WO2023224153A1 - Mutant microorganisms for producing 1,3-propanediol, and method for producing 1,3-propanediol using same - Google Patents

Mutant microorganisms for producing 1,3-propanediol, and method for producing 1,3-propanediol using same Download PDF

Info

Publication number
WO2023224153A1
WO2023224153A1 PCT/KR2022/007467 KR2022007467W WO2023224153A1 WO 2023224153 A1 WO2023224153 A1 WO 2023224153A1 KR 2022007467 W KR2022007467 W KR 2022007467W WO 2023224153 A1 WO2023224153 A1 WO 2023224153A1
Authority
WO
WIPO (PCT)
Prior art keywords
propanediol
ldha
gene
mutant
deleted
Prior art date
Application number
PCT/KR2022/007467
Other languages
French (fr)
Korean (ko)
Inventor
조윤기
정성원
박병규
이준학
김지수
이브 클라렌스레이첼
Original Assignee
주식회사 엑티브온
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 엑티브온 filed Critical 주식회사 엑티브온
Publication of WO2023224153A1 publication Critical patent/WO2023224153A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C12P7/18—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic polyhydric

Definitions

  • the present invention relates to a mutant microorganism in which genes involved in the production of by-products other than 1,3-propanediol have been deleted and a method for producing 1,3-propanediol using the same.
  • 1,3-Propanediol is a compound used as a monomer to synthesize polymers such as polyether, polyurethane, and PTT (polytrimethylene terephthalate).
  • the production method of 1,3-propanediol mainly relies on chemical synthesis methods, such as hydration of acrolein and hydroformylation of ethylene oxide in the presence of phosphine. is being used. These chemical production methods have limitations because they involve high costs and environmentally harmful production processes.
  • a method for producing 1,3-propanediol using microorganisms has recently been developed. It mainly uses microorganisms such as Klebsiella, Clostridia, Enterobacter, Citrobacter, and Lactobacillus, and uses glycerol as a carbon source to produce 1 ,Produces 3-propanediol. Microorganisms have the disadvantage of producing 1,3-propanediol as a product of glycerol reduction metabolism while also producing various by-products such as lactic acid, acetic acid, ethanol, and 2,3-butanediol through glycerol oxidation metabolism.
  • the purpose of the present invention is to provide a mutant microorganism with the ability to produce 1,3-propanediol, with suppressed by-product production and increased 1,3-propanediol production.
  • the present invention aims to provide a method for producing 1,3-propanediol using the above mutant microorganism.
  • One aspect of the invention is a gene encoding lactate dehydrogenase; and a mutant microorganism having the ability to produce 1,3-propanediol in which the gene encoding one or more of isocitrate lyase and malate synthase has been deleted.
  • “Lactate dehydrogenase A” used in the present invention is an enzyme encoded by the ldhA gene and is involved in converting pyruvate into lactic acid (lactate).
  • isocitrate lyase used in the present invention is an enzyme encoded by the aceA gene, which catalyzes the reaction that decomposes isocitrate into glyoxylic acid and succinate in the glyoxylate cycle. do.
  • “Malate synthase A” used in the present invention is an enzyme encoded by the aceB gene, which carries out the reaction of glyoxylic acid produced in the glyoxylic acid cycle, acetyl-CoA, and water (H 2 O). It catalyzes the synthesis of malate.
  • deletion is a concept that encompasses the mutation, substitution, or deletion of part or all bases of a gene to prevent the protein encoded by the gene from being produced or the produced protein from exhibiting its original activity. am.
  • gene deletion blocks the reaction or pathway involved in the gene in the microorganism.
  • aceA gene and/or aceB gene are deleted along with the ldhA gene as in the present invention, glycerol oxidation metabolism is blocked, production of metabolites such as lactic acid, succinic acid, and ethanol is suppressed, and glycerol producing 1,3-propanediol.
  • metabolites such as lactic acid, succinic acid, and ethanol
  • glycerol producing 1,3-propanediol By strengthening the energy flow in reduction metabolism, the ability to produce 1,3-propanediol within microorganisms is improved.
  • the mutant microorganism may have two genes deleted, including a gene encoding lactate dehydrogenase.
  • the mutant microorganism includes a gene encoding lactate dehydrogenase; and the gene encoding isocitrate lyase is deleted, or the gene encoding lactate dehydrogenase; And the gene encoding malate synthase may be deleted.
  • lactate dehydrogenase alone is deleted.
  • the amount of 1,3-propanediol can be increased by 3 to 50%, more specifically by 5 to 30%, and the amount of by-products such as succinic acid and ethanol produced is reduced by 3 to 50%, more specifically by 5 to 30%. can do.
  • the mutant microorganism includes a gene encoding lactate dehydrogenase; A gene encoding isocitrate lyase; And the gene encoding malate synthase may be deleted.
  • the amount of 1,3-propanediol produced is 3 to 3% compared to when lactate dehydrogenase alone is deleted. It can increase by 50%, more specifically 10 to 40%, and the amount of by-products such as succinic acid, ethanol, and 2,3-butanediol can be reduced by 3 to 50%, more specifically 5 to 30%.
  • the mutant microorganism may be derived from Klebsiella pneumoniae .
  • Another aspect of the present invention includes culturing the above-described mutant microorganism in a medium; and recovering 1,3-propanediol from the mutant microorganism or the medium in which the mutant microorganism was cultured.
  • the culture can be carried out according to appropriate media and culture conditions known in the art, and a person skilled in the art can easily adjust the medium and culture conditions.
  • the medium may be a liquid medium, but is not limited thereto.
  • Cultivation methods may include, for example, batch culture, continuous culture, fed-batch culture, or combinations thereof, but are not limited thereto.
  • the medium must meet the requirements of a specific strain in an appropriate manner and can be appropriately modified by a person skilled in the art.
  • the medium may contain various carbon sources, nitrogen sources, and trace element components.
  • the carbon sources include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose, oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil, palmitic acid, stearic acid, and linoleic acid.
  • sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose
  • oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil, palmitic acid, stearic acid, and linoleic acid.
  • fatty acids such as fatty acids
  • alcohols such as glycerol and ethanol
  • organic acids such as acetic acid.
  • the nitrogen source may include peptone, yeast extract, broth, malt extract, corn steep liquor, soybean meal, urea, or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. Nitrogen sources can also be used individually or in a mixture, but are not limited thereto.
  • the source of phosphorus may include, but is not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or a corresponding sodium-containing salt.
  • the medium may contain metal salts such as magnesium sulfate or iron sulfate necessary for growth, but is not limited thereto.
  • essential growth substances such as amino acids and vitamins may be included. Additionally, precursors suitable for the medium may be used. The medium or individual components may be added to the culture medium in an appropriate manner in a batch or continuous manner during the culture process, but are not limited thereto.
  • the medium may contain glycerol as a carbon source.
  • compounds such as sodium hydroxide, ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid can be added to the microbial culture medium in an appropriate manner to adjust the pH of the culture medium.
  • ammonia may be used as a pH adjuster in the step of culturing the mutant microorganism in a medium.
  • the ammonia may contain 1 to 20% by weight, specifically 5 to 15% by weight, of the total medium.
  • foam generation can be suppressed by using an antifoaming agent such as fatty acid polyglycol ester during culture.
  • an antifoaming agent such as fatty acid polyglycol ester during culture.
  • oxygen or oxygen-containing gas e.g., air
  • the stirring speed may typically be 20 to 300 rpm, for example 120 to 250 rpm.
  • the temperature of the culture medium may typically be 20 to 45°C, for example, 25 to 40°C.
  • the culturing period may continue until the desired yield of useful substance (e.g., 1,3-propanediol) is obtained, for example, from 4 to 160 hours.
  • the step of recovering 1,3-propanediol from the cultured mutant microorganism or the medium in which the mutant microorganism was cultured is produced from the medium using a suitable method known in the art according to the culture method.
  • the 1,3-propanediol can be collected or recovered. Examples include centrifugation, filtration, extraction, nebulization, drying, evaporation, precipitation, crystallization, electrophoresis, differential dissolution (e.g. ammonium sulfate precipitation), chromatography (e.g. ion exchange, affinity, hydrophobic and Methods such as size exclusion) can be used, but are not limited to this.
  • the step of recovering 1,3-propanediol can be performed by centrifuging the culture medium at low speed to remove solid content and separating the obtained supernatant through ion exchange chromatography.
  • the step of recovering 1,3-propanediol may include a process of purifying 1,3-propanediol.
  • the mutant microorganism according to the present invention has enhanced energy flow for the reduction metabolism of glycerol, thereby suppressing the production of by-products and improving the production amount of 1,3-propanediol.
  • a Klebsiella pneumoniae strain ( ⁇ ldhA ) with a deletion of the lactate dehydrogenase ( ldhA ) gene was created.
  • the ldhA gene encoding lactate dehydrogenase present on the chromosome of Klebsiella pneumoniae MGH78578 was replaced with the antibiotic apramycin resistance gene and removed from the chromosome. did.
  • To replace the apramycin resistance gene two DNA fragments each containing approximately 900 bp of the upstream (up) and downstream (down) regions of the ldhA gene were amplified by PCR, and these two DNA fragments were separated by overlapping PCR. After linking, an aframacin resistance gene was inserted. The resulting cassette was finally introduced into Krebsiella pneumoniae MGH78578, and then a strain forming colonies was isolated on a medium containing apramycin. The obtained colonies were confirmed to have accurately undergone homologous recombination through PCR, and a strain lacking the ldhA gene ( ⁇ ldhA ) was finally obtained.
  • the primers used here are shown in Table 1 below.
  • a mutant microorganism lacking the ldhA and aceA genes ( ⁇ ldhA ⁇ aceA ) was produced using the Klebsiella pneumoniae strain ( ⁇ ldhA ) with a deletion of the ldhA gene produced in Example 1-1 as the parent strain.
  • the aceA gene was deleted through . PCR was performed on the recombined deletion strain, and the final selection was made by confirming the sequence and size of the deletion site. In addition, the plasmid introduced for gene deletion was cultured in a medium containing sucrose and cured, and the ⁇ ldhA ⁇ aceA strain was finally screened.
  • the primers used here are shown in Table 2 below.
  • a mutant microorganism lacking the ldhA and aceB genes ( ⁇ ldhA ⁇ aceB ) was produced using the Klebsiella pneumoniae strain ( ⁇ ldhA ) with a deletion of the ldhA gene produced in Example 1-1 as the parent strain.
  • PCR was performed on the recombined deletion strain, and the final selection was made by confirming the sequence and size of the deletion site.
  • the plasmid introduced for gene deletion was cultured in a medium containing sucrose and cured, and the ⁇ ldhA ⁇ aceB strain was finally screened.
  • the primers used here are shown in Table 3 below.
  • PCR was performed on the recombined deletion strain, and the final selection was made by confirming the sequence and size of the deletion site.
  • the plasmid introduced for gene deletion was cultured in a medium containing sucrose and cured, and the ⁇ ldhA ⁇ aceA ⁇ aceB strain was finally screened.
  • the primers used here are shown in Table 4 below.
  • each strain was cultured in a 5 L fermentor, Changes in 3-propanediol production and metabolites were confirmed.
  • each strain cultured on solid medium was scraped with a loop, the strain was inoculated into 30 mL of LB liquid medium, and cultured at 37°C and 200 rpm for 12 hours.
  • the strain cultured in LB liquid medium was inoculated into 300 mL of flask medium at a ratio of 10% of the culture volume and cultured at 37°C, 200 rpm, for 4 hours.
  • the strain cultured in the flask medium was inoculated into 3 L of fermentor medium, and fermentation was carried out at 37°C, 200 rpm, 40 hours while feeding to maintain the concentration of crude glycerol at 20 to 40 g/L.
  • samples were collected at intervals of 2 to 6 hours, and metabolites were analyzed using HPLC.
  • composition of the medium used here is shown in Tables 5 to 7, and the HPLC analysis conditions are shown in Table 8 below.
  • Flask medium composition (Flask) ingredient Content (g/L) Crude glycerol 36 K 2 HPO 4 10.7 KH 2 PO 4 5.024 Yeast extract One (NH 4 ) 2 SO 4 2 CaCl 2 ⁇ 2H 2 O 0.002 MgSO 4 ⁇ 7H 2 O 0.2 FeSO4 ⁇ 7H2O 0.005 Trace element solution 0.1
  • Fermentation medium composition Fermentation ingredient Content (g/L)
  • Crude glycerol 24 K 2 HPO 4 0.85 KH 2 PO 4 0.33
  • Yeast extract 0 (NH 4 ) 2 SO 4 2 CaCl 2 ⁇ 2H 2 O 0.002 MgSO 4 ⁇ 7H 2 O 0.2 FeSO4 ⁇ 7H2O 0.005 Trace element solution 0.1
  • the mutant strain in which the aceA or aceB gene was deleted along with the ldhA gene increased the production of 1,3-propanediol by about 13% and 7%, respectively, compared to the mutant strain in which only the ldhA gene was deleted, while the production of succinic acid, a by-product, increased by about 13% and 7%, respectively.
  • the amount of succinate and ethanol produced decreased.
  • mutant strain in which all ldhA , aceA , and aceB genes were deleted had a significantly increased 1,3-propanediol production of about 21% compared to the mutant strain in which only the ldhA gene was deleted, and other mutants in which ldhA and aceA , or ldhA and aceB genes were deleted Compared to the mutant strain, 1,3-propanediol production increased by about 6% and 13%, respectively.
  • mutant strain with all of the ldhA , aceA , and aceB genes deleted had a significantly reduced amount of by-product production of 2,3-butanediol as well as succinic acid and ethanol compared to the mutant strain with the ldhA gene or other genes deleted.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The present invention relates to: mutant microorganisms in which genes involved in the production of by-products other than 1,3-propanediol are deleted; and a method for producing 1,3-propanediol using same, wherein the mutant microorganisms suppress the production of by-products by enhancing the energy flow for the reduction metabolism of glycerol, and can also improve the production of 1,3-propanediol.

