disclosure may be determined by the methods of the present invention so as to obtain an amount of the active ingredient, which is effective to achieve the desired therapeutic response for a particular subject, composition, and mode of administration, without being toxic to the subject.

[0189] Tablets, and other solid dosage forms, such as dragees, capsules, pills and granules, may optionally be scored or prepared with coatings and shells, such as enteric coatings and other coatings well known in the pharmaceutical-formulating art. They may also be formulated so as to provide slow or controlled release of the active ingredient therein using, for example, hydroxypropylmethyl cellulose in varying proportions to provide the desired release profile, other polymer matrices, liposomes and/or microspheres. They may be sterilized by, for example, filtration through a bacteria-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions, which can be dissolved in sterile water, or some other sterile injectable medium immediately before use. These compositions may also optionally contain opacifying agents and may be of a composition that they release the active ingredient(s) only, or preferentially, in a certain portion of the gastrointestinal tract, optionally, in a delayed manner. Examples of embedding compositions, which can be used include polymeric substances and waxes. The active ingredient can also be in micro-encapsulated form, if appropriate, with one or more of the above-described excipients.

[0190] Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups and elixirs. In addition to the active ingredient, the liquid dosage forms may contain inert diluents commonly used in the art, such as, for example, water or other solvents, solubilizing agents and emulsifiers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, oils (in particular, cottonseed, groundnut, com, germ, olive, castor and sesame oils), glycerol, tetrahydrofuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof.

[0191] Besides inert diluents, the oral compositions can also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, coloring, perfuming and preservative agents.

[0192] Suspensions, in addition to the active agent may contain suspending agents as, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, and mixtures thereof.

[0193] Formulations for rectal or vaginal administration may be presented as a suppository, which may be prepared by mixing one or more respiration uncoupling agents with one or more suitable nonirritating excipients or carriers comprising, for example, cocoa butter, polyethylene glycol, a suppository wax or a salicylate, and which is solid at room temperature, but liquid at body temperature and, therefore, will melt in the rectum or vaginal cavity and release the active agent.

[0194] Formulations which are suitable for vaginal administration also include pessaries, tampons, creams, gels, pastes, foams or spray formulations containing such carriers as are known in the art to be appropriate.

[0195] Dosage forms for the topical or transdermal administration of hydrogel compositions include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches and inhalants. The active component may be mixed under sterile conditions with a pharmaceutically-acceptable carrier, and with any preservatives, buffers, or propellants which may be required.

[0196] The ointments, pastes, creams and gels may contain, in addition to a respiration uncoupling agent, excipients, such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc and zinc oxide, or mixtures thereof.

[0197] Ophthalmic formulations, eye ointments, powders, solutions (e.g. eye drops) and the like, are also contemplated as being within the scope of the present disclosure.

[01981 Examples of suitable aqueous and nonaqueous carriers which may be employed in the pharmaceutical compositions of the invention include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.

[0199] These compositions may also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention of the action of microorganisms may be ensured by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol sorbic acid, and the like. It may also be desirable to include isotonic agents, such as sugars, sodium chloride, and the like into the compositions. In addition, prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption such as aluminum monostearate and gelatin.

[0200] The pharmaceutical compositions herein described comprise a therapeutically- effective amount of the nucleic acid complexes.

[0201] The phrase “therapeutically-effective amount” as used herein means that amount of nucleic acid complex disclosed herein which is effective for producing some desired therapeutic effect, e.g., cancer treatment, at a reasonable benefit/risk ratio. The therapeutically-effective amount also varies depending on the structure of the constructs, the route of administration utilized, the target sites, and the specific diseases or disorders to be treated as will be understood to a person skilled in the art. For example, if a given clinical treatment is considered effective when there is at least a 20% reduction in a measurable parameter associated with a disease or disorder, a therapeutically-effective amount of the constructs for the treatment of that disease or disorder is the amount necessary to achieve at least a 20% reduction in that measurable parameter.

[0202] In some embodiments, the pharmaceutical composition herein described comprises the oligonucleotide in a suitable dosage sufficient to inhibit expression of the target gene in a subject (e.g. animal or human) being treated. In some embodiments, a suitable dosage of the oligonucleotide is in the range of 0.001 to 0.25 milligrams per kilogram body weight of the subject per day, or in the range of 0.01 to 20 micrograms per kilogram body weight per day, or in the range of 0.01 to 10 micrograms per kilogram body weight per day, or in the range of 0.10 to 5 micrograms per kilogram body weight per day, or in the range of 0.1 to 2.5 micrograms per kilogram body weight per day. The pharmaceutical compositions comprising the oligonucleotide can be administered once daily, twice daily, three times daily or as needed or prescribed by a physician. The pharmaceutical composition herein described can also be provided in dosage units comprising two, three, four, five, six or more sub-doses administered at appropriate intervals throughout the day. The dosage unit can also be compounded for a single dose (e.g. using sustained or controlled release formulation) which can be sustainably released over several days in a controlled manner.

[0203] As will be apparent to a skilled person, a suitable dosage unit of the pharmaceutical composition herein described can be estimated from data obtained from cell culture assays and further determined from data obtained in animal studies. For example, toxicity and therapeutic efficacy of the pharmaceutical compositions described herein can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. Compositions that exhibit large therapeutic indices are preferred. Suitable dosages of the compositions in combination with particular delivery systems can be selected in order to minimize toxicity, such as to minimize potential damage to untargeted cells and to reduce side effects.

Administration

[0204] As will be apparent to a skilled artisan, the oligonucleotide herein described and compositions thereof can be administrated to a subject using any suitable administration routes. The nucleic acid complexes and compositions thereof can be administered to a target site locally or systematically.

[0205] The wording “local administration” or “topic administration” as used herein indicates any route of administration by which a composition is brought in contact with the body of the individual, so that the resulting composition location in the body is topic (limited to a specific tissue, organ or other body part where the imaging is desired). Exemplary local administration routes include injection into a particular tissue by a needle, gavage into the gastrointestinal tract, and spreading a solution containing hydrogel composition on a skin surface.

[0206] The wording “systemic administration” as used herein indicates any route of administration by which a nucleic acid complex composition is brought in contact with the body of the individual, so that the resulting composition location in the body is systemic (i.e. non limited to a specific tissue, organ or other body part where the imaging is desired). Systemic administration includes enteral and parenteral administration. Enteral administration is a systemic route of administration where the substance is given via the digestive tract, and includes but is not limited to oral administration, administration by gastric feeding tube, administration by duodenal feeding tube, gastrostomy, enteral nutrition, and rectal administration. Parenteral administration is a systemic route of administration where the substance is given by route other than the digestive tract and includes but is not limited to intravenous administration, intra-arterial administration, intramuscular administration, subcutaneous administration, intradermal, administration, intraperitoneal administration, and intravesical infusion.

[0207] In some embodiments, the methods of administration can comprise aerosol delivery, nasal delivery, vaginal delivery, rectal delivery, buccal delivery, ocular delivery, local delivery, topical delivery, intraci sternal delivery, intraperitoneal delivery, oral delivery, intramuscular injection, intravenous (IV) injection, subcutaneous (SC) injection, intranodal injection, intratumoral injection, intraperitoneal injection, and/or intradermal injection, or any combination thereof. The administration can also be site-specific injection (e.g. in the eye or the cerebral spinal fluid).

[0208] In some embodiments, the administration can be Ex vivo transduction, cell injection, subcutaneous injection, intravenous injection, intrathecal delivery, intracerebroventricular injection, intradermal injection, intravitreal delivery, intratumoral delivery, or topical application (e g. topical eye drop).

[0209] The methods of administration depends on the target site, the type of cells/tissues to be targeted at, and how the constructs are formulated. In some embodiments, lipid formulations can be administered to animals such as by intravenous, intramuscular, or intraperitoneal injection, or orally or by inhalation or other methods as known in the art.

[0210] In some embodiments, the administration can be IV injection. In some embodiments, IV administration can be associated with ligand-conjugated oligonucleotide or oligonucleotide associated with a carrier herein described. In some embodiments, IV administration can be associated with naked oligonucleotide herein described via gymnosis.

[0211] In some embodiments, the administration can be SC injection into the adipose tissue below the epidermis and dermis. In some embodiments, SC administration can be associated with ligand-conjugated oligonucleotide herein described. In some embodiments, SC administration can be associated with naked oligonucleotide herein described via gymnosis. In some embodiments, SC administration can render a slower release rate of the drugs into the systemic circulation and an entering into the lymphatic system, giving more time for recycling of cellular receptors that mediate uptake. In some embodiments, SC administration can be faster and easier to administer, reducing treatment burden. [0212] IV administration can, for example, be associated with nanoparticle and lipid nanoparticle formulated nucleic acid complex herein described. In some embodiments, IV administration can avoid first-pass metabolism in the liver and affords quick access to target tissue through the systemic circulation.

Target sites

[0213] The compositions herein described can be administered to any suitable target site. Target sites can be in vitro, in vivo or ex vivo. Exemplary target sites can include cells grown in an in vitro culture, including, primary mammalian, cells, immortalized cell lines, tumor cells, stem cells, and the like. Additional exemplary target sites include cells, tissues and organs in an ex vivo culture and cells, tissues, organs, or organs systems in vivo in a subject, for example, lungs, brain, kidney, liver, heart, the central nervous system, the peripheral nervous system, the gastrointestinal system, the circulatory system, the immune system, the skeletal system, the sensory system, within a body of an individual and additional environments identifiable by a skilled person.

