WO2023218453A1 - Methods of treating diseases associated with polyalanine expansion mutations - Google Patents

Methods of treating diseases associated with polyalanine expansion mutations Download PDF

Info

Publication number
WO2023218453A1
WO2023218453A1 PCT/IL2023/050474 IL2023050474W WO2023218453A1 WO 2023218453 A1 WO2023218453 A1 WO 2023218453A1 IL 2023050474 W IL2023050474 W IL 2023050474W WO 2023218453 A1 WO2023218453 A1 WO 2023218453A1
Authority
WO
WIPO (PCT)
Prior art keywords
uba6
cells
cell
polyalanine
neurons
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IL2023/050474
Other languages
French (fr)
Inventor
Avraham Ashkenazi
Yevgeny Berdichevsky
Fatima AMER-SARSOUR
Gad David VATINE
Daniel FALIK
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ramot at Tel Aviv University Ltd
BG Negev Technologies and Applications Ltd
Original Assignee
Ramot at Tel Aviv University Ltd
BG Negev Technologies and Applications Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ramot at Tel Aviv University Ltd, BG Negev Technologies and Applications Ltd filed Critical Ramot at Tel Aviv University Ltd
Publication of WO2023218453A1 publication Critical patent/WO2023218453A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0618Cells of the nervous system
    • C12N5/0619Neurons
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43Enzymes; Proenzymes; Derivatives thereof
    • A61K38/53Ligases (6)
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G01N33/5058Neurological cells
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/573Immunoassay; Biospecific binding assay; Materials therefor for enzymes or isoenzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10Growth factors
    • C12N2501/11Epidermal growth factor [EGF]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10Growth factors
    • C12N2501/115Basic fibroblast growth factor (bFGF, FGF-2)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10Growth factors
    • C12N2501/13Nerve growth factor [NGF]; Brain-derived neurotrophic factor [BDNF]; Cilliary neurotrophic factor [CNTF]; Glial-derived neurotrophic factor [GDNF]; Neurotrophins [NT]; Neuregulins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10Growth factors
    • C12N2501/155Bone morphogenic proteins [BMP]; Osteogenins; Osteogenic factor; Bone inducing factor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/40Regulators of development
    • C12N2501/415Wnt; Frizzeled
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/70Enzymes
    • C12N2501/72Transferases [EC 2.]
    • C12N2501/727Kinases (EC 2.7.)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/90Polysaccharides
    • C12N2501/91Heparin
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2506/00Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
    • C12N2506/45Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from artificially induced pluripotent stem cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2533/00Supports or coatings for cell culture, characterised by material
    • C12N2533/50Proteins
    • C12N2533/52Fibronectin; Laminin
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y602/00Ligases forming carbon-sulfur bonds (6.2)
    • C12Y602/01Acid-Thiol Ligases (6.2.1)

Definitions

  • the present invention in some embodiments thereof, relates to methods of treating a subject having a disease associated with a polyalanine expansion mutation and, methods of increasing ubiquitination of E6AP.
  • mutant RUNX2 in cleidocranial dysplasia 3
  • mutant homeobox D13 mutant HOXD13
  • mutant poly(A) binding protein nuclear 1 mutant PABPN1
  • OPMD oculopharyngeal muscular dystrophy
  • disease-causing expansion mutations may contain up to 13 additional alanine residues and can result in protein misfolding 9 11 .
  • the exact functional or structural role of the polyalanine stretches in normal proteins is unclear. Perturbations of ubiquitin activation, conjugation and transfer to target proteins via the El- E2-E3 enzymatic cascade have been linked to dysregulation of neuronal homeostasis and to a growing number of neurodevelopmental disorders 12 14 .
  • Ubiquitin protein ligase E3A (UBE3A, also known as “E6-AP” or “E6AP”) is part of the ubiquitin protein degradation system, and interactions of UBE3A with the E6 protein of human papillomavirus (HPV) types 16 and 18 are known to result in ubiquitination and proteolysis of tumor protein p53.
  • E6AP itself undergoes poly- ubiquitination as part of its proteasome-mediated degradation (Lee P., 2013, Mol. Cell, 50: 172-184). Maternally inherited deletions or point mutations in UBE3A cause Angelman Syndrome.
  • CNVs copy number variations
  • a method of treating a subject having a disease associated with a polyalanine expansion mutation comprising administering to the subject a therapeutically effective amount of an agent capable of upregulating expression or activity of a ubiquitin like modifier activating enzyme 6 (UBA6) in nervous system cells of the subject, thereby treating the subject.
  • UUA6 ubiquitin like modifier activating enzyme 6
  • UUA6 ubiquitin like modifier activating enzyme 6
  • a method of treating a subject diagnosed with autism spectrum disorders comprising administering to the subject a therapeutically effective amount of an agent capable of upregulating expression or activity of a ubiquitin like modifier activating enzyme 6 (UBA6) in nervous system cells of the subject, thereby treating the subject.
  • an agent capable of upregulating expression or activity of a ubiquitin like modifier activating enzyme 6 (UBA6) in nervous system cells of the subject, thereby treating the subject.
  • UUA6 ubiquitin like modifier activating enzyme 6
  • a method of increasing ubiquitination of an E6AP polypeptide in a cell comprising contacting the cell with a therapeutically effective amount of an agent capable of specifically upregulating expression or activity of a ubiquitin like modifier activating enzyme 6 (UBA6) in the cell, thereby increasing the ubiquitination of the E6AP polypeptide in the cell.
  • UUA6 ubiquitin like modifier activating enzyme 6
  • a method of generating neurons with a polyalanine expansion mutation comprising subjecting induced pluripotent stem cells (iPSCs) which comprise a genomic polyalanine expansion mutation to culture conditions suitable for differentiating said iPSCs into neurons, thereby generating the neurons with the Polyalanine expansion mutation.
  • iPSCs induced pluripotent stem cells
  • a method of screening for an agent capable of specifically modulating expression or activity of a ubiquitin like modifier activating enzyme 6 comprising:
  • contacting is in the presence of a functional portion of said UBA6 comprising a second catalytic cysteine half (SCCH) domain.
  • SCCH catalytic cysteine half
  • identifying the at least one molecule of the plurality of molecules which modulates the complex formed by the UBA6 and USE1 is effected by monitoring ubiquitination level of a target polypeptide.
  • the target polypeptide is E6AP.
  • contacting is effected in vivo.
  • contacting is effected ex vivo.
  • the cell is a nervous system cell.
  • the cell is of a subject diagnosed with a disease characterized by abnormally high levels of an E6AP polypeptide.
  • the cell is of a subject diagnosed with autism spectrum disorders (ASDs).
  • ASDs autism spectrum disorders
  • the polypeptide having said polyalanine expansion mutation has an aberrant cellular localization as compared to a corresponding wild-type polypeptide.
  • the polypeptide having said polyalanine expansion mutation is cytoplasmic.
  • the polyalanine expansion mutation occurs in a polypeptide selected from the group consisting of a paired like homeobox 2B (PH0X2B), aristaless related homeobox (ARX), SRY-box transcription factor 3 (SOX3), Zic family member 2 (ZIC2), forkhead box L2 (F0XL2), RUNX family transcription factor 2 (RUNX2), homeobox Al 3 (H0XA13), homeobox D13 (H0XD13), and poly(A) binding protein nuclear 1 (PABPN1).
  • a polypeptide selected from the group consisting of a paired like homeobox 2B (PH0X2B), aristaless related homeobox (ARX), SRY-box transcription factor 3 (SOX3), Zic family member 2 (ZIC2), forkhead box L2 (F0XL2), RUNX family transcription factor 2 (RUNX2), homeobox Al 3 (H0XA13), homeobox D13 (H0XD13), and poly(
  • the disease is selected from the group consisting of congenital central hypoventilation syndrome (CCHS), X-linked cognitive disability and epilepsy, X-linked cognitive disability with growth hormone deficiency, Holoprosencephaly type 5, Blepharophimosis syndrome, cleidocranial dysplasia (CCD), Hand-foot-genital syndrome, synpolydactyly, and oculopharyngeal muscular dystrophy (OPMD).
  • CCHS congenital central hypoventilation syndrome
  • X-linked cognitive disability and epilepsy X-linked cognitive disability with growth hormone deficiency
  • Holoprosencephaly type 5 e.g., X-linked cognitive disability with growth hormone deficiency
  • CHCD e.g., cleidocranial dysplasia
  • OPMD oculopharyngeal muscular dystrophy
  • the agent upregulates expression level of said UBA6.
  • the agent is a polynucleotide encoding at least a functional portion of said UBA6 comprising a second catalytic cysteine half (SCCH) domain.
  • SCCH catalytic cysteine half
  • the polynucleotide is an mRNA molecule.
  • the polynucleotide is comprised in a nucleic acid construct suitable for in-vivo delivery into nervous system cells of the subject.
  • the agent stabilizes formation of a protein complex between said UBA6 and USE1.
  • the agent is a peptide of 5-10 alanine residues.
  • the SCCH domain of the UBA6 is set forth by SEQ ID NO: 25.
  • the neurons are peripheral autonomic neurons.
  • the modulating is upregulating said expression or activity of said UBA6 in a cell of a nervous system
  • the modulating is downregulating said expression or activity of said UBA6 in a cell of a nervous system
  • the method further comprising synthesizing the identified agent.
  • the neurons are differentiated in vitro from induced pluripotent stem cells (iPSCs) comprising a genomic polyalanine expansion mutation.
  • iPSCs induced pluripotent stem cells
  • subjecting said iPSCs to culture conditions suitable for differentiating the iPSCs into neurons comprises the steps of:
  • NMPs neuromesodermal progenitor cells
  • the culture medium suitable for induction of iPSCs into neuromesodermal progenitor cells comprises a glycogen synthase kinase 3 (GSK-3) inhibitor and an ALK5 (activin receptor-like kinase 5) inhibitor.
  • GSK-3 glycogen synthase kinase 3
  • ALK5 activin receptor-like kinase 5
  • the culture medium suitable for induction of said NMPs into sympathetic neural crest comprises basic fibroblast growth factor (bFGF), bone morphogenic protein 4 (BMP4) and retinoic acid (RA).
  • bFGF basic fibroblast growth factor
  • BMP4 bone morphogenic protein 4
  • RA retinoic acid
  • the culture medium suitable for induction of sympathetic neuroblast crest comprises basic fibroblast growth factor (bFGF), bone morphogenic protein 4 (BMP4) and epidermal growth factor (EGF).
  • bFGF basic fibroblast growth factor
  • BMP4 bone morphogenic protein 4
  • EGF epidermal growth factor
  • the culture medium suitable for induction of sympathetic neuronal maturation comprises nerve growth factor (NFG), glial cell derived neurotrophic factor (GDNF) and brain derived neurotrophic factor (BDNF).
  • nerve growth factor nerve growth factor
  • GDNF glial cell derived neurotrophic factor
  • BDNF brain derived neurotrophic factor
  • the method further comprising detecting presence of differentiated neurons following step (d) using an immunological detection method.
  • the immunological detection method is performed with an antibody which specifically binds to a marker selected from the group consisting of: Tuj la, MAP2ab, Peripherin, AT0H1, PH0X2B, dopamine beta-hydroxylase (DBH) and Tyrosine hydroxylase (TH).
  • FIGs. 1A-G depict that a polyalanine stretch in USE1 regulates UBA6-USE1 ubiquitin transfer.
  • Figure 1A Structure of the USE1 enzyme (PDB 5A4P) indicating the catalytic cysteine (Cysl88), loop B (LB) with Trpl95 masking Cysl88, and model of the C-and N-terminal extensions including the alanine repeats (created by AlphaFold).
  • FIG. IB FLAG-wild type (WT) USE1, FLAG-USE 1 mutant with aberrations in the polyalanine (2A> 2R), and FLAG-USE 1 catalytic dead mutant (C188A) were co-expressed with HA-Ub (a ubiquitin molecule with HA tag) in control or UBA6-depleted (Uba6 small inhibitory RNA, siRNA) HEK293T cells.
  • Cell lysates were incubated with or without P mercaptoethanol (PME) and analyzed for ubiquitin loading. Results are mean ⁇ s.e.m normalized to control WT USE1.
  • PME P mercaptoethanol
  • Figure 1C Time- dependent in vitro ubiquitin loading of WT and APolyAla USE1 by UBA6.
  • Figure ID Quantification of UBA6-USE1 interaction in WT and USE1 APolyAla knockout (KO) HEK293T cells using FLIM-FRET. Representative 2pFLIM pseudo-colored images of WT cells and APolyAla KO cells, stained for USE1 and UBA6 using secondary antibodies as donor (Alexa 488) and acceptor (Alexa 555), respectively.
  • Figure IF WT and APolyAla KO cells were incubated for the last 6 hours with the proteasome inhibitor MG132 (10 pM), and E6AP was immunoprecipitated from cell lysates for ubiquitination analysis (under reducing conditions with PME).
  • Figure 1G E6AP purified from HEK293T cells was incubated with bacterially-produced UBA6, USE1 WT and USE1 mutants (APolyAla and C188A) for in vitro E6AP ubiquitination assay.
  • E6AP ubiquitin conjugates (under reducing conditions with PME) was resolved by SDS-page (* indicates the mono-ubiquitin conjugate), ns non- significant, * P ⁇ 0.05, ** P ⁇ 0.01, ****P ⁇ 0.0001.
  • FIGs. 2A-D demonstrate that UBA6 interacts with polyalanine stretches.
  • Figure 2A Electrostatic surface representation of the UBA6 structural model in comparison to UBA1. The location of key Arg and Eys residues forming the positively charged patch in UBA6 is presented.