Description

1,3-프로판디올 생산 변이 미생물 및 이를 이용한 1,3-프로판디올의 생산 방법1,3-propanediol producing mutant microorganism and method for producing 1,3-propanediol using the same
본 발명은 1,3-프로판디올 외 부산물 생산에 관여하는 유전자를 결실시킨 변이 미생물 및 이를 이용한 1,3-프로판디올의 생산 방법에 관한 것이다.The present invention relates to a mutant microorganism in which genes involved in the production of by-products other than 1,3-propanediol have been deleted and a method for producing 1,3-propanediol using the same.
1,3-프로판디올(1,3-Propanediol)은 폴리에테르, 폴리우레탄, PTT(polytrimethylene terephthalate)와 같은 고분자를 합성하는 단량체로 사용되는 화합물이다. 1,3-프로판디올의 생산 방법은 주로 화학적인 합성 방법에 의존하며, 아크롤레인(acrolein)의 수화, 에틸렌 옥사이드(ethylene oxide)를 포스핀(phosphine) 존재 하에서 하이드로포밀화(hydroformylation)하는 등의 방법이 사용되고 있다. 이러한 화학적인 생산 방법은 고비용 및 환경유해 생산공정이 포함되어 있어 한계가 있다. 1,3-Propanediol is a compound used as a monomer to synthesize polymers such as polyether, polyurethane, and PTT (polytrimethylene terephthalate). The production method of 1,3-propanediol mainly relies on chemical synthesis methods, such as hydration of acrolein and hydroformylation of ethylene oxide in the presence of phosphine. is being used. These chemical production methods have limitations because they involve high costs and environmentally harmful production processes.
이러한 한계를 극복하기 위해, 최근에는 미생물을 이용한 1,3-프로판디올의 생산 방법이 개발되고 있다. 주로 크렙시엘라(Klebsiella), 클로스트리디아(Clostridia), 엔테로박터(Enterobacter), 시트로박터(Citrobacter), 락토바실러스(Lactobacillus) 등의 미생물을 이용하며, 탄소원으로 글리세롤(glycerol)을 사용하여 1,3-프로판디올을 생산한다. 미생물은 글리세롤 환원대사 산물로 1,3-프로판디올을 생성하는 동시에 글리세롤 산화대사를 통해 젖산, 아세트산, 에탄올, 2,3-부탄디올 등의 다양한 부산물 또한 생산한다는 단점이 있어, 미생물에서의 1,3-프로판디올 생성량을 늘리기 위해 부산물의 생성을 억제시키려는 시도가 있었다. 대표적으로는 락테이트 디하이드로게나제 유전자를 결실시킨 변이 미생물을 이용하여 젖산의 생성을 억제하면서 1,3-프로판디올의 생산량을 증가시킨 바가 있었다. 하지만 부산물 중 하나인 2,3-부탄디올 생산량 또한 증가한다는 문제점이 발생하였으며, 2,3-부탄디올 합성에 관여하는 유전자를 결실시키면 글리세롤 발효대사와 균체 증식이 저하되면서 오히려 1,3-프로판디올의 생성량이 감소하는 것으로 나타났다 (Oh et al. Appl Biochem Biotechnol 166:127-137, 2012).To overcome these limitations, a method for producing 1,3-propanediol using microorganisms has recently been developed. It mainly uses microorganisms such as Klebsiella, Clostridia, Enterobacter, Citrobacter, and Lactobacillus, and uses glycerol as a carbon source to produce 1 ,Produces 3-propanediol. Microorganisms have the disadvantage of producing 1,3-propanediol as a product of glycerol reduction metabolism while also producing various by-products such as lactic acid, acetic acid, ethanol, and 2,3-butanediol through glycerol oxidation metabolism. -Attempts were made to suppress the production of by-products in order to increase the amount of propanediol produced. For example, the production of 1,3-propanediol was increased while suppressing the production of lactic acid using a mutant microorganism with a deletion of the lactate dehydrogenase gene. However, a problem occurred in that the production of 2,3-butanediol, one of the by-products, also increased, and if the gene involved in 2,3-butanediol synthesis was deleted, glycerol fermentation metabolism and bacterial growth decreased, and the production of 1,3-propanediol instead increased. was found to decrease (Oh et al. Appl Biochem Biotechnol 166:127-137, 2012).
따라서 미생물을 이용하여 부산물 생성을 억제하면서 1.3-프로판디올 생성량을 증가시키기 위해서는 여전히 많은 연구가 필요한 실정이다.Therefore, much research is still needed to increase the amount of 1.3-propanediol produced while suppressing the production of by-products using microorganisms.
[선행기술문헌][Prior art literature]
[특허문헌][Patent Document]
미국등록특허 제8,236,994호US Patent No. 8,236,994
본 발명은 부산물 생산이 억제되고 1,3-프로판디올 생성량이 증가된, 1,3-프로판디올 생성능을 가지는 변이 미생물을 제공하는 것을 목적으로 한다.The purpose of the present invention is to provide a mutant microorganism with the ability to produce 1,3-propanediol, with suppressed by-product production and increased 1,3-propanediol production.
또한, 본 발명은 상기 변이 미생물을 이용한 1,3-프로판디올의 생산 방법을 제공하는 것을 목적으로 한다.Additionally, the present invention aims to provide a method for producing 1,3-propanediol using the above mutant microorganism.
본 발명의 일 양상은 락테이트 디하이드로게나제를 암호화하는 유전자; 및 이소시트레이트 리아제 및 말레이트 신타아제 중 하나 이상을 암호화하는 유전자가 결실된 1,3-프로판디올 생성능을 가지는 변이 미생물을 제공한다.One aspect of the invention is a gene encoding lactate dehydrogenase; and a mutant microorganism having the ability to produce 1,3-propanediol in which the gene encoding one or more of isocitrate lyase and malate synthase has been deleted.
본 발명에서 사용된 "락테이트 디하이드로게나제(lactate dehydrogenase A)"는 ldhA 유전자에 의해 암호화된 효소로, 피루베이트(pyruvate)를 젖산(lactate)으로 전환하는데 관여한다.“Lactate dehydrogenase A” used in the present invention is an enzyme encoded by the ldhA gene and is involved in converting pyruvate into lactic acid (lactate).
본 발명에서 사용된 "이소시트레이트 리아제(isocitrate lyase)"는 aceA 유전자에 의해 암호화된 효소로, 글리옥실산(glyoxylate) 회로에서 이소시트레이트를 글리옥실산과 숙신산(succinate)으로 분해하는 반응을 촉매한다.“isocitrate lyase” used in the present invention is an enzyme encoded by the aceA gene, which catalyzes the reaction that decomposes isocitrate into glyoxylic acid and succinate in the glyoxylate cycle. do.
본 발명에서 사용된 "말레이트 신타아제(malate synthase A)"는 aceB 유전자에 의해 암호화된 효소로, 글리옥실산 회로에서 생산된 글리옥실산, 아세틸-CoA 및 물(H2O)의 반응을 촉매하여 말산(malate)을 합성한다.“Malate synthase A” used in the present invention is an enzyme encoded by the aceB gene, which carries out the reaction of glyoxylic acid produced in the glyoxylic acid cycle, acetyl-CoA, and water (H 2 O). It catalyzes the synthesis of malate.
본 발명에서 사용된 "결실(deletion)"은 유전자의 일부 또는 전체 염기를 변이, 치환 또는 삭제시켜 해당 유전자가 암호화하는 단백질을 생산할 수 없거나 생산된 단백질이 본연의 활성을 나타내지 못하도록 하는 것을 포괄하는 개념이다. 본 발명에서의 유전자 결실은 미생물 내 해당 유전자가 관여하는 반응 또는 경로를 차단하게 한다.As used in the present invention, "deletion" is a concept that encompasses the mutation, substitution, or deletion of part or all bases of a gene to prevent the protein encoded by the gene from being produced or the produced protein from exhibiting its original activity. am. In the present invention, gene deletion blocks the reaction or pathway involved in the gene in the microorganism.
본 발명에서와 같이 ldhA 유전자와 함께 aceA 유전자 및/또는 aceB 유전자가 결실된 경우에는 글리세롤 산화대사가 차단되어 젖산, 숙신산, 에탄올 등의 대사산물 생산이 억제되고 1,3-프로판디올을 생산하는 글리세롤 환원대사에 에너지 흐름이 강화됨으로써 미생물 내 1,3-프로판디올 생성능이 향상된다.When the aceA gene and/or aceB gene are deleted along with the ldhA gene as in the present invention, glycerol oxidation metabolism is blocked, production of metabolites such as lactic acid, succinic acid, and ethanol is suppressed, and glycerol producing 1,3-propanediol. By strengthening the energy flow in reduction metabolism, the ability to produce 1,3-propanediol within microorganisms is improved.
