WO2023220566A1 - Polypeptides effecteurs crispr-cas et leurs procédés d'utilisation - Google Patents

Polypeptides effecteurs crispr-cas et leurs procédés d'utilisation Download PDF

Info

Publication number
WO2023220566A1
WO2023220566A1 PCT/US2023/066735 US2023066735W WO2023220566A1 WO 2023220566 A1 WO2023220566 A1 WO 2023220566A1 US 2023066735 W US2023066735 W US 2023066735W WO 2023220566 A1 WO2023220566 A1 WO 2023220566A1
Authority
WO
WIPO (PCT)
Prior art keywords
amino acid
crispr
acid sequence
polypeptide
cas effector
Prior art date
Application number
PCT/US2023/066735
Other languages
English (en)
Inventor
Basem AL-SHAYEB
Jennifer A. Doudna
Jillian F. Banfield
Original Assignee
The Regents Of The University Of California
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Regents Of The University Of California filed Critical The Regents Of The University Of California
Publication of WO2023220566A1 publication Critical patent/WO2023220566A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/09—Fusion polypeptide containing a localisation/targetting motif containing a nuclear localisation signal
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]

Definitions

  • a Sequence Listing is provided herewith as a Sequence Listing XML, “BERK- 466WO_SEQ_LIST” created on May 8, 2023 and having a size of 1,391,496 bytes. The contents of the Sequence Listing XML are incorporated by reference herein in their entirety.
  • CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
  • CRISPR-Cas systems include: (i) Cas proteins, which are involved in acquisition, targeting and cleavage of foreign DNA or RNA; and (ii) a guide nucleic acid (e.g., a guide RNA), which includes a segment that binds a Cas protein and a segment that binds to a target nucleic acid.
  • a guide nucleic acid e.g., a guide RNA
  • the programmable nature of these systems has facilitated their use as a versatile technology for use in modification of target nucleic acid.
  • the present disclosure provides CRISPR-Cas effector proteins, nucleic acids encoding same, and compositions comprising same.
  • the present disclosure provides ribonucleoprotein complexes comprising: a CRISPR-Cas effector protein of the present disclosure; and a guide nucleic acid (e.g., a guide RNA).
  • the present disclosure provides methods of modifying a target nucleic acid, using an RNA- guided CRISPR-Cas effector protein of the present disclosure and a guide RNA.
  • the present disclosure provides methods of modulating transcription of a target nucleic acid.
  • the present disclosure provides methods of detecting a target nucleic acid, using an RNA-guided CRISPR-Cas effector protein of the present disclosure and a guide RNA.
  • FIG. 1A-1I provide amino acid sequences of examples of CasGamma polypeptides of the present disclosure, as well as nucleotide sequences of constant region portions of CasGamma guide RNAs (depicted as the DNA encoding the RNA); SEQ ID NOs:l-18, respectively.
  • FIG. 2 depicts a Maximum Likelihood phylogenetic tree of the miniature enzymes, produced from a multiple sequence alignment with 1000 iterations. CasGamma forms a distinct clade separate from previously described Casl2 and Type V proteins.
  • FIG. 3A-3AC provide amino acid sequences of examples of CasTheta polypeptides of the present disclosure, as well as nucleotide sequences of constant region portions of CasTheta guide RNAs (depicted as the DNA encoding the RNA); SEQ ID NOs:19-51, 50, 52-75, respectively.
  • FIG. 4 depicts a Maximum Likelihood phylogenetic tree of the miniature enzymes, produced from a multiple sequence alignment with 1000 iterations.
  • CasTheta forms a distinct clade separate from previously described Casl2 and Type V proteins.
  • FIG. 5A-5AB provide amino acid sequences of examples of CasOmega polypeptides of the present disclosure, as well as nucleotide sequences of constant region portions of CasOmega guide RNAs (depicted as the DNA encoding the RNA); SEQ ID NOs:76-131, and 103, respectively.
  • FIG. 6 depicts a Maximum Likelihood phylogenetic tree of the miniature enzymes, produced from a multiple sequence alignment with 1000 iterations. CasOmega forms a distinct clade separate from previously described Cast 2 and Type V proteins.
  • FIG. 7A-7CR depicts provide amino acid sequences of examples of CasMu polypeptides of the present disclosure, as well as nucleotide sequences of constant region portions of CasMu guide RNAs (depicted as the DNA encoding the RNA); SEQ ID NOs: 132-229, respectively.
  • FIG. 8A-8B depicts exemplary secondary structures for CasMu guide RNAs (depicted as the DNA encoding the RNA).
  • FIG . 9A-9L provide amino acid sequences of examples of Type II-X polypeptides of the present disclosure; SEQ ID NOs:230-239, respectively.
  • FIG. 10A-10B depict the secondary and tertiary structure of an exemplary Type II-X polypeptide.
  • FIG. 11A-11H provide amino acid sequences of examples of Type II-Y polypeptides of the present disclosure, as well as nucleotide sequences of constant region portions of Type ILY guide RNAs; SEQ ID NOs:240-251, respectively.
  • FIG. 12A-12C depict the primary, secondary and tertiary structure of an exemplary
  • Type II- Y polypeptide
  • FIG. 13A-13D depict exemplary secondary structures of RNAs for use with Type ILY polypeptides.
  • FIG. 14A-14F provide amino acid sequences of examples of Type ILZ polypeptides of the present disclosure; SEQ ID NOs:252-257, respectively.
  • FIG. 15 presents Table 1, which includes various CRISPR-Cas effector polypeptides; (SEQ ID NOs:258-266, 76, 267, 135, 268-273, 78, 80, 274, 19, 275-279, 21, 280, 82, 281-283, 23, 284- 287, 84, 288-301, 86, 302, 88, 303-304, 90, 305-310, 92, 94, 96, 311, 98, 312-330, 100, 331-343, 27, 29, 344-348, 31, 349-365, 102, 366-382, 104, 383-388, 106, 389-394, 108, 395-412, 33, 110, 35, 37, 413- 415, 112, 416-424, 114, 425-437, 39, 41, 438
  • FIG. 16A-16B depicts an exemplary CRISPR-Cas effector polypeptide, as well as nucleotide sequences of constant region portions of a CRISPR-Cas effector polypeptide guide RNAs (depicted as the DNA encoding the RNA); SEQ ID N0s:898-900, respectively.
  • FIG. 17 presents a workflow for the determination of CRISPR-Cas effector polypeptides of the disclosure.
  • FIG. 18 depicts a maximum likelihood phylogenetic tree of phage and previously reported bacterially-encoded type V nucleases.
  • FIG. 19A-19E present comparisons of CRISPR-Cas effector polypeptides of the present disclosure and Type II-A, B, and C proteins.
  • FIG. 20 depicts II-Y1 single -guide RNA (sgRNA) structure.
  • a II-Y1 sgRNA is depicted as having the sequence: NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCUGUUCUGUUGAGCUG A A A AGCUCUC CAGUGUAAAAAGCCUAUAGGUUUUGGGUCGUACGGCAGAAUUGGUCCAGUUCUGCCCUC UACUCCCGUUAUCCGCGGGAAGCCCAAAACCUGGGUGAGGACAUUUUAAUUA (SEQ ID NO:902)) with annotated regions, comprised of a 5’ spacer combined with a repeat, a linker, and tracrRNA. Lower left: Folded sgRNA with annotated regions; lower right: Folded sgRNA with Minimum Free Energy (MFE) predictions.
  • MFE Minimum Free Energy
  • FIG. 21 depicts II-Y 1 PAM preference.
  • Escherichia coli E. coli
  • crude extract-based depletion analysis of a DNA PAM library shows NGG preference for II-Y_Nucleasel.
  • Three different sgRNA designs were tested, with design 3 being the active II-Yl_sgRNA shown above.
  • FIG. 22 depicts II-Y2 single -guide RNA (sgRNA) structure.
  • a II-Y2 sgRNA is depicted as having the sequence: NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGUUACAGUUAAGAAAUUAAUUGUAAAAC GCCUAUACAGUGAAGGGAUAUACGCUUGGGUUUGUCCAGCCUGAGCCUCUAUGCCAGAA AUGGCGCCUUUAUUGUGGGUUAGGACAUUUAAUUUU (SEQ ID NO:903) with annotated regions, comprised of a 5’ spacer combined with a repeat, a linker, and tracrRNA. Lower left: Folded sgRNA with annotated regions; lower right: Folded sgRNA with MFE predictions.
  • FIG. 23 depicts II -Y2 PAM preference.
  • E. coli crude extract-based depletion analysis of a DNA PAM library shows NGG preference for II- Y_Nuclease2.
  • Three different sgR A designs were tested, with design 2 being II-Y2_sgRNA, and design 3 with mutations in several regions that still provides a functional sgRNA.
  • FIG. 24 depicts sgRNA mutations and tested variants.
  • the crispr repeat was trimmed from original 36nt sequence (16nt for Yl, lOnt for Y2), but could be trimmed further (or extended up to the original 36nt for functional activity to improve Cas binding).
  • Nucleotides shown in light blue tolerated mutations to enable successful DNA cleavage. Mutations of nucleotides shown in red and purple may still provide a functional sgRNA.
  • FIG. 25 depicts II-Y4 single -guide RNA (sgRNA) structure.
  • a II-Y4 sgRNA is depicted as having the sequence: NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGUUACAGUUAAGAAAUUAAUUGUAAAAC GCUCCGCCAGCAUUAAAUGCUGGCGAAAAGUACGAUGAAGGAACAUACCGUACGUAAAA ACGGAUUAUUCCGGGAGUAUAGGUCCAGCUCCAACCUCUACGGUCGGCAACGAUAAGCU UCAUCGUGGGUUAGGAACCAAUUUUU (SEQ ID NO:904) with annotated regions, comprised of a 5’ spacer combined with a repeat, a linker, and tracrRNA. Lower left: Folded sgRNA with annotated regions; lower right: Folded sgRNA with MFE predictions.
  • FIG. 26 depicts modifications to enhance gRNA expression in mammalian cells. Guide
  • FIG. 27A-27C provide a II-Y1 nucleotide sequence (FIG. 27 A), a II-Y1 amino acid sequence (FIG. 27B), and a II-Y1 sgRNA nucleotide sequence (FIG. 27C); SEQ ID NOs:905, 240, and
  • FIG. 28A-28C provide a 11-Y2 nucleotide sequence (FIG. 28A), a 11-Y2 amino acid sequence (FIG. 28B), and a II-Y2 sgRNA nucleotide sequence (FIG. 28C); SEQ ID NOs:906, 245, and
  • FIG. 29A-29C provide a II-Y4 nucleotide sequence (FIG. 29A), a II-Y4 amino acid sequence (FIG. 29B), and a II-Y4 sgRNA nucleotide sequence (FIG. 29C); SEQ ID NOs:907, 901, and
  • polynucleotide and “nucleic acid,” used interchangeably herein, refer to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. Thus, this term includes, but is not limited to, single-, double-, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a polymer comprising purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases.
  • hybridizable or “complementary” or “substantially complementary” it is meant that a nucleic acid (e.g. RNA, DNA) comprises a sequence of nucleotides that enables it to non-covalently bind, i.e. form Watson-Crick base pairs and/or G/U base pairs, “anneal”, or “hybridize,” to another nucleic acid in a sequence-specific, antiparallel, manner (i.e., a nucleic acid specifically binds to a complementary nucleic acid) under the appropriate in vitro and/or in vivo conditions of temperature and solution ionic strength.
  • a nucleic acid e.g. RNA, DNA
  • anneal i.e. form Watson-Crick base pairs and/or G/U base pairs
  • Standard Watson-Crick base-pairing includes: adenine (A) pairing with thymidine (T), adenine (A) pairing with uracil (U), and guanine (G) pairing with cytosine (C) [DNA, RNA].
  • adenine (A) pairing with thymidine (T) adenine (A) pairing with uracil (U)
  • guanine (G) can also base pair with uracil (U).
  • G/U base-pairing is at least partially responsible for the degeneracy (i.e., redundancy) of the genetic code in the context of tRNA anti-codon base-pairing with codons in mRNA.
  • a guanine (G) e.g., of dsRNA duplex of a guide RNA molecule; of a guide RNA base pairing with a target nucleic acid, etc.
  • U uracil
  • A an adenine
  • a G/U base-pair can be made at a given nucleotide position of a dsRNA duplex of a guide RNA molecule, the position is not considered to be non-complementary, but is instead considered to be complementary.
  • Hybridization requires that the two nucleic acids contain complementary sequences, although mismatches between bases are possible.
  • the conditions appropriate for hybridization between two nucleic acids depend on the length of the nucleic acids and the degree of complementarity, variables well known in the art. The greater the degree of complementarity between two nucleotide sequences, the greater the value of the melting temperature (Tm) for hybrids of nucleic acids having those sequences.
  • Tm melting temperature
  • the length for a hybridizable nucleic acid is 8 nucleotides or more (e.g., 10 nucleotides or more, 12 nucleotides or more, 15 nucleotides or more, 20 nucleotides or more, 22 nucleotides or more, 25 nucleotides or more, or 30 nucleotides or more).
  • Temperature, wash solution salt concentration, and other conditions may be adjusted as necessary according to factors such as length of the region of complementation and the degree of complementation.
  • sequence of a polynucleotide need not be 100% complementary to that of its target nucleic acid to be specifically hybridizablc or hybridizablc. Moreover, a polynucleotide may hybridize over one or more segments such that intervening or adjacent segments are not involved in the hybridization event (e.g., a bulge, a loop structure or hairpin structure, etc.).
  • a polynucleotide can comprise 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, 99.5% or more, or 100% sequence complementarity to a target region within the target nucleic acid sequence to which it will hybridize.
  • an antisense nucleic acid in which 18 of 20 nucleotides of the antisense compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity.
  • the remaining noncomplementary nucleotides may be clustered or interspersed with complementary nucleotides and need not be contiguous to each other or to complementary nucleotides.
  • Percent complementarity between particular stretches of nucleic acid sequences within nucleic acids can be determined using any convenient method.
  • Example methods include BLAST programs (basic local alignment search tools) and PowerBLAST programs (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656), the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), e.g., using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482-489), and the like.
  • peptide refers to a polymeric form of amino acids of any length, which can include coded and non-codcd amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides having modified peptide backbones.
  • Binding refers to a non-covalent interaction between macromolecules (e.g., between a protein and a nucleic acid; between a CRISPR-Cas polypeptide/guide RNA complex and a target nucleic acid; and the like).
  • the macromolecules While in a state of non-covalent interaction, the macromolecules are said to be “associated” or “interacting” or “binding” (e.g., when a molecule X is said to interact with a molecule Y, it is meant the molecule X binds to molecule Y in a non-covalent manner). Not all components of a binding interaction need be sequence-specific (e.g., contacts with phosphate residues in a DNA backbone), but some portions of a binding interaction may be sequence-specific.
  • Binding interactions arc generally characterized by a dissociation constant (KD) of less than 10 6 M, less than 10 7 M, less than 10 8 M, less than 10 9 M, less than 10 10 M, less than 10 11 M, less than 10 12 M, less than 10 13 M, less than 10 14 M, or less than 10 13 M.
  • KD dissociation constant
  • binding domain it is meant a protein domain that is able to bind non-covalently to another molecule.
  • a binding domain can bind to, for example, a DNA molecule (a DNA-binding domain), an RNA molecule (an RNA-binding domain) and/or a protein molecule (a protein-binding domain).
  • a DNA-binding domain a DNA-binding domain
  • RNA-binding domain an RNA-binding domain
  • protein-binding domain a protein-binding domain
  • it can in some cases bind to itself (to form homodimers, homotrimers, etc.) and/or it can bind to one or more regions of a different protein or proteins.
  • a group of amino acids having aliphatic side chains consists of glycine, alanine, valine, leucine, and isoleucine; a group of amino acids having aliphatic-hydroxyl side chains consists of serine and threonine; a group of amino acids having amide containing side chains consisting of asparagine and glutamine; a group of amino acids having aromatic side chains consists of phenylalanine, tyrosine, and tryptophan; a group of amino acids having basic side chains consists of lysine, arginine, and histidine; a group of amino acids having acidic side chains consists of glutamate and aspartate; and a group of amino acids having sulfur containing side chains consists of cysteine and methionine.
  • Exemplary conservative amino acid substitution groups are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine-glycine, and aspar agine-glutamine .
  • a polynucleotide or polypeptide has a certain percent "sequence identity" to another polynucleotide or polypeptide, meaning that, when aligned, that percentage of bases or amino acids arc the same, and in the same relative position, when comparing the two sequences. Sequence identity can be determined in a number of different ways.
  • sequences can be aligned using various convenient methods and computer programs (e.g., BLAST, T-COFFEE, MUSCLE, MAFFT, etc.), available over the world wide web at sites including ncbi.nlm.nili.gov/BLAST, ebi.ac.uk/Tools/msa/tcoffee/, ebi.ac.uk/Tools/msa/muscle/, mafft.cbrc.jp/alignment/software/. See, e.g., Altschul et al. (1990), J. Mol. Bioi. 215:403-10.
  • a DNA sequence that "encodes" a particular RNA is a DNA nucleotide sequence that is transcribed into RNA.
  • a DNA polynucleotide may encode an RNA (mRNA) that is translated into protein (and therefore the DNA and the mRNA both encode the protein), or a DNA polynucleotide may encode an RNA that is not translated into protein (e.g. tRNA, rRNA, microRNA (miRNA), a “noncoding” RNA (ncRNA), a guide RNA, etc.).
  • a "protein coding sequence” or a sequence that encodes a particular protein or polypeptide is a nucleotide sequence that is transcribed into mR A (in the case of DNA) and is translated (in the case of mRNA) into a polypeptide in vitro or in vivo when placed under the control of appropriate regulatory sequences.
  • DNA regulatory sequences refer to transcriptional and translational control sequences, such as promoters, enhancers, poly adenylation signals, terminators, protein degradation signals, and the like, that provide for and/or regulate transcription of a non-coding sequence (e.g., guide RNA) or a coding sequence (e.g., RNA-guided endonuclease, GeoCas9 polypeptide, GeoCas9 fusion polypeptide, and the like) and/or regulate translation of an encoded polypeptide.
  • a non-coding sequence e.g., guide RNA
  • a coding sequence e.g., RNA-guided endonuclease, GeoCas9 polypeptide, GeoCas9 fusion polypeptide, and the like
  • a “promoter” or a “promoter sequence” is a DNA regulatory region capable of binding RNA polymerase and initiating transcription of a downstream (3' direction) coding or non-coding sequence.
  • the promoter sequence is bounded at its 3' terminus by the transcription initiation site and extends upstream (5' direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background.
  • a transcription initiation site within the promoter sequence will be found a transcription initiation site, as well as protein binding domains responsible for the binding of RNA polymerase.
  • Eukaryotic promoters will often, but not always, contain "TATA" boxes and "CAT” boxes.
  • Various promoters, including inducible promoters may be used to drive expression by the various vectors of the present disclosure.
  • nucleic acid refers to a nucleic acid, polypeptide, cell, or organism that is found in nature.
  • a polypeptide or polynucleotide sequence that is present in an organism that can be isolated from a source in nature is naturally occurring.
  • fusion refers to two components that are defined by structures derived from different sources.
  • a fusion polypeptide e.g., a fusion CRISPR-Cas protein
  • the fusion polypeptide includes amino acid sequences that are derived from different polypeptides.
  • a fusion polypeptide may comprise either modified or naturally-occurring polypeptide sequences (e.g., a first amino acid sequence from a modified or unmodified CRISPR-Cas protein; and a second amino acid sequence from a modified or unmodified protein other than a CRISPR-Cas protein, etc.).
  • fusion in the context of a polynucleotide encoding a fusion polypeptide includes nucleotide sequences derived from different coding regions (e.g., a first nucleotide sequence encoding a modified or unmodified CRISPR-Cas protein; and a second nucleotide sequence encoding a polypeptide other than a CRISPR-Cas protein).
  • fusion polypeptide refers to a polypeptide which is made by the combination
  • Heterologous means a nucleotide or polypeptide sequence that is not found in the native nucleic acid or protein, respectively.
  • a portion of naturally-occurring CRISPR-Cas polypeptide (or a vaiiant thereof) may be fused to a heterologous polypeptide (i.e. an amino acid sequence from a protein other than a CRISPR-Cas polypeptide or an amino acid sequence from another organism).
  • a fusion CRISPR-Cas polypeptide can comprise all or a portion of a naturally- occurring CRISPR-Cas polypeptide (or variant thereof) fused to a heterologous polypeptide, i.e., a polypeptide from a protein other than a CRISPR-Cas polypeptide, or a polypeptide from another organism.
  • the heterologous polypeptide may exhibit an activity (e.g., enzymatic activity) that will also be exhibited by the variant CRISPR-Cas protein or the fusion CRISPR-Cas protein (e.g., biotin ligase activity; nuclear localization; etc.).
  • a heterologous nucleic acid sequence may be linked to a naturally- occurring nucleic acid sequence (or a variant thereof) (e.g., by genetic engineering) to generate a nucleotide sequence encoding a fusion polypeptide (a fusion protein).
  • a guide sequence of a guide RNA that is heterologous to a protein-binding sequence of a guide RNA is a guide sequence that is not found in nature together with the protein-binding sequence.
  • heterologous refers to a molecule not normally found in a cell.
  • a heterologous mRNA sequence is one that has been expressed in a cell that normally does not express that mRNA.
  • a heterologous gene sequence may be one comprising a wild type gene sequence present in a cell that normally expresses a mutated version of the same gene, or vice versa.
  • a heterologous protein may be one that is transduced into a cell where the cell normally does not comprise such a protein.
  • "Recombinant,” as used herein, means that a particular nucleic acid (DNA or RNA) is the product of various combinations of cloning, restriction, polymerase chain reaction (PCR) and/or ligation steps resulting in a construct having a structural coding or non-coding sequence distinguishable from endogenous nucleic acids found in natural systems.
  • DNA sequences encoding polypeptides can be assembled from cDNA fragments or from a series of synthetic oligonucleotides, to provide a synthetic nucleic acid which is capable of being expressed from a recombinant transcriptional unit contained in a cell or in a cell-free transcription and translation system.
  • Genomic DNA comprising the relevant sequences can also be used in the formation of a recombinant gene or transcriptional unit. Sequences of non-translated DNA may be present 5' or 3' from the open reading frame, where such sequences do not interfere with manipulation or expression of the coding regions, and may indeed act to modulate production of a desired product by various mechanisms (see "DNA regulatory sequences").
  • RNA sequences encoding RNA may also be considered recombinant.
  • the term "recombinant" nucleic acid refers to one which is not naturally occurring, e.g., is made by the artificial combination of two otherwise separated segments of sequence through human intervention. This artificial combination is often accomplished by either chemical synthesis means, or by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques. Such is usually done to replace a codon with a codon encoding the same amino acid, a conservative amino acid, or a non-conservative amino acid. Alternatively, it is performed to join together nucleic acid segments of desired functions to generate a desired combination of functions.
  • This artificial combination is often accomplished by either chemical synthesis means, or by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques.
  • a recombinant polynucleotide encodes a polypeptide
  • the sequence of the encoded polypeptide can be naturally occurring (“wild type”) or can be a variant (e.g., a mutant) of the naturally occurring sequence.
  • An example of such a case is a DNA (a recombinant) encoding a wild-type protein where the DNA sequence is codon optimized for expression of the protein in a cell (e.g., a eukaryotic cell) in which the protein is not naturally found (e.g., expression of a CRISPR/Cas RNA-guided polypeptide such as CRISPR-Cas (e.g., wild-type CRISPR-Cas; variant CRISPR-Cas; fusion CRISPR-Cas; etc.) in a eukaryotic cell).
  • a CRISPR/Cas RNA-guided polypeptide such as CRISPR-Cas (e.g., wild-type CRISPR-Cas; variant CRISPR-Cas; fusion CRISPR-Cas; etc.) in a eukaryotic cell).
  • a codon-optimized DNA can therefore be recombinant and non-naturally occurring while the
  • the term "recombinant" polypeptide does not necessarily refer to a polypeptide whose amino acid sequence does not naturally occur. Instead, a “recombinant” polypeptide is encoded by a recombinant non-naturally occurring DNA sequence, but the amino acid sequence of the polypeptide can be naturally occurring (“wild type”) or non-naturally occurring (e.g., a variant, a mutant, etc.). Thus, a “recombinant” polypeptide is the result of human intervention, but may have a naturally occurring amino acid sequence.
  • a "vector” or “expression vector” is a replicon, such as plasmid, phage, virus, artificial chromosome, or cosmid, to which another DNA segment, i.c. an “insert”, may be attached so as to bring about the replication of the attached segment in a cell.
  • An “expression cassette” comprises a DNA coding sequence operably linked to a promoter.
  • "Operably linked” refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner.
  • a promoter is operably linked to a coding sequence (or the coding sequence can also be said to be operably linked to the promoter) if the promoter affects its transcription or expression.
  • recombinant expression vector or “DNA construct” are used interchangeably herein to refer to a DNA molecule comprising a vector and an insert.
  • Recombinant expression vectors are usually generated for the purpose of expressing and/or propagating the insert(s), or for the construction of other recombinant nucleotide sequences.
  • the insert(s) may or may not be operably linked to a promoter sequence and may or may not be operably linked to DNA regulatory sequences.
  • a cell has been “genetically modified” or “transformed” or “transfected” by exogenous
  • RNA or exogenous RNA when such DNA has been introduced inside the cell.
  • the presence of the exogenous DNA results in permanent or transient genetic change.
  • the transforming DNA may or may not be integrated (covalently linked) into the genome of the cell.
  • the transforming DNA may be maintained on an episomal element such as a plasmid.
  • a stably transformed cell is one in which the transforming DNA has become integrated into a chromosome so that it is inherited by daughter cells through chromosome replication.
  • a "clone” is a population of cells derived from a single cell or common ancestor by mitosis.
  • a "cell line” is a clone of a primary cell that is capable of stable growth in vitro for many generations.
  • Suitable methods of genetic modification include e.g., viral or bacteriophage infection, transfection, conjugation, protoplast fusion, lipofection, electroporation, calcium phosphate precipitation, polyethyleneimine (PEI) -mediated transfection, DEAE- dextran mediated transfection, liposome-mediated transfection, particle gun technology, calcium phosphate precipitation, direct micro injection, nanoparticle-mediated nucleic acid delivery (see, e.g., Panyam et al. Adv Drug Deliv Rev. 2012 Sep 13. pii: S0169-409X(12)00283-9. doi: 10.1016/j.addr.2012.09.023 ), and the like.
  • transformation include e.g., viral or bacteriophage infection, transfection, conjugation, protoplast fusion, lipofection, electroporation, calcium phosphate precipitation, polyethyleneimine (PEI) -mediated transfection, DEAE- dextran mediated transfection, liposome-mediated transfection, particle gun
  • a “target nucleic acid” as used herein is a polynucleotide (e.g., DNA such as genomic
  • RNA-guided endonuclease polypeptide e.g., wild-type CRISPR-Cas; variant CRISPR-Cas; fusion CRISPR-Cas; etc.
  • the target sequence is the sequence to which the guide sequence of a subject CRISPR-Cas guide RNA (e.g., a dual CRISPR-Cas guide RNA or a single-molecule CRISPR-Cas guide RNA) will hybridize.
  • the target site (or target sequence) 5'-GAGCAUAUC-3' within a target nucleic acid is targeted by (or is bound hy, or hybridizes with, or is complementary to) the sequence 5’-GAUAUGCUC-3’.
  • Suitable hybridization conditions include physiological conditions normally present in a cell.
  • the strand of the target nucleic acid that is complementary to and hybridizes with the guide RNA is referred to as the “complementary strand” or “target strand”; while the strand of the target nucleic acid that is complementary to the “target strand” (and is therefore not complementary to the guide RNA) is referred to as the “non-target strand” or “non-complementary strand.”
