WO2023223183A1

WO2023223183A1 - Picornaviral vectors for gene editing

Info

Publication number: WO2023223183A1
Application number: PCT/IB2023/054994
Authority: WO
Inventors: Seshidhar Reddy Police; Kyungah MAENG; Volker Sandig; Alexander Karlas; Sven KRÜGENER; Deborah Horn
Original assignee: Crispr Therapeutics Ag; Probiogen Ag
Priority date: 2022-05-16
Filing date: 2023-05-15
Publication date: 2023-11-23

Abstract

The present disclosure relates to picornaviral vectors, methods and kits used in the production of a gutless picornavirus particle. In some embodiments, the gutless picornavirus particle comprises a mRNA encoding a heterologous polypeptide (e.g., a Cas protein) encapsulated in a picornavirus capsid.

Description

PICORNAVIRAL VECTORS FOR GENE EDITING

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Patent Application No. 63/342,317, filed May 16, 2022, the content of which is incorporated herein by reference in its entirety for all purposes.

REFERENCE TO SEQUENCE LISTING

[0002] The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled 80EM-341704-WO_SeqList, created May 11, 2023, which is 141 kilobytes in size. The information in the electronic format of the Sequence Listing is incorporated herein by reference in its entirety.

BACKGROUND

Field

[0003] The present disclosure generally relates to the field of molecular biology and biotechnology, including producing viral vectors.

Description of the Related Art

[0004] The targeting of DNA using the RNA-guided, DNA-targeting principle of CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-Cas (CRISPR associated) systems has been widely used. CRISPR-Cas systems can be divided in two classes, with class 1 systems utilizing a complex of multiple Cas proteins (such as type I, III, and IV CRISPR-Cas systems) and class 2 systems utilizing a single Cas protein (such as type II, V, and VI CRISPR- Cas systems). Type II CRISPR-Cas-based systems have been used for genome editing, and require a Cas polypeptide or variant thereof guided by a customizable guide RNA (gRNA) for programmable DNA targeting.

[0005] There is a need for a safe and effective viral vector system for ex vivo and in vivo gene editing such as a viral delivery system allowing transient expression of Cas protein.

SUMMARY

[0006] Disclosed herein include compositions and kits for a viral delivery system, as well as methods of making and using the compositions and kits.

[0007] Disclosed herein include a nucleic acid construct. The nucleic acid construct, in some embodiments, comprises a picornaviral 5’ untranslated region (UTR) comprising a cloverleaf-like structure; a coding sequence for a heterologous polypeptide; a cis-acting replication element (CRE) or variant thereof; and a picornaviral 3’ UTR. In some embodiments, the nucleic acid construct comprises a sequence encoding a ribozyme. In some embodiments, the nucleic acid construct does not comprise coding sequence for at least one picornavirus protein. In some embodiments, the nucleic acid construct does not comprise coding sequence for any picornavirus protein. The nucleic acid construct can comprise one or more stuffer sequences, for example at least one of the one or more stuffer sequences at 3’ of the coding sequence for the heterologous polypeptide.

[0008] In some embodiments, the picornaviral 5’ UTR, the picornaviral 3’ UTR, or both, are derived from a coxsackievirus, poliovirus, echovirus, rhinovirus, or enterovirus. In some embodiments, the picornaviral 5’ UTR, the picornaviral 3’ UTR, or both, are derived from Seneca Valley Virus (SVV). The CRE or variant thereof can, for example, comprise a sequence having at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to the sequence of SEQ ID NO: 20 or SEQ ID NO: 21. In some embodiments, the nucleic acid construct comprises an internal ribosome entry site (IRES), a 3’ psudoknot, or a combination thereof.

[0009] In some embodiments, the heterologous polypeptide is a RNA-guided DNA endonuclease. The RNA-guided DNA endonuclease can be or comprise, for example, Cas3, Cas8a, Cas5, Cas8b, Cas8c, CaslOd, Csel, Cse2, Csyl, Csy2, Csy3, GSU0054, CaslO, Csm2, Cmr5, CaslO, Csxl l, CsxlO, Csfl, Cas9, Csn2, Cas4, Casl2, Casl2a, Cpfl, Casl2b, C2cl, Casl2c, C2c3, Casl2d, CasY, Casl2e, CasX, Casl2f, Casl4, C2cl0, Casl2g, Casl2h, Casl2i, Casl2k, C2c5, C2c4, C2c8, C2c9, Casl3, Casl3a, C2c2, Casl3b, Casl3c, or Casl3d. In some embodiments, the RNA-guided DNA endonuclease comprises or is a Cas polypeptide or a variant thereof. The Cas polypeptide can be, for example Cas9 (e.g., dCas9). In some embodiments, the heterologous polypeptide is or comprises a base editor. The base editor can be, for example, a cytosine base editor, an adenine base editor, or a dual-deaminase editor.

[0010] The nucleic acid construct can be, for example, a DNA construct. In some embodiments, the nucleic acid construct comprises a promoter operably linked to the coding sequence for the heterologous polypeptide. In some embodiments, the promoter is not derived from a picornavirus. In some embodiments, the nucleic acid construct is a plasmid. The promoter can be, for example, a T7 promoter, cytomegalovirus (CMV) promoter, chicken beta-actin (CAG) promoter, ubiquitin C (UBC) promoter, or any variant thereof. The promoter and the coding sequence for the heterologous polypeptide can be located, for example, between the 3’ pseudoknot and the CRE or variant thereof. In some embodiments, the promoter and the coding sequence for the heterologous polypeptide are located between the IRES at its 5’ and the 3’ pseudoknot.

[0011] Provided herein include a nucleic acid construct. In some embodiments, the nucleic acid construct comprises: a sequence that encodes for one or more Seneca Valley Virus (SVV) proteins; an inactivated picornaviral 5’ cloverleaf-like structure and/or an inactivated picornaviral cis-acting replication element (CRE), or does not comprises a 5’ cloverleaf-like structure and/or a CRE or variant thereof; and a picornaviral 3’ UTR. The nucleic acid can comprise a sequence encoding a ribozyme. In some embodiments, the nucleic acid construct comprises an inactivated 5’ cloverleaf-like structure and an inactivated CRE. In some embodiments, the nucleic acid construct does not comprise any 5’ cloverleaf-like structure and any CRE. The sequence, in some embodiments, encodes for one or more of SVV VP1, VP2, VP3, VP4, 2A, 2B, 2C, 3A, 3B, 3C, and 3D proteins. In some embodiments, the sequence encodes for SVV polyprotein. In some embodiments, the nucleic acid construct does not comprise SVV packaging signal sequence. In some embodiments, the nucleic acid construct comprises an internal ribosome entry site (IRES), a 3’ pseudoknot, or a combination thereof.

[0012] The nucleic acid construct can be, for exmaple, a plasmid. In some embodiments, the nucleic acid construct is a DNA construct. In some embodiments, the nucleic acid construct comprises a promoter operably linked with the sequence that encodes for one or more SVV proteins. In some embodiments, the promoter is not derived from a picornavirus. The promoter can be, for example, a T7 promoter, cytomegalovirus (CMV) promoter, chicken betaactin (CAG) promoter, ubiquitin C (UBC) promoter, or any variant thereof.

[0013] Disclosed herein include a kit, comprising a first nucleic acid construct, wherein the first nucleic acid construct is a nucleic acid construct disclosed herein that comprises a coding sequence for a heterologous peptide; and a second nucleic acid construct, wherein the second nucleic acid construct is a nucleic acid construct disclosed herein that comprises a sequence that encodes for one or more SVV proteins. In some embodiments, the promoters of the first and the second nucleic acid constructs are the same, for example both promoters are T7 promoters.

[0014] Disclosed herein includes a cell, comprising a nucleic acid construct disclosed herein that comprises a coding sequence for a heterologous peptide, a nucleic acid construct disclosed herein that comprises a sequence that encodes for one or more SW proteins, or both.

[0015] Disclosed herein includes a method of producing a recombinant Vaccinia viral vector. The method, in some embodiments, comprises (a) co-transfecting a first cell with first nucleic acid construct and a parent Vaccinia vector, wherein the first nucleic acid construct is a nucleic acid construct disclosed herein that comprises a coding sequence for a heterologous peptide, thereby generating a first recombinant Vaccinia viral vector integrated with at least a portion of the first nucleic acid construct; and (b) co-transfecting a second cell with the first recombinant Vaccinia viral vector and a second nucleic acid construct, wherein the second nucleic acid construct is a nucleic acid construct disclosed herein that comprises a sequence that encodes for one or more SVV proteins, thereby generating a second recombinant Vaccinia viral vector integrated with at least a portion of the first nucleic acid construct, and at least a portion of the second nucleic acid construct. In some embodiments, the Vaccinia viral vector is a Modified Vaccinia Ankara (MV A) vector. In some embodiments, the first and the second cells are AGEl.CR.pIX cells. In some embodiments, the parent MVA is MVA CR19 virus strain.

[0016] Disclosed herein includes a recombinant Vaccinia viral vector, comprising: a first Seneca Valley Virus (SVV) 5’ cloverleaf-like structure and a first nucleic acid sequence encoding a heterologous polypeptide; and a second nucleic acid sequence encoding one or more of SVV proteins. In some embodiments, the recombinant Vaccinia viral vector is a Modified Vaccinia Ankara (MVA) viral vector. In some embodiments, the recombinant Vaccinia viral vector comprises a first promoter operably linked to the first nucleic acid sequence, a second promoter operably linked to the second nucleic acid sequence, or both. In some embodiments, the heterologous polypeptide is a RNA-guided DNA endonuclease. In some embodiments, the second nucleic acid sequence encodes all of structural SVV proteins and/or all of nonstructural SVV proteins. In some embodiments, the first and second promoters are the same, for example both the first and second promoters are T7 promoter. In some embodiments, the recombinant Vaccinia viral vector comprises one or more of an SVV CRE element, an SVV 3’ psudoknot and a stuffer sequence at 3’ of the first nucleic acid sequence encoding the heterologous polypeptide. In some embodiments, the recombinant Vaccinia viral vector comprises a nucleic acid sequence encoding one or more of A3L protein, A9L protein and A34R protein, wherein said nucleic acid sequence comprises at least one mutation resulting in an amino acid sequence modification of said gene product(s). In some embodiments, the nucleic acid sequence encodes A3L, A9L and A34R proteins, and wherein the A3L protein comprises an amino acid sequence modification of H639Y, the A9L protein comprises an amino acid sequence modification of K75E, and the A34R protein comprises an amino acid sequence modification of D86Y. Disclosed herein include a genome of a recombinant Vaccinia viral vector disclosed herein. Also disclosed herein includes a cell comprising a recombinant Vaccinia viral vector disclosed herein and/or a genome of a recombinant Vaccinia viral vector disclosed herein.

[0017] Disclosed herein includes a method of generating a gutless picornavirus particle. The method, in some embodiments, comprises: infecting a producer cell with a recombinant Vaccinia viral vector disclosed herein; culturing the producer cell; and obtaining a gutless picornavirus particle comprising a picornavirus capsid and a RNA comprising a sequence encoding the heterologous polypeptide. In some embodiments, the Vaccinia viral vector is a Modified Vaccinia Ankara (MVA) viral vector. In some embodiments, the method comprises lysing the producer cell after culturing the producer cell. Lysing the producer cell can comprise freezing and thawing the producer cell one or more times. In some embodiments, obtaining the gutless picornavirus particle comprises isolating the gutless picornavirus particle from Vaccinia viral vector using a lipid solvent. The lipid solvent can be, for example chloroform, methanol, acetone, dichloromethane, ether, benzene, acetone, or a combination thereof. In some embodiments, obtaining the gutless picornavirus particle comprises precipitating the gutless picornavirus particle by polyethylene glycol (PEG) and/or inactivating the Vaccinia viral vector using chloroform, ultracentrifugation, or a combination thereof. In some embodiments, the method comprises removing nucleic acids external of the picornavirus capsid by nuclease digestion. The producer cell can be, for example, an adherent cell. In some embodiments, the producer cell is a non-adherent cell. In some embodiments, the producer cell is a HEK293 or a AGEl.CR.pIX cell. In some embodiments, the producer cell stably expresses a T7 polymerase.

[0018] Disclosed herein include a gutless picornavirus particle. In some embodiments, the gutless picornavirus particle comprises: a picornavirus capsid; and a RNA comprising a sequence encoding a heterologous polypeptide. The RNA can be, for example, encapsulated in the picornavirus capsid. In some embodiments, the RNA is not covalently linked to a viral protein. In some embodiments, the RNA is not covalently linked to the picornavirus capsid. In some embodiments, the gutless picornavirus does not comprise any polynucleotides encoding viral proteins. In some embodiments, the gutless picornavirus does not comprise any polynucleotides encoding picomaviral proteins. In some embodiments, the RNA does not comprise any sequence encoding a viral protein. In some embodiments, the RNA does not comprise any sequence encoding a viral structural protein, any sequence encoding a viral non- structural protein, or both. The RNA comprises, in some embodiments, an internal ribosome entry site (IRES), a cis-acting replication element (CRE), a cloverleaf-like structure, a 3’ untranslated region (UTR), or a combination thereof. The picornavirus can be, for example, SSV. The heterologous polypeptide can be, for example a RNA-guided DNA endonuclease, including but not limited to a Cas protein. In some embodiments, Cas protein is a Cas9 (e.g., dCas9). Non-limiting examples of RNA-guided DNA endonuclease include Cas3, Cas8a, Cas5, Cas8b, Cas8c, CaslOd, Csel, Cse2, Csyl, Csy2, Csy3, GSU0054, CaslO, Csm2, Cmr5, CaslO, Csxl l, CsxlO, Csfl, Cas9, Csn2, Cas4, Casl2, Casl2a, Cpfl, Casl2b, C2cl, Casl2c, C2c3, Casl2d, CasY, Casl2e, CasX, Casl2f, Casl4, C2cl0, Casl2g, Casl2h, Casl2i, Casl2k, C2c5, C2c4, C2c8, C2c9, Casl3, Casl3a, C2c2, Cas 13b, Cas 13c, and Casl3d endonuclease. In some embodiments, the gutless picornavirus particle comprises a guide RNA. Disclosed herein includes a pharmaceutical composition, comprising a gutless picornavirus particle disclosed herein; and a pharmaceutical acceptable carrier.

[0019] Disclosed herein includes a method for producing a polypeptide of interest in a cell, comprising: contacting a gutless picomavirus particle disclosed herein in a cell, thereby expressing the heterologous polypeptide in the cell.

[0020] Also disclosed herein include a method for performing gene editing in a cell, comprising: contacting a gutless picomavirus particle with a cell, wherein the gutless picomavirus particle comprises a RNA comprising a sequence encoding a RNA-guided DNA endonuclease, thereby expressing the RNA-guided DNA endonuclease in the cell. In some embodiments, contacting the gutless picomavirus particle with the cell occurs in vitro, ex vivo, or both. In some embodiments, contacting the gutless picomavirus particle with the cell is in a subject. In some embodiments, the gutless picornavims particle is administered to the subject intravenously

BRIEF DESCRIPTION OF THE DRAWINGS

[0021] FIG. 1 illustrates a genome structure of an exemplary picornavims and processing of the polyprotein.