  • Figures 2B-C HA-tagged constructs of WT UBA1, WT UBA6, and UBA6 mutants with Ala or Asp substitution mutations in Lys628, Arg691, Eys709, and Lys714 (UBA6 mut 4Ala or UBA6 mut 4Asp) were co-transfected with FEAG-USE1 ( Figure 2B) or empty GFP and GFP-polyAla (19Ala) ( Figure 2C) into HEK293T cells. Cell lysates were immunoprecipitated with anti-HA antibodies and the immunocomplexes were analyzed with anti-FEAG, anti-HA, and anti-GFP antibodies. Results are mean + s.e.m.
  • FIGs. 3 A- J demonstrate that polyalanine-expanded disease proteins interact with UBA6 and inhibit E6AP degradation.
  • Figures 3A-E HEK293T cells were transfected with the indicated constructs and immunoprecipitated for endogenous UBA6.
  • Figure 3A Empty GFP, and GFP- polyAla with or without a nuclear localization sequence (NFS).
  • Figure 3B WT and mutant PHOX2B (+13Ala).
  • Figure 3C WT and mutant RUNX2 (+6Ala and +12Ala).
  • Figure 3D WT and mutant H0XD13 (+10Ala).
  • Figure 3E WT and mutant PABPN1 (+7 Ala).
  • CHX cycloheximide
  • Figure 31 Association of endogenous UBA6 (red) with GFP-PHOX2B (green). Scale bar 10 pm. Quantification is shown in Figure 11D.
  • FIGs. 4A-G demonstrate that UBA6 overexpression rescues CCHS patient-derived autonomic neurons from neuronal death.
  • Figure 4A Characterization of iPSC-derived autonomic neurons at day 31 of differentiation from healthy controls and CCHS patients, hnmunocytochemistry of PHOX2B (green), piH-tubulin (TUBP3, red), tyrosine hydroxylase (TH, green) peripherin (PRPH, green), and atonal BHLH Transcription Factor 1 (ATOH1, green). Scale bar 200 pm.
  • Figure 4B Quantification of the association of endogenous UBA6 with endogenous PHOX2B (Pearson’s coefficient) in autonomic neurons from control and CCHS patients.
  • Results are the average values from neurons in different imaged fields. Total number of neurons analyzed was 160 for 103iCTR 20/20, 350 for 102iCCHS 20/25, 380 for 105iCTR 20/20 and 550 for 104iCCHS 20/27. One-way ANOVA Tukey’s test. Images are shown in Figure 14D.
  • Figure 4C Representative 2pFLIM pseudo-colored images of control and CCHS patient-derived neurons, stained for USE1 and UBA6 using secondary antibodies as donor (Alexa 488) and acceptor (Alexa 555), respectively. Scale bar is 20 pm Comparison of the difference in lifetime for each group, for the subtraction of donor only to donor and acceptor fluorescence lifetime.
  • Figure 4D Analysis of E6AP levels in control (105iCTR 20/20) and CCHS patients (102iCCHS 20/25 and 104iCCHS 20/27). Results are mean + s.e.m normalized to control from three independent differentiation days. Paired 2-tailed t-test.
  • Figure 4E Quantification of E6AP mRNA in the control and patient-derived autonomic neurons. Results are mean + s.e.m. Unpaired 2-tailed t-test.
  • Figures 4F-G Patient-derived autonomic neurons (102iCCHS 20/25) were transduced with mCherry-UBA6 cDNA lentiviral vectors.
  • Figure 4G Representative images of TUNEL staining (colored green marked with arrows) of the transduced and non-transduced patient neurons.
  • the percentage of the TUNEL positive PHOX2B expressing cells is shown as mean ⁇ s.e.m. At least 1000 PHOX2B expressing cells were analyzed. Unpaired 2-tailed t-test. ns non- significant, *P ⁇ 0.05, ***P ⁇ 0.001, ****P ⁇ 0.0001.
  • FIGs. 5A-B depict an analysis of alanine repeats in the ubiquitin system.
  • Figure 5 A Analysis of alanine repeats domains in the human ubiquitin cascades comprising El, E2, and E3 enzymes.
  • Figure 5B A multiple sequence alignments of USE1 homologs from different vertebrates. Shown are partial sequences of the following polypeptides:
  • the alignment is colored according to sequence identity including the N-terminus containing the polyalanine stretch.
  • FIGs. 6A-C demonstrate that polyalanine stretches regulate UBA6-USE1 interaction and ubiquitin transfer.
  • Figure 6B A representative blot for time-dependent in vitro ubiquitin loading of WT and APolyAla USE1 by UBA6 (quantification is presented in Figure 1C).
  • FIGs. 7A-B depict a biophysical analysis of the interaction between a polyalanine peptide and the SCCH domains of the canonical El ubiquitin- like activating enzymes.
  • Figure 7A AlphaFold models of UBA6 and UBA7 and the crystal structures of UBA1, UBA2 and UBA3 are shown. The structures were aligned and electrostatic potential was calculated as described in GENERAL MATERIALS AND EXPERIMENTAL METHODS below. The yellow arrows indicate the location of the groove within the SCCH domains.
  • UBA6, UBA1 and UBA7 form an extended lobe within the SCCH, which is missing in UBA2 and UBA3. The groove in UBA7 is covered and do not exist in UBA2 and UBA3.
  • UBA1 and UBA6 are highly similar in terms of structure but present significantly different electro potential surfaces. The gradient from negative (red) to positive (blue) charge is shown.
  • the Figure was prepared by PyMol.
  • FIGs. 8A-E demonstrate that polyalanine expansion mutations cause cytoplasmic mislocalization of different nuclear proteins.
  • HEK293T cells were transfected with the indicated constructs, and were subjected to immunostaining.
  • Figure 8A GFP- 19Ala with nuclear localization sequence (NLS, green) or GFP-19Ala, labeled for endogenous UBA6 (red).
  • Figure 8B HA- PHOX2B WT and HA-PHOX2B +13Ala.
  • Figure 8C HA-RUNX2 WT, HA-RUNX2 +6Ala, and HA-RUNX2+ 12Ala.
  • Figure 8D HA-HOXD13 WT and HA-HOXD13 +10Ala.
  • Figure 8E HA- PABPN1 WT and HA-PABPN1 +7 Ala. Image scale bar 20 pm. Quantification of the association of HA-tagged proteins (labeled in red) with the nucleus (labeled in blue, Pearson’s coefficient) is indicated as well as the cytoplasmic intensity. Results are the average values from cells in different imaged fields. Between 60-100 transfected cells were analyzed. Results are mean ⁇ s.e.m. Unpaired 2-tailed t-test ( Figures 8B, 8D and 8E) and one-way ANOVA Tukey’s test (Figure 8C). ns nonsignificant, *P ⁇ 0.05, **P ⁇ 0.01, 0.0001.
  • FIGs. 9A-D demonstrate that soluble isolated polyalanine stretches regulate USE1 ubiquitin loading and E6AP levels.
  • Figure 9A HEK293T cells were transfected with empty GFP, GFP- polyAla (19 Ala), and GFP-polyAla with a nuclear localization sequence (NLS). Endogenous USE1 ubiquitin loading was analyzed in pME-untreated cell lysates.
  • Figure 9B HEK293T cells were transfected with empty GFP or GFP-polyAla. The cell lysates were analyzed for the soluble and sarkosyl-insoluble fractions of GFP-polyAla.
  • Figure 9C Control and UBA6-depleted HEK293T cells were transfected with empty vector or mutant PHOX2B and analyzed for E6AP levels.
  • Figure 9D Cells were transfected with empty GFP, or GFP-polyAla with or without HA- UBA6, and analyzed for E6AP levels. Results are mean ⁇ s.e.m.
  • FIGs. 10A-H demonstrate that cytoplasmic polyalanine-expanded disease proteins interact with UBA6, decrease USE1 ubiquitin loading and stabilize E6AP levels.
  • Figures 10A-D HEK293T cells were transfected with the indicated constructs: Figure 10A - HA-mutant PHOX2B (+13Ala). Figure 10B - HA-mutant RUNX2 (+12Ala). Figure 10C - HA-mutant HOXD13 (+10Ala). Figure 10D - HA-mutant PABPN1 (+7 Ala).
  • Endogenous UBA6 was immunoprecipitated from the nuclear fraction (Nuc, LaminBl enriched) or the cytoplasmic (Cyt, GAPDH enriched) fraction (unrelated IgG was used as a control).
  • the immunocomplexes were analyzed with anti-HA antibodies.
  • Figure 10E HEK293T cells were transfected with constructs expressing different polyalanine-expanded disease proteins (mutant PHOX2B, mutant RUNX2, mutant H0XD13, and mutant PABPN1) together with FLAG-USE 1. Cell lysates were incubated without P mercaptoethanol and analyzed for ubiquitin loading. Results are mean ⁇ s.e.m normalized to control (empty vector, no disease protein).
  • FIG. 10F Representative blot of E6AP levels in CHX-treated cells that were transfected with mutant PH0X2B or empty vector. Quantification of E6AP levels is shown in Figure 3F.
  • Figure 10H Control and UBA6- depleted HEK293T cells were transfected with HA-Ub, mutant PH0X2B or empty vector and incubated for the last 6 hours with the proteasome inhibitor MG132 (10 pM). Endogenous E6AP was immunoprecipitated from cell lysates for ubiquitination analysis, ns non-significant, * P ⁇ 0.05, ** P ⁇ 0.01.
  • FIGs. 11A-F demonstrate an analysis of UBA6 and mutant PHOX2B association and effects on Arc levels in primary neurons.
  • Figure 11 A Mouse primary cortical neurons were labeled for endogenous UBA6 (red) and MAP2 (green). Quantification of the association of UBA6 with the neuronal nucleus, cell body, and neurites is shown (Pearson’s coefficient).
  • Figure 11B Mouse primary cortical neurons were transduced with lentiviral vectors expressing GFP-tagged WT PHOX2B (green) or mutant PHOX2B (+13 Ala, green), and were labeled for endogenous MAP2 (red) and TAU (red) (non-nuclear fraction of mutant PHOX2B marked with arrows).
  • FIG. 11C Mouse primary cortical neurons were transduced with lentiviral vectors expressing GFP-tagged WT PHOX2B or mutant PHOX2B (+13Ala), and were analyzed for the levels of PHOX2B in the soluble and sarkosyl-insoluble fractions.
  • Figure 11D Quantification of UBA6 association with WT and mutant (+7 Ala, +13 Ala) GFP-PHOX2B (Pearson’s coefficient) related to Figure 31.
  • Figure HE Analysis of UBA6 intensity in aggregated and non- aggregated GFP-mutant PHOX2B (+13Ala) expressing cortical neurons. The results represent further analysis of the GFP signal in the images of Figure 11D.
  • FIGs. 12A-E demonstrate that OPMD-patient derived cells exhibit cytoplasmic presence of PABPN1 and reduced association between UBA6 and USE1.
  • Figure 12B Control and OPMD patient-derived primary fibroblasts were stained for PABPN1 and nuclei.
  • FIG. 12C Representative 2pFLIM pseudo colored images of control and OPMD fibroblasts, stained for USE 1 and UBA6 using secondary antibodies as donor (Alexa 488) and acceptor (Alexa 555), respectively. Scale bar is 200 pm
  • FIGs. 13A1-13O5 depict generation and characterization of CCHS patient and family relative-derived iPSCs.
  • Skin punch biopsies were collected from a 2-year-old female patient with CCHS who harbors a heterozygous 27 polyalanine expansion in PHOX2B (104iCCHS 20/27; data from this patient is referred by the number “2” in Figures 13A2- 13N2 and is also shown in Figures 1302-1304), and from her healthy sister (105iCTR 20/20; data from this subject is referred by the number “3” in Figures 13A3-13N3 and is also shown in 1305).
  • FIG. 13A1-13O1 A biopsy was also collected from the healthy father (103iCTR 20/20; data from this subject is referred by the number “1” in Figures 13A1-13O1) of the 4-year-old male patients who harbors a heterozygous 25 polyalanine expansion in PHOX2B (102iCCHS 20/25; data not shown).
  • Patient- specific fibroblasts were electroporated with non-integrating reprogramming episomal plasmids.
  • Figures 13A1-13E3 hnmunocytochemistry for pluripotency markers (NANOG, SOX2, OCT3/4 TRA-1-60, SSEA4).
  • Figures 13F1-13J3 Flow cytometry analysis for pluripotency markers (red-NANOG, SOX2, OCT3/4 TRA-1-60, SSEA4).
  • Figures 13K1-3 G-banding karyotype.
  • Figures 13L1-13N3 Embryoid bodies (EBs) were generated and allowed to spontaneously differentiate for 21 days. Differentiated EBs express the ectoderm marker heavy chain neurofilament, the mesoderm marker a- smooth muscle actin SMA, and the endoderm marker a-fetoprotein.
  • EBs Embryoid bodies
  • Figures 1301-1305 show the genetic analysis of the reprogrammed pluripotent stem cell lines to confirm the presence of a heterozygous expansion of seven alanine residues resulting in a 27 polyalanine stretch in PH0X2B .
  • Figure 1301 sequence from subject 103iCTR 20/20;
  • Figures 1302-1304 sequences from subject 104/CCHS 20/27, showing both alleles (Figure 1302), normal allele ( Figure 1303), and mutant allele (Figure 1304, shown is a partial sequence of the mutant PH0X2B with a polyalanine expansion mutation; SEQ ID NO: 85).
  • Figure 1305 sequence from subject 105iCTR 20/20). Sequencing of the 3rd PH0X2B exon confirms the heterozygous +7 polyalanine expansion in the CCHS patient, but not in the healthy controls. Image scale bars 100 pm
  • FIGs. 14A-I depict patient-derived autonomic neurons showing cytoplasmic mislocalized soluble PH0X2B, and reduced Arc levels.