[0214] The target site can comprise a site of disease or disorder or can be proximate to a site of a disease or disorder. The location of the one or more sites of a disease or disorder can be predetermined. The location of the one or more sites of a disease or disorder can be determined during the method (e.g., by an imaging-based method such as ultrasound or MRI). The target site can comprise a tissue, such as, for example, adrenal gland tissue, appendix tissue, bladder tissue, bone, bowel tissue, brain tissue, breast tissue, bronchi, coronal tissue, ear tissue, esophagus tissue, eye tissue, gall bladder tissue, genital tissue, heart tissue, hypothalamus tissue, kidney tissue, large intestine tissue, intestinal tissue, larynx tissue, liver tissue, lung tissue, lymph nodes, mouth tissue, nose tissue, pancreatic tissue, parathyroid gland tissue, pituitary gland tissue, prostate tissue, rectal tissue, salivary gland tissue, skeletal muscle tissue, skin tissue, small intestine tissue, spinal cord, spleen tissue, stomach tissue, thymus gland tissue, trachea tissue, thyroid tissue, ureter tissue, urethra tissue, soft and connective tissue, peritoneal tissue, blood vessel tissue and/or fat tissue. The tissue can be inflamed tissue. The tissue can comprise (i) grade I, grade II, grade III or grade IV cancerous tissue; (ii) metastatic cancerous tissue; (iii) mixed grade cancerous tissue; (iv) a subgrade cancerous tissue; (v) healthy or normal tissue; and/or (vi) cancerous or abnormal tissue. In some embodiments, upon administration, the nucleic acid complex and a composition thereof accumulates in vasculature of cancerous tissue. In some embodiments, the target site can comprise a solid tumor.

[0215] In some embodiments, target sites where the oligonucleotide or compositions thereof can be administered can vary in different embodiments depending on the mode of administration utilized and the types of diseases or disordered to be treated. In some embodiments, the target sites can be related to ocular tissues, respiratory system, muscle, liver, central nerve system, solid tumors, hematopoietic system, skin, eye, placenta, bone, or other target sites in an individual as will be apparent to a skilled artisan.

[0216] The term “individual” or “subject” or “patient” as used herein includes an animal and in particular higher animals and in particular vertebrates such as mammals and more particularly human beings.

[0217] In some embodiments, the ratio of the concentration of the oligonucleotide at the subject’s target site to the concentration of the oligonucleotide outside the target site (e.g. in subject’s blood circulation, serum, or plasma) can vary. In some embodiments, the ratio of the concentration of the oligonucleotide at the subject’s target site to the concentration of the oligonucleotide outside the target site (e.g. in subject’s blood circulation, serum, or plasma) can be, or be about, be at least, be at least about, be at most, or be at most about, 1:1, 1.1:1, 1.2:1, 1.3:1, 1.4:1, 1.5:1, 1.6:1, 1.7:1, 1.8:1, 1.9:1, 2:1, 2.5:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, 21:1, 22:1, 23:1, 24:1, 25:1, 26:1, 27:1, 28:1, 29:1,

30:1, 31:1, 32:1, 33:1, 34:1, 35:1, 36:1, 37:1, 38:1, 39:1, 40:1, 41:1, 42:1, 43:1, 44:1, 45:1, 46:1,

47:1, 48:1, 49:1, 50:1, 51:1, 52:1, 53:1, 54:1, 55:1, 56:1, 57:1, 58:1, 59:1, 60:1, 61:1, 62:1, 63:1,

64:1, 65:1, 66:1, 67:1, 68:1, 69:1, 70:1, 71:1, 72:1, 73:1, 74:1, 75:1, 76:1, 77:1, 78:1, 79:1, 80:1,

81:1, 82:1, 83:1, 84:1, 85:1, 86:1, 87:1, 88:1, 89:1, 90:1, 91:1, 92:1, 93:1, 94:1, 95:1, 96:1, 97:1,

98:1, 99:1, 100:1, 200:1, 300:1, 400:1, 500:1, 600:1, 700:1, 800:1, 900:1, 1000:1, 2000:1, 3000:1, 4000:1, 5000:1, 6000:1, 7000:1, 8000:1, 9000:1, 10000:1, or a number or a range between any two of the values.

[0218] The target site can comprise target cells. The target cells can be tumor cells (e.g. solid tumor cells). In some embodiments, the administration of the oligonucleotide and/or compositions herein described to a target site of the subject results in the death of at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%, or a number or a range between any two of these values, of the target cells. The ratio of target cell death to non-target cell death after administration of the oligonucleotide and/or compositions can be at least about 2:1. In some embodiments, the ratio of target cell death to non-target cell death after administration of the oligonucleotide and/or compositions can be, or be about, or be at least, or be at least about, or be at most, or be at most about, 1:1, 1.1:1, 1.2:1, 1.3:1, 1.4:1, 1.5:1, 1.6:1, 1.7:1, 1.8:1, 1.9:1, 2:1, 2.5:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, 21:1, 22:1, 23:1, 24:1, 25:1, 26:1, 27:1, 28:1, 29:1, 30:1, 31:1, 32:1, 33:1, 34:1, 35:1, 36:1, 37:1, 38:1, 39:1, 40:1, 41:1, 42:1,

43:1, 44:1, 45:1, 46:1, 47:1, 48:1, 49:1, 50:1, 51:1, 52:1, 53:1, 54:1, 55:1, 56:1, 57:1, 58:1, 59:1,

60:1, 61:1, 62:1, 63:1, 64:1, 65:1, 66:1, 67:1, 68:1, 69:1, 70:1, 71:1, 72:1, 73:1, 74:1, 75:1, 76:1,

77:1, 78:1, 79:1, 80:1, 81:1, 82:1, 83:1, 84:1, 85:1, 86:1, 87:1, 88:1, 89:1, 90:1, 91:1, 92:1, 93:1,

94:1, 95:1, 96:1, 97:1, 98:1, 99:1, 100:1, 200:1, 300:1, 400:1, 500:1, 600:1, 700:1, 800:1, 900:1, 1000:1, 2000:1, 3000:1, 4000:1, 5000:1, 6000:1, 7000:1, 8000:1, 9000:1, 10000:1, or a number or a range between any two of the values.

Methods of modulating a target nucleic acid

[0219] Also provided herein is a method of modulating a target nucleic acid using the oligonucleotides or a composition thereof herein described. In some embodiments, the method comprises contacting a cell comprising a target nucleic acid with a stem-loop oligonucleotide described herein. Upon detection of the target nuclei acid, the single-stranded overhang can bind to the target nucleic acid to cause displacement of the first region (protected domain) from the second region (protection domain) and binding of the first region to the target nucleic acid, thereby modulating the target nucleic acid.

[0220] In some embodiments, the method comprises contacting a cell with a duplex oligonucleotide complex described herein. The first single-stranded overhang in the antisense oligonucleotide strand binds to a target nucleotide in the cell to cause displacement of the first domain in the antisense oligonucleotide strand from the second domain in the adapter strand, thereby releasing the antisense oligonucleotide strand from the double-stranded duplex structure.

[0221] Contacting the cells with the oligonucleotide can be performed with cells in vitro, in vivo or ex vivo. For example, the cells can be cells grown in an in vitro culture, including, primary mammalian, cells, immortalized cell lines, tumor cells, neuronal cells, stem cells, and the like. The cells can comprise cells, tissues and organs in an ex vivo culture and cells, tissues, organs, or organs systems in vivo in a subject, for example, lungs, brain, kidney, liver, heart, the central nervous system, the peripheral nervous system, the gastrointestinal system, the circulatory system, the immune system, the skeletal system, the sensory system, within a body of an individual and additional environments identifiable by a skilled person. The cell can be a disease cell or a cell of disorder. The cell can be a cancer cell. The cell can be a neuronal cell. Contacting the cell with the oligonucleotide can occur can also occur in vitro, ex vivo, or in vivo e.g., in the body of a subject.

[0222] In some embodiments, a method disclosed herein can be used to inhibit or reduce the expression or transcription of a target gene. For example, the method disclosed herein can be used to down-regulate expression of the MAPT mRNA in a subject (e.g., in a human cell, particularly in a neuronal cell). Accordingly, provided herein includes a method of inhibiting or reducing Tau protein expression in a cell. The method can comprise contacting a cell expressing Tau protein with a stem-loop oligonucleotide described herein or a pharmaceutical composition comprising the stem-loop oligonucleotide, thereby inhibiting or reducing the Tau protein expression. The stem-loop oligonucleotide can comprises an ASO domain having a sequence complementary to a nucleic acid sequence within the MAPT mRNA (e.g., a mRNA transcript of SEQ ID NO: 175). In some embodiments, the stem-loop oligonucleotide can comprise a sequence selected from the group consisting of SEQ ID NOs: 1-94 or a variant thereof having one, two or three mismatches in any one of SEQ ID NOs: 1-94. In some embodiments, the stem-loop oligonucleotide can comprise a sequence selected from the group consisting of SEQ ID NOs: 1-68 or a variant thereof having one, two or three mismatches in any one of SEQ ID NOs: 1-68.

Methods of treating a disease or disorder

[0223] Also provided herein is a method of treating a disease or a condition using the oligonucleotides or a composition thereof herein described. The method can comprise administering the oligonucleotide described herein to a subject in need thereof. For example, upon the detection of a target nucleic acid, the single-stranded overhang in a stem-loop antisense oligonucleotide can bind to a target nucleic acid to cause displacement of the first region from the second region and binding of the first region to the target nucleic acid, thereby modulating the activity of the target nucleic acid or protein expression from the target nucleic acid in the subject to treat the disease or condition. In another example, upon the detection of a target nucleic acid, the first single-stranded overhang of the antisense oligonucleotide strand in the duplex oligonucleotide complex can bind to the target nucleic acid to cause displacement of the first domain from the second domain, thereby releasing the antisense oligonucleotide strand from the double-stranded duplex structure. The released antisense oligonucleotide strand is therefore activated and can modulate the activity of the target nucleic acid or protein expression from the target nucleic acid in the subject to treat the disease or condition.

[0224] The term “condition” as used herein indicates a physical status of the body of an individual (as a whole or as one or more of its parts), that does not conform to a standard physical status associated with a state of complete physical, mental and social well-being for the individual. Conditions herein described include but are not limited disorders and diseases wherein the term “disorder” indicates a condition of the living individual that is associated to a functional abnormality of the body or of any of its parts, and the term “disease” indicates a condition of the living individual that impairs normal functioning of the body or of any of its parts and is typically manifested by distinguishing signs and symptoms.