[0022] FIG. 2 shows schematic illustrations of a non-limiting embodiment of SVV vector encoding Cas9 protein (replication enabled) and a non-limiting embodiment of SVV vector encoding capsid proteins (replication disabled).

[0023] FIG. 3 shows non-limiting schematic illustrations for different recombinant SVV vectors (with T7 promoter, and with or without GFP insertion). The indicated positions mark the locations of the inserted point mutations at the sites of the predicted CRE sequences. pCTX- 1724: wildtype full length SW cDNA vector; pCTX-1725: recombinant full length SVV cDNA vector expressing small ultra red fluorescent protein (smURFP); pCTX-1726: recombinant full length SVV cDNA vector expressing GFP; pCTX-1727: recombinant full length SVV cDNA vector expressing GFP (with mutation A867G (AAACA->AAGCA)); pCTX-1728: recombinant full length SVV cDNA vector expressing GFP (with mutations A1188C and C1191T (AAACA- CAATA)); pCTX-1729: recombinant full length SVV cDNA vector expressing GFP (with mutation A5997G (AAACA-^ AAGCA)); and pCTX-1730: recombinant full length SVV cDNA vector expressing GFP (with mutations A6987G and C6990T (AAACA->GAATA)).

[0024] FIG. 4 shows detection of clear cytopathic effect (CPE) by different recombinant SVV vectors.

[0025] FIG. 5 is a schematic illustration of a non-limiting embodiment of recombinant MV A encoding picomaviral proteins and Cas9 protein.

[0026] FIG. 6 illustrates an exemplary T7-MVA system for production of picornaviral capsids carrying Cas9 mRNA.

[0027] FIG. 7A shows a non-limiting exemplary flowchart for generating gutless picomavirus particles FIG. 7B shows a non-limiting exemplary workflow for obtaining gutless SVV particles loaded with Cas9 mRNA.

[0028] FIG. 8 is a graph showing quantification of the non-homologous end joining (NHEJ) effect in cells treated with the SVV particles loaded with cas9-RNA or the indicated controls. The quantification was based on ddPCR results that allow monitoring the levels of nonmodified and modified target sequences upon treatment so that the percentage of gene editing events can be calculated.

[0029] FIG. 9 shows quantification of the NHEJ effect in cells treated with the SVV particles loaded with cas9-RNA using the web tool ‘ICE Analysis’ (Synthego, ice.synthego.com/). The dashed vertical line indicates the predicted cas9 cleavage site.

[0030] FIG. 10 shows two non-limiting exemplary SVV constructs with CMV promoters (left: an SVV construct encoding an SVV polyprotein with CRE deleted; right: an SVV construct encoding a Cas9 with a CRE region).

DETAILED DESCRIPTION

[0031] In the following detailed description, reference is made to the accompanying drawings, which form a part hereof. In the drawings, similar symbols typically identify similar components, unless context dictates otherwise. The illustrative embodiments described in the detailed description, drawings, and claims are not meant to be limiting. Other embodiments may be utilized, and other changes may be made, without departing from the spirit or scope of the subject matter presented herein. It will be readily understood that the aspects of the present disclosure, as generally described herein, and illustrated in the Figures, can be arranged, substituted, combined, separated, and designed in a wide variety of different configurations, all of which are explicitly contemplated herein and made part of the disclosure herein.

[0032] All patents, published patent applications, other publications, and sequences from GenBank, and other databases referred to herein are incorporated by reference in their entirety with respect to the related technology.

[0033] Disclosed herein include methods, compositions and kits for producing nucleic acid constructs comprising picornaviral element(s) and gutless picornavirus particles. In some embodiments, a first nucleic acid construct is disclosed. The first nucleic acid construct comprising a picornaviral 5’ untranslated region (UTR) comprising a cloverleaf-like structure, a coding sequence for a heterologous polypeptide, a cis-acting replication element (CRE) or variant thereof, and a picornaviral 3 ’-UTR. In some embodiments, the first nucleic acid construct comprises a promoter operably linked with the coding sequence for the heterologous polypeptide. Disclosed herein also includes a second nucleic acid construct comprising a sequence that encodes for one or more of SVV proteins, an inactivated picornaviral 5’ cloverleaf-like structure and/or an inactivated picornaviral CRE, or does not comprises a 5’ cloverleaf-like structure and/or a CRE or variant thereof, and a picornaviral 3’ UTR. Disclosed herein also include a kit or a cell comprising the first nucleic acid construct, and the second nucleic acid construct described herein. The second nucleic acid construct, in some embodiments, comprises a promoter operably linked with the sequence that encodes for one or more SVV proteins.

[0034] Disclosed herein includes a method of producing a recombinant Vaccinia viral vector. The Vaccinia viral vector can be, or comprise, for example, Modified Vaccinia Ankara (MV A) viral vector. The method can comprise (a) co-transfecting a first cell with first nucleic acid construct and a parent Vaccinia viral vector, thereby generating a first recombinant Vaccinia viral vector integrated with the first nucleic acid construct or a portion thereof; and (b) cotransfecting a second cell with the first recombinant Vaccinia viral vector and a second nucleic acid construct, thereby generating a second recombinant Vaccinia viral vector integrated with (i) the first nucleic acid construct or a portion thereof and (ii) the second nucleic acid construct or a portion thereof. Disclosed herein includes a recombinant Vaccinia viral vector. The recombinant Vaccinia viral vector can, for example, comprises an SVV 5’ cloverleaf-like structure and a first promoter operably linked to a first nucleic acid sequence encoding a heterologous polypeptide and a second promoter operably linked to a second nucleic acid sequence encoding one or more or all of SVV proteins. Disclosed herein also includes a genome or a cell comprising the recombinant Vaccinia viral vector described herein. The first promoter and/or the second promoter can be, for example, a promoter not derived from a picomavirus (e.g., an SVV).

[0035] Disclosed herein includes a method of generating a gutless picomavirus particle. The method can comprise infecting a producer cell with a Vaccinia viral vector (e.g., an MVA viral vector) herein describe, culturing the producer cell, and obtaining a gutless picomavirus particle comprising a picomavirus capsid and a messenger RNA (mRNA) encoding the heterologous polypeptide. Disclosed herein also includes a gutless picomavirus particle, generated using the method herein described. The gutless picomavirus particle can comprise a picomavirus capsid and a mRNA encoding a heterologous polypeptide.

[0036] Disclosed herein also includes a pharmaceutical composition comprising a gutless picomavirus particle and the method of using the pharmaceutical composition for treatment such as for performing gene editing.

Definition

[0037] As used herein, the term “about” means plus or minus 5% of the provided value.

[0038] As used herein, the term “RNA-guided endonuclease” refers to a polypeptide capable of binding a RNA (e.g., a gRNA) to form a complex targeted to a specific DNA sequence (e.g., in a target DNA). A non-limiting example of RNA-guided endonuclease is a Cas polypeptide (e.g., a Cas endonuclease, such as a Cas9 endonuclease). In some embodiments, the RNA-guided endonuclease as described herein is targeted to a specific DNA sequence in a target DNA by an RNA molecule to which it is bound. The RNA molecule can include a sequence that is complementary to and capable of hybridizing with a target sequence within the target DNA, thus allowing for targeting of the bound polypeptide to a specific location within the target DNA.

[0039] As used herein, the term “guide RNA” or “gRNA” refers to a site-specific targeting RNA that can bind an RNA-guided endonuclease to form a complex, and direct the activities of the bound RNA-guided endonuclease (such as a Cas endonuclease) to a specific target sequence within a target nucleic acid. The guide RNA can include one or more RNA molecules.

[0040] As used herein, a “secondary structure” of a nucleic acid molecule (e g., an RNA fragment, or a gRNA) refers to the base pairing interactions within the nucleic acid molecule.

[0041] As used herein, the term “target DNA” refers to a DNA that includes a “target site” or “target sequence.” The term “target sequence” is used herein to refer to a nucleic acid sequence present in a target DNA to which a DNA-targeting sequence or segment (also referred to herein as a “spacer”) of a gRNA can hybridize, provided sufficient conditions for hybridization exist. For example, the target sequence 5'-GAGCATATC-3' within a target DNA is targeted by (or is capable of hybridizing with, or is complementary to) the RNA sequence 5'-GAUAUGCUC- 3'. Hybridization between the DNA-targeting sequence or segment of a gRNA and the target sequence can, for example, be based on Watson-Crick base pairing rules, which enables programmability in the DNA-targeting sequence or segment. The DNA-targeting sequence or segment of a gRNA can be designed, for instance, to hybridize with any target sequence.

[0042] As used herein, the term “Cas endonuclease” or “Cas nuclease” refers to an RNA-guided DNA endonuclease associated with the CRISPR adaptive immunity system.

[0043] Unless otherwise indicated “nuclease” and “endonuclease” are used interchangeably herein to refer to an enzyme which possesses endonucleolytic catalytic activity for polynucleotide cleavage.

[0044] As used herein, the term “invariable region” of a gRNA refers to the nucleotide sequence of the gRNA that associates with the RNA-guided endonuclease. In some embodiments, the gRNA comprises a crRNA and a transactivating crRNA (tracrRNA), wherein the crRNA and tracrRNA hybridize to each other to form a duplex. In some embodiments, the crRNA comprises 5’ to 3’: a spacer sequence and minimum CRISPR repeat sequence (also referred to as a “crRNA repeat sequence” herein); and the tracrRNA comprises a minimum tracrRNA sequence complementary to the minimum CRISPR repeat sequence (also referred to as a “tracrRNA antirepeat sequence” herein) and a 3’ tracrRNA sequence. In some embodiments, the invariable region of the gRNA refers to the portion of the crRNA that is the minimum CRISPR repeat sequence and the tracrRNA.

[0045] The terms “polynucleotide” and “nucleic acid” are used interchangeably herein and refer to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. A polynucleotide can be single-, double-, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids/triple helices, or a polymer including purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases.

[0046] As used herein, the term “binding” refers to a non-covalent interaction between macromolecules (e.g., between a protein and a nucleic acid). While in a state of non-covalent interaction, the macromolecules are said to be “associated” or “interacting” or “binding” (e.g., when a molecule X is said to interact with a molecule Y, it means that the molecule X binds to molecule Y in a non-covalent manner). Binding interactions can be characterized by a dissociation constant (Kd), for example a Kd of, or a Kd less than, 10'⁶ M, 10'⁷ M, 10'⁸ M, 10'⁹M, 10'¹⁰ M, 10" ¹¹ M, 10'¹²M, 10'¹³ M, 10'¹⁴ M,10'¹⁵ M, or a number or a range between any two of these values. Kd can be dependent on environmental conditions, e.g., pH and temperature. “Affinity” refers to the strength of binding, and increased binding affinity is correlated with a lower Kd.

[0047] As used herein, the term “hybridizing” or “hybridize” refers to the pairing of substantially complementary or complementary nucleic acid sequences within two different molecules. Pairing can be achieved by any process in which a nucleic acid sequence joins with a substantially or fully complementary sequence through base pairing to form a hybridization complex. “Hybridizing” or “hybridize” can comprise denaturing the molecules to disrupt the intramolecular structure(s) (e.g., secondary structure(s)) in the molecule. In some embodiments, denaturing the molecules comprises heating a solution comprising the molecules to a temperature sufficient to disrupt the intramolecular structures of the molecules. In some instances, denaturing the molecules comprises adjusting the pH of a solution comprising the molecules to a pH sufficient to disrupt the intramolecular structures of the molecules. For purposes of hybridization, two nucleic acid sequences or segments of sequences are “substantially complementary” if at least 80% of their individual bases are complementary to one another. In some embodiments, a splint oligonucleotide sequence is not more than about 50% identical to one of the two polynucleotides (e.g., RNA fragments) to which it is designed to be complementary. The complementary portion of each sequence can be referred to herein as a ‘segment’, and the segments are substantially complementary if they have 80% or greater identity.

[0048] As used herein, the term "vector" refers to a polynucleotide construct, typically a plasmid or a virus, used to transmit genetic material to a host cell. Vectors can be, for example, viruses, plasmids, cosmids, or phage. A vector as used herein can be composed of either DNA or RNA. In some embodiments, a vector is composed of DNA. An "expression vector" is a vector that is capable of directing the expression of a protein encoded by one or more genes carried by the vector when it is present in the appropriate environment. Vectors are preferably capable of autonomous replication. Typically, an expression vector comprises a transcription promoter, a gene, and a transcription terminator. Gene expression is usually placed under the control of a promoter, and a gene is said to be "operably linked to" the promoter.

[0049] As used herein, the term "operably linked" is used to describe the connection between regulatory elements and a gene or its coding region. Typically, gene expression is placed under the control of one or more regulatory elements, for example, without limitation, constitutive or inducible promoters, tissue-specific regulatory elements, and enhancers. A gene or coding region is said to be "operably linked to" or "operatively linked to" or "operably associated with" the regulatory elements, meaning that the gene or coding region is controlled or influenced by the regulatory element. For instance, a promoter is operably linked to a coding sequence if the promoter effects transcription or expression of the coding sequence.

[0050] The term "construct," as used herein, refers to a recombinant nucleic acid that has been generated for the purpose of the expression of a specific nucleotide sequence(s), or that is to be used in the construction of other recombinant nucleotide sequences.

[0051] As used herein, the terms "nucleic acid" and "polynucleotide" are interchangeable and refer to any nucleic acid, whether composed of phosphodiester linkages or modified linkages such as phosphotriester, phosphorami date, siloxane, carbonate, carboxymethylester, acetamidate, carbamate, thioether, bridged phosphoramidate, bridged methylene phosphonate, bridged phosphoramidate, bridged phosphoramidate, bridged methylene phosphonate, phosphorothioate, methylphosphonate, phosphorodithioate, bridged phosphorothioate or sultone linkages, and combinations of such linkages. The terms "nucleic acid" and "polynucleotide" also specifically include nucleic acids composed of bases other than the five biologically occurring bases (adenine, guanine, thymine, cytosine and uracil).

[0052] The term "regulatory element" and "expression control element" are used interchangeably and refer to nucleic acid molecules that can influence the expression of an operably linked coding sequence in a particular host organism. These terms are used broadly to and cover all elements that promote or regulate transcription, including promoters, core elements required for basic interaction of RNA polymerase and transcription factors, upstream elements, enhancers, and response elements (see, e.g., Lewin, "Genes V" (Oxford University Press, Oxford) pages 847-873). Exemplary regulatory elements in prokaryotes include promoters, operator sequences and a ribosome binding sites. Regulatory elements that are used in eukaryotic cells can include, without limitation, transcriptional and translational control sequences, such as promoters, enhancers, splicing signals, polyadenylation signals, terminators, protein degradation signals, internal ribosome-entry element (IRES), 2A sequences, and the like, that provide for and/or regulate expression of a coding sequence and/or production of an encoded polypeptide in a host cell.

