WO2023218453A1 - Methods of treating diseases associated with polyalanine expansion mutations - Google Patents

Methods of treating diseases associated with polyalanine expansion mutations Download PDF

Info

Publication number
WO2023218453A1
WO2023218453A1 PCT/IL2023/050474 IL2023050474W WO2023218453A1 WO 2023218453 A1 WO2023218453 A1 WO 2023218453A1 IL 2023050474 W IL2023050474 W IL 2023050474W WO 2023218453 A1 WO2023218453 A1 WO 2023218453A1
Authority
WO
WIPO (PCT)
Prior art keywords
uba6
cells
cell
polyalanine
neurons
Prior art date
Application number
PCT/IL2023/050474
Other languages
French (fr)
Inventor
Avraham Ashkenazi
Yevgeny Berdichevsky
Fatima AMER-SARSOUR
Gad David VATINE
Daniel FALIK
Original Assignee
Ramot At Tel-Aviv University Ltd.
B.G. Negev Technologies & Applications Ltd., At Ben-Gurion University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ramot At Tel-Aviv University Ltd., B.G. Negev Technologies & Applications Ltd., At Ben-Gurion University filed Critical Ramot At Tel-Aviv University Ltd.
Publication of WO2023218453A1 publication Critical patent/WO2023218453A1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0618Cells of the nervous system
    • C12N5/0619Neurons
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43Enzymes; Proenzymes; Derivatives thereof
    • A61K38/53Ligases (6)
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G01N33/5058Neurological cells
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/573Immunoassay; Biospecific binding assay; Materials therefor for enzymes or isoenzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10Growth factors
    • C12N2501/11Epidermal growth factor [EGF]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10Growth factors
    • C12N2501/115Basic fibroblast growth factor (bFGF, FGF-2)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10Growth factors
    • C12N2501/13Nerve growth factor [NGF]; Brain-derived neurotrophic factor [BDNF]; Cilliary neurotrophic factor [CNTF]; Glial-derived neurotrophic factor [GDNF]; Neurotrophins [NT]; Neuregulins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10Growth factors
    • C12N2501/155Bone morphogenic proteins [BMP]; Osteogenins; Osteogenic factor; Bone inducing factor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/40Regulators of development
    • C12N2501/415Wnt; Frizzeled
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/70Enzymes
    • C12N2501/72Transferases (EC 2.)
    • C12N2501/727Kinases (EC 2.7.)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/90Polysaccharides
    • C12N2501/91Heparin
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2506/00Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
    • C12N2506/45Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from artificially induced pluripotent stem cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2533/00Supports or coatings for cell culture, characterised by material
    • C12N2533/50Proteins
    • C12N2533/52Fibronectin; Laminin
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y602/00Ligases forming carbon-sulfur bonds (6.2)
    • C12Y602/01Acid-Thiol Ligases (6.2.1)

Definitions

  • the present invention in some embodiments thereof, relates to methods of treating a subject having a disease associated with a polyalanine expansion mutation and, methods of increasing ubiquitination of E6AP.
  • mutant RUNX2 in cleidocranial dysplasia 3
  • mutant homeobox D13 mutant HOXD13
  • mutant poly(A) binding protein nuclear 1 mutant PABPN1
  • OPMD oculopharyngeal muscular dystrophy
  • disease-causing expansion mutations may contain up to 13 additional alanine residues and can result in protein misfolding 9 11 .
  • the exact functional or structural role of the polyalanine stretches in normal proteins is unclear. Perturbations of ubiquitin activation, conjugation and transfer to target proteins via the El- E2-E3 enzymatic cascade have been linked to dysregulation of neuronal homeostasis and to a growing number of neurodevelopmental disorders 12 14 .
  • Ubiquitin protein ligase E3A (UBE3A, also known as “E6-AP” or “E6AP”) is part of the ubiquitin protein degradation system, and interactions of UBE3A with the E6 protein of human papillomavirus (HPV) types 16 and 18 are known to result in ubiquitination and proteolysis of tumor protein p53.
  • E6AP itself undergoes poly- ubiquitination as part of its proteasome-mediated degradation (Lee P., 2013, Mol. Cell, 50: 172-184). Maternally inherited deletions or point mutations in UBE3A cause Angelman Syndrome.
  • CNVs copy number variations
  • a method of treating a subject having a disease associated with a polyalanine expansion mutation comprising administering to the subject a therapeutically effective amount of an agent capable of upregulating expression or activity of a ubiquitin like modifier activating enzyme 6 (UBA6) in nervous system cells of the subject, thereby treating the subject.
  • UUA6 ubiquitin like modifier activating enzyme 6
  • UUA6 ubiquitin like modifier activating enzyme 6
  • a method of treating a subject diagnosed with autism spectrum disorders comprising administering to the subject a therapeutically effective amount of an agent capable of upregulating expression or activity of a ubiquitin like modifier activating enzyme 6 (UBA6) in nervous system cells of the subject, thereby treating the subject.
  • an agent capable of upregulating expression or activity of a ubiquitin like modifier activating enzyme 6 (UBA6) in nervous system cells of the subject, thereby treating the subject.
  • UUA6 ubiquitin like modifier activating enzyme 6
  • a method of increasing ubiquitination of an E6AP polypeptide in a cell comprising contacting the cell with a therapeutically effective amount of an agent capable of specifically upregulating expression or activity of a ubiquitin like modifier activating enzyme 6 (UBA6) in the cell, thereby increasing the ubiquitination of the E6AP polypeptide in the cell.
  • UUA6 ubiquitin like modifier activating enzyme 6
  • a method of generating neurons with a polyalanine expansion mutation comprising subjecting induced pluripotent stem cells (iPSCs) which comprise a genomic polyalanine expansion mutation to culture conditions suitable for differentiating said iPSCs into neurons, thereby generating the neurons with the Polyalanine expansion mutation.
  • iPSCs induced pluripotent stem cells
  • a method of screening for an agent capable of specifically modulating expression or activity of a ubiquitin like modifier activating enzyme 6 comprising:
  • contacting is in the presence of a functional portion of said UBA6 comprising a second catalytic cysteine half (SCCH) domain.
  • SCCH catalytic cysteine half
  • identifying the at least one molecule of the plurality of molecules which modulates the complex formed by the UBA6 and USE1 is effected by monitoring ubiquitination level of a target polypeptide.
  • the target polypeptide is E6AP.
  • contacting is effected in vivo.
  • contacting is effected ex vivo.
  • the cell is a nervous system cell.
  • the cell is of a subject diagnosed with a disease characterized by abnormally high levels of an E6AP polypeptide.
  • the cell is of a subject diagnosed with autism spectrum disorders (ASDs).
  • ASDs autism spectrum disorders
  • the polypeptide having said polyalanine expansion mutation has an aberrant cellular localization as compared to a corresponding wild-type polypeptide.
  • the polypeptide having said polyalanine expansion mutation is cytoplasmic.
  • the polyalanine expansion mutation occurs in a polypeptide selected from the group consisting of a paired like homeobox 2B (PH0X2B), aristaless related homeobox (ARX), SRY-box transcription factor 3 (SOX3), Zic family member 2 (ZIC2), forkhead box L2 (F0XL2), RUNX family transcription factor 2 (RUNX2), homeobox Al 3 (H0XA13), homeobox D13 (H0XD13), and poly(A) binding protein nuclear 1 (PABPN1).
  • a polypeptide selected from the group consisting of a paired like homeobox 2B (PH0X2B), aristaless related homeobox (ARX), SRY-box transcription factor 3 (SOX3), Zic family member 2 (ZIC2), forkhead box L2 (F0XL2), RUNX family transcription factor 2 (RUNX2), homeobox Al 3 (H0XA13), homeobox D13 (H0XD13), and poly(
  • the disease is selected from the group consisting of congenital central hypoventilation syndrome (CCHS), X-linked cognitive disability and epilepsy, X-linked cognitive disability with growth hormone deficiency, Holoprosencephaly type 5, Blepharophimosis syndrome, cleidocranial dysplasia (CCD), Hand-foot-genital syndrome, synpolydactyly, and oculopharyngeal muscular dystrophy (OPMD).
  • CCHS congenital central hypoventilation syndrome
  • X-linked cognitive disability and epilepsy X-linked cognitive disability with growth hormone deficiency
  • Holoprosencephaly type 5 e.g., X-linked cognitive disability with growth hormone deficiency
  • CHCD e.g., cleidocranial dysplasia
  • OPMD oculopharyngeal muscular dystrophy
  • the agent upregulates expression level of said UBA6.
  • the agent is a polynucleotide encoding at least a functional portion of said UBA6 comprising a second catalytic cysteine half (SCCH) domain.
  • SCCH catalytic cysteine half
  • the polynucleotide is an mRNA molecule.
  • the polynucleotide is comprised in a nucleic acid construct suitable for in-vivo delivery into nervous system cells of the subject.
  • the agent stabilizes formation of a protein complex between said UBA6 and USE1.
  • the agent is a peptide of 5-10 alanine residues.
  • the SCCH domain of the UBA6 is set forth by SEQ ID NO: 25.
  • the neurons are peripheral autonomic neurons.
  • the modulating is upregulating said expression or activity of said UBA6 in a cell of a nervous system
  • the modulating is downregulating said expression or activity of said UBA6 in a cell of a nervous system
  • the method further comprising synthesizing the identified agent.
  • the neurons are differentiated in vitro from induced pluripotent stem cells (iPSCs) comprising a genomic polyalanine expansion mutation.
  • iPSCs induced pluripotent stem cells
  • subjecting said iPSCs to culture conditions suitable for differentiating the iPSCs into neurons comprises the steps of:
  • NMPs neuromesodermal progenitor cells
  • the culture medium suitable for induction of iPSCs into neuromesodermal progenitor cells comprises a glycogen synthase kinase 3 (GSK-3) inhibitor and an ALK5 (activin receptor-like kinase 5) inhibitor.
  • GSK-3 glycogen synthase kinase 3
  • ALK5 activin receptor-like kinase 5
  • the culture medium suitable for induction of said NMPs into sympathetic neural crest comprises basic fibroblast growth factor (bFGF), bone morphogenic protein 4 (BMP4) and retinoic acid (RA).
  • bFGF basic fibroblast growth factor
  • BMP4 bone morphogenic protein 4
  • RA retinoic acid
  • the culture medium suitable for induction of sympathetic neuroblast crest comprises basic fibroblast growth factor (bFGF), bone morphogenic protein 4 (BMP4) and epidermal growth factor (EGF).
  • bFGF basic fibroblast growth factor
  • BMP4 bone morphogenic protein 4
  • EGF epidermal growth factor
  • the culture medium suitable for induction of sympathetic neuronal maturation comprises nerve growth factor (NFG), glial cell derived neurotrophic factor (GDNF) and brain derived neurotrophic factor (BDNF).
  • nerve growth factor nerve growth factor
  • GDNF glial cell derived neurotrophic factor
  • BDNF brain derived neurotrophic factor
  • the method further comprising detecting presence of differentiated neurons following step (d) using an immunological detection method.
  • the immunological detection method is performed with an antibody which specifically binds to a marker selected from the group consisting of: Tuj la, MAP2ab, Peripherin, AT0H1, PH0X2B, dopamine beta-hydroxylase (DBH) and Tyrosine hydroxylase (TH).
  • FIGs. 1A-G depict that a polyalanine stretch in USE1 regulates UBA6-USE1 ubiquitin transfer.
  • Figure 1A Structure of the USE1 enzyme (PDB 5A4P) indicating the catalytic cysteine (Cysl88), loop B (LB) with Trpl95 masking Cysl88, and model of the C-and N-terminal extensions including the alanine repeats (created by AlphaFold).
  • FIG. IB FLAG-wild type (WT) USE1, FLAG-USE 1 mutant with aberrations in the polyalanine (2A> 2R), and FLAG-USE 1 catalytic dead mutant (C188A) were co-expressed with HA-Ub (a ubiquitin molecule with HA tag) in control or UBA6-depleted (Uba6 small inhibitory RNA, siRNA) HEK293T cells.
  • Cell lysates were incubated with or without P mercaptoethanol (PME) and analyzed for ubiquitin loading. Results are mean ⁇ s.e.m normalized to control WT USE1.
  • PME P mercaptoethanol
  • Figure 1C Time- dependent in vitro ubiquitin loading of WT and APolyAla USE1 by UBA6.
  • Figure ID Quantification of UBA6-USE1 interaction in WT and USE1 APolyAla knockout (KO) HEK293T cells using FLIM-FRET. Representative 2pFLIM pseudo-colored images of WT cells and APolyAla KO cells, stained for USE1 and UBA6 using secondary antibodies as donor (Alexa 488) and acceptor (Alexa 555), respectively.
  • Figure IF WT and APolyAla KO cells were incubated for the last 6 hours with the proteasome inhibitor MG132 (10 pM), and E6AP was immunoprecipitated from cell lysates for ubiquitination analysis (under reducing conditions with PME).
  • Figure 1G E6AP purified from HEK293T cells was incubated with bacterially-produced UBA6, USE1 WT and USE1 mutants (APolyAla and C188A) for in vitro E6AP ubiquitination assay.
  • E6AP ubiquitin conjugates (under reducing conditions with PME) was resolved by SDS-page (* indicates the mono-ubiquitin conjugate), ns non- significant, * P ⁇ 0.05, ** P ⁇ 0.01, ****P ⁇ 0.0001.
  • FIGs. 2A-D demonstrate that UBA6 interacts with polyalanine stretches.
  • Figure 2A Electrostatic surface representation of the UBA6 structural model in comparison to UBA1. The location of key Arg and Eys residues forming the positively charged patch in UBA6 is presented.
  • Figures 2B-C HA-tagged constructs of WT UBA1, WT UBA6, and UBA6 mutants with Ala or Asp substitution mutations in Lys628, Arg691, Eys709, and Lys714 (UBA6 mut 4Ala or UBA6 mut 4Asp) were co-transfected with FEAG-USE1 ( Figure 2B) or empty GFP and GFP-polyAla (19Ala) ( Figure 2C) into HEK293T cells. Cell lysates were immunoprecipitated with anti-HA antibodies and the immunocomplexes were analyzed with anti-FEAG, anti-HA, and anti-GFP antibodies. Results are mean + s.e.m.
  • FIGs. 3 A- J demonstrate that polyalanine-expanded disease proteins interact with UBA6 and inhibit E6AP degradation.
  • Figures 3A-E HEK293T cells were transfected with the indicated constructs and immunoprecipitated for endogenous UBA6.
  • Figure 3A Empty GFP, and GFP- polyAla with or without a nuclear localization sequence (NFS).
  • Figure 3B WT and mutant PHOX2B (+13Ala).
  • Figure 3C WT and mutant RUNX2 (+6Ala and +12Ala).
  • Figure 3D WT and mutant H0XD13 (+10Ala).
  • Figure 3E WT and mutant PABPN1 (+7 Ala).
  • CHX cycloheximide
  • Figure 31 Association of endogenous UBA6 (red) with GFP-PHOX2B (green). Scale bar 10 pm. Quantification is shown in Figure 11D.
  • FIGs. 4A-G demonstrate that UBA6 overexpression rescues CCHS patient-derived autonomic neurons from neuronal death.
  • Figure 4A Characterization of iPSC-derived autonomic neurons at day 31 of differentiation from healthy controls and CCHS patients, hnmunocytochemistry of PHOX2B (green), piH-tubulin (TUBP3, red), tyrosine hydroxylase (TH, green) peripherin (PRPH, green), and atonal BHLH Transcription Factor 1 (ATOH1, green). Scale bar 200 pm.
  • Figure 4B Quantification of the association of endogenous UBA6 with endogenous PHOX2B (Pearson’s coefficient) in autonomic neurons from control and CCHS patients.
  • Results are the average values from neurons in different imaged fields. Total number of neurons analyzed was 160 for 103iCTR 20/20, 350 for 102iCCHS 20/25, 380 for 105iCTR 20/20 and 550 for 104iCCHS 20/27. One-way ANOVA Tukey’s test. Images are shown in Figure 14D.
  • Figure 4C Representative 2pFLIM pseudo-colored images of control and CCHS patient-derived neurons, stained for USE1 and UBA6 using secondary antibodies as donor (Alexa 488) and acceptor (Alexa 555), respectively. Scale bar is 20 pm Comparison of the difference in lifetime for each group, for the subtraction of donor only to donor and acceptor fluorescence lifetime.
  • Figure 4D Analysis of E6AP levels in control (105iCTR 20/20) and CCHS patients (102iCCHS 20/25 and 104iCCHS 20/27). Results are mean + s.e.m normalized to control from three independent differentiation days. Paired 2-tailed t-test.
  • Figure 4E Quantification of E6AP mRNA in the control and patient-derived autonomic neurons. Results are mean + s.e.m. Unpaired 2-tailed t-test.
  • Figures 4F-G Patient-derived autonomic neurons (102iCCHS 20/25) were transduced with mCherry-UBA6 cDNA lentiviral vectors.
  • Figure 4G Representative images of TUNEL staining (colored green marked with arrows) of the transduced and non-transduced patient neurons.
  • the percentage of the TUNEL positive PHOX2B expressing cells is shown as mean ⁇ s.e.m. At least 1000 PHOX2B expressing cells were analyzed. Unpaired 2-tailed t-test. ns non- significant, *P ⁇ 0.05, ***P ⁇ 0.001, ****P ⁇ 0.0001.
  • FIGs. 5A-B depict an analysis of alanine repeats in the ubiquitin system.
  • Figure 5 A Analysis of alanine repeats domains in the human ubiquitin cascades comprising El, E2, and E3 enzymes.
  • Figure 5B A multiple sequence alignments of USE1 homologs from different vertebrates. Shown are partial sequences of the following polypeptides:
  • the alignment is colored according to sequence identity including the N-terminus containing the polyalanine stretch.
  • FIGs. 6A-C demonstrate that polyalanine stretches regulate UBA6-USE1 interaction and ubiquitin transfer.