[0225] Various diseases and disorders can be treated with the oligonucleotides and compositions provided herein. Diseases and disorders disclosed herein include, but are not limited to, HIV infection with lymphoma, hemophilia A, hemophilia B, hypercholesterolemia, atherosclerotic cardiovascular disease, renal impairment, chronic hepatitis B, acute intermittent porphyria, atypical hemolytic uraemic syndrome, primary hyperoxaluria, hereditary transthyretin amyloidosis (hATTR), al -antitrypsin deficiency liver disease, hepatitis B, sickle cell disease, primary hyperoxaluria, ewing sarcoma, advanced gynecological cancer, stage III/IV ovarian cancer, pancreatic cancer, advanced solid tumors, hepatocellular carcinoma/liver cancer, lymphoma and leukemias, heart disease, heart failure, keloids, hypertrophic cicatrix, relapsed or refractory B cell lymphoma, hypertrophic scar, age-related macular degeneration, retinal scarring, cardia surgery, cardiac hypertrophy, non-arteritic anterior ischaemic optic neuropathy, alport syndrome, HIV infections/ AIDS, pancreatic ductal adenocarcinoma/pancreatic cancer, dry eye disease, and various solid tumors.

[0226] In some embodiments, the disease or disorder can be a genetic disorder. A genetic disorder is a disease caused in a whole or in part by a change in the DNA sequence away from the normal sequence. Genetic disorders can be caused by a mutation in one gene (monogenic disorder), by mutations in multiple genes (multifactorial inheritance disorders), by a combination of gene mutations and environmental factors, or by damage to chromosomes. In some embodiments, the genetic disorder is caused by a mutation of the dystrophin gene. In some embodiments, the disease or disorder is Duchenne muscular dystrophy (DMD). In some embodiments, the genetic disorder is associated with mutations or variations in SMN1, SMN2, SCN1A, SCN8A, or CLN7. In some embodiments, the disease or disorder is spinal muscular atrophy, Batten’s disease, Dravet syndrome, or SCN8A encephalopathy.

[0227] In some embodiments, the disease or disorder can be a cancer. The cancer can be a solid tumor, a liquid tumor, or a combination thereof. The nucleic acid complex herein described or a composition thereof can be administered to the cells, tissues and/or organs comprising a tumor using any suitable administration route. For example, the nucleic acid complex or a composition thereof can be administered to the cells, tissues and/or organs comprising a tumor via subcutaneous injection or intratumoral delivery. [0228] The cancer can be selected from the group consisting of colon cancer, rectal cancer, renal-cell carcinoma, liver cancer, non-small cell carcinoma of the lung, cancer of the small intestine, cancer of the esophagus, melanoma, bone cancer, pancreatic cancer, skin cancer, cancer of the head or neck, cutaneous or intraocular malignant melanoma, uterine cancer, ovarian cancer, rectal cancer, cancer of the anal region, stomach cancer, testicular cancer, uterine cancer, carcinoma of the fallopian tubes, carcinoma of the endometrium, carcinoma of the cervix, carcinoma of the vagina, carcinoma of the vulva, Hodgkin's Disease, non-Hodgkin lymphoma, cancer of the endocrine system, cancer of the thyroid gland, cancer of the parathyroid gland, cancer of the adrenal gland, sarcoma of soft tissue, cancer of the urethra, cancer of the penis, solid tumors of childhood, cancer of the bladder, cancer of the kidney or ureter, carcinoma of the renal pelvis, neoplasm of the central nervous system (CNS), primary CNS lymphoma, tumor angiogenesis, spinal axis tumor, brain stem glioma, pituitary adenoma, Kaposi's sarcoma, epidermoid cancer, squamous cell cancer, T-cell lymphoma, environmentally induced cancers, combinations of said cancers, and metastatic lesions of said cancers.

[0229] The cancer can be a hematologic cancer chosen from one or more of chronic lymphocytic leukemia (CLL), acute leukemias, acute lymphoid leukemia (ALL), B-cell acute lymphoid leukemia (B-ALL), T-cell acute lymphoid leukemia (T-ALL), chronic myelogenous leukemia (CML), B cell prolymphocytic leukemia, blastic plasmacytoid dendritic cell neoplasm, Burkitt's lymphoma, diffuse large B cell lymphoma, follicular lymphoma, hairy cell leukemia, small cell- or a large cell-follicular lymphoma, malignant lymphoproliferative conditions, MALT lymphoma, mantle cell lymphoma, marginal zone lymphoma, multiple myeloma, myelodysplasia and myelodysplastic syndrome, non-Hodgkin's lymphoma, Hodgkin's lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell neoplasm, Waldenstrom macroglobulinemia, or preleukemia.

[0230] Non-limiting examples of cancers that can be prevented and/or treated using the nucleic acid complexes and compositions disclosed herein include: renal cancer; kidney cancer; glioblastoma multiforme; metastatic breast cancer; breast carcinoma; breast sarcoma; neurofibroma; neurofibromatosis; pediatric tumors; neuroblastoma; malignant melanoma; carcinomas of the epidermis; leukemias such as but not limited to, acute leukemia, acute lymphocytic leukemia, acute myelocytic leukemias such as myeloblastic, promyelocytic, myelomonocytic, monocytic, erythroleukemia leukemias and myelodysplastic syndrome, chronic leukemias such as but not limited to, chronic myelocytic (granulocytic) leukemia, chronic lymphocytic leukemia, hairy cell leukemia; polycythemia vera; lymphomas such as but not limited to Hodgkin's disease, non- Hodgkin's disease; multiple myelomas such as but not limited to smoldering multiple myeloma, nonsecretory myeloma, osteosclerotic myeloma, plasma cell leukemia, solitary plasmacytoma and extramedullary plasmacytoma; Waldenstrom's macroglobulinemia; monoclonal gammopathy of undetermined significance; benign monoclonal gammopathy; heavy chain disease; bone cancer and connective tissue sarcomas such as but not limited to bone sarcoma, myeloma bone disease, multiple myeloma, cholesteatoma-induced bone osteosarcoma, Paget's disease of bone, osteosarcoma, chondrosarcoma, Ewing's sarcoma, malignant giant cell tumor, fibrosarcoma of bone, chordoma, periosteal sarcoma, soft-tissue sarcomas, angiosarcoma (hemangiosarcoma), fibrosarcoma, Kaposi's sarcoma, leiomyosarcoma, liposarcoma, lymphangio sarcoma, neurilemmoma, rhabdomyosarcoma, and synovial sarcoma; brain tumors such as but not limited to, glioma, astrocytoma, brain stem glioma, ependymoma, oligodendroglioma, nonglial tumor, acoustic neurinoma, craniopharyngioma, medulloblastoma, meningioma, pineocytoma, pineoblastoma, and primary brain lymphoma; breast cancer including but not limited to adenocarcinoma, lobular (small cell) carcinoma, intraductal carcinoma, medullary breast cancer, mucinous breast cancer, tubular breast cancer, papillary breast cancer, Paget's disease (including juvenile Paget's disease) and inflammatory breast cancer; adrenal cancer such as but not limited to pheochromocytom and adrenocortical carcinoma; thyroid cancer such as but not limited to papillary or follicular thyroid cancer, medullary thyroid cancer and anaplastic thyroid cancer; pancreatic cancer such as but not limited to, insulinoma, gastrinoma, glucagonoma, vipoma, somatostatin-secreting tumor, and carcinoid or islet cell tumor; pituitary cancers such as but limited to Cushing's disease, prolactinsecreting tumor, acromegaly, and diabetes insipius; eye cancers such as but not limited to ocular melanoma such as iris melanoma, choroidal melanoma, and ciliary body melanoma, and retinoblastoma; vaginal cancers such as squamous cell carcinoma, adenocarcinoma, and melanoma; vulvar cancer such as squamous cell carcinoma, melanoma, adenocarcinoma, basal cell carcinoma, sarcoma, and Paget's disease; cervical cancers such as but not limited to, squamous cell carcinoma, and adenocarcinoma; uterine cancers such as but not limited to endometrial carcinoma and uterine sarcoma; ovarian cancers such as but not limited to, ovarian epithelial carcinoma, borderline tumor, germ cell tumor, and stromal tumor; cervical carcinoma; esophageal cancers such as but not limited to, squamous cancer, adenocarcinoma, adenoid cyctic carcinoma, mucoepidermoid carcinoma, adenosquamous carcinoma, sarcoma, melanoma, plasmacytoma, verrucous carcinoma, and oat cell (small cell) carcinoma; stomach cancers such as but not limited to, adenocarcinoma, fungating (polypoid), ulcerating, superficial spreading, diffusely spreading, malignant lymphoma, liposarcoma, fibrosarcoma, and carcinosarcoma; colon cancers; colorectal cancer, KRAS mutated colorectal cancer; colon carcinoma; rectal cancers; liver cancers such as but not limited to hepatocellular carcinoma and hepatoblastoma, gallbladder cancers such as adenocarcinoma; cholangiocarcinomas such as but not limited to papillary, nodular, and diffuse; lung cancers such as KRAS-mutated non-small cell lung cancer, non-small cell lung cancer, squamous cell carcinoma (epidermoid carcinoma), adenocarcinoma, large-cell carcinoma and small-cell lung cancer; lung carcinoma; testicular cancers such as but not limited to germinal tumor, seminoma, anaplastic, classic (typical), spermatocytic, nonseminoma, embryonal carcinoma, teratoma carcinoma, choriocarcinoma (yolk-sac tumor), prostate cancers such as but not limited to, androgenindependent prostate cancer, androgen-dependent prostate cancer, adenocarcinoma, leiomyosarcoma, and rhabdomyosarcoma; penal cancers; oral cancers such as but not limited to squamous cell carcinoma; basal cancers; salivary gland cancers such as but not limited to adenocarcinoma, mucoepidermoid carcinoma, and adenoidcystic carcinoma; pharynx cancers such as but not limited to squamous cell cancer, and verrucous; skin cancers such as but not limited to, basal cell carcinoma, squamous cell carcinoma and melanoma, superficial spreading melanoma, nodular melanoma, lentigo malignant melanoma, acrallentiginous melanoma; kidney cancers such as but not limited to renal cell cancer, adenocarcinoma, hypernephroma, fibrosarcoma, transitional cell cancer (renal pelvis and/or uterer); renal carcinoma; Wilms' tumor; and bladder cancers such as but not limited to transitional cell carcinoma, squamous cell cancer, adenocarcinoma, carcinosarcoma. In some embodiments, the cancer is myxosarcoma, osteogenic sarcoma, endotheliosarcoma, lymphangioendotheliosarcoma, mesothelioma, synovioma, hemangioblastoma, epithelial carcinoma, cystadenocarcinoma, bronchogenic carcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, or papillary adenocarcinomas.