  • Figures 14A-B Quantification of the association of endogenous PH0X2B with the nucleus (Pearson’ s coefficient) in autonomic neurons from control and CCHS patients. Quantification is shown also for PH0X2B cytoplasmic intensity. Results are mean ⁇ s.e.m *P ⁇ 0.05, **P ⁇ 0.01, ***P ⁇ 0.001 0.0001 one-way ANOVA Tukey’ s test. The results represent additional analysis from the same neurons analyzed in Figure 4B.
  • Figure 14C Autonomic neurons from control and CCHS patients were analyzed for the levels of PHOX2B in the soluble and sarkosyl-insoluble fractions.
  • Figure 14D iPSC-derived human autonomic neurons from control and CCHS patients were labeled by nuclear staining (colored blue, abnormal nuclear morphology marked with arrows), and for endogenous PHOX2B (colored green) and endogenous UBA6 (colored red). Images indicate events of severe cytoplasmic mislocalization of PH0X2B (marked with arrows). Scalebar 10 pm.
  • Figures 14E-F Immunostaining of Arc (colored green) and TUBP3 (colored red) in autonomic neurons from control and CCHS patients.
  • FIG. 15 is aWestern Blot demonstrating an E6AP ubiquitination assay.
  • E6AP purified from HEK293T cells was incubated in vitro for up to 1.5 hours with bacterially-produced UBA6, USE1, and ubiquitin with or without polyalanine peptides (cy5-7-Ala residues; SEQ ID NO: 22) for an E6AP ubiquitination assay.
  • E6AP ubiquitin conjugates (under reducing conditions withpME) were resolved by SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis). The results show that the addition of a peptide of 7-Ala residues (cy5-7Ala residues; SEQ ID NO: 22) results in an increase in E6AP poly- ubiquitination.
  • FIG. 16 is a schematic illustration of the differentiation protocol according to some embodiments of the invention PSCs (e.g., iPSCs) into peripheral sympathetic neurons.
  • DoD - refers to day of differentiation.
  • SB SB431542, an ALK5 inhibitor;
  • CHIR CHIR 99021, a glycogen synthase kinase 3 (GSK-3) inhibitor;
  • FGF2 - basic fibroblast growth factor;
  • BMP4 bone morphogenic protein 4;
  • SHH sonic hedgehog;
  • RA retinoic acid;
  • EGF epidermal growth factor;
  • NEF nerve growth factor;
  • BDNF brain derived neurotrophic factor;
  • GDNF glial cell derived neurotrophic factor.
  • the present invention in some embodiments thereof, relates to methods of treating a subject having a disease associated with a polyalanine expansion mutation and, methods of increasing ubiquitination of E6AP.
  • Expansion mutations in polyalanine tracts are known to be associated with a growing number of human diseases with common genotypes and similar phenotypes 1-6 .
  • the present inventors have investigated the normal function of physiological polyalanine stretches, and whether a common molecular mechanism is involved in these diseases.
  • the present inventors show that UBA6, an El ubiquitin- activating enzyme 7, 8 , recognizes a polyalanine stretch within its cognate E2 ubiquitin- conjugating enzyme, USEl. Aberrations in this polyalanine stretch reduce ubiquitin transfer to USEl and downstream target, the E3 ubiquitin ligase, E6AP.
  • the present inventors have identified competition for the UBA6-USE1 interaction by various proteins with polyalanine expansion mutations in the disease state.
  • the deleterious interactions of expanded polyalanine proteins with UBA6 alter the levels and ubiquitination- dependent degradation of E6AP, which in turn affects the levels of the synaptic protein, Arc.
  • E6AP the synaptic protein
  • Arc the synaptic protein
  • the present inventors have identified a polyalanine motif in the ubiquitin- conjugating E2 enzyme UBE2Z/USE1, which contributes to USE1 ubiquitin loading by the El ubiquitin activating enzyme, UBA6.
  • the present inventors identified a domain in UBA6 that recognizes polyalanine- containing proteins and demonstrate that, under disease conditions, UBA6 preferentially interacts with different polyalanine-expanded proteins, thereby competing with USEl binding.
  • similar effects were confirmed in neurons derived from patients with disease-causing polyalanine expansion mutations, thus suggesting a previously undescribed vulnerability caused by polyalanine expansion mutations.
  • a method of treating a subject having a disease associated with a polyalanine expansion mutation comprising administering to the subject a therapeutically effective amount of an agent capable of specifically upregulating expression or activity of a ubiquitin like modifier activating enzyme 6 (UBA6) in nervous system cells of the subject, thereby treating the subject.
  • UUA6 ubiquitin like modifier activating enzyme 6
  • UUA6 ubiquitin like modifier activating enzyme 6
  • treating refers to inhibiting, preventing or arresting the development of a pathology (disease, disorder or condition) and/or causing the reduction, remission, or regression of a pathology.
  • pathology disease, disorder or condition
  • Those of skill in the art will understand that various methodologies and assays can be used to assess the development of a pathology, and similarly, various methodologies and assays may be used to assess the reduction, remission or regression of a pathology.
  • treating is by rescuing neuronal cells from cell death that is associated with and/or caused by the polyalanine expansion mutation.
  • the therapeutically effective amount of the agent causes a rescue of the neuronal cells from the cell death associated with and/or caused by the polyalanine expansion mutation.
  • polyalanine refers to a tract of at least 4 consecutive alanine residues in a polypeptide.
  • the polyalanine tract comprises at least 5, at least 6, at least?, at least 8, at least 9, e.g., at least 10, or more consecutive alanine residues in a polypeptide.
  • polyalanine expansion mutation refers to an increase in the number of alanine residues comprised in a polyalanine tract of a polypeptide as compared to the number of alanine residues comprised in a polyalanine tract of a corresponding wild-type polypeptide.
  • WT wild- type
  • a “wild- type (WT)” form of a polypeptide-of-interest refers to a polypeptide encoded by a gene that predominates in a population of human beings, preferably in a population of healthy individuals of the same ethnic origin or genetic background.
  • the polypeptide with the polyalanine expansion mutation exhibits an identical amino acid sequence to the corresponding wild-type polypeptide, except for a change in the length of the polyalanine tract.
  • the level of identity between two amino acid sequences is determined typically by structure (identical amino acid or similar amino acid) and position in both the query and reference sequence, as determined by an alignment tool such as a global alignment tool, e.g., the EMBOSS - 6.0.1 Needleman- Wunsch algorithm using default parameters.
  • an alignment tool such as a global alignment tool, e.g., the EMBOSS - 6.0.1 Needleman- Wunsch algorithm using default parameters.
  • wild-type polypeptides comprise more than one polyalanine tract, e.g., they may comprise 2, 3, 4 or more polyalanine tracts.
  • more than one polyalanine tract a person skilled in the art can distinguish and unequivocally define each polyalanine tract based on its amino acid concrete position within the polypeptide, and/or by the specific adjacent amino acid sequences of the polyalanine tract.
  • ARX wild-type polypeptide GenBank Accession No.
  • NP_620689; SEQ ID NO: 14) comprises 4 polyalanine tracts at the following amino acid positions: (i) 100-115; (ii) 144-155; (iii) 275-281; and (iv) 432- 440, with respect to the wild-type polypeptide having the amino acid sequence set forth by SEQ ID NO: 14.
  • polyalanine expansion mutations occurring in polyalanine tracts are associated with Mental retardation, Epilepsy, West syndrome and Partington syndrome.
  • polyalanine expansion mutation is associated with a disease.
  • the disease is associated with neuronal death.
  • the disease is associated with death of neurons of the autonomic nervous system
  • neuronal death was demonstrated in neurons, which were differentiated from iPSCs, having the genomic polyalanine expansion mutation in the PH0X2B gene associated with CCHS ( Figures 4F, 4G, 14D).
  • a polyalanine expansion mutation which is associated with a disease, causes a change in the secondary and/or tertiary structure of the polypeptide.
  • the change in the secondary and/or tertiary structure of the polypeptide affects the normal polypeptide’s cellular localization and/or function.
  • the polyalanine expansion mutation can result in altered cellular localization, protein-protein interactions, cell signaling, post-translational modifications (e.g., ubiquitination), proliferation, differentiation, and/or growth as compared to the corresponding wild-type polypeptides.
  • post-translational modifications e.g., ubiquitination
  • nuclear polypeptides e.g., transcription factors
  • transcription factors which exhibit polyalanine expansion mutations
  • cytoplasm of the cell instead of the nucleus of the cell, and thus they are incapable of performing their normal function in the nucleus.
  • the polypeptide having the polyalanine expansion mutation has an aberrant cellular localization as compared to a corresponding wild-type polypeptide.
  • the polypeptide having the polyalanine expansion mutation is cytoplasmic.
  • a polyalanine tract in the polyalanine expansion mutation comprises at least one additional alanine residue as compared to a polyalanine tract of a corresponding wild-type polypeptide.
  • OPMD Oculopharyngeal muscular dystrophy
  • a polyalanine tract in the polyalanine expansion mutation comprises 1-14 additional alanine residues in the polyalanine tract as compared to number of alanine residues in the polyalanine tract of a corresponding wild-type polypeptide.
  • Table 1 hereinbelow provides a non-limiting description of polypeptides having polyalanine expansion mutations and the diseases associated with such expansion mutations.
  • the polyalanine expansion mutation has an autosomal dominant mode of inheritance.
  • polyalanine expansion mutations in FOXL2, ZIC2, PHOX2B, RUNX2, H0XA13 and H0XD13 as well as some of the polyalanine expansion mutations in PABPN1 (e.g.,
  • the mutation occurs de novo in the genome of the affected individual and is absent from the genome of the parents of the affected individual. This is usually the case in mutations causing severe life-threatening conditions.
  • the polyalanine expansion mutation occurs de novo.
  • the polyalanine expansion mutation has an autosomal recessive mode of inheritance.
  • some of the polyalanine expansion mutations in PABPN1 e.g., 10 Alanine residues — 11 Alanine residues
  • the polyalanine expansion mutation has an X-linked recessive mode of inheritance.
  • polyalanine expansion mutations in ARX and SOX3 exhibit an X-linked recessive mode of inheritance.
  • the polyalanine expansion mutation occurs in a polypeptide selected from the group consisting of a paired like homeobox 2B (PH0X2B), aristaless related homeobox (ARX), SRY-box transcription factor 3 (SOX3), Zic family member 2 (ZIC2), forkhead box L2 (FOXL2), RUNX family transcription factor 2 (RUNX2), homeobox Al 3 (H0XA13), homeobox D13 (H0XD13), and poly(A) binding protein nuclear 1 (PABPN1).
  • a polypeptide selected from the group consisting of a paired like homeobox 2B (PH0X2B), aristaless related homeobox (ARX), SRY-box transcription factor 3 (SOX3), Zic family member 2 (ZIC2), forkhead box L2 (FOXL2), RUNX family transcription factor 2 (RUNX2), homeobox Al 3 (H0XA13), homeobox D13 (H0XD13), and poly(A
  • the disease is congenital central hypoventilation syndrome (CCHS); X-linked cognitive disability and epilepsy, West syndrome, Partington syndrome; X-linked cognitive disability with growth hormone deficiency; Holoprosencephaly type 5 (HPE5); Blepharophimosis-epicanthus inversus syndactyly; cleidocranial dysplasia (CCD); Hand-foot-genital syndrome; synpolydactyly; or oculopharyngeal muscular dystrophy (OPMD).
  • CCHS congenital central hypoventilation syndrome
  • HPE5 Holoprosencephaly type 5
  • CCD cleidocranial dysplasia
  • OPMD oculopharyngeal muscular dystrophy
  • the method of some embodiments of the invention is effected by administering to the subject a therapeutically effective amount of an agent capable of specifically upregulating expression or activity of a ubiquitin like modifier activating enzyme 6 (UBA6) in nervous system cells of the subject.
  • UUA6 ubiquitin like modifier activating enzyme 6
  • UAA6 ubiquitin like modifier activating enzyme 6
  • E1-L2 E1-L2
  • MOP-4 MOP-4
  • UE1L2 UAA1
  • the human UBA6 polypeptide (GenBank Accession No. NP_060697.4, SEQ ID NO: 23) is encoded by a polynucleotide as set forth by SEQ ID NO: 24 (GenBank Accession No. NM_018227.6).
  • upregulating expression of UBA6 refers to increasing the level of the UBA6 polypeptide or the level of at least a functional portion thereof, which is capable of binding to USE1, e.g., which forms a complex with USEl.
  • upregulating activity of UBA6 refers to an El activity of UBA6 such as, without being bound by theory, increasing at least the ability of UBA6 to transfer ubiquitin molecule(s) to USEl.
  • UBE2Z ubiquitin conjugating enzyme E2 Z
  • UBE2Z ubiquitinates proteins which participate in signaling pathways and apoptosis.
  • Exemplary amino acid and nucleic acid sequences for USEl polypeptide and polynucleotide are provided in GenBank Accession Nos. NP_075567 (SEQ ID NO: 27), and NM_023079.5 (SEQ ID NO: 28).
  • the present inventors have identified a polyalanine motif in USE1 (amino acids 47-52 of SEQ ID NO: 27), which contributes to USE1 ubiquitin loading by UBA6 ( Figures 5B, IB, 1C, 6A, and 6B) and which is essential for ubiquitination of the target protein E6AP and the subsequent degradation thereof as is shown in Figure IE.
  • the functional portion of UBA6 comprises the SCCH domain of UBA6 (as set forth by SEQ ID NO: 25) or a functional homologous polypeptide thereof.
  • the phrase “functional homologue of SCCH”, refers to a polypeptide comprising an amino acid sequence having at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% global sequence identity to amino acids 1-267 of SEQ ID NO: 25, and which specifically binds to a USE1 polypeptide as set forth by SEQ ID NO: 27, or to a peptide consisting of a polyalanine tract of 7- alanine residues as set forth by SEQ ID NO: 22.