본 발명의 일 구체예에 따르면, 상기 변이 미생물은 락테이트 디하이드로게나제를 암호화하는 유전자를 포함한 두 개의 유전자가 결실된 것일 수 있다.According to one embodiment of the present invention, the mutant microorganism may have two genes deleted, including a gene encoding lactate dehydrogenase.
보다 구체적으로, 상기 변이 미생물은 락테이트 디하이드로게나제를 암호화하는 유전자; 및 이소시트레이트 리아제를 암호화하는 유전자가 결실되거나, 또는 락테이트 디하이드로게나제를 암호화하는 유전자; 및 말레이트 신타아제를 암호화하는 유전자가 결실된 것일 수 있다.More specifically, the mutant microorganism includes a gene encoding lactate dehydrogenase; and the gene encoding isocitrate lyase is deleted, or the gene encoding lactate dehydrogenase; And the gene encoding malate synthase may be deleted.
이러한 락테이트 디하이드로게나제 및 이소시트레이트 리아제를 암호화하는 유전자가 결실되거나, 또는 락테이트 디하이드로게나제 및 말레이트 신타아제를 암호화하는 유전자가 결실된 경우에는 락테이트 디하이드로게나제 단독이 결실된 경우에 비해 1,3-프로판디올 생성량이 3 내지 50%, 보다 구체적으로 5 내지 30% 증가할 수 있으며, 숙신산, 에탄올 등의 부산물 생성량이 3 내지 50%, 보다 구체적으로 5 내지 30% 감소할 수 있다.If the genes encoding lactate dehydrogenase and isocitrate lyase are deleted, or if the genes encoding lactate dehydrogenase and malate synthase are deleted, lactate dehydrogenase alone is deleted. Compared to the case where 1,3-propanediol is produced, the amount of 1,3-propanediol can be increased by 3 to 50%, more specifically by 5 to 30%, and the amount of by-products such as succinic acid and ethanol produced is reduced by 3 to 50%, more specifically by 5 to 30%. can do.
또한 본 발명의 일 구체예에 따르면, 상기 변이 미생물은 락테이트 디하이드로게나제를 암호화하는 유전자; 이소시트레이트 리아제를 암호화하는 유전자; 및 말레이트 신타아제를 암호화하는 유전자가 결실된 것일 수 있다.Additionally, according to one embodiment of the present invention, the mutant microorganism includes a gene encoding lactate dehydrogenase; A gene encoding isocitrate lyase; And the gene encoding malate synthase may be deleted.
이러한 락테이트 디하이드로게나제, 이소시트레이트 리아제 및 말레이트 신타아제를 암호화하는 유전자가 모두 결실된 경우에는 락테이트 디하이드로게나제 단독이 결실된 경우에 비해 1,3-프로판디올 생성량이 3 내지 50%, 보다 구체적으로 10 내지 40% 증가할 수 있으며, 숙신산, 에탄올, 2,3-부탄디올 등의 부산물 생성량이 3 내지 50%, 보다 구체적으로 5 내지 30% 감소할 수 있다.When all of the genes encoding lactate dehydrogenase, isocitrate lyase, and malate synthase are deleted, the amount of 1,3-propanediol produced is 3 to 3% compared to when lactate dehydrogenase alone is deleted. It can increase by 50%, more specifically 10 to 40%, and the amount of by-products such as succinic acid, ethanol, and 2,3-butanediol can be reduced by 3 to 50%, more specifically 5 to 30%.
본 발명의 일 구체예에 따르면, 상기 변이 미생물은 크렙시엘라 뉴모니아(Klebsiella pneumoniae)에서 유래한 것일 수 있다.According to one embodiment of the present invention, the mutant microorganism may be derived from Klebsiella pneumoniae .
본 발명의 다른 일 양상은 전술한 변이 미생물을 배지에서 배양하는 단계; 및 상기 변이 미생물 또는 변이 미생물이 배양된 배지로부터 1,3-프로판디올을 회수하는 단계를 포함하는 1,3-프로판디올의 생산 방법을 제공한다.Another aspect of the present invention includes culturing the above-described mutant microorganism in a medium; and recovering 1,3-propanediol from the mutant microorganism or the medium in which the mutant microorganism was cultured.
상기 배양은 당업계에 알려진 적절한 배지와 배양 조건에 따라 이루어질 수 있으며, 통상의 기술자라면 배지 및 배양 조건을 용이하게 조정하여 사용할 수 있다. 구체적으로, 상기 배지는 액체 배지일 수 있으나, 이에 한정되는 것은 아니다. 배양 방법은 예를 들면, 회분식 배양(batch culture), 연속식 배양(continuous culture), 유가식 배양(fed-batch culture) 또는 이들의 조합 배양을 포함할 수 있으나, 이에 한정되는 것은 아니다.The culture can be carried out according to appropriate media and culture conditions known in the art, and a person skilled in the art can easily adjust the medium and culture conditions. Specifically, the medium may be a liquid medium, but is not limited thereto. Cultivation methods may include, for example, batch culture, continuous culture, fed-batch culture, or combinations thereof, but are not limited thereto.
본 발명의 일 구체예에 따르면, 상기 배지는 적절한 방식으로 특정 균주의 요건을 충족해야 하며, 통상의 기술자에 의해 적절하게 변형될 수 있다. According to one embodiment of the present invention, the medium must meet the requirements of a specific strain in an appropriate manner and can be appropriately modified by a person skilled in the art.
보다 구체적으로, 상기 배지는 다양한 탄소원, 질소원 및 미량원소 성분을 포함하는 것일 수 있다. 상기 탄소원으로는 글루코스, 수크로스, 락토스, 프락토스, 말토스, 전분, 셀룰로스와 같은 당 및 탄수화물, 대두유, 해바라기유, 피마자유, 코코넛유 등과 같은 오일 및 지방, 팔미트산, 스테아린산, 리놀레산과 같은 지방산, 글리세롤, 에탄올과 같은 알코올, 아세트산과 같은 유기산이 포함된다. 이들 물질은 개별적으로 또는 혼합물로 사용될 수 있으나, 이에 한정되는 것은 아니다. 상기 질소원으로는 펩톤, 효모 추출물, 육즙, 맥아 추출물, 옥수수 침지액, 대두밀 및 요소 또는 무기 화합물, 예를 들면 황산 암모늄, 염화암모늄, 인산암모늄, 탄산암모늄 및 질산암모늄이 포함될 수 있다. 질소원 또한 개별적으로 또는 혼합물로서 사용할 수 있으나, 이에 한정되는 것은 아니다. 상기 인의 공급원으로는 인산이수소칼륨 또는 인산수소이칼륨 또는 상응하는 나트륨-함유 염이 포함될 수 있으며, 이에 한정되는 것은 아니다. 또한, 배지는 성장에 필요한 황산마그네슘 또는 황산철과 같은 금속염을 함유할 수 있으며, 이에 한정되는 것은 아니다. 그 외에, 아미노산 및 비타민과 같은 필수 성장 물질이 포함될 수 있다. 또한 배지에 적절한 전구체들이 사용될 수 있다. 상기 배지 또는 개별 성분은 배양 과정에서 배양액에 적절한 방식에 의해 회분식으로 또는 연속식으로 첨가될 수 있으나, 이에 한정되는 것은 아니다.More specifically, the medium may contain various carbon sources, nitrogen sources, and trace element components. The carbon sources include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose, oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil, palmitic acid, stearic acid, and linoleic acid. These include fatty acids such as fatty acids, alcohols such as glycerol and ethanol, and organic acids such as acetic acid. These substances may be used individually or in mixtures, but are not limited thereto. The nitrogen source may include peptone, yeast extract, broth, malt extract, corn steep liquor, soybean meal, urea, or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. Nitrogen sources can also be used individually or in a mixture, but are not limited thereto. The source of phosphorus may include, but is not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or a corresponding sodium-containing salt. Additionally, the medium may contain metal salts such as magnesium sulfate or iron sulfate necessary for growth, but is not limited thereto. In addition, essential growth substances such as amino acids and vitamins may be included. Additionally, precursors suitable for the medium may be used. The medium or individual components may be added to the culture medium in an appropriate manner in a batch or continuous manner during the culture process, but are not limited thereto.
본 발명의 일 구체예에 따르면, 상기 배지는 탄소원으로 글리세롤을 포함하는 것일 수 있다.According to one embodiment of the present invention, the medium may contain glycerol as a carbon source.
또한, 배양 중에 수산화나트륨, 수산화암모늄, 수산화칼륨, 암모니아, 인산 및 황산과 같은 화합물을 미생물 배양액에 적절한 방식으로 첨가하여 배양액의 pH를 조정할 수 있다. Additionally, during cultivation, compounds such as sodium hydroxide, ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid can be added to the microbial culture medium in an appropriate manner to adjust the pH of the culture medium.
