WO2023229417A1 - Molecular diagnostic method using retroreflection as signaling principle - Google Patents

Abstract

A molecular diagnostic method is disclosed. The molecular diagnostic method comprises: a first step of amplifying a target nucleic acid sequence so as to form a double-stranded amplicon composed of a first strand having a first small molecule compound modified at an end thereof and a second strand having a second small molecule compound modified at an end thereof; a second step of reacting the double-stranded amplicon with a first reactant that is fixed onto a substrate of a sensing chip and selectively reacts with the first small molecule compound; a third step of reacting, with the second small molecule compound of the amplicon having reacted with the first reactant, an optical probe having a surface on which a second reactant selectively reacting with the second small molecule compound is modified; a fourth step of emitting light at the optical probe; and a fifth step of analyzing retroreflected light from the optic probe so as to calculate quantitative information about the target nucleic acid sequence.

Description

Molecular diagnosis method using retroreflection phenomenon as a signal principle

The present invention relates to a molecular diagnosis method using retroreflection phenomenon as a signal principle.

Molecular diagnostics is a field of diagnostic testing that analyzes and detects DNA or RNA. It is excellent in terms of sensitivity and accuracy, and the field of diagnosing infections such as viruses and bacteria accounts for more than half of the entire molecular diagnostics market. The standard method for such molecular diagnosis is polymerase chain reaction (PCR), a technology that replicates and amplifies the desired DNA portion. PCR repeatedly proceeds through a cycle consisting of a denaturation step to separate double-stranded DNA into single-stranded DNA, annealing of primers, and elongation of DNA. The denaturation step includes: The primer annealing step and the DNA elongation step are performed at temperature conditions of 92-95°C, 50-65°C, and 70-74°C, respectively.

To confirm the amplified gene amplification product, agarose gel electrophoresis or a fluorescent probe is generally used. When performing electrophoresis, a DNA ladder, which serves as an analysis standard, is loaded together, and the approximate size of the PCR product is confirmed by comparing the band positions of the ladder and the PCR amplification product to determine whether the target gene has been amplified. do. In the case of fluorescent probes, there are fluorescent dyes that insert unspecifically into the double helix of DNA, sequence-specific DNA probes, etc. When using real-time equipment, the product amplified for the target DNA molecule can be detected in real time and its amount analyzed. there is.

As mentioned above, conventional molecular diagnosis necessarily requires equipment including a thermal cycler capable of controlling temperature based on PCR. In addition, electrophoresis, the standard analysis method, is performed with a complex procedure and requires skilled experts, and when using a fluorescent probe, expensive equipment containing optical components such as excitation light, filters, and light multipliers is required to detect the fluorescent signal. do. Therefore, it is difficult to miniaturize and implement for on-site diagnosis purposes, so there is a problem that it is only performed by specialized inspection agencies.

The purpose of the present invention is to provide a molecular diagnostic method using the retroreflection phenomenon as a signal principle, which can significantly simplify the analysis procedure and improve analysis accuracy.

The molecular diagnostic method according to an embodiment of the present invention amplifies a target nucleic acid sequence to produce a double-stranded amplicon consisting of a first strand modified at the end with a first small molecule compound and a second strand modified at the end with a second small molecule compound. The first step of forming; A second step of reacting the double-stranded amplicon with a first reactant fixed to the substrate of the sensing chip and selectively reacting with the first small molecule compound; a third step of reacting an optical probe whose surface is modified with a second reactant that selectively reacts with the second small molecule compound of the amplicon reacted with the first reactant; a fourth step of irradiating light to the optical probe; and a fifth step of calculating quantitative information of the target nucleic acid sequence by analyzing the light retroreflected from the optical probe.

In one embodiment, the optical probe includes transparent core particles; A total reflection induction layer covering a portion of the surface of the core particle and formed of a material having a lower refractive index than the core particle in the visible light wavelength range of 360 nm to 820 nm; A modifier layer formed on the total reflection inducing layer; And it may include the second reactant that is bound to the modifier layer and selectively reacts with the second small molecule compound.

In one embodiment, the double-stranded amplicon is a target through a LAMP (Loop-mediated isothermal amplification) method using four core primers and two loop primers whose ends are modified with the first and second small molecule compounds, respectively. It can be formed by amplifying nucleic acid molecules.

In one embodiment, the four core primers are synthesized by selecting and combining six regions (F1, F2, F3, B1, B2, B3) from the target nucleic acid molecule, and are forward inner primers. FIP), forward outer primer (F3), backward inner primer (BIP), and backward outer primer (B3), wherein the loop primer is modified with a first small molecule compound at its 5' end. It may include a forward loop primer and a backward loop primer whose 5' end is modified with a second small molecule compound.

In one embodiment, the first small molecule compound and the second small molecule compound are different compounds, each of which includes fluorescein isothiocyanate (FITC), digoxigenin (DIG), dinitrophenyl (DNP), acrylamide, and Alexa Fluor. (Alexa Fluor), Biotin, Biotin-TEG, Cholesterol, Cyanine, Desthiobiotin-TEG, DNP-TEG, GalNac (N-Acetylgalactosamine ), Inosine, PEG-2000, Puromycin, Rhodamine-6G, Texas red (C31H29N2O6S2Cl), Thymidine Glycol, FAM (Fluorescein amidite) , Hex (Hexachlorofluorescein), ROX (Carboxy-X-Rhodamine), and TAMRA (Tetramethylrhodamine-5-maleimide). For example, the first small molecule compound may include one selected from the group consisting of FITC, DIG, and DNP, and the first reactant may include an antibody against the first small molecule compound.

In one embodiment, in the fourth step, light generated from a light source that generates light mixed with light of wavelengths belonging to infrared light, visible light, or ultraviolet light or a light source that generates monochromatic light of a specific wavelength is irradiated to the optical probe. You can.

In one embodiment, in the fifth step, quantitative information of the target nucleic acid sequence can be calculated by generating an image of the light retroreflected from the optical probe and then counting the number of optical probes therefrom.