  • global sequence identity refers to an identity over the entire amino acid or nucleic acid sequences of the invention and not over portions thereof.
  • the degree of homology or identity between two or more sequences can be determined using various known sequence comparison tools. Following is a non- limiting description of such tools which can be used along with some embodiments of the invention .
  • the EMBOSS-6.0.1 Needleman- Wunsch algorithm (available from emboss(dot)sourceforge(dot)net/apps/cvs/emboss/apps/needle(dot)html) can be used to find the optimum alignment (including gaps) of two sequences along their entire length - a “Global alignment”.
  • the functional homologous polypeptide of UBA6 comprises lysine and arginine positively-charged amino acid residues at positions which correspond to the following amino acid positions in the wild-type UBA6 polypeptide (SEQ ID NO: 23): Lys628, Arg691, Lys714 and Lys709.
  • the agent upregulates expression level of the UBA6 polypeptide.
  • the agent is a polynucleotide encoding at least a functional portion of the UBA6 comprising the SCCH domain or a functional homologous polypeptide thereof.
  • SEQ ID NO: 26 is an exemplary polynucleotide which encodes the SCCH domain of UBA6.
  • the agent is a polypeptide comprising at least a functional portion of UBA6 comprising the SCCH domain or a functional homologous polypeptide thereof.
  • the agent is capable of rescuing neuronal cells from cell death.
  • an agent such as a UBA6 polypeptide was capable of rescuing neuronal cells from cell death which was associated with the polyalanine expansion mutation in CCHS ( Figures 4F, 4G, 14D).
  • Methods of qualifying agents for their ability to rescue cells (such as neuronal cells) from cell death include, for example, the TUNEE assay, which detects DNA fragmentation (e.g., using a TUNEL Assay Kit (e.g., Abeam, ab66108)) and an apoptosis assay, which detects cell surface exposure of phosphatidylserine using, e.g., the Annexin V-FETC apoptosis detection kit (e.g., Merck, CBA059).
  • TUNEE assay which detects DNA fragmentation (e.g., using a TUNEL Assay Kit (e.g., Abeam, ab66108))
  • an apoptosis assay which detects cell surface exposure of phosphatidylserine using, e.g., the Annexin V-FETC apoptosis detection kit (e.g., Merck, CBA059).
  • Polypeptides comprising at least a functional portion of UBA6 comprising the SCCH domain or a functional homologous polypeptide thereof can be chemically synthesized using well- known protein synthesis methods, which are further described hereinbelow.
  • polypeptides comprising at least a functional portion of UBA6 comprising the SCCH domain or a functional homologous polypeptide thereof can be recombinantly expressed from a polynucleotide comprising at least the nucleic acid sequence set forth in SEQ ID NO: 26, or a nucleic acid sequence encoding a functional homologous polypeptide thereof.
  • Suitable non-limiting polynucleotides include the nucleic acid sequences set forth by SEQ NO: 24 (UBA6 coding sequence) and/or SEQ ID NO: 26 (SCCH domain of UBA6 coding sequence).
  • tagged polypeptides such as those encoded by as SEQ ID NO: 61 (SCCH domain of UBA6 with His-Tag, coding sequence), SEQ ID NO: 66 (UBA6 with HA-tag, coding sequence) or SEQ ID NO: 68 (UBA6 with Hise-tag, coding sequence) can be used.
  • SEQ ID NO: 61 SCCH domain of UBA6 with His-Tag, coding sequence
  • SEQ ID NO: 66 UAA6 with HA-tag, coding sequence
  • SEQ ID NO: 68 UAA6 with Hise-tag, coding sequence
  • Upregulation of the UBA6 in a cell can be also achieved by means of gene therapy as is further described hereinbelow.
  • polynucleotide refers to a single or double stranded nucleic acid sequence which is isolated and provided in the form of an RNA sequence, a complementary polynucleotide sequence (cDNA), a genomic polynucleotide sequence and/or a composite polynucleotide sequences (e.g., a combination of the above).
  • isolated refers to at least partially separated from the natural environment e.g., from a human body or a cell.
  • the polynucleotide is an mRNA molecule.
  • the polynucleotide is comprised in a nucleic acid construct suitable for in-vivo delivery into nervous system cells of the subject.
  • Suitable nucleic acid constructs are provided hereinunder.
  • the present inventors show gene delivery of UBA6 using a lentiviral vector transduction of CCHS patient-derived neurons ( Figures 4F, 4G, and 141).
  • Qualifying the ability of the agent of some embodiments of the invention to upregulate expression or activity of UBA6 can be done by protein detection level (e.g., of UBA6) and/or activity assays (e.g., ubiquitination assays on target proteins; assessing stability of target proteins; and/or survival of neuronal cells).
  • protein detection level e.g., of UBA6
  • activity assays e.g., ubiquitination assays on target proteins; assessing stability of target proteins; and/or survival of neuronal cells.
  • Methods of detecting expression and/or activity of the polypeptides of some embodiments of the invention include, but are not limited to in-gel fluorescence assay (described in, e.g., han Attali et al., 2017. “Ubiquitylati on-dependent oligomerization regulates activity ofNedd4 ligases”. EMBO J.
  • Enzyme linked immunosorbent assay ELISA
  • Western blot analysis Radio-immunoassay (RIA); Fluorescence activated cell sorting (FACS); Immuno histochemical analysis; immunofluorescence analysis; in situ activity assay; and in vitro activity assays, all of which are well-known in the art.
  • RIA Radio-immunoassay
  • FACS Fluorescence activated cell sorting
  • in-gel fluorescence assay is based on detecting interactions between a fluorescently-labeled polypeptide with a non-labeled counterpart (e.g., a substrate or a polypeptide), and/or between polypeptides and a fluorescently-labeled substrate.
  • a fluorescently-labeled polypeptide with a non-labeled counterpart (e.g., a substrate or a polypeptide), and/or between polypeptides and a fluorescently-labeled substrate.
  • an in-gel fluorescence assay can employ a fluorescently-labeled ubiquitin molecule and/or a fluorescently-labeled enzyme of the ubiquitin cascade (e.g., El, E2 or E3).
  • the complexes can be resolved by SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) and be further visualized using a laser scanner at a suitable wavelength, e.g., Ubiquitin conjugates which are labeled with fluorescein can be visualized in a Typhoon laser scanner at 488 nm
  • SDS-PAGE sodium dodecyl sulfate-polyacrylamide gel electrophoresis
  • In situ activity assay According to this method, a chromogenic substrate is applied on the cells containing an active enzyme and the enzyme catalyzes a reaction in which the substrate is decomposed to produce a chromogenic product visible by a light or a fluorescent microscope.
  • In vitro activity assays In these methods the activity of a particular enzyme is measured in a protein mixture extracted from the cells. The activity can be measured in a spectrophotometer well using colorimetric methods or can be measured in a non- denaturing acrylamide gel (z.e., activity gel). Following electrophoresis the gel is soaked in a solution containing a substrate and colorimetric reagents. The resulting stained band corresponds to the enzymatic activity of the protein of interest. If well calibrated and within the linear range of response, the amount of enzyme present in the sample is proportional to the amount of color produced. An enzyme standard is generally employed to improve quantitative accuracy.
  • the agent upregulates activity of the UBA6 polypeptide.
  • Determination of the activity of UBA6 can be performed by ubiquitination assays which are well known in the art and which are further described hereinbelow.
  • the agent capable of specifically upregulating expression or activity of UBA6 stabilizes and/or increases the level of a complex formed between at least a functional portion of UBA6 comprising the SCCH domain and USE1.
  • Methods of detecting presence or level of a complex between at least a functional portion of UBA6 comprising the SCCH domain and USE1 include Western blot, immunoprecipitation analyses, Forster resonance energy transfer (FRET; reviewed e.g., in Bram Prevo et al., 2014. “Forster resonance energy transfer and kinesin motor proteins”; Chem Soc Rev 43(4): 1144-55, which is fully incorporated herein by reference in its entirety), fluorescence lifetime imaging microscopy (FUM; reviewed in Hellen C Ishikawa- Ankerhold et al., 2012. “Advanced fluorescence microscopy techniques--FRAP, FLIP, FEAP, FRET and FUM”.
  • microscale thermophoresis MST; described e.g., in Moran Jerabek- Willemsen 2012. “Molecular interaction studies using microscale thermophoresis”. Assay Drug Dev Technol. 9(4):342-53, which is fully incorporated herein by reference in its entirety), biophysical analysis of proteinprotein interactions (reviewed e.g., in Mahalakshmi Harish; et al. 2021. “Evolution of biophysical tools for quantitative protein interactions and drug discovery”. REVIEW ARTICLE. Emerging Topics in Life Science.
  • IP immunoprecipitation
  • polypeptides For generation of a complex which comprise UBA6 and USE1 in vitro these polypeptides are produced by recombinant techniques to include a detectable moiety such as hemagglutinin (HA), FLAG, GST, and/or a histidine tag (His6), which are identifiable by their respective antibodies.
  • a detectable moiety such as hemagglutinin (HA), FLAG, GST, and/or a histidine tag (His6), which are identifiable by their respective antibodies.
  • IP immunoprecipitation
  • the immunocomplexes are then washed with the IP buffer, and boiled (e.g., at 95°C for 5 minutes in Laemmli sample buffer containing 5% beta- mercaptoethanol) before being separated by SDS-PAGE for Western blotting assays.
  • the cells can be treated with a proteasome inhibitor MG132 (e.g., 10 pM) during the last 6 hours before lysis with the IP buffer supplemented with a protease inhibitor (e.g., 1 mM PMSF) and/or with a cysteine protease inhibitor such as iodoacetamide.
  • a proteasome inhibitor MG132 e.g. 10 pM
  • a protease inhibitor e.g., 1 mM PMSF
  • a cysteine protease inhibitor such as iodoacetamide.
  • the present inventors have uncovered that an agent which specifically upregulates the expression level or activity of UBA6 in cells of the nervous system can increase ubiquitination of a target protein of the UBA6-USE1 ubiquitination enzymes, e.g., E6AP (Example 6 of the Examples section which follows, and Figure 15), thus suggesting that such an agent can increase E6AP proteasome-mediated degradation.
  • E6AP ubiquitination of a target protein of the UBA6-USE1 ubiquitination enzymes
  • the agent is capable of increasing ubiquitination of a UBA6 target protein.
  • the UBA6 target protein is E6AP.
  • the agent is a peptide of 5-10 alanine residues.
  • an agent such as a 7-Alanine residue peptide can increase ubiquitination of a UBA6 target protein, e.g., E6AP ( Figure 15).
  • peptide encompasses native peptides (either degradation products, synthetically synthesized peptides or recombinant peptides) and peptidomimetics (typically, synthetically synthesized peptides), as well as peptoids and semipeptoids which are peptide analogs, which may have, for example, modifications rendering the peptides more stable while in a body or more capable of penetrating into cells. Such modifications include, but are not limited to N terminus modification, C terminus modification, peptide bond modification, backbone modifications, and residue modification. Methods for preparing peptidomimetic compounds are well known in the art and are specified, for example, in Quantitative Drug Design, C.A. Ramsden Gd., Chapter 17.2, F. Choplin Pergamon Press (1992), which is incorporated by reference as if fully set forth herein. Further details in this respect are provided hereinunder.
  • Natural aromatic amino acids, Trp, Tyr and Phe may be substituted by non-natural aromatic amino acids such as l,2,3,4-tetrahydroisoquinoline-3-carboxylic acid (Tic), naphthylalanine, ring- methylated derivatives of Phe, halogenated derivatives of Phe or O-methyl- Tyr.
  • the peptides of some embodiments of the invention may also include one or more modified amino acids or one or more non-amino acid monomers (e.g. fatty acids, complex carbohydrates etc.).
  • amino acid or “amino acids” is understood to include the 20 naturally occurring amino acids; those amino acids often modified post-translationally in vivo, including, for example, hydroxyproline, phosphoserine and phospho threonine; and other unusual amino acids including, but not limited to, 2-aminoadipic acid, hydroxylysine, isodesmosine, nor-valine, nor-leucine and ornithine.
  • amino acid includes both D- and L-amino acids.
  • Table 2 below lists non- conventional or modified amino acids (e.g., synthetic, Table 1) which can be used with some embodiments of the invention.
  • peptides of some embodiments of the invention are preferably utilized in a linear form, although it will be appreciated that in cases where cyclicization does not severely interfere with peptide characteristics, cyclic forms of the peptide can also be utilized.
  • peptides of some embodiments of the invention are preferably utilized in a linear form, although it will be appreciated that in cases where cyclicization does not severely interfere with peptide characteristics, cyclic forms of the peptide can also be utilized.
  • the agent is a peptide of 5-9 alanine residues.
  • the agent is a peptide of 5-8 alanine residues.
  • the agent is a peptide of 5-7 alanine residues.
  • Non-limiting exemplary peptide sequences are provided in SEQ ID NOs: 22, 29 and 30.
  • the agent is a peptide of 5-6 alanine residues.
  • the agent is a peptide of 5 alanine residues.
  • the peptide stabilizes the protein complex formed between the UBA6 and USE1.
  • the agent of some embodiments of the invention which is capable of specifically upregulating expression or activity of UBA6, and as such increases ubiquitination of E6AP, can be used to reduce the level of E6AP in a subject having autism spectrum disorders (ASDs) associated with abnormally high levels of E6AP.
  • ASDs autism spectrum disorders
  • a method of treating a subject diagnosed with autism spectrum disorders comprising administering to the subject a therapeutically effective amount of an agent capable of upregulating expression or activity of a ubiquitin like modifier activating enzyme 6 (UBA6) in nervous system cells of the subject, thereby treating the subject.