  • cleavage it is meant the breakage of the covalent backbone of a target nucleic acid molecule (e.g., RNA, DNA). Cleavage can be initiated by a variety of methods including, but not limited to, enzymatic or chemical hydrolysis of a phosphodiester bond. Both single-stranded cleavage and double-stranded cleavage are possible, and double-stranded cleavage can occur as a result of two distinct single-stranded cleavage events.
  • Nuclease and “endonuclease” are used interchangeably herein to mean an enzyme which possesses catalytic activity for nucleic acid cleavage (e.g., ribonuclease activity (ribonucleic acid cleavage), deoxyribonuclease activity (deoxyribonucleic acid cleavage), etc.).
  • catalytic activity for nucleic acid cleavage e.g., ribonuclease activity (ribonucleic acid cleavage), deoxyribonuclease activity (deoxyribonucleic acid cleavage), etc.
  • cleavage domain or “active domain” or “nuclease domain” of a nuclease it is meant the polypeptide sequence or domain within the nuclease which possesses the catalytic activity for nucleic acid cleavage.
  • a cleavage domain can be contained in a single polypeptide chain or cleavage activity can result from the association of two (or more) polypeptides.
  • a single nuclease domain may consist of more than one isolated stretch of amino acids within a given polypeptide.
  • stem cell is used herein to refer to a cell (e.g., plant stem cell, vertebrate stem cell) that has the ability both to self-renew and to generate a differentiated cell type (see Morrison et al. (1997) Cell 88:287-298).
  • the adjective "differentiated”, or “differentiating” is a relative term.
  • a "differentiated cell” is a cell that has progressed further down the developmental pathway than the cell it is being compared with.
  • pluripotent stem cells can differentiate into lineage-restricted progenitor cells (e.g., mesodermal stem cells), which in turn can differentiate into cells that are further restricted (e.g., neuron progenitors), which can differentiate into end-stage cells (i.e., terminally differentiated cells, e.g., neurons, cardiomyocytes, etc.), which play a characteristic role in a certain tissue type, and may or may not retain the capacity to proliferate further.
  • progenitor cells e.g., mesodermal stem cells
  • end-stage cells i.e., terminally differentiated cells, e.g., neurons, cardiomyocytes, etc.
  • Stem cells may be characterized by both the presence of specific markers (e.g., proteins, RNAs, etc.) and the absence of specific markers.
  • Stem cells may also be identified by functional assays both in vitro and in vivo, particularly assays relating to the ability of stem cells to give rise to multiple differentiated
  • Stem cells of interest include pluripotent stem cells (PSCs).
  • PSC pluripotent stem cell
  • the term “pluripotent stem cell” or “PSC” is used herein to mean a stem cell capable of producing all cell types of the organism. Therefore, a PSC can give rise to cells of all germ layers of the organism (e.g., the endoderm, mesoderm, and ectoderm of a vertebrate).
  • Pluripotent cells are capable of forming teratomas and of contributing to ectoderm, mesoderm, or endoderm tissues in a living organism.
  • Pluripotent stem cells of plants are capable of giving rise to all cell types of the plant (e.g., cells of the root, stem, leaves, etc.).
  • PSCs of animals can be derived in a number of different ways.
  • ESCs embryonic stem cells
  • iPSCs induced pluripotent stem cells
  • somatic cells Takahashi et. al, Cell. 2007 Nov 30; 131 (5):861 -72; Takahashi et. al, Nat Protoc. 2007;2(12):3081-9; Yu ct. al, Science. 2007 Dec 21;318(5858): 1917-20. Epub 2007 Nov 20).
  • PSC refers to pluripotent stem cells regardless of their derivation
  • the term PSC encompasses the terms ESC and iPSC, as well as the term embryonic germ stem cells (EGSC), which are another example of a PSC.
  • ESC and iPSC as well as the term embryonic germ stem cells (EGSC), which are another example of a PSC.
  • EGSC embryonic germ stem cells
  • PSCs may be in the form of an established cell line, they may be obtained directly from primary embryonic tissue, or they may be derived from a somatic cell. PSCs can be target cells of the methods described herein.
  • ESC embryonic stem cell
  • ESC lines are listed in the NIH Human Embryonic Stem Cell Registry, e.g.
  • Stem cells of interest also include embryonic stem cells from other primates, such as Rhesus stem cells and marmoset stem cells.
  • the stem cells may be obtained from any mammalian species, e.g.
  • ESCs typically grow as flat colonies with large nucleo-cytoplasmic ratios, defined borders and prominent nucleoli.
  • ESCs express SSEA-3, SSEA-4, TRA-1-60, TRA-1-81, and Alkaline Phosphatase, but not SSEA-1.
  • Examples of methods of generating and characterizing ESCs may be found in, for example, US Patent No. 7,029,913, US Patent No. 5,843,780, and US Patent No. 6,200,806, the disclosures of which are incorporated herein by reference. Methods for proliferating hESCs in the undifferentiated form are described in WO 99/20741, WO 01/51616, and WO 03/020920.
  • EGSC embryonic germ stem cell
  • EG cell a PSC that is derived from germ cells and/or germ cell progenitors, e.g. primordial germ cells, i.e. those that would become sperm and eggs.
  • Embryonic germ cells EG cells
  • Examples of methods of generating and characterizing EG cells may be found in, for example, US Patent No. 7,153,684; Matsui, Y., et al., (1992) Cell 70:841; Shamblott, M., et al. (2001) Proc. Natl. Acad. Sci.
  • iPSC induced pluripotent stem cell
  • iPSCs can be derived from multiple different cell types, including terminally differentiated cells. iPSCs have an ES cell-like morphology, growing as flat colonies with large nucleo-cytoplasmic ratios, defined borders and prominent nuclei.
  • iPSCs express one or more key pluripotency markers known by one of ordinary skill in the art, including but not limited to Alkaline Phosphatase, SSEA3, SSEA4, Sox2, Oct3/4, Nanog, TRA160, TRA181, TDGF 1, Dnmt3b, FoxD3, GDF3, Cyp26al, TERT, and zfp42.
  • Examples of methods of generating and characterizing iPSCs may be found in, for example, U.S. Patent Publication Nos. US20090047263, US20090068742, US20090191159, US20090227032, US20090246875, and US20090304646, the disclosures of which are incorporated herein by reference.
  • somatic cells are provided with reprogramming factors (e.g. Oct4, SOX2, KLF4, MYC, Nanog, Lin28, etc.) known in the art to reprogram the somatic cells to become pluripotent stem cells.
  • reprogramming factors e.g. Oct4, SOX2, KLF4, MYC, Nanog, Lin28, etc.
  • somatic cell it is meant any cell in an organism that, in the absence of experimental manipulation, does not ordinarily give rise to all types of cells in an organism.
  • somatic cells are cells that have differentiated sufficiently that they will not naturally generate cells of all three germ layers of the body, i.e. ectoderm, mesoderm and endoderm.
  • somatic cells would include both neurons and neural progenitors, the latter of which may be able to naturally give rise to all or some cell types of the central nervous system but cannot give rise to cells of the mesoderm or endoderm lineages.
  • mitotic cell it is meant a cell undergoing mitosis.
  • Mitosis is the process by which a eukaryotic cell separates the chromosomes in its nucleus into two identical sets in two separate nuclei. It is generally followed immediately by cytokinesis, which divides the nuclei, cytoplasm, organelles and cell membrane into two cells containing roughly equal shares of these cellular components.
  • post-mitotic cell it is meant a cell that has exited from mitosis, i.e., it is
  • quiescent i.e. it is no longer undergoing divisions. This quiescent state may be temporary, i.e. reversible, or it may be permanent.
  • meiotic cell it is meant a cell that is undergoing meiosis.
  • Meiosis is the process by which a cell divides its nuclear material for the purpose of producing gametes or spores. Unlike mitosis, in meiosis, the chromosomes undergo a recombination step which shuffles genetic material between chromosomes. Additionally, the outcome of meiosis is four (genetically unique) haploid cells, as compared with the two (genetically identical) diploid cells produced from mitosis.
  • a component e.g., a nucleic acid component (e.g., a CasGamma guide RNA); a protein component (e.g., wild-type CasGamma polypeptide; variant CasGamma polypeptide; fusion CasGamma polypeptide; etc.); and the like) includes a label moiety.
  • label “detectable label”, or “label moiety” as used herein refer to any moiety that provides for signal detection and may vary widely depending on the particular nature of the assay.
  • Label moieties of interest include both directly detectable labels (direct labels; e.g., a fluorescent label) and indirectly detectable labels (indirect labels; e.g., a binding pair member).
  • a fluorescent label can be any fluorescent label (e.g., a fluorescent dye (e.g., fluorescein, Texas red, rhodamine, ALEXAFLUOR® labels, and the like), a fluorescent protein (e.g., green fluorescent protein (GFP), enhanced GFP (EGFP), yellow fluorescent protein (YFP), red fluorescent protein (RFP), cyan fluorescent protein (CFP), cherry, tomato, tangerine, and any fluorescent derivative thereof), etc.).
  • GFP green fluorescent protein
  • EGFP enhanced GFP
  • YFP yellow fluorescent protein
  • RFP red fluorescent protein
  • CFP cyan fluorescent protein
  • Suitable detectable (directly or indirectly) label moieties for use in the methods include any moiety that is detectable by spectroscopic, photochemical, biochemical, immunochemical, electrical, optical, chemical, or other means.
  • suitable indirect labels include biotin (a binding pair member), which can be bound by streptavidin (which can itself be directly or indirectly labeled).
  • Labels can also include: a radiolabel (a direct label)(e.g., 3 H, 125 1, 35 S, 14 C, or 32 P); an enzyme (an indirect label)(e.g., peroxidase, alkaline phosphatase, galactosidase, luciferase, glucose oxidase, and the like); a fluorescent protein (a direct label)(e.g., green fluorescent protein, red fluorescent protein, yellow fluorescent protein, and any convenient derivatives thereof); a metal label (a direct label); a colorimetric label; a binding pair member; and the like.
  • a radiolabel a direct label
  • an enzyme an indirect label
  • a fluorescent protein a direct label
  • a direct label e.g., green fluorescent protein, red fluorescent protein, yellow fluorescent protein, and any convenient derivatives thereof
  • a metal label a direct label
  • a colorimetric label a binding pair member
  • binding pair or “binding pair member” is meant one of a first and a second moiety, wherein the first and the second moiety have a specific binding affinity for each other.
  • Suitable binding pairs include, but are not limited to: antigen/antibodies (for example, digoxigenin/anti-digoxigenin, dinitrophenyl (DNP)Zanti-DNP, dansyl- X-anti-dansyl, fluorescein/anti-fluorescein, lucifer yellow/anti-lucifer yellow, and rhodamine antirhodamine), biotin/avidin (or biotin/streptavidin) and calmodulin binding protein (CBP)/calmodulin.
  • antigen/antibodies for example, digoxigenin/anti-digoxigenin, dinitrophenyl (DNP)Zanti-DNP, dansyl- X-anti-dansyl, fluorescein/anti-fluorescein, lucifer yellow/anti-lucifer
  • Any binding pair member can be suitable for use as an indirectly detectable label moiety.
  • Any given component, or combination of components can be unlabeled, or can be dctcctably labeled with a label moiety. In some cases, when two or more components arc labeled, they can be labeled with label moieties that are distinguishable from one another.
  • treatment refers to obtaining a desired pharmacologic and/or physiologic effect.
  • the effect may be prophylactic in terms of completely or partially preventing a disease or symptom thereof and/or may be therapeutic in terms of a partial or complete cure for a disease and/or adverse effect attributable to the disease.
  • Treatment covers any treatment of a disease in a mammal, e.g., in a human, and includes: (a) preventing the disease from occurring in a subject which may be predisposed to the disease but has not yet been diagnosed as having it; (b) inhibiting the disease, i.e., arresting its development; and (c) relieving the disease, i.e., causing regression of the disease.
  • the terms "individual,” “subject,” “host,” and “patient,” used interchangeably herein, refer to an individual organism, e.g., a mammal, including, but not limited to, murines, simians, humans, non-human primates, ungulates, felines, canines, bovines, ovines, mammalian farm animals, mammalian sport animals, and mammalian pets.
  • CRTSPR-Cas effector protein includes a plurality of such CRISPR-Cas effector proteins
  • the CRISPR-Cas guide RNA includes reference to one or more CRISPR-Cas guide RNAs and equivalents thereof known to those skilled in the art, and so forth.
  • the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as “solely,” “only” and the like in connection with the recitation of claim elements, or use of a “negative” limitation.
  • the present disclosure provides CRISPR-Cas effector proteins, nucleic acids encoding same, and compositions comprising same.
  • the present disclosure provides ribonucleoprotein complexes comprising: a CRISPR-Cas effector protein of the present disclosure; and a guide nucleic acid (e.g., a guide RNA).
  • the present disclosure provides methods of modifying a target nucleic acid, using an RNA- guided CRISPR-Cas effector protein of the present disclosure and a guide RNA.
  • the present disclosure provides methods of modulating transcription of a target nucleic acid.
  • the present disclosure provides methods of detecting a target nucleic acid, using an RNA-guided CRISPR-Cas effector protein of the present disclosure and a guide RNA.
  • the present disclosure provides a composition comprising a CRISPR-Cas effector polypeptide (e.g., CasGamma, CasTheta, CasOmega, CasMu, Type II-X, Type II-Y, Type II-Z) and a guide nucleic acid.
  • a CRISPR-Cas effector polypeptide of the present disclosure comprises a RuvC domain.
  • a CRISPR-Cas effector polypeptide of the present disclosure comprises both a RuvC domain and an HNH domain.
  • a CRISPR-Cas effector polypeptide of the present disclosure when complexed with a guide nucleic acid (e.g., a guide RNA), cleaves one or more of double-stranded DNA, single-stranded DNA, double-stranded RNA, and single-stranded RNA.
  • a guide nucleic acid e.g., a guide RNA
  • the CRISPR-Cas effector polypeptide has a length ranging from 30 amino acids to 2250 amino acids
  • a guide nucleic acid comprises: i) an activation region that binds to a
  • the activation region is heterologous to the targeting region.
  • the targeting region is not 100% complementary to a naturally-occurring bacteriophage nucleic acid.
  • the targeting region is complementary to a target sequence of a eukaryotic target nucleic acid.
  • the nucleotide sequence that is complementary to a target sequence of a target nucleic acid is 15 nucleotides to 18 nucleotides long. In some cases, the nucleotide sequence that is complementary to a target sequence of a target nucleic acid is 18 nucleotides to 25 nucleotides long.
  • a CRISPR-Cas effector protein e.g., a CRISPR-Cas effector polypeptide; also referred to as a “CRISPR/Cas protein or CRISPR/Cas polypeptide”
  • CRISPR/Cas protein or CRISPR/Cas polypeptide interacts with (binds to) a corresponding guide RNA (e.g., a CRISPR-Cas guide RNA) to form a ribonucleoprotein (RNP) complex that is targeted to a particular site in a target nucleic acid (e.g. a target DNA) via base pairing between the guide RNA and a target sequence within the target nucleic acid molecule.
  • a target nucleic acid e.g. a target DNA
  • a guide RNA includes a nucleotide sequence (a guide sequence) that is complementary to a sequence (the target site) of a target nucleic acid.
  • a CRISPR-Cas effector protein forms a complex with a CRISPR-Cas guide RNA and the guide RNA provides sequence specificity to the RNP complex via the guide sequence.
  • the CRISPR-Cas protein of the complex provides the site-specific activity.
  • the CRISPR-Cas protein is guided to a target site (e.g., stabilized at a target site) within a target nucleic acid sequence (e.g. a chromosomal sequence or an extrachromosomal sequence, e.g., an episomal sequence, a minicircle sequence, a mitochondrial sequence, a chloroplast sequence, etc.) by virtue of its association with the guide RNA.
  • a target nucleic acid sequence e.g. a chromosomal sequence or an extrachromosomal sequence, e.
  • a CRISPR/Cas effector polypeptide of the present disclosure when complexed with a guide RNA, cleaves double-stranded DNA or single-stranded DNA.
  • a CRISPR/Cas effector polypeptide of the present disclosure catalyzes processing of pre-crRNA in a magnesium-dependent manner.
  • compositions comprising a CRISPR-Cas effector polypeptide (and/or a nucleic acid comprising a nucleotide sequence encoding the CRISPR-Cas polypeptide) (e.g., where the CRISPR-Cas polypeptide can be a naturally existing protein, a nickase CRISPR-Cas protein, a catalytically inactive (“dead” CRISPR-Cas; also referred to herein as a “dCRISPR-Cas protein”), a fusion CRISPR-Cas protein, etc.).
  • a CRISPR-Cas effector polypeptide and/or a nucleic acid comprising a nucleotide sequence encoding the CRISPR-Cas polypeptide
  • the CRISPR-Cas polypeptide can be a naturally existing protein, a nickase CRISPR-Cas protein, a catalytically inactive (“dead” CRIS
  • compositions comprising a CRISPR-Cas guide RNA (and/or a nucleic acid comprising a nucleotide sequence encoding the CRISPR-Cas guide RNA).
  • compositions comprising (a) a CRISPR-Cas polypeptide (and/or a nucleic acid encoding the CRISPR-Cas polypeptide) (e.g., where the CRISPR-Cas polypeptide can be a naturally existing protein, a nickase CRISPR-Cas protein, a dCRISPR-Cas protein, a fusion CRISPR-Cas protein, etc.) and (b) a CRISPR-Cas guide RNA (and/or a nucleic acid encoding the CRISPR-Cas guide RNA).
  • the present disclosure provides a nucleic acid/protein complex (RNP complex) comprising: (a) a CRISPR-Cas effector polypeptide of the present disclosure (e.g., where the CRISPR-Cas polypeptide can be a naturally existing protein, a nickase CRISPR-Cas protein, a dCRISPR-Cas protein, a fusion CRISPR-Cas polypeptide, etc.); and (b) a CRISPR-Cas effector guide RNA.
  • a CRISPR-Cas effector polypeptide of the present disclosure e.g., where the CRISPR-Cas polypeptide can be a naturally existing protein, a nickase CRISPR-Cas protein, a dCRISPR-Cas protein, a fusion CRISPR-Cas polypeptide, etc.
  • a CRISPR-Cas effector guide RNA e.g., where the CRISPR-
  • CRISPR-Cas effector polypeptides of the disclosure include, for example, CasGamma polypeptides, CasTheta polypeptides, CasOmega polypeptides, CasMu polypeptides, Type II-X polypeptides, Type II-Y polypeptides, and Type II-Z.
  • compositions of the disclosure may include CasGamma polypeptides, CasTheta polypeptides, CasOmega polypeptides, CasMu polypeptides, Type II-X polypeptides, and Type II-Y, Type II-Z polypeptides, or a combination thereof.
  • compositions include a CasGamma polypeptide.
  • compositions include a CasTheta polypeptide. In still other cases, compositions include a CasOmega polypeptide. In yet other cases, compositions include a CasMu polypeptide. In still other cases, compositions include a Type II-X polypeptide. In yet other cases, compositions include a Type II-Y polypeptide. In still other instances, compositions include a Type 11-Z polypeptide.
  • compositions of the disclosure may include a CRISPR-Cas guide RNA, such as a CasGamma guide RNA, a CasTheta guide RNA, a CasOmega guide RNA, a CasMu guide RNA, a Type II-X guide RNA, a Type II-Y guide RNA, a Type II-Z guide RNA, or a combination thereof.
  • a CasGamma polypeptide (this term is used interchangeably with the term “CasGamma protein”, “Casy polypeptide”, and “CRISPR/CasGamma protein”) can bind and/or modify (e.g., cleave, nick, methylate, demethylate, etc.) a target nucleic acid and/or a polypeptide associated with target nucleic acid (e.g., methylation or acetylation of a histone tail) (e.g., in some cases, the CasGamma protein includes a fusion partner with an activity, and in some cases, the CasGamma protein provides nuclease activity).
  • a target nucleic acid e.g., methylation or acetylation of a histone tail
  • the CasGamma protein is a naturally-occurring protein (e.g., naturally occurs in bacteriophage). In other cases, the CasGamma protein is not a naturally-occurring polypeptide (e.g., the CasGamma protein is a variant CasGamma protein (e.g., a catalytically inactive CasGamma protein, a fusion CasGamma protein, and the like).
  • a CasGamma polypeptide (e.g., not fused to any heterologous fusion partner) can have a molecular weight of from about 25 kiloDaltons (kDa) to about 60 kDa.
  • a CasGamma polypeptide can have a molecular weight of from about 25 kDa to about 30 kDa, from about 30 kDa to about 35 kDa, from about 35 kDa to about 40 kDa, from about 40 kDa to about 45 kDa, from about 45 kDa to about 50 kDa, from about 50 kDa to about 55 kDa, or from about 55 kDa to about 60 kDa.
  • Assays to determine whether a given protein interacts with a CasGamma guide RNA can be any convenient binding assay that tests for binding between a protein and a nucleic acid. Suitable binding assays (e.g., gel shift assays) will be known to one of ordinary skill in the art (e.g., assays that include adding a CasGamma guide RNA and a protein to a target nucleic acid).
  • Assays to determine whether a protein has an activity can be any convenient assay (e.g., any convenient nucleic acid cleavage assay that tests for nucleic acid cleavage). Suitable assays (e.g., cleavage assays) will be known to one of ordinary skill in the art.
  • a naturally occurring CasGamma protein functions as an endonuclease that catalyzes a double strand break at a specific sequence in a targeted double stranded DNA (dsDNA).
  • the sequence specificity is provided by the associated guide RNA, which hybridizes to a target sequence within the target DNA.
  • the naturally occurring CasGamma guide RNA is a crRNA, where the crRNA includes (i) a guide sequence that hybridizes to a target sequence in the target DNA and (ii) a protein binding segment which includes a stem-loop (hairpin - dsRNA duplex) that binds to the CasGamma protein.
  • a CasGamma polypeptide of the present disclosure when complexed with a CasGamma guide RNA, generates a product nucleic acid comprising 5’ overhang following site specific cleavage of a target nucleic acid.
  • the 5’ overhang can be an 8 to 12 nucleotide (nt) overhang.
  • the 5’ overhang can be 8 nt, 9 nt, 10 nt, 11, nt, or 12 nt in length.
  • a CasGamma polypeptide of the present disclosure includes a RuvC-like domain at or near the C-tcrminus of the protein.
  • a CasGamma protein of the subject methods and/or compositions is (or is derived from) a naturally occurring (wild type) protein. Examples of naturally occurring CasGamma proteins are depicted in FIG. 1A-1I.
  • a CasGamma protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with any one of the CasGamma amino acid sequences depicted in FIG. 1A-1I.
  • a CasGamma protein (of the subject compositions and/or methods) includes an amino acid sequence depicted in FIG. 1A-1I.
  • a CasGamma protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the RuvC domain (which includes the RuvC-1, RuvC-11, and RuvC-111 domains) of any one of the CasGamma amino acid sequences depicted in any one of FIG. 1A-1I.
  • a CasGamma protein (of the subject compositions and/or methods) includes an amino acid sequence having 70% or more sequence identity (e.g., 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the RuvC domain (which includes the RuvC-I, RuvC-II, and RuvC-III domains) of any one of the CasGamma amino acid sequences depicted in FIG. 1A-1I.
  • a CasGamma protein (of the subject compositions and/or methods) includes the RuvC domain (which includes the RuvC-I, RuvC-II, and RuvC-III domains) of any one of the CasGamma amino acid sequences depicted in FIG. 1A-1I.
  • a guide RNA that binds a CasGamma polypeptide is encoded by a DNA molecule that includes a nucleotide sequence depicted in FIG. 1A-1I (or in some cases the reverse complement of same).
  • the guide RNA comprises the nucleotide sequence (N)nX or the reverse complement of same, where N is any nucleotide, n is an integer from 15 to 30 (e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30), and X is any one of the nucleotide sequences depicted in FIG. 1A-1I (or in some cases the reverse complement of same).
  • the “repeat” portion of a CasGamma guide RNA is encoded by a DNA molecule comprising a nucleotide sequence selected from: 1) GCTTCAACCCCTCAAGGGTCCATCTGATAC (SEQ ID NO:2; FIG. 1A); 2) GTTCGAGACGAACCCTTGTGGGGTTGAAG (SEQ ID NO:4; FIG. IB); 3) GTTCCAGACGGACCCTTGTGGGGTTGAAGC (SEQ ID N0:6; FIG. 1C); 4) GTTTCAGCCCCAGTGTAGCTGAACCATTT (SEQ ID N0:8; FIG.
  • a guide RNA that binds a CasGamma polypeptide is encoded by a DNA molecule that includes a nucleotide sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with any one of the sequences depicted in FIG. 1A-1I (or in some cases the reverse complement of same).
  • sequence identity e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity
  • the guide RNA comprises the nucleotide sequence (N)nX or the reverse complement of same, where N is any nucleotide, n is an integer from 15 to 30 (e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30), and X a nucleotide sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with an RNA encoded by any one of the sequences depicted in FIG. 1A-1I.
  • N is any nucleotide
  • n is an integer from 15 to 30 (e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30)
  • X a nucleotide sequence
  • FIG. 1A-1I Examples of CasGamma proteins arc depicted in FIG. 1A-1I. For example:
  • CasGamma polypeptide designated “CasGammal 178272566_6” and depicted in FIG. 1A is also referred to herein as “CasGammal”;
  • FIG. IB is also referred to herein as “CasGamma2”’
  • FIG. 1C is also referred to herein as “CasGamma3”;
  • CasGamma4 the CasGamma polypeptide designated “CasGamma4 10674641_l 1” and depicted in FIG. ID is also referred to herein as “CasGamma4”;
  • FIG. IE is also referred to herein as “CasGamma5”;
  • CasGamma6 10524560_124 the CasGamma polypeptide designated “CasGamma6 10524560_124” and depicted in FIG. IF is also referred to herein as “CasGamma6”;
  • FIG. 1H is also referred to herein as “CasGamma8”;
  • CasGamma9 the CasGamma polypeptide designated “CasGamma9 10376425_5” and depicted in FIG. II is also referred to herein as “CasGamma9”.
  • a CasGamma protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasGammal amino acid sequence depicted in FIG. 1A.
  • a CasGamma protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasGammal amino acid sequence depicted in FIG. 1A.
  • a CasGamma protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasGammal amino acid sequence depicted in FIG. 1A.
  • a CasGamma protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasGammal amino acid sequence depicted in FIG. 1A.
  • a CasGamma protein includes an amino acid sequence having the CasGammal amino acid sequence depicted in FIG. 1A.
  • a CasGamma protein includes an amino acid sequence having the CasGammal amino acid sequence depicted in FIG. 1A, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasGamma polypeptide has a length of from 380 amino acids (aa) to 400 aa, e.g., from 380 aa to 390 aa, or from 390 aa to 400 aa). In some cases, a CasGamma polypeptide has a length of 389 amino acids.
  • a guide RNA that binds a CasGamma polypeptide includes the following nucleotide sequence: GCTTCAACCCCTCAAGGGTCCATCTGATAC (SEQ ID NO:2) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nGCTTCAACCCCTCAAGGGTCCATCTGATAC (SEQ ID NO:908) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30).
  • a CasGamma protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasGamma2 amino acid sequence depicted in FIG. IB.
  • a CasGamma protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasGamma2 amino acid sequence depicted in FIG. IB.
  • a CasGamma protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasGamma2 amino acid sequence depicted in FIG. IB.
  • a CasGamma protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasGamma2 amino acid sequence depicted in FIG. IB.
  • a CasGamma protein includes an amino acid sequence having the CasGamma2 amino sequence depicted in FIG. IB.
  • a CasGamma protein includes an amino acid sequence having the CasGamma2 amino sequence depicted in FIG. IB, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasGamma polypeptide has a length of from 380 amino acids (aa) to 400 aa, e.g., from 380 aa to 390 aa, or from 390 aa to 400 aa). In some cases, the CasGamma polypeptide has a length of 388 amino acids.
  • a guide RNA that binds a CasGamma polypeptide includes the following nucleotide sequence: GTTCGAGACGAACCCTTGTGGGGTTGAAG (SEQ ID NO:4) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nGTTCGAGACGAACCCTTGTGGGGTTGAAG (SEQ ID NO:909) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30).