The molecular diagnosis method according to an embodiment of the present invention amplifies two or more different target nucleic acid molecule sequences to produce a second small molecule compound identical to the first strand with one of the two or more different first small molecule compounds modified at the end. A first step of forming two or more different double-stranded amplicons, each consisting of a second strand modified at the end; A second step of reacting each of the amplicons with different first reactants that are fixed to the substrate of the sensing chip and each selectively reacts with the first small molecule compounds; A third step of reacting an optical probe whose surface is modified with a second reactant that selectively reacts with the second small molecule compound to the amplicons fixed to the sensing chip; a fourth step of irradiating light to the optical probe; and a fifth step of calculating quantitative information of target nucleic acid molecule sequences by analyzing the light retroreflected from the optical probe.

In one embodiment, the sensing chip includes two or more spatially spaced sensing regions, and the different first reactants may be modified in each of the sensing regions.

In one embodiment, the sensing areas may be formed inside a single fluid channel.

In one embodiment, the densities of the first reactants modified in each of the sensing regions may be the same.

In one embodiment, each of the different first small molecule compounds and the second small molecule compound is fluorescein isothiocyanate (FITC), digoxigenin (DIG), dinitrophenyl (DNP), acrylamide, and Alexa Fluor. , Biotin, Biotin-TEG, Cholesterol, Cyanine, Desthiobiotin-TEG, DNP-TEG, GalNac (N-Acetylgalactosamine), Ionsin (Inosine), PEG-2000, Puromycin (Puromycin), Rhodamine-6G, Texas red (C31H29N2O6S2Cl), Thymidine Glycol, FAM (Fluorescein amidite), Hex (Hexachlorofluorescein) ), ROX (Carboxy-X-Rhodamine), and TAMRA (Tetramethylrhodamine-5-maleimide).

According to the molecular diagnosis method of the present invention, retroreflected light is applied as a signal principle, making it possible to detect and quantitatively analyze target nucleic acids with high sensitivity using extremely simplified optical signal analysis equipment. In addition, the LAMP method, which uses core primers and loop primers together, amplifies the target nucleic acid molecule to generate a uniform amplicon and performs analysis on it, which not only greatly simplifies the analysis procedure but also enables the analysis. Accuracy can be improved.

1 is a flowchart for explaining a molecular diagnosis method according to an embodiment of the present invention.

Figure 2 is a schematic diagram to explain the system for the molecular diagnosis method.

Figure 3 is a diagram for comparing amplification products by the conventional LAMP method and the LAMP method of the present invention.

FIG. 4 is a cross-sectional view illustrating an optical probe applied to the molecular diagnosis system shown in FIG. 2.

FIG. 5 is a diagram illustrating a method of modifying the substrate of a sensing chip in the molecular diagnostic system shown in FIG. 2 with a first reactant.

Figure 6 is a flowchart for explaining a molecular diagnosis method according to another embodiment of the present invention.

Figure 7 is a schematic diagram for explaining a molecular diagnosis method according to another embodiment of the present invention.

Figure 8 is an image showing the gel electrophoresis results for the LAMP amplification product according to the example.

Figure 9a is an image obtained after reacting Salmonella samples of various concentrations to a sensing substrate, and Figure 9b is a graph showing the concentration of Salmonella analyzed from the image of Figure 9a.

Figure 10a is a graph showing the concentration of Salmonella calculated according to Example 2-1, and Figure 10b is a graph showing the concentration of Salmonella calculated according to Example 2-2.

Hereinafter, embodiments of the present invention will be described in detail. Since the present invention can be subject to various changes and can have various forms, specific embodiments will be illustrated in the drawings and described in detail in the text. However, this is not intended to limit the present invention to a specific disclosed form, and should be understood to include all changes, equivalents, and substitutes included in the spirit and technical scope of the present invention. While describing each drawing, similar reference numerals are used for similar components. In the attached drawings, the dimensions of the structures are enlarged from the actual size for clarity of the present invention.

Terms such as first, second, etc. may be used to describe various components, but the components should not be limited by the terms. The above terms are used only for the purpose of distinguishing one component from another. For example, a first component may be named a second component, and similarly, the second component may also be named a first component without departing from the scope of the present invention.

The terms used in this application are only used to describe specific embodiments and are not intended to limit the present invention. Singular expressions include plural expressions unless the context clearly dictates otherwise. In this application, terms such as “comprise” or “have” are intended to designate the presence of features, steps, operations, components, parts, or combinations thereof described in the specification, but are not intended to indicate the presence of one or more other features or steps. , it should be understood that it does not exclude in advance the possibility of the existence or addition of operations, components, parts, or combinations thereof.

Unless otherwise defined, all terms used herein, including technical or scientific terms, have the same meaning as commonly understood by a person of ordinary skill in the technical field to which the present invention pertains. Terms defined in commonly used dictionaries should be interpreted as having a meaning consistent with the meaning in the context of the related technology, and unless explicitly defined in the present application, should not be interpreted in an ideal or excessively formal sense. No.

Figure 1 is a flowchart for explaining a molecular diagnosis method according to an embodiment of the present invention, Figure 2 is a schematic diagram for explaining a system for the molecular diagnosis method, and Figure 3 is a conventional LAMP method and the LAMP method of the present invention. It is a diagram for comparing amplification products by , FIG. 4 is a cross-sectional view for explaining an optical probe applied to the molecular diagnostic system shown in FIG. 2, and FIG. 5 is a substrate of a sensing chip in the molecular diagnostic system shown in FIG. 2. This is a diagram to explain a method of modifying the first reactant.