  • an agent capable of upregulating expression or activity of a ubiquitin like modifier activating enzyme 6 (UBA6) in nervous system cells of the subject, thereby treating the subject.
  • UUA6 ubiquitin like modifier activating enzyme 6
  • the ASD is associated with increased levels of E6AP in the nervous system cells.
  • Figure 15 demonstrates that a peptide of 7-alanine residues (SEQ ID NO: 22) can increase E6AP poly- ubiquitination.
  • the agent for treating the ASD is a peptide having a polyalanine tract of 5-10 alanine residues, e.g., having a polyalanine tract of 5-9 alanine residues, e.g., having a polyalanine tract of 5-8 alanine residues, e.g., having a polyalanine tract of 5-7 alanine residues, e.g., having a polyalanine tract of 5-6 alanine residues.
  • the agent for treating the ASD is a peptide having a polyalanine tract of 5-alanine residues.
  • the agent for treating ASD which is associated with increased levels of E6AP in the nervous system cells, is a peptide comprising an amino acid sequence consisted of SEQ ID NO: 29.
  • the agent for treating the ASD is a peptide having a polyalanine tract of 6-alanine residues.
  • the agent for treating ASD which is associated with increased levels of E6AP in the nervous system cells, is a peptide comprising an amino acid sequence consisted of SEQ ID NO: 30.
  • the agent for treating the ASD is a peptide having a polyalanine tract of 7 alanine residues.
  • the agent for treating ASD which is associated with increased levels of E6AP in the nervous system cells, is a peptide comprising an amino acid sequence consisted of SEQ ID NO: 22.
  • a method of increasing ubiquitination of an E6AP polypeptide in a cell comprising contacting the cell with a therapeutically effective amount of an agent capable of upregulating expression or activity of a ubiquitin like modifier activating enzyme 6 (UBA6) in the cell, thereby increasing the ubiquitination of the E6AP polypeptide in the cell.
  • UUA6 ubiquitin like modifier activating enzyme 6
  • contacting is effected ex vivo.
  • the cell is a nervous system cell.
  • the cell is of peripheral nervous system.
  • the cell is an autonomous neuron of the peripheral nervous system
  • the cell is obtained from a subject diagnosed with a disease characterized by abnormally high levels of an E6AP polypeptide.
  • the cell is obtained from a subject diagnosed with autism spectrum disorders (ASDs).
  • ASDs autism spectrum disorders
  • contacting is effected in vivo.
  • contacting of the agent with the cell is achieved by administering the agent to the subject in need thereof.
  • the subject is diagnosed with a disease characterized by abnormally high levels of an E6AP polypeptide.
  • the subject is diagnosed with autism spectrum disorders (ASDs).
  • ASDs autism spectrum disorders
  • a method of generating neurons with a polyalanine expansion mutation comprising subjecting induced pluripotent stem cells (iPSCs) which comprise a genomic polyalanine expansion mutation to culture conditions suitable for differentiating the iPSCs into neurons, thereby generating the neurons with the polyalanine expansion mutation.
  • iPSCs induced pluripotent stem cells
  • pluripotent stem cells refers to cells which can differentiate into all three embryonic germ layers, z.e., ectoderm, endoderm and mesoderm or remaining in an undifferentiated state.
  • the pluripotent stem cells include embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs).
  • iPSCs embryonic-like stem cells
  • pluripotent stem cells are cells obtained by de-differentiation of adult somatic cells, which are endowed with pluripotency (z.e., being capable of differentiating into the three embryonic germ cell layers, i.e., endoderm, ectoderm and mesoderm).
  • such cells are obtained from a differentiated tissue (e.g., a somatic tissue such as skin) and undergo de-differentiation by genetic manipulation which re-program the cell to acquire embryonic stem cells characteristics.
  • a differentiated tissue e.g., a somatic tissue such as skin
  • iPSCs can be obtained by retroviral transduction of somatic cells such as skin cells, fibroblasts, hepatocytes, gastric epithelial cells with transcription factors such as Oct-3/4, Sox2, c-Myc, and KEF4 [Yamanaka S, Cell Stem Cell. 2007, l(l):39-49; Aoi T, et al., Generation of Pluripotent Stem Cells from Adult Mouse Liver and Stomach Cells. Science. 2008 Feb 14. (Epub ahead of print); IH Park, Zhao R, West JA, et al. Reprogramming of human somatic cells to pluripotency with defined factors. Nature 2008;451: 141-146; K Takahashi, Tanabe K, Ohnuki M, et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 2007;131:861-872],
  • the induced pluripotent stem cells are formed by inducing the expression of Oct-4, Sox2, Kfl4 and c-Myc in a somatic stem cell.
  • the culture conditions are suitable for differentiating the iPSCs into peripheral autonomic neurons.
  • the iPSCs are generated by de- differentiation of a skin biopsy of a subject having the genomic polyalanine expansion mutation.
  • the genomic polyalanine expansion mutation is endogenous to the cells used to generate the iPSCs.
  • subjecting the iPSCs, which comprise a genomic polyalanine expansion mutation, to culture conditions suitable for differentiating the iPSCs into neurons comprises the steps of:
  • NMPs neuromesodermal progenitor cells
  • culturing in step (a) is performed for 2- 4 days, e.g., about 3 days.
  • the culture medium suitable for induction of iPSCs into neuromesodermal progenitor cells comprises glycogen synthase kinase 3 (GSK-3) inhibitor (e.g., CHIR 99021) and an ALK5 (activin receptor-like kinase 5) inhibitor (e.g., SB431542).
  • GSK-3 glycogen synthase kinase 3
  • ALK5 activin receptor-like kinase 5 inhibitor
  • the CHIR 99021 is provided at a concentration of 0.5-5 mM, e.g., about 1.5 mM.
  • the SB431542 is provided at a concentration ofl-100 pM, e.g., about 10 pM.
  • culturing in step (b) is performed for 6- 8 days, e.g., about 7 days.
  • the culture medium suitable for induction of NMPs into sympathetic neural crest comprises basic fibroblast growth factor (FGF2, bFGF), bone morphogenic protein 4 (BMP4) and retinoic acid (RA).
  • FGF2 basic fibroblast growth factor
  • BMP4 bone morphogenic protein 4
  • RA retinoic acid
  • the culture medium comprises Sonic hedgehog (SHH) instead of BMP4.
  • SHH Sonic hedgehog
  • the culture medium suitable for induction of NMPs into sympathetic neural crest comprises basic fibroblast growth factor (FGF2, bFGF), Sonic hedgehog (SHH) and retinoic acid (RA).
  • FGF2 basic fibroblast growth factor
  • SHH Sonic hedgehog
  • RA retinoic acid
  • the bFGF is provided at a concentration of 10-200 ng/ml, e.g., about 20 ng/ml.
  • the BMP4 is provided at a concentration of 10-200 ng/ml, e.g., about 50 ng/ml.
  • the SHH is provided at a concentration of 50-200 ng/ml, e.g., 100 ng/ml.
  • the retinoic acid (RA) is provided at a concentration of 10-1000 nM, e.g., about 100 nM.
  • culturing in step (c) is performed for 6- 8 days, e.g., about 7 days.
  • the culture medium suitable for induction of sympathetic neuroblast crest comprises basic fibroblast growth factor (FGF2, bFGF), bone morphogenic protein 4 (BMP4) and epidermal growth factor (EGF).
  • FGF2 basic fibroblast growth factor
  • BMP4 bone morphogenic protein 4
  • EGF epidermal growth factor
  • the culture medium suitable for induction of sympathetic neuroblast crest comprises basic fibroblast growth factor (FGF2, bFGF), Sonic hedgehog (SHH) and epidermal growth factor (EGF).
  • FGF2 basic fibroblast growth factor
  • SHH Sonic hedgehog
  • EGF epidermal growth factor
  • the EGF is provided at a concentration of 10-1000 ng/ml, e.g., about 20 ng/ml.
  • culturing in step (c) is performed for 12-16 days, e.g., about 14 days.
  • the culture medium suitable for induction of sympathetic neuronal maturation comprises nerve growth factor (NFG), glial cell derived neurotrophic factor (GDNF) and brain derived neurotrophic factor (BDNF).
  • nerve growth factor nerve growth factor
  • GDNF glial cell derived neurotrophic factor
  • BDNF brain derived neurotrophic factor
  • the iPSCs are separated to single cell suspensions (suspensions in which the cells are single cells and not cell clusters) using for example, a Versene solution (Gibco, 15040033), Accutase (StemPro, Thermofisher), TrypleE or trypsin.
  • a Versene solution Gibco, 15040033
  • Accutase StemPro, Thermofisher
  • TrypleE Trypsin.
  • Evaluation of differentiation into the neuronal cells is performed using immunocytochemistry or FACS analysis using the pan neuronal marker Tuj la, the dendritic marker MAP2ab, the peripheral neuronal marker Peripherin, the chemosensitive markers ATOH1 and PHOX2B, the sympathetic markers dopamine beta-hydroxylase (DBH) and/or Tyrosine hydroxylase (TH).
  • PSCs pluripotent stem cells
  • iPSCs induced pluripotent stem cells
  • the PSCs Prior to initiation of differentiation, the PSCs are cultured on MATRIGEL or mouse embryonic fibroblasts (MEFs) in a pluripotent stem cells culture medium such as Nutristem (Sartorius, 05- 100-1 A) or mTeSR/mTeSRl (Stemcell technologies), or knockout serum based ‘homebrewed’ medium preferably to a confluence of about 1 million cells/well.
  • a pluripotent stem cells culture medium such as Nutristem (Sartorius, 05- 100-1 A) or mTeSR/mTeSRl (Stemcell technologies), or knockout serum based ‘homebrewed’ medium preferably to a confluence of about 1 million cells/well.
  • the PSCs are washed with a phosphate buffered saline (PBS) and single cell suspensions are prepared (e.g., using Versene solution (Gibco, 15040033), Accutase (StemPro, Thermofisher), TrypleE or trypsin for about 2 minutes), and then the single cell PSCs are transferred to Poly-Hema (2-hydroxyethyl methacrylate)-coated flasks (e.g., T25 flasks) or commercially available low adherent flasks at a concentration of about 350,000 cells/ml.
  • the single cell PSCs are cultured in a neuromesodermal progenitor cell induction (NMP) medium for the formation of aggregates.
  • NMP neuromesodermal progenitor cell induction
  • the NMP medium comprises an Essential 6 medium (Gibco) or DMEM:F12 medium, and several inhibitors, such as CHIR 99021 (e.g., at a concentration of 0.5-5 mM, e.g., about 1.5 mM), SB431542 (e.g., at a concentration of 1-100 pM, e.g., about 10 pM), ROCK inhibitor (e.g., at a concentration of 1-20 pM, e.g., about 10 pM) and preferably also a Penicillin-Streptomycin-Amphotericin B solution (PSA, Sartorius).
  • PSA Penicillin-Streptomycin-Amphotericin B solution
  • the medium is replaced with sympathetic (NCi) neural crest induction medium containing an Essential 6 medium or DMEM:F12 medium, supplemented with CHIR 99021 (e.g., at a concentration of 0.5-5 mM, e.g., about 1.5 mM), bFGF (basic fibroblast growth factor) (e.g., at a concentration of 10-200 ng/ml, e.g., about 20 ng/ml), bone morphogenetic protein 4 (BMP4) or BMP2; at a concentration of 10-200 ng/ml, e.g., about 50 ng/ml), retinoic acid (e.g., all trans retinoic acid at a concentration of 10- 1000 nM, e.g., about 100 nM), and preferably also PSA.
  • CHIR 99021 e.g., at a concentration of 0.5-5 mM, e.g., about 1.5 mM
  • bFGF basic fibroblast
  • the culture is dissociated into single cells using Versene solution (Gibco, 15040033), Accutase (StemPro, Thermofisher), TrypleE or trypsin for about 2 minutes) (e.g., by incubation for about 4 minutes at 37°C), and the cells are cultured in sympathetic neuroblast induction and propagation (NCC) medium, comprising neurobasal medium or DMEM:F12, supplemented with bFGF (e.g., at a concentration of 10-1000 ng/ml, e.g., about 20 ng/ml), BMP4 or BMP2 (e.g., at a concentration of 10-200 ng/ml, e.g., about 50 ng/ml), EGF (epidermal growth factor) (e.g., at a concentration of 10-1000 ng/ml, e.g., about 20 ng/ml), heparin (e.g., at a concentration of 1-10 pg
  • NCC medium is replaced with NCC medium without ROCKi and half of the medium is replaced every other day.
  • medium is preferably replaced with sympathetic neuronal maturation medium (NMM medium) comprising neurobasal medium, B27, N2, GDNF (glial cell derived neurotrophic factor) (e.g., at a concentration of 1-100 ng/ml, e.g., about 10 ng/ml), BDNF (brain derived neurotrophic factor, e.g., at a concentration of 1-100 ng/ml, e.g., about 10 ng/ml), NGF (nerve growth factor; e.g., at a concentration of 1-100 ng/ml, e.g., about 10 ng/ml), GlutaMAX or glutamine, and preferably PSA.
  • NMM medium sympathetic neuronal maturation medium
  • GDNF glial cell derived neurotrophic factor
  • BDNF brain derived neurotrophic factor
  • NGF nerve growth factor
  • a method of screening for an agent capable of modulating expression or activity of a ubiquitin like modifier activating enzyme 6 comprising: (a) contacting neurons comprising a genomic polyalanine expansion mutation with a plurality of molecules,
  • the neurons are differentiated in vitro from induced pluripotent stem cells (iPSCs) comprising a genomic polyalanine expansion mutation.
  • iPSCs induced pluripotent stem cells
  • contacting is in the presence of a functional portion of the UBA6 comprising a second catalytic cysteine half (SCCH) domain or a functional homologous polypeptide thereof.