[0231] In some embodiments, the disease or disorder can be a neurological disease or disorder such as a neurodegenerative disease. Neurodegenerative diseases or disorders are a heterogeneous group of disorders that are characterized by the progressive degeneration of the structure and function of the central nervous system or peripheral nervous system. In some embodiments, neurodegenerative diseases are diseases marked by continuous and progressive deterioration of the function of neural cells which are not caused by any underlying trauma or infection. In some embodiments, the disease or disorder can be a central nervous system (CNS) disease or condition. The oligonucleotides herein described or a composition thereof can be administered to the cells, tissues and/or organs of the CNS using any suitable administration route. For example, the oligonucleotide or a composition thereof can be administered to the cells, tissues and/or organs of the CNS of a subject via intrathecal injection, intracerebroventricular injection, or intracerebral injection to penetrate the blood-brain barrier. In some embodiments, the cell(s), tissue(s), and/or organ(s) of the CNS comprises damaged or inflamed cell(s), tissue(s), or organ(s). In some embodiments, the cells(s), tissue(s), and/or organ(s) of the CNS comprise the brain, the white matter, the gray matter, the brainstem, the cerebellum, the diencephalon, the cerebrum, the spinal cord, the cranial nerve, cell(s) of any of the preceding, tissue(s) of any of the preceding, or a combination thereof.

[0232] In some embodiments, the CNS disease is a movement disorder, a memory disorder, addiction, attention deficit/hyperactivity disorder (ADHD), autism, bipolar disorder, depression, encephalitis, epilepsy/seizure, migraine, multiple sclerosis, a neurodegenerative disorder, a psychiatric disease, a neuroinflammatory disease, Alzheimer’s disease, Huntington's disease, Parkinson's disease, Tourette syndrome, dystonia, or a combination thereof. In some embodiments, the disease is a neuroinflammatory disease. For example, the neuroinflammatory disease is Parkinson’s disease, Alzheimer’s disease, multiple sclerosis, or a combination thereof.

Kits

[0233] Also provided herein include kits comprising one or more compositions described herein, in suitable packaging such as in a container, pack, or dispenser, and may further comprise written material that can include instructions for use, discussion of clinical studies, listing of side effects, and the like. Such kits can also include information, such as scientific literature references, package insert materials, clinical trial results, and/or summaries of these and the like, which indicate or establish the activities and/or advantages of the composition, and/or which describe dosing, administration, side effects, drug interactions, or other information useful to the health care provider. Such information can be based on the results of various studies, for example, studies using experimental animals involving in vivo models and studies based on human clinical trials. A kit can comprise one or more unit doses described herein. The compositions can be in the form of kits of parts. In a kit of parts, one or more components of the compositions disclosed herein are provided independent of one another (e.g., oligonucleotides, constructs, excipients, and/or diluents are provided as separate compositions) and are then employed (e.g., by a user) to generate the compositions.

EXAMPLES

[0234] Some aspects of the embodiments discussed above are disclosed in further detail in the following examples, which are not in any way intended to limit the scope of the present disclosure.

Example 1

Antisense activity of exemplary stem-loop antisense oligonucleotides

[0235] This example demonstrates the antisense activity of various stem-loop antisense oligonucleotide constructs with different designs, including 3’ toehold, 5’ toehold, partially modified ASO domain, and 3’ or 5’ palmitic acids. The sequences of various oligonucleotide constructs evaluated in this example are provided in Tables 1-11 in the Sequence section. FIG. 9 illustrates the naming convention for the sequences shown in the sequence tables.

[0236] ASO microtubule-associated protein tau (MAPT) target sequences were cloned into the 3’ UTR of the pGL4.13[luc2/SV40] vector (Promega), a dual luciferase reporter plasmid, using standard molecular biology methods. Two variants of the MAPT ASO1 target vectors were used for assays. Both have identical complementary binding sites but differ slightly in the surrounding sequence. Both constructs produced similar results in dual luciferase assays.

[0237] ASO1 MAPT target sequence context, variant 1 :

5’ - AATAATCTGTAAAAGTGAATTTGGAAATA - 3’ (SEQ ID NO: 169)

[0238] ASO1 MAPT target sequence context, variant 2:

5’ - CACTGACTGTTAATGTAAAAGTGAATTTGGAAATATTGTAATTACTCTG - 3’ (SEQ ID NO: 170)

[0239] Underlined area indicates ASO1 complementary sequence.

[0240] ASO2 and ASO3 bind to overlapping sequences and are assayed using the same pGL4.13[luc2/SV40] plasmid vector reporter derivative. ASO2 and ASO3 binding sequences are indicated by bold and underlined fonts, respectively.

5’ - ATTTTGGCCACTTTGCAGACCTGGGACTTTAGGGCTAACCATT - 3’ (SEQ ID NO: 171)

[0241] The accuracy of all target constructs and DNA preparations are verified by DNA sequencing.

[0242] The following gapmers targeting the above MAPT target sequences were used as control sequences:

Seql-Control: 21.5 nM IC50, non-toxic +A*dT*+T*+T*+C*dC*dA*dA*dA*dT*dT*dC*dA*dC*dT*+T*+T*dT*+A*+C (SEQ ID NO: 161)

ATTTCCAAATTCACTTTTAC (SEQ ID NO: 162)

Seq2-Control: 150 nM IC50, toxic in in vivo screen Kl*Kl*+C*dT*dA*dA*dA*dG*dT*dC*dC*+C*+A*+G (SEQ ID NO: 163) CCCTAAAGTCCCAG (SEQ ID NO: 164) Seq3-Control: 40 nM IC50, non-toxic +T*+A*+G*dC*dC*dC*dT*dA*dA*dA*dG*dT*dC*+C*+C*+A (SEQ ID NO: 165) TAGCCCTAAAGTCCCA (SEQ ID NO: 166) Negative-Control: non-toxic +C*dC*+A*+A*+A*dT*dC*dT*dT*dA*dT*dA*dA*dT*dA*+A*+C*dT*+A*+C (SEQ ID NO: 167)

CCAAATCTTATAATAACTAC (SEQ ID NO: 168)

[0243] All dual luciferase assays used HCT116 colorectal carcinoma cells. Cells were maintained using McCoy’s 5 A basal medium (Sigma) supplemented with 10% fetal bovine serum (FBS) and 1.5 mM L-glutamine without antibiotics and incubated in a humidified 5% CO2 incubator at 37 °C. Cells were seeded one day before transfection into 96-well plates at 10,000 cells/well in 100 pl of medium.

[0244] For dual luciferase assays, cells were co-transfected with the following final amounts of nucleic acids on a per well basis: the ASO test article at the appropriate concentration; 19 ng of the cognate pGL4.13[luc2/SV40] plasmid target vector; 1.0 ng of the pNLl.l.PGK[Nluc/PGK] plasmid (Promega) as an internal standard for normalization; and 55 ng of pUC plasmid as carrier. Transfection mixes on a per well basis contain: 5 pl of a mix of all plasmids at 20X final concentration; 5 pl of the test ASO in IX PBS at 20X of the final concentration, or vehicle (IX PBS) for no knockdown control; and 10 pl of 1 :50 Lipofectamine 2000 (Thermo) dilution in OptiMEM (Gibco). After incubation according to manufacturer’s instructions for Lipofectamine 2000, the nucleic acid/lipofectamine mixture (20 ul) was added to cells that in wells with 80 pl of fresh medium. In practice, a plasmid master mix was used to generate a 5X (100 ul) transfection mix (nucleic acids/Lipofectamine) for each ASO condition, to be assayed in technical triplicate by aliquoting 20 ul/well to three 96 wells contain 80 pl medium.

[0245] The cell medium was replaced with 175 pl of fresh complete medium the day following transfection and incubation continued until termination of the assay at 48 hours. At that point, cell medium was removed, and transfected cells washed with cold IX PBS which was completely removed before the addition of 50 pl of IX Dual Luciferase Passive Lysis Buffer (Promega). Lysis was completed by shaking for 15-30 minutes at room temperature; lysates may be assayed immediately or stored at -80 °C.

[0246] Dual luciferase assays were performed using the Promega Nano-Gio Dual- Luciferase Reporter Assay System according to the manufacturer’s instructions. ASO target luciferase values (cognate target pGL4.13[luc2/SV40] plasmid output) were normalized to Nano- Glo luciferase values (pNLl. l.PGK[Nluc/PGK] plasmid output) on a per well basis. For ASO screens, target knockdown was expressed as a fraction of average ASO triplicate value relative to average vehicle (no ASO) value. For full dose-response curves, each ASO value as expressed relative to the average vehicle control and plotted in GraphPad Prism using log(inhibitor) vs. response (three parameters) least squares fit.

[0247] FIG. 10A shows a graphic representation of the relative luminescence data of exemplary oligonucleotide constructs derived from control sequence 1.

[0248] These data suggests no loss in the antisense activity after adding hairpin structure to the stem-loop ASO constructs. Comparable or improved activity was observed in the stem-loop ASO constructs compared to the original gapmer design. An improved activity was also observed after reducing phosphorothioate backbone sites, particularly in the ASO domain (e.g., portion of the ASO domain protected by the protection domain).

[0249] FIG. 10B shows a graphic representation of the target protein expression of exemplary oligonucleotide constructs derived from control sequence 2 and control sequence 3. The dashed lines in FIG. 10B mark target expression for parental ASO controls at 10 nM. The data suggests that for sequence 2, designs with a 8-nt toehold and 6-nt duplex are more potent than designs with a 6-nt toehold and 8-nt duplex. The location of the palmitic acid does not appear to significantly affect the potency for sequence 2 and 3 designs. Designs with a 5’ toehold can be more potent than designs with a 3’ toehold in some cases.

Example 2

Single point screening of stem-loop antisense oligonucleotides by free uptake

[0250] In this example, stem-loop ASOs were screened in a single point assay format for down selection. The selected constructs can be used for multi-point dose activity curve.