1 to 5, the molecular diagnosis method according to an embodiment of the present invention amplifies a target nucleic acid molecule to form a first strand whose ends are modified with a first small molecule compound and a strand whose ends are modified with a second small molecule compound. The first step (S110) of forming a double-stranded amplicon (10) consisting of two strands; A second step (S120) of reacting the double-stranded amplicon 10 with a first reactant 112 that is fixed to the substrate 111 of the sensing chip 110 and selectively reacts with the first small molecule compound. ; An optical probe (120) whose surface is modified with a second reactant (125) that selectively reacts with the second small molecule compound of the double-stranded amplicon (10) reacted with the first reactant (112). ) a third step (S130) of reacting; A fourth step (S140) of radiating light to the optical probe 120; and a fifth step (S150) of detecting and analyzing the light retroreflected from the optical probe 120.

In the first step (S110), the double-stranded amplicon is LAMP (Loop-mediated isothermal amplification) using four core primers and two loop primers each modified with the first and second small molecule compounds. It can be formed by amplifying the target nucleic acid molecule through a method. The target nucleic acid molecule may include DNA or RNA of viruses, bacteria, etc.

In one embodiment, the four core primers are synthesized by selecting and combining six regions (F1, F2, F3, B1, B2, B3) from the target nucleic acid molecule, and are forward inner primers. FIP), forward outer primer (F3), backward inner primer (BIP), and backward outer primer (B3). In addition, the loop primer is a forward loop primer whose first small molecule compound is modified at one end, for example, the 5' end, and a second small molecule compound is modified at one end, for example, the 5' end. It may include a backward loop primer.

The first small molecule compound and the second small molecule compound are different compounds, each of which contains FITC (fluorescein isothiocyanate), DIG (Digoxigenin), DNP (Dinitrophenyl), acrylamide, Alexa Fluor, and biotin. (Biotin), Biotin-TEG, Cholesterol, Cyanine, Desthiobiotin-TEG, DNP-TEG, GalNac (N-Acetylgalactosamine), Inosine ), PEG-2000, Puromycin, Rhodamine-6G, Texas red (C31H29N2O6S2Cl), Thymidine Glycol, FAM (Fluorescein amidite), Hex (Hexachlorofluorescein), It may include one selected from the group consisting of ROX (Carboxy-X-Rhodamine), TAMRA (Tetramethylrhodamine-5-maleimide), etc.

As shown in Figure 3, when a target nucleic acid molecule is amplified through the conventional LAMP method using only four core primers, various types of concatemers are formed. When detection and analysis is performed by targeting all of the various concatamers, it is difficult to perform accurate quantitative analysis, and the procedure becomes complicated because DNA-based analysis methods such as DNA-DNA hybridization must be performed for detection.

On the other hand, as in the present invention, when a target nucleic acid molecule is amplified through the LAMP method using four core primers and two loop primers, a first strand at one end of which the first small molecule is modified and the end A uniform double-stranded amplicon 10 may be formed consisting of a second strand modified with the second small molecule at the end opposite to the amplicon. In one embodiment, the F2 of the FIP (forward internal primer) and the F2c of the target gene bind complementary, and the DNA chain is extended by DNA polymerase and dNTP to form double-stranded DNA. Double-stranded DNA After is formed, F3 (forward external primer) can bind complementary to the F3c part of the gene. The DNA chain formed by FIP can be separated during the amplification process when F3 (forward external primer) binds to form a single strand. In addition, the back loop primer containing a small molecule compound binds to the single-stranded DNA chain extended by FIP, thereby extending the DNA chain to form double-stranded DNA. Afterwards, the B2 part of BIP (backward internal primer) and the double-stranded DNA are combined. The B2c portion can bind complementary. The DNA chain extended by the backward loop primer can be separated during the amplification process when the BIP (backward internal primer) binds to the DNA and forms a single strand. A forward loop primer to which a small molecule compound is bound can bind to a single-stranded DNA chain formed by a backward loop primer, thereby extending the DNA chain, and then FIP can bind complementary to the formed double-stranded DNA strand.

In the second step (S120), the sensing chip 110 may be provided with a sensing area, and at one end of the target amplicon 10 is placed on the surface of the substrate 111 corresponding to the sensing area. A first reactant 112 that selectively reacts with the modified first small molecule compound is combined. In one embodiment, the first reactant 112 may be an antibody. For example, when the first small molecule compound includes FITC, the first reactant 112 may include an anti-FITC antibody, and the first small molecule compound includes DIG. In this case, the first reactant 112 may include an anti-DIG antibody, and if the first small molecule compound includes DNP, the first reactant 112 may include an anti-DIG antibody. -May include DNP antibody (anti-DNP antibody).

Meanwhile, the sensing area of the sensing chip 110 may be provided in the form of a fluid channel that can accommodate the fluid containing the target amplicon 10, and the first reactant 112 is inside the fluid channel. It can be fixed to the surface of the substrate 111. In order to react the first small molecule compound of the target amplicon 10 with the first reactant 112 fixed to the substrate 111, a fluid containing the target amplicon 10 is applied to the sensing chip 110. ) can be maintained for a certain period of time after injection into the rapeseed channel.

In one embodiment, the material or shape of the substrate 111 of the sensing chip 110 is not particularly limited as long as it can bind to and fix the first reactant 112. For example, the substrate 111 may be formed of glass, silicon, polymer, etc., and the surface area of the substrate 111 constituting the bottom surface of the fluid channel is bonded to the first reactant 112. It can be flat so that it can be. The polymer may include polystyrene (PS), polymethyl methacrylate (PMMA), olefin copolymer (COC), polydimethylsiloxane (PDMS), etc.

In one embodiment, when the substrate 111 of the sensing chip 110 is formed of one of glass, silicon, and polymer, the surface of the sensing substrate is activated through plasma treatment or ultraviolet irradiation, as shown in FIG. 5. After treatment with 3-aminopropyltriethoxysilane (APTES) to expose the amine group, and then with an amine-reactive crosslinking agent such as BS3 (bis(sulfosuccinimidyl)suberate) or glutaraldehyde, the first reaction is performed. By treating the material 112, the first reactant 112 can be fixed to the surface of the substrate 111 through a covalent bond such as an imine bond. Meanwhile, after binding the first reactant 112 to the substrate 111, it is attached to the surface of the substrate 111 using a molecule containing an amine group such as ethanolamine and bovine serum albumin (BSA). Remaining reactive residues, such as aldehyde, succinimide group, etc., can be blocked.