[0053] As used herein, the term "promoter" is a nucleotide sequence that permits binding of RNA polymerase and directs the transcription of a gene. Typically, a promoter is located in the 5' non-coding region of a gene, proximal to the transcriptional start site of the gene. Sequence elements within promoters that function in the initiation of transcription are often characterized by consensus nucleotide sequences. Examples of promoters include, but are not limited to, promoters from bacteria, yeast, plants, viruses, and mammals (including humans). A promoter can be inducible, repressible, and/or constitutive. Inducible promoters initiate increased levels of transcription from DNA under their control in response to some change in culture conditions, such as a change in temperature.

[0054] As used herein, the term "enhancer" refers to a type of regulatory element that can increase the efficiency of transcription, regardless of the distance or orientation of the enhancer relative to the start site of transcription.

[0055] As used herein, the terms "transfection" or “infection” refer to the introduction of a nucleic acid into a host cell, such as by contacting the cell with a recombinant MVA virus or a gutless picornaviral particle as described herein.

[0056] As used herein, the term "transgene" refers to any nucleotide or DNA sequence that is integrated into one or more chromosomes of a target cell by human intervention. In some embodiment, the transgene comprises a polynucleotide that encodes a protein of interest. The protein-encoding polynucleotide is generally operatively linked to other sequences that are useful for obtaining the desired expression of the gene of interest, such as transcriptional regulatory sequences. In some embodiments, the transgene can additionally comprise a nucleic acid or other molecule(s) that is used to mark the chromosome where it has integrated.

[0057] As used herein, "treatment" refers to a clinical intervention made in response to a disease, disorder or physiological condition manifested by a patient or to which a patient may be susceptible. The aim of treatment includes, but is not limited to, the alleviation or prevention of symptoms, slowing or stopping the progression or worsening of a disease, disorder, or condition and/or the remission of the disease, disorder or condition. "Treatments" refer to one or both of therapeutic treatment and prophylactic or preventative measures. Subjects in need of treatment include those already affected by a disease or disorder or undesired physiological condition as well as those in which the disease or disorder or undesired physiological condition is to be prevented.

[0058] As used herein, the term "effective amount" refers to an amount sufficient to effect beneficial or desirable biological and/or clinical results.

[0059] As used herein, a "subject" refers to an animal that is the object of treatment, observation or experiment. "Animal" includes cold- and warm-blooded vertebrates and invertebrates such as fish, shellfish, reptiles, and in particular, mammals. "Mammal," as used herein, refers to an individual belonging to the class Mammalia and includes, but not limited to, humans, domestic and farm animals, zoo animals, sports and pet animals. Non-limiting examples of mammals include mice; rats; rabbits; guinea pigs; dogs; cats; sheep; goats; cows; horses; primates, such as monkeys, chimpanzees and apes, and, in particular, humans. In some embodiments, the mammal is a human. However, in some embodiments, the mammal is not a human, for example the mammal is a domestic animal.

[0060] Gene editing requires multiple editing components, for example Cas9, gRNA and HDR template. It is still challenging to deliver these macro-biomolecules to target tissues for ex vivo and in vivo gene editing. Therefore, there is a need for a novel delivery tool for gene editing components (e.g., CRISPR/Cas9). Described herein include a picornavirus-based viral vector system capable of expressing a RNA-guided DNA endonuclease (e g., Cas9) in a mRNA format with no DNA intermediate. In some embodiments, it is advantageous that the viral vector, RNA or both are incapable of replicating inside the target cell. The viral vector particle disclosed herein, in some embodiments, has a preference in infecting target cells (e.g., neuronal, muscle or liver cells (and infecting those cells efficiently)) than endothelial cells, macrophages and/or glia cells). In addition, it is advantageous that the capsid of the picomavirus particles disclosed herein does not induce adverse innate immune system or be target of the adaptive system upon primary infection of a typical patient (no preexisting immunity). In some embodiments, the picomavirus particles do not comprise any nucleic acid encoding viral proteins (e.g., viral structural proteins, or viral nonstructural proteins), and/or any nucleic acid encoding any protein other than the RNA- guided DNA endonuclease (e.g., Cas9).

Picomavirus System

[0061] As described herein, a picomavirus system (e g , Seneca valley vims “SVV”) allows large loading capacity (about 7 kb compared to about 4.7 kb for adeno-associated vims vector “AAV”), transient expression of heterologous proteins, and can achieve ex vivo and in vivo gene targeting with reduced immunogenicity and/or reduced off-target activity, as well as effective tissue penetration.

[0062] Picomavims genomes are single stranded linear (+) RNA of about 6.7-10.1 kb long. The genomic RNA is polyadenylated and covalently linked to viral protein (VPg) at its 5’ end. The 5 ’-untranslated region (5’-UTR) of the picomavirus genomes contains an internal ribosome entry site (IRES) and a single open reading frame (ORF) translated via IRES into a polyprotein which processed into structural and nonstructural proteins. Pl region of the genome encodes structural polypeptides, and P2 and P3 regions encode nonstructural proteins associated with replication and packaging of viral genome. 3' UTR is important for (-) strand RNA synthesis for picornaviruses. As used herein, the term “picomavirus genome” refers to a picomavirus genome in a RNA or a DNA form, any portion or variant thereof, or the complementary sequence thereof. In some embodiments, the picomavirus genome is or comprises cDNA of an SVV genome (e.g., SVV-001 genome), or a portion thereof. In some embodiments, the picomavirus genome is or comprises cDNA of a variant SVV genome (e.g., a mutated SVV-001 genome), or a portion thereof. cDNA of the SVV genome can be, for example, synthesized by RT-PCR. In some embodiments, two or more cDNA fragments of the picomavirus genome (e.g., SVV genome) are generated and then assembled into the complete picomavirus genome sequence. As used herein, the terms “untranslated region” (i.e., UTR) and “nontranslated region” (i.e., NTR) are used interchangeably. For example, a 5’ UTR is also called a 5’ NTR, and a 3’ UTR can also be called 3’ NTR

[0063] The coding region of the picomavirus can be translated in the cytoplasm of a host cell into a polyprotein that contains one structural (Pl) and two nonstructural domains (P2 and P3). The polyprotein is processed into precursor and mature proteins primarily by viral proteinases, 2A and 3C^pro/3CD^pro, via cleavage (see e.g., FIG. 1). The role of P2 proteins (2A, 2B and 2C) is primarily to induce the biochemical and biophysical changes that occur in the infected cell. The P3 proteins (3 A, 3B, 3C and 3D) are more directly involved in the process of RNA synthesis. The maturation cleavage of VPO into VP4 and VP2 occurs by an autocatalytic mechanism. An exemplary genome structure of a picomavirus and processing of the polyprotein is provided in FIG. 1.

[0064] Cloverleaf, CRE and 3’ pseudoknot are three essential elements for replication and packaging of the picornaviral genome. The cloverleaf-like structure is at the 5 ’-end of viral RNA genome, and followed by a cis acting RNA element (CRE) and a 3’ pseudoknot containing two stem-loops. The position for the CRE element in the genome can vary and the CRE element is functional anywhere between the cloverleaf and pseudoknot. Viral polymerase (e.g., 3C^pro/3CD^pro) interacts with CRE and recruits viral protein G (VPg) to the site which is uridylated. Uridylated VPg serves as primer for synthesis of plus sense and minus RNAs. VPg is a small, basic peptide having about 19-26 amino acids in length. VPg typically contains a fully conserved tyrosine at position 3 of the VPg amino acid sequence, the attachment site to the RNA. Replication and packaging of the viral genomes are coupled, and there is no replication and packaging of cellular RNAs by the viral replication machinery. The picomavirus genome structure and factors involved in the initiation of RNA synthesis are described in details in Paul and Wimmer. Virus Research 2015; 206-12 and Ping Jiang et al. Microbiol. Mol. Biol. Rev. 2014;78:418-437, both of which are incorporated by reference herein in their entirety. Exemplary genome structures of picornavirus (e.g., SVV) are illustrated in FIG. 1 and FIG. 2 (SVV wild type virus).

[0065] Picomaviruses used herein refer a group of related nonenveloped RNA viruses that can infect vertebrates including mammals, fish and birds. Picomaviruses represent a large family of small, positive-sense, single- stranded RNA viruses with about 30 nm icosahedral capsid. Picomaviruses constitute the family Picornaviridae order Picornavirales, and realm Riboviria. Picomaviruses comprise a number of genera including genera Enterovirus (e.g., poliovirus, rhinovirus, coxsackievirus, and echovirus), Aphthovirus (foot-and-mouth disease vims “FMDV”), Cardiovirus (encephalomyocarditis vims “EMCV” and Theiler’s vims), Hepatovirus (hepatitis A vims “HAV”), and Senecavirus (seneca valley vims “SVV”). In some embodiments, the picornavims used herein is an SVV (e.g., seneca valley vims A). In some embodiments, the picornavims is a coxsackievims, poliovims, echovims, rhinovims, or enterovims.

[0066] Provided herein include a nucleic acid constmct comprising a picornavims genome or a portion thereof. The nucleic acid constmct can be a plasmid, such as a cDNA plasmid. The nucleic acid constmct can comprise a cloverleaf-like stmcture at the 5’ end, such as in the 5’ untranslated region (5’ UTR). The cloverleaf-like stmcture comprises an internal ribosome entry site (IRES) which directs cap-independent internal initiation of protein synthesis. Different picornavims genome can comprise different types of IRES element. For example, the enterovimses and rhinovimses share one type of element (Type I IRES), while the cardiovimses and aphthovimses (e.g., EMCV and foot-and-mouth disease vims FMDV, respectively) share a second type (Type II IRES). HAV has a third distinct class of IRES (Type III IRES). SVV has a fourth class of IRES (Type IV IRES). A nucleic acid constmct herein described can comprise any one of these IRES. In some embodiments, the nucleic acid constmct can comprise an SVV IRES (Type IV IRES). In some other embodiments, a nucleic acid constmct can have a EMC IRES (Type II IRES).

[0067] The nucleic acid constmct herein described can comprise a promoter (e.g., a promoter that is not derived from picornavims (e.g., SVV)) operably linked with a coding sequence for a heterologous polypeptide. The terms "heterologous polypeptide” or “heterologous nucleic acid sequence", as used herein, refer to a polypeptide or nucleic acid sequence that is not normally found intimately associated with the vims, particularly with the picornavims in nature. As used herein, the term “heterologous promoter” refers to a promoter sequence that is not normally found within a picomavirus in nature. The expression of the coding sequence for the heterologous polypeptide is under the transcriptional control of the heterologous promoter.

[0068] The promoter (e.g., heterologous promoter) and the coding sequence for the heterologous polypeptide are inserted into the nucleic acid sequence of the nucleic acid construct. In some embodiments, the promoter and the coding sequence for the heterologous polypeptide are located between the 3’ pseudoknot and the CRE or variant thereof. In some embodiments, the promoter and the coding sequence for the heterologous polypeptide are located between the IRES at its 5 ’ and the 3 ’ pseudoknot.

[0069] Exemplary promoters that can be used in the nucleic acid construct described herein include a T7 promoter, a cytomegalovirus (CMV) promoter, a SV40 promoter, a metallothionein promoter, a murine mammary tumor virus (MMTV) promoter, a Rous sarcoma virus (RSV) promoter, a polyhedrin promoter, a chicken P-actin (CAG) promoter, an EF-1 alpha promoter, ubiquitin C (UBC) promoter, a spleen focus forming virus (SFFV) promoter, a dihydrofolate reductase (DHFR) promoter, a GUSB240 promoter (e.g., a human GUSB240 (hGUSB240) promoter), GUSB379 promoter (e.g., a human GUSB379 (hGUSB379) promoter), and a phosphoglycerol kinase (PGK) promoter (e.g., a human PGK (hPGK) promoter, or any variants thereof. In some embodiments, the heterologous promoter is a T7 promoter, CMV promoter, CAG promoter, UBC promoter, or any variant thereof.

[0070] Various heterologous polypeptides can be encoded by the nucleic acid construct disclosed herein. For example, the heterologous polypeptide can be, or comprise, a therapeutic protein. In some embodiments, the heterologous polypeptide is, or comprises, a cytokine, a vaccine subunit, an enzyme (e.g., a protease, a kinase), an antibody or an antibody fragment, In some embodiments, the heterologous polypeptide is a RNA-guided DNA endonuclease such as any RNA-guided endonuclease herein described. For example, the RNA- guided DNA endonuclease is a Cas polypeptide, optionally the Cas polypeptide is Cas9.

[0071] The nucleic acid construct herein described can comprise an internally located cis-acting replication element (CRE) or a variant thereof. The CRE of the nucleic acid construct has a stem loop structure containing conserved adenosines and serves to template the uridylylation of VPg, a small viral protein that primes the initiation of RNA synthesis in a reaction catalyzed a viral RNA-dependent RNA polymerase. The CRE can possess different nucleotide sequence. Two consecutive adenosine residues within the 5’ half of the CRE loop and two residues, guanosine and adenosine, at the bottom of the loop have been shown to be conserved and critical for both VPg uridylylation and viral RNA replication. The two adenosine residues within the 5’ half of the loop template the uridylyation of VPg in a two-step, slide-back mechanism for VPg-pUpU synthesis. The CRE of the nucleic acid construct is involved in the replication and packaging of a viral genome. The location for the CRE element in a nucleic acid construct can vary and the CRE element is functional anywhere between the cloverleaf and 3’ NTR In some embodiments, the CRE is located downstream of the coding sequence for a heterologous polypeptide and upstream ofthe 3’ NTR.

[0072] In some embodiments, the nucleic acid construct further comprises at least one stuffer sequence. The stuffer sequence typically comprise segments of noncoding DNA used to build the construct to a size that is suitable for optimal packaging as will be understood by a skilled person For example, an SVV vector typically accept inserts of DNA having a size about 7kb. Thus, for shorter sequences, it may be necessary to include additional nucleic acid in the insert fragment in order to achieve the required length which is acceptable for the SVV vector. It is desirable that a stuffer sequence used herein would not affect the function, replication, and stability of the nucleic acid construct herein described. The stuffer sequence can be isolated or derived from a non-coding region (e.g., an intronic region) of a known gene or nucleic acid sequence. The stuffer sequence can be for example, a sequence between 1-10, 10-20, 20-30, 30- 40, 40-50, 50-60, 60-75, 75-100, 100-150, 150-200, 200-250, 250-300, 300-400, 400-500, 500- 750, 750-1,000, 1,000-1,500, 1,500-2,000, 2,000-2,500, 2,500-3,000, 3,000-3,500, 3,500-4,000, 4,000-4,500, 4,500-5,000, 5,500-6,000, 6,000-7,000, 7,000-8,000, or 8,000-9,000 nucleotides in length. The stuffer sequence can be located in the nucleic acid construct at any desired position such that it does not prevent a function or activity. For example, the at least one stuffer sequence can be at 3’ or 5’ end of the coding sequence for the heterologous sequence.

[0073] In some embodiments, the nucleic acid construct herein described can comprise a 3’ UTR. The 3’ UTR can comprise a pseudoknot structure containing two stem-loops. It has been shown that the interaction between the two stem-loops are required for adequate genome synthesis. The 3’ UTR can also comprises a poly(A) tail. The poly(A) tail can be variable in length. In some embodiments, the poly(A) tail can be 1-10, 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70- 80, 80-90, 90-100 or more nucleotides in length. The 5’ UTR, CRE and/or 3’UTR can be derived from a same picomavirus or different picornaviruses.