본 발명의 일 구체예에 따르면, 상기 변이 미생물을 배지에서 배양하는 단계에서, pH 조절제로 암모니아를 사용하는 것일 수 있다. 예를 들면, 상기 암모니아는 전체 배지 중 1 내지 20 중량%, 구체적으로는 5 내지 15 중량%를 포함할 수 있다. According to one embodiment of the present invention, ammonia may be used as a pH adjuster in the step of culturing the mutant microorganism in a medium. For example, the ammonia may contain 1 to 20% by weight, specifically 5 to 15% by weight, of the total medium.
또한, 배양 중에 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 추가적으로, 배양액의 호기 상태를 유지하기 위하여, 배양액 내로 산소 또는 산소-함유 기체 (예, 공기)를 주입할 수 있으며, 교반기 사용도 할 수 있다. 교반 속도는 통상 20 내지 300 rpm, 예를 들면 120 내지 250 rpm일 수 있다. 배양액의 온도는 통상 20 내지 45℃, 예를 들면 25 내지 40℃일 수 있다. 배양 기간은 유용물질 (예를 들면, 1,3-프로판디올)이 원하는 생산량으로 수득될 때까지 계속될 수 있으며, 예를 들면 4 내지 160 시간일 수 있다. Additionally, foam generation can be suppressed by using an antifoaming agent such as fatty acid polyglycol ester during culture. Additionally, in order to maintain the aerobic state of the culture medium, oxygen or oxygen-containing gas (e.g., air) can be injected into the culture medium, and a stirrer can also be used. The stirring speed may typically be 20 to 300 rpm, for example 120 to 250 rpm. The temperature of the culture medium may typically be 20 to 45°C, for example, 25 to 40°C. The culturing period may continue until the desired yield of useful substance (e.g., 1,3-propanediol) is obtained, for example, from 4 to 160 hours.
본 발명의 일 구체예에 따르면, 상기 배양된 변이 미생물 또는 변이 미생물이 배양된 배지에서 1,3-프로판디올을 회수하는 단계는 배양 방법에 따라 당해 분야에 공지된 적합한 방법을 이용하여 배지로부터 생산된 1,3-프로판디올을 수집 또는 회수할 수 있다. 예를 들면 원심분리, 여과, 추출, 분무, 건조, 증발, 침전, 결정화, 전기영동, 분별용해 (예를 들면, 암모늄 설페이트 침전), 크로마토그래피 (예를 들면, 이온 교환, 친화성, 소수성 및 크기배제) 등의 방법을 사용할 수 있으나, 이에 한정되는 것은 않는다.According to one embodiment of the present invention, the step of recovering 1,3-propanediol from the cultured mutant microorganism or the medium in which the mutant microorganism was cultured is produced from the medium using a suitable method known in the art according to the culture method. The 1,3-propanediol can be collected or recovered. Examples include centrifugation, filtration, extraction, nebulization, drying, evaporation, precipitation, crystallization, electrophoresis, differential dissolution (e.g. ammonium sulfate precipitation), chromatography (e.g. ion exchange, affinity, hydrophobic and Methods such as size exclusion) can be used, but are not limited to this.
본 발명의 일 구체예에 따르면, 1,3-프로판디올을 회수하는 단계는 배양 배지를 저속 원심분리하여 고형분을 제거하고 얻어진 상등액을 이온교환 크로마토그래피를 통하여 분리할 수 있다.According to one embodiment of the present invention, the step of recovering 1,3-propanediol can be performed by centrifuging the culture medium at low speed to remove solid content and separating the obtained supernatant through ion exchange chromatography.
본 발명의 일 구체예에 따르면, 상기 1,3-프로판디올을 회수하는 단계는 1,3-프로판디올을 정제하는 공정을 포함할 수 있다.According to one embodiment of the present invention, the step of recovering 1,3-propanediol may include a process of purifying 1,3-propanediol.
본 발명에 따른 변이 미생물은 글리세롤의 환원대사에 대한 에너지 흐름이 강화되어 부산물의 생성을 억제하는 동시에 1,3-프로판디올의 생성량을 향상시킬 수 있다.The mutant microorganism according to the present invention has enhanced energy flow for the reduction metabolism of glycerol, thereby suppressing the production of by-products and improving the production amount of 1,3-propanediol.
이하, 본 발명을 보다 상세하게 설명한다. 그러나, 이러한 설명은 본 발명의 이해를 돕기 위하여 예시적으로 제시된 것일 뿐, 본 발명의 범위가 이러한 예시적인 설명에 의하여 제한되는 것은 아니다.Hereinafter, the present invention will be described in more detail. However, this description is merely provided as an example to aid understanding of the present invention, and the scope of the present invention is not limited by this example description.
실시예 1. Example 1. ldhAldhA 및 and aceAaceA 유전자가 결손된 변이 미생물 제작 Production of mutant microorganisms with defective genes
1-1. 1-1. ldhAldhA 유전자가 결손된 변이 미생물 Mutant microorganisms with missing genes
락테이트 디하이드로게나제(Lactate dehydrogenase, ldhA) 유전자가 결실된 크렙시엘라 뉴모니아 균주 (ΔldhA)를 제작하였다. A Klebsiella pneumoniae strain (Δ ldhA ) with a deletion of the lactate dehydrogenase ( ldhA ) gene was created.
먼저, 크렙시엘라 뉴모니아(Klebsiella pneumoniae) MGH78578 (ATCC 700721)의 염색체 상에 존재하는 락테이트 디하이드로게나제를 암호화하는 ldhA 유전자를 항생제 아프라마이신(apramycin) 내성 유전자로 치환하면서 염색체상에서 제거하였다. 아프라마이신 내성 유전자로 치환하기 위해 ldhA 유전자의 상류(up) 및 하류(down) 영역의 약 900 bp씩 포함하는 2개의 DNA 단편을 각각 PCR로 증폭시키고, 이 2개의 DNA 단편을 중첩 PCR로 서로 연결한 후 아프라마아신 내성 유전자를 삽입하였다. 만들어진 카세트를 최종적으로 크렙시엘라 뉴모니아 MGH78578에 도입한 후 아프라마이신이 첨가된 배지에서 콜로니를 형성하는 균주를 분리하였다. 얻어진 콜로니는 PCR을 통해 상동재조합(homologous recombination)이 정확하게 일어났음을 확인하였으며 최종적으로 ldhA 유전자가 결손된 균주 (ΔldhA)를 확보하였다.First, the ldhA gene encoding lactate dehydrogenase present on the chromosome of Klebsiella pneumoniae MGH78578 (ATCC 700721) was replaced with the antibiotic apramycin resistance gene and removed from the chromosome. did. To replace the apramycin resistance gene, two DNA fragments each containing approximately 900 bp of the upstream (up) and downstream (down) regions of the ldhA gene were amplified by PCR, and these two DNA fragments were separated by overlapping PCR. After linking, an aframacin resistance gene was inserted. The resulting cassette was finally introduced into Krebsiella pneumoniae MGH78578, and then a strain forming colonies was isolated on a medium containing apramycin. The obtained colonies were confirmed to have accurately undergone homologous recombination through PCR, and a strain lacking the ldhA gene (Δ ldhA ) was finally obtained.
여기서 사용된 프라이머는 하기 표 1에 나타내었다.The primers used here are shown in Table 1 below.
프라이머 명칭Primer name 프라이머 서열 (5'-3')Primer sequence (5'-3') 서열번호sequence number
ldhA upldhA up F : CAGCCAGACGGGAATAGCTTF: CAGCCAGACGGGAATAGCTT 1One
R : CGCCAATTTTCTGGTGCTTCAGATATCGCCTCAAGGTCGACGTTGTTAAR: CGCCAATTTTCTGGTGCTTCAGATATCGCCTCAAGGTCGACGTTGTTAA 22
ldhA downldhA down F : TTAACAACGTCGACCTTGAGGCGATATCTGAAGCACCAGAAAATTGGCGF: TTAACAACGTCGACCTTGAGGCGATATCTGAAGCACCAGAAAATTGGCG 33
R : AGCTCGATGGTTCGGCGATTR : AGCTCGATGGTTCGGCGATT 44
1-2. 1-2. ldhAldhA 및 and aceAaceA 유전자가 결손된 변이 미생물 Mutant microorganisms with missing genes
실시예 1-1에서 제작된 ldhA 유전자가 결실된 크렙시엘라 뉴모니아 균주 (ΔldhA)를 모균주로 하여 ldhA 및 aceA 유전자가 결손된 변이 미생물 (ΔldhAΔaceA)을 제작하였다.A mutant microorganism lacking the ldhA and aceA genes (Δ ldhA Δ aceA ) was produced using the Klebsiella pneumoniae strain (Δ ldhA ) with a deletion of the ldhA gene produced in Example 1-1 as the parent strain.