  • Figure 6B A representative blot for time-dependent in vitro ubiquitin loading of WT and APolyAla USE1 by UBA6 (quantification is presented in Figure 1C).
  • FIGs. 7A-B depict a biophysical analysis of the interaction between a polyalanine peptide and the SCCH domains of the canonical El ubiquitin- like activating enzymes.
  • Figure 7A AlphaFold models of UBA6 and UBA7 and the crystal structures of UBA1, UBA2 and UBA3 are shown. The structures were aligned and electrostatic potential was calculated as described in GENERAL MATERIALS AND EXPERIMENTAL METHODS below. The yellow arrows indicate the location of the groove within the SCCH domains.
  • UBA6, UBA1 and UBA7 form an extended lobe within the SCCH, which is missing in UBA2 and UBA3. The groove in UBA7 is covered and do not exist in UBA2 and UBA3.
  • UBA1 and UBA6 are highly similar in terms of structure but present significantly different electro potential surfaces. The gradient from negative (red) to positive (blue) charge is shown.
  • the Figure was prepared by PyMol.
  • FIGs. 8A-E demonstrate that polyalanine expansion mutations cause cytoplasmic mislocalization of different nuclear proteins.
  • HEK293T cells were transfected with the indicated constructs, and were subjected to immunostaining.
  • Figure 8A GFP- 19Ala with nuclear localization sequence (NLS, green) or GFP-19Ala, labeled for endogenous UBA6 (red).
  • Figure 8B HA- PHOX2B WT and HA-PHOX2B +13Ala.
  • Figure 8C HA-RUNX2 WT, HA-RUNX2 +6Ala, and HA-RUNX2+ 12Ala.
  • Figure 8D HA-HOXD13 WT and HA-HOXD13 +10Ala.
  • Figure 8E HA- PABPN1 WT and HA-PABPN1 +7 Ala. Image scale bar 20 pm. Quantification of the association of HA-tagged proteins (labeled in red) with the nucleus (labeled in blue, Pearson’s coefficient) is indicated as well as the cytoplasmic intensity. Results are the average values from cells in different imaged fields. Between 60-100 transfected cells were analyzed. Results are mean ⁇ s.e.m. Unpaired 2-tailed t-test ( Figures 8B, 8D and 8E) and one-way ANOVA Tukey’s test (Figure 8C). ns nonsignificant, *P ⁇ 0.05, **P ⁇ 0.01, 0.0001.
  • FIGs. 9A-D demonstrate that soluble isolated polyalanine stretches regulate USE1 ubiquitin loading and E6AP levels.
  • Figure 9A HEK293T cells were transfected with empty GFP, GFP- polyAla (19 Ala), and GFP-polyAla with a nuclear localization sequence (NLS). Endogenous USE1 ubiquitin loading was analyzed in pME-untreated cell lysates.
  • Figure 9B HEK293T cells were transfected with empty GFP or GFP-polyAla. The cell lysates were analyzed for the soluble and sarkosyl-insoluble fractions of GFP-polyAla.
  • Figure 9C Control and UBA6-depleted HEK293T cells were transfected with empty vector or mutant PHOX2B and analyzed for E6AP levels.
  • Figure 9D Cells were transfected with empty GFP, or GFP-polyAla with or without HA- UBA6, and analyzed for E6AP levels. Results are mean ⁇ s.e.m.
  • FIGs. 10A-H demonstrate that cytoplasmic polyalanine-expanded disease proteins interact with UBA6, decrease USE1 ubiquitin loading and stabilize E6AP levels.
  • Figures 10A-D HEK293T cells were transfected with the indicated constructs: Figure 10A - HA-mutant PHOX2B (+13Ala). Figure 10B - HA-mutant RUNX2 (+12Ala). Figure 10C - HA-mutant HOXD13 (+10Ala). Figure 10D - HA-mutant PABPN1 (+7 Ala).
  • Endogenous UBA6 was immunoprecipitated from the nuclear fraction (Nuc, LaminBl enriched) or the cytoplasmic (Cyt, GAPDH enriched) fraction (unrelated IgG was used as a control).
  • the immunocomplexes were analyzed with anti-HA antibodies.
  • Figure 10E HEK293T cells were transfected with constructs expressing different polyalanine-expanded disease proteins (mutant PHOX2B, mutant RUNX2, mutant H0XD13, and mutant PABPN1) together with FLAG-USE 1. Cell lysates were incubated without P mercaptoethanol and analyzed for ubiquitin loading. Results are mean ⁇ s.e.m normalized to control (empty vector, no disease protein).
  • FIG. 10F Representative blot of E6AP levels in CHX-treated cells that were transfected with mutant PH0X2B or empty vector. Quantification of E6AP levels is shown in Figure 3F.
  • Figure 10H Control and UBA6- depleted HEK293T cells were transfected with HA-Ub, mutant PH0X2B or empty vector and incubated for the last 6 hours with the proteasome inhibitor MG132 (10 pM). Endogenous E6AP was immunoprecipitated from cell lysates for ubiquitination analysis, ns non-significant, * P ⁇ 0.05, ** P ⁇ 0.01.
  • FIGs. 11A-F demonstrate an analysis of UBA6 and mutant PHOX2B association and effects on Arc levels in primary neurons.
  • Figure 11 A Mouse primary cortical neurons were labeled for endogenous UBA6 (red) and MAP2 (green). Quantification of the association of UBA6 with the neuronal nucleus, cell body, and neurites is shown (Pearson’s coefficient).
  • Figure 11B Mouse primary cortical neurons were transduced with lentiviral vectors expressing GFP-tagged WT PHOX2B (green) or mutant PHOX2B (+13 Ala, green), and were labeled for endogenous MAP2 (red) and TAU (red) (non-nuclear fraction of mutant PHOX2B marked with arrows).
  • FIG. 11C Mouse primary cortical neurons were transduced with lentiviral vectors expressing GFP-tagged WT PHOX2B or mutant PHOX2B (+13Ala), and were analyzed for the levels of PHOX2B in the soluble and sarkosyl-insoluble fractions.
  • Figure 11D Quantification of UBA6 association with WT and mutant (+7 Ala, +13 Ala) GFP-PHOX2B (Pearson’s coefficient) related to Figure 31.
  • Figure HE Analysis of UBA6 intensity in aggregated and non- aggregated GFP-mutant PHOX2B (+13Ala) expressing cortical neurons. The results represent further analysis of the GFP signal in the images of Figure 11D.
  • FIGs. 12A-E demonstrate that OPMD-patient derived cells exhibit cytoplasmic presence of PABPN1 and reduced association between UBA6 and USE1.
  • Figure 12B Control and OPMD patient-derived primary fibroblasts were stained for PABPN1 and nuclei.
  • FIG. 12C Representative 2pFLIM pseudo colored images of control and OPMD fibroblasts, stained for USE 1 and UBA6 using secondary antibodies as donor (Alexa 488) and acceptor (Alexa 555), respectively. Scale bar is 200 pm
  • FIGs. 13A1-13O5 depict generation and characterization of CCHS patient and family relative-derived iPSCs.
  • Skin punch biopsies were collected from a 2-year-old female patient with CCHS who harbors a heterozygous 27 polyalanine expansion in PHOX2B (104iCCHS 20/27; data from this patient is referred by the number “2” in Figures 13A2- 13N2 and is also shown in Figures 1302-1304), and from her healthy sister (105iCTR 20/20; data from this subject is referred by the number “3” in Figures 13A3-13N3 and is also shown in 1305).
  • FIG. 13A1-13O1 A biopsy was also collected from the healthy father (103iCTR 20/20; data from this subject is referred by the number “1” in Figures 13A1-13O1) of the 4-year-old male patients who harbors a heterozygous 25 polyalanine expansion in PHOX2B (102iCCHS 20/25; data not shown).
  • Patient- specific fibroblasts were electroporated with non-integrating reprogramming episomal plasmids.
  • Figures 13A1-13E3 hnmunocytochemistry for pluripotency markers (NANOG, SOX2, OCT3/4 TRA-1-60, SSEA4).
  • Figures 13F1-13J3 Flow cytometry analysis for pluripotency markers (red-NANOG, SOX2, OCT3/4 TRA-1-60, SSEA4).
  • Figures 13K1-3 G-banding karyotype.
  • Figures 13L1-13N3 Embryoid bodies (EBs) were generated and allowed to spontaneously differentiate for 21 days. Differentiated EBs express the ectoderm marker heavy chain neurofilament, the mesoderm marker a- smooth muscle actin SMA, and the endoderm marker a-fetoprotein.
  • EBs Embryoid bodies
  • Figures 1301-1305 show the genetic analysis of the reprogrammed pluripotent stem cell lines to confirm the presence of a heterozygous expansion of seven alanine residues resulting in a 27 polyalanine stretch in PH0X2B .
  • Figure 1301 sequence from subject 103iCTR 20/20;
  • Figures 1302-1304 sequences from subject 104/CCHS 20/27, showing both alleles (Figure 1302), normal allele ( Figure 1303), and mutant allele (Figure 1304, shown is a partial sequence of the mutant PH0X2B with a polyalanine expansion mutation; SEQ ID NO: 85).
  • Figure 1305 sequence from subject 105iCTR 20/20). Sequencing of the 3rd PH0X2B exon confirms the heterozygous +7 polyalanine expansion in the CCHS patient, but not in the healthy controls. Image scale bars 100 pm
  • FIGs. 14A-I depict patient-derived autonomic neurons showing cytoplasmic mislocalized soluble PH0X2B, and reduced Arc levels.
  • Figures 14A-B Quantification of the association of endogenous PH0X2B with the nucleus (Pearson’ s coefficient) in autonomic neurons from control and CCHS patients. Quantification is shown also for PH0X2B cytoplasmic intensity. Results are mean ⁇ s.e.m *P ⁇ 0.05, **P ⁇ 0.01, ***P ⁇ 0.001 0.0001 one-way ANOVA Tukey’ s test. The results represent additional analysis from the same neurons analyzed in Figure 4B.
  • Figure 14C Autonomic neurons from control and CCHS patients were analyzed for the levels of PHOX2B in the soluble and sarkosyl-insoluble fractions.
  • Figure 14D iPSC-derived human autonomic neurons from control and CCHS patients were labeled by nuclear staining (colored blue, abnormal nuclear morphology marked with arrows), and for endogenous PHOX2B (colored green) and endogenous UBA6 (colored red). Images indicate events of severe cytoplasmic mislocalization of PH0X2B (marked with arrows). Scalebar 10 pm.
  • Figures 14E-F Immunostaining of Arc (colored green) and TUBP3 (colored red) in autonomic neurons from control and CCHS patients.
  • FIG. 15 is aWestern Blot demonstrating an E6AP ubiquitination assay.
  • E6AP purified from HEK293T cells was incubated in vitro for up to 1.5 hours with bacterially-produced UBA6, USE1, and ubiquitin with or without polyalanine peptides (cy5-7-Ala residues; SEQ ID NO: 22) for an E6AP ubiquitination assay.
  • E6AP ubiquitin conjugates (under reducing conditions withpME) were resolved by SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis). The results show that the addition of a peptide of 7-Ala residues (cy5-7Ala residues; SEQ ID NO: 22) results in an increase in E6AP poly- ubiquitination.
  • FIG. 16 is a schematic illustration of the differentiation protocol according to some embodiments of the invention PSCs (e.g., iPSCs) into peripheral sympathetic neurons.
  • DoD - refers to day of differentiation.
  • SB SB431542, an ALK5 inhibitor;
  • CHIR CHIR 99021, a glycogen synthase kinase 3 (GSK-3) inhibitor;
  • FGF2 - basic fibroblast growth factor;
  • BMP4 bone morphogenic protein 4;
  • SHH sonic hedgehog;
  • RA retinoic acid;
  • EGF epidermal growth factor;
  • NEF nerve growth factor;
  • BDNF brain derived neurotrophic factor;
  • GDNF glial cell derived neurotrophic factor.
  • the present invention in some embodiments thereof, relates to methods of treating a subject having a disease associated with a polyalanine expansion mutation and, methods of increasing ubiquitination of E6AP.
  • Expansion mutations in polyalanine tracts are known to be associated with a growing number of human diseases with common genotypes and similar phenotypes 1-6 .
  • the present inventors have investigated the normal function of physiological polyalanine stretches, and whether a common molecular mechanism is involved in these diseases.
  • the present inventors show that UBA6, an El ubiquitin- activating enzyme 7, 8 , recognizes a polyalanine stretch within its cognate E2 ubiquitin- conjugating enzyme, USEl. Aberrations in this polyalanine stretch reduce ubiquitin transfer to USEl and downstream target, the E3 ubiquitin ligase, E6AP.
  • the present inventors have identified competition for the UBA6-USE1 interaction by various proteins with polyalanine expansion mutations in the disease state.
  • the deleterious interactions of expanded polyalanine proteins with UBA6 alter the levels and ubiquitination- dependent degradation of E6AP, which in turn affects the levels of the synaptic protein, Arc.
  • E6AP the synaptic protein
  • Arc the synaptic protein
  • the present inventors have identified a polyalanine motif in the ubiquitin- conjugating E2 enzyme UBE2Z/USE1, which contributes to USE1 ubiquitin loading by the El ubiquitin activating enzyme, UBA6.
  • the present inventors identified a domain in UBA6 that recognizes polyalanine- containing proteins and demonstrate that, under disease conditions, UBA6 preferentially interacts with different polyalanine-expanded proteins, thereby competing with USEl binding.
  • similar effects were confirmed in neurons derived from patients with disease-causing polyalanine expansion mutations, thus suggesting a previously undescribed vulnerability caused by polyalanine expansion mutations.
  • a method of treating a subject having a disease associated with a polyalanine expansion mutation comprising administering to the subject a therapeutically effective amount of an agent capable of specifically upregulating expression or activity of a ubiquitin like modifier activating enzyme 6 (UBA6) in nervous system cells of the subject, thereby treating the subject.
  • UUA6 ubiquitin like modifier activating enzyme 6
  • UUA6 ubiquitin like modifier activating enzyme 6
  • treating refers to inhibiting, preventing or arresting the development of a pathology (disease, disorder or condition) and/or causing the reduction, remission, or regression of a pathology.
  • pathology disease, disorder or condition
  • Those of skill in the art will understand that various methodologies and assays can be used to assess the development of a pathology, and similarly, various methodologies and assays may be used to assess the reduction, remission or regression of a pathology.
  • treating is by rescuing neuronal cells from cell death that is associated with and/or caused by the polyalanine expansion mutation.
  • the therapeutically effective amount of the agent causes a rescue of the neuronal cells from the cell death associated with and/or caused by the polyalanine expansion mutation.
  • polyalanine refers to a tract of at least 4 consecutive alanine residues in a polypeptide.
  • the polyalanine tract comprises at least 5, at least 6, at least?, at least 8, at least 9, e.g., at least 10, or more consecutive alanine residues in a polypeptide.
  • polyalanine expansion mutation refers to an increase in the number of alanine residues comprised in a polyalanine tract of a polypeptide as compared to the number of alanine residues comprised in a polyalanine tract of a corresponding wild-type polypeptide.
  • WT wild- type
  • a “wild- type (WT)” form of a polypeptide-of-interest refers to a polypeptide encoded by a gene that predominates in a population of human beings, preferably in a population of healthy individuals of the same ethnic origin or genetic background.
  • the polypeptide with the polyalanine expansion mutation exhibits an identical amino acid sequence to the corresponding wild-type polypeptide, except for a change in the length of the polyalanine tract.
  • the level of identity between two amino acid sequences is determined typically by structure (identical amino acid or similar amino acid) and position in both the query and reference sequence, as determined by an alignment tool such as a global alignment tool, e.g., the EMBOSS - 6.0.1 Needleman- Wunsch algorithm using default parameters.
  • an alignment tool such as a global alignment tool, e.g., the EMBOSS - 6.0.1 Needleman- Wunsch algorithm using default parameters.
  • wild-type polypeptides comprise more than one polyalanine tract, e.g., they may comprise 2, 3, 4 or more polyalanine tracts.
  • more than one polyalanine tract a person skilled in the art can distinguish and unequivocally define each polyalanine tract based on its amino acid concrete position within the polypeptide, and/or by the specific adjacent amino acid sequences of the polyalanine tract.
  • ARX wild-type polypeptide GenBank Accession No.
  • NP_620689; SEQ ID NO: 14) comprises 4 polyalanine tracts at the following amino acid positions: (i) 100-115; (ii) 144-155; (iii) 275-281; and (iv) 432- 440, with respect to the wild-type polypeptide having the amino acid sequence set forth by SEQ ID NO: 14.
  • polyalanine expansion mutations occurring in polyalanine tracts are associated with Mental retardation, Epilepsy, West syndrome and Partington syndrome.
  • polyalanine expansion mutation is associated with a disease.
  • the disease is associated with neuronal death.
  • the disease is associated with death of neurons of the autonomic nervous system
  • neuronal death was demonstrated in neurons, which were differentiated from iPSCs, having the genomic polyalanine expansion mutation in the PH0X2B gene associated with CCHS ( Figures 4F, 4G, 14D).
  • a polyalanine expansion mutation which is associated with a disease, causes a change in the secondary and/or tertiary structure of the polypeptide.
  • the change in the secondary and/or tertiary structure of the polypeptide affects the normal polypeptide’s cellular localization and/or function.
  • the polyalanine expansion mutation can result in altered cellular localization, protein-protein interactions, cell signaling, post-translational modifications (e.g., ubiquitination), proliferation, differentiation, and/or growth as compared to the corresponding wild-type polypeptides.
  • post-translational modifications e.g., ubiquitination
  • nuclear polypeptides e.g., transcription factors
  • transcription factors which exhibit polyalanine expansion mutations
  • cytoplasm of the cell instead of the nucleus of the cell, and thus they are incapable of performing their normal function in the nucleus.