[0074] In some embodiments, the nucleic acid construct herein described comprises from the 5’ to the 3’ a cloverleaf-like structure comprising an SVV IRES, a coding sequence for a RNA-guided endonuclease, a CRE, a stuffer sequence, a 3’ UTR comprising a 3’ pseudoknot and a poly(A) tail (see e.g., the Cas9-relicon construct in FIG. 2).

[0075] In some embodiments, the nucleic acid construct herein described does not comprise a coding sequence for at least one picomavirus polypeptide (e.g., one or more picoarnavirus polypeptide forming the polyprotein). In some embodiments, the nucleic acid construct herein described does not comprise coding sequence for any picornavirus protein. For example, the nucleic acid construct herein described does not comprise one or more of the coding sequences for the structure region (Pl) and non- structural protein (P2 and P3) of the polyprotein. In some embodiments, the nucleic acid construct does not comprise one or more of the coding sequence for SVV VP1, VP2, VP3, VP4, 2A, 2B, 2C, 3A, 3B, 3C, and 3D proteins. In some embodiments, the nucleic acid construct does not comprise all the coding sequences for SVV VP 1, VP2, VP3, VP4, 2A, 2B, 2C, 3A, 3B, 3C, and 3D proteins.

[0076] Provided herein also includes a nucleic acid construct comprising a sequence that encodes for one or more SVV proteins (e.g., one or more of SVV VP1, VP2, VP3, VP4, 2A, 2B, 2C, 3A, 3B, 3C, and 3D polypeptides). The nucleic acid construct can comprise, for example, a promoter operably linked with the sequence that encodes for the one or more SVV proteins. The promoter can be a promoter that is not derived from picornavirus. The nucleic acid construct is structured such that the replication of the construct is disabled by deleting or mutating CRE. The nucleic acid construct can be a plasmid, such as a cDNA plasmid. In some embodiments, the nucleic acid construct does not comprise one or more picornavirus packaging signal sequence.

[0077] In some embodiments, the nucleic acid construct does not comprise a 5’ cloverleaf-like structure (e.g., the IRES) and/or a CRE or variant thereof. In some embodiments, the nucleic acid construct comprises an inactivated 5’ cloverleaf-like structure and/or an inactivated CRE or deleted 5’ cloverleaf-like structure and/or CRE. According, the nucleic acid construct that does not comprise a 5’ cloverleaf-like structure and/or a CRE or variant thereof or comprises an inactivated 5’ cloverleaf-like structure and/or CRE can be detected by assaying for cytoplathic effects. In an example, cells transfected with an inactivated CRE does not show cytopathic effects (see Example 2).

[0078] In some embodiments, the nucleic acid construct comprises an inactivated CRE, i.e., a CRE incapable of genome replication and formation of infectious picornavirus particles. The inactivated CRE can be generated by introducing one or more point mutations in the stem-loop structure of the CRE. For example, at least one of the conserved adenosines in the loop can be substituted with a guanosine. In some embodiments, one or more of the A in the AAAC sequence common in the loop of picornavirus CRE is substituted with a G (see e.g., in FIG. 3). In some embodiments, the C of the AAAC sequence is substituted with a T (see e.g., in FIG. 3). In some embodiments, the mutations are introduced in the CRE element in the 2C coding region of a picornavirus. In some embodiments, the inactivated CRE comprises one or more of nucleotide mutations A867G, A1188C, A5997G, C1191T, A6987G, and C6990T. In some embodiments, the inactivated CRE comprises nucleotide mutations Al 188C and Cl 191T. In some embodiments, the AAAC sequence in the loop of the picornavirus CRE is mutated to CAAT (see e.g., pCTX-1728 plasmid in FIG. 3). In some embodiments, the CRE element in the 2C coding region of the picornavirus (e.g., SVV 2C region) or a portion thereof is deleted. In some embodiments, none of the one or more CREs have both A1188C and C1191T mutations. In the nucleic acid constructs (e.g., a DNA construct or a plasmid construct) disclosed herein, a sequence (e.g., a picomaviral sequence or an SW sequence) comprising a CRE motif can comprise, for example, a sequence having at least about, or at least, 80%, 82%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or a number or a range between any two of these values, sequence identity to SEQ ID NO: 20, or SEQ ID NO: 21. In some embodiments, the sequence (e.g., a picornaviral sequence or an SVV sequence) comprising a CRE motif can comprise, for example, a sequence having at least about, or at least, one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or a number or a range between any two of these values, mismatches relative to SEQ ID NO: 20, or SEQ ID NO: 21.

Table 1. Non-limiting exemplary SVV sequences with CRE motif

[0079] In some embodiments, the nucleic acid construct comprises an inactivated 5’ cloverleaf-like structure. For example, the inactivated 5’ cloverleaf-like structure can have one or more mutations and/or deletions in one or more domains of the SVV IRES, such as in domain II and/or domain III such that the activity of IRES is inhibited or abolished. Secondary structure of an SVV IRES is described in Willcocks et al., J Virol. 2011 May; 85(9): 4452-4461, the content of which is incorporated herein by reference. In some embodiments, the nucleic acid construct comprises an inactivated 5’ cloverleaf-like structure (e.g., the IRES) and an inactivated CRE. In some embodiments, the nucleic acid construct does not comprise the 5’ cloverleaf-like structure and the CRE.

[0080] In some embodiments, the coding sequence of the nucleic acid construct encodes for a picornavirus polyprotein (e g., an SVV polyprotein) or a portion thereof. For example, the sequence can encodes for one or more of SVV VP1, VP2, VP3, VP4, 2A, 2B, 2C, 3A, 3B, 3C, and 3D proteins. The expression of the coding sequence for the SVV polypeptide is under the transcriptional control of a heterologous promoter. The heterologous promoter can be any promoter herein described. The heterologous promoter and the sequence encoding for the one or more SVV polypeptides can be located between the 5’ UTR and the 3’ UTR. In some embodiments, the heterologous promoter and the sequence encoding for the one or more SVV polypeptides are located downstream from the IRES.

[0081] In some embodiments, the nucleic acid construct can comprise an IRES herein described. The IRES can be a Type I, Type II, Type III or Type IV IRES. In some embodiments, the IRES is an IRES derived from EMCV. The nucleic acid constructure can further comprise a 3’ UTR containing a 3’ pseudoknot and a poly(A) tail.

[0082] In some embodiments, the nucleic acid construct herein described comprises from the 5’ to the 3’ a cloverleaf-like structure comprising a EMCV IRES, a coding sequence for an SVV VP4, VP2, VP3, VP1, 2A, 2B, 2C, 3A, 3B, 3C, 3D, a 3’ UTR comprising a 3’ pseudoknot and a poly(A) tail (see e.g., the Capsid-donor construct in FIG. 2).

[0083] The nucleic acid constructs herein described can also comprise a reporter gene. A variety of reporter genes can be inserted in the constructs. Exemplary reporter genes include, but are not limited to, green fluorescent protein (GFP), blue fluorescent protein (BFP), yellow fluorescent protein (YFP), cyan fluorescent protein (CYP), mCherry, luciferase, or a variant or a combination thereof.

[0084] Provided herein also includes a kit comprising a first nucleic acid construct, wherein the first nucleic acid construct is a nucleic acid construct encoding a heterologous polypeptide (e.g., a RNA-guided endonuclease) and a second nucleic acid construct, wherein the second nucleic acid construct is a nucleic acid construct encoding an SVV polyprotein or a portion thereof. The heterologous promoters of the first and the second nucleic acid constructs can be the same or different. For example, both heterologous promoters can be T7 promoters.

[0085] Provided herein also includes a cell comprising a first nucleic acid construct, wherein the first nucleic acid construct is a nucleic acid construct encoding a heterologous polypeptide (e.g., a RNA-guided endonuclease) and a second nucleic acid construct, wherein the second nucleic acid construct is a nucleic acid construct encoding an SVV polyprotein or a portion thereof.

Recombinant Vaccinia Virus and Viral Vector

[0086] Provided herein includes recombinant Vaccinia viruses, for example Modified Vaccinia Ankara (MV A) virus, a genome thereof or a cell comprising a recombinant Vaccinia virus (e.g., MV A). The recombinant Vaccinia virus (e.g., MV A) can comprise a first SVV 5’ cloverleaf-like structure and a first heterologous promoter operably linked to a first nucleic acid sequence encoding a heterologous polypeptide and a second heterologous promoter operably linked to a second nucleic acid sequence encoding one or more of SVV proteins. The first and second heterologous promoters can be the same or different. In some embodiments, the first and second heterologous promoters are T7 promoter. The first nucleic acid sequence can be downstream or upstream of the second nucleic acid sequence. In some embodiments, the first nucleic acid sequence is downstream of the second nucleic acid sequence. The recombinant MVA herein described therefore carries two nucleic acid cassettes, one encoding for the heterologous polypeptide and the other encoding the one or more SVV proteins described herein.

[0087] In some embodiments, the heterologous polypeptide is a RNA-guided DNA endonuclease (e.g., Cas9). The recombinant MVA can also comprise an SVV CRE element, an SVV 3’ pseudoknot, and a stuffer sequence at 3’ of the first nucleic acid sequence encoding the heterologous polypeptide. The second nucleic acid sequence can encode one or more of the SVV polypeptides herein described, including one or both of the structural and non-structural regions, such as one or more of the SVV VP1, VP2, VP3, VP4, 2A, 2B, 2C, 3A, 3B, 3C, and 3D proteins herein described. The second nucleic acid sequence comprises an inactivated 5’ cloverleaf-like structure and/or an inactivated CRE, or does not comprises a 5’ cloverleaf-like structure and/or a CRE or variant thereof as described above.

[0088] The recombinant Vaccinia viral vector (e.g., an MVA) can be generated by (a) co-transfecting a first cell with first nucleic acid construct and a parent Vaccinia viral vector (e.g., an MVA), wherein the first nucleic acid construct is a nucleic acid construct encoding a heterologous polypeptide, thereby generating a first recombinant Vaccinia viral vector integrated with the first nucleic acid construct or a portion thereof, and (b) co-transfecting a second cell with the first recombinant Vaccinia viral vector and a second nucleic acid construct, wherein the second nucleic acid construct is a nucleic acid construct encoding an SVV polyprotein or a portion thereof, thereby generating a second recombinant Vaccinia viral vector integrated with (i) the first nucleic acid construct or a portion thereof and (ii) the second nucleic acid construct or a portion thereof. The generated recombinant Vaccinia viral vector can encode the heterologous polypeptide and the SVV polyprotein or a portion/variant thereof. The terms “co-transfecting” means transfecting the nucleic acid construct and the Vaccinia viral vector (e.g., a parent Vaccinia viral vector (e.g., MVA) or the first recombinant Vaccinia viral vector) simultaneously or immediately following one another. Co-transfection can be performed according to standard procedures known to a skilled person. In some embodiments, the step (a) can be repeated for multiple times. For example, the first cell, the parent Vaccinia viral vector and the first nucleic acid construct can be incubated for a period of time (e.g. 4 hours, 8 hours, 16 hours, 24 hours, 2 days, 3 days). Cells revealing a cytopathic effect (CPE) can be picked and viral materials thereof can be used for reinfection of the first cell. This process is also referred to as “serial virus passaging.” In some embodiments, step (a) can be repeated for 2, 3, 4, 5, 6, 7, 8, 9, 10 or more times.

[0089] The parent Vaccinia viral vector (e.g., MV A) used herein is a hyperattenuated poxvirus that has demonstrated safety in clinical trials. The MVA virus is related to Vaccinia virus, a member of the genera Orthopoxvirus in the family of Poxviridae. In some embodiments, the MVA used herein is a mutated MVA comprising a nucleic acid sequence encoding an A3L gene product and/or an A34R gene product and/or A9L gene product, wherein said nucleic acid sequence comprises at least one mutation (e g., 1, 2, 3, 4, 5, or 6 mutations) resulting in an amino acid sequence modification (e.g., 1, 2, 3, 4, 5, or 6 amino acid sequence modifications) of said gene product(s). The amino acid modifications can be an amino acid deletion, amino acid insertion, amino acid addition, and/or amino acid replacement/substitution. In some embodiments, the MVA virus can comprise a nucleic acid sequence prior to mutation according to accession number AY603355 (version AY603355.1 and GL47088326).

[0090] The A3L gene product mentioned herein (also designated as P4b protein) of MVA is one of three major core proteins and is processed by the 17L-encoded viral protease during the maturation of the spherical and non-infectious immature virion (IV) to the intracellular mature virion (IMV). The A3L gene product of MVA contributes to virion morphogenesis at a very early step to allow correct condensation and membrane rearrangements in the transition towards the infectious IMV.

[0091] The A34R gene product of MVA mentioned herein destabilizes the outer membrane of the extracellular enveloped virus (EEV) and is, thus, extremely important for infectious activity in the extracellular space and for virus spread. The EEV has evolved as a vehicle to allow virus to spread to distant sites. The additional membrane of the EEV is not equipped to mediate fusion with the target cell and must be disrupted to release the IMV, the actual virus infectious unit. In addition, the A34R gene product of MVA modulates the rate at which the cell- associated enveloped virus (CEV) detaches from the producing cell. Furthermore, the A9L gene product of MV A is, like the A3L gene product, involved in the early steps of MV A maturation. It is a factor important for correct condensation of the core of the IMV.

[0092] In some embodiments, the MVA used herein comprises H639Y and/or R638Y substitution in A3L gene product. Accordingly, the MVA used herein comprises the amino acid Y at position 639 or at an amino acid position corresponding thereto. Alternatively or in addition, the MVA used herein can comprise the amino acid Y at position 638 or at an amino acid position corresponding thereto.

[0093] In some embodiments, the MVA used herein comprises a D86Y mutation in the A34R gene product. Accordingly, the MVA used herein can comprise an amino acid Y at position 86 or at an amino acid position corresponding thereto.

[0094] In some embodiments, the MVA used herein comprises K75E and/or K74E substitution in A9L gene product. Accordingly, the MVA used herein comprises the amino acid E at position 75 or at an amino acid position corresponding thereto. Alternatively or in addition, the MVA used herein can comprise the amino acid E at position 74 or at an amino acid position corresponding thereto.

[0095] In some embodiments, the MVA used herein comprises a K75E mutation and/or a H639Y mutation in A9L gene product. Alternatively or in addition, the MVA used herein can comprise the amino acid E at position K or at an amino acid position corresponding thereto.

[0096] Additional description of the MVA used herein can be found in EP 2900810 and US 2015/0299666 Al, the contents of which are incorporated herein by reference in their entirety.

[0097] The parent MVA virus used herein can be an isolated MVA virus, i.e., a virus that is removed from its native or culturing environment. The MVA virus can be a purified MVA virus which has been isolated under conditions to reduce or eliminate the presence of unrelated materials, such as contaminants including native materials from which the virus is obtained. In some embodiments, the parent MVA is MVA-CR virus strain. In some embodiments, the parent MVA is an MVA-CR19 virus strain, for example a pure isolate of MVA-CR.