In the third step (S130), the optical probe 120 reacts with a second reactant 125 that selectively reacts with the second small molecule compound of the amplicon 10 that reacted with the first reactant 112. It may include, and the light irradiated from the light source 130 may be retroreflected in the direction of the light source 130.

In one embodiment, the optical probe 120 includes transparent core particles 121; A total reflection induction layer 122 that covers a portion of the surface of the core particle 121 and is formed of a material with a lower refractive index than the core particle 121 in the visible light wavelength range of at least 360 nm to 820 nm; a modification layer 123 formed on the total reflection inducing layer 122; And it may include the second reactant 125 that is bound to the modifier layer 123 and selectively reacts with the second small molecule compound.

The core particle 121 may have a spherical shape. In the present invention, ‘spherical’ is defined to include not only a perfect sphere where the radii from the center to all points on the surface are the same, but also a substantially spherical body in which the difference between the maximum and minimum radii is less than about 10%.

In one embodiment, the core particles 121 may have an average diameter of about 600 nm or more and 2 μm or less, considering the relationship with the wavelength of light irradiated from the light source 130 and the operability of biosensing.

In one embodiment, the core particles 121 may be formed of a transparent material capable of transmitting incident light. For example, the core particles 121 may be formed of transparent oxide or transparent polymer material. The transparent oxide may include, for example, silica, glass, etc., and the transparent polymer material may include, for example, polystyrene, poly(methyl methacrylate), etc. )), etc.

The total reflection induction layer 122 is formed to cover a portion of the surface of the core particle 121, and totally reflects at least a portion of the light traveling inside the core particle 121 to be retroreflected in the direction of the light source 130. The amount of light can be increased.

In one embodiment, the total reflection induction layer 122 may be formed on the surface of the core particle 121 to cover an area of about 30% to 70% of the surface of the core particle 121. If the total reflection inducing layer 122 covers less than 30% of the surface of the core particle 121, a problem may occur in which the amount of light incident on the inside of the core particle 121 that is not retroreflected and leaks increases. In the case where the total reflection inducing layer 122 covers the surface of the core particle 121 by more than 70%, a problem may occur in which the amount of light incident on the inside of the core particle 121 is reduced. In one embodiment, the total reflection inducing layer 122 may be formed on the surface of the core particle 121 to cover about 40% to 60% of the surface of the core particle 121.

In one embodiment, in order to increase the amount of light retroreflected in the direction of the light source 130 by total reflection of at least a portion of the light traveling inside the core particle 121, the total reflection inducing layer 122 is provided with the core particle ( 121) and can be formed of a material with a smaller refractive index. In one embodiment, the core particles 121 may be formed of a material having a refractive index of about 1.4 or more in the visible light wavelength range of at least 360 nm to 820 nm, and the total reflection inducing layer 122 may have a refractive index greater than that of the core particles 121. It can be formed of a material with a small refractive index. Specifically, when the core particles 121 are formed of a transparent oxide or transparent polymer material having a refractive index of about 1.4 or more in the visible light region, the total reflection inducing layer 122 may be formed of a metal material having a refractive index less than that. . For example, the total reflection induction layer 122 is made of gold (Au) with a refractive index of about 0.22, silver (Ag) with a refractive index of about 0.15, and aluminum (Al) with a refractive index of about 1.0 for light with a wavelength of 532 nm. , copper (Cu) with a refractive index of about 0.4, zinc (Zn) with a refractive index of about 1.2, and the like.

Meanwhile, in one embodiment, in order to improve the adhesion between the total reflection induction layer 122 and the core particles 121, chromium (Cr) is applied to the surface of the core particles 121 and then the total reflection induction layer ( 122) can be formed. In this case, in order to prevent retroreflection from being reduced, the chrome is preferably applied to a thickness of about 2 nm to 5 nm or less. In contrast, in another embodiment, the total reflection inducing layer 122 itself may be formed of a material that has strong adhesion to the core particles 121. For example, when the core particles 121 are formed of transparent oxide, the total reflection inducing layer 122 may be formed of aluminum (Al) or copper (Cu).

In one embodiment, in order to prevent light leakage due to light transmission and improve dispersibility of the optical probe 120, the total reflection induction layer 122 may have a thickness of about 10 to 100 nm. If the thickness of the total reflection induction layer 122 is less than 10 nm, a problem may occur in which some of the light incident on the inside of the core particle 121 leaks through the total reflection induction layer 122, and the total reflection induction layer 122 may leak. When the thickness of 122 exceeds 100 nm, the weight of the optical probe 120 increases, which may cause a problem in which the dispersibility of the optical probe 120 in the liquid is reduced.

The modifier layer 123 may be formed on the surface of the total reflection inducing layer 122. The modification layer 123 may be formed of a metal material that is easy to combine with the second reactant. For example, the modification layer 123 may be formed of a noble metal such as platinum (Pt), gold (Au), silver (Ag), etc., which is easy to modify with biological materials and has excellent oxidation stability.

In one embodiment, the modifier layer 123 may be formed as a separate layer independent of the total reflection induction layer 122. For example, when the total reflection inducing layer 122 is formed of a metal material other than a noble metal, the modifier layer 123 may be a noble metal material layer covering the total reflection inducing layer 122.

In contrast, in another embodiment, the modifier layer 123 and the total reflection induction layer 122 may be formed integrally. For example, when the total reflection inducing layer 122 is formed of a noble metal with a lower refractive index than the core particles, such as gold (Au), silver (Ag), etc., the total reflection inducing layer 122 is formed by the modifier layer 123. can also function.