[0251] Prior to the single point screening, quality control (QC) check was performed on ASOs. To validate the ASO structure, ASOs were heated at 95 °C for 5 minutes via thermocycler, with the temperature slowly dropping down to 25 °C at 0.1 °C/sec. Samples were run on a 20% TBE gel and stained with 0.2 pg/mL of ethidium bromide for 30 minutes followed by a 15-minute wash with ddFLO To check the ASO concentration, ASOs were diluted to 10 pM in O.lx filtered DPBS and the absorbance was measured at 260 nm. The Beer-Lambert Law was used to verify that the ASOs were reconstituted to the correct concentration. FIG. 11 provides the data from the QC check of exemplary ASOs. The best screening concentration was determined to be 1 pM after pilot experiment. For GABANeurons, purity, mycoplasma, and sterility of the iCell GABANeurons and culture medium were validated by the distributor.

[0252] To validate the primer probe set, three commercial MAPT primer probe sets and two housekeeping/reference genes were tested against the RNA extracted from the neurons upon thaw. One MAPT primer probe set (Hs.PT.58.28269192) and the two reference genes (Hs.PT.39a.22214847, Hs.PT.58.3714142) were used in a multiplexed qPCR for the primary and dose response screens. RiboGreen reagent and nanodrop measurements were used to quantitate the amount of RNA yield achieved from a 384-well plate. For dose optimization, an ACNT1 ASO was used to verify the ASO concentration needed to conduct the primary single dose screen. Cells were treated with ASO on day 2 post-thaw and RNA was extracted on post-transfection days 5, 6, and 7. Results suggest that scaling up to a 96-well plate with 40,000 cells per well and extracting RNA on post-transfection day 5 are preferrable. MAPT LNA gapmers used in Example 1 above were also used as control sequences in this example.

[0253] To conduct a primary screen, GABAneurons were seeded at 40,000 cells per well and treated on day 3 post-thaw. A 50% media change was conducted every other day until RNA extraction, which occurred 5 days post transfection. RNA yield was assessed via Quant-it™ RiboGreen RNA assay. MAPT expression was measured via qPCT, and normalized to ACTB using the Pfaffl method.

[0254] FIG. 12 is a plot showing qPCT standard curves of ACTB and MAPT. FIGS. 13- 18 are plots showing the antisense activity of exemplary stem-loop ASOs in comparison to controls. In particular, FIGS. 13 and 14 are plots showing the antisense activity of exemplary stem-loop ASOs with a 5’ overhang (FIG. 13) and a 3’ overhang (FIG. 14) derived from control Sequence 1 (SEQ ID NO: 161 or 162). FIGS. 15 and 16 are plots showing the antisense activity of exemplary stem-loop ASOs with a 5’ overhang (FIG. 15) and a 3’ overhang (FIG. 16) derived from control Sequence 2 (SEQ ID NO: 163 or 164). FIGS. 17 and 18 are plots showing the antisense activity of exemplary stem-loop ASOs with a 5’ overhang (FIG. 17) and a 3’ overhang (FIG. 18) derived from control Sequence 3 (SEQ ID NO: 165 or 166). FIG. 19 provides plots showing the antisense activity of control sequences.

[0255] The single point screening assay identifies hairpin ASOs with either comparable or improved activity compared to the original gapmer design The data also suggests that reducing the number of phosphorothioate linkages in the ASO domain can be beneficial for improved potency of target knockdown. The effect of a terminal palmitic acid on the ASO performance appears sequence specific. In some cases, additional spacer 2’-0Me bases added in the hairpin loop does not appear to improve the potency of the ASO. Furthermore, different parental ASO sequences can be more or less potent depending on whether a 3' or 5' toehold is used. For the exemplary sequence 1, designs with 5' toeholds are more potent than designs with 3' toeholds. However, for sequence 2 and sequence 3, designs with 3' and 5' toeholds are equally active.

Example 3

MAPT modulation by exemplary stem-loop antisense oligonucleotides

[0256] In this example, positive control ASOs seql -control 1 and seq2-control 1, along with three hairpin ASOs were tested in iPSC GABA neurons out to 7 and 10 days. GABAneurons were seeded at 40,000 cells per well and treated on day 2 post-thaw. The cells were treated at a starting concentration of 3 uM ASO following five, log(3) serial dilutions. A 50% media change was conducted every other day until RNA extraction, which occurred at day 7 and day 10 post transfection. RNA yield was assessed via Quant-it™ RiboGreen RNA Assay. MAPT expression was measured via qPCR and normalized to ACTB using the Pfaffl method.

[0257] The following compounds were selected for this study:

1. S2021-1 : Seql -Control 1

2. S2021-2: Seq2-Control 1

3. S2013-13: 1-5A-12-6

4. S2013-28: 1-5B-12-6

5. S2013-10: 1-5A-10-6

[0258] For ASO quality check, the concentrations were verified by measuring the absorbance (260 nm) with a UV-Vis spectrophotometer after the initial thermal annealing step. For GABANeurons quality check, neurons were seeded in a 96-well plate in wells B2 - G11 to avoid edge effects. Neurons were assessed under phase contrast microscopy and images of the neurons dosed at the highest ASO concentration were captured every day until RNA extraction. FIG. 20 shows qPCT standard curves of ACTB and MAPT at day 7 (upper panel) and day 10 (lower panel). Two biological and two technical replicates were used in the qPCR assay. Cq values from RNA extracted at 7 days appear to be around 1 to 1.5 Cq values lower than RNA extracted at 10 days post transfection. Cq values of the samples at 7 days have a median of 23.0 (ACTB) and 25.1 (MAPT) vs. the median Cq values at 10 days which is 24.3 (ACTB) and 25.8 (MAPT). The Cq values of the samples at 7 days (Table 13) and 10 days (Table 14) are shown in the following tables.

[0259] Table 13. Cq values of samples at day 7.

[0260] Table 14. Cq values of samples at day 10.

[0261] Total RNA yield was assessed via Quant-it™ RiboGreen RNA Assay (ThermoFisher, Cat. # R11490). Results showed that more total RNA yield was extracted at 7 days vs. 10 days post transfection (data not shown). These results are comparative to what was observed with the Cq values in the qPCR assay.

[0262] Five compounds (2 controls and 3 samples) were selected for dose response. The knock down effects were compared at 2 different time points (7 days and 10 days post transfection). The 10-day time point was sufficient for generating IC50s in the 2 controls and 1 sample (1-5A-10- 6). Two samples (1-5A-12-6 and 1-5B-12-6) did not have sufficient knock down to calculate IC50 values. FIGS. 21A-B provide bar charts representation of MAPT expression when treated with selected compounds at different doses 7 days (FIG. 21 A) and 10 days (FIG. 21B) post transfection.

[0263] Relative IC50 values were calculated using the function:

Y=Bottom + (Top-Bottom)/(l+(X/IC50)), where the top and bottom are plateaus defined by the y-values of the dose response curve, and the bottom is equivalent to the baseline.

[0264] Absolute IC50 values were calculated using the equations:

F ifty=(T op+Baseline)/2

Y= Bottom + (Top-Bottom)/(l+((Top-Bottom)/(Fifty-Bottom)-l)*(AbsoluteIC50/X)^AHillSlope) where the top and bottom are plateaus defined by the y-values of the dose response curve, and the baseline is equivalent to the bottom value of Seql-Controll.

[0265] FIG. 22 provides tables showing IC50 values for samples at day 7 and 10 post transfection. FIGS. 23A-E provide plots showing dose response results of each compound (FIG. 23A: Seql-Control 1; FIG. 23B: Seq2-Control 1; FIG. 23C: 1-5A-10-6; FIG. 23D: 1-5A-12-6; FIG. 23E: 1-5B-12-6) at day 7 and day 10 post transfection. The bar chart plot on the left represents the results from primary screen transfection (see Example 2) with ASO concentration of 1 pM 5 days post transfection.

[0266] The data shows deeper knockdown by tested ASOs 10 days after exposure. The knockdown effects by hairpin ASO 1-5A-10-6 were not as pronounced as the single point experiment, which could be due to experimental variations.

Example 4

Toxicity assay of exemplary stem-loop oligonucleotides

[0267] In this example, LDH cytotoxicity assay of exemplary stem-loop ASOs were performed in a time-dependent manner. Supernatants from the samples were collected every other day during the 50% media changes. The measured timepoints are as follows: day 0 (day of transfection/2 days post thaw); and days 2, 4, 6, 7, 8, and 10 post transfection. Standard operating procedures were followed to carry out the LDH-Glo™ Cytotoxicity Assay (Promega, Cat. #J2381 ).

[0268] For assay quality check, a standard curve was generated using the LDH positive control provided by Promega. Sample data fell within the lower end of the linear range with a minimum RLU at 8,209 and a maximum RLU at 159,385. An increase in LDH was observed at day 0 (2 days post thaw). LDH levels appear higher at days 2 and 4 post transfection but decreased at day 6 and remained constant through day 10. FIGS. 24A-E provide scatter plots of LDH measurement assay in relative light units of exemplary ASO samples.

Example 5

Evaluating adapter strands for the delivery of morpholinos

[0269] In this example, adapter strands were designed to deliver three exemplary morpholino drugs. The morpholino oligonucleotides (PMO) were purchased together with adapter sequences and RNA strands simulating targets. The three exemplary PMOs include Golodirsen (//gsrs. neats. nih.gov/ginas/app/beta/substances/e54505d8-4af5-43f6-95b4-f70effe0b457), Casimersen (//gsrs. neats. nih. gov/ginas/app/beta/substances/905e0fD5-b9c5-412c-a0el-

5bb898111944) and Eteplirsen (//gsrs. neats. nih.gov/ginas/app/beta/substances/4d0cddf7-f088-45af- af78-27659898e442). Detailed information about these morpholinos can be found in the Global Substance Registration System (GSRS) (gsrs.ncats.nih.gov/ginas/app/beta/home).

[0270] Morpholinos have similar binding affinity as DNAs for RNA strands. Therefore, fairly long adapter regions (base-paring between delivery strand and morpholino oligos) need to be used to achieve stable complex. At least an 8 nt toehold on the morpholino is also preferred so that it can interact with its RNA target with a desired binding affinity. In some cases, a compromise needs to be made between adapter base-pairing stability and morpholino toehold length on some strands. The designed strands were also checked for unintended complementarity between the adapter strands and RNA transcripts in the human genome. All adapter strands were designed with 2’-0Me base modifications and PS modifications for the single-stranded regions and terminal regions. The sequences of exemplary adaptor strands evaluated in this example are provided in Table 12 in the Sequences section below.