[0098] The first nucleic acid construct and the second nucleic acid construct can be inserted into a non-essential region of the Vaccinia virus (e.g., MVA) nucleic acid sequence/genome. For example, the first nucleic acid construct and the second nucleic acid construct can be inserted at a naturally occurring deletion site (e.g., deletion site I, II, III, IV, V, or VI) of the Vaccinia nucleic acid sequence. In some embodiments, the first nucleic acid construct encoding a heterologous polypeptide can be inserted into deletion site III. In some embodiments, the second nucleic acid construct encoding an SVV polyprotein or a portion thereof can be inserted into the thymidine kinase (TK) locus (see e.g., FIG. 5).

[0099] The cell used herein for the coinfection can be any cell that may be used for virus production such as an expression cell or expression cell line, a host cell or host cell line. HEK293 and 239T cells are common viral production cell lines. “HEK293” refers to a cell line originally derived from human embryonic kidney cells grown in tissue culture. The HEK293 cell line grows readily in culture, and is commonly used for viral production. As used herein, “HEK293” can also refer to one or more variant HEK293 cell lines, i.e., cell lines derived from the original HEK293 cell line that additionally comprise one or more genetic alterations.

[0100] The cell can be an avian cell (e g., a chicken, quail, goose, or duck cell such as a duck retina cell). The cells can be primary cells (or cells from a primary cell culture), secondary cells (or cells from a secondary cell culture), or immortalized cells (or cells from a cell line). The terms a "primary cell" or "primary cell culture", as used herein, refer to a cell or culture which usually cannot be passaged beyond 50 population doublings before suffering senescence, culture arrest, or cell death. The terms a "secondary cell" or "secondary cell culture", as used herein, refer to a cell or culture which is directly derived from a primary cell or primary cell culture The population doubling limit still applies. The terms an "immortalized cell" or "immortalized cell culture", as used herein, refer to a cell or culture and its progeny that is not limited by the number of potential cell doublings.

[0101] In some embodiments, the cells are from a CR or CR.pIX cell line. The CR and CR.pIX cell lines are derived from immortalized Muscovy duck retina cells (Jordan, et al. 2009 in Vaccine 27, 748-756), designed for vaccine production. In some embodiments, the CR.pIX cell line is stably integrated into its genome a gene encoding the Adenovirus pIX protein or a functional variant thereof and expresses said gene. In some embodiments, the cells are chicken embryo fibroblast (CEF) cells. In some embodiment, the cell is an AGEl. CR.pIX cell. In some embodiments, the cell is a HEK293.

[0102] The cell used herein can be modified to express a T7 polymerase, for example, when the promoter is T7 promoter. The modified cell can be generated with a plasmid encoding a T7 polymerase using standard procedures known in the art (see e g., Example 3).

Gutless Picornavirus Particle

[0103] Provided herein includes a gutless picornavirus particle. The gutless picornavirus particle can comprise a picornavirus capsid and a messenger RNA (mRNA) encoding a heterologous polypeptide. The term “gutless picornavirus particle” used herein refers to a picornavirus capsid (e.g., a picornavirus capsid/particle with removal of all viral protein coding sequences both structural and nonstructural and retaining a minimal amount of picornavirus cis elements required for replication and packaging into the capsid) and are incapable of expressing any picornavirus antigens in the infected cells (hence the term “gutless”). The gutless picornavirus particle herein described can provide a significant advantage of accommodating large inserts of foreign DNA (~7kp) while eliminating the problem of expressing picornavirus genes that may result in an immunological response to viral proteins when the vector is used in gene therapy. In some embodiments, the gutless picornavirus particle comprises an SVV capsid.

[0104] In some embodiments, the picornavirus capsid of the gutless picornavirus particle has structural features similar to that of a wild type picornavirus. For example, the gutless picornavirus particles can be non-enveloped, spherical, about 30 nm in diameter, and have an icosahedral capsid encapsulating the mRNA encoding a heterologous polypeptide. The capsid consists of a densely-packed icosahedral arrangement of 60 protomers each consisting of four polypeptides, VP1, VP2, Vp3 and VP4. VP4 is located on the internal side of the capsid.

[0105] The gutless picornavirus particle described herein can comprise a mRNA encapsulated in the picornavirus capsid (e.g., an SVV capsid). In some embodiments, the mRNA is not linked (e g., covalently linked) to a picornavirus polyprotein or a portion thereof (either structural or non- structural proteins including VP1, VP2, VP3, VP4, 2A, 2B, 2C, 3 A, 3B, 3C, and 3D proteins). In some embodiments, the mRNA is not linked to a picornaviral protein (e.g., VP1, VP2, VP3, or VP4). In some embodiments, the mRNA is not covalently linked to the picornavirus capsid.

[0106] In some embodiments, the gutless picornavirus particle does not comprise a picornavirus genome or a portion thereof. In some embodiments, the gutless picornavirus particle does not comprise any polynucleotides (e.g., mRNAs) encoding viral proteins. In some embodiments, the gutless picornavirus particles does not comprise any polynucleotides (e.g., mRNAs) encoding a picornavirus polyprotein or a portion thereof (either structural or non- structural proteins including VP1, VP2, VP3, VP4, 2A, 2B, 2C, 3A, 3B, 3C, and 3D proteins). In some embodiments, the gutless picornavirus particle does not comprise any polynucleotides (e.g., mRNAs) encoding one or more picornaviral protein SVV VP1, VP2, VP3, or VP4. In some embodiments, the mRNA in the gutless picornavirus particles is heterologous to the picornavirus genome. The picornavirus can be any strain of genera Enterovirus, Aphthovirus, Cardiovirus, Hepatovirus, or Senecavirus. In some embodiments, the picornavirus is SVV (e.g., Seneca valley virus A).

[0107] A variety of therapeutic genes can be encapsulated in the gutless picornavirus particle. Non-limiting examples of a therapeutic gene can include a therapeutic antibody or fragment thereof, a CRISPR/Cas system or portion(s) thereof, antisense RNA, siRNA and others identifiable to a skilled person. In some embodiments, the heterologous polypeptide is a RNA- guided DNA endonuclease (e.g., a Cas protein). In some embodiments, the gutless picornavirus particle can further comprise a guide RNA.

[0108] FIG. 6 illustrates an exemplary T7-MVA system for production of picornaviral capsids carrying Cas9 mRNA.

[0109] Provided herein also includes a method of generating a gutless picornavirus particle herein described. The method can comprise infecting a producer cell with a recombinant Vaccinia viral vector herein described, culturing the producer cell, and obtaining a gutless picornavirus particle comprising a picornavirus capsid and a messenger RNA (mRNA) encoding the heterologous polypeptide. The Vaccinia viral vector can be, for example, a Modified Vaccinia Ankara (MV A) viral vector.

[0110] The producer cell can be infected with a recombinant Vaccinia viral vector (e.g., MV A) described herein techniques known in the art. The producer cells infected with a recombinant Vaccinia viral vector can be cultured under conditions sufficient and suitable for the production of the gutless picornavirus particles. The cells can be cultured under serum-free conditions devoid of animal serum. In some embodiments, the cells are cultured in cell proliferation medium (e.g., a medium that supports cell division) and/or virus production medium (e.g., a medium that enhances production of a virus) for 1, 2 or 3 days.

[OHl] In some embodiments, the method can comprise isolating viral particles from the cells. Accordingly, in some embodiments, the method can comprise lysing the producer cell after culturing the producer cell. Any cell lysis techniques suitable to effectively release viral particles in the cells can be used herein. Cell lysis can comprise physical approaches such as mechanical disruption, liquid homogenization, high frequency sound waves (sonication), freeze/thaw cycles and manual grinding, or detergent- or solution-based cell lysis methods as will be understood by a person skilled in the art. In some embodiments, lysing the producer cell comprises freezing and thawing the producer cell one or more times. This step involves freezing a cell suspension in a dry ice/ethanol bath or freezer and then thawing the material at room temperature or higher (e g., 37 °C). This method of lysis can cause cells to swell and ultimately break. Multiple cycles may be necessary for efficient lysis.

[0112] Viral particles can be isolated from cell-free supernatant and/or cell lysate. In some embodiments, the viral particles are isolated from the cell lysate via centrifugation, sedimentation, and/or filtration. A person skilled in the art will be able to adapt/adjust the appropriate separation parameters such as the acceleration force and/or time using centrifugation for separation, filter size using filtration for separation, and/or sedimentation time using sedimentation for separation, in order to isolate viral particles from the cells.

[0113] In some embodiments, the method comprises separating the gutless picornavirus particles from the Vaccinia viral particles (e.g., MVA viral particles) also generated from the transfection. The method can comprise contacting the isolated viral particles with a solvent (e.g., a lipid solvent) that can damage or solubilize the lipid membrane of enveloped Vaccinia viral particles (e.g., MVA particles) due to the solvent’ s effect on the physical properties of the lipid matrix while leaving the non-enveloped picornavirus particles intact. The lipid solvent can be any non-polar or weakly polar organic solvent including, for example, chloroform, methanol, acetone, dichloromethane, ether, benzene, acetone or any lipid solvent suitable for lipid extraction. In some embodiments, the lipid solvent comprises chloroform. The method can also comprise precipitating the picornavirus particle by polyethylene glycol (PEG), inactivating the Vaccinia viral vector (e.g., MVA viral vector) using chloroform, ultracentrifugation, or a combination thereof. To remove the nucleic acids external of the picomavirus particles, the method can further comprise a nuclease digestion process (see e g., Example 4).

[0114] FIG. 7A shows a non-limiting exemplary flowchart for generating gutless picomavirus particles. The method can comprise providing a producer cell and a recombinant MVA encoding picornaviral proteins and a heterologous polypeptide (e g., Cas9) (601). The producer cell can be an adherent cell or a non-adherent cell. The method also comprises infecting the producer cell with the recombinant MVA (602), culturing the producer cell (603), lysing the producer cell (e g., using free/thaw cycles) (604), isolating the viral particles which contain MVA viral particles and gutless picornaviral particles (605). The method also comprises isolating the gutless picornaviral particles from the MVA particles by, for example, exposing the viral particles with a lipid solvent (606). The method can also comprise removing exterior nucleotide acids with nuclease digestion (607), and then collecting the gutless picornaviral particles using ultracentrifugation (608). FIG. 7B shows a non-limiting exemplary workflow for obtaining gutless SVV particles loaded with Cas9 mRNA.

[0115] In some embodiments, the producer cell is a non-adherent/suspension cell. The terms “non-adherent cell” and “suspension cell” refer to a cell that is able to survive in a suspension culture without being attached to a surface (e.g. tissue culture plastic carrier or microcarrier). The cell may be a cell which can naturally live in suspension without being attached to a surface. The cell may also be a cell which has been modified or adapted to be able to survive in a suspension culture without being attached to a surface (e.g., tissue culture plastic carrier or microcarrier). A non-adherent cell can usually be grown to a higher density than adherent conditions would allow. It is, thus, more suited for culturing in an industrial scale, e.g. in a bioreactor setting or in an agitated culture. Cells can be adapted to a non-adherent cell culture using protocols for transferring a cell from an adherent state into a non-adherent state (see e.g., Appl Microbiol Biotechnol. 2008 Mar;78(3):391-9. Epub 2008 Jan 9). In some embodiments, the non- adherent/suspension cell grows under serum-free conditions. The term “serum-free conditions” as used herein refers to conditions where cells grow in medium devoid of animal serum and/or animal derived components and without any complex mixtures of biologic component.

[0116] In some embodiments, the producer cell is an adherent cell. The term “adherent cell” as used herein refers to a cell which requires a surface, such as tissue culture plastic carrier or micro-carrier. Said surface can be coated with extracellular matrix components to increase adhesion properties and provide other signals needed for growth and differentiation. The adherent cells require periodic passaging, but allow easy visual inspection under inverted microscope. The adherent cells have to be dissociated enzymatically (e.g. with trypsin). In addition, the growth of adherent cells is limited by surface area, which may limit product yields. In some embodiments, the adherent producer cell comprises HEK293 cell.

[0117] The producer cell can be any virus production cell or cell line herein described above in the context of generating a recombinant MVA. The producer cells useful for production of the viral particles described herein can include animal cells permissive for the MVA virus or cells modified to be permissive for the virus. In some embodiments, the producer cells can comprise HEK293, CR or CR.pIX cell line or AGEl.CR.pIX.

CRISPR-Cas System and RNA-Guided Endonucleases

[0118] The vectors, viral particles, methods, and kits described herein can be used in a gene editing system, such as in a CRISPR-Cas gene editing system, to genetically edit one or more target genes. For example, the CRISPR-Cas9 system is a naturally-occurring defense mechanism in prokaryotes that has been repurposed as a RNA-guided DNA-targeting platform used for gene editing. It relies on the DNA nuclease Cas9, and two noncoding RNAs-crisprRNA (crRNA) and trans-activating RNA (tracrRNA) to target the cleavage of DNA. crRNA drives sequence recognition and specificity of the CRISPR-Cas9 complex through Watson-Crick base pairing typically with a 20 nucleotide (nt) sequence in the target DNA. The CRISPR-Cas9 complex only binds DNA sequences that contain a sequence match to the first 20 nt of the crRNA, single-guide RNA (sgRNA), if the target sequence is followed by a specific short DNA motif (with the sequence NGG) referred to as a protospacer adjacent motif (PAM). TracrRNA hybridizes with the 3’ end of crRNA to form an RNA-duplex structure that is bound by the Cas9 endonuclease to form the catalytically active CRISPR-Cas9 complex, which can then cleave the target DNA. Once the CRISPR-Cas9 complex is bound to DNA at a target site, two independent nuclease domains within the Cas9 enzyme each cleave one of the DNA strands upstream of the PAM site, leaving a double-strand break (DSB) where both strands of the DNA terminate in a base pair (a blunt end). After binding of CRISPR-Cas9 complex to DNA at a specific target site and formation of the site-specific DSB, the next key step is repair of the DSB. Cells use two main DNA repair pathways to repair the DSB: non-homologous end-joining (NHEJ) and homology- directed repair (HDR). In some embodiments, CRISPR-Cas9 gene editing system comprises an RNA-guided nuclease and one or more guide RNAs targeting one or more target genes.

[0119] As described herein, the RNA-guided endonuclease can be naturally-occurring or non-naturally occurring. Non-limiting Examples of RNA-guided endonuclease include a Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csxl2), CaslOO, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, and Cpfl endonuclease, and functional derivatives thereof. In some instances, the RNA-guided endonuclease is a Cas9 endonuclease. The Cas9 endonuclease can be from, e.g., Streptococcus pyogenes (SpyCas9 or SpCas9), Staphylococcus lugdunensis (SluCas9), or Staphylococcus aureus (SaCas9). In some embodiments, the RNA- guided endonuclease is a variant of Cas9, including but not limited to, a small Cas9, a dead Cas9 (dCas9), and a Cas9 nickase.