In one embodiment, the modifier layer 123 may have a thickness of about 100 nm or less to prevent dispersion and aggregation within the liquid of the optical probe 120.

The second reactant 135 is directly or indirectly bound to the modification layer 123 and can selectively bind to the second small molecule compound of the amplicon 10. The second reactant 135 may vary depending on the second small molecule compound and may include one or more selected from proteins, nucleic acids, ligands, etc. For example, when the second small molecule compound contains biotin, the second reactant 135 is avidin or streptavidin that can selectively bind to biotin. , NeutrAvidin, etc. may include one or more protein compounds selected from the group.

Meanwhile, the second reactant 135 may be formed to bind only to the surface of the modifier layer 123 and not to the exposed surface of the core particle 121. In this way, when the second reactant 135 is site-selectively formed with respect to the core particle 121 covered by the total reflection inducing layer 122 and the modifier layer 123, the amplicon bound to the amplicon In this state, the exposed portion of the core particle 121 faces the light source unit 140, so a stronger retroreflection signal can be induced.

In one embodiment of the present invention, as shown in FIG. 4, the optical probe 120 is disposed between the total reflection induction layer 122 and the modifier layer 123, and the magnetic layer 124 formed of a magnetic material. ) may further be included. The magnetic layer 124 may be formed of a magnetic material such as iron (Fe), nickel (Ni), manganese (Mn), or a sintered body or oxide thereof. When the optical probe 120 further includes the magnetic layer 124, a stronger retroreflection signal can be induced by adjusting the orientation of the optical probe 120 by applying a magnetic field from the outside. Among the optical probes 120 that are not bound to the amplicon, the optical probe 120 can be easily separated using an external magnetic field.

In the fourth step (S140), after the optical probe 120 is coupled to the amplicon 10, the optical probe 120 is illuminated through the light source 130 disposed on the upper part of the sensing chip 110. ) can be irradiated with light. As the light source 130, a light source that generates light mixed with light of various wavelengths belonging to infrared light, visible light, and ultraviolet light may be used, or a light source that generates monochromatic light of a specific wavelength may be used without limitation.

In one embodiment, in order to eliminate the influence of light mirror-reflected from the sensing chip 110, the light source 130 emits light in a direction inclined at about 5 to 60° with respect to the normal line of the surface of the substrate 111. can be investigated.

In the fifth step (S150), the light retroreflected by the optical probe 120 may be detected and analyzed by the light receiving device 140. The light receiving device 140 is disposed on the sensing chip 110 adjacent to the light source 130, and receives light retroreflected by the optical probe 110 to detect the presence or absence of the target amplicon 10. , concentration, etc. can be analyzed, and quantitative information about the target nucleic acid molecule can be generated based on this information.

The configuration of the light receiving device 140 is not particularly limited as long as it can receive the retroreflected light and analyze information about the target amplicon 10. In one embodiment, the light receiving device 140 may include an image generator that images the retroreflected optical signal and an image analysis unit that analyzes image information generated by the image generator. In another embodiment, the light receiving device 140 includes a light splitting unit that splits the incident light incident on the optical probe 120 from the light source 130 and the light retroreflected from the optical probe 120, and the light splitting unit It may include a lens capable of focusing and enlarging the divided optical signal, an image generator that receives the magnified optical signal and turns it into an image, and an image analysis unit that analyzes the image information generated by the image generator.

Meanwhile, when the light receiving device 140 includes the light splitting unit, the image generating unit, and the image analyzing unit, the light source 130 is inclined in a direction inclined by about 5 to 60° with respect to the normal line of the surface of the substrate 111. The light splitter can also be arranged to be inclined at a certain angle with respect to the normal line of the surface of the substrate 111 to minimize the effect of mirror reflection of light generated from the light splitter.

In one embodiment, the light receiving device 140 may generate quantitative information of the target amplicon by counting the number of retroreflective particles identified by light retroreflected from the image generated by the image generator. .

In another embodiment, the light receiving device 140 may include a microscope that can directly check the retroreflected light.

Figure 6 is a flow chart for explaining a molecular diagnosis method according to another embodiment of the present invention, and Figure 7 is a schematic diagram for explaining a molecular diagnosis method according to another embodiment of the present invention. The molecular diagnosis method according to this embodiment can simultaneously analyze quantitative information on a plurality of different target nucleic acid molecule sequences, and the steps of analyzing quantitative information on each of a plurality of target nucleic acid molecule sequences are described in FIGS. 1 to 5. Since it is the same or similar to the molecular diagnosis method described above, the following description will focus on the differences between the two methods, and redundant detailed description will be omitted.

Referring to FIGS. 2 to 5 and to FIGS. 6 and 7, the molecular diagnostic method according to another embodiment of the present invention amplifies two or more different target nucleic acid molecule sequences to produce two or more different first small molecule compounds. A second small molecule compound that forms two or more different double-stranded amplicons (10a, 10b, 10c), each consisting of a first strand modified at the end and a second strand modified at the end, one of which is identical to the first strand modified at the end. Step 1 (S210); The two or more double-stranded amplicons are fixed to the substrate 211 of the sensing chip 210 and each react selectively with the different first small molecule compounds. A second step (S220) of reacting the elements 10a, 10b, and 10c, respectively; A second reactant 125 that selectively reacts with the second small molecule compound of the two or more amplicons 10a, 10b, and 10c that reacted with the first reactants 212a, 212b, and 212c, respectively, is placed on the surface. A third step (S230) of reacting the modified optical probe 120; A fourth step (S240) of radiating light to the optical probe 120; and a fifth step (S250) of detecting and analyzing the light retroreflected from the optical probe 120.

In the first step (S210), the two or more different target nucleic acid molecule sequences may be different nucleic acid sequences of the same virus or bacteria, or may be nucleic acid sequences of different viruses or bacteria. For convenience of explanation below, as shown in FIG. 5, the case where the two or more different target nucleic acid molecule sequences include a first nucleic acid molecule sequence, a second nucleic acid molecule sequence, and a third nucleic acid molecule sequence will be described as an example. do.