  • the polypeptide having the polyalanine expansion mutation has an aberrant cellular localization as compared to a corresponding wild-type polypeptide.
  • the polypeptide having the polyalanine expansion mutation is cytoplasmic.
  • a polyalanine tract in the polyalanine expansion mutation comprises at least one additional alanine residue as compared to a polyalanine tract of a corresponding wild-type polypeptide.
  • OPMD Oculopharyngeal muscular dystrophy
  • a polyalanine tract in the polyalanine expansion mutation comprises 1-14 additional alanine residues in the polyalanine tract as compared to number of alanine residues in the polyalanine tract of a corresponding wild-type polypeptide.
  • Table 1 hereinbelow provides a non-limiting description of polypeptides having polyalanine expansion mutations and the diseases associated with such expansion mutations.
  • the polyalanine expansion mutation has an autosomal dominant mode of inheritance.
  • polyalanine expansion mutations in FOXL2, ZIC2, PHOX2B, RUNX2, H0XA13 and H0XD13 as well as some of the polyalanine expansion mutations in PABPN1 (e.g.,
  • the mutation occurs de novo in the genome of the affected individual and is absent from the genome of the parents of the affected individual. This is usually the case in mutations causing severe life-threatening conditions.
  • the polyalanine expansion mutation occurs de novo.
  • the polyalanine expansion mutation has an autosomal recessive mode of inheritance.
  • some of the polyalanine expansion mutations in PABPN1 e.g., 10 Alanine residues — 11 Alanine residues
  • the polyalanine expansion mutation has an X-linked recessive mode of inheritance.
  • polyalanine expansion mutations in ARX and SOX3 exhibit an X-linked recessive mode of inheritance.
  • the polyalanine expansion mutation occurs in a polypeptide selected from the group consisting of a paired like homeobox 2B (PH0X2B), aristaless related homeobox (ARX), SRY-box transcription factor 3 (SOX3), Zic family member 2 (ZIC2), forkhead box L2 (FOXL2), RUNX family transcription factor 2 (RUNX2), homeobox Al 3 (H0XA13), homeobox D13 (H0XD13), and poly(A) binding protein nuclear 1 (PABPN1).
  • a polypeptide selected from the group consisting of a paired like homeobox 2B (PH0X2B), aristaless related homeobox (ARX), SRY-box transcription factor 3 (SOX3), Zic family member 2 (ZIC2), forkhead box L2 (FOXL2), RUNX family transcription factor 2 (RUNX2), homeobox Al 3 (H0XA13), homeobox D13 (H0XD13), and poly(A
  • the disease is congenital central hypoventilation syndrome (CCHS); X-linked cognitive disability and epilepsy, West syndrome, Partington syndrome; X-linked cognitive disability with growth hormone deficiency; Holoprosencephaly type 5 (HPE5); Blepharophimosis-epicanthus inversus syndactyly; cleidocranial dysplasia (CCD); Hand-foot-genital syndrome; synpolydactyly; or oculopharyngeal muscular dystrophy (OPMD).
  • CCHS congenital central hypoventilation syndrome
  • HPE5 Holoprosencephaly type 5
  • CCD cleidocranial dysplasia
  • OPMD oculopharyngeal muscular dystrophy
  • the method of some embodiments of the invention is effected by administering to the subject a therapeutically effective amount of an agent capable of specifically upregulating expression or activity of a ubiquitin like modifier activating enzyme 6 (UBA6) in nervous system cells of the subject.
  • UUA6 ubiquitin like modifier activating enzyme 6
  • UAA6 ubiquitin like modifier activating enzyme 6
  • E1-L2 E1-L2
  • MOP-4 MOP-4
  • UE1L2 UAA1
  • the human UBA6 polypeptide (GenBank Accession No. NP_060697.4, SEQ ID NO: 23) is encoded by a polynucleotide as set forth by SEQ ID NO: 24 (GenBank Accession No. NM_018227.6).
  • upregulating expression of UBA6 refers to increasing the level of the UBA6 polypeptide or the level of at least a functional portion thereof, which is capable of binding to USE1, e.g., which forms a complex with USEl.
  • upregulating activity of UBA6 refers to an El activity of UBA6 such as, without being bound by theory, increasing at least the ability of UBA6 to transfer ubiquitin molecule(s) to USEl.
  • UBE2Z ubiquitin conjugating enzyme E2 Z
  • UBE2Z ubiquitinates proteins which participate in signaling pathways and apoptosis.
  • Exemplary amino acid and nucleic acid sequences for USEl polypeptide and polynucleotide are provided in GenBank Accession Nos. NP_075567 (SEQ ID NO: 27), and NM_023079.5 (SEQ ID NO: 28).
  • the present inventors have identified a polyalanine motif in USE1 (amino acids 47-52 of SEQ ID NO: 27), which contributes to USE1 ubiquitin loading by UBA6 ( Figures 5B, IB, 1C, 6A, and 6B) and which is essential for ubiquitination of the target protein E6AP and the subsequent degradation thereof as is shown in Figure IE.
  • the functional portion of UBA6 comprises the SCCH domain of UBA6 (as set forth by SEQ ID NO: 25) or a functional homologous polypeptide thereof.
  • the phrase “functional homologue of SCCH”, refers to a polypeptide comprising an amino acid sequence having at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% global sequence identity to amino acids 1-267 of SEQ ID NO: 25, and which specifically binds to a USE1 polypeptide as set forth by SEQ ID NO: 27, or to a peptide consisting of a polyalanine tract of 7- alanine residues as set forth by SEQ ID NO: 22.
  • global sequence identity refers to an identity over the entire amino acid or nucleic acid sequences of the invention and not over portions thereof.
  • the degree of homology or identity between two or more sequences can be determined using various known sequence comparison tools. Following is a non- limiting description of such tools which can be used along with some embodiments of the invention .
  • the EMBOSS-6.0.1 Needleman- Wunsch algorithm (available from emboss(dot)sourceforge(dot)net/apps/cvs/emboss/apps/needle(dot)html) can be used to find the optimum alignment (including gaps) of two sequences along their entire length - a “Global alignment”.
  • the functional homologous polypeptide of UBA6 comprises lysine and arginine positively-charged amino acid residues at positions which correspond to the following amino acid positions in the wild-type UBA6 polypeptide (SEQ ID NO: 23): Lys628, Arg691, Lys714 and Lys709.
  • the agent upregulates expression level of the UBA6 polypeptide.
  • the agent is a polynucleotide encoding at least a functional portion of the UBA6 comprising the SCCH domain or a functional homologous polypeptide thereof.
  • SEQ ID NO: 26 is an exemplary polynucleotide which encodes the SCCH domain of UBA6.
  • the agent is a polypeptide comprising at least a functional portion of UBA6 comprising the SCCH domain or a functional homologous polypeptide thereof.
  • the agent is capable of rescuing neuronal cells from cell death.
  • an agent such as a UBA6 polypeptide was capable of rescuing neuronal cells from cell death which was associated with the polyalanine expansion mutation in CCHS ( Figures 4F, 4G, 14D).
  • Methods of qualifying agents for their ability to rescue cells (such as neuronal cells) from cell death include, for example, the TUNEE assay, which detects DNA fragmentation (e.g., using a TUNEL Assay Kit (e.g., Abeam, ab66108)) and an apoptosis assay, which detects cell surface exposure of phosphatidylserine using, e.g., the Annexin V-FETC apoptosis detection kit (e.g., Merck, CBA059).
  • TUNEE assay which detects DNA fragmentation (e.g., using a TUNEL Assay Kit (e.g., Abeam, ab66108))
  • an apoptosis assay which detects cell surface exposure of phosphatidylserine using, e.g., the Annexin V-FETC apoptosis detection kit (e.g., Merck, CBA059).
  • Polypeptides comprising at least a functional portion of UBA6 comprising the SCCH domain or a functional homologous polypeptide thereof can be chemically synthesized using well- known protein synthesis methods, which are further described hereinbelow.
  • polypeptides comprising at least a functional portion of UBA6 comprising the SCCH domain or a functional homologous polypeptide thereof can be recombinantly expressed from a polynucleotide comprising at least the nucleic acid sequence set forth in SEQ ID NO: 26, or a nucleic acid sequence encoding a functional homologous polypeptide thereof.
  • Suitable non-limiting polynucleotides include the nucleic acid sequences set forth by SEQ NO: 24 (UBA6 coding sequence) and/or SEQ ID NO: 26 (SCCH domain of UBA6 coding sequence).
  • tagged polypeptides such as those encoded by as SEQ ID NO: 61 (SCCH domain of UBA6 with His-Tag, coding sequence), SEQ ID NO: 66 (UBA6 with HA-tag, coding sequence) or SEQ ID NO: 68 (UBA6 with Hise-tag, coding sequence) can be used.
  • SEQ ID NO: 61 SCCH domain of UBA6 with His-Tag, coding sequence
  • SEQ ID NO: 66 UAA6 with HA-tag, coding sequence
  • SEQ ID NO: 68 UAA6 with Hise-tag, coding sequence
  • Upregulation of the UBA6 in a cell can be also achieved by means of gene therapy as is further described hereinbelow.
  • polynucleotide refers to a single or double stranded nucleic acid sequence which is isolated and provided in the form of an RNA sequence, a complementary polynucleotide sequence (cDNA), a genomic polynucleotide sequence and/or a composite polynucleotide sequences (e.g., a combination of the above).
  • isolated refers to at least partially separated from the natural environment e.g., from a human body or a cell.
  • the polynucleotide is an mRNA molecule.
  • the polynucleotide is comprised in a nucleic acid construct suitable for in-vivo delivery into nervous system cells of the subject.
  • Suitable nucleic acid constructs are provided hereinunder.
  • the present inventors show gene delivery of UBA6 using a lentiviral vector transduction of CCHS patient-derived neurons ( Figures 4F, 4G, and 141).
  • Qualifying the ability of the agent of some embodiments of the invention to upregulate expression or activity of UBA6 can be done by protein detection level (e.g., of UBA6) and/or activity assays (e.g., ubiquitination assays on target proteins; assessing stability of target proteins; and/or survival of neuronal cells).
  • protein detection level e.g., of UBA6
  • activity assays e.g., ubiquitination assays on target proteins; assessing stability of target proteins; and/or survival of neuronal cells.
  • Methods of detecting expression and/or activity of the polypeptides of some embodiments of the invention include, but are not limited to in-gel fluorescence assay (described in, e.g., han Attali et al., 2017. “Ubiquitylati on-dependent oligomerization regulates activity ofNedd4 ligases”. EMBO J.
  • Enzyme linked immunosorbent assay ELISA
  • Western blot analysis Radio-immunoassay (RIA); Fluorescence activated cell sorting (FACS); Immuno histochemical analysis; immunofluorescence analysis; in situ activity assay; and in vitro activity assays, all of which are well-known in the art.
  • RIA Radio-immunoassay
  • FACS Fluorescence activated cell sorting
  • in-gel fluorescence assay is based on detecting interactions between a fluorescently-labeled polypeptide with a non-labeled counterpart (e.g., a substrate or a polypeptide), and/or between polypeptides and a fluorescently-labeled substrate.
  • a fluorescently-labeled polypeptide with a non-labeled counterpart (e.g., a substrate or a polypeptide), and/or between polypeptides and a fluorescently-labeled substrate.
  • an in-gel fluorescence assay can employ a fluorescently-labeled ubiquitin molecule and/or a fluorescently-labeled enzyme of the ubiquitin cascade (e.g., El, E2 or E3).
  • the complexes can be resolved by SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) and be further visualized using a laser scanner at a suitable wavelength, e.g., Ubiquitin conjugates which are labeled with fluorescein can be visualized in a Typhoon laser scanner at 488 nm
  • SDS-PAGE sodium dodecyl sulfate-polyacrylamide gel electrophoresis
  • In situ activity assay According to this method, a chromogenic substrate is applied on the cells containing an active enzyme and the enzyme catalyzes a reaction in which the substrate is decomposed to produce a chromogenic product visible by a light or a fluorescent microscope.
  • In vitro activity assays In these methods the activity of a particular enzyme is measured in a protein mixture extracted from the cells. The activity can be measured in a spectrophotometer well using colorimetric methods or can be measured in a non- denaturing acrylamide gel (z.e., activity gel). Following electrophoresis the gel is soaked in a solution containing a substrate and colorimetric reagents. The resulting stained band corresponds to the enzymatic activity of the protein of interest. If well calibrated and within the linear range of response, the amount of enzyme present in the sample is proportional to the amount of color produced. An enzyme standard is generally employed to improve quantitative accuracy.
  • the agent upregulates activity of the UBA6 polypeptide.
  • Determination of the activity of UBA6 can be performed by ubiquitination assays which are well known in the art and which are further described hereinbelow.
  • the agent capable of specifically upregulating expression or activity of UBA6 stabilizes and/or increases the level of a complex formed between at least a functional portion of UBA6 comprising the SCCH domain and USE1.
  • Methods of detecting presence or level of a complex between at least a functional portion of UBA6 comprising the SCCH domain and USE1 include Western blot, immunoprecipitation analyses, Forster resonance energy transfer (FRET; reviewed e.g., in Bram Prevo et al., 2014. “Forster resonance energy transfer and kinesin motor proteins”; Chem Soc Rev 43(4): 1144-55, which is fully incorporated herein by reference in its entirety), fluorescence lifetime imaging microscopy (FUM; reviewed in Hellen C Ishikawa- Ankerhold et al., 2012. “Advanced fluorescence microscopy techniques--FRAP, FLIP, FEAP, FRET and FUM”.
  • microscale thermophoresis MST; described e.g., in Moran Jerabek- Willemsen 2012. “Molecular interaction studies using microscale thermophoresis”. Assay Drug Dev Technol. 9(4):342-53, which is fully incorporated herein by reference in its entirety), biophysical analysis of proteinprotein interactions (reviewed e.g., in Mahalakshmi Harish; et al. 2021. “Evolution of biophysical tools for quantitative protein interactions and drug discovery”. REVIEW ARTICLE. Emerging Topics in Life Science.
  • IP immunoprecipitation
  • polypeptides For generation of a complex which comprise UBA6 and USE1 in vitro these polypeptides are produced by recombinant techniques to include a detectable moiety such as hemagglutinin (HA), FLAG, GST, and/or a histidine tag (His6), which are identifiable by their respective antibodies.
  • a detectable moiety such as hemagglutinin (HA), FLAG, GST, and/or a histidine tag (His6), which are identifiable by their respective antibodies.
  • IP immunoprecipitation
  • the immunocomplexes are then washed with the IP buffer, and boiled (e.g., at 95°C for 5 minutes in Laemmli sample buffer containing 5% beta- mercaptoethanol) before being separated by SDS-PAGE for Western blotting assays.
  • the cells can be treated with a proteasome inhibitor MG132 (e.g., 10 pM) during the last 6 hours before lysis with the IP buffer supplemented with a protease inhibitor (e.g., 1 mM PMSF) and/or with a cysteine protease inhibitor such as iodoacetamide.
  • a proteasome inhibitor MG132 e.g. 10 pM
  • a protease inhibitor e.g., 1 mM PMSF
  • a cysteine protease inhibitor such as iodoacetamide.
  • the present inventors have uncovered that an agent which specifically upregulates the expression level or activity of UBA6 in cells of the nervous system can increase ubiquitination of a target protein of the UBA6-USE1 ubiquitination enzymes, e.g., E6AP (Example 6 of the Examples section which follows, and Figure 15), thus suggesting that such an agent can increase E6AP proteasome-mediated degradation.
  • E6AP ubiquitination of a target protein of the UBA6-USE1 ubiquitination enzymes
  • the agent is capable of increasing ubiquitination of a UBA6 target protein.
  • the UBA6 target protein is E6AP.
  • the agent is a peptide of 5-10 alanine residues.
  • an agent such as a 7-Alanine residue peptide can increase ubiquitination of a UBA6 target protein, e.g., E6AP ( Figure 15).
  • peptide encompasses native peptides (either degradation products, synthetically synthesized peptides or recombinant peptides) and peptidomimetics (typically, synthetically synthesized peptides), as well as peptoids and semipeptoids which are peptide analogs, which may have, for example, modifications rendering the peptides more stable while in a body or more capable of penetrating into cells. Such modifications include, but are not limited to N terminus modification, C terminus modification, peptide bond modification, backbone modifications, and residue modification. Methods for preparing peptidomimetic compounds are well known in the art and are specified, for example, in Quantitative Drug Design, C.A. Ramsden Gd., Chapter 17.2, F. Choplin Pergamon Press (1992), which is incorporated by reference as if fully set forth herein. Further details in this respect are provided hereinunder.
  • Natural aromatic amino acids, Trp, Tyr and Phe may be substituted by non-natural aromatic amino acids such as l,2,3,4-tetrahydroisoquinoline-3-carboxylic acid (Tic), naphthylalanine, ring- methylated derivatives of Phe, halogenated derivatives of Phe or O-methyl- Tyr.
  • the peptides of some embodiments of the invention may also include one or more modified amino acids or one or more non-amino acid monomers (e.g. fatty acids, complex carbohydrates etc.).
  • amino acid or “amino acids” is understood to include the 20 naturally occurring amino acids; those amino acids often modified post-translationally in vivo, including, for example, hydroxyproline, phosphoserine and phospho threonine; and other unusual amino acids including, but not limited to, 2-aminoadipic acid, hydroxylysine, isodesmosine, nor-valine, nor-leucine and ornithine.
  • amino acid includes both D- and L-amino acids.
  • Table 2 below lists non- conventional or modified amino acids (e.g., synthetic, Table 1) which can be used with some embodiments of the invention.
  • peptides of some embodiments of the invention are preferably utilized in a linear form, although it will be appreciated that in cases where cyclicization does not severely interfere with peptide characteristics, cyclic forms of the peptide can also be utilized.