[0120] The RNA-guided endonuclease can be a small RNA-guided endonuclease. The small RNA-guided endonucleases can be engineered from portions of RNA-guided endonucleases derived from any of the RNA-guided endonucleases described herein and known in the art. The small RNA-guided endonucleases can be, e.g., small Cas endonucleases. In some cases, a small RNA-guided nuclease is shorter than about 1100 amino acids in length.

[0121] The RNA-guided endonuclease can be a mutant RNA-guided endonuclease. For example, the RNA-guided endonuclease can be a mutant of a naturally occurring RNA-guided endonuclease. The mutant RNA-guided endonuclease can also be a mutant RNA-guided endonuclease with altered activity compared to a naturally occurring RNA-guided endonuclease, such as altered endonuclease activity (e.g., altered or abrogated DNA endonuclease activity without substantially diminished binding affinity to DNA). Such modification can allow for the sequence-specific DNA targeting of the mutant RNA-guided endonuclease for the purpose of transcriptional modulation (e.g., activation or repression); epigenetic modification or chromatin modification by methylation, demethylation, acetylation or deacetylation, or any other modifications of DNA binding and/or DNA-modifying proteins known in the art. In some embodiments, the mutant RNA-guided endonuclease has no DNA endonuclease activity.

[0122] The RNA-guided endonuclease can be a nickase that cleaves the complementary strand of the target DNA but has reduced ability to cleave the non-compl ementary strand of the target DNA, or that cleaves the non-complementary strand of the target DNA but has reduced ability to cleave the complementary strand of the target DNA. In some embodiments, the RNA-guided endonuclease has a reduced ability to cleave both the complementary and the non- complementary strands of the target DNA.

[0123] The RNA-guided endonuclease can be derived from different types of CRISPR/Cas systems. In some embodiments, the CRISPR/Cas system comprises components derived from a Type-I, Type-II, or Type-III system. Updated classification schemes for CRISPR/Cas loci define Class 1 and Class 2 CRISPR/Cas systems, having Types I to V or VI (Makarova et al., (2015) Nat Rev Microbiol, 13(11):722-36; Shmakov et al., (2015) Mol Cell, 60:385-397). Class 2 CRISPR/Cas systems have single protein effectors. Cas proteins of Types II, V, and VI are single-protein, RNA-guided endonucleases, herein called “Class 2 Cas nucleases.” Class 2 Cas nucleases include, for example, Cas9, Cpfl, C2cl, C2c2, and C2c3 proteins. The Cpfl nuclease (Zetsche et al., (2015) Cell 163 : 1-13) is homologous to Cas9, and contains a RuvC-like nuclease domain.

[0124] In some embodiments, the Cas nuclease is from a Type-I CRISPR/Cas system. In some embodiments, the Cas nuclease is a component of the Cascade complex of a Type-I CRISPR/Cas system. For example, the Cas nuclease is a Cas3 nuclease In some embodiments, the Cas nuclease is derived from a Type-III CRISPR/Cas system. In some embodiments, the Cas nuclease is derived from Type-IV CRISPR/Cas system. In some embodiments, the Cas nuclease is derived from a Type-V CRISPR/Cas system. In some embodiments, the Cas nuclease is derived from a Type-VI CRISPR/Cas system.

Guide RNAs (gRNAs)

[0125] In some embodiments, the disclosure provides methods for synthesizing a gRNA (e.g., sgRNA) for use with an RNA-guided endonuclease. A guide RNA can direct the activities of the RNA-guided endonuclease to a specific target sequence within a target nucleic acid. A guide RNA comprises at least a spacer sequence that hybridizes to a target nucleic acid sequence of interest, and a CRISPR repeat sequence. The gRNA can be a single-molecule guide RNA or a double-molecule guide RNA. The RNA-guided endonuclease can be, for example a Cas endonuclease, including Cas9 endonuclease. The Cas9 endonuclease can be, for example, a SpyCas9, a SaCas9, or a SluCas9 endonuclease. In some embodiments, the RNA-endonuclease is a Cas9 variant. In some embodiments, the RNA-guided endonuclease is a small RNA-guided endonuclease. In some embodiments, the RNA-guided endonuclease is a small Cas endonuclease.

[0126] In some embodiments, the gRNA comprise 5’ to 3’ : a crRNA and a tracrRNA, wherein the crRNA and tracrRNA hybridize to form a duplex. In some embodiments, the crRNA comprises a spacer sequence capable of targeting a target sequence in a target nucleic acid (e.g., genomic DNA molecule) and a crRNA repeat sequence. In some embodiments, the tracrRNA comprises a tracrRNA anti-repeat sequence and a 3’ tracrRNA sequence. In some embodiments, the 3’ end of the crRNA repeat sequence is linked to the 5’ end of the tracrRNA anti-repeat sequence, e.g., by a tetraloop, wherein the crRNA repeat sequence and the tracrRNA anti-repeat sequence hybridize to form the sgRNA. In some embodiments, the sgRNA comprises 5’ to 3’ : a spacer sequence, a crRNA repeat sequence, a tetraloop, a tracrRNA anti-repeat sequence, and a 3’ tracrRNA sequence. In some embodiments, the sgRNA comprise a 5’ spacer extension sequence. In some embodiments, the sgRNA comprise a 3’ tracrRNA extension sequence. The 3’ tracrRNA can comprise, or consist of, one or more stem loops, for example one, two, three, or more stem loops. [0127] In some embodiments, the invariable sequence of the sgRNA comprises the nucleotide sequence of

GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 19), or a nucleotide sequence having up to 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide deletions, insertions, or substitutions relative to SEQ ID NO: 19 In some embodiments, the sgRNA is for use with a SpyCas9 endonuclease

[0128] The guide RNA disclosed herein can target any sequence of interest via the spacer sequence in the crRNA. In some embodiments, the degree of complementarity between the spacer sequence of the guide RNA and the target sequence in the target gene can be about, at least, at least about, at most or at most about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, 100% or a number between any two of the values. In some embodiments, the spacer sequence of the guide RNA and the target sequence in the target gene is 100% complementary. In other embodiments, the spacer sequence of the guide RNA and the target sequence in the target gene may contain up to 10 mismatches, e.g., up to 9, up to 8, up to 7, up to 6, up to 5, up to 4, up to 3, up to 2, or up to 1 mismatch.

[0129] In some embodiments, the gRNAs described herein can be produced in vitro transcription (IVT), synthetic and/or chemical synthesis methods, or a combination thereof. Enzymatic (IVT), solid-phase, liquid-phase, combined synthetic methods, small region synthesis, and ligation methods are utilized. In one embodiment, the gRNAs are made using IVT enzymatic synthesis methods. Methods of making polynucleotides by IVT are known in the art and are described in WO2013/151666. Polynucleotides constructs and vectors can be used to in vitro transcribe a gRNA described herein.

[0130] Various types of RNA modifications can be introduced to the gRNAs to enhance stability, reduce the likelihood or degree of innate immune response, and/or enhance other attributes as described in the art. The gRNAs described herein can comprise one or more modifications including internucleoside linkages, purine or pyrimidine bases, or sugar. In some embodiments, a modification is introduced at the terminal of a gRNA with chemical synthesis or with a polymerase enzyme. Examples of modified nucleic acids and their synthesis are disclosed in WO2013/052523. Synthesis of modified polynucleotides is also described in Verma and Eckstein, Annual Review of Biochemistry, vol. 76, 99-134 (1998).

[0131] In certain embodiments, more than one guide RNA can be used with a CRISPR/Cas nuclease system. Each guide RNA can contain a different targeting sequence, such that the CRISPR/Cas system cleaves more than one target nucleic acid. In some embodiments, one or more guide RNAs can have the same or differing properties such as activity or stability within the Cas9 RNP complex. Where more than one guide RNA is used, each guide RNA can be encoded on the same or on different vectors.

Pharmaceutical Compositions and Methods of Treatments

[0132] Provided herein also includes pharmaceutical compositions comprising a gutless picornavirus particle described herein and pharmaceutically acceptable carrier and/or excipient. The gutless picornavirus particle can be used for various therapeutic applications in vivo, ex vivo, or in vitro.

[0133] The term "excipient", when used herein, is intended to indicate all substances in a pharmaceutical composition which are not active ingredients. Examples of excipients include, but are not limited to, binders, lubricants, thickeners, surface active agents, preservatives, emulsifiers, buffers, flavoring agents, and/or colorants. Acceptable carrier(s) and/or diluent(s) for therapeutic use are well known in the pharmaceutical art and are described, for example, in Remington's Pharmaceutical Sciences, Mack Publishing Co. (A. R Gennaro edit. 1985). Examples of suitable carriers include, but are not limited to, magnesium carbonate, magnesium stearate, talc, sugar, lactose, pectin, dextrin, starch, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose, a low melting wax, and/or cocoa butter. Examples of suitable diluents include, but are not limited to, ethanol, glycerol, and/or water. The pharmaceutical excipient(s), diluent(s), and/or carrier(s) can be selected with regard to the intended route of administration and standard pharmaceutical practice. The pharmaceutical compositions may further comprise suitable binder(s), lubricant(s), suspending agent(s), coating agent(s), and/or solubilizing agent(s). Examples of suitable binders include, but are not limited to, starch, gelatin, natural sugars such as glucose, anhydrous lactose, free-flow lactose, beta-lactose, corn sweeteners, natural and synthetic gums, such as acacia, tragacanth or sodium alginate, carboxymethyl cellulose, and/or polyethylene glycol. Examples of suitable lubricants include, but are not limited to, sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, and/or sodium chloride. Preservatives, stabilizers, dyes, antioxidants, suspending agents and/or flavoring agents may also be comprised in the pharmaceutical composition. Examples of preservatives include, but are not limited to, sodium benzoate, sorbic acid, and/or esters of phydroxybenzoic acid.

[0134] The pharmaceutical compositions can be formulated in any conventional manner using one or more physiologically acceptable carriers and/or excipients and to be compatible with its intended route of administration. The gutless picornavirus particles may be formulated for administration by, for example, injection (e.g., cutaneous, subcutaneous, or intravenous), inhalation or insulation (either through the mouth or the nose) or by oral, buccal, parenteral or rectal administration, or by administration directly to a target site (e.g., tumor site).

[0135] Pharmaceutical compositions for oral administration can be in tablet, capsule, powder or liquid form. A tablet can comprise a solid carrier or an adjuvant. Liquid pharmaceutical compositions generally comprise a liquid carrier such as water, petroleum, animal or vegetable oils, mineral oil or synthetic oil, physiological saline solution, dextrose or other saccharide solution or glycols such as ethylene glycol, propylene glycol or polyethylene glycol. A capsule can comprise a solid carrier such a gelatin. Pharmaceutical compositions for injection can be in the form of an aqueous solution with suitable pH, isotonicity and stability. Suitable solutions can comprise, for example, isotonic vehicles such as Sodium Chloride, Ringer's solution, and/or Lactated Ringers solution. Preservatives, stabilizers, buffers, antioxidants and/or other additives may be included, as required The mode of administration, the dose, and the number of administrations of the pharmaceutical composition can be optimized by the skilled person.

[0136] Accordingly, the present disclosure also provides a method of treating a subject in need thereof. The method can comprise administering to the subject a pharmaceutically effective amount of a gutless picomavirus particle herein described or the pharmaceutical composition comprising the gutless picomavirus particle. In some embodiments, the gutless picornavirus particle or the pharmaceutical composition thereof can be administered by aerosol delivery, nasal delivery, vaginal delivery, rectal delivery, buccal delivery, ocular delivery, local delivery, topical delivery, intraci sternal delivery, intraperitoneal delivery, oral delivery, intramuscular injection, intravenous injection, subcutaneous injection, intranodal injection, intratumoral injection, intraperitoneal injection, and/or intradermal injection, or any combination thereof. The administration can be local or systemic. The systemic administration includes enteral and parenteral administration. In some embodiments, the gutless picomavirus particles or the pharmaceutical composition thereof can be administered by direct injection into cardiac or central nervous system (CNS) tissue. In some embodiments, more than one administration can be employed to achieve the desired level of gene expression over a period of various intervals, e.g., daily, weekly, monthly, or yearly.

[0137] The gutless picornavirus particle herein described and the pharmaceutical composition thereof can be administered to a subject in need thereof at a pharmaceutically effective amount. The term “pharmaceutically effective amount” as used herein means that the amount of the pharmaceutical composition that will elicit a desired therapeutic effect and/or biological or medical responses of a tissue, system, animal or human. The administration can result in expression of a therapeutically effective amount of a heterologous peptide encoded by the mRNA encapsulated in the gutless picornavirus particles.

[0138] Provided herein also includes a method for performing gene editing in a cell. The method can comprise contacting a gutless picomavirus particle herein described with a cell, wherein the gutless picornavirus particle comprises a mRNA encoding a RNA-guided DNA endonuclease, thereby expressing the RNA-guided DNA endonuclease in the cell. The gutless picornavirus particle can be contacted with the cell in vitro, ex vivo, or in vivo. In some embodiments, the contacting can occur in a subject (e g., a human).

EXAMPLES

[0139] Some aspects of the embodiments discussed above are disclosed in further detail in the following examples, which are not in any way intended to limit the scope of the present disclosure.

Example 1

Generation of wild-type Seneca Valiev Virus (SVV) from plasmid carrying full-length cDNA

[0140] This example describes the generation of a full-length infectious SVV cDNA plasmid with and without GFP encoding sequences under the transcriptional control of the T7 promoter.

[0141] Materials used in this example include: (1) Plasmids: (a) pCTX-1724 (SEQ ID NO: 4) and (b) pCTX-1726-mod-2A (SEQ ID NO: 5); and (2) Reagents and Kits: (a) QIAquick Gel Extraction Kit (Qiagen), (b) Restriction endonuclease ‘Asci’ (New England Biolabs), (c) Hi- T7 RNA Polymerase Kit (New England Biolabs), (d) ReliaPrep™ RNA Clean-Up and Concentration System (Promega), and (e) MessengerMAX Transfection Reagent (Thermo Fisher).

[0142] Plasmids containing the wild-type sequence of the Seneca Valley Virus A (SVV) were generated by gene synthesis. For the rescue of full-length infectious SVV particles with and without GFP expression, isolated plasmid DNA was linearized using the endonuclease Asci. The plasmid DNA was then purified using the QIAquick Gel Extraction Kit and collected in a final volume of 30 pl. Purified DNA was then used as template for the in vitro transcription of RNA using the T7 promoter and the Hi-T7 RNA Polymerase Kit. For the transcription of infectious SVV RNA in a 20 pl scale, 2 pl lOx reaction buffer, 1 pl NTPs (ImM each), 1 pg template, 0.5 pl RNase inhibitor, and 2 pl Hi-T7 RNA Polymerase were used. Samples were subsequently incubated at 45°C for 90 minutes followed by DNase digestion (incubation at 37°C for 30 minutes). The in vitro transcribed RNA was then harvested using the ReliaPrep™ RNA Clean-Up and Concentration System.