Each of the first to third nucleic acid molecule sequences is amplified through the LAMP (Loop-mediated isothermal amplification) method using the four core primers described above and two loop primers modified with the first and second small molecule compounds, respectively. First to third double-stranded amplicons (10a, 10b, 10c) can be generated. In one embodiment, the first nucleic acid molecule sequence is a LAMP method using four core primers having corresponding base sequences and two loop primers each having a 1-1 small molecule compound and a second small molecule compound modified at the ends. The first double-stranded amplicon (10a) is composed of a first strand whose ends are modified with the 1-1 small molecule compound and a second strand whose ends are modified with the second small molecule compound. can be created. And the second nucleic acid molecule sequence can be amplified through the LAMP method using four core primers with corresponding base sequences and two loop primers each having the first and second small molecule compounds and the second small molecule compound modified at the ends. Thereby, the second double-stranded amplicon (10b) consisting of a first strand whose ends are modified with the 1-2 small molecule compound and a second strand whose ends are modified with the second small molecule compound can be generated. . In addition, the third nucleic acid molecule sequence can be amplified through the LAMP method using four core primers with corresponding base sequences and two loop primers each of which has a 1-3 small molecule compound and a 2nd small molecule compound modified at the ends. This can produce the third double-stranded amplicon (10c), which consists of a first strand whose ends are modified with the 1-3 small molecule compound and a second strand whose ends are modified with the second small molecule compound. there is. At this time, the 1-1 to 1-3 small molecule compounds may be different compounds.

The 1-1 to 1-3 small molecule compounds and the second small molecule compounds are different compounds, and each of them is FITC (fluorescein isothiocyanate), DIG (Digoxigenin), DNP (Dinitrophenyl), acrylamide, and Alexa Fluor. (Alexa Fluor), Biotin, Biotin-TEG, Cholesterol, Cyanine, Desthiobiotin-TEG, DNP-TEG, GalNac (N-Acetylgalactosamine ), Inosine, PEG-2000, Puromycin, Rhodamine-6G, Texas red (C31H29N2O6S2Cl), Thymidine Glycol, FAM (Fluorescein amidite) , Hex (Hexachlorofluorescein), ROX (Carboxy-X-Rhodamine), TAMRA (Tetramethylrhodamine-5-maleimide), etc.

In the second step (S220), the sensing chip 210 may be provided with two or more sensing regions respectively corresponding to the two or more different target nucleic acid molecule sequences, and the substrate corresponding to the sensing regions ( On the surfaces of 211), two or more different first reactants each capable of selectively reacting with different first small molecule compounds modified at one end of the plurality of target amplicons 10a, 10b, and 10c, respectively. The elements 212a, 212b, and 212c may each be combined. The sensing regions may be formed to be spatially spaced from each other, and the densities of the first reactants 212a, 212b, and 212c modified in each sensing region may be the same. In one embodiment, the sensing areas may be formed to be spaced apart from each other within a single fluid channel as shown in FIG. 5 . In another embodiment, each of the sensing areas may be formed in different oil channels.

In one embodiment, first to third amplicons 10a, 10b, and 10c are each modified with the 1-1 to 1-3 small molecule compounds at one end and the second small molecule compound at the other end. When attempting to simultaneously quantitatively analyze the first to third amplicons 10a, 10b, and 10c from a sample containing the first to third amplicons 10a, 10b, and 10c, the first sensing region of the sensing chip 210 selectively reacts with the 1-1 small molecule compound. A 1-1 reactant (212a) capable of reacting selectively with the 1-2 small molecule compound may be bound to the second sensing region of the sensing chip 210. A material 212b may be bound, and a 1-3 reactant 212c capable of selectively reacting with the 1-3 small molecule compound may be bound to the third sensing region of the sensing chip 210. You can. And when a sample containing the first to third double-stranded amplicons 10a, 10b, and 10c is injected into the first to third sensing regions to react, the 1-1 small molecule compound and the first -1 The first amplicon (10a) can be fixed to the first sensing region by a selective reaction between the reactant (212a), and the 1-2 small molecule compound and the 1-2 reactant (212b) ) The second amplicon (10b) can be fixed to the second sensing region by a selective reaction between the 1-3 small molecule compound and the 1-3 reactant (212c). The third amplicon 10c can be fixed to the third sensing region.

In the third step (S230), as shown in FIG. 4, the optical probe 120 includes transparent core particles 121, a total reflection induction layer 122 covering a portion of the core particles 121, and It may include a modifier layer 123 formed on the total reflection inducing layer 122 and a second reactant 125 directly or indirectly bonded to the modifier layer 123. When providing the optical probe 120 to the sensing areas of the sensing chip 110, the second small molecule compound and the second reactant of the first to third amplicons 10a, 10b, and 10c Through a selective reaction between (125), the optical probe 120 can bind to the first to third amplicons 10a, 10b, and 10c bound to the sensing regions.

In one embodiment, a selective reaction between the 1-1 small molecule compound and the 1-1 reactant (212a), a selective reaction between the 1-2 small molecule compound and the 1-2 reactant (121b) The first to third amplicons (10a, 10b, 10c) are formed in the first to third sensing regions by reaction and selective reaction between the first to third small molecule compounds and the first to third reactants (121c). ) are each fixed, when the optical probe 120 is inserted into the first to third sensing regions, the optical probe 120 is between the second small molecule compound and the second reactant 125. It can be bound to the first to third amplicons 10a, 10b, and 10c through a selective reaction.

In the fourth step (S240), after the optical probe 120 is coupled to the plurality of amplicons 10a, 10b, and 10c, the light source 130 disposed on the upper part of the sensing chip 210 is used. Light can be irradiated to the optical probe 120 through. As the light source 130, a light source that generates light mixed with light of various wavelengths belonging to infrared light, visible light, and ultraviolet light may be used, or a light source that generates monochromatic light of a specific wavelength may be used without limitation.