우선, ldhA 유전자가 결실된 크렙시엘라 뉴모니아 균주 (ΔldhA)의 aceA 유전자의 상류 및 하류 영역의 500 bp씩 포함하는 2개의 DNA 단편을 각각 PCR로 증폭시키고, 이 2개의 DNA 단편을 중첩 PCR로 서로 연결하였다. 이어서 중첩된 단편을 NotI 및 XbalI 또는 BamHI 제한 자리를 이용해 Pkov 벡터 (Addgene, Cat No. 25769)에 클로닝하였다. 이후 생성된 플라스미드로 ΔldhA 균주를 형질전환한 후 클로람페니콜(chloramphenicol)을 항생제 마커로 사용하여 스크리닝하였고, 30℃에서의 밤새(overnight) 배양과 42℃에서 12시간의 배양을 순차적으로 진행함으로써 상동재조합을 통한 aceA 유전자 결실을 진행하였다. 이렇게 재조합된 결실 균주에 대해 PCR을 실시하여 결실부위의 서열 및 사이즈 확인을 통해 최종 선정하였다. 또한 유전자 결실을 위해 도입된 플라스미드는 수크로스(sucrose)가 포함된 배지에 배양하여 큐어링(curing)하여, 최종적으로 ΔldhAΔaceA 균주를 스크리닝하였다. First, two DNA fragments each containing 500 bp of the upstream and downstream regions of the aceA gene of the Krebsiella pneumoniae strain (Δ ldhA ) with the ldhA gene deleted were amplified by PCR, and these two DNA fragments were overlapped. They were linked together by PCR. The overlapping fragment was then cloned into the Pkov vector (Addgene, Cat No. 25769) using NotI and XbalI or BamHI restriction sites. After transforming the Δ ldhA strain with the generated plasmid, it was screened using chloramphenicol as an antibiotic marker, and homologous recombination was achieved by sequentially cultivating overnight at 30°C and culturing for 12 hours at 42°C. The aceA gene was deleted through . PCR was performed on the recombined deletion strain, and the final selection was made by confirming the sequence and size of the deletion site. In addition, the plasmid introduced for gene deletion was cultured in a medium containing sucrose and cured, and the Δ ldhA Δ aceA strain was finally screened.
여기서 사용된 프라이머는 하기 표 2에 나타내었다.The primers used here are shown in Table 2 below.
프라이머 명칭Primer name 프라이머 서열 (5'-3')Primer sequence (5'-3') 서열번호sequence number
aceAaceA F: ATGGAGCATCTGCACATGAAF:ATGGAGCATCTGCACATGAA 55
R: TTAAAACTGATCTTCTTCGGR: TTAAAACTGATCTTCTTCGG 66
실시예 2. Example 2. ldhAldhA 및 and aceBaceB 유전자가 결손된 변이 미생물 제작 Production of mutant microorganisms with defective genes
실시예 1-1에서 제작된 ldhA 유전자가 결실된 크렙시엘라 뉴모니아 균주 (ΔldhA)를 모균주로 하여 ldhA 및 aceB 유전자가 결손된 변이 미생물 (ΔldhAΔaceB)을 제작하였다.A mutant microorganism lacking the ldhA and aceB genes (Δ ldhA Δ aceB ) was produced using the Klebsiella pneumoniae strain (Δ ldhA ) with a deletion of the ldhA gene produced in Example 1-1 as the parent strain.
우선, ldhA 유전자가 결실된 크렙시엘라 뉴모니아 균주 (ΔldhA)의 aceB 유전자의 상류 및 하류 영역의 500 bp씩 포함하는 2개의 DNA 단편을 각각 PCR로 증폭시키고, 이 2개의 DNA 단편을 중첩 PCR로 서로 연결하였다. 이어서 중첩된 단편을 NotI 및 XbalI 또는 BamHI 제한 자리를 이용해 pKOV 벡터에 클로닝하였다. 이후 생성된 플라스미드로 ΔldhA 균주를 형질전환한 후 항생제 마커를 이용하여 스크리닝하였고, 30℃에서의 밤새 배양과 42℃에서 12시간의 배양을 순차적으로 진행함으로써 상동재조합을 통한 aceB 유전자 결실을 진행하였다. 이렇게 재조합된 결실 균주에 대해 PCR을 실시하여 결실부위의 서열 및 사이즈 확인을 통해 최종 선정하였다. 또한 유전자 결실을 위해 도입된 플라스미드는 수크로스(sucrose)가 포함된 배지에 배양하여 큐어링(curing)하여, 최종적으로 ΔldhAΔaceB 균주를 스크리닝하였다. First, two DNA fragments each containing 500 bp of the upstream and downstream regions of the aceB gene of the Krebsiella pneumoniae strain (Δ ldhA ) with the ldhA gene deleted were amplified by PCR, and these two DNA fragments were overlapped. They were linked together by PCR. The overlapping fragments were then cloned into the pKOV vector using NotI and XbalI or BamHI restriction sites. Afterwards, the Δ ldhA strain was transformed with the generated plasmid and screened using an antibiotic marker. The aceB gene was deleted through homologous recombination by sequentially cultivating overnight at 30°C and culturing at 42°C for 12 hours. . PCR was performed on the recombined deletion strain, and the final selection was made by confirming the sequence and size of the deletion site. In addition, the plasmid introduced for gene deletion was cultured in a medium containing sucrose and cured, and the Δ ldhA Δ aceB strain was finally screened.
여기서 사용된 프라이머는 하기 표 3에 나타내었다.The primers used here are shown in Table 3 below.
프라이머 명칭Primer name 프라이머 서열 (5'-3')Primer sequence (5'-3') 서열번호sequence number
aceBaceB F: ATGACGCAGCAGGCGACAATF: ATGACGCAGCAGGCGACAAT 77
R: TTAGGCCAGCAGGCGGTAGCR: TTAGGCCAGCAGGCGGTAGC 88
실시예 3. Example 3. ldhAldhA , , aceAaceA 및 and aceBaceB 유전자가 결손된 변이 미생물 제작 Production of mutant microorganisms with defective genes
실시예 1-2에서 제작된 ldhA 및 ldhA 유전자가 결실된 크렙시엘라 뉴모니아 균주 (ΔldhAΔaceA)를 모균주로 하여 ldhA, aceA 및 aceB 유전자가 결손된 변이 미생물 (ΔldhAΔaceAΔaceB)을 제작하였다. Using the Klebsiella pneumoniae strain (Δ ldhA Δ aceA ) with deletion of the ldhA and ldhA genes produced in Example 1-2 as the parent strain, a mutant microorganism with deletion of the ldhA , aceA and aceB genes (Δ ldhA Δ aceA Δ aceB ) was produced.
우선, ΔldhAΔaceA 균주의 aceB 유전자의 상류 및 하류 영역의 500 bp씩 포함하는 2개의 DNA 단편을 각각 PCR로 증폭시키고, 이 2개의 DNA 단편을 중첩 PCR로 서로 연결하였다. 이어서 중첩된 단편을 NotI 및 XbalI 또는 BamHI 제한 자리를 이용해 pKOV 벡터에 클로닝하였다. 이후 생성된 플라스미드로 ΔldhAΔaceA 균주를 형질전환한 후 항생제 마커를 이용하여 스크리닝하였고, 30℃에서의 밤새 배양과 42℃에서 12시간의 배양을 순차적으로 진행함으로써 상동재조합을 통한 aceB 유전자 결실을 진행하였다. 이렇게 재조합된 결실 균주에 대해 PCR을 실시하여 결실부위의 서열 및 사이즈 확인을 통해 최종 선정하였다. 또한 유전자 결실을 위해 도입된 플라스미드는 수크로스(sucrose)가 포함된 배지에 배양하여 큐어링(curing)하여, 최종적으로 ΔldhAΔaceAΔaceB 균주를 스크리닝하였다. First, two DNA fragments each containing 500 bp of the upstream and downstream regions of the aceB gene of the Δ ldhA Δ aceA strain were amplified by PCR, and these two DNA fragments were linked together by overlapping PCR. The overlapping fragments were then cloned into the pKOV vector using NotI and XbalI or BamHI restriction sites. Afterwards, the Δ ldhA Δ aceA strain was transformed with the generated plasmid and screened using an antibiotic marker. The aceB gene was deleted through homologous recombination by sequentially cultivating overnight at 30°C and culturing at 42°C for 12 hours. proceeded. PCR was performed on the recombined deletion strain, and the final selection was made by confirming the sequence and size of the deletion site. In addition, the plasmid introduced for gene deletion was cultured in a medium containing sucrose and cured, and the Δ ldhA Δ aceA Δ aceB strain was finally screened.
여기서 사용된 프라이머는 하기 표 4에 나타내었다.The primers used here are shown in Table 4 below.
프라이머 명칭Primer name 프라이머 서열 (5'-3')Primer sequence (5'-3') 서열번호sequence number
aceBaceB F: ATGACGCAGCAGGCGACAATF: ATGACGCAGCAGGCGACAAT 77
R: TTAGGCCAGCAGGCGGTAGCR: TTAGGCCAGCAGGCGGTAGC 88
실험예 1. 변이 미생물의 대사산물 생산능 측정Experimental Example 1. Measurement of metabolite production ability of mutant microorganisms