  • peptides of some embodiments of the invention are preferably utilized in a linear form, although it will be appreciated that in cases where cyclicization does not severely interfere with peptide characteristics, cyclic forms of the peptide can also be utilized.
  • the agent is a peptide of 5-9 alanine residues.
  • the agent is a peptide of 5-8 alanine residues.
  • the agent is a peptide of 5-7 alanine residues.
  • Non-limiting exemplary peptide sequences are provided in SEQ ID NOs: 22, 29 and 30.
  • the agent is a peptide of 5-6 alanine residues.
  • the agent is a peptide of 5 alanine residues.
  • the peptide stabilizes the protein complex formed between the UBA6 and USE1.
  • the agent of some embodiments of the invention which is capable of specifically upregulating expression or activity of UBA6, and as such increases ubiquitination of E6AP, can be used to reduce the level of E6AP in a subject having autism spectrum disorders (ASDs) associated with abnormally high levels of E6AP.
  • ASDs autism spectrum disorders
  • a method of treating a subject diagnosed with autism spectrum disorders comprising administering to the subject a therapeutically effective amount of an agent capable of upregulating expression or activity of a ubiquitin like modifier activating enzyme 6 (UBA6) in nervous system cells of the subject, thereby treating the subject.
  • an agent capable of upregulating expression or activity of a ubiquitin like modifier activating enzyme 6 (UBA6) in nervous system cells of the subject, thereby treating the subject.
  • UUA6 ubiquitin like modifier activating enzyme 6
  • the ASD is associated with increased levels of E6AP in the nervous system cells.
  • Figure 15 demonstrates that a peptide of 7-alanine residues (SEQ ID NO: 22) can increase E6AP poly- ubiquitination.
  • the agent for treating the ASD is a peptide having a polyalanine tract of 5-10 alanine residues, e.g., having a polyalanine tract of 5-9 alanine residues, e.g., having a polyalanine tract of 5-8 alanine residues, e.g., having a polyalanine tract of 5-7 alanine residues, e.g., having a polyalanine tract of 5-6 alanine residues.
  • the agent for treating the ASD is a peptide having a polyalanine tract of 5-alanine residues.
  • the agent for treating ASD which is associated with increased levels of E6AP in the nervous system cells, is a peptide comprising an amino acid sequence consisted of SEQ ID NO: 29.
  • the agent for treating the ASD is a peptide having a polyalanine tract of 6-alanine residues.
  • the agent for treating ASD which is associated with increased levels of E6AP in the nervous system cells, is a peptide comprising an amino acid sequence consisted of SEQ ID NO: 30.
  • the agent for treating the ASD is a peptide having a polyalanine tract of 7 alanine residues.
  • the agent for treating ASD which is associated with increased levels of E6AP in the nervous system cells, is a peptide comprising an amino acid sequence consisted of SEQ ID NO: 22.
  • a method of increasing ubiquitination of an E6AP polypeptide in a cell comprising contacting the cell with a therapeutically effective amount of an agent capable of upregulating expression or activity of a ubiquitin like modifier activating enzyme 6 (UBA6) in the cell, thereby increasing the ubiquitination of the E6AP polypeptide in the cell.
  • UUA6 ubiquitin like modifier activating enzyme 6
  • contacting is effected ex vivo.
  • the cell is a nervous system cell.
  • the cell is of peripheral nervous system.
  • the cell is an autonomous neuron of the peripheral nervous system
  • the cell is obtained from a subject diagnosed with a disease characterized by abnormally high levels of an E6AP polypeptide.
  • the cell is obtained from a subject diagnosed with autism spectrum disorders (ASDs).
  • ASDs autism spectrum disorders
  • contacting is effected in vivo.
  • contacting of the agent with the cell is achieved by administering the agent to the subject in need thereof.
  • the subject is diagnosed with a disease characterized by abnormally high levels of an E6AP polypeptide.
  • the subject is diagnosed with autism spectrum disorders (ASDs).
  • ASDs autism spectrum disorders
  • a method of generating neurons with a polyalanine expansion mutation comprising subjecting induced pluripotent stem cells (iPSCs) which comprise a genomic polyalanine expansion mutation to culture conditions suitable for differentiating the iPSCs into neurons, thereby generating the neurons with the polyalanine expansion mutation.
  • iPSCs induced pluripotent stem cells
  • pluripotent stem cells refers to cells which can differentiate into all three embryonic germ layers, z.e., ectoderm, endoderm and mesoderm or remaining in an undifferentiated state.
  • the pluripotent stem cells include embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs).
  • iPSCs embryonic-like stem cells
  • pluripotent stem cells are cells obtained by de-differentiation of adult somatic cells, which are endowed with pluripotency (z.e., being capable of differentiating into the three embryonic germ cell layers, i.e., endoderm, ectoderm and mesoderm).
  • such cells are obtained from a differentiated tissue (e.g., a somatic tissue such as skin) and undergo de-differentiation by genetic manipulation which re-program the cell to acquire embryonic stem cells characteristics.
  • a differentiated tissue e.g., a somatic tissue such as skin
  • iPSCs can be obtained by retroviral transduction of somatic cells such as skin cells, fibroblasts, hepatocytes, gastric epithelial cells with transcription factors such as Oct-3/4, Sox2, c-Myc, and KEF4 [Yamanaka S, Cell Stem Cell. 2007, l(l):39-49; Aoi T, et al., Generation of Pluripotent Stem Cells from Adult Mouse Liver and Stomach Cells. Science. 2008 Feb 14. (Epub ahead of print); IH Park, Zhao R, West JA, et al. Reprogramming of human somatic cells to pluripotency with defined factors. Nature 2008;451: 141-146; K Takahashi, Tanabe K, Ohnuki M, et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 2007;131:861-872],
  • the induced pluripotent stem cells are formed by inducing the expression of Oct-4, Sox2, Kfl4 and c-Myc in a somatic stem cell.
  • the culture conditions are suitable for differentiating the iPSCs into peripheral autonomic neurons.
  • the iPSCs are generated by de- differentiation of a skin biopsy of a subject having the genomic polyalanine expansion mutation.
  • the genomic polyalanine expansion mutation is endogenous to the cells used to generate the iPSCs.
  • subjecting the iPSCs, which comprise a genomic polyalanine expansion mutation, to culture conditions suitable for differentiating the iPSCs into neurons comprises the steps of:
  • NMPs neuromesodermal progenitor cells
  • culturing in step (a) is performed for 2- 4 days, e.g., about 3 days.
  • the culture medium suitable for induction of iPSCs into neuromesodermal progenitor cells comprises glycogen synthase kinase 3 (GSK-3) inhibitor (e.g., CHIR 99021) and an ALK5 (activin receptor-like kinase 5) inhibitor (e.g., SB431542).
  • GSK-3 glycogen synthase kinase 3
  • ALK5 activin receptor-like kinase 5 inhibitor
  • the CHIR 99021 is provided at a concentration of 0.5-5 mM, e.g., about 1.5 mM.
  • the SB431542 is provided at a concentration ofl-100 pM, e.g., about 10 pM.
  • culturing in step (b) is performed for 6- 8 days, e.g., about 7 days.
  • the culture medium suitable for induction of NMPs into sympathetic neural crest comprises basic fibroblast growth factor (FGF2, bFGF), bone morphogenic protein 4 (BMP4) and retinoic acid (RA).
  • FGF2 basic fibroblast growth factor
  • BMP4 bone morphogenic protein 4
  • RA retinoic acid
  • the culture medium comprises Sonic hedgehog (SHH) instead of BMP4.
  • SHH Sonic hedgehog
  • the culture medium suitable for induction of NMPs into sympathetic neural crest comprises basic fibroblast growth factor (FGF2, bFGF), Sonic hedgehog (SHH) and retinoic acid (RA).
  • FGF2 basic fibroblast growth factor
  • SHH Sonic hedgehog
  • RA retinoic acid
  • the bFGF is provided at a concentration of 10-200 ng/ml, e.g., about 20 ng/ml.
  • the BMP4 is provided at a concentration of 10-200 ng/ml, e.g., about 50 ng/ml.
  • the SHH is provided at a concentration of 50-200 ng/ml, e.g., 100 ng/ml.
  • the retinoic acid (RA) is provided at a concentration of 10-1000 nM, e.g., about 100 nM.
  • culturing in step (c) is performed for 6- 8 days, e.g., about 7 days.
  • the culture medium suitable for induction of sympathetic neuroblast crest comprises basic fibroblast growth factor (FGF2, bFGF), bone morphogenic protein 4 (BMP4) and epidermal growth factor (EGF).
  • FGF2 basic fibroblast growth factor
  • BMP4 bone morphogenic protein 4
  • EGF epidermal growth factor
  • the culture medium suitable for induction of sympathetic neuroblast crest comprises basic fibroblast growth factor (FGF2, bFGF), Sonic hedgehog (SHH) and epidermal growth factor (EGF).
  • FGF2 basic fibroblast growth factor
  • SHH Sonic hedgehog
  • EGF epidermal growth factor
  • the EGF is provided at a concentration of 10-1000 ng/ml, e.g., about 20 ng/ml.
  • culturing in step (c) is performed for 12-16 days, e.g., about 14 days.
  • the culture medium suitable for induction of sympathetic neuronal maturation comprises nerve growth factor (NFG), glial cell derived neurotrophic factor (GDNF) and brain derived neurotrophic factor (BDNF).
  • nerve growth factor nerve growth factor
  • GDNF glial cell derived neurotrophic factor
  • BDNF brain derived neurotrophic factor
  • the iPSCs are separated to single cell suspensions (suspensions in which the cells are single cells and not cell clusters) using for example, a Versene solution (Gibco, 15040033), Accutase (StemPro, Thermofisher), TrypleE or trypsin.
  • a Versene solution Gibco, 15040033
  • Accutase StemPro, Thermofisher
  • TrypleE Trypsin.
  • Evaluation of differentiation into the neuronal cells is performed using immunocytochemistry or FACS analysis using the pan neuronal marker Tuj la, the dendritic marker MAP2ab, the peripheral neuronal marker Peripherin, the chemosensitive markers ATOH1 and PHOX2B, the sympathetic markers dopamine beta-hydroxylase (DBH) and/or Tyrosine hydroxylase (TH).
  • PSCs pluripotent stem cells
  • iPSCs induced pluripotent stem cells
  • the PSCs Prior to initiation of differentiation, the PSCs are cultured on MATRIGEL or mouse embryonic fibroblasts (MEFs) in a pluripotent stem cells culture medium such as Nutristem (Sartorius, 05- 100-1 A) or mTeSR/mTeSRl (Stemcell technologies), or knockout serum based ‘homebrewed’ medium preferably to a confluence of about 1 million cells/well.
  • a pluripotent stem cells culture medium such as Nutristem (Sartorius, 05- 100-1 A) or mTeSR/mTeSRl (Stemcell technologies), or knockout serum based ‘homebrewed’ medium preferably to a confluence of about 1 million cells/well.
  • the PSCs are washed with a phosphate buffered saline (PBS) and single cell suspensions are prepared (e.g., using Versene solution (Gibco, 15040033), Accutase (StemPro, Thermofisher), TrypleE or trypsin for about 2 minutes), and then the single cell PSCs are transferred to Poly-Hema (2-hydroxyethyl methacrylate)-coated flasks (e.g., T25 flasks) or commercially available low adherent flasks at a concentration of about 350,000 cells/ml.
  • the single cell PSCs are cultured in a neuromesodermal progenitor cell induction (NMP) medium for the formation of aggregates.
  • NMP neuromesodermal progenitor cell induction
  • the NMP medium comprises an Essential 6 medium (Gibco) or DMEM:F12 medium, and several inhibitors, such as CHIR 99021 (e.g., at a concentration of 0.5-5 mM, e.g., about 1.5 mM), SB431542 (e.g., at a concentration of 1-100 pM, e.g., about 10 pM), ROCK inhibitor (e.g., at a concentration of 1-20 pM, e.g., about 10 pM) and preferably also a Penicillin-Streptomycin-Amphotericin B solution (PSA, Sartorius).
  • PSA Penicillin-Streptomycin-Amphotericin B solution
  • the medium is replaced with sympathetic (NCi) neural crest induction medium containing an Essential 6 medium or DMEM:F12 medium, supplemented with CHIR 99021 (e.g., at a concentration of 0.5-5 mM, e.g., about 1.5 mM), bFGF (basic fibroblast growth factor) (e.g., at a concentration of 10-200 ng/ml, e.g., about 20 ng/ml), bone morphogenetic protein 4 (BMP4) or BMP2; at a concentration of 10-200 ng/ml, e.g., about 50 ng/ml), retinoic acid (e.g., all trans retinoic acid at a concentration of 10- 1000 nM, e.g., about 100 nM), and preferably also PSA.
  • CHIR 99021 e.g., at a concentration of 0.5-5 mM, e.g., about 1.5 mM
  • bFGF basic fibroblast
  • the culture is dissociated into single cells using Versene solution (Gibco, 15040033), Accutase (StemPro, Thermofisher), TrypleE or trypsin for about 2 minutes) (e.g., by incubation for about 4 minutes at 37°C), and the cells are cultured in sympathetic neuroblast induction and propagation (NCC) medium, comprising neurobasal medium or DMEM:F12, supplemented with bFGF (e.g., at a concentration of 10-1000 ng/ml, e.g., about 20 ng/ml), BMP4 or BMP2 (e.g., at a concentration of 10-200 ng/ml, e.g., about 50 ng/ml), EGF (epidermal growth factor) (e.g., at a concentration of 10-1000 ng/ml, e.g., about 20 ng/ml), heparin (e.g., at a concentration of 1-10 pg
  • NCC medium is replaced with NCC medium without ROCKi and half of the medium is replaced every other day.
  • medium is preferably replaced with sympathetic neuronal maturation medium (NMM medium) comprising neurobasal medium, B27, N2, GDNF (glial cell derived neurotrophic factor) (e.g., at a concentration of 1-100 ng/ml, e.g., about 10 ng/ml), BDNF (brain derived neurotrophic factor, e.g., at a concentration of 1-100 ng/ml, e.g., about 10 ng/ml), NGF (nerve growth factor; e.g., at a concentration of 1-100 ng/ml, e.g., about 10 ng/ml), GlutaMAX or glutamine, and preferably PSA.
  • NMM medium sympathetic neuronal maturation medium
  • GDNF glial cell derived neurotrophic factor
  • BDNF brain derived neurotrophic factor
  • NGF nerve growth factor
  • a method of screening for an agent capable of modulating expression or activity of a ubiquitin like modifier activating enzyme 6 comprising: (a) contacting neurons comprising a genomic polyalanine expansion mutation with a plurality of molecules,
  • the neurons are differentiated in vitro from induced pluripotent stem cells (iPSCs) comprising a genomic polyalanine expansion mutation.
  • iPSCs induced pluripotent stem cells
  • contacting is in the presence of a functional portion of the UBA6 comprising a second catalytic cysteine half (SCCH) domain or a functional homologous polypeptide thereof.
  • SCCH catalytic cysteine half
  • identifying the at least one molecule of the plurality of molecules which modulates the complex formed by the UBA6 and USE1 is effected by monitoring ubiquitination level of a target polypeptide.
  • the target polypeptide is E6AP.
  • Ubiquitin protein ligase E3A (UBE3A, also known as “E6-AP” or “E6AP”) is part of the ubiquitin protein degradation system, and interactions of UBE3A with the E6 protein of human papillomavirus types 16 and 18 are known to result in ubiquitination and proteolysis of tumor protein p53. Maternally inherited deletions or point mutations in UBE3A cause Angelman Syndrome. On the other hand, copy number variations (CNVs) that result in the overexpression of E6AP are strongly associated with the development of autism spectrum disorders (ASDs) (Khatri Natasha et al., 2019. Front Mol Neurosci. 12: 109).
  • ASDs autism spectrum disorders
  • NP_000453.2 SEQ ID NO: 31
  • NP_001341434.1 SEQ ID NO: 32
  • NP_001341435.1 SEQ ID NO: 33
  • NP_001341436.1 SEQ ID NO: 34
  • NP_001341437.1 SEQ ID NO: 35
  • NP_001341438.1 SEQ ID NO: 36
  • NP_001341440.1 SEQ ID NO: 37
  • NP_001341441.1 SEQ ID NO: 38
  • NP_001341442.1 SEQ ID NO: 39
  • NP_001341452.1 SEQ ID NO: 40
  • NP_001341455.1 SEQ ID NO: 41
  • NP_001341467.1 SEQ ID NO: 42
  • NP_001341468.1 SEQ ID NO: 43
  • the E6AP polypeptide which is used by the method, for monitoring ubiquitination level thereof is the polypeptide set forth by SEQ ID NO: 31.
  • tagged polypeptides can be used, such as HA-tagged E6AP isoform II as set forth by SEQ ID NO: 63 (e.g., encoded by SEQ ID NO: 64).
  • contacting is effected in vivo.
  • contacting is effected ex vivo.
  • the cell is a nervous system cell.
  • modulating is upregulating the expression or activity of the UBA6 in a cell, such as a cell of the nervous system
  • modulating is downregulating the expression or activity of the UBA6 in in a cell, such as a cell of the nervous system
  • the method further comprising synthesizing the identified agent.
  • the identified agent which is capable of upregulating the expression or activity of the UBA6 in a cell (e.g., in a cell of the nervous system) is used for treating a disorder of the autism spectrum disorders (ASDs) associated with abnormally high levels of the E6AP in neuronal cells of the subject.
  • ASDs autism spectrum disorders
  • the identified agent which is capable of downregulating the expression or activity of the UBA6 in a cell (e.g., in a cell of the nervous system), can be used for treating a disorder associated with abnormally low levels of the E6AP in neuronal cells of the subject (such as Angelman syndrome that is caused by loss of function of E6AP).