In the fifth step 250, light retroreflected from the optical probe 120 coupled to the plurality of sensing regions is detected, and a plurality of amplicons respectively fixed to the plurality of sensing regions ( 10a, 10b, 10c) Quantitative information about the presence or absence, concentration, etc. of each can be analyzed simultaneously, and based on this information, quantitative information about two or more different target nucleic acid molecule sequences can be analyzed simultaneously.

According to the molecular diagnosis method of the present invention, retroreflected light is applied as a signal principle, making it possible to detect and quantitatively analyze target nucleic acids with high sensitivity using extremely simplified optical signal analysis equipment. In addition, the LAMP method, which uses core primers and loop primers together, amplifies the target nucleic acid molecule to generate a uniform amplicon and performs analysis on it, which not only greatly simplifies the analysis procedure but also enables the analysis. Accuracy can be improved.

Hereinafter, embodiments of the present invention will be described in detail. However, the following examples are for several embodiments of the present invention, and the present invention should not be construed as being limited to the following examples.

[Example 1]

Target gene amplification using the LAMP system incorporating improved loop primers

Core primers and loop primers with the base sequences listed in Table 1 below targeting the invA gene of Salmonella Typhimurium, an infectious microorganism, were designed.

primer	base sequence
FIP core primer	5’CCGGCCTTCAAATCGGCATCAAGCCCGATTTTCTCTGGATGG 3’
BIP Core Primer	5’GAACGGCGAAGCGTACTGGACATCGCACCGTCAAAGGAA 3’
F3 Core Primer	5’GAACGTGTCGCGGAAGTC 3’
B3 Core Primer	5’CGGCAATAGCGTCACCTT 3’
LF_FITC Loop Primer	5’FITC-TATGCCCGGTAAACAGATGAGTA 3’
LB_biotin loop primer	5’biotin-CCGTAAAGCTGGCTTTCCCTT 3’

Six primers (FIP, BIP, F3, B3, LF_FITC, LB_biotin) including an improved loop primer, genomic DNA (gDNA) eluted from the target pathogen Salmonella, a reaction buffer containing dNTP and magnesium sulfate, and Bst DNA polymerase. After mixing to form a reaction solution, it was maintained for a certain period of time at a temperature between 60°C and 65°C to induce a loop-mediated isothermal amplification reaction, thereby performing an amplification reaction on the genomic DNA (gDNA) eluted from Salmonella. Specifically, using Salmonella samples with various concentrations of 10 CFU, 10 ² CFU, 10 ³ CFU, 10 ⁴ CFU, 10 ⁵ CFU and 10 ⁶ CFU, including non-template sample without Salmonella (NTC, 0 CFU). The modified LAMP method was performed.

Quantitative analysis of infectious microbial genes using an affinity-based optical molecular diagnostic system employing retroreflection

To detect the target amplicon, which is a product produced by the improved LAMP method, a glass-based sensing substrate on which a specific antibody for the target amplicon was immobilized and a retroreflective particle modified with streptavidin were used. At this time, in order to detect the target amplicon, the target amplicon, which is a LAMP amplification product, was reacted with the sensing substrate and then washed to remove unreacted substances. After reacting with retroreflective particles modified with streptavidin, unreacted substances were removed by washing. .

Subsequently, the corresponding sensing substrates were analyzed and image information was obtained using a digital camera connected to an objective lens with an aperture of 0.065 and a white LED light source.

[Example 2-1]

After inoculating and culturing Salmonella in milk, Salmonella was obtained from the milk by centrifugation. Next, NaOH was added and heat was applied to lyse the cells, and the lysed sample was used as a template to perform an improved LAMP method at various concentrations. A sample was produced.

Next, the sample was reacted on a glass-based sensing substrate on which a specific antibody for the target amplicon was immobilized and washed, and then retroreflective particles modified with streptavidin were reacted and washed.

Next, the sensing substrates were analyzed using a digital camera connected to an objective lens with an aperture of 0.065 and a white LED light source, image information was obtained, and the concentration of Salmonella bacteria was calculated.

[Example 2-2]

After inoculating and culturing Salmonella in chicken, Salmonella was obtained from chicken by homogenizing and centrifuging using a stomacher. Next, NaOH was added and heat was applied to lyse the cells, and the lysed sample was used as a template to perform an improved LAMP method. Proceeding, samples of various concentrations were produced.

Next, the sample was reacted on a glass-based sensing substrate on which a specific antibody for the target amplicon was immobilized and washed, and then retroreflective particles modified with streptavidin were reacted and washed.

Next, the sensing substrates were analyzed using a digital camera connected to an objective lens with an aperture of 0.065 and a white LED light source, image information was obtained, and the concentration of Salmonella bacteria was calculated.

[Experimental Example 1]

Figure 8 is an image showing the gel electrophoresis results for the LAMP amplification product according to the example.

Referring to Figure 8, it can be seen that the amplification reaction occurs only in samples containing the gDNA of the target pathogen, so that when using the LAMP system including an improved loop primer, the gDNA of the target pathogen can be successfully amplified.

Figure 9a is an image obtained after reacting Salmonella samples of various concentrations to a sensing substrate, and Figure 9b is a graph showing the concentration of Salmonella analyzed from the image of Figure 9a.

Referring to Figures 9a and 9b, as the concentration of Salmonella increases, the number of retroreflective particles observed on the sensing substrate appears to gradually increase, and retroreflective incidence is counted from the image in Figure 8a using the Image J analysis program. As a result of calculating this concentration, a concentration value extremely similar to that of the Salmonella sample was calculated.

[Experimental Example 2]

Figure 10a is a graph showing the concentration of Salmonella calculated according to Example 2-1, and Figure 10b is a graph showing the concentration of Salmonella calculated according to Example 2-2.