  • a CasGamma protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasGamma3 amino acid sequence depicted in FIG. 1C.
  • a CasGamma protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasGamma3 amino acid sequence depicted in FIG. 1C.
  • a CasGamma protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasGamma amino acid sequence depicted in FIG. 1C.
  • a CasGamma protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasGamma amino acid sequence depicted in FIG. 1C.
  • a CasGamma protein includes an amino acid sequence having the CasGamma amino acid sequence depicted in FIG. 1C.
  • a CasGamma protein includes an amino acid sequence having the CasGamma amino acid sequence depicted in FIG. 1C, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasGamma polypeptide has a length of from 385 amino acids (aa) to 405 aa, e.g., from 385 aa to 390 aa, from 390 aa to 395 aa, from 395 aa to 400 aa, or from 400 aa to 405 aa). In some cases, the CasGamma polypeptide has a length of 395 amino acids.
  • a guide RNA that binds a CasGamma polypeptide includes the following nucleotide sequence:
  • the guide RNA comprises the nucleotide sequence (N)n GTTCCAGACGGACCCTTGTGGGGTTGAAGC (SEQ ID NO:910) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30).
  • a CasGamma protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasGamma4 amino acid sequence depicted in FIG. ID.
  • a CasGamma protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasGamma4 amino acid sequence depicted in FIG. ID.
  • a CasGamma protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasGamma4 amino acid sequence depicted in FIG. ID.
  • a CasGamma protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasGamma4 amino acid sequence depicted in FIG. ID.
  • a CasGamma protein includes an amino acid sequence having the CasGamma amino acid sequence depicted in FIG. ID.
  • a CasGamma protein includes an amino acid sequence having the CasGamma amino acid sequence depicted in FIG. ID, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasGamma polypeptide has a length of from 390 amino acids (aa) to 410 aa, e.g., from 390 aa to 395 aa, from 395 aa to 400 aa, from
  • the CasGamma polypeptide has a length of
  • a guide RNA that binds a CasGamma polypeptide includes the following nucleotide sequence: GTTTCAGCCCCAGTGTAGCTGAACCATTT (SEQ ID NO: 8) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nGTTTCAGCCCCAGTGTAGCTGAACCATTT (SEQ ID NO:911) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30).
  • a CasGamma protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasGamma5 amino acid sequence depicted in FIG. IE.
  • a CasGamma protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasGamma5 amino acid sequence depicted in FIG. IE.
  • a CasGamma protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasGamma5 amino acid sequence depicted in FIG. IE.
  • a CasGamma protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasGamma5 amino acid sequence depicted in FIG. IE.
  • a CasGamma protein includes an amino acid sequence having the CasGamma amino acid sequence depicted in FIG. IE.
  • a CasGamma protein includes an amino acid sequence having the CasGamma amino acid sequence depicted in FIG. IE, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasGamma polypeptide has a length of from 270 amino acids (aa) to 290 aa, e.g., from 270 aa to 275 aa, from 275 aa to 280 aa, from 280 aa to 285 aa, or from 285 aa to 290 aa). In some cases, the CasGamma polypeptide has a length of 277 amino acids.
  • a guide RNA that binds a CasGamma polypeptide e.g., a CasGamma polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasGamma amino acid sequence depicted in FIG. IE) includes the following nucleotide sequence: CAAATAGTTCAGCTACACTGGGGCTGAAACTTCACC (SEQ ID NO: 10) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nCAAATAGTTCAGCTACACTGGGGCTGAAACTTCACC (SEQ ID NO:912) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30).
  • a CasGamma protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasGamma6 amino acid sequence depicted in FIG. IF.
  • a CasGamma protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasGamma6 amino acid sequence depicted in FIG. IF.
  • a CasGamma protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasGamma6 amino acid sequence depicted in FIG. IF.
  • a CasGamma protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasGamma6 amino acid sequence depicted in FIG. IF.
  • a CasGamma protein includes an amino acid sequence having the CasGamma amino acid sequence depicted in FIG. IF.
  • a CasGamma protein includes an amino acid sequence having the CasGamma amino acid sequence depicted in FIG. IF, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasGamma polypeptide has a length of from 390 amino acids (aa) to 410 aa, e.g., from 390 aa to 395 aa, from 395 aa to 400 aa, from 400 aa to 405 aa, or from 405 aa to 410 aa). In some cases, the CasGamma polypeptide has a length of 398 amino acids.
  • a guide RNA that binds a CasGamma polypeptide e.g., a CasGamma polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasGamma amino acid sequence depicted in FIG. IF) includes the following nucleotide sequence: ATGAACCCTTGTGGGGTTGAAGG (SEQ ID NO: 12) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nATGAACCCTTGTGGGGTTGAAGG (SEQ ID NO:913) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30).
  • a CasGamma protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasGamma7 amino acid sequence depicted in FIG. 1G.
  • a CasGamma protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasGamma7 amino acid sequence depicted in FIG. 1G.
  • a CasGamma protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasGamma7 amino acid sequence depicted in FIG. 1G.
  • a CasGamma protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasGamma7 amino acid sequence depicted in FIG. 1G.
  • a CasGamma protein includes an amino acid sequence having the CasGamma amino acid sequence depicted in FIG. 1G.
  • a CasGamma protein includes an amino acid sequence having the CasGamma amino acid sequence depicted in FIG. 1G, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasGamma polypeptide has a length of from 455 amino acids (aa) to 475 aa, e.g., from 455 aa to 460 aa, from 460 aa to 465 aa, from 465 aa to 470 aa, or from 470 aa to 475 aa). In some cases, the CasGamma polypeptide has a length of 464 amino acids.
  • a guide RNA that binds a CasGamma polypeptide e.g., a CasGamma polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasGamma amino acid sequence depicted in FIG. 1G) includes the following nucleotide sequence: GCTTCGACCCTACAATGGTTCTTCTGTGAC (SEQ ID NO: 14) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nGCTTCGACCCTACAATGGTTCTTCTGTGAC (SEQ ID NO:914) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasGamma protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasGamma8 amino acid sequence depicted in FIG. 1H.
  • a CasGamma protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasGamma8 amino acid sequence depicted in FIG. 1H.
  • a CasGamma protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasGamma8 amino acid sequence depicted in FIG. 1H.
  • a CasGamma protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasGamma8 amino acid sequence depicted in FIG. 1H.
  • a CasGamma protein includes an amino acid sequence having the CasGamma amino acid sequence depicted in FIG. 1H.
  • a CasGamma protein includes an amino acid sequence having the CasGamma amino acid sequence depicted in FIG. 1H, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasGamma polypeptide has a length of from 320 amino acids (aa) to 340 aa, e.g., from 320 aa to 325 aa, from 325 aa to 330 aa, from 330 aa to 335 aa, or from 335 aa to 340 aa. In some cases, the CasGamma polypeptide has a length of 329 amino acids.
  • a guide RNA that binds a CasGamma polypeptide includes the following nucleotide sequence: GTTTCAATCCCCTCTCGGGGTTTTCTTGGATTGCAAC (SEQ ID NO: 16) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)n GTTTCAATCCCCTCTCGGGGTTTTCTTGGATTGCAAC (SEQ ID NO:915) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasGamma protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasGamma9 amino acid sequence depicted in FIG. II.
  • a CasGamma protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasGamma9 amino acid sequence depicted in FIG. II.
  • a CasGamma protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasGamma9 amino acid sequence depicted in FIG. II.
  • a CasGamma protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasGamma9 amino acid sequence depicted in FIG. II.
  • a CasGamma protein includes an amino acid sequence having the CasGamma amino acid sequence depicted in FIG. II.
  • a CasGamma protein includes an amino acid sequence having the CasGamma amino acid sequence depicted in FIG. II, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasGamma polypeptide has a length of from 415 amino acids (aa) to 435 aa, e.g., from 415 aa to 420 aa, 420 aa to 425 aa, from 425 aa to 430 aa, or rom 430 aa to 435 aa). In some cases, the CasGamma polypeptide has a length of 426 amino acids.
  • a guide RNA that binds a CasGamma polypeptide includes the following nucleotide sequence:
  • the guide RNA comprises the nucleotide sequence (N)n GTTTCAATCCCGTTCTGGGTTTTCTCCCTGTTGCAACA (SEQ ID NO:916) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasGamma protein (of the subject compositions and/or methods) has more sequence identity to an amino acid sequence depicted in any one of FIG. 1A-1I than to any of the following: Casl2a proteins, Casl2b proteins, Casl2c proteins, Casl2d proteins, Casl2e proteins, Casl2 g proteins, Casl2h proteins, and Casl2i proteins.
  • a CasGamma protein (of the subject compositions and/or methods) includes an amino acid sequence having a RuvC domain (which includes the RuvC-I, RuvC-II, and RuvC-III domains) that has more sequence identity to the RuvC domain of an amino acid sequence depicted in FIG. 1A-1I (e.g., the RuvC domain of any of the CasGamma amino acid sequences depicted in FIG.
  • FIG. 2 depicts a Maximum Likelihood phylogenetic tree of the miniature enzymes, produced from a multiple sequence alignment with 1000 iterations. As shown in FIG. 2, CasGamma forms a distinct clade separate from previously described Casl2 and Type V proteins.
  • a CasTheta polypeptide (this term is used interchangeably with the terms “CasTheta protein”, “Cash polypeptide”, “Casl2m polypeptide,” and “CRISPR/CasTheta protein”) can bind and/or modify (e.g., cleave, nick, methylate, demethylate, etc.) a target nucleic acid and/or a polypeptide associated with target nucleic acid (e.g., methylation or acetylation of a histone tail) (e.g., in some cases, the CasTheta protein includes a fusion partner with an activity, and in some cases, the CasTheta protein provides nuclease activity or regulates expression of a target nucleic acid).
  • modify e.g., cleave, nick, methylate, demethylate, etc.
  • a polypeptide associated with target nucleic acid e.g., methylation or acetylation of a
  • the CasTheta protein is a naturally-occurring protein (e.g., naturally occurs in bacteriophage). In other cases, the CasTheta protein is not a naturally-occurring polypeptide (e.g., the CasTheta protein is a variant CasTheta protein (e.g., a catalytically inactive CasTheta protein, a fusion CasTheta protein, and the like).
  • a CasTheta polypeptide (e.g., not fused to any heterologous fusion partner) can have a molecular weight of from about 20 kiloDaltons (kDa) to about 75 kDa.
  • a CasTheta polypeptide can have a molecular weight of from about 20 kDa to about 25 kDa, from about 25 kDa to about 30 kDa, from about 30 kDa to about 35 kDa, from about 35 kDa to about 40 kDa, from about 40 kDa to about 45 kDa, from about 45 kDa to about 50 kDa, from about 50 kDa to about 55 kDa, from about 55 kDa to about 60 kDa, from about 60 kDa to about 65 kDa, from about 65 kDa to about 70 kDa, or from about 70 kDa to about 75 kDa.
  • Assays to determine whether a given protein interacts with a CasTheta guide RNA can be any convenient binding assay that tests for binding between a protein and a nucleic acid. Suitable binding assays (e.g., gel shift assays) will be known to one of ordinary skill in the art (e.g., assays that include adding a CasTheta guide RNA and a protein to a target nucleic acid).
  • Assays to determine whether a protein has an activity can be any convenient assay (e.g., any convenient nucleic acid cleavage assay that tests for nucleic acid cleavage). Suitable assays (e.g., cleavage assays) will be known to one of ordinary skill in the art.
  • a naturally occurring CasTheta protein functions as an endonuclease that catalyzes a double strand break at a specific sequence in a targeted double stranded DNA (dsDNA).
  • the sequence specificity is provided by the associated guide RNA, which hybridizes to a target sequence within the target DNA.
  • the naturally occurring CasTheta guide RNA is a crRNA, where the crRNA includes (i) a guide sequence that hybridizes to a target sequence in the target DNA and (ii) a protein binding segment which includes a stem-loop (hairpin - dsRNA duplex) that binds to the CasTheta protein.
  • a CasTheta polypeptide of the present disclosure when complexed with a CasTheta guide RNA, generates a product nucleic acid comprising 5’ overhang following site specific cleavage of a target nucleic acid.
  • the 5’ overhang can be an 8 to 12 nucleotide (nt) overhang.
  • the 5’ overhang can be 8 nt, 9 nt, 10 nt, 11, nt, or 12 nt in length.
  • a CasTheta polypeptide of the present disclosure includes a RuvC-like domain at or near the C-terminus of the protein.
  • a CasTheta protein of the subject methods and/or compositions is (or is derived from) a naturally occurring (wild type) protein. Examples of naturally occurring CasTheta proteins are depicted in FIG. 3A-3AC.
  • a CasTheta protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with any one of the CasTheta amino acid sequences depicted in FIG. 3A-3AC.
  • a CasTheta protein (of the subject compositions and/or methods) includes an amino acid sequence depicted in FIG. 3A-3AC.
  • a CasTheta protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the RuvC domain (which includes the RuvC-I, RuvC-II, and RuvC-III domains) of any one of the CasTheta amino acid sequences depicted in any one of FIG. 3A-3AC.
  • sequence identity e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity
  • RuvC domain which includes the RuvC-I, RuvC-II, and RuvC-III domains
  • a CasTheta protein (of the subject compositions and/or methods) includes an amino acid sequence having 70% or more sequence identity (e.g., 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the RuvC domain (which includes the RuvC-I, RuvC-II, and RuvC-III domains) of any one of the CasTheta amino acid sequences depicted in FIG. 3A-3AC.
  • a CasTheta protein (of the subject compositions and/or methods) includes the RuvC domain (which includes the RuvC-I, RuvC-II, and RuvC-III domains) of any one of the CasTheta amino acid sequences depicted in FIG. 3A-3AC.
  • a guide RNA that binds a CasTheta polypeptide is encoded by a DNA molecule that includes a nucleotide sequence depicted in FIG. 3A-3AC (or in some cases the reverse complement of same).
  • the guide RNA comprises the nucleotide sequence (N)nX or the reverse complement of same, where N is any nucleotide, n is an integer from 15 to 30 (e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30), and X is any one of the nucleotide sequences depicted in FIG. 1 (or in some cases the reverse complement of same).
  • the “repeat” portion of a CasTheta guide RNA is encoded by a DNA molecule comprising a nucleotide sequence selected from: 1) GGTCGACGCGCCCCGGATCTGAGGGGTGATCAGAGG (SEQ ID NO:20; FIG. 3A); 2) GGTTGCGCTGTCCTTGCGAACGTAAGCTCACAGCAAC (SEQ ID NO:22; FIG. 3B); 3) CCCCCGTCCCCGCGCCCACAGGCGAACC (SEQ ID NO:26; FIG. 3C); 4) CTTTCATTTCCCACTATTCCTATTCAATCGCTGAAAC (SEQ ID NO:26; FIG.
  • a guide RNA that binds a CasTheta polypeptide is encoded by a DNA molecule that includes a nucleotide sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with any one of the sequences depicted in FIG. 3A-3AC (or in some cases the reverse complement of same).
  • sequence identity e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity
  • the guide RNA comprises the nucleotide sequence (N)nX or the reverse complement of same, where N is any nucleotide, n is an integer from 15 to 30 (e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30), and X a nucleotide sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with an RNA encoded by any one of the sequences depicted in FIG. 3A-3AC.
  • Examples of CasTheta proteins are depicted in FIG. 3A-3AC. For example:
  • CasTheta2 135257259_6 the CasTheta polypeptide designated “CasTheta2 135257259_6” and depicted in FIG. 3B is also referred to herein as “CasTheta2”’
  • CasTheta4 262849453_2 the CasTheta polypeptide designated “CasTheta4 262849453_2” and depicted in FIG. 3D is also referred to herein as “CasTheta4”;
  • CasTheta5 the CasTheta polypeptide designated “CasTheta5 119549308_l” and depicted in FIG. 3E is also referred to herein as “CasTheta5”;
  • CasTheta6 the CasTheta polypeptide designated “CasTheta6 119556445_26” and depicted in FIG. 3F is also referred to herein as “CasTheta6”;
  • CasTheta9 the CasTheta polypeptide designated “CasTheta9_kl41_1530526 192187832_7” and depicted in FIG. 31 is also referred to herein as “CasTheta9”.
  • CasTheta polypeptide designated “CasThetalO 191972780_3” and depicted in FIG. 3J is also referred to herein as “CasThetalO”.
  • CasTheta polypeptide designated “CasThetal 1 114640373_5” and depicted in FIG. 3K is also referred to herein as “CasThetal 1”.
  • CasTheta polypeptide designated “CasThetal2 115083973_2” and depicted in FIG. 3L is also referred to herein as “CasThetal2”.
  • CasTheta polypeptide designated “CasThetal4 118516021_3” and depicted in FIG. 3N is also referred to herein as “CasThetal4”.
  • CasTheta polypeptide designated “CasThetal5 47247254_12” and depicted in FIG. 30 is also referred to herein as “CasThetal5”.
  • CasTheta polypeptide designated “CasThetal8 2896432_6” and depicted in FIG. 3R is also referred to herein as “CasThetal8”.
  • CasTheta polypeptide designated “CasThetal9 3834302_2” and depicted in FIG. 3S is also referred to herein as “CasThetal9”.
  • CasTheta20 141450812_7 the CasTheta polypeptide designated “CasTheta20 141450812_7” and depicted in FIG. 3T is also referred to herein as “CasTheta20”.
  • CasTheta22 141575229_1 the CasTheta polypeptide designated “CasTheta22 141575229_1” and depicted in FIG. 3V is also referred to herein as “CasTheta22”.
  • CasTheta23 the CasTheta polypeptide designated “CasTheta23 45583024_l” and depicted in FIG. 3W is also referred to herein as “CasTheta23”.
  • CasTheta24 the CasTheta polypeptide designated “CasTheta24 174732399_1” and depicted in FIG. 3X is also referred to herein as “CasTheta24”.
  • CasTheta25 the CasTheta polypeptide designated “CasTheta25 192356227_1” and depicted in FIG. 3Y is also referred to herein as “CasTheta25”.
  • CasTheta26 the CasTheta polypeptide designated “CasTheta26 146048927_7” and depicted in FIG. 3Z is also referred to herein as “CasTheta26”.
  • 3AA is also referred to herein as “CasTheta27”.
  • CasTheta29 7246786_2 the CasTheta polypeptide designated “CasTheta29 7246786_2” and depicted in FIG. 3AC is also referred to herein as “CasTheta29”.
  • a CasTheta protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasThetal amino acid sequence depicted in FIG. 3A.
  • a CasTheta protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasThetal amino acid sequence depicted in FIG. 3A.
  • a CasTheta protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasThetal amino acid sequence depicted in FIG. 3A.
  • a CasTheta protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasThetal amino acid sequence depicted in FIG. 3A.
  • a CasTheta protein includes an amino acid sequence having the CasThetal amino acid sequence depicted in FIG. 3A.
  • a CasTheta protein includes an amino acid sequence having the CasThetal amino acid sequence depicted in FIG. 3A, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasTheta polypeptide has a length of from 575 amino acids (aa) to 595 aa, e.g. from 575 aa to 580 aa, from 580 aa to 585 aa, from 585 aa to 590 aa, or from 590 aa to 595 aa. In some cases, a CasTheta polypeptide has a length of 585 amino acids.
  • a guide RNA that binds a CasTheta polypeptide includes the following nucleotide sequence:
  • the guide RNA comprises the nucleotide sequence (N)n GGTCGACGCGCCCCGGATCTGAGGGGTGATCAGAGG (SEQ ID NO:917) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30).
  • a CasTheta protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta2 amino acid sequence depicted in FIG. 3B.
  • a CasTheta protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta2 amino acid sequence depicted in FIG. 3B.
  • a CasTheta protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta2 amino acid sequence depicted in FIG. 3B.
  • a CasTheta protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta2 amino acid sequence depicted in FIG. 3B.
  • a CasTheta protein includes an amino acid sequence having the CasTheta2 amino sequence depicted in FIG. 3B.
  • a CasTheta protein includes an amino acid sequence having the CasTheta2 amino sequence depicted in FIG. 3B, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasTheta polypeptide has a length of from 385 amino acids (aa) to 405 aa, e.g., from 385 aa to 390 aa, from 390 aa to 395 aa, from 395 aa to 400 aa, or from 400 aa to 405 aa. In some cases, the CasTheta polypeptide has a length of 395 amino acids.
  • a guide RNA that binds a CasTheta polypeptide e.g., a CasTheta polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasTheta amino acid sequence depicted in FIG. 3B) includes the following nucleotide sequence: GTTGCGCTGTCCTTGCGAACGTAAGCTCACAGCAAC (SEQ ID NO:22) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)n GTTGCGCTGTCCTTGCGAACGTAAGCTCACAGCAAC (SEQ ID NO:918) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30).
  • a CasTheta protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta3 amino acid sequence depicted in FIG. 3C.
  • a CasTheta protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta3 amino acid sequence depicted in FIG. 3C.
  • a CasTheta protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta amino acid sequence depicted in FIG. 3C.
  • a CasTheta protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta amino acid sequence depicted in FIG. 3C.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3C.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3C, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasTheta polypeptide has a length of from 525 amino acids (aa) to 545 aa, e.g., from 525 aa to 530 aa, from 530 aa to 535 aa, from 535 aa to 540 aa, or from 540 aa to 545 aa. In some cases, the CasTheta polypeptide has a length of 537 amino acids.
  • a guide RNA that binds a CasTheta polypeptide e.g., a CasTheta polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasTheta amino acid sequence depicted in FIG. 3C) includes the following nucleotide sequence: CCCCCGTCCCCGCGCCCACAGGCGAACC (SEQ ID NO:24) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nCCCCCGTCCCCGCGCCCACAGGCGAACC (SEQ ID NO:919) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30).
  • a CasTheta protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta4 amino acid sequence depicted in FIG. 3D.
  • a CasTheta protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta4 amino acid sequence depicted in FIG. 3D.
  • a CasTheta protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta4 amino acid sequence depicted in FIG. 3D.
  • a CasTheta protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta4 amino acid sequence depicted in FIG. 3D.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3D.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3D, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasTheta polypeptide has a length of from 490 amino acids (aa) to 510 aa, e.g., from 490 aa to 495 aa, from 495 aa to 500 aa, from 500 aa to 505 aa, or from 505 aa to 510 aa. In some cases, the CasTheta polypeptide has a length of 502 amino acids.
  • a guide RNA that binds a CasTheta polypeptide e.g., a CasTheta polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasTheta amino acid sequence depicted in FIG. 3D) includes the following nucleotide sequence: CTTTCATTTCCCACTATTCCTATTCAATCGCTGAAAC (SEQ ID NO: 26) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)n CTTTCATTTCCCACTATTCCTATTCAATCGCTGAAAC (SEQ ID NO:920) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30).
  • a CasTheta protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta5 amino acid sequence depicted in FIG. 3E.
  • a CasTheta protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta5 amino acid sequence depicted in FIG. 3E.
  • a CasTheta protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta5 amino acid sequence depicted in FIG. 3E.
  • a CasTheta protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta5 amino acid sequence depicted in FIG. 3E.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3E.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3E, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasTheta polypeptide has a length of from 580 amino acids (aa) to 600 aa, e.g., from 580 aa to 585 aa, from 585 aa to 590 aa, from 590 aa to 595 aa, or from 595 aa to 600 aa. In some cases, the CasTheta polypeptide has a length of 589 amino acids.
  • a guide RNA that binds a CasTheta polypeptide e.g., a CasTheta polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasTheta amino acid sequence depicted in FIG. 3E) includes the following nucleotide sequence: ATGCTGTAGTCCCCCGGGAAACACCGGCCGGCAACACC (SEQ ID NO:28) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nATGCTGTAGTCCCCCGGGAAACACCGGCCGGCAACACC (SEQ ID NO:921) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30).
  • a CasTheta protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta6 amino acid sequence depicted in FIG. 3F.
  • a CasTheta protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta6 amino acid sequence depicted in FIG. 3F.
  • a CasTheta protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta6 amino acid sequence depicted in FIG. 3F.
  • a CasTheta protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta6 amino acid sequence depicted in FIG. 3F.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3F.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3F, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasTheta polypeptide has a length of from 530 amino acids (aa) to 550 aa, e.g., from 530 aa to 535 aa, from 535 aa to 540 aa, from 540 aa to 545 aa, or from 545 aa to 550 aa. In some cases, the CasTheta polypeptide has a length of 541 amino acids.
  • a guide RNA that binds a CasTheta polypeptide e.g., a CasTheta polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasTheta amino acid sequence depicted in FIG. 3F) includes the following nucleotide sequence: GTTGCAACAGGGTTCTTGTGCTGGAAGTTACTGAAAC (SEQ ID NO:30) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nGTTGCAACAGGGTTCTTGTGCTGGAAGTTACTGAAAC (SEQ ID NO:922) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30).
  • a CasTheta protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta7 amino acid sequence depicted in FIG. 3G.
  • a CasTheta protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta7 amino acid sequence depicted in FIG. 3G.
  • a CasTheta protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta7 amino acid sequence depicted in FIG. 3G.
  • a CasTheta protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta7 amino acid sequence depicted in FIG. 3G.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3G.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3G, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasTheta polypeptide has a length of from 500 amino acids (aa) to 520 aa, e.g., from 500 aa to 505 aa, from 505 aa to 510 aa, from 510 aa to 515 aa, or from 515 aa to 520 aa. In some cases, the CasTheta polypeptide has a length of 509 amino acids.
  • a guide RNA that binds a CasTheta polypeptide e.g., a CasTheta polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasTheta amino acid sequence depicted in FIG. 3G) includes the following nucleotide sequence: GACTCAACGGTATGTGCGCTTAAGCGAGGATTGAAAC (SEQ ID NO:32) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nGACTCAACGGTATGTGCGCTTAAGCGAGGATTGAAAC (SEQ ID NO:923) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasTheta protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta8 amino acid sequence depicted in FIG. 3H.
  • a CasTheta protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta8 amino acid sequence depicted in FIG. 3H.
  • a CasTheta protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta8 amino acid sequence depicted in FIG. 3H.
  • a CasTheta protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasThetaS amino acid sequence depicted in FIG. 3H.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3H.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3H, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasTheta polypeptide has a length of from 510 amino acids (aa) to 530 aa, e.g., from 510 aa to 515 aa, from 515 aa to 520 aa, from 520 aa to 525 aa, or from 525 aa to 530 aa. In some cases, the CasTheta polypeptide has a length of 519 amino acids.