  • An agent capable of upregulating expression of a UBA6 may be an exogenous polynucleotide sequence designed and constructed to express UBA6 or at least a functional portion thereof comprising the SCCH domain as described hereinabove. Accordingly, the exogenous polynucleotide sequence may be a DNA or RNA sequence encoding UB A6 or at least a functional portion thereof comprising the SCCH domain, capable of binding to USE1 and/or increasing the ability of UBA6 to transfer ubiquitin molecule(s) to USEl.
  • a polynucleotide sequence encoding a UBA6 (GenBank Accession number NP_060697.4 (SEQ ID NO: 23)) or at least a functional portion thereof comprising the SCCH domain (SEQ ID NO: 25) is preferably ligated into a nucleic acid construct suitable for mammalian cell expression.
  • a nucleic acid construct includes a promoter sequence for directing transcription of the polynucleotide sequence in the cell in a constitutive or inducible manner.
  • nucleic acid construct of some embodiments of the invention can also utilize UBA6 homologues which exhibit the desired activity (such as binding to USE1 , and/or increasing ability of UBA6 to transfer ubiquitin molecule(s) to USE1).
  • Such homologues may exhibit, for example, at least 60%, at least 65%, at least 70%, at least 75%, at least 80 %, at least 81 % , at least 82 % , at least 83 % , at least 84 % , at least 85 % , at least 86 % , at least 87 % , at least 88 %, at least 89 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100 % sequence identity (e.g., global sequence identity) to SEQ ID NO:23 or 26, as determined using the BestFit software of the Wisconsin sequence analysis package, utilizing the Smith and Waterman algorithm, where gap weight equals 50, length weight equals 3, average match equals 10 and average mismatch equals -9.
  • sequence identity e.g.,
  • Constitutive promoters suitable for use with some embodiments of the invention are promoter sequences which are active under most environmental conditions and most types of cells such as the cytomegalovirus (CMV) and Rous sarcoma virus (RSV).
  • Inducible promoters suitable for use with some embodiments of the invention include for example inducible promoters such as the tetracycline- inducible promoter (Zabala M, et al., Cancer Res. 2004, 64(8): 2799-804).
  • the promoter is a cytomegalovirus (CMV).
  • CMV cytomegalovirus
  • the nucleic acid construct (also referred to herein as an "expression vector") of some embodiments of the invention includes additional sequences which render this vector suitable for replication and integration in prokaryotes, eukaryotes, or preferably both (e.g., shuttle vectors).
  • a typical cloning vectors may also contain a transcription and translation initiation sequence, transcription and translation terminator and a polyadenylation signal.
  • such constructs will typically include a 5' LTR, a tRNA binding site, a packaging signal, an origin of second-strand DNA synthesis, and a 3' LTR or a portion thereof.
  • the nucleic acid construct of some embodiments of the invention typically includes a signal sequence for secretion of the peptide from a host cell in which it is placed.
  • the signal sequence for this purpose is a mammalian signal sequence or the signal sequence of the polypeptide variants of some embodiments of the invention.
  • Eukaryotic promoters typically contain two types of recognition sequences, the TATA box and upstream promoter elements.
  • the TATA box located 25-30 base pairs upstream of the transcription initiation site, is thought to be involved in directing RNA polymerase to begin RNA synthesis.
  • the other upstream promoter elements determine the rate at which transcription is initiated.
  • the promoter utilized by the nucleic acid construct of some embodiments of the invention is active in the specific cell population transformed.
  • neuron- specific promoters include the neurofilament promoter [Byrne et al. (1989) Proc. Natl. Acad. Sci. USA 86:5473-5477], human Synapsin I promoter (Thiel G., et al., 1991; Proc Natl Acad Sci USA 88(8):3431-5), human calmodulin- dependent kinase (CaMKII) promoter (Joana E Coelho et al., 2014. Front Psychiatry. 5:67), and Nestin promoter (Hirokazu Kambara 2005; Cancer Res. 65(7):2832-9).
  • Enhancer elements can stimulate transcription up to 1,000 fold from linked homologous or heterologous promoters. Enhancers are active when placed downstream or upstream from the transcription initiation site. Many enhancer elements derived from viruses have a broad host range and are active in a variety of tissues. For example, the SV40 early gene enhancer is suitable for many cell types. Other enhancer/promoter combinations that are suitable for some embodiments of the invention include those derived from polyoma virus, human or murine cytomegalovirus (CMV), the long-term repeat from various retroviruses such as murine leukemia virus, murine or Rous sarcoma virus and HIV. See, Enhancers and Eukaryotic Expression, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. 1983, which is incorporated herein by reference.
  • CMV cytomegalovirus
  • the promoter is preferably positioned approximately the same distance from the heterologous transcription start site as it is from the transcription start site in its natural setting. As is known in the art, however, some variation in this distance can be accommodated without loss of promoter function .
  • Polyadenylation sequences can also be added to the expression vector in order to increase the efficiency of UBA6 mRNA translation.
  • Two distinct sequence elements are required for accurate and efficient polyadenylation: GU or U rich sequences located downstream from the polyadenylation site and a highly conserved sequence of six nucleotides, AAUAAA, located 11- 30 nucleotides upstream.
  • Termination and polyadenylation signals that are suitable for some embodiments of the invention include those derived from SV40 .
  • the expression vector of some embodiments of the invention may typically contain other specialized elements intended to increase the level of expression of cloned nucleic acids or to facilitate the identification of cells that carry the recombinant DNA.
  • a number of animal viruses contain DNA sequences that promote the extra chromosomal replication of the viral genome in permissive cell types. Plasmids bearing these viral replicons are replicated episomally as long as the appropriate factors are provided by genes either carried on the plasmid or with the genome of the host cell .
  • the vector may or may not include a eukaryotic replicon. If a eukaryotic replicon is present, then the vector is amplifiable in eukaryotic cells using the appropriate selectable marker. If the vector does not comprise a eukaryotic replicon, no episomal amplification is possible. Instead, the recombinant DNA integrates into the genome of the engineered cell, where the promoter directs expression of the desired nucleic acid.
  • the expression vector of some embodiments of the invention can further include additional polynucleotide sequences that allow, for example, the translation of several proteins from a single mRNA such as an internal ribosome entry site (IRES) and sequences for genomic integration of the promoter- chimeric polypeptide.
  • IRS internal ribosome entry site
  • nucleic acids by viral infection offers several advantages over other methods such as lipofection and electroporation, since higher transfection efficiency can be obtained due to the infectious nature of viruses .
  • enhancer elements, promoters and the like, and even the polynucleotide sequence(s) encoding a UBA6 can be arranged in a "head-to- tail" configuration, may be present as an inverted complement, or in a complementary configuration, as an anti-parallel strand.
  • mammalian expression vectors include, but are not limited to, pcDNA3, pcDNA3.1 (+/-), pGL3, pZeoSV2(+/-), pSecTag2, pDisplay, pEF/myc/cyto, pCMV/myc/cyto, pCR3.1, pSinRep5, DH26S, DHBB, pNMTl, pNMT41, pNMT81, which are available from Invitrogen, pCI which is available from Promega, pMbac, pPbac,pBK-RSV and pBK-CMV which are available from Strategene, pTRES which is available from Clontech, and their derivatives.
  • Expression vectors containing regulatory elements from eukaryotic viruses such as retroviruses can be also used.
  • SV40 vectors include pSVT7 and pMT2.
  • Vectors derived from bovine papilloma virus include pB V- 1MTHA, and vectors derived from Epstein Bar virus include pHEBO, and p2O5.
  • exemplary vectors include pMSG, pAV009/A+, pMTO10/A+, pMAMneo-5, baculovirus pDSVE, and any other vector allowing expression of proteins under the direction of the SV-40 early promoter, SV-40 later promoter, metallothionein promoter, murine mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters shown effective for expression in eukaryotic cells.
  • nucleic acid transfer techniques include transfection with viral or non- viral constructs, such as adenovirus, lentivirus, Herpes simplex I virus, or adeno-associated virus (AAV), naked polynucleotides (e.g., naked DNA or naked mRNA) and lipid-based systems .
  • viral or non- viral constructs such as adenovirus, lentivirus, Herpes simplex I virus, or adeno-associated virus (AAV), naked polynucleotides (e.g., naked DNA or naked mRNA) and lipid-based systems .
  • the nucleic acid construct is encapsulated in a particle (e.g., a viral particle, a lipid-based particle).
  • a particle e.g., a viral particle, a lipid-based particle.
  • viruses are very specialized infectious agents that have evolved, in many cases, to elude host defense mechanisms.
  • viruses infect and propagate in specific cell types.
  • the targeting specificity of viral vectors utilizes its natural specificity to specifically target predetermined cell types and thereby introduce a recombinant gene into the infected cell.
  • the type of vector used by some embodiments of the invention will depend on the cell type transformed. The ability to select suitable vectors according to the cell type transformed is well within the capabilities of the ordinary skilled artisan and as such no general description of selection consideration is provided herein.
  • Recombinant viral vectors are useful for in vivo expression of UBA6 since they offer advantages such as lateral infection and targeting specificity.
  • Lateral infection is inherent in the life cycle of, for example, retrovirus and is the process by which a single infected cell produces many progeny virions that bud off and infect neighboring cells. The result is that a large area becomes rapidly infected, most of which was not initially infected by the original viral particles. This is in contrast to vertical-type of infection in which the infectious agent spreads only through daughter progeny.
  • Viral vectors can also be produced that are unable to spread laterally. This characteristic can be useful if the desired purpose is to introduce a specified gene into only a localized number of targeted cells .
  • Viral vectors offer several advantages including higher efficiency of transformation, and targeting to, and propagation in, specific cell types. Viral vectors can also be modified with specific receptors or ligands to alter target specificity through specific cell receptors, such as neuronal cell receptors (for example, refer to Kaspar BK. et al., 2002. Mol Ther. 5:50-6).
  • Non-limiting examples of viral vectors which can be used include, adenoviruses, the recombinant adeno-associated virus 2 (AAV), SV40-based [Kimchi-Sarfaty C, and Gottesman MM, 2004, Curr. Pharm Biotechnol.
  • retroviruses such as Molony murine leukemia virus (Mo-MuLV); and lentiviruses [Amado RG, Chen IS., 1999, Science. 285: 674-6].
  • the most preferred constructs for use in gene therapy are viruses, most preferably adenoviruses, AAV, lentiviruses, or retroviruses.
  • a viral construct such as a retroviral construct includes at least one transcriptional promoter/enhancer or locus-defining elements), or other elements that control gene expression by other means such as alternate splicing, nuclear RNA export, or post-translational modification of messenger.
  • Such vector constructs also include a packaging signal, long terminal repeats (LTRs) or portions thereof, and positive and negative strand primer binding sites appropriate to the virus used, unless it is already present in the viral construct.
  • LTRs long terminal repeats
  • such a construct typically includes a signal sequence for secretion of the peptide from a host cell in which it is placed.
  • the signal sequence for this purpose is a mammalian signal sequence or the signal sequence of the polypeptide variants of some embodiments of the invention.
  • the construct may also include a signal that directs polyadenylation, as well as one or more restriction sites and a translation termination sequence.
  • a signal that directs polyadenylation will typically include a 5' LTR, a tRNA binding site, a packaging signal, an origin of second-strand DNA synthesis, and a 3' LTR or a portion thereof.
  • Other vectors can be used that are non-viral, such as cationic lipids, polylysine, and dendrimers.
  • Retroviral vectors represent one class of vectors suitable for use with some embodiments of the invention.
  • Defective retroviruses are routinely used in transfer of genes into mammalian cells [reviewed in Miller, A.D. Blood 76: 271 (1990)].
  • a recombinant retrovirus including a polynucleotide encoding UBA6 of some embodiments of the invention can be constructed using well known molecular techniques. Portions of the retroviral genome can be removed to render the retrovirus replication defective and the replication defective retrovirus can then packaged into virions, which can be used to infect target cells through the use of a helper virus and while employing standard techniques.
  • Retroviruses have been used to introduce a variety of genes into many different cell types, including neuronal cells, epithelial cells endothelial cells, lymphocytes, myoblasts, hepatocytes and bone marrow cells.
  • Another suitable expression vector may be an adenovirus vector.
  • the adenovirus is an extensively studied and routinely used gene transfer vector. Key advantages of an adenovirus vector include relatively high transduction efficiency of dividing and quiescent cells, natural tropism to a wide range of epithelial tissues and easy production of high titers [Russel, W.C. [J. Gen. Virol. 81: 57-63 (2000)].
  • the adenovirus DNA is transported to the nucleus, but does not integrate thereinto. Thus the risk of mutagenesis with adenoviral vectors is minimized, while short term expression may be suitable.
  • a suitable viral expression vector may also be a chimeric adenovirus/retrovirus vector which combines retroviral and adenoviral components. Such vectors may be more efficient than traditional expression vectors for transducing tumor cells [Pan et al., Cancer Letters 184: 179-188 (2002)].
  • a specific example of a suitable viral vector for introducing and expressing the polynucleotide sequence of some embodiments of the invention in an individual is the adenovirus- derived vector Ad-TK.
  • Ad-TK adenovirus- derived vector expresses a herpes virus thymidine kinase (TK) gene for either positive or negative selection and includes an expression cassette for desired recombinant sequences.
  • TK herpes virus thymidine kinase
  • This vector can be used to infect cells that have an adenovirus receptor which includes most cancers of epithelial origin (Sandmair et al., 2000. Hum Gene Ther. 11:2197-2205).
  • Secretion signals generally contain a short sequence (7-20 residues) of hydrophobic amino acids. Secretion signals are widely available and are well known in the art, refer, for example to von Heijne [J. Mol. Biol. 184:99-105 (1985)] and Lej et al., [J. Bacteriol. 169: 4379 (1987)].
  • the recombinant vector can be administered in several ways. If viral vectors are used the procedure can take advantage of their target specificity and consequently, such vectors do not have to be administered locally. However, local administration can provide a quicker and more effective treatment. Administration of viral vectors can also be performed by, for example, intravenous or subcutaneous injection into a subject. Following injection, the viral vectors will circulate until they recognize host cells with appropriate target specificity for infection.
  • An agent capable of upregulating UBA6 or at least a functional portion thereof comprising the SCCH domain may be the mRNA molecule itself which encodes the UBA6 or at least a functional portion thereof comprising the SCCH domain.
  • mRNAs therapies are advantageous as they utilize a cell’ s translational machinery to code production of the desired protein in vivo, saving time and expense on purification procedures.
  • Methods of stabilizing mRNA include modulation of the length of the polyadenine tail found at the 3” end of the mRNA transcript.
  • the mRNA cap found at the molecule’s 5’ end can be modified.
  • the naturally occurring cap structure typical in mammalian cells has a tendency to be improperly incorporated into mRNAs synthesized in vitro, rendering them less effective.
  • Synthetic “anti-reverse cap analogs” e.g. those commercially available at Thermo Fisher Scientific) can prevent this misincorporation, which results in more stable mRNA with improved translational efficiency.
  • substitution of particular nucleotides can be exchanged with chemically modified alternatives such as 5-methylcytosine or pseudoruidine. Such substitutions can mute the immune response whilst also bolstering the stability of the mRNA and efficiency of translation.
  • chemically modified nucleotides are described herein above.
  • particular nucleotides can be incorporated into the mRNA to increase immunogenicity. This may be particularly relevant for vaccine therapy.
  • the mRNA may be encapsulated in lipid-based particles to enhance fusion with the lipid cell membrane.
  • Naked DNA e.g., naked plasmid DNA (pDNA)
  • pDNA naked plasmid DNA
  • pDNA naked plasmid DNA
  • naked UBA6 DNA can be introduced by intravascular and electroporation techniques as described in Wolff JA, Budker V, 2005, Adv. Genet. 54: 3-20.
  • naked UBA6 DNA can be administered in vivo by jet injection essentially as described in Walther W, et al., 2004, Mol. Biotechnol. 28: 121-8.
  • naked UBA6 DNA can be administered into epidermis cells via DNA-coated gold particles as described in Dean HJ, 2005, Expert Opin Drug Deliv. 2: 227-36. Still alternatively, naked UBA6 DNA can be administered to cells via cavitation bubbles which induce transient membrane permeabilization (sonoporation) on a single cell level [using low frequency sonication (kilohertz frequencies), lithotripter shockwaves, HIFU, and even diagnostic ultrasound (megahertz frequencies)]. Cavitation initiation and control can be enhanced by cavitation nucleation agents, such as an ultrasound contrast agent [for further details see Miller DL, et al., 2002, Somat Cell Mol. Genet. 27: 115-34; using e.g., the Sonitron 2000 sonoporation system (Sonidel Limited, Dublin, Republic Ireland).
  • an ultrasound contrast agent for further details see Miller DL, et al., 2002, Somat Cell Mol. Genet. 27: 115-34; using e.
  • Liposome delivery system - Liposomes can be used for in vivo delivery of UBA6 polynucleotides to target cells.
  • the cationic lipid formulation 3 beta [N-(N',N'- Dimethylaminoethane)-Carbamoyl] Cholesterol (DC-Chol) is a non-viral delivery agent which can be used to target of UBA6 or at least a functional portion thereof into cells of interest (e.g., cells of the nervous system).
  • the UBA6 liposomes can be administered directly into the cells of the nervous system or can be administered intravenously and be directed to the cells-of-interest using a cell specific recognition moiety such as a ligand, antibody or receptor capable of specifically binding to the cell-of-interest. Additionally or alternatively, targeting of the liposome to specific cells can be performed by antibodies essentially as described in Dass CR. and Choong PF, J Control Release. 2006 May 9; [Epub ahead of print].
  • the polypeptide can be produced by recombinant means.
  • the polynucleotide of some embodiments of the invention can be introduced into cells by any one of a variety of known methods within the art.
  • the expression construct of some embodiments of the invention can also include sequences engineered to enhance stability, production, purification, yield or toxicity of the expressed peptide.
  • the expression of a fusion protein or a cleavable fusion protein comprising the UBA6 protein of some embodiments of the invention and a heterologous protein can be engineered.