Referring to FIGS. 10A and 10B, the concentration of Salmonella calculated according to Examples 2-1 and 2-2, similar to the concentration of Salmonella in the actual sample, was shown in the form of a linear graph, and the detection sensitivity (limit of detection) ) was also confirmed to be 10 CFU. Therefore, it can be seen that the molecular diagnostic method of the present invention can also be used to detect and analyze microorganisms present in actual contaminated food.

Although the present invention has been described above with reference to preferred embodiments, those skilled in the art can make various modifications and changes to the present invention without departing from the spirit and scope of the present invention as set forth in the following patent claims. You will understand that it is possible.

[Explanation of symbols]

10: Double-stranded amplicon 110: Sensing chip

120: optical probe 130: light source

Claims (13)

1. A first step of amplifying the target nucleic acid sequence to form a double-stranded amplicon consisting of a first strand modified at the end with a first small molecule compound and a second strand modified at the end with a second small molecule compound;

   A second step of reacting the double-stranded amplicon with a first reactant fixed to the substrate of the sensing chip and selectively reacting with the first small molecule compound;

   a third step of reacting an optical probe whose surface is modified with a second reactant that selectively reacts with the second small molecule compound of the amplicon reacted with the first reactant;

   a fourth step of irradiating light to the optical probe; and

   A fifth step of calculating quantitative information of the target nucleic acid sequence by analyzing the light retroreflected from the optical probe.
2. According to paragraph 1,

   The optical probe includes transparent core particles; A total reflection induction layer covering a portion of the surface of the core particle and formed of a material having a lower refractive index than the core particle in the visible light wavelength range of 360 nm to 820 nm; A modifier layer formed on the total reflection inducing layer; and a second reactant that is bound to the modifier layer and selectively reacts with the second small molecule compound.
3. According to paragraph 1,

   The double-stranded amplicon is formed by amplifying the target nucleic acid molecule through the LAMP (Loop-mediated isothermal amplification) method using four core primers and two loop primers modified at the ends with the first and second small molecule compounds, respectively. A molecular diagnostic method, characterized in that
4. According to paragraph 3,

   The four core primers are synthesized by selecting and combining six regions (F1, F2, F3, B1, B2, B3) from the target nucleic acid molecule, including a forward inner primer (FIP) and a forward outer primer. (forward outer primer, F3), backward inner primer (BIP), and backward outer primer (B3),

   The loop primer is characterized in that it includes a forward loop primer whose 5' end is modified with a first small molecule compound and a backward loop primer whose 5' end is modified with a second small molecule compound. , molecular diagnostic methods.
5. According to paragraph 3,

   The first small molecule compound and the second small molecule compound are different compounds, each of which contains FITC (fluorescein isothiocyanate), DIG (Digoxigenin), DNP (Dinitrophenyl), acrylamide, Alexa Fluor, and biotin. (Biotin), Biotin-TEG, Cholesterol, Cyanine, Desthiobiotin-TEG, DNP-TEG, GalNac (N-Acetylgalactosamine), Inosine ), PEG-2000, Puromycin, Rhodamine-6G, Texas red (C31H29N2O6S2Cl), Thymidine Glycol, FAM (Fluorescein amidite), Hex (Hexachlorofluorescein), A molecular diagnostic method comprising one selected from the group consisting of ROX (Carboxy-X-Rhodamine) and TAMRA (Tetramethylrhodamine-5-maleimide).
6. According to clause 5,

   The first small molecule compound includes one selected from the group consisting of FITC, DIG, and DNP,

   A molecular diagnostic method, wherein the first reactant includes an antibody against the first small molecule compound.
7. According to paragraph 1,

   In the fourth step, light generated from a light source that generates light mixed with light of wavelengths belonging to infrared, visible, or ultraviolet rays or a light source that generates monochromatic light of a specific wavelength is irradiated to the optical probe. Molecules, Diagnosis method.
8. In clause 7,

   A molecular diagnostic method, characterized in that, in the fifth step, quantitative information of the target nucleic acid sequence is calculated by generating an image of the light retroreflected from the optical probe and then counting the number of the optical probe therefrom.
9. Two or more different target nucleic acid molecule sequences are amplified to produce at least two different first small molecule compounds each consisting of a first strand modified at the end with one of two or more different first small molecule compounds and a second strand modified at the end with the same second small molecule compound. A first step of forming different double-stranded amplicons;

   A second step of reacting each of the amplicons with different first reactants that are fixed to the substrate of the sensing chip and each selectively reacts with the first small molecule compounds;

   A third step of reacting an optical probe whose surface is modified with a second reactant that selectively reacts with the second small molecule compound to the amplicons fixed to the sensing chip;

   a fourth step of irradiating light to the optical probe; and

   A fifth step of calculating quantitative information of target nucleic acid molecule sequences by analyzing the light retroreflected from the optical probe.
10. According to clause 8,

    The sensing chip includes two or more spatially spaced sensing areas,

    A molecular diagnostic method, characterized in that the different first reactants are each modified in the sensing regions.
11. According to clause 10,

    A molecular diagnostic method, characterized in that the sensing areas are formed inside a single fluid channel.
12. According to clause 10,

    A molecular diagnosis method, characterized in that the densities of the first reactants modified in each of the sensing regions are the same.
13. According to clause 10,

    Each of the different first small molecule compounds and the second small molecule compound includes fluorescein isothiocyanate (FITC), digoxigenin (DIG), dinitrophenyl (DNP), acrylamide, Alexa Fluor, biotin, Biotin-TEG, Cholesterol, Cyanine, Desthiobiotin-TEG, DNP-TEG, GalNac (N-Acetylgalactosamine), Inosine, PEG- 2000, Puromycin, Rhodamine-6G, Texas red, C31H29N2O6S2Cl, Thymidine Glycol, FAM (Fluorescein amidite), Hex (Hexachlorofluorescein), ROX (Carboxy- A molecular diagnostic method comprising one selected from the group consisting of X-Rhodamine) and TAMRA (Tetramethylrhodamine-5-maleimide).

Images