  • a guide RNA that binds a CasTheta polypeptide e.g., a CasTheta polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasTheta amino acid sequence depicted in FIG. 3H) includes the following nucleotide sequence: CGTTGCAGCGCTGCTCGCAGCATCGGTGGGAGTGAAACA (SEQ ID NO:34) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nCGTTGCAGCGCTGCTCGCAGCATCGGTGGGAGTGAAACA (SEQ ID NO:924) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasTheta protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta9 amino acid sequence depicted in FIG. 31.
  • a CasTheta protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta9 amino acid sequence depicted in FIG. 31.
  • a CasTheta protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta9 amino acid sequence depicted in FIG. 31.
  • a CasTheta protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta9 amino acid sequence depicted in FIG. 31.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 31.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 31, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasTheta polypeptide has a length of from 500 amino acids (aa) to 520 aa, e.g., from 500 aa to 505 aa, 505 aa to 510 aa, from 510 aa to 515 aa, or from 515 aa to 520 aa. In some cases, the CasTheta polypeptide has a length of 507 amino acids.
  • a guide RNA that binds a CasTheta polypeptide e.g., a CasTheta polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasTheta amino acid sequence depicted in FIG. 31) includes the following nucleotide sequence: GTTGCAGTGCTGCCCGAAGCTTCGGTGGGAGTGAAACT (SEQ ID NO:36) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nGTTGCAGTGCTGCCCGAAGCTTCGGTGGGAGTGAAACT (SEQ ID NO:925) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasTheta protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasThetalO amino acid sequence depicted in FIG. 3J.
  • a CasTheta protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasThetalO amino acid sequence depicted in FIG. 3J.
  • a CasTheta protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasThetalO amino acid sequence depicted in FIG. 3J.
  • a CasTheta protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasThetalO amino acid sequence depicted in FIG. 3J.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3J.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3J, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasTheta polypeptide has a length of from 490 amino acids (aa) to 510 aa, e.g., from 490 aa to 495 aa, 495 aa to 500 aa, from 500 aa to 505 aa, or from 505 aa to 510 aa. In some cases, the CasTheta polypeptide has a length of 503 amino acids.
  • a guide RNA that binds a CasTheta polypeptide e.g., a CasTheta polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasTheta amino acid sequence depicted in FIG. 3J) includes the following nucleotide sequence: GTCTCAACGCTACCACGGCAGCCCCGGAAC (SEQ ID NO:38) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nGTCTCAACGCTACCACGGCAGCCCCGGAAC (SEQ ID NO:926) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasTheta protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasThetal 1 amino acid sequence depicted in FIG. 3K.
  • a CasTheta protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasThetal 1 amino acid sequence depicted in FIG. 3K.
  • a CasTheta protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasThetal 1 amino acid sequence depicted in FIG. 3K.
  • a CasTheta protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasThetal 1 amino acid sequence depicted in FIG. 3K.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3K.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3K, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasTheta polypeptide has a length of from 510 amino acids (aa) to 530 aa, e.g., from 510 aa to 515 aa, 515 aa to 520 aa, from 520 aa to 525 aa, or from 525 aa to 530 aa. In some cases, the CasTheta polypeptide has a length of 520 amino acids.
  • a guide RNA that binds a CasTheta polypeptide e.g., a CasTheta polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasTheta amino acid sequence depicted in FIG. 3K) includes the following nucleotide sequence: GTTGCACAGTCTGCAGATGAACCTGGTGGACTGTGAC (SEQ ID NO:40) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nGTTGCACAGTCTGCAGATGAACCTGGTGGACTGTGAC (SEQ ID NO:927) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasTheta protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasThetal2 amino acid sequence depicted in FIG. 3L.
  • a CasTheta protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasThetal2 amino acid sequence depicted in FIG. 3L.
  • a CasTheta protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasThetal2 amino acid sequence depicted in FIG. 3L.
  • a CasTheta protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasThetal2 amino acid sequence depicted in FIG. 3L.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3L.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3L, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasTheta polypeptide has a length of from 445 amino acids (aa) to 465 aa, e.g., from 445 aa to 450 aa, 450 aa to 455 aa, from 455 aa to 460 aa, or from 460 aa to 465 aa. In some cases, the CasTheta polypeptide has a length of 456 amino acids.
  • a guide RNA that binds a CasTheta polypeptide e.g., a CasTheta polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasTheta amino acid sequence depicted in FIG. 3L) includes the following nucleotide sequence: GCTGTAGTTTCGCTCGCATTTGCGGGGTGATATGAC (SEQ ID NO:42) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nGCTGTAGTTTCGCTCGCATTTGCGGGGTGATATGAC (SEQ ID NO:928) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasTheta protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasThetal3 amino acid sequence depicted in FIG. 3M.
  • a CasTheta protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasThetal3 amino acid sequence depicted in FIG. 3M.
  • a CasTheta protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasThetal3 amino acid sequence depicted in FIG. 3M.
  • a CasTheta protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasThetal3 amino acid sequence depicted in FIG. 3M.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3M.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3M, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasTheta polypeptide has a length of from 550 amino acids (aa) to 570 aa, e.g., from 550 aa to 555 aa, 555 aa to 560 aa, from 560 aa to 565 aa, or from 565 aa to 570 aa. In some cases, the CasTheta polypeptide has a length of 561 amino acids.
  • a guide RNA that binds a CasTheta polypeptide e.g., a CasTheta polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasTheta amino acid sequence depicted in FIG. 3M) includes the following nucleotide sequence: ACCTCATTTCCACCCTATTGAAATTTAAAC (SEQ ID NO:44) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nACCTCATTTCCACCCTATTGAAATTTAAAC (SEQ ID NO:929) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasTheta protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasThetal4 amino acid sequence depicted in FIG. 3N.
  • a CasTheta protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasThetal4 amino acid sequence depicted in FIG. 3N.
  • a CasTheta protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasThetal4 amino acid sequence depicted in FIG. 3N.
  • a CasTheta protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasThetal4 amino acid sequence depicted in FIG. 3N.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3N.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3N, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasTheta polypeptide has a length of from 495 amino acids (aa) to 515 aa, e.g., from 495 aa to 500 aa, 500 aa to 505 aa, from 505 aa to 510 aa, or from 510 aa to 515 aa. In some cases, the CasTheta polypeptide has a length of 506 amino acids.
  • a guide RNA that binds a CasTheta polypeptide e.g., a CasTheta polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasTheta amino acid sequence depicted in FIG. 3N) includes the following nucleotide sequence: CTTTCATCTGAACCATGTGGGATATAAAGT (SEQ ID NO:46) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nCTTTCATCTGAACCATGTGGGATATAAAGT (SEQ ID NO:930) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasTheta protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasThetal5 amino acid sequence depicted in FIG. 30.
  • a CasTheta protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta 15 amino acid sequence depicted in FIG. 30.
  • a CasTheta protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasThetal5 amino acid sequence depicted in FIG. 30.
  • a CasTheta protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasThetal5 amino acid sequence depicted in FIG. 30.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 30.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 30, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasTheta polypeptide has a length of from 445 amino acids (aa) to 465 aa, e.g., from 445 aa to 450 aa, 450 aa to 455 aa, from 455 aa to 460 aa, or from 460 aa to 465 aa. In some cases, the CasTheta polypeptide has a length of 453 amino acids.
  • a guide RNA that binds a CasTheta polypeptide includes the following nucleotide sequence: GGTAGCGGCAATGAGAGGCCTTGGTAAAACGATGCAAC (SEQ ID NO:48) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nGGTAGCGGCAATGAGAGGCCTTGGTAAAACGATGCAAC (SEQ ID NO:931) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasTheta protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasThetal6 amino acid sequence depicted in FIG. 3P.
  • a CasTheta protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasThetal6 amino acid sequence depicted in FIG. 3P.
  • a CasTheta protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasThetal6 amino acid sequence depicted in FIG. 3P.
  • a CasTheta protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasThetal6 amino acid sequence depicted in FIG. 3P.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3P.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3P, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasTheta polypeptide has a length of from 210 amino acids (aa) to 230 aa, e.g., from 210 aa to 215 aa, 215 aa to 220 aa, from 220 aa to 225 aa, or from 225 aa to 230 aa. In some cases, the CasTheta polypeptide has a length of 220 amino acids.
  • a guide RNA that binds a CasTheta polypeptide e.g., a CasTheta polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasTheta amino acid sequence depicted in FIG. 3P) includes the following nucleotide sequence: GTTTCACTCCCACTGGAATTTGGGCGGCGCTACAGC (SEQ ID NO:50) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nGTTTCACTCCCACTGGAATTTGGGCGGCGCTACAGC (SEQ ID NO:932) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasTheta protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasThetal7 amino acid sequence depicted in FIG. 3Q.
  • a CasTheta protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasThetal7 amino acid sequence depicted in FIG. 3Q.
  • a CasTheta protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasThetal7 amino acid sequence depicted in FIG. 3Q.
  • a CasTheta protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasThetal7 amino acid sequence depicted in FIG. 3Q.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3Q.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3Q, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasTheta polypeptide has a length of from 275 amino acids (aa) to 295 aa, e.g., from 275 aa to 280 aa, 280 aa to 285 aa, from 285 aa to 290 aa, or from 290 aa to 295 aa. In some cases, the CasTheta polypeptide has a length of 286 amino acids.
  • a guide RNA that binds a CasTheta polypeptide e.g., a CasTheta polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasTheta amino acid sequence depicted in FIG. 3Q) includes the following nucleotide sequence: GTTTCACTCCCACTGGAATTTGGGCGGCGCTACAGC (SEQ ID NO:50) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nGTTTCACTCCCACTGGAATTTGGGCGGCGCTACAGC (SEQ ID NO:932) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasTheta protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasThetal8 amino acid sequence depicted in FIG. 3R.
  • a CasTheta protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasThetal8 amino acid sequence depicted in FIG. 3R.
  • a CasTheta protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasThetal8 amino acid sequence depicted in FIG. 3R.
  • a CasTheta protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasThetal8 amino acid sequence depicted in FIG. 3R.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3R.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3R, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasTheta polypeptide has a length of from 600 amino acids (aa) to 620 aa, e.g., from 600 aa to 605 aa, 605 aa to 610 aa, from 610 aa to 615 aa, or from 615 aa to 620 aa. In some cases, the CasTheta polypeptide has a length of 609 amino acids.
  • a guide RNA that binds a CasTheta polypeptide e.g., a CasTheta polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasTheta amino acid sequence depicted in FIG. 3R) includes the following nucleotide sequence: ATTTCGATTCAACTATAGTCCGATTAAAAC (SEQ ID NO:53) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nATTTCGATTCAACTATAGTCCGATTAAAAC (SEQ ID NO:933) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasTheta protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasThetal9 amino acid sequence depicted in FIG. 3S.
  • a CasTheta protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasThetal9 amino acid sequence depicted in FIG. 3S.
  • a CasTheta protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasThetal9 amino acid sequence depicted in FIG. 3S.
  • a CasTheta protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasThetal9 amino acid sequence depicted in FIG. 3S.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3S.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3S, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasTheta polypeptide has a length of from 560 amino acids (aa) to 580 aa, e.g., from 560 aa to 565 aa, 565 aa to 570 aa, from 570 aa to 575 aa, or from 575 aa to 580 aa. In some cases, the CasTheta polypeptide has a length of 571 amino acids.
  • a guide RNA that binds a CasTheta polypeptide e.g., a CasTheta polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasTheta amino acid sequence depicted in FIG. 3S) includes the following nucleotide sequence: GTTGCAATACTCTCCAAAGAACACACATCATTGCAA (SEQ ID NO:55) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nGTTGCAATACTCTCCAAAGAACACACATCATTGCAA (SEQ ID NO:934) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasTheta protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta20 amino acid sequence depicted in FIG. 3T.
  • a CasTheta protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta20 amino acid sequence depicted in FIG. 3T.
  • a CasTheta protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta20 amino acid sequence depicted in FIG. 3T.
  • a CasTheta protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta20 amino acid sequence depicted in FIG. 3T.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3T.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3T, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasTheta polypeptide has a length of from 520 amino acids (aa) to 540 aa, e.g., from 520 aa to 525 aa, 525 aa to 530 aa, from 530 aa to 535 aa, or from 535 aa to 540 aa. In some cases, the CasTheta polypeptide has a length of 530 amino acids.
  • a guide RNA that binds a CasTheta polypeptide e.g., a CasTheta polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasTheta amino acid sequence depicted in FIG. 3T) includes the following nucleotide sequence: GTCACAGTCTACCAGTGTCGCTGGCAGCCTGTGCAAT (SEQ ID NO:57) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nGTCACAGTCTACCAGTGTCGCTGGCAGCCTGTGCAAT (SEQ ID NO:935) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasTheta protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta21 amino acid sequence depicted in FIG. 3U.
  • a CasTheta protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta21 amino acid sequence depicted in FIG. 3U.
  • a CasTheta protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta21 amino acid sequence depicted in FIG. 3U.
  • a CasTheta protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta21 amino acid sequence depicted in FIG. 3U.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3U.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3U, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasTheta polypeptide has a length of from 345 amino acids (aa) to 365 aa, e.g., from 345 aa to 350 aa, 350 aa to 355 aa, from 355 aa to 360 aa, or from 360 aa to 365 aa. In some cases, the CasTheta polypeptide has a length of 356 amino acids.
  • a guide RNA that binds a CasTheta polypeptide e.g., a CasTheta polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasTheta amino acid sequence depicted in FIG. 3U) includes the following nucleotide sequence: ATATGCACAGCCTCGATGAAAGATTGGTAGGCTGTGAC (SEQ ID NO:59) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nATATGCACAGCCTCGATGAAAGATTGGTAGGCTGTGAC (SEQ ID NO:936) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasTheta protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta22 amino acid sequence depicted in FIG. 3V.
  • a CasTheta protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta22 amino acid sequence depicted in FIG. 3V.
  • a CasTheta protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta22 amino acid sequence depicted in FIG. 3V.
  • a CasTheta protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta22 amino acid sequence depicted in FIG. 3V.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3V.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3V, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasTheta polypeptide has a length of from 465 amino acids (aa) to 485 aa, e.g., from 465 aa to 470 aa, 470 aa to 475 aa, from 475 aa to 480 aa, or from 480 aa to 485 aa. In some cases, the CasTheta polypeptide has a length of 476 amino acids.
  • a guide RNA that binds a CasTheta polypeptide e.g., a CasTheta polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasTheta amino acid sequence depicted in FIG. 3 V) includes the following nucleotide sequence: GTTGCAGGGCGCAACGCACAACGGAGCACAATGCGAC (SEQ ID NO:61) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nGTTGCAGGGCGCAACGCACAACGGAGCACAATGCGAC (SEQ ID NO:937) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasTheta protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta23 amino acid sequence depicted in FIG. 3W.
  • a CasTheta protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta23 amino acid sequence depicted in FIG. 3W.
  • a CasTheta protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta23 amino acid sequence depicted in FIG. 3W.
  • a CasTheta protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta23 amino acid sequence depicted in FIG. 3W.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3W.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3W, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasTheta polypeptide has a length of from 570 amino acids (aa) to 590 aa, e.g., from 570 aa to 575 aa, 575 aa to 580 aa, from 580 aa to 585 aa, or from 585 aa to 590 aa. In some cases, the CasTheta polypeptide has a length of 578 amino acids.
  • a guide RNA that binds a CasTheta polypeptide e.g., a CasTheta polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasTheta amino acid sequence depicted in FIG. 3W) includes the following nucleotide sequence: GTTGCATCGTTTTACCAAGGCCTCTCATTGTCGCCAC (SEQ ID NO:63) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nGTTGCATCGTTTTACCAAGGCCTCTCATTGTCGCCAC (SEQ ID NO:938) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasTheta protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta24 amino acid sequence depicted in FIG. 3X.
  • a CasTheta protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta24 amino acid sequence depicted in FIG. 3X.
  • a CasTheta protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta24 amino acid sequence depicted in FIG. 3X.
  • a CasTheta protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta24 amino acid sequence depicted in FIG. 3X.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3X.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3X, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasTheta polypeptide has a length of from 525 amino acids (aa) to 545 aa, e.g., from 525 aa to 530 aa, 530 aa to 535 aa, from 535 aa to 540 aa, or from 540 aa to 545 aa. In some cases, the CasTheta polypeptide has a length of 533 amino acids.
  • a guide RNA that binds a CasTheta polypeptide e.g., a CasTheta polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasTheta amino acid sequence depicted in FIG. 3X) includes the following nucleotide sequence: GTTTCACTCCCACCGATGCTGCGAGCAGCGTTGCAAC (SEQ ID NO:65) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nGTTTCACTCCCACCGATGCTGCGAGCAGCGTTGCAAC (SEQ ID NO:939) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasTheta protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta25 amino acid sequence depicted in FIG. 3Y.
  • a CasTheta protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta25 amino acid sequence depicted in FIG. 3Y.
  • a CasTheta protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta25 amino acid sequence depicted in FIG. 3Y.
  • a CasTheta protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta25 amino acid sequence depicted in FIG. 3Y.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3Y.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3Y, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasTheta polypeptide has a length of from 480 amino acids (aa) to 500 aa, e.g., from 480 aa to 485 aa, 485 aa to 490 aa, from 490 aa to 495 aa, or from 495 aa to 500 aa. In some cases, the CasTheta polypeptide has a length of 489 amino acids.
  • a guide RNA that binds a CasTheta polypeptide e.g., a CasTheta polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasTheta amino acid sequence depicted in FIG. 3Y) includes the following nucleotide sequence: GTTACACTCCCGCCCCGGTAATTGGGGGGAGTGAAAC (SEQ ID NO:67) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nGTTACACTCCCGCCCCGGTAATTGGGGGGAGTGAAAC (SEQ ID NO:940) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasTheta protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta26 amino acid sequence depicted in FIG. 3Z.
  • a CasTheta protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta26 amino acid sequence depicted in FIG. 3Z.
  • a CasTheta protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta26 amino acid sequence depicted in FIG. 3Z.
  • a CasTheta protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta26 amino acid sequence depicted in FIG. 3Z.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3Z.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3Z, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasTheta polypeptide has a length of from 490 amino acids (aa) to 510 aa, e.g., from 490 aa to 495 aa, 495 aa to 500 aa, from 500 aa to 505 aa, or from 505 aa to 510 aa. In some cases, the CasTheta polypeptide has a length of 503 amino acids.
  • a guide RNA that binds a CasTheta polypeptide includes the following nucleotide sequence: CCTTCCGCCCACGGGCGCGAGGACGGGGCG (SEQ ID NO:69) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nCCTTCCGCCCACGGGCGCGAGGACGGGGCG (SEQ ID NO:941) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasTheta protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta27 amino acid sequence depicted in FIG. 3AA.
  • a CasTheta protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta27 amino acid sequence depicted in FIG. 3AA.
  • a CasTheta protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta27 amino acid sequence depicted in FIG. 3AA.
  • a CasTheta protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta27 amino acid sequence depicted in FIG. 3AA.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3AA.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3AA, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasTheta polypeptide has a length of from 535 amino acids (aa) to 555 aa, e.g., from 535 aa to 540 aa, 540 aa to 545 aa, from 545 aa to 550 aa, or from 550 aa to 555 aa. In some cases, the CasTheta polypeptide has a length of 546 amino acids.
  • a guide RNA that binds a CasTheta polypeptide e.g., a CasTheta polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasTheta amino acid sequence depicted in FIG. 3AA) includes the following nucleotide sequence: TGTTGCATCGTTTTACCAAGGCCTCTCATTGCCGCTAC (SEQ ID NO:71) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nTGTTGCATCGTTTTACCAAGGCCTCTCATTGCCGCTAC (SEQ ID NO:942) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasTheta protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta28 amino acid sequence depicted in FIG. 3 AB.
  • a CasTheta protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta28 amino acid sequence depicted in FIG. 3AB.
  • a CasTheta protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta28 amino acid sequence depicted in FIG. 3AB.
  • a CasTheta protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta28 amino acid sequence depicted in FIG. 3AB.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3AB.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3AB, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasTheta polypeptide has a length of from 470 amino acids (aa) to 490 aa, e.g., from 470 aa to 475 aa, 475 aa to 480 aa, from 480 aa to 485 aa, or from 485 aa to 490 aa. In some cases, the CasTheta polypeptide has a length of 480 amino acids.
  • a guide RNA that binds a CasTheta polypeptide e.g., a CasTheta polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasTheta amino acid sequence depicted in FIG. 3AB) includes the following nucleotide sequence: CTTTCAATACCCCAAGGGTACGATTCGAAC (SEQ ID NO:73) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nCTTTCAATACCCCAAGGGTACGATTCGAAC (SEQ ID NO:943) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasTheta protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta29 amino acid sequence depicted in FIG. 3 AC.
  • a CasTheta protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta29 amino acid sequence depicted in FIG. 3 AC.
  • a CasTheta protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta29 amino acid sequence depicted in FIG. 3AC.
  • a CasTheta protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasTheta29 amino acid sequence depicted in FIG. 3AC.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3AC.
  • a CasTheta protein includes an amino acid sequence having the CasTheta amino acid sequence depicted in FIG. 3AC, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasTheta polypeptide has a length of from 585 amino acids (aa) to 605 aa, e.g., from 585 aa to 590 aa, 590 aa to 595 aa, from 595 aa to 600 aa, or from 600 aa to 605 aa. In some cases, the CasTheta polypeptide has a length of 593 amino acids.
  • a guide RNA that binds a CasTheta polypeptide e.g., a CasTheta polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasTheta amino acid sequence depicted in FIG. 3AC) includes the following nucleotide sequence: GTTGCAAAGGCTGGGTCATGAGGGTGATAAATGCAAC (SEQ ID NO:75) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)n GTTGCAAAGGCTGGGTCATGAGGGTGATAAATGCAAC (SEQ ID NO:944) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasTheta protein (of the subject compositions and/or methods) has more sequence identity to an amino acid sequence depicted in any one of FIG. 3A-3AC than to any of the following: Casl2a proteins, Casl2b proteins, Casl2c proteins, Casl2d proteins, Casl2e proteins, Casl2 g proteins, Casl2h proteins, and Casl2i proteins.
  • a CasTheta protein (of the subject compositions and/or methods) includes an amino acid sequence having a RuvC domain (which includes the RuvC-I, RuvC-II, and RuvC-III domains) that has more sequence identity to the RuvC domain of an amino acid sequence depicted in FIG. 3A-3AC (e.g., the RuvC domain of any of the CasTheta amino acid sequences depicted in FIG.
  • FIG. 4 depicts a Maximum Likelihood phylogenetic tree of the miniature enzymes, produced from a multiple sequence alignment with 1000 iterations. As shown in FIG. 4, CasTheta forms a distinct clade separate from previously described Casl2 and Type V proteins.
  • a CasOmega polypeptide (this term is used interchangeably with the term “CasOmega protein”, “Casco polypeptide”, and “CRISPR/CasOmega protein”) can bind and/or modify (e.g., cleave, nick, methylate, demethylate, etc.) a target nucleic acid and/or a polypeptide associated with target nucleic acid (e.g., methylation or acetylation of a histone tail) (e.g., in some cases, the CasOmega protein includes a fusion partner with an activity, and in some cases, the CasOmega protein provides nuclease activity).
  • modify e.g., cleave, nick, methylate, demethylate, etc.
  • a polypeptide associated with target nucleic acid e.g., methylation or acetylation of a histone tail
  • the CasOmega protein includes a fusion partner with an activity,
  • the CasOmega protein is a naturally-occurring protein (e.g., naturally occurs in bacteriophage). In other cases, the CasOmega protein is not a naturally-occurring polypeptide (e.g., the CasOmega protein is a variant CasOmega protein (e.g., a catalytically inactive CasOmega protein, a fusion CasOmega protein, and the like).