[0143] For the rescue of infectious SVV viruses (with and without GFP) the purified RNA was transfected into adherent Human Embryonic Kidney (HEK) 293 cells in a T25 flask using the MessengerMAX Transfection Reagent. The supernatant (500 pl) containing the infectious SVV particles was purified by centrifugation (500x g, 5 min at room temperature) and passaged further onto non-infected HEK 293 cells. It was found that clear cytopathic effect (CPE) was detectable 24-48 hours post infection.

Example 2

Identification of Cis regulatory element (CRE) of SVV

[0144] Infectious cDNA plasmids pCTX-1726-mod-2A (SEQ ID NO: 5), pCTX- 1727-mod-2A (SEQ ID NO: 6), pCTX-1728-mod-2A (SEQ ID NO: 7), pCTX-1729-mod-2A (SEQ ID NO: 8), and pCTX-1730-mod-2A (SEQ ID NO: 9) were generated and assayed in this example.

[0145] Using sequence analysis, putative CRE regions within the SVV genome were identified. All putative CRE regions were mutated by point mutations (see FIG. 3) to identify the CRE regions reveals biological function,. It was expected that virus rescue could only occur in case the authentic CRE region is still intact. For the rescue experiments, isolated plasmid DNA was linearized by using restriction endonuclease Asci (New England Biolabs) and purified using the QIAquick Gel Extraction Kit (Qiagen) and collected in a final volume of 30 pl . Purified DNA was then used as template for the in vitro transcription of RNA using the T7 promoter and the Hi- T7 RNA Polymerase Kit (New England Biolabs). For the transcription of infectious SVV RNA in a 20 pl scale: 2 pl lOx reaction buffer, 1 pl NTPs (ImM each), 1 pg template, 0.5 pl RNase inhibitor, and 2 pl Hi-T7 RNA Polymerase were used. Samples were subsequently incubated at 45°C for 90 minutes followed by DNase digestion (incubation at 37°C for 30 minutes). The in vitro transcribed RNA was then harvested using the ReliaPrep™ RNA Clean-Up and Concentration System (Promega).

[0146] For the rescue of infectious SVV viruses (with and without GFP) the purified RNA was transfected into adherent Human Embryonic Kidney (HEK) 293 cells in a T25 flask using the MessengerMAX Transfection Reagent (Thermo Fisher). The supernatant (500 pl) containing the infectious SVV particles was purified several days post transfection by centrifugation (300x g, 5 min at room temperature) and passaged further onto non-infected HEK 293 cells. As shown in FIG. 4, in all cases, a clear cytopathic effect (CPE) was detectable 24 post infection except in two samples: the mock transfected control and the well transfected with construct pCTX-1728-mod-2A (SEQ ID NO: 7). The results indicated that the mutation of the authentic CRE region prevented the formation of infectious SVV particles.

Example 3

Generation of vaccinia virus system for expression of SVV structural and non- structural proteins Generation of an AGEl.CR.pIX cell expressing the T7 polymerase

[0147] AGE1 CR.pIX cells were transfected using the Effectene Transfection Reagent (Qiagen) and the plasmid PBGGPEx2.0_TD_T7opt (SEQ ID NO: 1) in presence of RNA encoding the DirectedLuck transposase. Single cell clones of transfected cells were subsequently screened based on the expression level of T7 polymerase gene and the cell clone with highest expression was selector for further experiments.

Generation of a recombinant MVA strain encoding cas9 and the modified SW genome

[0148] MVA encoding cas9 and the modified SVV genome was generated by homologous recombination. Firstly, AGEl.CR.pIX cells were transfected with the plasmid SVV replicon-Cas9 (SEQ ID NO: 11) using the Effectene transfection reagent (Qiagen) and infected simultaneously with the MVA CR19 virus strain. Cell plaques revealing a clear cytopathic effect (CPE) 48 hours post transfection/infection were picked, screened for the presence of the transgene via PCR, and viral material thereof was used for re-infection of AGEl .CR.pIX cells. After seven passages, the recombinant virus was free of contaminating wild type MVA CR19 and the identical procedure for the second integration (the SVV genome) was started by transfecting the AGEl.CR.pIX cells with the plasmid SVV Capsid Donor (SEQ ID NO: 10) and infecting them with the newly generated recombinant MVAs.

Example 4

Generation of gutless SVV vector carrying Cas9 mRNA

[0149] This example shows that SVV particles carrying cas9 RNA were generated by infecting AGEl.CR.pIX cells stably transfected with the T7 polymerase expressing construct.

[0150] AGEl.CR.pIX cell culture in 100 ml culture volume (at a cell density of 2 x 10⁶ cells per ml) was infected with the recombinant MVA that encodes cas9 and the modified SVV genome under a T7 promoter using a multiplicity of infection (MOI) of 1. Forty-eight hours post infection cells were lysed by 3x freeze/thaw lysis steps and cell debris was removed by centrifugation (300 x g, 5 minutes). Subsequently, SVV particles were concentrated by mixing 16% polyethylene glycol (PEG) supplemented with 1 M NaCl with the lysate at equal amounts (v:v) followed by incubation for 72 hours at 4° C. Then, PEG precipitated SVV particles were collected by centrifugation (3,200 x g, 60 min) and the resulting pellet was resuspended in 500 pl purification buffer (10 mM TrisHCl, 200 mMNaCl, 50 mM MgCE, pH 7.5). To inactivate MVA particles while keeping the SVV particles intact, chloroform was added to a final concentration of 5% and the solution was incubated for 60 min at room temperature while vortexing every 5 minutes. Then the solution was centrifuged at 12,000 x g, 60 sec and the aqueous phase was isolated.

[0151] To remove all nucleic acids (except those in the SVV particles) Salt Active Nuclease (SAN-HQ, 250 U/ml) was added and incubated at 37° C for 16 hours. SW particles within the resulting material were further concentrated using ultracentrifugation (30% sucrose cushion, 38,000 rpm, 18° C, 7 hours, Beckman SW40Ti). The pellet was incubated with 500 pl purification buffer (10 mM Tris-HCl, 200 mM NaCl, 50 mM MgCh, pH 7.5) at 4° C for 16 hours, resuspended and finally stored at -80° C.

Example 5

In vitro editing mediated by gutless SVV-Cas9 vector expressing SpCas9

[0152] This example demonstrates that the gutless SVV-Cas9 vector expressing SpCas9 is capable of mediating in vitro editing.

Generation of reporter cells to detect NHEJ by induction ofGFP

[0153] HEK 293 (293vs, Probiogen) cells were transfected with the plasmid ‘PBGPPEx2.0p_PGK_Target-Site_GFP_U6 promoter’ (SEQ ID NO: 2) together with RNA encoding the DirectedLuck transposase the using the Effectene transfection reagent (Qiagen). One pg of the plasmid DNA was mixed together with one pg RNA in 200 pl reaction buffer and 16 pl of the ‘enhancer’ solution. Five minutes later, 20 pl of the Effectene transfection mix was added, incubated for ten minutes and added to one well of a six well plate filled with HEK 293 cells (8 x 10⁵ cells) seeded the day before. Two days post transfection the puromycin selection process was initiated, followed by single cell cloning nine additional days later. Resulting, duplicated cell colonies were tested 19 days later using plasmid ‘pCTX528sv40’ which encodes the SpCas9 driven by a pol II promoter (SEQ ID NO: 3) and one clone (293TS LB689/72) was selected that showed the lowest GFP expression without SpCas9 stimulation and the highest GFP expression with SpCas9 stimulation.

Demonstration of in vitro editing mediated by gutless SW-Cas9 vector expressing SpCas9

[0154] Though the generated reporter cells are capable to detect the presence of SpCas9 at high concentrations, the NHEJ effect induced by lower amounts of Cas9 cannot be monitored directly by measuring GFP expression (e.g., by flow cytometry or microscopy). Therefore, the target sequence edited by the SpCas9 nuclease was enriched by a so-called ‘enhanced-ice-COLD-PCR’ technique (described in Tost J. The clinical potential of Enhanced- ice-COLD-PCR. Expert Review of Molecular Diagnostics. 2016;16(3):265-268, PMID: 26589575). DNA containing potentially edited target sequences was isolated using the QIAamp DNA Blood Mini Kit (Qiagen) and applied within the enhanced-ice-COLD-PCR reaction using the oligonucleotides ‘Primer F cas9_rep’ (TTTTCCCAAGGCAGTCTGGA, SEQ ID NO: 12) and ‘Primer R reporter’ in the presence of the blocking probe containing LNA modifications (AACgAATTCgAAACCTTCgAAAggAggCCgCCA+C+A+C+A+T+CgCTgTC— PH, SEQ ID NO: 13, “+” represents LNA modification) and a phosphate adaption at the 3 ’-end. Thereby, the wild-type DNA is preferentially not amplified by PCR since the blocking probe binds at higher affinity to the wild-type compared to the edited sequence, and the phosphate modification at the 3 ’-end prevents further elongation. Thereby, those sequences are enriched that do show a mismatch at the cas9 cleavage site, since the blocking probe cannot bind here at the given annealing temperature of 70° C.

[0155] Resulting material was then analyzed using the digital droplet PCR (ddPCR). In the analysis, oligonucleotides ‘Primer F’ (CTGTTCTCCTCTTCCTCATCTC, SEQ ID NO: 14) and ‘Primer_R’ (CAATGACTACGTGTAAATACAACGA, SEQ ID NO: 15) were mixed together with two probes: (1) ‘Probe_WT’ (6-FAM-AGCG+A+T+GTG+T+GG-Iowa Black FQ, SEQ ID NO: 16, “+” indicates LNA modification) and (2) ‘Probe_Reference’ (HEX- GCT+GA+TT+G+ATT+G+GTC-Iowa Black FQ, SEQ ID NO: 17, “+” indicates LNA modification) and the 2x ddPCR Supermix (Bio-Rad) to perform ddPCR.

[0156] As shown in FIG. 8, cells that were treated with SVV particles obtained by infection with the MVA encoding both the cas9 and the SVV polyprotein sequence showed an increased level of gene editing at similar rates compared to the positive control ATG_gRNA_pos_ctrl (gBlock with an indel at the predicted cas9 cleavage site). However, AGEl.CR.pIX cells that were infected with the recombinant MVA encoding cas9 only are not capable of producing SVV particles and, as expected, did not show any signs of NHEJ.

AT G_gRNA _pos_ctrl :

CCCATGAGACATACAAAAAGGTAATGCCGCCTCGCTAGGTGAGCTACAGCTCGATTGTCACGTT AAGCTGGCCTCAGGGGCGGGGCGGGCGCCCGAAGGTCCTCCGGAGGCCCGGCATTCCGCACGCT TCAAAAGCGCACGTCTGCCGCGCTGTTCTCCTCTTCCTCATCTCCGGGCCTTTCAGCGCTGATT GATTGGTCTGACAGCGAGTGTGGCGGCCTCCTTTCGAAGGTTTCGAATTCGTTGTATTTACACG TAGTCATTGGTATCGGAAAAGGTGACCCGTTTATCAGGCAAGTCGCTTTGACCGTTTTCCTAGG GATTCAGTACATCTGGATTGCAGGGCTGAAGTGGCTGAAAAGGAAAGAGCCGAATCCGTACCGC AGCCGACCAGCACGTCTGCCGCCATCCGACAACCCCAGTATACACGCGGTGCCCACTTGACTGA CACCTTTGCCACCGGTCTCGACTATACGCCCGTTTTCGGATC ( SEQ ID NO : 18 )

[0157] In addition, to confirm the formation of indels upon treatment with SVV particles loaded with cas9 RNA, PCR amplified regions of the cas9 target region were analyzed using Sanger sequencing. Using the ‘ICE Analysis’ tool (Synthego, ice.synthego.com/) the profile files of the Sanger sequencing were utilized to determine the rate of gene editing. The results (e.g., FIG. 9) confirmed the levels of NHEJ determined by ddPCR before (FIG. 8).

Terminology

[0158] In at least some of the previously described embodiments, one or more elements used in an embodiment can interchangeably be used in another embodiment unless such a replacement is not technically feasible. It will be appreciated by those skilled in the art that various other omissions, additions and modifications may be made to the methods and structures described above without departing from the scope of the claimed subject matter. All such modifications and changes are intended to fall within the scope of the subject matter, as defined by the appended claims.

[0159] With respect to the use of substantially any plural and/or singular terms herein, those having skill in the art can translate from the plural to the singular and/or from the singular to the plural as is appropriate to the context and/or application. The various singular/plural permutations may be expressly set forth herein for sake of clarity. As used in this specification and the appended claims, the singular forms “a,” “an,” and “the” include plural references unless the context clearly dictates otherwise. Any reference to “or” herein is intended to encompass “and/or” unless otherwise stated.

[0160] It will be understood by those within the art that, in general, terms used herein, and especially in the appended claims (e.g., bodies of the appended claims) are generally intended as “open” terms (e.g., the term “including” should be interpreted as “including but not limited to,” the term “having” should be interpreted as “having at least,” the term “includes” should be interpreted as “includes but is not limited to,” etc.). It will be further understood by those within the art that if a specific number of an introduced claim recitation is intended, such an intent will be explicitly recited in the claim, and in the absence of such recitation no such intent is present. For example, as an aid to understanding, the following appended claims may contain usage of the introductory phrases “at least one” and “one or more” to introduce claim recitations. However, the use of such phrases should not be construed to imply that the introduction of a claim recitation by the indefinite articles “a” or “an” limits any particular claim containing such introduced claim recitation to embodiments containing only one such recitation, even when the same claim includes the introductory phrases “one or more” or “at least one” and indefinite articles such as “a” or “an” (e.g., “a” and/or “an” should be interpreted to mean “at least one” or “one or more”); the same holds true for the use of definite articles used to introduce claim recitations. In addition, even if a specific number of an introduced claim recitation is explicitly recited, those skilled in the art will recognize that such recitation should be interpreted to mean at least the recited number (e.g., the bare recitation of “two recitations,” without other modifiers, means at least two recitations, or two or more recitations). Furthermore, in those instances where a convention analogous to “at least one of A, B, and C, etc.” is used, in general such a construction is intended in the sense one having skill in the art would understand the convention (e.g., “ a system having at least one of A, B, and C” would include but not be limited to systems that have A alone, B alone, C alone, A and B together, A and C together, B and C together, and/or A, B, and C together, etc.). In those instances where a convention analogous to “at least one of A, B, or C, etc.” is used, in general such a construction is intended in the sense one having skill in the art would understand the convention (e.g., “ a system having at least one of A, B, or C” would include but not be limited to systems that have A alone, B alone, C alone, A and B together, A and C together, B and C together, and/or A, B, and C together, etc.). It will be further understood by those within the art that virtually any disjunctive word and/or phrase presenting two or more alternative terms, whether in the description, claims, or drawings, should be understood to contemplate the possibilities of including one of the terms, either of the terms, or both terms. For example, the phrase “A or B” will be understood to include the possibilities of “A” or “B” or “A and B ”

[0161] In addition, where features or aspects of the disclosure are described in terms of Markush groups, those skilled in the art will recognize that the disclosure is also thereby described in terms of any individual member or subgroup of members of the Markush group.