  • Such a fusion protein can be designed so that the fusion protein can be readily isolated by affinity chromatography; e.g., by immobilization on a column specific for the heterologous protein.
  • the UBA6 protein can be released from the chromatographic column by treatment with an appropriate enzyme or agent that disrupts the cleavage site [e.g., see Booth et al. (1988) Immunol. Lett. 19:65-70; and Gardella et al., (1990) J. Biol. Chem 265: 15854-15859].
  • prokaryotic or eukaryotic cells can be used as hostexpression systems to express the polypeptides of some embodiments of the invention.
  • hostexpression systems include, but are not limited to, microorganisms, such as bacteria transformed with a recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vector containing the coding sequence; yeast transformed with recombinant yeast expression vectors containing the coding sequence; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors, such as Ti plasmid, containing the coding sequence.
  • Mammalian expression systems can also be used to express the polypeptides of some embodiments of the invention .
  • polypeptides of some embodiments of the invention can be purified using a variety of standard protein purification techniques, such as, but not limited to, affinity chromatography, ion exchange chromatography, filtration, electrophoresis, hydrophobic interaction chromatography, gel filtration chromatography, reverse phase chromatography, concanavalin A chromatography, chromatofocusing and differential solubilization.
  • standard protein purification techniques such as, but not limited to, affinity chromatography, ion exchange chromatography, filtration, electrophoresis, hydrophobic interaction chromatography, gel filtration chromatography, reverse phase chromatography, concanavalin A chromatography, chromatofocusing and differential solubilization.
  • polypeptide or the peptide of some embodiments of the invention may be synthesized by any techniques that are known to those skilled in the art of peptide synthesis.
  • solid phase peptide synthesis a summary of the many techniques may be found in J. M. Stewart and J. D. Young, Solid Phase Peptide Synthesis, W. H. Freeman Co. (San Francisco), 1963 and J. Meienhofer, Hormonal Proteins and Peptides, vol. 2, p. 46, Academic Press (New York), 1973.
  • For classical solution synthesis see G. Schroder and K. Lupke, The Peptides, vol. 1, Academic Press (New York), 1965.
  • these methods comprise the sequential addition of one or more amino acids or suitably protected amino acids to a growing peptide chain.
  • amino acids or suitably protected amino acids Normally, either the amino or carboxyl group of the first amino acid is protected by a suitable protecting group.
  • the protected or derivatized amino acid can then either be attached to an inert solid support or utilized in solution by adding the next amino acid in the sequence having the complimentary (amino or carboxyl) group suitably protected, under conditions suitable for forming the amide linkage.
  • the protecting group is then removed from this newly added amino acid residue and the next amino acid (suitably protected) is then added, and so forth. After all the desired amino acids have been linked in the proper sequence, any remaining protecting groups (and any solid support) are removed sequentially or concurrently, to afford the final peptide compound.
  • a preferred method of preparing the peptide compounds of some embodiments of the invention involves solid phase peptide synthesis.
  • the agent which is capable of specifically upregulating expression or activity of UBA6 of some embodiments of the invention can be administered to an organism per se, or in a pharmaceutical composition where it is mixed with suitable carriers or excipients.
  • a "pharmaceutical composition” refers to a preparation of one or more of the active ingredients described herein with other chemical components such as physiologically suitable carriers and excipients.
  • the purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism.
  • active ingredient refers to the agent which is capable of specifically upregulating expression or activity of UBA6 in a cell accountable for the biological effect.
  • physiologically acceptable carrier and “pharmaceutically acceptable carrier” which may be interchangeably used refer to a carrier or a diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound.
  • An adjuvant is included under these phrases.
  • excipient refers to an inert substance added to a pharmaceutical composition to further facilitate administration of an active ingredient.
  • excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols.
  • Suitable routes of administration may, for example, include oral, rectal, transmucosal, especially transnasal, intestinal or parenteral delivery, including intramuscular, subcutaneous and intramedullary injections as well as intrathecal, direct intraventricular, intracardiac, e.g., into the right or left ventricular cavity, into the common coronary artery, intravenous, inrtaperitoneal, intranasal, or intraocular injections.
  • neurosurgical strategies e.g., intracerebral injection or intracerebroventricular infusion
  • molecular manipulation of the agent e.g., production of a chimeric fusion protein that comprises a transport peptide that has an affinity for an endothelial cell surface molecule in combination with an agent that is itself incapable of crossing the BBB
  • pharmacological strategies designed to increase the lipid solubility of an agent (e.g., conjugation of water-soluble agents to lipid or cholesterol carriers)
  • the transitory disruption of the integrity of the BBB by hyperosmotic disruption resulting from the infusion of a mannitol solution into the carotid artery or the use of a biologically active agent such as an angiotensin peptide).
  • each of these strategies has limitations, such as the inherent risks associated with an invasive surgical procedure, a size limitation imposed by a limitation inherent in the endogenous transport systems, potentially undesirable biological side effects associated with the systemic administration of a chimeric molecule comprised of a carrier motif that could be active outside of the CNS, and the possible risk of brain damage within regions of the brain where the BBB is disrupted, which renders it a suboptimal delivery method.
  • tissue refers to part of an organism consisting of cells designed to perform a function or functions. Examples include, but are not limited to, brain tissue, retina, skin tissue, hepatic tissue, pancreatic tissue, bone, cartilage, connective tissue, blood tissue, muscle tissue, cardiac tissue brain tissue, vascular tissue, renal tissue, pulmonary tissue, gonadal tissue, hematopoietic tissue.
  • compositions of some embodiments of the invention may be manufactured by processes well known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee- making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.
  • compositions for use in accordance with some embodiments of the invention thus may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into preparations which, can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.
  • the active ingredients of the pharmaceutical composition may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank’s solution, Ringer’s solution, or physiological salt buffer.
  • physiologically compatible buffers such as Hank’s solution, Ringer’s solution, or physiological salt buffer.
  • penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
  • the pharmaceutical composition can be formulated readily by combining the active compounds with pharmaceutically acceptable carriers well known in the art. Such carriers enable the pharmaceutical composition to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for oral ingestion by a patient.
  • Pharmacological preparations for oral use can be made using a solid excipient, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries if desired, to obtain tablets or dragee cores.
  • Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carbomethylcellulose; and/or physiologically acceptable polymers such as polyvinylpyrrolidone (PVP).
  • disintegrating agents may be added, such as cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.
  • Dragee cores are provided with suitable coatings.
  • suitable coatings For this purpose, concentrated sugar solutions may be used which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, titanium dioxide, lacquer solutions and suitable organic solvents or solvent mixtures.
  • Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.
  • compositions which can be used orally include push-fit capsules made of gelatin as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol.
  • the push-fit capsules may contain the active ingredients in admixture with filler such as lactose, binders such as starches, lubricants such as talc or magnesium stearate and, optionally, stabilizers.
  • the active ingredients may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols.
  • stabilizers may be added. All formulations for oral administration should be in dosages suitable for the chosen route of administration.
  • compositions may take the form of tablets or lozenges formulated in conventional manner.
  • the active ingredients for use according to some embodiments of the invention are conveniently delivered in the form of an aerosol spray presentation from a pressurized pack or a nebulizer with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro-tetrafluoroethane or carbon dioxide.
  • a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro-tetrafluoroethane or carbon dioxide.
  • the dosage unit may be determined by providing a valve to deliver a metered amount.
  • Capsules and cartridges of, e.g., gelatin for use in a dispenser may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
  • compositions described herein may be formulated for parenteral administration, e.g., by bolus injection or continuous infusion.
  • Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multidose containers with optionally, an added preservative.
  • the compositions may be suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • compositions for parenteral administration include aqueous solutions of the active preparation in water-soluble form
  • suspensions of the active ingredients may be prepared as appropriate oily or water based injection suspensions.
  • Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acids esters such as ethyl oleate, triglycerides or liposomes.
  • Aqueous injection suspensions may contain substances, which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol or dextran.
  • the suspension may also contain suitable stabilizers or agents which increase the solubility of the active ingredients to allow for the preparation of highly concentrated solutions.
  • the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile, pyrogen- free water based solution, before use.
  • a suitable vehicle e.g., sterile, pyrogen- free water based solution
  • compositions of some embodiments of the invention may also be formulated in rectal compositions such as suppositories or retention enemas, using, e.g., conventional suppository bases such as cocoa butter or other glycerides.
  • compositions suitable for use in context of some embodiments of the invention include compositions wherein the active ingredients are contained in an amount effective to achieve the intended purpose. More specifically, a therapeutically effective amount means an amount of active ingredients (the agent which is capable of specifically upregulating expression or activity of UBA6 of some embodiments of the invention) effective to prevent, alleviate or ameliorate symptoms of a disorder (e.g., a disease associated with polyalanine expansion mutation, or autism spectrum disorders) or prolong the survival of the subject being treated.
  • a therapeutically effective amount means an amount of active ingredients (the agent which is capable of specifically upregulating expression or activity of UBA6 of some embodiments of the invention) effective to prevent, alleviate or ameliorate symptoms of a disorder (e.g., a disease associated with polyalanine expansion mutation, or autism spectrum disorders) or prolong the survival of the subject being treated.
  • the therapeutically effective amount or dose can be estimated initially from in vitro and cell culture assays.
  • a dose can be formulated in animal models to achieve a desired concentration or titer. Such information can be used to more accurately determine useful doses in humans.
  • Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals.
  • the data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in human.
  • the dosage may vary depending upon the dosage form employed and the route of administration utilized.
  • the exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See e.g., Fingl, et al., 1975, in "The Pharmacological Basis of Therapeutics", Ch. 1 P-l).
  • Dosage amount and interval may be adjusted individually to provide levels of the active ingredient in the nervous system cells which are sufficient to induce or suppress the biological effect (minimal effective concentration, MEC).
  • MEC minimum effective concentration
  • the MEC will vary for each preparation, but can be estimated from in vitro data. Dosages necessary to achieve the MEC will depend on individual characteristics and route of administration. Detection assays can be used to determine plasma concentrations.
  • dosing can be of a single or a plurality of administrations, with course of treatment lasting from several days to several weeks or until cure is effected or diminution of the disease state is achieved.
  • compositions to be administered will, of course, be dependent on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc.
  • compositions of some embodiments of the invention may, if desired, be presented in a pack or dispenser device, such as an FDA approved kit, which may contain one or more unit dosage forms containing the active ingredient.
  • the pack may, for example, comprise metal or plastic foil, such as a blister pack.
  • the pack or dispenser device may be accompanied by instructions for administration.
  • the pack or dispenser may also be accommodated by a notice associated with the container in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the compositions or human or veterinary administration.
  • Such notice for example, may be of labeling approved by the U.S. Food and Drug Administration for prescription drugs or of an approved product insert.
  • compositions comprising a preparation of the invention formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition, as is further detailed above.
  • antibody as used in this invention includes intact molecules as well as functional fragments thereof (that are capable of binding to an epitope of an antigen) .
  • epitopic determinants refers to any antigenic determinant on an antigen to which the paratope of an antibody binds.
  • Epitopic determinants usually consist of chemically active surface groupings of molecules such as amino acids or carbohydrate side chains and usually have specific three dimensional structural characteristics, as well as specific charge characteristics.
  • the antibody fragments include, but are not limited to, single chain, Fab, Fab’ and F(ab')2 fragments, Fd, Fcab, Fv, dsFv, scFvs, diabodies, minibodies, nanobodies, Fab expression library or single domain molecules such as VH and VE that are capable of binding to an epitope of the antigen in an HEA restricted manner.
  • Suitable antibody fragments for practicing some embodiments of the invention include a complementarity-determining region (CDR) of an immunoglobulin light chain (referred to herein as “light chain”), a complementarity-determining region of an immunoglobulin heavy chain (referred to herein as “heavy chain”), a variable region of a light chain, a variable region of a heavy chain, a light chain, a heavy chain, an Fd fragment, and antibody fragments comprising essentially whole variable regions of both light and heavy chains such as an Fv, a single chain Fv (scFv), a disulfide-stabilized Fv (dsFv), an Fab, an Fab’, and an F(ab’)2, or antibody fragments comprising the Fc region of an antibody.
  • CDR complementarity-determining region
  • light chain referred to herein as “light chain”
  • heavy chain a complementarity-determining region of an immunoglobulin heavy chain
  • variable region of a light chain a variable region of a heavy chain
  • antibodies for detection of the level of UBA6, USE1, E6AP, and/or ubiquitinated (or poly-ubiquitinated) forms thereof can be conjugated to a functional moiety such as a detectable moiety, and can be used in methods of some embodiments of the invention.
  • detectable or reporter moieties may be conjugated to the antibody of the invention. These include, but not are limited to, a radioactive isotope (such as [125] iodine), a phosphorescent chemical, a chemiluminescent chemical, a fluorescent chemical (fluorophore), an enzyme, a fluorescent polypeptide, an affinity tag, and molecules (contrast agents) detectable by Positron Emission Tomography (PET) or Magnetic Resonance Imaging (MRI).
  • a radioactive isotope such as [125] iodine
  • fluorophores examples include, but are not limited to, phycoerythrin (PE), fluorescein isothiocyanate (FETC), Cy-chrome, rhodamine, green fluorescent protein (GFP), blue fluorescent protein (BFP), Texas red, PE-Cy5, and the like.
  • PE phycoerythrin
  • FETC fluorescein isothiocyanate
  • Cy-chrome Cy-chrome
  • rhodamine green fluorescent protein
  • GFP green fluorescent protein
  • BFP blue fluorescent protein
  • Texas red PE-Cy5, and the like.
  • fluorophore selection methods of linking fluorophores to various types of molecules see Richard P. Haugland, “Molecular Probes: Handbook of Fluorescent Probes and Research Chemicals 1992- 1994”, 5th ed., Molecular Probes, Inc. (1994); U.S. Pat. No. 6,037,137 to Oncoimmunin Inc.; Hermanson, “Bioconjugate Techniques”, Academic Press New York, N
  • Fluorescence detection methods which can be used to detect the antibody when conjugated to a fluorescent detectable moiety include, for example, fluorescence activated flow cytometry (FACS), immunofluorescence confocal microscopy, fluorescence in-situ hybridization (FISH) and fluorescence resonance energy transfer (FRET).
  • FACS fluorescence activated flow cytometry
  • FISH fluorescence in-situ hybridization
  • FRET fluorescence resonance energy transfer
  • enzymes may be attached to the antibody of the invention [e.g., horseradish peroxidase (HPR), beta-galactosidase, and alkaline phosphatase (AP)] and detection of enzyme- conjugated antibodies can be performed using EEISA (e.g., in solution), enzyme-linked immunohistochemical assay (e.g., in a fixed tissue), enzyme-linked chemiluminescence assay (e.g., in an electrophoretic ally separated protein mixture) or other methods known in the art [see e.g., Khatkhatay MI. and Desai M., 1999. J Immunoassay 20: 151-83; wisdom GB., 1994. Methods Mol Biol.
  • HPR horseradish peroxidase
  • AP alkaline phosphatase
  • the affinity tag (or a member of a binding pair) can be an antigen identifiable by a corresponding antibody [e.g., digoxigenin (DIG) which is identified by an anti-DIG antibody) or a molecule having a high affinity towards the tag [e.g., streptavidin and biotin].
  • DIG digoxigenin
  • the antibody or the molecule which binds the affinity tag can be fluorescently labeled or conjugated to enzyme as described above.
  • a streptavidin or biotin molecule may be attached to the antibody of the invention via the recognition sequence of a biotin protein ligase (e.g., BirA) as described in the Examples section which follows and in Denkberg, G. et al., 2000. Eur. J. Immunol. 30:3522-3532.
  • a streptavidin molecule may be attached to an antibody fragment, such as a single chain Fv, essentially as described in Cloutier SM. et al. , 2000. Molecular Immunology 37: 1067-1077; Dubel S. et al., 1995.
  • Functional moieties such as fluorophores, conjugated to streptavidin are commercially available from essentially all major suppliers of immunofluorescence flow cytometry reagents (for example, Pharmingen or Becton- Dickinson).
  • the functional moiety e.g., the detectable moiety of the invention
  • the immunoconjugate may be produced by recombinant means.
  • a fluorescent protein e.g., green fluorescent protein (GFP), red fluorescent protein (RFP) or yellow fluorescent protein (YFP)
  • GFP green fluorescent protein
  • RFP red fluorescent protein
  • YFP yellow fluorescent protein
  • the functional moiety may be chemically synthesized by, for example, the stepwise addition of one or more amino acid residues in defined order such as solid phase peptide synthetic techniques.
  • a functional moiety may also be attached to the antibody of the invention using standard chemical synthesis techniques widely practiced in the art [see e.g., hypertexttransferprotocol://worldwideweb (dot) chemistry (dot) org/portal/Chemistry)], such as using any suitable chemical linkage, director indirect, as via a peptide bond (when the functional moiety is a polypeptide), or via covalent bonding to an intervening linker element, such as a linker peptide or other chemical moiety, such as an organic polymer.
  • standard chemical synthesis techniques widely practiced in the art [see e.g., hypertexttransferprotocol://worldwideweb (dot) chemistry (dot) org/portal/Chemistry)], such as using any suitable chemical linkage, director indirect, as via a peptide bond (when the functional moiety is a polypeptide), or via covalent bonding to an intervening linker element, such as a linker peptide or other chemical moiety,
  • Chimeric peptides may be linked via bonding at the carboxy (C) or amino (N) termini of the peptides, or via bonding to internal chemical groups such as straight, branched or cyclic side chains, internal carbon or nitrogen atoms, and the like.
  • Description of fluorescent labeling of antibodies is provided in details in U.S. Pat. Nos. 3,940,475, 4,289,747, and 4,376,110.