  • a CasOmega polypeptide (e.g., not fused to any heterologous fusion partner) can have a molecular weight of from about 25 kiloDaltons (kDa) to about 60 kDa.
  • a CasOmega polypeptide can have a molecular weight of from about 25 kDa to about 30 kDa, from about 30 kDa to about 35 kDa, from about 35 kDa to about 40 kDa, from about 40 kDa to about 45 kDa, from about 45 kDa to about 50 kDa, from about 50 kDa to about 55 kDa, or from about 55 kDa to about 60 kDa.
  • Assays to determine whether a given protein interacts with a CasOmega guide RNA can be any convenient binding assay that tests for binding between a protein and a nucleic acid. Suitable binding assays (e.g., gel shift assays) will be known to one of ordinary skill in the art (e.g., assays that include adding a CasOmega guide RNA and a protein to a target nucleic acid).
  • Assays to determine whether a protein has an activity can be any convenient assay (e.g., any convenient nucleic acid cleavage assay that tests for nucleic acid cleavage). Suitable assays (e.g., cleavage assays) will be known to one of ordinary skill in the art.
  • a naturally occurring CasOmega protein functions as an endonuclease that catalyzes a double strand break at a specific sequence in a targeted double stranded DNA (dsDNA).
  • the sequence specificity is provided by the associated guide RNA, which hybridizes to a target sequence within the target DNA.
  • the naturally occurring CasOmega guide RNA is a crRNA, where the crRNA includes (i) a guide sequence that hybridizes to a target sequence in the target DNA and (ii) a protein binding segment which includes a stem-loop (hairpin - dsRNA duplex) that binds to the CasOmega protein.
  • a CasOmega polypeptide of the present disclosure when complexed with a CasOmega guide RNA, generates a product nucleic acid comprising 5’ overhang following site specific cleavage of a target nucleic acid.
  • the 5’ overhang can be an 8 to 12 nucleotide (nt) overhang.
  • the 5’ overhang can be 8 nt, 9 nt, 10 nt, 11, nt, or 12 nt in length.
  • a CasOmega polypeptide of the present disclosure includes a RuvC-like domain at or near the C-terminus of the protein.
  • a CasOmega protein of the subject methods and/or compositions is (or is derived from) a naturally occurring (wild type) protein. Examples of naturally occurring CasOmega proteins are depicted in FIG. 5A-5AB.
  • a CasOmega protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with any one of the CasOmega amino acid sequences depicted in FIG. 5A-5AB.
  • a CasOmega protein (of the subject compositions and/or methods) includes an amino acid sequence depicted in FIG. 5A-5AB.
  • a CasOmega protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the RuvC domain (which includes the RuvC-I, RuvC-II, and RuvC-III domains) of any one of the CasOmega amino acid sequences depicted in any one of FIG. 5A-5AB.
  • sequence identity e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity
  • RuvC domain which includes the RuvC-I, RuvC-II, and RuvC-III domains
  • a CasOmega protein (of the subject compositions and/or methods) includes an amino acid sequence having 70% or more sequence identity (e.g., 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the RuvC domain (which includes the RuvC-I, RuvC-II, and RuvC-III domains) of any one of the CasOmega amino acid sequences depicted in FIG. 5A-5AB.
  • sequence identity e.g., 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity
  • RuvC domain which includes the RuvC-I, RuvC-II, and RuvC-III domains
  • a CasOmega protein (of the subject compositions and/or methods) includes the RuvC domain (which includes the RuvC-I, RuvC-II, and RuvC-III domains) of any one of the CasOmega amino acid sequences depicted in FIG. 5A-5AB.
  • a guide RNA that binds a CasOmega polypeptide is encoded by a DNA molecule that includes a nucleotide sequence depicted in FIG. 5A-5AB (or in some cases the reverse complement of same).
  • the guide RNA comprises the nucleotide sequence (N)nX or the reverse complement of same, where N is any nucleotide, n is an integer from 15 to 30 (e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30), and X is any one of the nucleotide sequences depicted in FIG. 5A-5AB (or in some cases the reverse complement of same).
  • the “repeat” portion of a CasOmega guide RNA is encoded by a DNA molecule comprising a nucleotide sequence selected from: 1) CTGCGGCAGTGTGATTCTTGAATGATACTGCGGCGG (SEQ ID NO:77; FIG. 5A); 2) CCCTCACTCTTCCCAAGCGCCTGCATCAGAGTCCGAC (SEQ ID NO:79; FIG. 5B); 3) CCCGACAACCTCGATGACCAACGGTTAGAGGTTGCGGT (SEQ ID NO:81; FIG. 5C); 4) CCCGAAGCCACTCCGGACTTTGGTAGTTGCTTCCGG (SEQ ID NO:83; FIG.
  • a guide RNA that binds a CasOmega polypeptide is encoded by a DNA molecule that includes a nucleotide sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with any one of the sequences depicted in FIG. 5A-5AB (or in some cases the reverse complement of same).
  • sequence identity e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity
  • the guide RNA comprises the nucleotide sequence (N)nX or the reverse complement of same, where N is any nucleotide, n is an integer from 15 to 30 (e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30), and X a nucleotide sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with an RNA encoded by any one of the sequences depicted in FIG. 5A-5AB.
  • N is any nucleotide
  • n is an integer from 15 to 30 (e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30)
  • X a nucleotide sequence
  • FIG. 5A-5AB Examples of CasOmega proteins are depicted in FIG. 5A-5AB. For example:
  • 5C is also referred to herein as “CasOmega3”;
  • 5D is also referred to herein as “CasOmega4”;
  • 5F is also referred to herein as “CasOmega6”;
  • 5G is also referred to herein as “CasOmega7”;
  • 5J is also referred to herein as “CasOmegalO”.
  • CasOmegal 1 5K is also referred to herein as “CasOmegal 1”.
  • CasOmega polypeptide designated “CasOmegal3_3587562 222800616_l” and depicted in FIG. 5M is also referred to herein as “CasOmegal3”.
  • 5N is also referred to herein as “CasOmega 14”.
  • 5P is also referred to herein as “CasOmegal6”.
  • 5Q is also referred to herein as “CasOmegal7”.
  • 5R is also referred to herein as “CasOmega 18”.
  • 5S is also referred to herein as “CasOmegal9”.
  • FIG. 5T is also referred to herein as “CasOmega20”.
  • 5U is also referred to herein as “CasOmega21”.
  • 5W is also referred to herein as “CasOmega23”.
  • FIG. 5X is also referred to herein as “CasOmega24”.
  • 5Y is also referred to herein as “CasOmega25”.
  • 5AA is also referred to herein as “CasOmega27”.
  • a CasOmega protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmegal amino acid sequence depicted in FIG. 5A.
  • a CasOmega protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmeg l amino acid sequence depicted in FIG. 5A.
  • a CasOmega protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmegal amino acid sequence depicted in FIG. 5A.
  • a CasOmega protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmegal amino acid sequence depicted in FIG. 5A.
  • a CasOmega protein includes an amino acid sequence having the CasOmegal amino acid sequence depicted in FIG. 5A.
  • a CasOmega protein includes an amino acid sequence having the CasOmegal amino acid sequence depicted in FIG. 5A, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasOmega polypeptide has a length of from 380 amino acids (aa) to 400 aa, e.g., from 380 aa to 385 aa, from 385 aa to 390 aa, from 390 aa to 395 aa, or from 395 aa to 400 aa. In some cases, a CasOmega polypeptide has a length of 387 amino acids.
  • a guide RNA that binds a CasOmega polypeptide e.g., a CasOmega polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasOmega amino acid sequence depicted in FIG. 5A.
  • a CasOmega polypeptide includes the following nucleotide sequence: CTGCGGCAGTGTGATTCTTGAATGATACTGCGGCGG (SEQ ID NO:77) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nCTGCGGCAGTGTGATTCTTGAATGATACTGCGGCGG (SEQ ID NO: 945) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30).
  • a CasOmega protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega2 amino acid sequence depicted in FIG. 5B.
  • a CasOmega protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega2 amino acid sequence depicted in FIG. 5B.
  • a CasOmega protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega2 amino acid sequence depicted in FIG. 5B.
  • a CasOmega protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega2 amino acid sequence depicted in FIG. 5B.
  • a CasOmega protein includes an amino acid sequence having the CasOmega2 amino sequence depicted in FIG. 5B.
  • a CasOmega protein includes an amino acid sequence having the CasOmega2 amino sequence depicted in FIG. 5B, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasOmega polypeptide has a length of from 410 amino acids (aa) to 430 aa, e.g., from 410 aa to 415 aa, from 415 aa to 420 aa, from 420 aa to 425 aa, or from 425 aa to 430 aa. In some cases, the CasOmega polypeptide has a length of 418 amino acids.
  • a guide RNA that binds a CasOmega polypeptide includes the following nucleotide sequence:
  • the guide RNA comprises the nucleotide sequence (N)nCCCTCACTCTTCCCAAGCGCCTGCATCAGAGTCCGAC (SEQ ID NO:946) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30).
  • a CasOmega protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega3 amino acid sequence depicted in FIG. 5C.
  • a CasOmega protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega3 amino acid sequence depicted in FIG. 5C.
  • a CasOmega protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega amino acid sequence depicted in FIG. 5C.
  • a CasOmega protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega amino acid sequence depicted in FIG. 5C.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5C.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5C, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasOmega polypeptide has a length of from 370 amino acids (aa) to 390 aa, e.g., from 370 aa to 375 aa, from 375 aa to 380 aa, from 380 aa to 385 aa, or from 385 aa to 390 aa. In some cases, the CasOmega polypeptide has a length of 380 amino acids.
  • a guide RNA that binds a CasOmega polypeptide includes the following nucleotide sequence:
  • the guide RNA comprises the nucleotide sequence (N)nCCCGACAACCTCGATGACCAACGGTTAGAGGTTGCGGT (SEQ ID NO:947) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30).
  • a CasOmega protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega4 amino acid sequence depicted in FIG. 5D.
  • a CasOmega protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega4 amino acid sequence depicted in FIG. 5D.
  • a CasOmega protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega4 amino acid sequence depicted in FIG. 5D.
  • a CasOmega protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega4 amino acid sequence depicted in FIG. 5D.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5D.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5D, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasOmega polypeptide has a length of from 395 amino acids (aa) to 415 aa, e.g., from 395 aa to 400 aa, from 400 aa to 405 aa, from 405 aa to 410 aa, or from 410 aa to 415 aa. In some cases, the CasOmega polypeptide has a length of 403 amino acids.
  • a guide RNA that binds a CasOmega polypeptide e.g., a CasOmega polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasOmega amino acid sequence depicted in FIG. 5D) includes the following nucleotide sequence: CCCGAAGCCACTCCGGACTTTGGTAGTTGCTTCCGG (SEQ ID NO:83) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nCCCGAAGCCACTCCGGACTTTGGTAGTTGCTTCCGG (SEQ ID NO:948) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30).
  • a CasOmega protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega5 amino acid sequence depicted in FIG. 5E.
  • a CasOmega protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega5 amino acid sequence depicted in FIG. 5E.
  • a CasOmega protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega5 amino acid sequence depicted in FIG. 5E.
  • a CasOmega protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega5 amino acid sequence depicted in FIG. 5E.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5E.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5E, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasOmega polypeptide has a length of from 425 amino acids (aa) to 445 aa, e.g., from 425 aa to 430 aa, from 430 aa to 435 aa, from 435 aa to 440 aa, or from 440 aa to 445 aa. In some cases, the CasOmega polypeptide has a length of 435 amino acids.
  • a guide RNA that binds a CasOmega polypeptide e.g., a CasOmega polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasOmega amino acid sequence depicted in FIG. 5E) includes the following nucleotide sequence: CCGGTGCCGACGACGTGAACACGGGATCGGTGCAGG (SEQ ID NO: 85) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nCCGGTGCCGACGACGTGAACACGGGATCGGTGCAGG (SEQ ID NO:949) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30).
  • a CasOmega protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega6 amino acid sequence depicted in FIG. 5F.
  • a CasOmega protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega6 amino acid sequence depicted in FIG. 5F.
  • a CasOmega protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega6 amino acid sequence depicted in FIG. 5F.
  • a CasOmega protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega6 amino acid sequence depicted in FIG. 5F.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5F.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5F, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasOmega polypeptide has a length of from 370 amino acids (aa) to 390 aa, e.g., from 370 aa to 375 aa, from 375 aa to 380 aa, from 380 aa to 385 aa, or from 385 aa to 390 aa. In some cases, the CasOmega polypeptide has a length of 379 amino acids.
  • a guide RNA that binds a CasOmega polypeptide e.g., a CasOmega polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasOmega amino acid sequence depicted in FIG. 5F) includes the following nucleotide sequence: CCTGCAACGGCTTTCTGTCGATCAGTGCCGTTGCAGG (SEQ ID NO: 87) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nCCTGCAACGGCTTTCTGTCGATCAGTGCCGTTGCAGG (SEQ ID NO:950) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30).
  • a CasOmega protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega7 amino acid sequence depicted in FIG. 5G.
  • a CasOmega protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega7 amino acid sequence depicted in FIG. 5G.
  • a CasOmega protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega7 amino acid sequence depicted in FIG. 5G.
  • a CasOmega protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega7 amino acid sequence depicted in FIG. 5G.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5G.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5G, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasOmega polypeptide has a length of from 445 amino acids (aa) to 465 aa, e.g., from 445 aa to 450 aa, from 450 aa to 455 aa, from 455 aa to 460 aa, or from 460 aa to 465 aa. In some cases, the CasOmega polypeptide has a length of 454 amino acids.
  • a guide RNA that binds a CasOmega polypeptide e.g., a CasOmega polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasOmega amino acid sequence depicted in FIG. 5G) includes the following nucleotide sequence: CCCGCAATGATCGTTGGTGTCCTCCGATCATTCCGGGA (SEQ ID NO: 89) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nCCCGCAATGATCGTTGGTGTCCTCCGATCATTCCGGGA (SEQ ID NO:951) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasOmega protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega8 amino acid sequence depicted in FIG. 5H.
  • a CasOmega protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega8 amino acid sequence depicted in FIG. 5H.
  • a CasOmega protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega8 amino acid sequence depicted in FIG. 5H.
  • a CasOmega protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega8 amino acid sequence depicted in FIG. 5H.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5H.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5H, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasOmega polypeptide has a length of from 410 amino acids (aa) to 430 aa, e.g., from 410 aa to 415 aa, from 415 aa to 420 aa, from 420 aa to 425 aa, or from 425 aa to 430 aa. In some cases, the CasOmega polypeptide has a length of 420 amino acids.
  • a guide RNA that binds a CasOmega polypeptide e.g., a CasOmega polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasOmega amino acid sequence depicted in FIG. 5H) includes the following nucleotide sequence: CCCGAAGTAGATCAAAACAGACTCATCTACTGCGAG (SEQ ID NO:91) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nCCCGAAGTAGATCAAAACAGACTCATCTACTGCGAG (SEQ ID NO:952) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasOmega protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega9 amino acid sequence depicted in FIG. 51.
  • a CasOmega protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega9 amino acid sequence depicted in FIG. 51.
  • a CasOmega protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega9 amino acid sequence depicted in FIG. 51.
  • a CasOmega protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega9 amino acid sequence depicted in FIG. 51.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 51.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 51, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasOmega polypeptide has a length of from 430 amino acids (aa) to 450 aa, e.g., from 430 aa to 435 aa, 435 aa to 440 aa, from 440 aa to 445 aa, or from 445 aa to 450 aa. In some cases, the CasOmega polypeptide has a length of 438 amino acids.
  • a guide RNA that binds a CasOmega polypeptide e.g., a CasOmega polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasOmega amino acid sequence depicted in FIG. 51) includes the following nucleotide sequence: GCCGCAGCAGCCATGACCTGATCATCACCGCTCCCGC (SEQ ID NO:93) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nGCCGCAGCAGCCATGACCTGATCATCACCGCTCCCGC (SEQ ID NO:953) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasOmega protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmegalO amino acid sequence depicted in FIG. 5J.
  • a CasOmega protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmegalO amino acid sequence depicted in FIG. 5J.
  • a CasOmega protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmegalO amino acid sequence depicted in FIG. 5J.
  • a CasOmega protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmegalO amino acid sequence depicted in FIG. 5J.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5J.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5J, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasOmega polypeptide has a length of from 420 amino acids (aa) to 440 aa, e.g., from 420 aa to 425 aa, 425 aa to 430 aa, from 430 aa to 435 aa, or from 435 aa to 440 aa. In some cases, the CasOmega polypeptide has a length of 430 amino acids.
  • a guide RNA that binds a CasOmega polypeptide e.g., a CasOmega polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasOmega amino acid sequence depicted in FIG. 5J) includes the following nucleotide sequence: GTTGAACGACCGGACGCATCGGAATCGGGTTGCGGC (SEQ ID NO:95) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nGTTGAACGACCGGACGCATCGGAATCGGGTTGCGGC (SEQ ID NO:954) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasOmega protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmegal 1 amino acid sequence depicted in FIG. 5K.
  • a CasOmega protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmegal 1 amino acid sequence depicted in FIG. 5K.
  • a CasOmega protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmegal 1 amino acid sequence depicted in FIG. 5K.
  • a CasOmega protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmegal 1 amino acid sequence depicted in FIG. 5K.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5K.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5K, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasOmega polypeptide has a length of from 455 amino acids (aa) to 475 aa, e.g., from 455 aa to 460 aa, 460 aa to 465 aa, from 465 aa to 470 aa, or from 470 aa to 475 aa. In some cases, the CasOmega polypeptide has a length of 467 amino acids.
  • a guide RNA that binds a CasOmega polypeptide e.g., a CasOmega polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasOmega amino acid sequence depicted in FIG. 5K) includes the following nucleotide sequence: GTCACAACCCATCCTGGTGTTCGAACAGGGTTTCCAG (SEQ ID NO:97) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nGTCACAACCCATCCTGGTGTTCGAACAGGGTTTCCAG (SEQ ID NO:955) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasOmega protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmegal2 amino acid sequence depicted in FIG. 5L.
  • a CasOmega protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmegal2 amino acid sequence depicted in FIG. 5L.
  • a CasOmega protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmegal2 amino acid sequence depicted in FIG. 5L.
  • a CasOmega protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmegal2 amino acid sequence depicted in FIG. 5L.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5L.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5L, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasOmega polypeptide has a length of from 315 amino acids (aa) to 335 aa, e.g., from 315 aa to 320 aa, 320 aa to 325 aa, from 325 aa to 330 aa, or from 330 aa to 335 aa. In some cases, the CasOmega polypeptide has a length of 326 amino acids.
  • a guide RNA that binds a CasOmega polypeptide e.g., a CasOmega polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasOmega amino acid sequence depicted in FIG. 5L) includes the following nucleotide sequence: CCTGAGTGAGTGTGACCAGACACCACACTCATGCAGG (SEQ ID NO:99) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nCCTGAGTGAGTGTGACCAGACACCACACTCATGCAGG (SEQ ID NO:956) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasOmega protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmegal3 amino acid sequence depicted in FIG. 5M.
  • a CasOmega protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmegal3 amino acid sequence depicted in FIG. 5M.
  • a CasOmega protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmegal3 amino acid sequence depicted in FIG. 5M.
  • a CasOmega protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmegal3 amino acid sequence depicted in FIG. 5M.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5M.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5M, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasOmega polypeptide has a length of from 390 amino acids (aa) to 410 aa, e.g., from 390 aa to 395 aa, 395 aa to 400 aa, from 400 aa to 405 aa, or from 405 aa to 410 aa. In some cases, the CasOmega polypeptide has a length of 400 amino acids.
  • a guide RNA that binds a CasOmega polypeptide e.g., a CasOmega polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasOmega amino acid sequence depicted in FIG. 5M) includes the following nucleotide sequence: CCCGCAGTGACCAAGTTGTGTTTTGGTCACTTCGGG (SEQ ID NO: 101) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nCCCGCAGTGACCAAGTTGTGTTTTGGTCACTTCGGG (SEQ ID NO:957) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasOmega protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmegal4 amino acid sequence depicted in FIG. 5N.
  • a CasOmega protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmegal4 amino acid sequence depicted in FIG. 5N.
  • a CasOmega protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmegal4 amino acid sequence depicted in FIG. 5N.
  • a CasOmega protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmegal4 amino acid sequence depicted in FIG. 5N.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5N.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5N, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasOmega polypeptide has a length of from 405 amino acids (aa) to 425 aa, e.g., from 405 aa to 410 aa, 410 aa to 415 aa, from 415 aa to 420 aa, or from 420 aa to 425 aa. In some cases, the CasOmega polypeptide has a length of 413 amino acids.
  • a guide RNA that binds a CasOmega polypeptide includes the following nucleotide sequence: CCTCGCAGCAACCAAACAACTTGGCGAATGCTGTGGGC (SEQ ID NO: 103) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nCCTCGCAGCAACCAAACAACTTGGCGAATGCTGTGGGC (SEQ ID NO:958) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasOmega protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega 15 amino acid sequence depicted in FIG. 50.
  • sequence identity e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity
  • a CasOmega protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmegal5 amino acid sequence depicted in FIG. 50.
  • a CasOmega protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmegal5 amino acid sequence depicted in FIG. 50.
  • a CasOmega protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmegal5 amino acid sequence depicted in FIG. 50.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 50.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 50, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasOmega polypeptide has a length of from 455 amino acids (aa) to 475 aa, e.g., from 455 aa to 460 aa, 460 aa to 465 aa, from 465 aa to 470 aa, or from 470 aa to 475 aa. In some cases, the CasOmega polypeptide has a length of 463 amino acids.
  • a guide RNA that binds a CasOmega polypeptide includes the following nucleotide sequence: CTCGCAGCCCCCTTGGGATTCGATGAACGCTGCGGC (SEQ ID NO: 105) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nCTCGCAGCCCCCTTGGGATTCGATGAACGCTGCGGC (SEQ ID NO:959) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasOmega protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmegal6 amino acid sequence depicted in FIG. 5P.
  • a CasOmega protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmegal6 amino acid sequence depicted in FIG. 5P.
  • a CasOmega protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmegal6 amino acid sequence depicted in FIG. 5P.
  • a CasOmega protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmegal6 amino acid sequence depicted in FIG. 5P.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5P.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5P, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasOmega polypeptide has a length of from 425 amino acids (aa) to 445 aa, e.g., from 425 aa to 430 aa, 430 aa to 435 aa, from 435 aa to 440 aa, or from 440 aa to 445 aa. In some cases, the CasOmega polypeptide has a length of 434 amino acids.
  • a guide RNA that binds a CasOmega polypeptide includes the following nucleotide sequence:
  • the guide RNA comprises the nucleotide sequence (N)nCCCACAACGCCTGTCCCGATGAGACTGCGTTGCGGGG (SEQ ID NO:960) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasOmega protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmegal7 amino acid sequence depicted in FIG. 5Q.
  • a CasOmega protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmegal7 amino acid sequence depicted in FIG. 5Q.
  • a CasOmega protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmegal7 amino acid sequence depicted in FIG. 5Q.
  • a CasOmega protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmegal7 amino acid sequence depicted in FIG. 5Q.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5Q.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5Q, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasOmega polypeptide has a length of from 390 amino acids (aa) to 410 aa, e.g., from 390 aa to 395 aa, 395 aa to 400 aa, from 400 aa to 405 aa, or from 405 aa to 410 aa. In some cases, the CasOmega polypeptide has a length of 399 amino acids.
  • a guide RNA that binds a CasOmega polypeptide e.g., a CasOmega polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasOmega amino acid sequence depicted in FIG. 5Q) includes the following nucleotide sequence: CCCACAACAGCTAAGTACTTTTTCAGCCACTGCAGG (SEQ ID NO: 109) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nCCCACAACAGCTAAGTACTTTTTCAGCCACTGCAGG (SEQ ID NO:961) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasOmega protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmegal8 amino acid sequence depicted in FIG. 5R.
  • a CasOmega protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmegal8 amino acid sequence depicted in FIG. 5R.
  • a CasOmega protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmegal8 amino acid sequence depicted in FIG. 5R.
  • a CasOmega protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmegal8 amino acid sequence depicted in FIG. 5R.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5R.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5R, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasOmega polypeptide has a length of from 410 amino acids (aa) to 430 aa, e.g., from 410 aa to 415 aa, 415 aa to 420 aa, from 420 aa to 425 aa, or from 425 aa to 430 aa. In some cases, the CasOmega polypeptide has a length of 422 amino acids.
  • a guide RNA that binds a CasOmega polypeptide e.g., a CasOmega polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasOmega amino acid sequence depicted in FIG. 5R) includes the following nucleotide sequence: CCCACAGTGTGTTTCCATTCGGAAATCAACTGCGGG (SEQ ID NO:111) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nCCCACAGTGTGTTTCCATTCGGAAATCAACTGCGGG (SEQ ID NO:962) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasOmega protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmegal9 amino acid sequence depicted in FIG. 5S.