  • SCCH catalytic cysteine half
  • identifying the at least one molecule of the plurality of molecules which modulates the complex formed by the UBA6 and USE1 is effected by monitoring ubiquitination level of a target polypeptide.
  • the target polypeptide is E6AP.
  • Ubiquitin protein ligase E3A (UBE3A, also known as “E6-AP” or “E6AP”) is part of the ubiquitin protein degradation system, and interactions of UBE3A with the E6 protein of human papillomavirus types 16 and 18 are known to result in ubiquitination and proteolysis of tumor protein p53. Maternally inherited deletions or point mutations in UBE3A cause Angelman Syndrome. On the other hand, copy number variations (CNVs) that result in the overexpression of E6AP are strongly associated with the development of autism spectrum disorders (ASDs) (Khatri Natasha et al., 2019. Front Mol Neurosci. 12: 109).
  • ASDs autism spectrum disorders
  • NP_000453.2 SEQ ID NO: 31
  • NP_001341434.1 SEQ ID NO: 32
  • NP_001341435.1 SEQ ID NO: 33
  • NP_001341436.1 SEQ ID NO: 34
  • NP_001341437.1 SEQ ID NO: 35
  • NP_001341438.1 SEQ ID NO: 36
  • NP_001341440.1 SEQ ID NO: 37
  • NP_001341441.1 SEQ ID NO: 38
  • NP_001341442.1 SEQ ID NO: 39
  • NP_001341452.1 SEQ ID NO: 40
  • NP_001341455.1 SEQ ID NO: 41
  • NP_001341467.1 SEQ ID NO: 42
  • NP_001341468.1 SEQ ID NO: 43
  • the E6AP polypeptide which is used by the method, for monitoring ubiquitination level thereof is the polypeptide set forth by SEQ ID NO: 31.
  • tagged polypeptides can be used, such as HA-tagged E6AP isoform II as set forth by SEQ ID NO: 63 (e.g., encoded by SEQ ID NO: 64).
  • contacting is effected in vivo.
  • contacting is effected ex vivo.
  • the cell is a nervous system cell.
  • modulating is upregulating the expression or activity of the UBA6 in a cell, such as a cell of the nervous system
  • modulating is downregulating the expression or activity of the UBA6 in in a cell, such as a cell of the nervous system
  • the method further comprising synthesizing the identified agent.
  • the identified agent which is capable of upregulating the expression or activity of the UBA6 in a cell (e.g., in a cell of the nervous system) is used for treating a disorder of the autism spectrum disorders (ASDs) associated with abnormally high levels of the E6AP in neuronal cells of the subject.
  • ASDs autism spectrum disorders
  • the identified agent which is capable of downregulating the expression or activity of the UBA6 in a cell (e.g., in a cell of the nervous system), can be used for treating a disorder associated with abnormally low levels of the E6AP in neuronal cells of the subject (such as Angelman syndrome that is caused by loss of function of E6AP).
  • An agent capable of upregulating expression of a UBA6 may be an exogenous polynucleotide sequence designed and constructed to express UBA6 or at least a functional portion thereof comprising the SCCH domain as described hereinabove. Accordingly, the exogenous polynucleotide sequence may be a DNA or RNA sequence encoding UB A6 or at least a functional portion thereof comprising the SCCH domain, capable of binding to USE1 and/or increasing the ability of UBA6 to transfer ubiquitin molecule(s) to USEl.
  • a polynucleotide sequence encoding a UBA6 (GenBank Accession number NP_060697.4 (SEQ ID NO: 23)) or at least a functional portion thereof comprising the SCCH domain (SEQ ID NO: 25) is preferably ligated into a nucleic acid construct suitable for mammalian cell expression.
  • a nucleic acid construct includes a promoter sequence for directing transcription of the polynucleotide sequence in the cell in a constitutive or inducible manner.
  • nucleic acid construct of some embodiments of the invention can also utilize UBA6 homologues which exhibit the desired activity (such as binding to USE1 , and/or increasing ability of UBA6 to transfer ubiquitin molecule(s) to USE1).
  • Such homologues may exhibit, for example, at least 60%, at least 65%, at least 70%, at least 75%, at least 80 %, at least 81 % , at least 82 % , at least 83 % , at least 84 % , at least 85 % , at least 86 % , at least 87 % , at least 88 %, at least 89 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100 % sequence identity (e.g., global sequence identity) to SEQ ID NO:23 or 26, as determined using the BestFit software of the Wisconsin sequence analysis package, utilizing the Smith and Waterman algorithm, where gap weight equals 50, length weight equals 3, average match equals 10 and average mismatch equals -9.
  • sequence identity e.g.,
  • Constitutive promoters suitable for use with some embodiments of the invention are promoter sequences which are active under most environmental conditions and most types of cells such as the cytomegalovirus (CMV) and Rous sarcoma virus (RSV).
  • Inducible promoters suitable for use with some embodiments of the invention include for example inducible promoters such as the tetracycline- inducible promoter (Zabala M, et al., Cancer Res. 2004, 64(8): 2799-804).
  • the promoter is a cytomegalovirus (CMV).
  • CMV cytomegalovirus
  • the nucleic acid construct (also referred to herein as an "expression vector") of some embodiments of the invention includes additional sequences which render this vector suitable for replication and integration in prokaryotes, eukaryotes, or preferably both (e.g., shuttle vectors).
  • a typical cloning vectors may also contain a transcription and translation initiation sequence, transcription and translation terminator and a polyadenylation signal.
  • such constructs will typically include a 5' LTR, a tRNA binding site, a packaging signal, an origin of second-strand DNA synthesis, and a 3' LTR or a portion thereof.
  • the nucleic acid construct of some embodiments of the invention typically includes a signal sequence for secretion of the peptide from a host cell in which it is placed.
  • the signal sequence for this purpose is a mammalian signal sequence or the signal sequence of the polypeptide variants of some embodiments of the invention.
  • Eukaryotic promoters typically contain two types of recognition sequences, the TATA box and upstream promoter elements.
  • the TATA box located 25-30 base pairs upstream of the transcription initiation site, is thought to be involved in directing RNA polymerase to begin RNA synthesis.
  • the other upstream promoter elements determine the rate at which transcription is initiated.
  • the promoter utilized by the nucleic acid construct of some embodiments of the invention is active in the specific cell population transformed.
  • neuron- specific promoters include the neurofilament promoter [Byrne et al. (1989) Proc. Natl. Acad. Sci. USA 86:5473-5477], human Synapsin I promoter (Thiel G., et al., 1991; Proc Natl Acad Sci USA 88(8):3431-5), human calmodulin- dependent kinase (CaMKII) promoter (Joana E Coelho et al., 2014. Front Psychiatry. 5:67), and Nestin promoter (Hirokazu Kambara 2005; Cancer Res. 65(7):2832-9).
  • Enhancer elements can stimulate transcription up to 1,000 fold from linked homologous or heterologous promoters. Enhancers are active when placed downstream or upstream from the transcription initiation site. Many enhancer elements derived from viruses have a broad host range and are active in a variety of tissues. For example, the SV40 early gene enhancer is suitable for many cell types. Other enhancer/promoter combinations that are suitable for some embodiments of the invention include those derived from polyoma virus, human or murine cytomegalovirus (CMV), the long-term repeat from various retroviruses such as murine leukemia virus, murine or Rous sarcoma virus and HIV. See, Enhancers and Eukaryotic Expression, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. 1983, which is incorporated herein by reference.
  • CMV cytomegalovirus
  • the promoter is preferably positioned approximately the same distance from the heterologous transcription start site as it is from the transcription start site in its natural setting. As is known in the art, however, some variation in this distance can be accommodated without loss of promoter function .
  • Polyadenylation sequences can also be added to the expression vector in order to increase the efficiency of UBA6 mRNA translation.
  • Two distinct sequence elements are required for accurate and efficient polyadenylation: GU or U rich sequences located downstream from the polyadenylation site and a highly conserved sequence of six nucleotides, AAUAAA, located 11- 30 nucleotides upstream.
  • Termination and polyadenylation signals that are suitable for some embodiments of the invention include those derived from SV40 .
  • the expression vector of some embodiments of the invention may typically contain other specialized elements intended to increase the level of expression of cloned nucleic acids or to facilitate the identification of cells that carry the recombinant DNA.
  • a number of animal viruses contain DNA sequences that promote the extra chromosomal replication of the viral genome in permissive cell types. Plasmids bearing these viral replicons are replicated episomally as long as the appropriate factors are provided by genes either carried on the plasmid or with the genome of the host cell .
  • the vector may or may not include a eukaryotic replicon. If a eukaryotic replicon is present, then the vector is amplifiable in eukaryotic cells using the appropriate selectable marker. If the vector does not comprise a eukaryotic replicon, no episomal amplification is possible. Instead, the recombinant DNA integrates into the genome of the engineered cell, where the promoter directs expression of the desired nucleic acid.
  • the expression vector of some embodiments of the invention can further include additional polynucleotide sequences that allow, for example, the translation of several proteins from a single mRNA such as an internal ribosome entry site (IRES) and sequences for genomic integration of the promoter- chimeric polypeptide.
  • IRS internal ribosome entry site
  • nucleic acids by viral infection offers several advantages over other methods such as lipofection and electroporation, since higher transfection efficiency can be obtained due to the infectious nature of viruses .
  • enhancer elements, promoters and the like, and even the polynucleotide sequence(s) encoding a UBA6 can be arranged in a "head-to- tail" configuration, may be present as an inverted complement, or in a complementary configuration, as an anti-parallel strand.
  • mammalian expression vectors include, but are not limited to, pcDNA3, pcDNA3.1 (+/-), pGL3, pZeoSV2(+/-), pSecTag2, pDisplay, pEF/myc/cyto, pCMV/myc/cyto, pCR3.1, pSinRep5, DH26S, DHBB, pNMTl, pNMT41, pNMT81, which are available from Invitrogen, pCI which is available from Promega, pMbac, pPbac,pBK-RSV and pBK-CMV which are available from Strategene, pTRES which is available from Clontech, and their derivatives.
  • Expression vectors containing regulatory elements from eukaryotic viruses such as retroviruses can be also used.
  • SV40 vectors include pSVT7 and pMT2.
  • Vectors derived from bovine papilloma virus include pB V- 1MTHA, and vectors derived from Epstein Bar virus include pHEBO, and p2O5.
  • exemplary vectors include pMSG, pAV009/A+, pMTO10/A+, pMAMneo-5, baculovirus pDSVE, and any other vector allowing expression of proteins under the direction of the SV-40 early promoter, SV-40 later promoter, metallothionein promoter, murine mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters shown effective for expression in eukaryotic cells.
  • nucleic acid transfer techniques include transfection with viral or non- viral constructs, such as adenovirus, lentivirus, Herpes simplex I virus, or adeno-associated virus (AAV), naked polynucleotides (e.g., naked DNA or naked mRNA) and lipid-based systems .
  • viral or non- viral constructs such as adenovirus, lentivirus, Herpes simplex I virus, or adeno-associated virus (AAV), naked polynucleotides (e.g., naked DNA or naked mRNA) and lipid-based systems .
  • the nucleic acid construct is encapsulated in a particle (e.g., a viral particle, a lipid-based particle).
  • a particle e.g., a viral particle, a lipid-based particle.
  • viruses are very specialized infectious agents that have evolved, in many cases, to elude host defense mechanisms.
  • viruses infect and propagate in specific cell types.
  • the targeting specificity of viral vectors utilizes its natural specificity to specifically target predetermined cell types and thereby introduce a recombinant gene into the infected cell.
  • the type of vector used by some embodiments of the invention will depend on the cell type transformed. The ability to select suitable vectors according to the cell type transformed is well within the capabilities of the ordinary skilled artisan and as such no general description of selection consideration is provided herein.
  • Recombinant viral vectors are useful for in vivo expression of UBA6 since they offer advantages such as lateral infection and targeting specificity.
  • Lateral infection is inherent in the life cycle of, for example, retrovirus and is the process by which a single infected cell produces many progeny virions that bud off and infect neighboring cells. The result is that a large area becomes rapidly infected, most of which was not initially infected by the original viral particles. This is in contrast to vertical-type of infection in which the infectious agent spreads only through daughter progeny.
  • Viral vectors can also be produced that are unable to spread laterally. This characteristic can be useful if the desired purpose is to introduce a specified gene into only a localized number of targeted cells .
  • Viral vectors offer several advantages including higher efficiency of transformation, and targeting to, and propagation in, specific cell types. Viral vectors can also be modified with specific receptors or ligands to alter target specificity through specific cell receptors, such as neuronal cell receptors (for example, refer to Kaspar BK. et al., 2002. Mol Ther. 5:50-6).
  • Non-limiting examples of viral vectors which can be used include, adenoviruses, the recombinant adeno-associated virus 2 (AAV), SV40-based [Kimchi-Sarfaty C, and Gottesman MM, 2004, Curr. Pharm Biotechnol.
  • retroviruses such as Molony murine leukemia virus (Mo-MuLV); and lentiviruses [Amado RG, Chen IS., 1999, Science. 285: 674-6].
  • the most preferred constructs for use in gene therapy are viruses, most preferably adenoviruses, AAV, lentiviruses, or retroviruses.
  • a viral construct such as a retroviral construct includes at least one transcriptional promoter/enhancer or locus-defining elements), or other elements that control gene expression by other means such as alternate splicing, nuclear RNA export, or post-translational modification of messenger.
  • Such vector constructs also include a packaging signal, long terminal repeats (LTRs) or portions thereof, and positive and negative strand primer binding sites appropriate to the virus used, unless it is already present in the viral construct.