  • Exemplary methods for conjugating peptide moieties to the antibody of the invention include, but are not limited to SPDP conjugation (e.g., as described in Cumber et al. (1985, Methods of Enzymology 112: 207-224); glutaraldehyde conjugation (e.g., as described in G.T. Hermanson (1996, “Antibody Modification and Conjugation, in Bioconjugate Techniques, Academic Press, San Diego); carbodiimide conjugation [e.g., as describedin J. March, Advanced Organic Chemistry: Reaction's, Mechanism, and Structure, pp. 349-50 & 372-74 (3d ed.), 1985; B. Neises et al. (1978), Angew Chem, Int.
  • SPDP conjugation e.g., as described in Cumber et al. (1985, Methods of Enzymology 112: 207-224
  • glutaraldehyde conjugation e.g., as described in G.T
  • compositions, methods or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.
  • a compound or “at least one compound” may include a plurality of compounds, including mixtures thereof.
  • range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.
  • a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range.
  • the phrases “ranging/ranges between” a first indicate number and a second indicate number and “ranging/ranges from” a first indicate number “to” a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween.
  • method refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.
  • sequences that substantially correspond to its complementary sequence as including minor sequence variations, resulting from, e.g., sequencing errors, cloning errors, or other alterations resulting in base substitution, base deletion or base addition, provided that the frequency of such variations is less than 1 in 50 nucleotides, alternatively, less than 1 in 100 nucleotides, alternatively, less than 1 in 200 nucleotides, alternatively, less than 1 in 500 nucleotides, alternatively, less than 1 in 1000 nucleotides, alternatively, less than 1 in 5,000 nucleotides, alternatively, less than 1 in 10,000 nucleotides.
  • any Sequence Identification Number can refer to either a DNA sequence or a RNA sequence, depending on the context where that SEQ ID NO is mentioned, even if that SEQ ID NO is expressed only in a DNA sequence format or a RNA sequence format.
  • SEQ ID NO: 24 is expressed in a DNA sequence format (e.g., reciting T for thymine), but it can refer to either a DNA sequence that corresponds to an UBA6 nucleic acid sequence, or the RNA sequence of an RNA molecule nucleic acid sequence.
  • RNA sequence format e.g., reciting U for uracil
  • it can refer to either the sequence of a RNA molecule comprising a dsRNA, or the sequence of a DNA molecule that corresponds to the RNA sequence shown.
  • both DNA and RNA molecules having the sequences disclosed with any substitutes are envisioned.
  • the SCCH domains of UBA6 or UBA1 were constructed by introduction of PCR fragments containing amino acids 623-889 (UBA6) and 624-891 (UBA1) into plasmid pYB50 by Gibson assembly (lab collection).
  • UBA6 PCR fragments containing amino acids 623-889
  • UBA1 amino acids 624-891
  • UBA6 wild type and mutant UBA1 and UBA6 genes where subcloned into modified and improved vector pET28a 44 .
  • E2 USE1 (UBE2Z) expressing plasmids pcDNA3.1-His6-3xFlag-USEl was kindly provided by Dr. Annette Aichem
  • the putative Kozak sequence was first added to the USE1 gene, which was subcloned into pEGFP-Nl based plasmid resulting in plasmid pCMV-His6-3xFlag-USEl new Kozak used in this study.
  • the APolyAla region mutant where amino acids 47-56 of the USE1 gene were deleted, the 2A ⁇ 2R mutant where Alanine 49 and Alanine 52 were changed to Arginine respectively, the ALB mutant where amino acids 194- 197 comprising a Loop B 16 were deleted, and the C188A mutant were constructed by site-directed mutagenesis and Gibson assembly applying Q5® Site-Directed Mutagenesis Kit and NEBuilder® HiFi DNA Assembly respectively.
  • the USE1 wild type and mutant genes were subcloned into modified plasmid pET30-Hise-N-AviTag (Laboratory collection).
  • Hise-Ub plasmid for expression in E. coli of the His-tagged ubiquitin gene was described previously 45 .
  • the HA-ubiquitin plasmid for mammalian expression was a gift from Dr. Edward Yeh (Addgene plasmid # 18712 46 ).
  • the p4054 HA-E6AP isoform II was a gift from Dr. Peter Howley (Addgene plasmid # 8658 47 ).
  • pEGFP-Cl 19 Alanines and pEGFP-Cl 19 Alanines with nuclear localization sequence (NLS) constructs for expression in mammalian cells as well as HA- bovine PABPN1 wild type and HA-bovine PABPN1 mut +7 Ala mutant constructs were a gift of Dr. David Rubinsztein.
  • pEGFP-C119 Alanines and pEGFP-C119 Alanines with nuclear localization sequence (NLS) constructs for expression in mammalian cells as well as HA-bovine PABPN1 wild type and HA-bovine PABPN1 mut +7 Ala mutant constructs were a gift of Dr. David Rubinsztein.
  • the present inventors deleted the PolyA region from the wild type gene performing a site-directed mutagenesis applying Inverse PCR and Q5® Site-Directed Mutagenesis Kit (New England Biolabs, NEB). Then the HA-tagged delta Ala mutant bovine gene was humanized by changing amino acids Asp 95 and Ser 102 to Ser 95 and Pro 102 respectively, applying Q5® Site-Directed Mutagenesis Kit (NEB). Following humanization, 10 Ala (wild type) and 17 Ala (+7 mutant) regions were added using gene blocks (IDT) and Gibson assembly (NEBuilder® HiFi DNA Assembly kit, NEB).
  • the mouse H0XD13 bearing plasmids pcDNA3.1-Hoxdl3 wild type and pcDNA3.1- Hoxdl3 mut +10Ala were a gift of Dr. Denes Hnisz.
  • the Valine259 to Glutamate mutation was corrected in both constructs and then the wild type and the mutant Hoxdl3 genes were subcloned into pEGFP-N 1 derived vector whereas adding a putative Kozak sequence and the C- terminal HA-tag.
  • the PH0X2B carrying plasmids pcDNA3.0-HA-PHOX2B wild type and pcDNA3.0-HA- PH0X2B mut (+13 Ala) were kindly provided Dr. Diego Fornasari.
  • the PHOX2B genes were subcloned into lentiviral pLL3.7 vector bearing the Synapsin I promoter.
  • Plasmids bearing the HA-PHOX2B mut (+7 Ala) gene were constructed applying Gibson assembly and resulted in plasmids pcDNA3.0-HA-PHOX2B mut (+7 Ala), pLL3.7-hSyn-HA-PHOX2B mut (+7 Ala) and pLL3.7-hSyn-HA-PHOX2B mut (+7 Ala)- EGFP.
  • a lentiviral target vector bearing wild type UBA6-mCherry fusion protein under the control of pCMV promoter (SEQ ID NO: 59) was constructed by subcloning of the Nhel-Kpnl fragment from plasmid pLL3.7-hSyn-UBA6-mCherry into plasmid pLL3.7-pCMV-Kozak-HA- linker-EGFP (Lab collection).
  • SEQ ID NO: 59 A lentiviral target vector bearing wild type UBA6-mCherry fusion protein under the control of pCMV promoter
  • the PHOX2B mut (+13 Ala) gene was obtained by PCR from plasmid pET30-NAvitag-PHOX2B mut (+13), and introduced into N he]- Hind]]] sites of the plasmid pET43-Hise- TIG- TEV site-PHOX2B wild type.
  • Cell lines and transfection - Cell lines used in this study include human embryonic kidney cells, HEK293T (ATCC CRL-1573) and HEK293FT (Invitrogen, R70007).
  • the cells were authenticated by STR profiling and were routinely tested for mycoplasma contamination.
  • the cells were grown in Dulbecco’s modified Eagle’s medium (01-052-1 A, Sartorius) supplemented with 10% heat-inactivated fetal bovine serum (04-007-1 A, Sartorius), 10000 units/mL penicillin, and 10 mg/mL streptomycin (03-031- IB Sartorius) and 2 mM L-glutamine (G7513, Merck) at 37 °C with 5% CO2.
  • Transient transfection of indicated plasmids was accomplished using TransIT-LTl (Mirus, MIR 2300) according to the manufacturer’s protocol.
  • Vector and Mirus were mixed in a reduced serum medium (Opti-MEM® 10001865, Gibco) and incubated at room temperature for up to 30 min before being dripped gently onto the cell culture and incubated for 24 to 48 hours. Transfection efficiency was confirmed by western blot analysis.
  • RNA interference experiments cells were transfected 24 hours after seeding with 50-100 nM S 4/ 7'pool siRNAs (Dharmacon) for gene silencing and Lipofectamine 2000 (1000186, Invitrogen), with two rounds of knockdown for 5 days, according to the manufacturer's instructions (Invitrogen).
  • siRNAs and Lipofectamine were diluted separately in reduced serum medium Opti-MEM® (10001865, Gibco), then mixed for 15 minutes at room temperature and dripped gently onto the cell culture, which was then incubated at 37 °C for 4-6 hours, before restoration of full medium.
  • siRNA J-006403-09 UBA6 for the following target sequence: GUGUAGAAUUAGCAAGAUU (SEQ ID NO: 1); siRNA J-006403-10, UBA6 for the following target sequence: GCAUAGCUGUCCAAGUUAA (SEQ ID NO: 2); siRNA J-006403-11, UBA6 for the following target sequence: CAGUGUUGUAGGAGCAAUA (SEQ ID NO: 3); siRNA J-006403-12, UBA6 for the following target sequence: GGAAUUUGGUCAGGUUAU (SEQ ID NO: 4);
  • GenCRISPRTM gene editing technology was applied using a service from GenScript USA.
  • the gRNAs cleavage efficiency was tested by transient transfection and a gRNA with the highest cleavage efficiency was chosen (gRNA CCTGCCGGATGTGTGGGCGG; SEQ ID NO: 5) to generate the gene deletion resulted in the deletion of the domain located at position 47-56 of the UBE2Z/USE1 human protein comprising the polyalanine domain.
  • the sequence of donor is designed as below:
  • the editing materials were transfected in the HEK293T cells and the transfected cells were plated in 96-well plates by limiting dilution to generate isogenic single clones.
  • the clones were picked from wells and screened by PCR and Sanger sequencing screening to identify full allelic deletion clones.
  • dissociated neurons were resuspended and cultured at 37°C in a humidified incubator with 5% CO2 and 95% O2 in poly-D- lysine coated 6-well plates in neurobasal media (12349015, Gibco) supplemented with 1% GlutaMAXTM Supplement (35050-061, Thermofisher), 1% Sodium pyruvate (11360039, Gibco), 2% B27 supplement (17504044, Gibco) and 1% Penicillin- Streptomycin (O3-O31-1B, Sartorius). One-half of the culture media was changed every three days until treatment. Differentiated cortical neurons were infected with indicated lentiviral vectors after 5 days in culture.
  • Lentivirus production and infection - Third generation lentiviral vectors pLL3.7 (Addgene, #11795) that express shRNA under the mouse U6 promoter and CMV-EGFP or hSyn- EGFP reporter cassettes were obtained from the TAU Viral Core facility.
  • VSV G vesicular stomatitis virus envelope G
  • HEK-293FT packaging cells growing in 15 cm dishes were transfected with a mix of 7.8 pg helper vector pMDLg/pRRE, 3 pg helper vector pRSV-Rev, 4.2 pg envelope vector pCMV-VSVG, and 12 pg target vector pLL3.7-hSyn-PHOX2B-EGFP carrying the wild type or mutant PHOX2B gene, or CMV-mCherry UBA6.
  • PEI Polyethylenimine
  • the culture media was removed and replaced with fresh high-serum medium, which was harvested 48 h later and filtered through Amicon Ultra -15 (UFC910024) vials at 1500g for 30 minutes to obtain concentrated and purified lentiviruses for transduction.
  • UOC910024 Amicon Ultra -15
  • the culture medium was replaced by a 1: 1 mix of fresh and the conditioned medium that was collected previously. The neurons were then incubated for up to a week before being harvested for either western blot or immunostaining.
  • iPSCs - Fibroblast 10 6 cells were harvested using TrypLE Express (Gibco, 12604021) and electroporated with non-integrating episomal vectors using a Neon transfection system (Invitrogen, kit MPK10096). The cells were then plated on mouse embryonic fibroblast (MEF)-coated plates and cultured in DMEM with 15% FBS, 5 ng/ml basic fibroblast growth factor (bFGF, Peprotech 10018B) and 5 pM ROCK inhibitor (Enzo, ALX270333). After two days, the medium was replaced with NutriStem (BI) supplemented with 5 ng/ml bFGF, with fresh medium added every other day.
  • BI NutriStem
  • iPSC characterization - iPSCs were assessed for the expression of the pluripotency markers NANOG, SOX2, OCT3/4, TRA 1-60, and SSEA by immunocytochemistry and FACS analysis.
  • the differentiation potential was assessed by harvesting the iPSCs at confluency using TrypLE and resuspending the cells in NutriStem supplemented with 10 ng/ml bFGF and 7 pM ROCK inhibitor (Enzo, ALX270333).
  • Embryoid bodies (EBs) spontaneously formed after 2 days, at which time, the medium was replaced with EB medium (DMEM with 15% FBS, 1% Non- Essential Amino Acids and 0.1 mM P-mercaptoethanol, Gibco 31350010). After 4-7 days, the EBs were plated on 0.1% gelatin-coated plates and cultured for 21 days with EB medium replacement twice weekly.
  • iPSCs were supplemented with 100 ng/ml colcemid (Sartorius 120041D), incubated for 60 minutes, and harvested in Versene solution (Gibco 15040033). Cells were fixed in 1:3 glacial acetic acid:methanol (Biolabs- chemicals) solution and the G-banding karyotype was determined. Finally, all lines were tested for mycoplasma contamination using the Hy-mycoplasma PCR kit (Hylabs, KI5034I).
  • iPSCs Differentiation of iPSCs into autonomic neurons - The protocol was performed as previously described with modifications 48 .
  • iPSCs were cultured in Nutristem (Sartorius, 05-100- 1A) to a confluence of 1 million cells/well.
  • iPSCs washed with DPBS (Dulbecco's Phosphate-Buffered Saline), and a single cell suspension was prepared using Versene solution for 2 minutes (Gibco, 15040033), and then cells were transferred to T25 flasks coated with Poly-Hema (2-hydroxyethyl methacrylate) at a concentration of 350,000 cells/ml in neuromesodermal progenitor cell induction (NMP) medium containing Essential 6 medium (Gibco, A1516401), 1.5 mM CEUR (Tocris biotech, 4423), 10 pM SB (Tocris biotech, 431542), Penicillin-Streptomycin- Amphotericin B solution (PSA, Sartorius, 03-033- IB), supplemented with 10 pM ROCK inhibitor (ROCKi Enzo, ALX270333), where they formed aggregates.
  • NMP neuromesodermal progenitor cell induction
  • NMP neuromesodermal progenitor cell in
  • NMP neurotrophic
  • NMP nerve crest induction medium containing Essential 6 medium, 1.5 mM CHIR, 20 ng/ml bFGF (Peprotech 10018B), 50 ng/ml BMP4 (Prospec, Cyt-1093), 100 nM all trans retinoic acid (RA, Merck, R2625), and PSA.
  • NMP sympathetic neural crest induction medium containing Essential 6 medium, 1.5 mM CHIR, 20 ng/ml bFGF (Peprotech 10018B), 50 ng/ml BMP4 (Prospec, Cyt-1093), 100 nM all trans retinoic acid (RA, Merck, R2625), and PSA.
  • NCi sympathetic neural crest induction medium containing Essential 6 medium, 1.5 mM CHIR, 20 ng/ml bFGF (Peprotech 10018B), 50 ng/ml BMP4 (Prospec, Cyt-1093), 100 nM all trans retinoic acid (RA, Merck,
  • the culture was dissociated into single cells using Accutase (Gibco, Al 110501) for 4 min at 37°C, and cultured in sympathetic neuroblast induction and propagation (NCC) medium, containing neurobasal medium (Gibco, 21103049), 20 ng/ml bFGF, 50 ng/ml BMP4, 20 ng/ml EGF, 2 pg/ml heparin, B27 (Gibco, 17504044), N2 (Gibco, 17502048), GlutaMAX (Gibco, 35050038), PSA and 10 pM ROCKi.
  • NCC sympathetic neuroblast induction and propagation
  • NCC medium On day 11, half of the NCC medium was replaced with NCC medium without ROCKi and half of the medium was replaced every other day. On day 17, medium was replaced with sympathetic neuronal maturation medium (NMM medium) containing neurobasal medium, B27, N2, 10 ng/ml GDNF (Peprotech, 45010), 10 ng/ml BDNF (Peprotech 45002), 10 ng/ml NGF (R & D 256-GF), GlutaMAX, and PSA. One third of the medium was replaced every other day until day 31.
  • coverslips were incubated in poly- L- ornithine solution (Merck, P3655) overnight at 37°C followed by 3 washes with cell culture grade water and drying for 15 min. On seeding day, the coverslips were incubated in laminin (Merck, L2020) for 1 hour at 37°C before being washed with PBS. The neurospheres were harvested manually and seeded on the coverslips.
  • the cells on the coverslips were washed with Dulbecco's Phosphate-Buffered Saline (DPBS, Sartorius, 020231 A) and fixed in 4% paraformaldehyde at room temperature for 15 minutes.
  • the cells then were washed twice in DPBS, and blocked with DPBS containing 0.1% Triton X-100 (Merck, T8532) and 1% bovine serum albumin (blocking solution, Merck, A7906100G), for 1 hour at RT.
  • Primary antibodies were added to the blocking solution and incubated overnight at 4°C. Following three washes with blocking solution, the cells were incubated with fluorescent secondary antibodies for 2 h at room temperature.
  • DRAQ5 was used to stain the cell nuclei.
  • Flow cytometry - iPSCs were harvested and dissociated into single cells by incubation with TrypLE for 2 minutes at 37°C.
  • samples were incubated in fixation solution (Invitrogen, 00522356, 00512343) for 40 minutes at room temperature followed by washings withpermeabilization solution (Invitrogen, 00833356).