실시예 1 내지 3에서 제작된 변이 미생물 ΔldhA, ΔldhAΔaceA, ΔldhAΔaceB 및 ΔldhAΔaceAΔaceB의 대사산물 생산능을 측정하기 위해, 5 L 발효기에서 각 균주를 배양하여 1,3-프로판디올 생산 및 대사산물의 변화를 확인하였다. To measure the metabolite production ability of the mutant microorganisms Δ ldhA , Δ ldhA Δ aceA , Δ ldhA Δ aceB , and Δ ldhA Δ aceA Δ aceB prepared in Examples 1 to 3, each strain was cultured in a 5 L fermentor, Changes in 3-propanediol production and metabolites were confirmed.
균주 배양은 고체배지 (LB Agar)에 배양한 각 균주를 루프(loop)로 긁어서 30 mL의 LB 액체배지에 균주를 접종하고 37℃, 200 rpm에서 12 시간 동안 배양하였다. LB 액체배지에서 배양된 균주를 배양 부피의 10% 비율로 300 mL의 플라스크 배지에 접종하고 37℃, 200 rpm, 4시간 동안 배양을 진행한다. 이후 플라스크 배지에 배양된 균주를 3 L의 발효기 배지에 접종하고, crude glycerol의 농도가 20 ~ 40 g/L를 유지하도록 피딩(feeding)을 하면서 37℃, 200 rpm, 40시간 발효를 진행하였다. 발효 진행중에 2 ~ 6시간 간격으로 샘플을 채취하여 대사산물을 HPLC를 이용하여 분석하였다.For strain culture, each strain cultured on solid medium (LB Agar) was scraped with a loop, the strain was inoculated into 30 mL of LB liquid medium, and cultured at 37°C and 200 rpm for 12 hours. The strain cultured in LB liquid medium was inoculated into 300 mL of flask medium at a ratio of 10% of the culture volume and cultured at 37°C, 200 rpm, for 4 hours. Afterwards, the strain cultured in the flask medium was inoculated into 3 L of fermentor medium, and fermentation was carried out at 37°C, 200 rpm, 40 hours while feeding to maintain the concentration of crude glycerol at 20 to 40 g/L. During fermentation, samples were collected at intervals of 2 to 6 hours, and metabolites were analyzed using HPLC.
여기서 사용된 배지의 조성은 하기 표 5 내지 7에 나타내었으며, HPLC 분석 조건은 하기 표 8에 나타내었다.The composition of the medium used here is shown in Tables 5 to 7, and the HPLC analysis conditions are shown in Table 8 below.
미량 원소 용액(Trace element solution)Trace element solution
성분ingredient 함량content
ZnCl2 ZnCl 2 0.07 g (70 mg/L)0.07 g (70 mg/L)
MnCl2·4H2O MnCl 2 ·4H 2 O 0.1 g (100 mg/L)0.1 g (100 mg/L)
H3BO3 H3BO3 _ 0.6 g (60 mg/L)0.6 g (60 mg/L)
CoCl2·6H2O CoCl 2 ·6H 2 O 2 g (200 mg/L)2 g (200 mg/L)
CuCl2·2H2OCuCl 2 ·2H 2 O 0.02 g (20 mg/L)0.02 g (20 mg/L)
NiCl2·6H2ONiCl 2 ·6H 2 O 0.025 g (25 mg/L)0.025 g (25 mg/L)
Na2MoO4·2H2O Na 2 MoO 4 ·2H 2 O 0.35 g (35 mg/L)0.35 g (35 mg/L)
HCl (37%)HCl (37%) 4 mL4mL
정제수Purified water to 1,000 mLto 1,000 mL
플라스크 배지 조성 (Flask)Flask medium composition (Flask)
성분ingredient 함량 (g/L)Content (g/L)
Crude glycerolCrude glycerol 3636
K2HPO4 K 2 HPO 4 10.710.7
KH2PO4 KH 2 PO 4 5.0245.024
Yeast extractYeast extract 1One
(NH4)2SO4 (NH 4 ) 2 SO 4 22
CaCl2·2H2OCaCl 2 ·2H 2 O 0.0020.002
MgSO4·7H2OMgSO 4 ·7H 2 O 0.20.2
FeSO4·7H2O FeSO4 · 7H2O 0.0050.005
Trace element solutionTrace element solution 0.10.1
발효기 배지 조성 (Fermentation)Fermentation medium composition (Fermentation)
성분ingredient 함량 (g/L)Content (g/L)
Crude glycerolCrude glycerol 2424
K2HPO4 K 2 HPO 4 0.850.85
KH2PO4 KH 2 PO 4 0.330.33
Yeast extractYeast extract 00
(NH4)2SO4 (NH 4 ) 2 SO 4 22
CaCl2·2H2OCaCl 2 ·2H 2 O 0.0020.002
MgSO4·7H2OMgSO 4 ·7H 2 O 0.20.2
FeSO4·7H2O FeSO4 · 7H2O 0.0050.005
Trace element solutionTrace element solution 0.10.1
HPLC 분석 조건HPLC analysis conditions
분석장치analysis device Agilent 1260 HPLC (Bio-rad 87H) (Column 300 x 7.8 mm)Agilent 1260 HPLC (Bio-rad 87H) (Column 300 x 7.8 mm)
이동상mobile phase 5 mM H2SO4 solution5mM H 2 SO 4 solution
유량flux 0.6 ml/min0.6ml/min
또한, 각 균주의 대사산물 생성량은 하기 표 9에 나타내었다.Additionally, the amount of metabolites produced by each strain is shown in Table 9 below.
ΔldhA ΔldhA ΔldhAΔaceA Δ ldhA Δ aceA ΔldhAΔaceB Δ ldhA Δ aceB ΔldhAΔaceAΔaceB Δ ldhA Δ aceA Δ aceB
Glycerol consumed (g/L)Glycerol consumed (g/L) 126.63126.63 126.61126.61 126.13126.13 125.23125.23
Cell growth (OD600)Cell growth (OD 600 ) 18.9018.90 16.5116.51 17.0017.00 15.6015.60
1,3-Propanediol (g/L)1,3-Propanediol (g/L) 38.3338.33 43.4543.45 41.0541.05 46.3446.34
2,3-Butanediol (g/L)2,3-Butanediol (g/L) 13.5113.51 14.8414.84 14.6214.62 12.6012.60
Lactate (g/L)Lactate (g/L) 00 00 00 00
Succinate (g/L)Succinate (g/L) 4.694.69 2.452.45 4.444.44 1.781.78
Ethanol (g/L)Ethanol (g/L) 9.379.37 7.237.23 6.826.82 6.796.79
상기 표 8에 나타낸 바와 같이, ldhA 유전자와 함께 aceA 또는 aceB 유전자가 결실된 변이주는 ldhA 유전자만 결실된 변이주에 비해 1,3-프로판디올 생성량이 각각 약 13% 및 7% 증가한 반면, 부산물인 숙신산(succinate) 및 에탄올(ethanol)의 생성량이 감소하였다. As shown in Table 8, the mutant strain in which the aceA or aceB gene was deleted along with the ldhA gene increased the production of 1,3-propanediol by about 13% and 7%, respectively, compared to the mutant strain in which only the ldhA gene was deleted, while the production of succinic acid, a by-product, increased by about 13% and 7%, respectively. The amount of succinate and ethanol produced decreased.
또한 ldhA, aceA 및 aceB 유전자가 모두 결실된 변이주는 ldhA 유전자만 결실된 변이주에 비해 1,3-프로판디올 생성량이 약 21%로 현저히 증가하였고, ldhA 및 aceA, 또는 ldhA 및 aceB 유전자가 결실된 다른 변이주에 비해서도 1,3-프로판디올 생성량이 각각 약 6% 및 13% 증가하였다. 그리고 ldhA, aceA 및 aceB 유전자가 모두 결실된 변이주는 ldhA 유전자 또는 이와 다른 유전자가 결실된 변이주에 비해 숙신산 및 에탄올뿐만 아니라 2,3-부탄디올(2,3-butanediol)의 부산물 생성량이 현저히 감소하였다.In addition, the mutant strain in which all ldhA , aceA , and aceB genes were deleted had a significantly increased 1,3-propanediol production of about 21% compared to the mutant strain in which only the ldhA gene was deleted, and other mutants in which ldhA and aceA , or ldhA and aceB genes were deleted Compared to the mutant strain, 1,3-propanediol production increased by about 6% and 13%, respectively. And the mutant strain with all of the ldhA , aceA , and aceB genes deleted had a significantly reduced amount of by-product production of 2,3-butanediol as well as succinic acid and ethanol compared to the mutant strain with the ldhA gene or other genes deleted.
이제까지 본 발명에 대하여 그 바람직한 실시예들을 중심으로 살펴보았다. 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자는 본 발명이 본 발명의 본질적인 특성에서 벗어나지 않는 범위에서 변형된 형태로 구현될 수 있음을 이해할 수 있을 것이다. 그러므로 개시된 실시예들은 한정적인 관점이 아니라 설명적인 관점에서 고려되어야 한다. 본 발명의 범위는 전술한 설명이 아니라 특허청구범위에 나타나 있으며, 그와 동등한 범위 내에 있는 모든 차이점은 본 발명에 포함된 것으로 해석되어야 할 것이다.So far, the present invention has been examined focusing on its preferred embodiments. A person skilled in the art to which the present invention pertains will understand that the present invention may be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered from an illustrative rather than a restrictive perspective. The scope of the present invention is indicated in the claims rather than the foregoing description, and all differences within the equivalent scope should be construed as being included in the present invention.