  • LTRs long terminal repeats
  • such a construct typically includes a signal sequence for secretion of the peptide from a host cell in which it is placed.
  • the signal sequence for this purpose is a mammalian signal sequence or the signal sequence of the polypeptide variants of some embodiments of the invention.
  • the construct may also include a signal that directs polyadenylation, as well as one or more restriction sites and a translation termination sequence.
  • a signal that directs polyadenylation will typically include a 5' LTR, a tRNA binding site, a packaging signal, an origin of second-strand DNA synthesis, and a 3' LTR or a portion thereof.
  • Other vectors can be used that are non-viral, such as cationic lipids, polylysine, and dendrimers.
  • Retroviral vectors represent one class of vectors suitable for use with some embodiments of the invention.
  • Defective retroviruses are routinely used in transfer of genes into mammalian cells [reviewed in Miller, A.D. Blood 76: 271 (1990)].
  • a recombinant retrovirus including a polynucleotide encoding UBA6 of some embodiments of the invention can be constructed using well known molecular techniques. Portions of the retroviral genome can be removed to render the retrovirus replication defective and the replication defective retrovirus can then packaged into virions, which can be used to infect target cells through the use of a helper virus and while employing standard techniques.
  • Retroviruses have been used to introduce a variety of genes into many different cell types, including neuronal cells, epithelial cells endothelial cells, lymphocytes, myoblasts, hepatocytes and bone marrow cells.
  • Another suitable expression vector may be an adenovirus vector.
  • the adenovirus is an extensively studied and routinely used gene transfer vector. Key advantages of an adenovirus vector include relatively high transduction efficiency of dividing and quiescent cells, natural tropism to a wide range of epithelial tissues and easy production of high titers [Russel, W.C. [J. Gen. Virol. 81: 57-63 (2000)].
  • the adenovirus DNA is transported to the nucleus, but does not integrate thereinto. Thus the risk of mutagenesis with adenoviral vectors is minimized, while short term expression may be suitable.
  • a suitable viral expression vector may also be a chimeric adenovirus/retrovirus vector which combines retroviral and adenoviral components. Such vectors may be more efficient than traditional expression vectors for transducing tumor cells [Pan et al., Cancer Letters 184: 179-188 (2002)].
  • a specific example of a suitable viral vector for introducing and expressing the polynucleotide sequence of some embodiments of the invention in an individual is the adenovirus- derived vector Ad-TK.
  • Ad-TK adenovirus- derived vector expresses a herpes virus thymidine kinase (TK) gene for either positive or negative selection and includes an expression cassette for desired recombinant sequences.
  • TK herpes virus thymidine kinase
  • This vector can be used to infect cells that have an adenovirus receptor which includes most cancers of epithelial origin (Sandmair et al., 2000. Hum Gene Ther. 11:2197-2205).
  • Secretion signals generally contain a short sequence (7-20 residues) of hydrophobic amino acids. Secretion signals are widely available and are well known in the art, refer, for example to von Heijne [J. Mol. Biol. 184:99-105 (1985)] and Lej et al., [J. Bacteriol. 169: 4379 (1987)].
  • the recombinant vector can be administered in several ways. If viral vectors are used the procedure can take advantage of their target specificity and consequently, such vectors do not have to be administered locally. However, local administration can provide a quicker and more effective treatment. Administration of viral vectors can also be performed by, for example, intravenous or subcutaneous injection into a subject. Following injection, the viral vectors will circulate until they recognize host cells with appropriate target specificity for infection.
  • An agent capable of upregulating UBA6 or at least a functional portion thereof comprising the SCCH domain may be the mRNA molecule itself which encodes the UBA6 or at least a functional portion thereof comprising the SCCH domain.
  • mRNAs therapies are advantageous as they utilize a cell’ s translational machinery to code production of the desired protein in vivo, saving time and expense on purification procedures.
  • Methods of stabilizing mRNA include modulation of the length of the polyadenine tail found at the 3” end of the mRNA transcript.
  • the mRNA cap found at the molecule’s 5’ end can be modified.
  • the naturally occurring cap structure typical in mammalian cells has a tendency to be improperly incorporated into mRNAs synthesized in vitro, rendering them less effective.
  • Synthetic “anti-reverse cap analogs” e.g. those commercially available at Thermo Fisher Scientific) can prevent this misincorporation, which results in more stable mRNA with improved translational efficiency.
  • substitution of particular nucleotides can be exchanged with chemically modified alternatives such as 5-methylcytosine or pseudoruidine. Such substitutions can mute the immune response whilst also bolstering the stability of the mRNA and efficiency of translation.
  • chemically modified nucleotides are described herein above.
  • particular nucleotides can be incorporated into the mRNA to increase immunogenicity. This may be particularly relevant for vaccine therapy.
  • the mRNA may be encapsulated in lipid-based particles to enhance fusion with the lipid cell membrane.
  • Naked DNA e.g., naked plasmid DNA (pDNA)
  • pDNA naked plasmid DNA
  • pDNA naked plasmid DNA
  • naked UBA6 DNA can be introduced by intravascular and electroporation techniques as described in Wolff JA, Budker V, 2005, Adv. Genet. 54: 3-20.
  • naked UBA6 DNA can be administered in vivo by jet injection essentially as described in Walther W, et al., 2004, Mol. Biotechnol. 28: 121-8.
  • naked UBA6 DNA can be administered into epidermis cells via DNA-coated gold particles as described in Dean HJ, 2005, Expert Opin Drug Deliv. 2: 227-36. Still alternatively, naked UBA6 DNA can be administered to cells via cavitation bubbles which induce transient membrane permeabilization (sonoporation) on a single cell level [using low frequency sonication (kilohertz frequencies), lithotripter shockwaves, HIFU, and even diagnostic ultrasound (megahertz frequencies)]. Cavitation initiation and control can be enhanced by cavitation nucleation agents, such as an ultrasound contrast agent [for further details see Miller DL, et al., 2002, Somat Cell Mol. Genet. 27: 115-34; using e.g., the Sonitron 2000 sonoporation system (Sonidel Limited, Dublin, Republic Ireland).
  • an ultrasound contrast agent for further details see Miller DL, et al., 2002, Somat Cell Mol. Genet. 27: 115-34; using e.
  • Liposome delivery system - Liposomes can be used for in vivo delivery of UBA6 polynucleotides to target cells.
  • the cationic lipid formulation 3 beta [N-(N',N'- Dimethylaminoethane)-Carbamoyl] Cholesterol (DC-Chol) is a non-viral delivery agent which can be used to target of UBA6 or at least a functional portion thereof into cells of interest (e.g., cells of the nervous system).
  • the UBA6 liposomes can be administered directly into the cells of the nervous system or can be administered intravenously and be directed to the cells-of-interest using a cell specific recognition moiety such as a ligand, antibody or receptor capable of specifically binding to the cell-of-interest. Additionally or alternatively, targeting of the liposome to specific cells can be performed by antibodies essentially as described in Dass CR. and Choong PF, J Control Release. 2006 May 9; [Epub ahead of print].
  • the polypeptide can be produced by recombinant means.
  • the polynucleotide of some embodiments of the invention can be introduced into cells by any one of a variety of known methods within the art.
  • the expression construct of some embodiments of the invention can also include sequences engineered to enhance stability, production, purification, yield or toxicity of the expressed peptide.
  • the expression of a fusion protein or a cleavable fusion protein comprising the UBA6 protein of some embodiments of the invention and a heterologous protein can be engineered.
  • Such a fusion protein can be designed so that the fusion protein can be readily isolated by affinity chromatography; e.g., by immobilization on a column specific for the heterologous protein.
  • the UBA6 protein can be released from the chromatographic column by treatment with an appropriate enzyme or agent that disrupts the cleavage site [e.g., see Booth et al. (1988) Immunol. Lett. 19:65-70; and Gardella et al., (1990) J. Biol. Chem 265: 15854-15859].
  • prokaryotic or eukaryotic cells can be used as hostexpression systems to express the polypeptides of some embodiments of the invention.
  • hostexpression systems include, but are not limited to, microorganisms, such as bacteria transformed with a recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vector containing the coding sequence; yeast transformed with recombinant yeast expression vectors containing the coding sequence; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors, such as Ti plasmid, containing the coding sequence.
  • Mammalian expression systems can also be used to express the polypeptides of some embodiments of the invention .
  • polypeptides of some embodiments of the invention can be purified using a variety of standard protein purification techniques, such as, but not limited to, affinity chromatography, ion exchange chromatography, filtration, electrophoresis, hydrophobic interaction chromatography, gel filtration chromatography, reverse phase chromatography, concanavalin A chromatography, chromatofocusing and differential solubilization.
  • standard protein purification techniques such as, but not limited to, affinity chromatography, ion exchange chromatography, filtration, electrophoresis, hydrophobic interaction chromatography, gel filtration chromatography, reverse phase chromatography, concanavalin A chromatography, chromatofocusing and differential solubilization.
  • polypeptide or the peptide of some embodiments of the invention may be synthesized by any techniques that are known to those skilled in the art of peptide synthesis.
  • solid phase peptide synthesis a summary of the many techniques may be found in J. M. Stewart and J. D. Young, Solid Phase Peptide Synthesis, W. H. Freeman Co. (San Francisco), 1963 and J. Meienhofer, Hormonal Proteins and Peptides, vol. 2, p. 46, Academic Press (New York), 1973.
  • For classical solution synthesis see G. Schroder and K. Lupke, The Peptides, vol. 1, Academic Press (New York), 1965.
  • these methods comprise the sequential addition of one or more amino acids or suitably protected amino acids to a growing peptide chain.
  • amino acids or suitably protected amino acids Normally, either the amino or carboxyl group of the first amino acid is protected by a suitable protecting group.
  • the protected or derivatized amino acid can then either be attached to an inert solid support or utilized in solution by adding the next amino acid in the sequence having the complimentary (amino or carboxyl) group suitably protected, under conditions suitable for forming the amide linkage.
  • the protecting group is then removed from this newly added amino acid residue and the next amino acid (suitably protected) is then added, and so forth. After all the desired amino acids have been linked in the proper sequence, any remaining protecting groups (and any solid support) are removed sequentially or concurrently, to afford the final peptide compound.
  • a preferred method of preparing the peptide compounds of some embodiments of the invention involves solid phase peptide synthesis.
  • the agent which is capable of specifically upregulating expression or activity of UBA6 of some embodiments of the invention can be administered to an organism per se, or in a pharmaceutical composition where it is mixed with suitable carriers or excipients.
  • a "pharmaceutical composition” refers to a preparation of one or more of the active ingredients described herein with other chemical components such as physiologically suitable carriers and excipients.
  • the purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism.
  • active ingredient refers to the agent which is capable of specifically upregulating expression or activity of UBA6 in a cell accountable for the biological effect.
  • physiologically acceptable carrier and “pharmaceutically acceptable carrier” which may be interchangeably used refer to a carrier or a diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound.
  • An adjuvant is included under these phrases.
  • excipient refers to an inert substance added to a pharmaceutical composition to further facilitate administration of an active ingredient.
  • excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols.
  • Suitable routes of administration may, for example, include oral, rectal, transmucosal, especially transnasal, intestinal or parenteral delivery, including intramuscular, subcutaneous and intramedullary injections as well as intrathecal, direct intraventricular, intracardiac, e.g., into the right or left ventricular cavity, into the common coronary artery, intravenous, inrtaperitoneal, intranasal, or intraocular injections.
  • neurosurgical strategies e.g., intracerebral injection or intracerebroventricular infusion
  • molecular manipulation of the agent e.g., production of a chimeric fusion protein that comprises a transport peptide that has an affinity for an endothelial cell surface molecule in combination with an agent that is itself incapable of crossing the BBB
  • pharmacological strategies designed to increase the lipid solubility of an agent (e.g., conjugation of water-soluble agents to lipid or cholesterol carriers)
  • the transitory disruption of the integrity of the BBB by hyperosmotic disruption resulting from the infusion of a mannitol solution into the carotid artery or the use of a biologically active agent such as an angiotensin peptide).
  • each of these strategies has limitations, such as the inherent risks associated with an invasive surgical procedure, a size limitation imposed by a limitation inherent in the endogenous transport systems, potentially undesirable biological side effects associated with the systemic administration of a chimeric molecule comprised of a carrier motif that could be active outside of the CNS, and the possible risk of brain damage within regions of the brain where the BBB is disrupted, which renders it a suboptimal delivery method.
  • tissue refers to part of an organism consisting of cells designed to perform a function or functions. Examples include, but are not limited to, brain tissue, retina, skin tissue, hepatic tissue, pancreatic tissue, bone, cartilage, connective tissue, blood tissue, muscle tissue, cardiac tissue brain tissue, vascular tissue, renal tissue, pulmonary tissue, gonadal tissue, hematopoietic tissue.
  • compositions of some embodiments of the invention may be manufactured by processes well known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee- making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.
  • compositions for use in accordance with some embodiments of the invention thus may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into preparations which, can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.
  • the active ingredients of the pharmaceutical composition may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank’s solution, Ringer’s solution, or physiological salt buffer.
  • physiologically compatible buffers such as Hank’s solution, Ringer’s solution, or physiological salt buffer.
  • penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
  • the pharmaceutical composition can be formulated readily by combining the active compounds with pharmaceutically acceptable carriers well known in the art. Such carriers enable the pharmaceutical composition to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for oral ingestion by a patient.
  • Pharmacological preparations for oral use can be made using a solid excipient, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries if desired, to obtain tablets or dragee cores.
  • Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carbomethylcellulose; and/or physiologically acceptable polymers such as polyvinylpyrrolidone (PVP).
  • disintegrating agents may be added, such as cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.
  • Dragee cores are provided with suitable coatings.