  • fixation solution Invitrogen, 00522356, 00512343
  • permeabilization solution Invitrogen, 00833356
  • the cells were washed once with 3% FBS in DPBS. In both cases, the samples were incubated with the appropriate primary antibodies for 2 hours at room temperature, then were washed twice and incubated for 1 hour with the relevant secondary antibody followed by three more washes.
  • Analysis was performed using a NovoCyte flow cytometer (ACEA). The first gating was SSC- H/FSC-H, and the entire cell population was selected (without cell debris) followed by FSC- H/FSC-A
  • TUNEL assay detecting DNA fragmentation the cells were fixed in 4% PFA for 20 minutes and then washed twice. TUNEL Assay Kit (Abeam, ab66108) was used according to the manufacturer’s instruction. The cells were washed twice with wash buffer followed by adding the DNA labeling solution for 1 hour at 37°C without agitation. The DNA labeling solution was removed, and the cells were washed twice with Rinse buffer followed by adding Propidium lodide/RNase A solution for 30 minutes. The Propidium lodide/RNase A solution was removed and the cells were washed twice with blocking solution and blocked for 1 hour at room temperature. The blocking solution was removed and primary anti-PHOX2B antibody was added overnight for immunostaining.
  • Annexin V-FETC apoptosis detection kit (Merck, CBA059) was used according to manufacturer’s protocol.
  • Annexin V-FITC solution containing 1: 100 Annexin: calcium buffer was prepared and was added to the neurons for 10 minutes at room temperature without agitation. Then, the cells were washed with calcium buffer and were fixed using 4% PFA for 20 minutes, washed with a blocking solution and blocked for 1 hour at room temperature. The blocking solution was removed and primary anti-P3-Tubulin antibody was added overnight for immunostaining.
  • the tissue biopsy was obtained from an OPMD patient undergoing cricopharyngeal myotomy (heterozygous polyalanine expansion mutation resulted in + 3 Ala in PABPN1).
  • the tissue was submerged by incubation with collagenase II solution (Merck, C0130). After the incubation, the tissue was transferred using a 5% BSA coated pipette tip into a 5% BSA pre-coated 10-cm plate filled with DMEM supplemented with 2.5% pen- strep-Nystatin (PSN). The tissue was further incubated for 30 minutes, and the muscle was then repeatedly pipetted to dissociate the myofibers.
  • the cells were lysed on ice in lysis buffer (20 mM Tris-HCl, pH 6.8, 137 mM NaCl, 1 mM EGTA, 1% Triton xlOO, 10% glycerol, and a protease inhibitors cocktail), centrifuged to discard the cell pellet and then the supernatant was added to Laemmli buffer at a ratio of 1: 1 without using beta-mercaptoethanol. Protein samples were boiled for 5 minutes at 95°C, separated by SDS-PAGE, transferred onto PVDF membranes, subjected to western blot analysis, and visualized using the ECL enhanced chemiluminescence reagent (CYANAGEN). Protein levels in each sample were evaluated by normalization to the housekeeping P-actin. The bands were quantified using ImageJ software.
  • IP immunoprecipitation
  • MG132 proteasome inhibitor
  • the beads were then discarded, and the cell lysates were incubated with antibody overnight as already described.
  • the different polyalanine constructs were expressed in HEK293T cells for 72 hours while the FLAG-USE1 was expressed in the cells for the last 24 hours.
  • sequences used in the experiments are as follows: Sequences of E6AP isoform II (GenBank Accession No. NP_000453.2) with the HA-tag as expressed in mammalian cells under control of the CMV promoter are provided in SEQ ID NOs: 63 (polypeptide) and 64 (polynucleotide encoding same);
  • Sequences of wild-type UBA6 with HA-tag as expressed in mammalian cells under control of the CMV promoter are provided in SEQ ID NOs: 65 (polypeptide) and 66 (polynucleotide encoding same);
  • sequences of the wild type 3x-FLAG-tagged USE1 (UBE2Z) as expressed in mammalian cells under control of the CMV promoter are provided in SEQ ID NOs: 69 (polypeptide) and 70 (polynucleotide encoding same);
  • sequences of the wild type Hise-AviTag-tagged USE1 (UBE2Z) as expressed in bacterial (E. coli) cells under control of the T7 promoter are provided in SEQ ID NO: 71 (polypeptide) and 72 (polynucleotide encoding same);
  • the sequences of the Hise-tagged SCCH domain of the UBA6 (UBE1L2) [amino acids (aa) 623-889] as expressed in bacterial (E. coli) cells under control of the T7 promoter are provided in SEQ ID NOs: 62 (polypeptide) and 61 (polynucleotide encoding same).
  • Fluorescein-5-Maleimide (AnaSpec) was attached to ubiquitin following the directions as previously described 45 . Briefly, proteins in 20 mM Tris (pH 7.5), 150 mM NaCl and 1 mM TCEP were incubated for 2 hours in the presence of the fluorophore at room temperature such that the label : protein ratio would be 4. To quench the reaction, beta-mercaptoethanol was added at a ratio of 10: 1 to fluorescein. Fluorescein-labeled ubiquitin was then separated from free dye on PD10 desalting columns (Cytiva) and was stored at 80 °C.
  • El and E2 loading assays All loading assays were performed at 32 °C in a buffer containing 20 mM HEPES (pH 7.5), 150 mM NaCl and 10% (w/v) glycerol. El and E2 loading assays were performed using 3 pM fluorescein ubiquitin, a range of 10 nM to 1 pM El, 1 pM E2, and 2.5 mM concentrations each of ATP and MgCL. Reactions were stopped using non-reducing SDS-PAGE loading buffer. Samples were separated on 4-20% Tris-Glycine NuPAGE gels (Thermo) in Tris-Glycine buffer.
  • the present inventors have constructed models for UBA6 using the Protein Homology/analogY Recognition Engine V 2.0 (PHYRE2) and the AlphaFold server 49, 50 . Further idealization of the geometry was achieved by five cycles of minimization with Refmac5. The model of full length USE1 was downloaded from the AlphaFold server 49, 50 . Structure visualization and figures preparations were performed with PyMOL (Molecular Graphics System, hypertexttransferprotocol://worldwideweb(dot)pymol(dot)org). The present inventors employed the continuum solvation method APBS (Adaptive Poisson-Boltzmann Solver) with the CHARMM force field to calculate the electro-potential surface of UBA1 and UBA6 51 .
  • APBS Adaptive Poisson-Boltzmann Solver
  • Microscopy - The cells were grown on coverslips, and then washed and fixed in 4% Paraformaldehyde for 10-15 minutes before being permeabilized with 0.1% Triton X-100.
  • a solution of, 1% BSA in PBS was used to block both primary and secondary antibodies.
  • the primary antibody was added at a ratio of 1: 100 and incubated for at least 1 hour at room temperature while the secondary antibody (1:300 Invitrogen) was allowed to incubate with the sample for 30 minutes at room temperature.
  • Neurons were permeabilized in 2% BSA + 0.1% Triton, and blocked with 2% BSA and the primary antibodies were incubated overnight at 4°C, at a ratio of 1: 150, with the secondary antibody incubated for 2 hours at room temperature at 1:500.
  • a Zeiss 710 confocal microscope was utilized for confocal imaging with a 63X oil-immersion lens. Nuclear staining was detected by staining with DRAQ5. For quantification, the operator was blinded to the outcome of the experiment when selecting suitably similar fields to image for subsequent computerized analysis.
  • the association of PHOX2B and UBA6 outside the nucleus was measured by selecting PHOX2B positive cells manually using Fiji, and excluding the nuclei by segmenting and removing the nuclear channel.
  • the colocalization between the channels of interest was then measured using the JACops plugin in Fiji with the default parameters, and Pearson’ s correlation coefficient was calculated.
  • the cytoplasmic intensity was measured for the channel of interest and the mean gray value was recorded after excluding the nuclei as already described.
  • the association of UBA6 with the cell body was examined by selecting the neuronal cell bodies manually using Fiji 52 .
  • the cell bodies were selected manually and removed.
  • Arc intensity in the neurons was measured by circulating the neuronal cell body together with the first neurite junction manually using Fiji.
  • the mean integrated value and the area for each neuron were recorded. The value of the mean divided by the area was used for statistical analysis.
  • FLIM imaging was performed using two-photon FLIM microscopy.
  • the cells were immunostained by mouse anti-USEl and rabbit anti-UBA6 primary antibodies, with secondary antibodies anti-mouse Alexa Fluor 488 and anti-rabbit Alexa Fluor 555, respectively.
  • the donor antibody Alexa Fluor 488) was excited with a Ti-sapphire laser (Chameleon, Coherent) at a wavelength of 920 nm and a power of 1.0-2.0 mW.
  • the images were acquired by Bergamo two- photon microscope (Thorlabs) equipped with a Time-Correlated Single Photon Counting board (Time Harp 260, Picoquant), thorough a 18x0.8na objective (Nikon).
  • the present inventors calculated the mean lifetime of multiple ROIs at each image using double exponent fitting.
  • the present inventors determined the lifetime of donor only samples (prepared with staining for USE1 only) and compared them with the mean lifetime of cells stained for donor and acceptor (USE1+ UBA6). Then, the present inventors subtracted donor- (donor/acceptor) lifetime, to compare the change in lifetime between groups.
  • RNA analysis by qRT-PCR - RNA purification was performed using the total RNA purification Micro kit (Norgen, 35300) according to manufacturer’s protocol. The concentration and quality of the RNA were measured by NanoDrop one (Thermo Fisher).
  • the cDNA generation was done by using a High capacity cDNA reverse transcription kit (Applied Biosystem, 4368814) with RNase inhibitor (Applied Biosystem, N8080119) as described in the kit protocol. Then, the cDNA was diluted in ultra-pure water in a ratio of 1:5 (each biological replicate was assessed in triplicates). Reaction solutions were prepared for each set of primers including the genes E6AP/UBE3A and two different sets of primers for P- Actin.
  • the reaction volume contained Fast SYBER green master mix (Applied Biosystem, 43856120), forward and reverse primers, ultra- pure water, and the cDNA template.
  • FSA Fast SYBER green master mix
  • forward and reverse primers the mean of two sets of primers for P- Actin was included as an endogenous control.
  • the data were analyzed using the AACT method.
  • the sequence of the primers used are provided in Table 3 below.
  • the supernatant was adjusted to 1% sarkosyl and incubated for 1 hour at 37 °C on orbital shaker followed by ultracentrifugation for 1 hour at 4°C.
  • the pellet (sarkosyl-insoluble fraction) was resuspended 50 pl TBSX1 for further analysis.
  • Bioinformatics analysis - USE1/UBE2Z human homologs were searched against the Uniprot (Pubmed id 29425356) and NCBI databases using BLAST (Pubmed id 2231712).
  • Prosite (Pubmed id 23161676) was used to scan for alanine residues motifs with between 6 and 10 continuous alanine residues in the BLAST results (a search for proteins containing polyalanine stretches in the ubiquitin cascades).
  • Alignments of the E2 family in vertebrates and across all databases were calculated using MAFFT (Pubmed id 28968734). The figures were generated using J al view (Pubmed id 19151095).
  • USE1 has both N- and C-terminal extensions as well as the ubiquitin-conjugating (UBC) core domain ( Figure 1A), classifying it as a class IV E2, which can be specifically loaded with ubiquitin by the El ubiquitin activating enzyme, UBA6, via a transthiolation reaction 7, 8 ’ 15 .
  • the polyalanine stretch of USE1 is located in the N-terminal extension and is well conserved in primates, several other mammals, and reptiles ( Figure 1A and Figure 5B).
  • the present inventors replaced two alanine residues in the stretch with arginine residues (the 2A— >2R mutant) .
  • a deletion mutant devoid of the polyalanine stretch has reduced ubiquitin loading compared to a wild type USE1 or a hyperactive mutant (deletion of Loop B) -
  • the present inventors constructed additional USE1 mutants including one with a deletion of the polyalanine stretch (USE1 APolyAla), and a deletion of Eoop B (USE1 AEB), which is hyperactive 16 ( Figure 1C).
  • the USE1 APolyAla mutant exhibits reduced ubiquitin loading compared to wild type USE1 or to USE1 ALB both in cells and in vitro with purified recombinant UBA6 ( Figure 1C, Figure ID and Figures 6A-B).
  • the present inventors have mutated the endogenous polyalanine stretch of USE1 by generating a knockout HEK293T cell line harboring a deletion of the polyalanine stretch in the UBE2Z alleles (USE1 APolyAla KO).
  • the endogenous USE1-UBA6 interaction in these cells was detected with Forster resonance energy transfer (FRET) based fluorescence lifetime imaging microscopy (FLIM).
  • FRET Forster resonance energy transfer
  • FLIM fluorescence lifetime imaging microscopy
  • E6AP/UBE3 A is a highly potent E3 ubiquitin ligase whose regulation is critical for proper development of the nervous system. Indeed, decreased activity of the ligase results in Angelman syndrome while increased activity causes autism spectrum disorders 14, 17, 18 .
  • Harper and coworkers identified a unique regulatory cascade by which UBA6-USE1 ubiquitinates E6AP for degradation in the proteasome 13 .
  • the present inventors have examined the stability of E6AP in the USE1 APolyAla KO cells. In control HEK293T cells, a cycloheximide chase experiment revealed that E6AP has an apparent half-life of approximately 10-14 hours ( Figure IE), which is consistent with previous reports in cultured cells 13 .
  • E6AP was stabilized in the USE1 APolyAla KO cells and showed a decrease in Lys48-linked polyubiquitination ( Figures IE and IF), suggesting that proteasome-mediated degradation of E6AP is inhibited in the USE1 APolyAla KO cells.
  • E6AP is monoubiquitinated and polyubiquitinated by the UBA6-USE1 cascade 13
  • the present inventors have further investigated the role of the polyalanine stretch of USE1 in E6AP ubiquitination by incubating purified E6AP with UBA6, USE1 WT and USE 1 mutants (APolyAla and C188A) in vitro.
  • UBA6 Identification of regions in UBA6 which determine specificity to USE1 -
  • the ubiquitin- activating El enzymes, UBA1 and UBA6 share 40% identity of protein sequence and a strong specificity for their cognate ubiquitin-like proteins 19-21 .
  • the ubiquitin fold domain of El interacts with the al helix of E2 and is responsible for determining the selectivity between E2s or different ubiquitin-like proteins 22 .
  • UBA1 and UBA6 assume the same domain architecture and folds. Therefore, to identify additional regions in UBA6 that are likely to determine the specificity to USE1, the present inventors compared the physico-chemical properties of UBA6 to those of UBA1 ( Figure 2A). Using AlphaFold the present inventors constructed a model of UB A6 (data is presented in Figure 2A). In addition, the crystal structures of UBA6 have been recently published 23,24 . These experimental data confirmed the AlphaFold model with very minor differences. Comparison of the models for the general structure containing 698 Ca atoms yielded an RMSD of 1.2A.
  • the SCCH domain of UBA6 and the polyAla stretch in USE1 affect the interaction between UBA6 and USE1 but not the mechanism of ubiquitin activation or transthiolation -
  • a biophysical analysis revealed that a peptide of 7 alanine residues interacts directly with the SCCH domain of UBA6, but has significantly weaker binding to the SCCH domain of UBA1 ( Figure 7B).
  • the present inventors have further constructed UBA6 mutants with the positive residues in the SCCH domain replaced by Ala (UBA6 mut 4Ala) or Asp (UBA6 mut 4Asp).
  • Polyalanine stretches which are expressedin the cytoplasm bind effectively to UBA6 and reduce loading of ubiquitin on USEl - Since UBA6 is mainly localized in the cytoplasm in HEK293T cells, the present inventors expressed the isolated GFP-19Ala stretches with or without a nuclear localization sequence (NFS) and monitored their binding to UBA6 (Figure 8A and Figure 3 A) as well as their ability to affect ubiquitin loading of USEl ( Figure 9A). The results show that polyalanine stretches bind UBA6 effectively when expressed in the cytoplasm without an NLS (Figure 3A), and reduce the ubiquitin loading of USEl (Figure 9A).
  • NLS nuclear localization sequence
  • Polyalanine stretches which are expressed in the nucleus do not bind UBA6 and do not affect USEl loading - In contrast to the cytoplasmic expression of the isolated polyAla stretches, when the isolated polyalanine stretches are expressed in the nucleus (due to the NLS) they do not bind UBA6 and they do not have any apparent effect on USE1 loading ( Figure 3 A, Figure 9A).
  • PH0X2B WT, +13 Ala, Figure 3B
  • RUNX2 WT, +6 Ala, +12 Ala, Figure 3C
  • H0XD13 WT, +10 Ala, Figure 3D
  • PABPN1 WT, +7 Ala, Figure 3E
  • mutant PHOX2B (+ 13 Ala) have further tested the effect of mutant PHOX2B (+ 13 Ala) on the binding between USE1 and UBA6. As shown in Figure 3F recombinant mutant PHOX2B (+ 13 Ala) competes with USE1 for binding to UBA6 in vitro.
  • mutant PHOX2B increases the levels of E6AP due to its stabilization in HEK293T cells ( Figure 3G, Figure 9C, Figure 10F).
  • mutant PHOX2B does not increase E6AP mRNA levels, indicating that the increased E6AP levels are not related to transcriptional effects ( Figure 10G). This correlates with a decrease in Eys48-linked polyubiquitination of E6AP ( Figure 3H, Figure 10H), suggesting that proteasome-mediated degradation of E6AP is inhibited by mutant PHOX2B in the cells.
  • mutant PH0X2B exhibit increased colocalization with UBA6, which correlates with increasing length of the polyalanine stretch ( Figure 31, Figure 11D).
  • expression of mutant PH0X2B with +7 Ala and +13 Ala increase the levels of E6AP in the primary neurons by 1.3 fold (Figure 3 J), which is consistent with physiological induction rates of E6AP protein levels in cultured neurons 28 .
  • the synap