Claims (7)

  1. 락테이트 디하이드로게나제를 암호화하는 유전자; 및A gene encoding lactate dehydrogenase; and
    이소시트레이트 리아제 및 말레이트 신타아제 중 하나 이상을 암호화하는 유전자가 결실된 1,3-프로판디올 생성능을 가지는 변이 미생물.A mutant microorganism with the ability to produce 1,3-propanediol in which the gene encoding one or more of isocitrate lyase and malate synthase has been deleted.
  2. 청구항 1에 있어서,In claim 1,
    상기 변이 미생물은 락테이트 디하이드로게나제를 암호화하는 유전자; 및 이소시트레이트 리아제를 암호화하는 유전자가 결실된 것인 변이 미생물.The mutant microorganism includes a gene encoding lactate dehydrogenase; and mutant microorganisms in which the gene encoding isocitrate lyase has been deleted.
  3. 청구항 1에 있어서,In claim 1,
    상기 변이 미생물은 락테이트 디하이드로게나제를 암호화하는 유전자; 및 말레이트 신타아제를 암호화하는 유전자가 결실된 것인 변이 미생물.The mutant microorganism includes a gene encoding lactate dehydrogenase; and mutant microorganisms in which the gene encoding malate synthase has been deleted.
  4. 청구항 1에 있어서,In claim 1,
    상기 변이 미생물은 락테이트 디하이드로게나제를 암호화하는 유전자; 이소시트레이트 리아제를 암호화하는 유전자; 및 말레이트 신타아제를 암호화하는 유전자가 결실된 것인 변이 미생물.The mutant microorganism includes a gene encoding lactate dehydrogenase; A gene encoding isocitrate lyase; and mutant microorganisms in which the gene encoding malate synthase has been deleted.
  5. 청구항 1에 있어서,In claim 1,
    상기 변이 미생물은 크렙시엘라 뉴모니아(Klebsiella pneumoniae)인 것인 변이 미생물.The mutant microorganism is Klebsiella pneumoniae .
  6. 청구항 1 내지 5 중 어느 한 항의 변이 미생물을 배지에서 배양하는 단계; 및Culturing the mutant microorganism of any one of claims 1 to 5 in a medium; and
    상기 변이 미생물 또는 변이 미생물이 배양된 배지로부터 1,3-프로판디올을 회수하는 단계를 포함하는 1,3-프로판디올의 생산 방법.A method for producing 1,3-propanediol comprising the step of recovering 1,3-propanediol from the mutant microorganism or the medium in which the mutant microorganism was cultured.
  7. 청구항 6에 있어서,In claim 6,
    상기 배지는 글리세롤을 포함하는 것인 방법.A method wherein the medium contains glycerol.
PCT/KR2022/007467 2022-05-17 2022-05-26 Mutant microorganisms for producing 1,3-propanediol, and method for producing 1,3-propanediol using same WO2023224153A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2022-0060348 2022-05-17
KR1020220060348A KR102558672B1 (en) 2022-05-17 2022-05-17 Mutant microorganism producing 1,3-propanediol and method for preparing 1,3-propanediol using the same