[0162] As will be understood by one skilled in the art, for any and all purposes, such as in terms of providing a written description, all ranges disclosed herein also encompass any and all possible sub-ranges and combinations of sub-ranges thereof. Any listed range can be easily recognized as sufficiently describing and enabling the same range being broken down into at least equal halves, thirds, quarters, fifths, tenths, etc. As a non-limiting example, each range discussed herein can be readily broken down into a lower third, middle third and upper third, etc. As will also be understood by one skilled in the art all language such as “up to,” “at least,” “greater than,” “less than,” and the like include the number recited and refer to ranges which can be subsequently broken down into sub-ranges as discussed above. Finally, as will be understood by one skilled in the art, a range includes each individual member. Thus, for example, a group having 1-3 articles refers to groups having 1, 2, or 3 articles. Similarly, a group having 1-5 articles refers to groups having 1, 2, 3, 4, or 5 articles, and so forth.

[0163] While various aspects and embodiments have been disclosed herein, other aspects and embodiments will be apparent to those skilled in the art. The various aspects and embodiments disclosed herein are for purposes of illustration and are not intended to be limiting, with the true scope and spirit being indicated by the following claims.

Claims

WHAT IS CLAIMED IS:

1. A nucleic acid construct, comprising a picomaviral 5’ untranslated region (UTR) comprising a cloverleaf-like structure; a coding sequence for a heterologous polypeptide; a cis-acting replication element (CRE) or variant thereof; and a picomaviral 3’ UTR.

2. The nucleic acid construct of claim 1, comprising a sequence encoding a ribozyme.

3. The nucleic acid construct of claim 1, wherein the nucleic acid construct does not comprise coding sequence for at least one picornavirus protein

4. The nucleic acid construct of claim 1, wherein the nucleic acid construct does not comprise coding sequence for any picornavirus protein.

5. The nucleic acid construct of any one of claims 1-4, further comprising one or more stuffer sequences; and optionally wherein at least one of the one or more stuffer sequences is at 3’ of the coding sequence for the heterologous polypeptide.

6. The nucleic acid construct of any one of claims 1-5, wherein the picomaviral 5’ UTR, the picomaviral 3’ UTR, or both, are derived from a coxsackievirus, poliovirus, echovirus, rhinovirus, or enterovirus.

7. The nucleic acid construct of any one of claims 1-5, wherein the picomaviral 5’ UTR, the picomaviral 3’ UTR, or both, are derived from Seneca Valley Vims (SVV).

8. The nucleic acid construct of claim 7, wherein the CRE or variant thereof comprises a sequence having at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to the sequence of SEQ ID NO: 20 or SEQ ID NO: 21.

9. The nucleic acid construct of any one of claims 7-8, comprising an internal ribosome entry site (IRES), a 3’ pseudoknot, or a combination thereof.

10. The nucleic acid construct of any one of claims 1-9, wherein the heterologous polypeptide is a RNA-guided DNA endonuclease, and optionally the RNA-guided DNA endonuclease is Cas3, Cas8a, Cas5, Cas8b, Cas8c, CaslOd, Csel, Cse2, Csyl, Csy2, Csy3, GSU0054, CaslO, Csm2, Cmr5, CaslO, Csxll, CsxlO, Csfl, Cas9, Csn2, Cas4, Casl2, Casl2a, Cpfl, Casl2b, C2cl, Casl2c, C2c3, Casl2d, CasY, Casl2e, CasX, Casl2f, Casl4, C2cl0, Casl2g, Casl2h, Casl2i, Casl2k, C2c5, C2c4, C2c8, C2c9, Casl3, Casl3a, C2c2, Casl3b, Casl3c, or Casl3d.

11. The nucleic acid construct of claim 10, wherein the RNA-guided DNA endonuclease comprises or is a Cas polypeptide or a variant thereof, optionally the Cas polypeptide is Cas9, and further optionally the Cas9 is dCas9.

12. The nucleic acid construct of any one of claim 1-11, wherein the heterologous polypeptide comprises a base editor; and optionally the base editor is a cytosine base editor, an adenine base editor, or a dual-deaminase editor.

13. The nucleic acid construct of any one of claim 1-12, wherein the nucleic acid construct is a DNA construct, optionally wherein the nucleic acid construct comprises a promoter operably linked to the coding sequence for the heterologous polypeptide; and further optionally wherein the promoter is not derived from a picornavirus.

14. The nucleic acid construct of any one of claims 1-13, wherein the nucleic acid construct is a plasmid.

15. The nucleic acid construct of any one of claims 13-14, wherein the promoter is a T7 promoter, cytomegalovirus (CMV) promoter, chicken beta-actin (CAG) promoter, ubiquitin C (UBC) promoter, or any variant thereof.

16. A nucleic acid construct, comprising: a sequence that encodes for one or more Seneca Valley Virus (SVV) proteins; an inactivated picornaviral 5’ cloverleaf-like structure and/or an inactivated picornaviral cis-acting replication element (CRE), or does not comprises a 5’ cloverleaflike structure and/or a CRE or variant thereof; and a picornaviral 3’ UTR.

17. The nucleic acid construct of claim 16, comprising a sequence encoding a ribozyme.

18. The nucleic acid construct of any one of claims 16-17, comprising an inactivated 5’ cloverleaf-like structure and an inactivated CRE.

19. The nucleic acid construct of any one of claims 16-17, wherein the nucleic acid construct does not comprise any 5’ cloverleaf-like structure and any CRE.

20. The nucleic acid construct of any one of claims 16-19, wherein the sequence encodes for one or more of SVV VP1, VP2, VP3, VP4, 2A, 2B, 2C, 3A, 3B, 3C, and 3D proteins.

21. The nucleic acid construct of any one of claims 16-19, wherein the sequence encodes for SVV polyprotein.

22. The nucleic acid construct of any one of claims 16-21, wherein the nucleic acid construct does not comprise SVV packaging signal sequence.

23. The nucleic acid construct of any one of claims 16-22, further comprising an internal ribosome entry site (IRES), a 3’ pseudoknot, or a combination thereof.

24. The nucleic acid construct of any one of claims 16-23, wherein the nucleic acid construct is a plasmid.

25. The nucleic acid construct of any one of claims 16-24, wherein the nucleic acid construct is a DNA construct; and optionally the nucleic acid construct comprises a promoter operably linked with the sequence that encodes for one or more SVV proteins; optionally wherein the promoter is not derived from a picornavirus.

26. The nucleic acid construct of any one of claims 16-25, wherein the promoter is a T7 promoter, cytomegalovirus (CMV) promoter, chicken beta-actin (CAG) promoter, ubiquitin C (UBC) promoter, or any variant thereof.

27. A kit, comprising a first nucleic acid construct, wherein the first nucleic acid construct is a nucleic acid construct of any one of claims 1-15; and a second nucleic acid construct, wherein the second nucleic acid construct is a nucleic acid construct of any one of claims 16-26.

28. The kit of claim 27, wherein the promoters of the first and the second nucleic acid constructs are the same, and optionally both promoters are T7 promoters.

29. A cell, comprising a nucleic acid construct of any one of claims 1-15, a nucleic acid construct of any one of claims 16-26, or both.

30. A method of producing a recombinant Vaccinia viral vector, comprising

(a) co-transfecting a first cell with first nucleic acid construct and a parent Vaccinia vector, wherein the first nucleic acid construct is a nucleic acid construct of any one of claims 1-15, thereby generating a first recombinant Vaccinia viral vector integrated with the first nucleic acid construct or a portion thereof; and

(b) co-transfecting a second cell with the first recombinant Vaccinia viral vector and a second nucleic acid construct, wherein the second nucleic acid construct is a nucleic acid construct of any one of claims 16-26, thereby generating a second recombinant Vaccinia viral vector integrated with (i) the first nucleic acid construct or a portion thereof and (ii) the second nucleic acid construct or portion thereof.

31. The method of claim 30, wherein the Vaccinia viral vector is a Modified Vaccinia Ankara (MV A) vector.

32. The method of any one of claims 30-31, wherein the first and the second cells are AGEl.CR.pIX cells.

33. The method of any one of claims 31-32, wherein the parent MVA is MVA CR19 virus strain.

34. A recombinant vaccinia viral vector, comprising: a first Seneca Valley Virus (SVV) 5’ cloverleaf-like structure and a first nucleic acid sequence encoding a heterologous polypeptide; and a second nucleic acid sequence encoding one or more of SVV proteins.

35. The recombinant vaccinia viral vector of claim 34, wherein the recombinant vaccinia viral vector is a Modified Vaccinia Ankara (MV A) viral vector.

36. The recombinant vaccinia viral vector of any one of claims 34-35, comprising a first promoter operably linked to the first nucleic acid sequence, a second promoter operably linked to the second nucleic acid sequence, or both.

37. The recombinant vaccinia viral vector of any one of claims 34-36, wherein the heterologous polypeptide is a RNA-guided DNA endonuclease.

38. The recombinant vaccinia viral vector of any one of claims 34-35, wherein the second nucleic acid sequence encodes all of structural SVV proteins and/or all of nonstructural SVV proteins.

39. The recombinant vaccinia viral vector of any one of claims 34-38, wherein the first and second promoters are the same, and optionally both the first and second promoters are T7 promoter.

40. The recombinant vaccinia viral vector of any one of claims 34-39, comprising one or more of an SVV CRE element, an SVV 3’ pseudoknot and a stuffer sequence at 3’ of the first nucleic acid sequence encoding the heterologous polypeptide.

41. The recombinant vaccinia viral vector of any one of claims 34-40, comprising a nucleic acid sequence encoding one or more of A3L protein, A9L protein and A34R protein, wherein said nucleic acid sequence comprises at least one mutation resulting in an amino acid sequence modification of said gene product(s).

42. The recombinant vaccinia viral vector of claim 41, wherein the nucleic acid sequence encodes A3L, A9L and A34R proteins, and wherein the A3L protein comprises an amino acid sequence modification of H639Y, the A9L protein comprises an amino acid sequence modification of K75E, and the A34R protein comprises an amino acid sequence modification of D86Y.

43. A genome of a recombinant vaccinia viral vector of any one of claims 34-42.

44. A cell comprising a recombinant vaccinia viral vector of any one of claims 34-42 or the genome of claim 43.

45. A method of generating a gutless picornavirus particle, comprising: infecting a producer cell with a recombinant vaccinia viral vector of any one of claims 34-42; culturing the producer cell; and obtaining a gutless picornavirus particle comprising a picornavirus capsid and a RNA comprising a sequence encoding the heterologous polypeptide.

46. The method of claim 45, wherein the vaccinia viral vector is a Modified Vaccinia Ankara (MV A) viral vector.

47. The method of any one of claim 45-46, comprising lysing the producer cell after culturing the producer cell; and optionally wherein lysing the producer cell comprises freezing and thawing the producer cell one or more times.

48. The method of any one of claims 45-47, wherein obtaining the gutless picornavirus particle comprises isolating the gutless picornavirus particle from the vaccinia viral vector using a lipid solvent, optionally the lipid solvent is selected from the group consisting of: chloroform, methanol, acetone, dichloromethane, ether, benzene, acetone, or a combination thereof.

49. The method of any one of claims 45-48, wherein obtaining the gutless picornavirus particle comprises precipitating the gutless picornavirus particle by polyethylene glycol (PEG) and/or inactivating the vaccinia viral vector using chloroform, ultracentrifugation, or a combination thereof.

50. The method of any one of claims 45-49, comprising removing nucleic acids external of the picornavirus capsid by nuclease digestion.

51. The method of any one of claims 45-50, wherein the producer cell is an adherent cell.

52. The method of any one of claims 45-50, wherein the producer cell is a non-adherent cell.

53. The method of any one of claims 45-52, wherein the producer cell is a HEK293 or a AGEl.CR.pIX cell.

54. The method of any one of claims 45-53, wherein the producer cell stably expresses a T7 polymerase.

55. A gutless picornavirus particle, comprising: a picornavirus capsid; and a RNA comprising a sequence encoding a heterologous polypeptide, and optionally wherein the RNA is encapsulated in the picornavirus capsid.

56. The gutless picornavirus particle of claim 55, wherein the RNA is not covalently linked to a viral protein.

57. The gutless picornavirus particle of any one of claims 55-56, wherein the RNA is not covalently linked to the picornavirus capsid.

58. The gutless picornavirus particle of any one of claims 55-57, wherein the gutless picornavirus does not comprise any polynucleotides encoding viral proteins.

59. The gutless picornavirus particle of any one of claims 55-57, wherein the gutless picornavirus does not comprise any polynucleotides encoding picornaviral proteins.

60. The gutless picornavirus particle of any one of claims 55-57, wherein the RNA does not comprise any sequence encoding a viral protein.

61. The gutless picornavirus particle of any one of claims 55-57, wherein the RNA does not comprise any sequence encoding a viral structural protein, any sequence encoding a viral non- structural protein, or both.

62. The gutless picornavirus particle of any one of claims 55-57, wherein the RNA comprises an internal ribosome entry site (IRES), a cis-acting replication element (CRE), a cloverleaf-like structure, a 3’ untranslated region (UTR), or a combination thereof.

63. The gutless picornavirus particle of any one of claim 55-62, wherein the picornavirus is Seneca Valley Virus (SSV).

64. The gutless picornavirus particle of any one of claim 55-61, wherein the heterologous polypeptide is a RNA-guided DNA endonuclease, optionally wherein the RNA- guided DNA endonuclease is a Cas protein, further optionally the Cas protein is a Cas9, and further optionally the Cas9 is dCas9.

65. The gutless picornavirus particle of claim 64, wherein the RNA-guided DNA endonuclease is Cas3, Cas8a, Cas5, Cas8b, Cas8c, CaslOd, Csel, Cse2, Csyl, Csy2, Csy3, GSU0054, CaslO, Csm2, Cmr5, CaslO, Csxll, CsxlO, Csfl, Cas9, Csn2, Cas4, Casl2, Casl2a, Cpfl, Casl2b, C2cl, Casl2c, C2c3, Casl2d, CasY, Casl2e, CasX, Casl2f, Casl4, C2cl0, Casl2g, Casl2h, Casl2i, Casl2k, C2c5, C2c4, C2c8, C2c9, Casl3, Casl3a, C2c2, Casl3b, Cas 13c, or Casl3d endonuclease.

66. The gutless picornavirus particle of any one of claims 55-65, further comprises a guide RNA.

67. A pharmaceutical composition, comprising a gutless picornavirus particle of any one of claims 55-66; and a pharmaceutical acceptable carrier.

68. A method for producing a polypeptide of interest in a cell, comprising: contacting a gutless picornavirus particle of any one of claims 55-66 in a cell, thereby expressing the heterologous polypeptide in the cell.

69. A method for performing gene editing in a cell, comprising: contacting a gutless picornavirus particle with a cell, wherein the gutless picornavirus particle comprises a RNA comprising a sequence encoding a RNA-guided DNA endonuclease, thereby expressing the RNA- guided DNA endonuclease in the cell.

70. The method of any one of claims 68-69, wherein contacting the gutless picornavirus particle with the cell occurs in vitro and/or ex vivo.

71. The method of any one of claims 68-69, wherein contacting the gutless picornavirus particle with the cell is in a subject; and optionally wherein the gutless picornavirus particle is administered to the subject intravenously.