[0271] Annealing was carried out to demonstrate that duplex ASO constructs can be readily assembled from the adapter strands and PMOs such as the FDA approved PMO drugs. Briefly, stock solutions were prepared for each oligos (10-20pM) in water. 1 pM solution for individual oligos were then prepared in water. Duplex (Ad-5P/ASO-M, Ad-3P/ASO-M & Target/ASO-M) were made at 1 uM for each component in 1XPBS. AD/ASO-M duplex were prepared under the following thermal profile: 95/90/80/70/65/60/55/50/45/40/35/30/25 (10 min)/4 °C O.N. 0.1 degree/S with ramp speed at 5 degree/50 S for a duration of 3 min at each step. Adapter strands and PMOs were annealed on thermocycler for about 40 mins from 95 °C to 25 °C and then analyzed on 20% TBE gel. As shown in FIG. 25, the Casimersen adapter strands and Casimersen PMOs were properly assembled to form duplex ASO constructs.

[0272] Next, the duplex casimersen-adapter complex is exposed with an RNA strand mimicking the target of casimersen. Prior to the procedure, tubes containing oligos, duplexes and targets were warmed up at RT. The thermocycler was pre-heated at 25 °C and 37 °C. 25 ul of the target was aliquoted into 8-strip tubes and stored at RT (1 & 3) or at 37 °C (2 & 4). 25 ul of preannealed duplex was added into the target at each timepoint. 3.5 ul of SB buffer were prepared in 8- strip tubes. Right after adding the target at t=0 into the duplex, 7 ul of each reaction was transferred into the 8-strip tubes containing SB and run on 20% TBE gel.

[0273] FIGS. 26A-D show images from gel electrophoresis of duplex casimersen ASOs mixed with casimersen targets at 25 °C and 37 °C (FIGS. 26A-B: duplex with 5’ adapter; FIGS. 26C-D: duplex with 3’ adapter). Incubation after addition of target into the pre-annealed duplex: 8A, 9A: 0 min, 8B, 9B: 30 min; 8C, 9C: 60 min; 8D, 9D: 90 min; 8E, 9E: 120 min.

[0274] The data suggests that when the casimersen-adapter complex is exposed to an RNA strand mimicking the target of casimersen, the target strand base-pairs with casimersen, displacing the 3’ and 5’ adapters at 25 °C and 37 °C.

[0275] Similar experiments were also performed for golodirsen adapter strands, ASO strands and targets, as well as for eteplirsen adapter strands, ASO strands and targets using the same procedure described above for casimersen. 7 pl of each sample and 3.5 pl of SB buffer were analyzed on 20% TBE gel.

[0276] FIG. 27A shows results and images from gel electrophoresis indicating that golodirsen adapter strands and golodirsen PMOs were properly assembled to form duplex ASO constructs. FIG. 27B shows results and images from gel electrophoresis indicating that eteplirsen adapter strands and eteplirsen PMOs were properly assembled to form duplex ASO constructs. Annealing of golodirsen and eteplirsen with their respective 3’ and 5’ adapter strands show efficient assembly into duplexes.

[0277] The same procedures were also used to further test non-specific switch by incubating 25 ul of pre-annealed duplex (Cas-M/Ad-5P or Ad-3P, 1 uM) and 25 ul target (Cas, Golo or Etep, 1 uM) at 25 °C for 2 hrs.

[0278] FIGS. 28A-B show results and images from gel electrophoresis of duplex casimersen ASOs (FIG. 28 A: 5’ adapter; FIG. 28B: 3’ adapter) mixed with casimersen, golodirsen, and eteplirsen targets. Exposure of casimersen-adapter complexes to casimersen-target RNA strands show displacement of the adapters from the casimersen PMO, but exposure to targets for golodirsen and eteplirsen show no displacement effect. This demonstrates that displacement is sequence specific and based on toehold mediated strand displacement, as intended.

Sequences

[0279] This section includes a list of tables providing sequences of exemplary oligonucleotides described herein and evaluated in Examples 1-5. Exemplary stem-loop oligonucleotide constructs in Tables 1-7 are derived from Control Sequence 1 (SEQ ID NO: 161 and 162). Exemplary stem-loop oligonucleotide constructs in Table 8-9 are derived from Control Sequence 2 (SEQ ID NO: 163 and 164). Exemplary stem-loop oligonucleotide constructs in Tables 10-11 are derived from Control Sequence 3 (SEQ ID NO: 165 and 166). Various domains/regions in the stem-loop oligonucleotide constructs (e.g., the overhang, protected domain, hairpin, and protection domain) are separated by a space. Table 12 provides exemplary adapter strands and morpholino ASD strands in duplex oligonucleotide complexes, and corresponding target sequences.

[0280] Table 1 provides exemplary stem-loop oligonucleotide constructs with a 5’ overhang derived from Control Sequence 1.

[0281] Table 2 provides exemplary stem-loop oligonucleotide constructs with a 5’ overhang derived from Control Sequence 1. The DNA domain is partially modified with a reduced number of phosphorothioate backbone linkage.

[0282] Table 3 provides exemplary stem-loop oligonucleotide constructs with a 5’ overhang derived from Control Sequence 1. The exposed 3’ LNA portion in the hairpin loop is replaced with 2’-O-methyl nucleotides.

[0283] Table 4 provides exemplary stem-loop oligonucleotide constructs with a 5’ overhang derived from Control Sequence 1. A palmatic acid is added to the 5’ terminus or the 3’ terminus of the oligonucleotide.

[0284] Table 5 provides exemplary stem-loop oligonucleotide constructs with a 3’ overhang derived from Control Sequence 1.

[0285] Table 6 provides exemplary stem-loop oligonucleotide constructs with a 3’ overhang derived from Control Sequence 1. The exposed 3’ LNA portion in the hairpin loop is replaced with 2’-O-methyl nucleotides.

[0286] Table 7 provides exemplary stem-loop oligonucleotide constructs with a 3’ overhang derived from Control Sequence 1. A palmitic acid is attached to the 5’ or 3’ terminus of the oligonucleotide strand.

[0287] Exemplary stem-loop oligonucleotide constructs in Tables 8-9 are derived from control sequence 2 (SEQ ID NO: 163 and 164). Table 8 provides exemplary stem-loop oligonucleotide constructs with a 5’ or 3’ overhang derived from Control Sequence 2.

overhang derived from Control Sequence 2. A palmitic acid is attached to the 5’ or 3’ terminus of the oligonucleotide strand.

[0289] Exemplary stem-loop oligonucleotide constructs in Tables 10-11 are derived from Control sequence 3 (SEQ ID NO: 165 and 166). Table 10 provides exemplary stem-loop oligonucleotide constructs with a 5’ or 3’ overhang derived from Control Sequence 3.

[0290] Table 11 provides exemplary stem-loop oligonucleotide constructs with a 5’ or 3’ overhang derived from Control Sequence 3. A palmitic acid is attached to the 5’ or 3’ terminus of the oligonucleotide strand.

[0291] Table 12 provides exemplary adapter strands, morpholino ASD strands, and corresponding target sequences.

Terminology

[0292] In at least some of the previously described embodiments, one or more elements used in an embodiment can interchangeably be used in another embodiment unless such a replacement is not technically feasible. It will be appreciated by those skilled in the art that various other omissions, additions and modifications may be made to the methods and structures described above without departing from the scope of the claimed subject matter. All such modifications and changes are intended to fall within the scope of the subject matter, as defined by the appended claims.

[0293] With respect to the use of substantially any plural and/or singular terms herein, those having skill in the art can translate from the plural to the singular and/or from the singular to the plural as is appropriate to the context and/or application. The various singular/plural permutations may be expressly set forth herein for sake of clarity. As used in this specification and the appended claims, the singular forms “a,” “an,” and “the” include plural references unless the context clearly dictates otherwise. Any reference to “or” herein is intended to encompass “and/or” unless otherwise stated.

[0294] It will be understood by those within the art that, in general, terms used herein, and especially in the appended claims (e.g., bodies of the appended claims) are generally intended as “open” terms (e.g., the term “including” should be interpreted as “including but not limited to,” the term “having” should be interpreted as “having at least,” the term “includes” should be interpreted as “includes but is not limited to,” etc ). It will be further understood by those within the art that if a specific number of an introduced claim recitation is intended, such an intent will be explicitly recited in the claim, and in the absence of such recitation no such intent is present. For example, as an aid to understanding, the following appended claims may contain usage of the introductory phrases “at least one” and “one or more” to introduce claim recitations. However, the use of such phrases should not be construed to imply that the introduction of a claim recitation by the indefinite articles “a” or “an” limits any particular claim containing such introduced claim recitation to embodiments containing only one such recitation, even when the same claim includes the introductory phrases “one or more” or “at least one” and indefinite articles such as “a” or “an” e.g., “a” and/or “an” should be interpreted to mean “at least one” or “one or more”); the same holds true for the use of definite articles used to introduce claim recitations. In addition, even if a specific number of an introduced claim recitation is explicitly recited, those skilled in the art will recognize that such recitation should be interpreted to mean at least the recited number (e.g., the bare recitation of “two recitations,” without other modifiers, means at least two recitations, or two or more recitations). Furthermore, in those instances where a convention analogous to “at least one of A, B, and C, etc.” is used, in general such a construction is intended in the sense one having skill in the art would understand the convention (e.g., “a system having at least one of A, B, and C” would include but not be limited to systems that have A alone, B alone, C alone, A and B together, A and C together, B and C together, and/or A, B, and C together, etc.). In those instances where a convention analogous to “at least one of A, B, or C, etc.” is used, in general such a construction is intended in the sense one having skill in the art would understand the convention (e.g., “a system having at least one of A, B, or C” would include but not be limited to systems that have A alone, B alone, C alone, A and B together, A and C together, B and C together, and/or A, B, and C together, etc.). It will be further understood by those within the art that virtually any disjunctive word and/or phrase presenting two or more alternative terms, whether in the description, claims, or drawings, should be understood to contemplate the possibilities of including one of the terms, either of the terms, or both terms. For example, the phrase “A or B” will be understood to include the possibilities of “A” or “B” or “A and B.”