Publications (1)

Publication Number Publication Date
WO2023224153A1 true WO2023224153A1 (en) 2023-11-23

Family

ID=87428499

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/007467 WO2023224153A1 (en) 2022-05-17 2022-05-26 Mutant microorganisms for producing 1,3-propanediol, and method for producing 1,3-propanediol using same

Country Status (2)

Country Link
KR (2) KR102558672B1 (en)
WO (1) WO2023224153A1 (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013012293A2 (en) * 2011-07-21 2013-01-24 한국생명공학연구원 Method for preparing diol compound at high yield using glycerol fermentation microorganism variant
KR20140058206A (en) * 2012-11-06 2014-05-14 한국생명공학연구원 Microorganism variants having co-producing ability of 1,3-propanediol and isobutanol using glycerol or crude glycerol and method for co-producing 1,3-propanediol and isobutanol using the same
KR20190025969A (en) * 2016-07-08 2019-03-12 메타볼릭 익스플로러 A method for the fermentative production of a molecule of interest by a microorganism comprising a gene encoding a sugar phosphotransferase system (PTS)

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2233562A1 (en) * 2009-03-24 2010-09-29 Metabolic Explorer Method for producing high amount of glycolic acid by fermentation

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013012293A2 (en) * 2011-07-21 2013-01-24 한국생명공학연구원 Method for preparing diol compound at high yield using glycerol fermentation microorganism variant
KR20140058206A (en) * 2012-11-06 2014-05-14 한국생명공학연구원 Microorganism variants having co-producing ability of 1,3-propanediol and isobutanol using glycerol or crude glycerol and method for co-producing 1,3-propanediol and isobutanol using the same
KR20190025969A (en) * 2016-07-08 2019-03-12 메타볼릭 익스플로러 A method for the fermentative production of a molecule of interest by a microorganism comprising a gene encoding a sugar phosphotransferase system (PTS)

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
CHEN LIFEI; MA CHUNLING; WANG RUIMING; YANG JIANLOU; ZHENG HAIJIE: "Deletion ofldhA andaldH genes inKlebsiellapneumoniaeto enhance 1,3-propanediol production", BIOTECHNOLOGY LETTERS, KLUWER ACADEMIC PUBLISHERS, DORDRECHT, vol. 38, no. 10, 24 June 2016 (2016-06-24), Dordrecht , pages 1769 - 1774, XP036050612, ISSN: 0141-5492, DOI: 10.1007/s10529-016-2155-7 *
WANG WEIJIAN, YU XIAO, WEI YONGJUN, LEDESMA-AMARO RODRIGO, JI XIAO-JUN: "Reprogramming the metabolism of Klebsiella pneumoniae for efficient 1,3-propanediol production", CHEMICAL ENGINEERING SCIENCE, OXFORD, GB, vol. 236, 1 June 2021 (2021-06-01), GB , pages 116539, XP093110868, ISSN: 0009-2509, DOI: 10.1016/j.ces.2021.116539 *

Also Published As

Publication number Publication date
KR102558673B1 (en) 2023-07-25
KR102558672B1 (en) 2023-07-25

Similar Documents

Publication Publication Date Title
US10494600B2 (en) Bacteria and methods of use thereof
WO2017034343A1 (en) Microorganism having l-leucine productivity, and method for preparing l-leucine using same
US20060211095A1 (en) Process for the fermentative production of S-adenosylmethionine
WO2011115439A2 (en) Microorganism with improved production of 5'-xanthosine monophosphate and 5'-guanine monophosphate, and production method of 5'-xanthosine monophosphate and 5'-guanine monophosphate using same
WO2011052819A1 (en) Novel method for producing 3-hydroxypropionic acid from glycerol
CN105154381A (en) Novel mutant microorganism producing succinic acid simultaneously using sucrose and glycerol, and method for preparing succinic acid using same
WO2020251290A1 (en) Mutant strain overproducing taps and taps production method using same
EP3978603A1 (en) A butyric acid-producing bacillus subtilis strain, method of construction and application thereof
KR100864672B1 (en) A method for producing a 1,2-propanediol using Klebsiella pneumoniae
WO2011149248A2 (en) Method for preparing 3-hydroxypropionic acid from glycerol in high yield
CN113564190A (en) High-yield riboflavin escherichia coli engineering strain and construction method thereof
WO2010071367A2 (en) A corynebacteria strain having enhanced 5'-xanthosine monophosphate productivity and a method of producing 5'-xanthosine monophosphate using the same
WO2023224153A1 (en) Mutant microorganisms for producing 1,3-propanediol, and method for producing 1,3-propanediol using same
WO2017069567A1 (en) Recombinant microorganism for producing l-threonine and method for producing l-threonine by using same
WO2013012293A2 (en) Method for preparing diol compound at high yield using glycerol fermentation microorganism variant
WO2021201489A1 (en) Recombinant vector for transformation improving glutamine productivity, and strain employing same
CN115927513A (en) Method for preparing beta-nicotinamide mononucleotide by using biological enzyme
WO2012008810A2 (en) Microorganism with enhanced l-lysine productivity and method for producing l-lysine using the same
CN103820506A (en) Method for producing coenzyme Q10 by fermenting genetic recombinant bacteria
WO2015126112A1 (en) Method for producing 1,3-propanediol using microorganism variant with deletion of 2,3-butanediol synthetic gene
WO2014171635A1 (en) Novel d-sorbitol dehydrogenase and method for producing l-sorbose using same
WO2023106543A1 (en) Corynebacterium glutamicum variant having improved l-lysine production ability and method for producing l-lysine by using same
WO2017065457A1 (en) Microorganism having l-threonine producing ability, and method for producing l-threonine using same
EP3119874B1 (en) Microorganisms having enhanced l-amino acids productivity and process for producing l-amino acids using the same
WO2023136421A1 (en) Mutant in escherichia having enhanced l-histidine productivity and method for producing l-histidine using same

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22942817

Country of ref document: EP

Kind code of ref document: A1