  • a CasOmega protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmegal9 amino acid sequence depicted in FIG. 5S.
  • a CasOmega protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmegal9 amino acid sequence depicted in FIG. 5S.
  • a CasOmega protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmegal9 amino acid sequence depicted in FIG. 5S.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5S.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5S, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasOmega polypeptide has a length of from 410 amino acids (aa) to 430 aa, e.g., from 410 aa to 415 aa, 415 aa to 420 aa, from 420 aa to 425 aa, or from 425 aa to 430 aa. In some cases, the CasOmega polypeptide has a length of 418 amino acids.
  • a guide RNA that binds a CasOmega polypeptide e.g., a CasOmega polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasOmega amino acid sequence depicted in FIG. 5S) includes the following nucleotide sequence: CCCGAAGTGACTGAGACGTTGAACAGGCACTGCGGG (SEQ ID NO: 113) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nCCCGAAGTGACTGAGACGTTGAACAGGCACTGCGGG (SEQ ID NO:963) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasOmega protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega20 amino acid sequence depicted in FIG. 5T.
  • a CasOmega protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega20 amino acid sequence depicted in FIG. 5T.
  • a CasOmega protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega20 amino acid sequence depicted in FIG. 5T.
  • a CasOmega protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega20 amino acid sequence depicted in FIG. 5T.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5T.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5T, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasOmega polypeptide has a length of from 410 amino acids (aa) to 430 aa, e.g., from 410 aa to 415 aa, 415 aa to 420 aa, from 420 aa to 425 aa, or from 425 aa to 430 aa.
  • the CasOmega polypeptide has a length of 418 amino acids.
  • the CasOmega polypeptide has a length of 426 amino acids.
  • a guide RNA that binds a CasOmega polypeptide e.g., a CasOmega polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasOmega amino acid sequence depicted in FIG. 5T) includes the following nucleotide sequence: CCCATAATCCCTAACATGTTTTTTCGGGATTCTAGG (SEQ ID NO:115) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nCCCATAATCCCTAACATGTTTTTTCGGGATTCTAGG (SEQ ID NO:964) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasOmega protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega21 amino acid sequence depicted in FIG. 5U.
  • a CasOmega protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega21 amino acid sequence depicted in FIG. 5U.
  • a CasOmega protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega21 amino acid sequence depicted in FIG. 5U.
  • a CasOmega protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega21 amino acid sequence depicted in FIG. 5U.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5U.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5U, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasOmega polypeptide has a length of from 380 amino acids (aa) to 400 aa, e.g., from 380 aa to 385 aa, 385 aa to 390 aa, from 390 aa to 395 aa, or from 395 aa to 400 aa. In some cases, the CasOmega polypeptide has a length of 391 amino acids.
  • a guide RNA that binds a CasOmega polypeptide e.g., a CasOmega polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasOmega amino acid sequence depicted in FIG. 5U) includes the following nucleotide sequence: GTGACGCGGCTGGAATCGTGTATTCGACCCTCAAGG (SEQ ID NO: 117) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nGTGACGCGGCTGGAATCGTGTATTCGACCCTCAAGG (SEQ ID NO:965) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasOmega protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega22 amino acid sequence depicted in FIG. 5V.
  • a CasOmega protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega22 amino acid sequence depicted in FIG. 5V.
  • a CasOmega protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega22 amino acid sequence depicted in FIG. 5V.
  • a CasOmega protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega22 amino acid sequence depicted in FIG. 5V.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5V.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5V, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasOmega polypeptide has a length of from 380 amino acids (aa) to 400 aa, e.g., from 380 aa to 385 aa, 385 aa to 390 aa, from 390 aa to 395 aa, or from 395 aa to 400 aa. In some cases, the CasOmega polypeptide has a length of 391 amino acids.
  • a guide RNA that binds a CasOmega polypeptide includes the following nucleotide sequence: CTGAGAGCGAGCGAAAGAGAAAACGCTCGCTACGGG (SEQ ID NO:119) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nCTGAGAGCGAGCGAAAGAGAAAACGCTCGCTACGGG (SEQ ID NO:966) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasOmega protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega23 amino acid sequence depicted in FIG. 5W.
  • a CasOmega protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega23 amino acid sequence depicted in FIG. 5W.
  • a CasOmega protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega23 amino acid sequence depicted in FIG. 5W.
  • a CasOmega protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega23 amino acid sequence depicted in FIG. 5W.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5W.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5W, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasOmega polypeptide has a length of from 400 amino acids (aa) to 420 aa, e.g., from 400 aa to 405 aa, 405 aa to 410 aa, from 410 aa to 415 aa, or from 415 aa to 420 aa. In some cases, the CasOmega polypeptide has a length of 409 amino acids.
  • a guide RNA that binds a CasOmega polypeptide includes the following nucleotide sequence:
  • the guide RNA comprises the nucleotide sequence (N)nCCGGAAGTGACTGACGAAATGGTCGGAAACTTCGGC (SEQ ID NO:967) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasOmega protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega24 amino acid sequence depicted in FIG. 5X.
  • a CasOmega protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega24 amino acid sequence depicted in FIG. 5X.
  • a CasOmega protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega24 amino acid sequence depicted in FIG. 5X.
  • a CasOmega protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega24 amino acid sequence depicted in FIG. 5X.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5X.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5X, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasOmega polypeptide has a length of from 390 amino acids (aa) to 410 aa, e.g., from 390 aa to 395 aa, 395 aa to 400 aa, from 400 aa to 405 aa, or from 405 aa to 410 aa. In some cases, the CasOmega polypeptide has a length of 400 amino acids.
  • a guide RNA that binds a CasOmega polypeptide includes the following nucleotide sequence:
  • the guide RNA comprises the nucleotide sequence (N)nCCGGGAGTGACTAACAATTCGAATCGTCACTCCGGG (SEQ ID NO:968) or (N)nCCGGGGGTGACTAACAATTCGAATGGTCACTCCGGC (SEQ ID NO: 969) or either reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasOmega protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega25 amino acid sequence depicted in FIG. 5Y.
  • a CasOmega protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega25 amino acid sequence depicted in FIG. 5Y.
  • a CasOmega protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega25 amino acid sequence depicted in FIG. 5Y.
  • a CasOmega protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega25 amino acid sequence depicted in FIG. 5Y.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5Y.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5Y, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasOmega polypeptide has a length of from 425 amino acids (aa) to 445 aa, e.g., from 425 aa to 430 aa, 430 aa to 435 aa, from 435 aa to 440 aa, or from 440 aa to 445 aa. In some cases, the CasOmega polypeptide has a length of 437 amino acids.
  • a guide RNA that binds a CasOmega polypeptide e.g., a CasOmega polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasOmega amino acid sequence depicted in FIG. 5Y) includes the following nucleotide sequence: GTCGCACACACTTCCTGCGCTTTGATGCACTGCGACG (SEQ ID NO: 126) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nGTCGCACACACTTCCTGCGCTTTGATGCACTGCGACG (SEQ ID NO: 970) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasOmega protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega26 amino acid sequence depicted in FIG. 5Z.
  • a CasOmega protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega26 amino acid sequence depicted in FIG. 5Z.
  • a CasOmega protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega26 amino acid sequence depicted in FIG. 5Z.
  • a CasOmega protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega26 amino acid sequence depicted in FIG. 5Z.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5Z.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5Z, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasOmega polypeptide has a length of from 465 amino acids (aa) to 485 aa, e.g., from 465 aa to 470 aa, 470 aa to 475 aa, from 475 aa to 480 aa, or from 480 aa to 485 aa. In some cases, the CasOmega polypeptide has a length of 473 amino acids.
  • a guide RNA that binds a CasOmega polypeptide includes the following nucleotide sequence: TCCCGCACCACCACCACAAATTTT (SEQ ID NO: 128) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nTCCCGCACCACCACCACCACAAATTTT (SEQ ID NO:971) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasOmega protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega27 amino acid sequence depicted in FIG. 5AA.
  • a CasOmega protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega27 amino acid sequence depicted in FIG. 5AA.
  • a CasOmega protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega27 amino acid sequence depicted in FIG. 5AA.
  • a CasOmega protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega27 amino acid sequence depicted in FIG. 5AA.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5AA.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5AA, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasOmega polypeptide has a length of from 385 amino acids (aa) to 405 aa, e.g., from 385 aa to 390 aa, 390 aa to 395 aa, from 395 aa to 400 aa, or from 400 aa to 405 aa. In some cases, the CasOmega polypeptide has a length of 395 amino acids.
  • a guide RNA that binds a CasOmega polypeptide includes the following nucleotide sequence: GCCGGCAACGTCTGAACGAAGCGCTAAGACGTTGCGGC (SEQ ID NO: 130) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nGCCGGCAACGTCTGAACGAAGCGCTAAGACGTTGCGGC (SEQ ID NO:972) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasOmega protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega28 amino acid sequence depicted in FIG. 5AB.
  • a CasOmega protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega28 amino acid sequence depicted in FIG. 5AB.
  • a CasOmega protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega28 amino acid sequence depicted in FIG. 5AB.
  • a CasOmega protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasOmega28 amino acid sequence depicted in FIG. 5AB.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5AB.
  • a CasOmega protein includes an amino acid sequence having the CasOmega amino acid sequence depicted in FIG. 5AB, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasOmega polypeptide has a length of from 385 amino acids (aa) to 405 aa, e.g., from 385 aa to 390 aa, 390 aa to 395 aa, from 395 aa to 400 aa, or from 400 aa to 405 aa. In some cases, the CasOmega polypeptide has a length of 393 amino acids.
  • a guide RNA that binds a CasOmega polypeptide includes the following nucleotide sequence: CCTCGCAGCAACCAAACAACTTGGCGAATGCTGTGGGC (SEQ ID NO: 103) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nCCTCGCAGCAACCAAACAACTTGGCGAATGCTGTGGGC (SEQ ID NO:958) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30.
  • a CasOmega protein (of the subject compositions and/or methods) has more sequence identity to an amino acid sequence depicted in any one of FIG. 5A-5AB than to any of the following: Casl2a proteins, Casl2b proteins, Casl2c proteins, Casl2d proteins, Casl2e proteins, Casl2 g proteins, Casl2h proteins, and Casl2i proteins.
  • a CasOmega protein (of the subject compositions and/or methods) includes an amino acid sequence having a RuvC domain (which includes the RuvC-I, RuvC-II, and RuvC-III domains) that has more sequence identity to the RuvC domain of an amino acid sequence depicted in FIG. 5A-5AB (e.g., the RuvC domain of any of the CasOmega amino acid sequences depicted in FIG.
  • FIG. 6 depicts a Maximum Likelihood phylogenetic tree of the miniature enzymes, produced from a multiple sequence alignment with 1000 iterations. As shown in FIG. 6, CasOmega forms a distinct clade separate from previously described Casl2 and Type V proteins.
  • a CasMu polypeptide (this term is used interchangeably with the term “CasMu protein”, “Casp polypeptide”, and “CRISPR/CasMu protein”) can bind and/or modify (e.g., cleave, nick, methylate, demethylate, etc.) a target nucleic acid and/or a polypeptide associated with target nucleic acid (e.g., methylation or acetylation of a histone tail) (e.g., in some cases, the CasMu protein includes a fusion partner with an activity, and in some cases, the CasMu protein provides nuclease activity).
  • a target nucleic acid e.g., methylation or acetylation of a histone tail
  • the CasMu protein is a naturally-occurring protein (e.g., naturally occurs in bacteriophage). In other cases, the CasMu protein is not a naturally-occurring polypeptide (e.g., the CasMu protein is a variant CasMu protein (e.g., a catalytically inactive CasMu protein, a fusion CasMu protein, and the like).
  • a CasMu polypeptide (e.g., not fused to any heterologous fusion partner) can have a molecular weight of from about 25 kiloDaltons (kDa) to about 60 kDa.
  • a CasMu polypeptide can have a molecular weight of from about 25 kDa to about 30 kDa, from about 30 kDa to about 35 kDa, from about 35 kDa to about 40 kDa, from about 40 kDa to about 45 kDa, from about 45 kDa to about 50 kDa, from about 50 kDa to about 55 kDa, or from about 55 kDa to about 60 kDa.
  • Assays to determine whether a given protein interacts with a CasMu guide RNA can be any convenient binding assay that tests for binding between a protein and a nucleic acid. Suitable binding assays (e.g., gel shift assays) will be known to one of ordinary skill in the art (e.g., assays that include adding a CasMu guide RNA and a protein to a target nucleic acid).
  • Assays to determine whether a protein has an activity can be any convenient assay (e.g., any convenient nucleic acid cleavage assay that tests for nucleic acid cleavage). Suitable assays (e.g., cleavage assays) will be known to one of ordinary skill in the art.
  • a naturally occurring CasMu protein functions as an endonuclease that catalyzes a double strand break at a specific sequence in a targeted double stranded DNA (dsDNA).
  • the sequence specificity is provided by the associated guide RNA, which hybridizes to a target sequence within the target DNA.
  • the naturally occurring CasMu guide RNA is a crRNA, where the crRNA includes (i) a guide sequence that hybridizes to a target sequence in the target DNA and (ii) a protein binding segment which includes a stem-loop (hairpin - dsRNA duplex) that binds to the CasMu protein.
  • a CasMu polypeptide of the present disclosure when complexed with a CasMu guide RNA, generates a product nucleic acid comprising 5’ overhang following site specific cleavage of a target nucleic acid.
  • the 5’ overhang can be an 8 to 12 nucleotide (nt) overhang.
  • the 5’ overhang can be 8 nt, 9 nt, 10 nt, 11, nt, or 12 nt in length.
  • a CasMu polypeptide of the present disclosure includes a RuvC-like domain at or near the C-terminus of the protein.
  • a CasMu protein of the subject methods and/or compositions is (or is derived from) a naturally occurring (wild type) protein. Examples of naturally occurring CasMu proteins are depicted in FIG. 7A-7CR.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with any one of the CasMu amino acid sequences depicted in FIG. 7A-7CR.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence depicted in FIG. 7A-7CR.
  • a CasMu protein (of the subject compositions and/or methods) has more sequence identity to an amino acid sequence depicted in any one of FIG. 7A-7CR than to any of the following: Casl2a proteins, Casl2b proteins, Casl2c proteins, Casl2d proteins, Casl2e proteins, Casl2 g proteins, Casl2h proteins, and Casl2i proteins.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having a RuvC domain (which includes the RuvC-I, RuvC-II, and RuvC-III domains) that has more sequence identity to the RuvC domain of an amino acid sequence depicted in FIG. 7A-7CR (e.g., the RuvC domain of any of the CasMu amino acid sequences depicted in FIG. 7A-7CR) than to the RuvC domain of any of the following: Casl2a proteins, Casl2b proteins, Casl2c proteins, Casl2d proteins, Casl2e proteins, Casl2 g proteins, Casl2h proteins, and Casl2i proteins.
  • a Casl2a proteins Casl2b proteins, Casl2c proteins, Casl2d proteins, Casl2e proteins, Casl2 g proteins, Casl2h proteins, and Casl2i proteins.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the RuvC domain (which includes the RuvC-I, RuvC-II, and RuvC-III domains) of any one of the CasMu amino acid sequences depicted in any one of FIG. 7A-7CR.
  • sequence identity e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity
  • RuvC domain which includes the RuvC-I, RuvC-II, and RuvC-III domains
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 70% or more sequence identity (e.g., 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the RuvC domain (which includes the RuvC-I, RuvC-II, and RuvC-III domains) of any one of the CasMu amino acid sequences depicted in FIG. 7A-7CR.
  • sequence identity e.g., 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity
  • RuvC domain which includes the RuvC-I, RuvC-II, and RuvC-III domains
  • a CasMu protein (of the subject compositions and/or methods) includes the RuvC domain (which includes the RuvC-I, RuvC-II, and RuvC-III domains) of any one of the CasMu amino acid sequences depicted in FIG. 7A-7CR.
  • a CasMu protein (of the subject compositions and/or methods) has a length of 440 amino acids (aa) to 900 aa, such as 440 aa to 450 aa, such as 450 aa to 460 aa, such as 460 aa to 470 aa, such as 470 aa to 480 aa, such as 480 aa to 490 aa, such as 490 aa to 500 aa, such as 500 aa to 510 aa, such as 510 aa to 520 aa, such as 520 aa to 530 aa, such as 530 aa to 540 aa, such as 540 aa to 550 aa, such as 550 aa to 560 aa, such as 560 aa to 570 aa, such as 570 aa to 580 aa, such as 580 aa to 590 aa,
  • a guide RNA that binds a CasMu polypeptide is encoded by a DNA molecule that includes a nucleotide sequence depicted in FIG. 7A-7CR (or in some cases the reverse complement of same).
  • the guide RNA comprises the nucleotide sequence (N)nX or the reverse complement of same, where N is any nucleotide, n is an integer from 15 to 30 (e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30), and X is any one of the nucleotide sequences depicted in FIG. 7 (or in some cases the reverse complement of same).
  • a guide RNA that binds a CasMu polypeptide is encoded by a DNA molecule that includes a nucleotide sequence depicted in FIG. 7A-7CR (or in some cases the reverse complement of same).
  • the guide RNA comprises the nucleotide sequence (N)nX or the reverse complement of same, where N is any nucleotide, n is an integer from 15 to 30 (e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30), and X is any one of the nucleotide sequences depicted in FIG. 7A-7CR (or in some cases the reverse complement of same).
  • the “repeat” portion of a CasMu guide RNA is encoded by a DNA molecule comprising a nucleotide sequence selected from
  • GTGCCTCTGTCTTGGTGCTTGAAGGTGAACAGGCAC SEQ ID NO: 133; FIG. 7A and FIG. 8A
  • GTGACAATACCTGCCCAAGCGGTTGACGTTTGGGAC SEQ ID NO: 140; FIG. 7G and FIG. 8B
  • a guide RNA that binds a CasMu polypeptide is encoded by a DNA molecule that includes a nucleotide sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with any one of the sequences depicted in FIG. 7A-7CR (or in some cases the reverse complement of same).
  • sequence identity e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity
  • the guide RNA comprises the nucleotide sequence (N)nX or the reverse complement of same, where N is any nucleotide, n is an integer from 15 to 30 (e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30), and X a nucleotide sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with an RNA encoded by any one of the sequences depicted in FIG. 7A-7CR.
  • N is any nucleotide
  • n is an integer from 15 to 30 (e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30)
  • X a nucleotide sequence
  • CasMu proteins are depicted in FIG. 7A-7CR.
  • FIG. 7A-7CR Examples of CasMu proteins are depicted in FIG. 7A-7CR.
  • CasMu4 the CasMu polypeptide designated “258574213_106” and depicted in FIG. 7D is also referred to herein as “CasMu4”;
  • CasMu8 the CasMu polypeptide designated “206933875_44” and depicted in FIG. 7H is also referred to herein as “CasMu8”;
  • CasMu polypeptide designated “263054608_2” and depicted in FIG. 7J is also referred to herein as “CasMulO”;
  • CasMu polypeptide designated “263308075_l” and depicted in FIG. 7K is also referred to herein as “CasMul 1”;
  • CasMu polypeptide designated “263310189_13” and depicted in FIG. 7L is also referred to herein as “CasMul2”;
  • CasMu polypeptide designated “263312967_5” and depicted in FIG. 7M is also referred to herein as “CasMul3”;
  • CasMu polypeptide designated “263313713 19” and depicted in FIG. 7N is also referred to herein as “CasMul4”;
  • CasMu polypeptide designated “263313828_34” and depicted in FIG. 70 is also referred to herein as “CasMul5”;
  • CasMu polypeptide designated “263318070_46” and depicted in FIG. 7S is also referred to herein as “CasMul9”;
  • CasMu20 the CasMu polypeptide designated “263321570_8” and depicted in FIG. 7T is also referred to herein as “CasMu20”;
  • CasMu21 the CasMu polypeptide designated “263328211_115” and depicted in FIG. 7U is also referred to herein as “CasMu21”;
  • CasMu22 the CasMu polypeptide designated “263328423_61” and depicted in FIG. 7V is also referred to herein as “CasMu22”;
  • CasMu23 the CasMu polypeptide designated “240706530_77” and depicted in FIG. 7W is also referred to herein as “CasMu23”;
  • CasMu24 the CasMu polypeptide designated “222630474_440” and depicted in FIG. 7X is also referred to herein as “CasMu24”;
  • CasMu25 the CasMu polypeptide designated “222540733_258” and depicted in FIG. 7Y is also referred to herein as “CasMu25”;
  • CasMu26 the CasMu polypeptide designated “130649980_18” and depicted in FIG. 7Z is also referred to herein as “CasMu26”;
  • CasMu28 the CasMu polypeptide designated “132091997_26” and depicted in FIG. 7AB is also referred to herein as “CasMu28”;
  • CasMu29 the CasMu polypeptide designated “187712120_9” and depicted in FIG. 7AC is also referred to herein as “CasMu29”;
  • CasMu30 the CasMu polypeptide designated “158101465_111” and depicted in FIG. 7AD is also referred to herein as “CasMu30”;
  • CasMu31 the CasMu polypeptide designated “158101698_49” and depicted in FIG. 7AE is also referred to herein as “CasMu31”;
  • CasMu32 the CasMu polypeptide designated “21604173_l 1” and depicted in FIG. 7AF is also referred to herein as “CasMu32”;
  • CasMu34 the CasMu polypeptide designated “99284756_25” and depicted in FIG. 7AH is also referred to herein as “CasMu34”;
  • CasMu38 the CasMu polypeptide designated “16164373_74” and depicted in FIG. 7AL is also referred to herein as “CasMu38”;
  • CasMu39 the CasMu polypeptide designated “16234934_3” and depicted in FIG. 7AM is also referred to herein as “CasMu39”;
  • CasMu40 the CasMu polypeptide designated “169221349_10” and depicted in FIG. 7AN is also referred to herein as “CasMu40”;
  • CasMu41 the CasMu polypeptide designated “170210955_13” and depicted in FIG. 7AO is also referred to herein as “CasMu41”;
  • CasMu42 the CasMu polypeptide designated “172928183_79” and depicted in FIG. 7AP is also referred to herein as “CasMu42”;
  • CasMu43 the CasMu polypeptide designated “173020289_12” and depicted in FIG. 7AQ is also referred to herein as “CasMu43”;
  • CasMu44 the CasMu polypeptide designated “173074365_39” and depicted in FIG. 7AR is also referred to herein as “CasMu44”;
  • CasMu45 the CasMu polypeptide designated “173143063_5” and depicted in FIG. 7AS is also referred to herein as “CasMu45”;
  • CasMu46 the CasMu polypeptide designated “173180031_31” and depicted in FIG. 7AT is also referred to herein as “CasMu46”;
  • CasMu48 the CasMu polypeptide designated “192837700_6” and depicted in FIG. 7AV is also referred to herein as “CasMu48”;
  • CasMu49 the CasMu polypeptide designated “192873809_17” and depicted in FIG. 7AW is also referred to herein as “CasMu49”;
  • CasMu49 the CasMu polypeptide designated “192883597_8” and depicted in FIG. 7AX is also referred to herein as “CasMu49”;
  • CasMu51 the CasMu polypeptide designated “192892191_1” and depicted in FIG. 7AY is also referred to herein as “CasMu51”;
  • CasMu52 the CasMu polypeptide designated “192950824_7” and depicted in FIG. 7AZ is also referred to herein as “CasMu52”;
  • CasMu54 the CasMu polypeptide designated “192987174_58” and depicted in FIG. 7BB is also referred to herein as “CasMu54”;
  • CasMu55 the CasMu polypeptide designated “193010725_21” and depicted in FIG. 7BC is also referred to herein as “CasMu55”;
  • CasMu56 the CasMu polypeptide designated “193011406_34” and depicted in FIG. 7BD is also referred to herein as “CasMu56”;
  • CasMu59 the CasMu polypeptide designated “193144684_11” and depicted in FIG. 7BG is also referred to herein as “CasMu59”;
  • CasMu60 the CasMu polypeptide designated “189207256_21” and depicted in FIG. 7BH is also referred to herein as “CasMu60”;
  • CasMu61 the CasMu polypeptide designated “48004045_174” and depicted in FIG. 7BI is also referred to herein as “CasMu61”;
  • CasMu62 the CasMu polypeptide designated “212100177_10” and depicted in FIG. 7BJ is also referred to herein as “CasMu62”;
  • CasMu63 the CasMu polypeptide designated “212453162_32” and depicted in FIG. 7BK is also referred to herein as “CasMu63”;
  • CasMu68 the CasMu polypeptide designated “79782_81” and depicted in FIG. 7BP is also referred to herein as “CasMu68”;
  • CasMu69 the CasMu polypeptide designated “459152_27” and depicted in FIG. 7BQ is also referred to herein as “CasMu69”;
  • CasMu79 the CasMu polypeptide designated “152277477_56” and depicted in FIG. 7CA is also referred to herein as “CasMu79”;
  • CasMu80 the CasMu polypeptide designated “174470290_73” and depicted in FIG. 7CB is also referred to herein as “CasMu80”;
  • CasMu81 the CasMu polypeptide designated “ 174499519_28” and depicted in FIG. 7CC is also referred to herein as “CasMu81”;
  • CasMu82 the CasMu polypeptide designated “176215113_37” and depicted in FIG. 7CD is also referred to herein as “CasMu82”;
  • CasMu83 the CasMu polypeptide designated “87065839_57” and depicted in FIG. 7CE is also referred to herein as “CasMu83”;
  • CasMu84 the CasMu polypeptide designated “90785604_26” and depicted in FIG. 7CF is also referred to herein as “CasMu84”;
  • CasMu85 the CasMu polypeptide designated “81999563_22” and depicted in FIG. 7CG is also referred to herein as “CasMu85”;
  • CasMu86 the CasMu polypeptide designated “86675138_30” and depicted in FIG. 7CH is also referred to herein as “CasMu86”;
  • CasMu89 the CasMu polypeptide designated “191790226_2” and depicted in FIG. 7CK is also referred to herein as “CasMu89”;
  • CasMu90 the CasMu polypeptide designated “192323575_4” and depicted in FIG. 7CL is also referred to herein as “CasMu90”;
  • CasMu91 the CasMu polypeptide designated “226658174_2” and depicted in FIG. 7CM is also referred to herein as “CasMu91”;
  • CasMu92 the CasMu polypeptide designated “226665585_4” and depicted in FIG. 7CN is also referred to herein as “CasMu92”;
  • CasMu94 the CasMu polypeptide designated “34352336_12” and depicted in FIG. 7CP is also referred to herein as “CasMu94”;
  • CasMu95 the CasMu polypeptide designated “34352336_12” and depicted in FIG. 7CQ is also referred to herein as “CasMu95”;
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMul amino acid sequence depicted in FIG. 7A.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMul amino acid sequence depicted in FIG. 7A.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMul amino acid sequence depicted in FIG. 7A.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMul amino acid sequence depicted in FIG. 7A.
  • a CasMu protein includes an amino acid sequence having the CasMul amino acid sequence depicted in FIG. 7A.
  • a CasMu protein includes an amino acid sequence having the CasMul amino acid sequence depicted in FIG. 7A, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu polypeptide has a length of from 640 amino acids (aa) to 660 aa, e.g., from 650 aa to 660 aa, or from 650 aa to 655 aa). In some cases, a CasMu polypeptide has a length of 654 amino acids.