[0295] In addition, where features or aspects of the disclosure are described in terms of Markush groups, those skilled in the art will recognize that the disclosure is also thereby described in terms of any individual member or subgroup of members of the Markush group.

[0296] As will be understood by one skilled in the art, for any and all purposes, such as in terms of providing a written description, all ranges disclosed herein also encompass any and all possible sub-ranges and combinations of sub-ranges thereof Any listed range can be easily recognized as sufficiently describing and enabling the same range being broken down into at least equal halves, thirds, quarters, fifths, tenths, etc. As a non-limiting example, each range discussed herein can be readily broken down into a lower third, middle third and upper third, etc. As will also be understood by one skilled in the art all language such as “up to,” “at least,” “greater than,” “less than,” and the like include the number recited and refer to ranges which can be subsequently broken down into sub-ranges as discussed above. Finally, as will be understood by one skilled in the art, a range includes each individual member. Thus, for example, a group having 1-3 articles refers to groups having 1, 2, or 3 articles. Similarly, a group having 1-5 articles refers to groups having 1, 2, 3, 4, or 5 articles, and so forth.

[0297] While various aspects and embodiments have been disclosed herein, other aspects and embodiments will be apparent to those skilled in the art. The various aspects and embodiments disclosed herein are for purposes of illustration and are not intended to be limiting, with the true scope and spirit being indicated by the following claims.

Claims

WHAT IS CLAIMED IS:

1. An oligonucleotide, comprising: a single-stranded overhang comprising 1-16 linked nucleotides; a double-stranded stem region formed by a first region base-pairing with a second region, wherein the first region is linked to the single-stranded overhang and wherein the single-stranded overhang and the first region forms an antisense oligonucleotide (ASO) domain comprising a sequence complementary to a target nucleic acid; and a hairpin loop comprising unpaired nucleotides, wherein the singled-stranded overhang is capable of binding to the target nucleic acid to cause displacement of the first region from the second region.

2. The oligonucleotide of claim 1, wherein the oligonucleotide is a single-stranded oligonucleotide.

3. The oligonucleotide of claim 1 or 2, wherein the oligonucleotide comprises, from 5’ to 3’, the single-stranded overhang, the first region, the hairpin loop, and the second region.

4. The oligonucleotide of any one of claims 1-3, wherein the first region is linked to the 3’ region of the single-stranded overhang.

5. The oligonucleotide of any one of claim 1-4, wherein the first region is linked to the 5’ region of the hairpin loop and the second region is linked to the 3’ region of the hairpin loop.

6. The oligonucleotide of claim 1, wherein the oligonucleotide comprises, from 3’ to 5’, the single-stranded overhang, the first region, the hairpin loop region, and the second region.

7. The oligonucleotide of claim 6, wherein the first region is linked to the 5’ region of the single-stranded overhang.

8. The oligonucleotide of claim 6 or 7, wherein the first region is linked to the 3’ region of the hairpin loop and the second region is linked to the 5’ of the hairpin loop.

9. The oligonucleotide of claim 1-8, wherein the single-stranded overhang is about 2-16 or 6-14 nucleotide in length, optionally 6-12 nucleotides in length.

10. The oligonucleotide of claim 1-9, wherein the first region is 4-20 nucleotides in length, optionally 6-16 nucleotides in length.

11. The oligonucleotide of claim 1-10, wherein the second region is 4-20 nucleotides in length, optionally 6-16 nucleotides in length.

12. The oligonucleotide of claim 1-11, wherein the first region and the second region are the same in length.

13. The oligonucleotide of claim 1-12, wherein the first region is adjacent to the single- stranded overhang.

14. The oligonucleotide of claim 1-13, wherein the ASO domain is about 8-35 nucleotides in length.

15. The oligonucleotide of any one of claims 1-14, wherein the sequence complementary to the target nucleic acid is 6-28 nucleotides in length.

16. The oligonucleotide of any one of claims 1-15, wherein the hairpin loop has 4-20 nucleotides in length, optionally 4-16 nucleotides in length, and further optionally 4-8 nucleotides in length.

17. The oligonucleotide of any one of claims 1-16, wherein the second region is fully complementary to the first region.

18. The oligonucleotide of any one of claims 1-17, wherein the second region does not have an overhang.

19. The oligonucleotide of any one of claims 1-18, wherein the single-stranded overhang comprises at least one phosphorothioate internucleoside linkage.

20. The oligonucleotide of claim 19, wherein all intemucleoside linkages in the singlestranded overhang are phosphorothioate intemucleoside linkages.

21. The oligonucleotide of any one of claims 1-20, wherein the single-stranded overhang comprises at least one locked nucleic acid or analogue thereof.

22. The oligonucleotide of claim 21, wherein about 10%-50% of the nucleotides in the single-stranded overhang are locked nucleic acid or analogues thereof.

23. The oligonucleotide of claim 21 or 22, wherein the single-stranded overhang comprises at least one deoxyribonucleotide.

24. The oligonucleotide of any one of claims 1-23, wherein the first region comprises at least one phosphorothioate intemucleoside linkage.

25. The oligonucleotide of claim 24, wherein about 50%-100% of the nucleotides in the first region are connected via phosphorothioate intemucleoside linkages.

26. The oligonucleotide of claim 24, wherein the first region comprises at least one phosphodiester intemucleoside linkage.

27. The oligonucleotide of claim 26, wherein the first region comprises one, two, three or four phosphodiester intemucleoside linkages.

28. The oligonucleotide of any one of claims 1-27, wherein the first region comprises at least one locked nucleic acid or analogue thereof.

29. The oligonucleotide of any one of claims 1-27, wherein the first region does not comprise a locked nucleic acid or analogue thereof.

30. The oligonucleotide of any one of claims 1-27, wherein about 50%-100% of the nucleotides in the first region are deoxyribonucleotides.

31. The oligonucleotide of any one of claims 1-30, wherein the hairpin loop comprises at least one locked nucleic acid or analogue thereof, at least one deoxyribonucleotide, at least one ribonucleotide, or a combination thereof.

32. The oligonucleotide of claim 31, wherein the hairpin loop comprises one, two, three or four ribonucleotides, optionally at least one of the ribonucleotides comprises a 2’-O- methylation.

33. The oligonucleotide of claim 31 or 32, wherein the hairpin loop comprises one, two, three or four locked nucleic acid or analogues thereof.

34. The oligonucleotide of any one of claims 31-33, wherein the hairpin loop comprises one, two or three deoxyribonucleotides.

35. The oligonucleotide of any one of claims 1-34, wherein one to three nucleotides in the hairpin loop adjacent to the second region are ribonucleotides, optionally the ribonucleotides are modified nucleotides, optionally the modified ribonucleotides comprises 2’-O-methyl modification.

36. The oligonucleotide of any one of claims 1-35, wherein one to three nucleotides in the hairpin loop adjacent to the first region are locked nucleic acid or analogues thereof, deoxyribonucleotides, or a combination thereof.

37. The oligonucleotide of any one of claims 1-36, wherein the hairpin loop comprises at least one phosphorothioate intemucleoside linkage.

38. The oligonucleotide of claim 37, wherein all internucleoside linkages in the hairpin loop are phosphorothioate intemucleoside linkages.

39. The oligonucleotide of any one of claims 1-38, wherein the hairpin loop comprises a sequence complementary to the target nucleic acid, optionally the sequence complementary to the target nucleic acid is 2-4 nucleotides in length.

40. The oligonucleotide of any one of claims 1-38, wherein the hairpin loop does not comprise a sequence complementary to the target nucleic acid.

41. The oligonucleotide of any one of claims 1-40, wherein the second region comprises at least one ribonucleotide.

42. The oligonucleotide of claim 41, wherein all the nucleotides in the second region are ribonucleotides.

43. The oligonucleotide of any one of claims 1-42, wherein the second region comprises at least one phosphorothioate intemucleoside linkage.

44. The oligonucleotide of claim 43, wherein the internucleoside linkages between the one to three nucleotides at a terminus of the second region are phosphorothioate internucleoside linkages.

45. The oligonucleotide of any one of claims 1-44, wherein the second region comprises a modified nucleotide, optionally the modified nucleotide is a 2’-O-methyl nucleotide.

46. The oligonucleotide of claim 45, wherein at least 80%, at least 85%, at least 90%, at least 95%, or all of the nucleotides of the second region are chemically modified.

47. The oligonucleotide of claim 46, wherein the chemically modification comprises 2’- O-methylation.

48. The oligonucleotide of any one of claims 1-47, wherein the second region comprises a delivery ligand.

49. The oligonucleotide of any one of claims 1-48, wherein the 5’ terminus, the 3’ terminus, or both of the oligonucleotide comprises a terminal moiety.

50. The oligonucleotide of claim 49, wherein the terminal moiety comprises a ligand, a fluorophore, an exonuclease, a fatty acid, a Cy3, an inverted dT attached to a tri-ethylene glycol, or a combination thereof.

51. The oligonucleotide of any one of claims 1-50, wherein the target nucleic acid is a RNA.

52. The oligonucleotide of claim 51, wherein the target RNA is an mRNA, an miRNA, a non-coding RNA, a viral RNA transcript, or a combination thereof.

53. The oligonucleotide of any one of claims 1-52, wherein the single-stranded overhang is capable of binding to the target nucleic acid to form a toehold, thereby causing displacement of the first region from the second region and subsequent binding between the first region and the target nucleic acid.

54. The oligonucleotide of claim 53, wherein the binding between the first region and the target nucleic acid initiates cleavage of the target nucleic acid by RNase H.

55. The oligonucleotide of any one of claims 1-54, wherein the second region does not bind to the target nucleic acid upon the displacement of the first region from the second region.

56. The oligonucleotide of any one of claims 1 to 55, wherein the ASO domain has reduced toxicity, increased stability, and/or specific binding to the target nucleic acid.