  • a guide RNA that binds a CasMu polypeptide includes the following nucleotide sequence: GTGCCTCTGTCTTGGTGCTTGAAGGTGAACAGGCAC (SEQ ID NO: 133) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nGTGCCTCTGTCTTGGTGCTTGAAGGTGAACAGGCAC (SEQ ID NO:973) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30).
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu2 amino acid sequence depicted in FIG. 7B.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu2 amino acid sequence depicted in FIG. 7B.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7B.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7B.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7B.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7B, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasMu polypeptide has a length of from 550 amino acids (aa) to 570 aa, e.g., from 550 aa to 555 aa, from 555 aa to 560 aa, from 560 aa to 565 aa, or from 565 aa to 570 aa). In some cases, the CasMu polypeptide has a length of 563 amino acids.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu3 amino acid sequence depicted in FIG. 7C.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu3 amino acid sequence depicted in FIG. 7C.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7C.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7C.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7C.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7C, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasMu polypeptide has a length of from 590 amino acids (aa) to 610 aa, e.g., from 590 aa to 595 aa, from 595 aa to 600 aa, from 600 aa to 605 aa, or from 605 aa to 610 aa). In some cases, the CasMu polypeptide has a length of 605 amino acids.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu4 amino acid sequence depicted in FIG. 7D.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu4 amino acid sequence depicted in FIG. 7D.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7D.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7D.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7D.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7D, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasMu polypeptide has a length of from 570 amino acids (aa) to 590 aa, e.g., from 570 aa to 575 aa, from 575 aa to 800 aa, from 800 aa to 805 aa, or from 805 aa to 810 aa). In some cases, the CasMu polypeptide has a length of 579 amino acids.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu5 amino acid sequence depicted in FIG. 7E.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu5 amino acid sequence depicted in FIG. 7E.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7E.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7E.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7E.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7E, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • the CasMu polypeptide has a length of from 710 amino acids (aa) to 730 aa, e.g., from 710 aa to 715 aa, from 715 aa to 720 aa, from 720 aa to 725 aa, or from 725 aa to 730 aa). In some cases, the CasMu polypeptide has a length of 718 amino acids.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu6 amino acid sequence depicted in FIG. 7F.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu6 amino acid sequence depicted in FIG. 7F.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7F.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7F.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7F.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7F, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the natur ally occurring catalytic activity of the protein.
  • the CasMu polypeptide has a length of from 510 amino acids (aa) to 530 aa, e.g., from 510 aa to 515 aa, from 515 aa to 520 aa, from 520 aa to 525 aa, or from 525 aa to 530 aa). In some cases, the CasMu polypeptide has a length of 518 amino acids.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu7 amino acid sequence depicted in FIG. 7G.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu7 amino acid sequence depicted in FIG. 7G.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7G.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7G.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7G.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7G, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu polypeptide has a length of from 690 amino acids (aa) to 710 aa, e.g., from 690 aa to 695 aa, or from 695 aa to 700 aa, from 700 aa to 705 aa). In some cases, a CasMu polypeptide has a length of 703 amino acids.
  • a guide RNA that binds a CasMu polypeptide e.g., a CasMu polypeptide comprising an amino acid sequence having 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, amino acid sequence identity to the CasMu amino acid sequence depicted in FIG. 7G) includes the following nucleotide sequence: GTGACAATACCTGCCCAAGCGGTTGACGTTTGGGAC (SEQ ID NO: 140) or the reverse complement of same.
  • the guide RNA comprises the nucleotide sequence (N)nGTGACAATACCTGCCCAAGCGGTTGACGTTTGGGAC (SEQ ID NO:974) or the reverse complement of same, where N is any nucleotide and n is an integer from 15 to 30, e.g., from 15 to 20, from 17 to 25, from 17 to 22, from 18 to 22, from 18 to 20, from 20 to 25, or from 25 to 30).
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu8 amino acid sequence depicted in FIG. 7H.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu8 amino acid sequence depicted in FIG. 7H.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7H.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7H.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7H.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7H, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu9 amino acid sequence depicted in FIG. 71.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu9 amino acid sequence depicted in FIG. 71.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 71.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 71.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 71.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 71, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMulO amino acid sequence depicted in FIG. 7J.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMulO amino acid sequence depicted in FIG. 7J.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7J.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7J.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7J.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7J, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMull amino acid sequence depicted in FIG. 7K.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMull amino acid sequence depicted in FIG. 7K.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7K.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7K.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7K.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7K, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMul2 amino acid sequence depicted in FIG. 7L.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMul2 amino acid sequence depicted in FIG. 7L.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7L.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7L.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7L.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7L, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMul3 amino acid sequence depicted in FIG. 7M.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMul3 amino acid sequence depicted in FIG. 7M.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7M.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7M.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7M.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7M, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMul4 amino acid sequence depicted in FIG. 7N.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMul4 amino acid sequence depicted in FIG. 7N.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7N.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7N.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7N.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7N, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the natur ally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMul5 amino acid sequence depicted in FIG. 70.
  • sequence identity e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMul5 amino acid sequence depicted in FIG. 70.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 70.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 70.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 70.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 70, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the natur ally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMul6 amino acid sequence depicted in FIG. 7P.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMul6 amino acid sequence depicted in FIG. 7P.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7P.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7P.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7P.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7P, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMul7 amino acid sequence depicted in b.
  • sequence identity e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMul7 amino acid sequence depicted in FIG. 7Q.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7Q.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7Q.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7Q.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7Q, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMul8 amino acid sequence depicted in FIG. 7R.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMul8 amino acid sequence depicted in FIG. 7R.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7R.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7R.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7R.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7R, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMul9 amino acid sequence depicted in FIG. 7S.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMul9 amino acid sequence depicted in FIG. 7S.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7S.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7S.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7S.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7S, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu20 amino acid sequence depicted in FIG. 7T.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu20 amino acid sequence depicted in FIG. 7T.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7T.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7T.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7T.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7T, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu21 amino acid sequence depicted in FIG. 7U.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu21 amino acid sequence depicted in FIG. 7U.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7U.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7U.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7U.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7U, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu22 amino acid sequence depicted in FIG. 7V.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu22 amino acid sequence depicted in FIG. 7V.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7V.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7V.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7V.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7V, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu23 amino acid sequence depicted in FIG. 7W.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu23 amino acid sequence depicted in FIG. 7W.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7W.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7W.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7W.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7W, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu24 amino acid sequence depicted in FIG. 7X.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu24 amino acid sequence depicted in FIG. 7X.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7X.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7X.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7X.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7X, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu25 amino acid sequence depicted in FIG. 7Y.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu25 amino acid sequence depicted in FIG. 7Y.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7Y.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7Y.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7Y.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7Y, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu26 amino acid sequence depicted in FIG. 7Z.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu26 amino acid sequence depicted in FIG. 7Z.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7Z.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7Z.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7Z.
  • Ill protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7Z.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7Z, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu27 amino acid sequence depicted in FIG. 7AA.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu27 amino acid sequence depicted in FIG. 7AA.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AA.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AA.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AA.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AA, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu28 amino acid sequence depicted in FIG. 7AB.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu28 amino acid sequence depicted in FIG. 7AB.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AB.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AB.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AB.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AB, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu29 amino acid sequence depicted in FIG. 7AC.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu29 amino acid sequence depicted in FIG. 7AC.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AC.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AC.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AC.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AC, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu30 amino acid sequence depicted in FIG. 7AD.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu30 amino acid sequence depicted in FIG. 7AD.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AD.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AD.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AD.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AD, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu31 amino acid sequence depicted in FIG. 7AE.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu31 amino acid sequence depicted in FIG. 7AE.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AE.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AE.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AE.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AE, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu32 amino acid sequence depicted in FIG. 7AF.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu32 amino acid sequence depicted in FIG. 7AF.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AF.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AF.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AF.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AF, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu33 amino acid sequence depicted in FIG. 7AG.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu33 amino acid sequence depicted in FIG. 7AG.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AG.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AG.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AG.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AG, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu34 amino acid sequence depicted in FIG. 7AH.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu34 amino acid sequence depicted in FIG. 7AH.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AH.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AH.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AH.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AH, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu35 amino acid sequence depicted in FIG. 7AI.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu35 amino acid sequence depicted in FIG. 7AI.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AI.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AI.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AI.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AI, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu36 amino acid sequence depicted in FIG. 7AJ.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu36 amino acid sequence depicted in FIG. 7AJ.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AJ.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AJ.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AJ.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AJ, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu37 amino acid sequence depicted in FIG. 7AK.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu37 amino acid sequence depicted in FIG. 7AK.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AK.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AK.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AK.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AK, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu38 amino acid sequence depicted in FIG. 7AL.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu38 amino acid sequence depicted in FIG. 7AL.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AL.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AL.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AL.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AL, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu39 amino acid sequence depicted in FIG. 7AM.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu39 amino acid sequence depicted in FIG. 7AM.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AM.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AM.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AM.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AM, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu40 amino acid sequence depicted in FIG. 7AN.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu40 amino acid sequence depicted in FIG. 7AN.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AN.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AN.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AN.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AN, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu41 amino acid sequence depicted in FIG. 7AO.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu41 amino acid sequence depicted in FIG. 7AO.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AO.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AO.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AO.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AO, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu42 amino acid sequence depicted in FIG. 7AP.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu42 amino acid sequence depicted in FIG. 7AP.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AP.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AP.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AP.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AP, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu43 amino acid sequence depicted in FIG. 7AQ.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu43 amino acid sequence depicted in FIG. 7AQ.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AQ.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AQ.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AQ.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AQ, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu44 amino acid sequence depicted in FIG. 7AR.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu44 amino acid sequence depicted in FIG. 7AR.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AR.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AR.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AR.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AR, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu45 amino acid sequence depicted in FIG. 7AS.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu45 amino acid sequence depicted in FIG. 7AS.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AS.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AS.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AS.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AS, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu46 amino acid sequence depicted in FIG. 7AT.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu46 amino acid sequence depicted in FIG. 7AT.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AT.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AT.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AT.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AT, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu47 amino acid sequence depicted in FIG. 7 AU.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu47 amino acid sequence depicted in FIG. 7AU.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AU.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AU.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AU.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AU, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu48 amino acid sequence depicted in FIG. 7AV.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu48 amino acid sequence depicted in FIG. 7AV.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AV.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AV.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AV.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AV, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu49 amino acid sequence depicted in FIG. 7AQ.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu49 amino acid sequence depicted in FIG. 7AQ.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AQ.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AQ.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AQ.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AQ, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu50 amino acid sequence depicted in FIG. 7AX.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu50 amino acid sequence depicted in FIG. 7AX.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AX.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AX.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AX.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AX, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu51 amino acid sequence depicted in FIG. 7AY.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu51 amino acid sequence depicted in FIG. 7AY.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AY.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AY.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AY.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in b, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu52 amino acid sequence depicted in FIG. 7AZ.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu52 amino acid sequence depicted in FIG. 7AZ.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AZ.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7AZ.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AZ.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7AZ, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu53 amino acid sequence depicted in FIG. 7BA.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu53 amino acid sequence depicted in FIG. 7BA.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7BA.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7BA.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7BA.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7BA, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu54 amino acid sequence depicted in FIG. 7BB.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu54 amino acid sequence depicted in FIG. 7BB.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7BB.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7BB.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7BB.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7BB, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu55 amino acid sequence depicted in FIG. 7BC.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu55 amino acid sequence depicted in FIG. 7BC.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7BC.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7BC.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7BC.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7BC, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu56 amino acid sequence depicted in FIG. 7BD.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu56 amino acid sequence depicted in FIG. 7BD.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7BD.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7BD.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7BD.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7BD, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu57 amino acid sequence depicted in FIG. 7BE.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu57 amino acid sequence depicted in FIG. 7BE.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7BE.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7BE.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7BE.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7BE, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu58 amino acid sequence depicted in FIG. 7BF.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu58 amino acid sequence depicted in FIG. 7BF.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7BF.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7BF.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7BF.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7BF, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu59 amino acid sequence depicted in FIG. 7BG.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu59 amino acid sequence depicted in FIG. 7BG.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7BG.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7BG.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7BG.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7BG, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu60 amino acid sequence depicted in FIG. 7BH.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu60 amino acid sequence depicted in FIG. 7BH.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7BH.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7BH.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7BH.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7BH, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu61 amino acid sequence depicted in FIG. 7BI.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu61 amino acid sequence depicted in FIG. 7BI.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7BI.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7BI.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7BI.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7BI, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.
  • a CasMu protein (of the subject compositions and/or methods) includes an amino acid sequence having 20% or more sequence identity (e.g., 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu62 amino acid sequence depicted in FIG. 7BJ.
  • a CasMu protein includes an amino acid sequence having 50% or more sequence identity (e.g., 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu62 amino acid sequence depicted in FIG. 7BJ.
  • a CasMu protein includes an amino acid sequence having 80% or more sequence identity (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7BJ.
  • a CasMu protein includes an amino acid sequence having 90% or more sequence identity (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity) with the CasMu amino acid sequence depicted in FIG. 7BJ.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7BJ.
  • a CasMu protein includes an amino acid sequence having the CasMu amino acid sequence depicted in FIG. 7BJ, with the exception that the sequence includes an amino acid substitution (e.g., 1, 2, or 3 amino acid substitutions) that reduces the naturally occurring catalytic activity of the protein.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