57. The oligonucleotide of any one of claims 1 to 56, wherein the ASO domain comprises a sequence complementary to a nucleic acid sequence within a microtubule-associated protein tau (MAPT) transcript, optionally the MAP transcript is a transcript of MAPT gene having SEQ ID NO: 175.

58. The oligonucleotide of any one of claims 1 to 57, having a sequence selected from the group consisting of SEQ ID NOs: 1-94 or a variant thereof having one, two or three mismatches in any one of SEQ ID NOs: 1-94.

59. The oligonucleotide of any one of claims 1 to 58, wherein the ASO domain comprises the nucleic acid sequence ATTTCCAAATTCACTTTTAC (SEQ ID NO: 162).

60. The oligonucleotide of any one of claims 1 to 59, wherein the ASO domain comprises the nucleic acid sequence ATTtCcaaattcacTtTtAC (SEQ ID NO: 176) or ATtTCcaaattcactTTtAC (SEQ ID NO: 177), wherein each upper case letter is a beta-D-oxy-LNA nucleoside, and wherein each lower case letter is a DNA nucleoside.

61. A method of modulating a target nucleic acid, comprising: contacting a cell comprising a target nucleic acid with the oligonucleotide of any one of claims 1 to 60, wherein the single-stranded overhang binds to the target nucleic acid to cause displacement of the first region from the second region and binding of the first region to the target nucleic acid, thereby modulating the target nucleic acid.

62. The method of claim 61, wherein contacting the cell with the oligonucleotide is performed in vitro, in vivo, ex vivo, or a combination thereof.

63. The method of claim 61, wherein contacting the cell with the oligonucleotide occurs in the body of a subject.

64. The method of any one of claims 61-63, wherein the cell is a disease cell, and optionally the cell is a cancer cell.

65. The method of any one of claims 61-63, wherein the cell is a neuron.

66. A method of treating a disease or a condition, comprising administering the oligonucleotide of any one of claims 1 to 60 to a subject in need thereof, wherein the singlestranded overhang binds to a target nucleic acid to cause displacement of the first region from the second region and binding of the first region to the target nucleic acid, thereby modulating the activity of the target nucleic acid or protein expression from the target nucleic acid in the subject to treat the disease or condition.

67. The method of claim 66, wherein the disease or condition is a central nervous system (CNS) disease or disorder, or cancer.

68. The method of claim 67, wherein the CNS disease or disorder is a movement disorder, a memory disorder, addiction, attention deficit/hyperactivity disorder (ADHD), autism, bipolar disorder, depression, encephalitis, epilepsy/seizure, migraine, multiple sclerosis, a neurodegenerative disorder, a psychiatric disease, a neuroinflammatory disease, Alzheimer’s disease, Huntington's disease, Parkinson's disease, Tourette syndrome, dystonia, or a combination thereof.

69. The method of any one of claims 66-68, wherein the oligonucleotide is administered to a subject via a lipid-mediated delivery system, optionally via liposomes, nanoparticles, or micelles.

70. The method of any one of claims 66-68, wherein the oligonucleotide is administered to a subject via gymnotic delivery.

71. The method of any one of claims 66-70, wherein the oligonucleotide is administered to a subject in need thereof via a subcutaneous injection.

72. The method of any one of claims 66-70, wherein the oligonucleotide is administered to a subject in need thereof via an intravenous injection.

73. The method of any one of claims 59-72, wherein the target nucleic acid is a mRNA or a miRNA.

74. The method of claim 73, wherein the target nucleic acid is MAPT mRNA.

75. The method of any one of claims 66-74, wherein the oligonucleotide is administered to the subject at a concentration about 0.1-10 nM, optionally about 1-1.0 nM.

76. An oligonucleotide complex, comprising: an anti-sense oligonucleotide (ASO) strand comprising a first single-stranded overhang and a first domain, and an adapter oligonucleotide strand comprising a second single-stranded overhang and a second domain, wherein the first domain base pairs with the second domain forming a doublestranded duplex structure and wherein the first single-stranded overhang in the ASO strand is capable of binding to a target nucleic acid to cause displacement of the first domain from the second domain, thereby releasing the ASO strand from the double-stranded duplex structure.

77. The oligonucleotide complex of claim 76, wherein the first single-stranded overhang in the ASO strand is about 2-15 nucleotides in length, optionally at least 8 nucleotides in length.

78. The oligonucleotide complex of claim 76 or 77, wherein the second single-stranded overhang in the adapter oligonucleotide strand is about 2-15 nucleotides in length, optionally at least 8 nucleotides in length.

79. The oligonucleotide complex of any one of claims 76-78, wherein the first domain and/or the second domain is about 6-25 nucleotides in length.

80. The oligonucleotide complex of any one of claims 76-79, wherein the adapter strand is about 8-35 nucleotides in length.

81. The oligonucleotide complex of any one of claims 76-80, wherein the ASO strand is about 8-35 nucleotides in length.

82. The oligonucleotide complex of any one of claims 76-81, wherein the second singlestranded overhang comprises at least one phosphorothioate intemucleoside linkage.

83. The oligonucleotide complex of claim 82, wherein all internucleoside linkages in the second single-stranded overhang are phosphorothioate internucleoside linkages.

84. The oligonucleotide complex of any one of claims 76-83, wherein the second domain comprises at least one phosphorothioate internucleoside linkage.

85. The oligonucleotide complex of any one of claims 76-84, wherein the internucleoside linkages between the one to three nucleotides adjacent to the 3’ and/or 5’ of the adapter oligonucleotide strand are phosphorothioate intemucleoside linkages.

86. The oligonucleotide complex of any one of claims 76-85, wherein the intemucleoside linkages between the three nucleotides adjacent to the terminus in the second domain are phosphorothioate intemucleoside linkages and the remaining intemucleoside linkages in the second domain are phosphodiester intemucleoside linkages.

87. The oligonucleotide complex of any one of claims 76-86, wherein the adapter strand comprises one or more modified nucleotides.

88. The oligonucleotide complex of claim 87, wherein the modified nucleotides comprise 2’-O-methyl modification.

89. The oligonucleotide complex of any one of claims 76-88, wherein all the nucleotides in the adapter strand are 2’-O-methyl nucleotides.

90. The oligonucleotide complex of any one of claims 76-89, wherein the adapter strand comprises a delivery ligand.

91. The oligonucleotide complex of claim 90, wherein the second single-stranded overhang in the adapter strand comprises a delivery ligand.

92. The oligonucleotide complex of any one of claims 76-91, wherein the 5’ terminus, the 3’ terminus, or both of the adapter strand comprises a terminal moiety.

93. The oligonucleotide complex of claim 92, wherein the terminal moiety comprises a ligand, a fluorophore, an exonuclease, a fatty acid, a Cy3, an inverted dT attached to a tri-ethylene glycol, or a combination thereof.

94. The oligonucleotide complex of any one of claims 76-93, wherein the ASO strand is incompatible with gymnosis.

95. The oligonucleotide complex of any one of claims 76-94, wherein the ASO strand does not comprise a locked nucleic acid (LNA), optionally the ASO strand does not comprise a LNA at the 3’ - and/or 5 ’-terminus of the ASO strand.

96. The oligonucleotide complex of any one of claims 76-95, wherein the ASO strand is non-ionic or uncharged.

97. The oligonucleotide complex of any one of claims 76-96, wherein the ASO strand comprises a phosphorodiamidate morpholino oligomer.

98. The oligonucleotide complex of claim 97, wherein the phosphorodiamidate morpholino oligomer is golodirsen, casimersen or eteplirsen.

99. The oligonucleotide complex of any one of claims 76-96, wherein the ASO strand is peptide nucleic acid.

100. The oligonucleotide complex of any one of claims 76-99, wherein the first singlestranded overhang in the ASO strand comprises a sequence complementary to the target nucleic acid.

101. The oligonucleotide complex of any one of claims 76-100, wherein the ASO strand comprises a sequence complementary to the target nucleic acid, optionally the sequence complementary to the target nucleic acid is about 8-35 nucleotides in length.

102. The oligonucleotide complex of any one of claims 76-101, wherein the target nucleic acid is a RNA.

103. The oligonucleotide complex of claim 102, wherein the target RNA is an mRNA, an miRNA, a non-coding RNA, a viral RNA transcript, or a combination thereof.

104. The oligonucleotide complex of any one of claims 76-103, wherein the first singlestranded overhang in the ASO strand comprises the nucleic acid sequence ATTTCCAAATTCACTTTTAC (SEQ ID NO: 162).

105. The oligonucleotide of claim of any one of claims 76-104, wherein the ASO domain comprises the nucleic acid sequence ATTtCcaaattcacTtTtAC (SEQ ID NO: 176) or ATtTCcaaattcactTTtAC (SEQ ID NO: 177), wherein each upper case letter is a beta-D-oxy-LNA nucleoside, and wherein each lower case letter is a DNA nucleoside.

106. A method of delivering an antisense oligonucleotide strand to a cell, comprising: contacting the cell with any one of the oligonucleotide complex of claims 76-105, wherein the first single-stranded overhang in the antisense oligonucleotide strand binds to a target nucleotide in the cell to cause displacement of the first domain from the second domain, thereby releasing the antisense oligonucleotide strand from the double-stranded duplex structure.

107. The method of claim 106, wherein contacting the cell with the oligonucleotide complex is performed in vitro in vivo, ex vivo, or a combination thereof

108. The method of claim 106, wherein contacting the cell with the oligonucleotide complex occurs in the body of a subject.

109. The method of any one of claims 106-108, wherein the cell is a disease cell, and optionally the cell is a cancer cell.

110. The method of any one of claims 106-109, wherein the cell is a neuron.

111. The method of any one of claims 106-110, wherein the oligonucleotide complex is administered to a subject via a lipid-mediated delivery system, optionally via liposomes, nanoparticles, or micelles.

112. The method of any one of claims 106-110, wherein the oligonucleotide is administered to a subject via gymnotic delivery.

113. The method of any one of claims 106-112, wherein the antisense oligonucleotide strand is uncharged or non-ionic, optionally the antisense oligonucleotide strand comprises morpholino or peptide nucleic acid.

114. The method of any one of claims 106-113, wherein the antisense oligonucleotide strand comprises a morpholino, optionally the morpholino is golodirsen, casimersen, or eteplirsen.