La présente divulgation concerne des protéines effectrices CRISPR-Cas, des acides nucléiques codant pour celles-ci et des compositions comprenant celles-ci. La présente divulgation concerne des complexes ribonucléoprotéiques comprenant : une protéine effectrice CRISPR-Cas de la présente divulgation ; et un acide nucléique guide (par exemple, un ARN guide). La présente divulgation concerne des procédés de modification d'un acide nucléique cible à l'aide d'une protéine effectrice CRISPR-Cas guidée par ARN de la présente divulgation et d'un ARN guide. La présente divulgation concerne des procédés de modulation de la transcription dans un acide nucléique cible. La présente divulgation concerne des procédés de modification d'un acide nucléique cible, à l'aide d'une protéine effectrice CRISPR-Cas guidée par ARN selon la présente divulgation et d'un ARN guide.
PCT/US2023/066735 2022-05-09 2023-05-08 Polypeptides effecteurs crispr-cas et leurs procédés d'utilisation WO2023220566A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202263339770P 2022-05-09 2022-05-09
US63/339,770 2022-05-09

Publications (1)

Publication Number Publication Date
WO2023220566A1 true WO2023220566A1 (fr) 2023-11-16

Family

ID=88731100

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2023/066735 WO2023220566A1 (fr) 2022-05-09 2023-05-08 Polypeptides effecteurs crispr-cas et leurs procédés d'utilisation

Country Status (1)

Country Link
WO (1) WO2023220566A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070031844A1 (en) * 2002-11-14 2007-02-08 Anastasia Khvorova Functional and hyperfunctional siRNA
US20200131488A1 (en) * 2017-03-15 2020-04-30 The Broad Institute, Inc. Novel cas13b orthologues crispr enzymes and systems

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070031844A1 (en) * 2002-11-14 2007-02-08 Anastasia Khvorova Functional and hyperfunctional siRNA
US20200131488A1 (en) * 2017-03-15 2020-04-30 The Broad Institute, Inc. Novel cas13b orthologues crispr enzymes and systems

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
ALTAE-TRAN HAN, KANNAN SOUMYA, DEMIRCIOGLU F. ESRA, OSHIRO RACHEL, NETY SUCHITA P., MCKAY LUKE J., DLAKIĆ MENSUR, INSKEEP WILLIAM : "The widespread IS200/IS605 transposon family encodes diverse programmable RNA-guided endonucleases", SCIENCE, AMERICAN ASSOCIATION FOR THE ADVANCEMENT OF SCIENCE, US, vol. 374, no. 6563, 9 September 2021 (2021-09-09), US , pages 57 - 65, XP055901842, ISSN: 0036-8075, DOI: 10.1126/science.abj6856 *
DATABASE UniProtKB ANONYMOUS : "Putative transposase", XP093113334 *

Similar Documents

Publication Publication Date Title
US11377646B2 (en) Modified cells comprising CRISPR systems
US20200172886A1 (en) Casz compositions and methods of use
US20200255858A1 (en) Casy compositions and methods of use
WO2019089808A1 (fr) Compositions de crispr/cas de classe 2 et leurs procédés d'utilisation
US20230028178A1 (en) Crispr-cas effector polypeptides and methods of use thereof
US20230348872A1 (en) Crispr-cas effector polypeptides and methods of use thereof
WO2023220566A1 (fr) Polypeptides effecteurs crispr-cas et leurs procédés d'utilisation
US20240102032A1 (en) Crispr-cas effector polypeptides and methods of use thereof
WO2023039373A2 (fr) Polypeptides effecteurs crispr-cas et leurs procédés d'utilisation
WO2023201203A2 (fr) Polypeptides effecteurs crispr-cas et leurs procédés d'utilisation

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23804433

Country of ref document: EP

Kind code of ref document: A1