  • suitable coatings For this purpose, concentrated sugar solutions may be used which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, titanium dioxide, lacquer solutions and suitable organic solvents or solvent mixtures.
  • Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.
  • compositions which can be used orally include push-fit capsules made of gelatin as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol.
  • the push-fit capsules may contain the active ingredients in admixture with filler such as lactose, binders such as starches, lubricants such as talc or magnesium stearate and, optionally, stabilizers.
  • the active ingredients may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols.
  • stabilizers may be added. All formulations for oral administration should be in dosages suitable for the chosen route of administration.
  • compositions may take the form of tablets or lozenges formulated in conventional manner.
  • the active ingredients for use according to some embodiments of the invention are conveniently delivered in the form of an aerosol spray presentation from a pressurized pack or a nebulizer with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro-tetrafluoroethane or carbon dioxide.
  • a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro-tetrafluoroethane or carbon dioxide.
  • the dosage unit may be determined by providing a valve to deliver a metered amount.
  • Capsules and cartridges of, e.g., gelatin for use in a dispenser may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
  • compositions described herein may be formulated for parenteral administration, e.g., by bolus injection or continuous infusion.
  • Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multidose containers with optionally, an added preservative.
  • the compositions may be suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • compositions for parenteral administration include aqueous solutions of the active preparation in water-soluble form
  • suspensions of the active ingredients may be prepared as appropriate oily or water based injection suspensions.
  • Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acids esters such as ethyl oleate, triglycerides or liposomes.
  • Aqueous injection suspensions may contain substances, which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol or dextran.
  • the suspension may also contain suitable stabilizers or agents which increase the solubility of the active ingredients to allow for the preparation of highly concentrated solutions.
  • the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile, pyrogen- free water based solution, before use.
  • a suitable vehicle e.g., sterile, pyrogen- free water based solution
  • compositions of some embodiments of the invention may also be formulated in rectal compositions such as suppositories or retention enemas, using, e.g., conventional suppository bases such as cocoa butter or other glycerides.
  • compositions suitable for use in context of some embodiments of the invention include compositions wherein the active ingredients are contained in an amount effective to achieve the intended purpose. More specifically, a therapeutically effective amount means an amount of active ingredients (the agent which is capable of specifically upregulating expression or activity of UBA6 of some embodiments of the invention) effective to prevent, alleviate or ameliorate symptoms of a disorder (e.g., a disease associated with polyalanine expansion mutation, or autism spectrum disorders) or prolong the survival of the subject being treated.
  • a therapeutically effective amount means an amount of active ingredients (the agent which is capable of specifically upregulating expression or activity of UBA6 of some embodiments of the invention) effective to prevent, alleviate or ameliorate symptoms of a disorder (e.g., a disease associated with polyalanine expansion mutation, or autism spectrum disorders) or prolong the survival of the subject being treated.
  • the therapeutically effective amount or dose can be estimated initially from in vitro and cell culture assays.
  • a dose can be formulated in animal models to achieve a desired concentration or titer. Such information can be used to more accurately determine useful doses in humans.
  • Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals.
  • the data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in human.
  • the dosage may vary depending upon the dosage form employed and the route of administration utilized.
  • the exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See e.g., Fingl, et al., 1975, in "The Pharmacological Basis of Therapeutics", Ch. 1 P-l).
  • Dosage amount and interval may be adjusted individually to provide levels of the active ingredient in the nervous system cells which are sufficient to induce or suppress the biological effect (minimal effective concentration, MEC).
  • MEC minimum effective concentration
  • the MEC will vary for each preparation, but can be estimated from in vitro data. Dosages necessary to achieve the MEC will depend on individual characteristics and route of administration. Detection assays can be used to determine plasma concentrations.
  • dosing can be of a single or a plurality of administrations, with course of treatment lasting from several days to several weeks or until cure is effected or diminution of the disease state is achieved.
  • compositions to be administered will, of course, be dependent on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc.
  • compositions of some embodiments of the invention may, if desired, be presented in a pack or dispenser device, such as an FDA approved kit, which may contain one or more unit dosage forms containing the active ingredient.
  • the pack may, for example, comprise metal or plastic foil, such as a blister pack.
  • the pack or dispenser device may be accompanied by instructions for administration.
  • the pack or dispenser may also be accommodated by a notice associated with the container in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the compositions or human or veterinary administration.
  • Such notice for example, may be of labeling approved by the U.S. Food and Drug Administration for prescription drugs or of an approved product insert.
  • compositions comprising a preparation of the invention formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition, as is further detailed above.
  • antibody as used in this invention includes intact molecules as well as functional fragments thereof (that are capable of binding to an epitope of an antigen) .
  • epitopic determinants refers to any antigenic determinant on an antigen to which the paratope of an antibody binds.
  • Epitopic determinants usually consist of chemically active surface groupings of molecules such as amino acids or carbohydrate side chains and usually have specific three dimensional structural characteristics, as well as specific charge characteristics.
  • the antibody fragments include, but are not limited to, single chain, Fab, Fab’ and F(ab')2 fragments, Fd, Fcab, Fv, dsFv, scFvs, diabodies, minibodies, nanobodies, Fab expression library or single domain molecules such as VH and VE that are capable of binding to an epitope of the antigen in an HEA restricted manner.
  • Suitable antibody fragments for practicing some embodiments of the invention include a complementarity-determining region (CDR) of an immunoglobulin light chain (referred to herein as “light chain”), a complementarity-determining region of an immunoglobulin heavy chain (referred to herein as “heavy chain”), a variable region of a light chain, a variable region of a heavy chain, a light chain, a heavy chain, an Fd fragment, and antibody fragments comprising essentially whole variable regions of both light and heavy chains such as an Fv, a single chain Fv (scFv), a disulfide-stabilized Fv (dsFv), an Fab, an Fab’, and an F(ab’)2, or antibody fragments comprising the Fc region of an antibody.
  • CDR complementarity-determining region
  • light chain referred to herein as “light chain”
  • heavy chain a complementarity-determining region of an immunoglobulin heavy chain
  • variable region of a light chain a variable region of a heavy chain
  • antibodies for detection of the level of UBA6, USE1, E6AP, and/or ubiquitinated (or poly-ubiquitinated) forms thereof can be conjugated to a functional moiety such as a detectable moiety, and can be used in methods of some embodiments of the invention.
  • detectable or reporter moieties may be conjugated to the antibody of the invention. These include, but not are limited to, a radioactive isotope (such as [125] iodine), a phosphorescent chemical, a chemiluminescent chemical, a fluorescent chemical (fluorophore), an enzyme, a fluorescent polypeptide, an affinity tag, and molecules (contrast agents) detectable by Positron Emission Tomography (PET) or Magnetic Resonance Imaging (MRI).
  • a radioactive isotope such as [125] iodine
  • fluorophores examples include, but are not limited to, phycoerythrin (PE), fluorescein isothiocyanate (FETC), Cy-chrome, rhodamine, green fluorescent protein (GFP), blue fluorescent protein (BFP), Texas red, PE-Cy5, and the like.
  • PE phycoerythrin
  • FETC fluorescein isothiocyanate
  • Cy-chrome Cy-chrome
  • rhodamine green fluorescent protein
  • GFP green fluorescent protein
  • BFP blue fluorescent protein
  • Texas red PE-Cy5, and the like.
  • fluorophore selection methods of linking fluorophores to various types of molecules see Richard P. Haugland, “Molecular Probes: Handbook of Fluorescent Probes and Research Chemicals 1992- 1994”, 5th ed., Molecular Probes, Inc. (1994); U.S. Pat. No. 6,037,137 to Oncoimmunin Inc.; Hermanson, “Bioconjugate Techniques”, Academic Press New York, N
  • Fluorescence detection methods which can be used to detect the antibody when conjugated to a fluorescent detectable moiety include, for example, fluorescence activated flow cytometry (FACS), immunofluorescence confocal microscopy, fluorescence in-situ hybridization (FISH) and fluorescence resonance energy transfer (FRET).
  • FACS fluorescence activated flow cytometry
  • FISH fluorescence in-situ hybridization
  • FRET fluorescence resonance energy transfer
  • enzymes may be attached to the antibody of the invention [e.g., horseradish peroxidase (HPR), beta-galactosidase, and alkaline phosphatase (AP)] and detection of enzyme- conjugated antibodies can be performed using EEISA (e.g., in solution), enzyme-linked immunohistochemical assay (e.g., in a fixed tissue), enzyme-linked chemiluminescence assay (e.g., in an electrophoretic ally separated protein mixture) or other methods known in the art [see e.g., Khatkhatay MI. and Desai M., 1999. J Immunoassay 20: 151-83; wisdom GB., 1994. Methods Mol Biol.
  • HPR horseradish peroxidase
  • AP alkaline phosphatase
  • the affinity tag (or a member of a binding pair) can be an antigen identifiable by a corresponding antibody [e.g., digoxigenin (DIG) which is identified by an anti-DIG antibody) or a molecule having a high affinity towards the tag [e.g., streptavidin and biotin].
  • DIG digoxigenin
  • the antibody or the molecule which binds the affinity tag can be fluorescently labeled or conjugated to enzyme as described above.
  • a streptavidin or biotin molecule may be attached to the antibody of the invention via the recognition sequence of a biotin protein ligase (e.g., BirA) as described in the Examples section which follows and in Denkberg, G. et al., 2000. Eur. J. Immunol. 30:3522-3532.
  • a streptavidin molecule may be attached to an antibody fragment, such as a single chain Fv, essentially as described in Cloutier SM. et al. , 2000. Molecular Immunology 37: 1067-1077; Dubel S. et al., 1995.
  • Functional moieties such as fluorophores, conjugated to streptavidin are commercially available from essentially all major suppliers of immunofluorescence flow cytometry reagents (for example, Pharmingen or Becton- Dickinson).
  • the functional moiety e.g., the detectable moiety of the invention
  • the immunoconjugate may be produced by recombinant means.
  • a fluorescent protein e.g., green fluorescent protein (GFP), red fluorescent protein (RFP) or yellow fluorescent protein (YFP)
  • GFP green fluorescent protein
  • RFP red fluorescent protein
  • YFP yellow fluorescent protein
  • the functional moiety may be chemically synthesized by, for example, the stepwise addition of one or more amino acid residues in defined order such as solid phase peptide synthetic techniques.
  • a functional moiety may also be attached to the antibody of the invention using standard chemical synthesis techniques widely practiced in the art [see e.g., hypertexttransferprotocol://worldwideweb (dot) chemistry (dot) org/portal/Chemistry)], such as using any suitable chemical linkage, director indirect, as via a peptide bond (when the functional moiety is a polypeptide), or via covalent bonding to an intervening linker element, such as a linker peptide or other chemical moiety, such as an organic polymer.
  • standard chemical synthesis techniques widely practiced in the art [see e.g., hypertexttransferprotocol://worldwideweb (dot) chemistry (dot) org/portal/Chemistry)], such as using any suitable chemical linkage, director indirect, as via a peptide bond (when the functional moiety is a polypeptide), or via covalent bonding to an intervening linker element, such as a linker peptide or other chemical moiety,
  • Chimeric peptides may be linked via bonding at the carboxy (C) or amino (N) termini of the peptides, or via bonding to internal chemical groups such as straight, branched or cyclic side chains, internal carbon or nitrogen atoms, and the like.
  • Description of fluorescent labeling of antibodies is provided in details in U.S. Pat. Nos. 3,940,475, 4,289,747, and 4,376,110.
  • Exemplary methods for conjugating peptide moieties to the antibody of the invention include, but are not limited to SPDP conjugation (e.g., as described in Cumber et al. (1985, Methods of Enzymology 112: 207-224); glutaraldehyde conjugation (e.g., as described in G.T. Hermanson (1996, “Antibody Modification and Conjugation, in Bioconjugate Techniques, Academic Press, San Diego); carbodiimide conjugation [e.g., as describedin J. March, Advanced Organic Chemistry: Reaction's, Mechanism, and Structure, pp. 349-50 & 372-74 (3d ed.), 1985; B. Neises et al. (1978), Angew Chem, Int.
  • SPDP conjugation e.g., as described in Cumber et al. (1985, Methods of Enzymology 112: 207-224
  • glutaraldehyde conjugation e.g., as described in G.T
  • compositions, methods or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.
  • a compound or “at least one compound” may include a plurality of compounds, including mixtures thereof.
  • range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.
  • a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range.
  • the phrases “ranging/ranges between” a first indicate number and a second indicate number and “ranging/ranges from” a first indicate number “to” a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween.
  • method refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.
  • sequences that substantially correspond to its complementary sequence as including minor sequence variations, resulting from, e.g., sequencing errors, cloning errors, or other alterations resulting in base substitution, base deletion or base addition, provided that the frequency of such variations is less than 1 in 50 nucleotides, alternatively, less than 1 in 100 nucleotides, alternatively, less than 1 in 200 nucleotides, alternatively, less than 1 in 500 nucleotides, alternatively, less than 1 in 1000 nucleotides, alternatively, less than 1 in 5,000 nucleotides, alternatively, less than 1 in 10,000 nucleotides.
  • any Sequence Identification Number can refer to either a DNA sequence or a RNA sequence, depending on the context where that SEQ ID NO is mentioned, even if that SEQ ID NO is expressed only in a DNA sequence format or a RNA sequence format.
  • SEQ ID NO: 24 is expressed in a DNA sequence format (e.g., reciting T for thymine), but it can refer to either a DNA sequence that corresponds to an UBA6 nucleic acid sequence, or the RNA sequence of an RNA molecule nucleic acid sequence.
  • RNA sequence format e.g., reciting U for uracil
  • it can refer to either the sequence of a RNA molecule comprising a dsRNA, or the sequence of a DNA molecule that corresponds to the RNA sequence shown.
  • both DNA and RNA molecules having the sequences disclosed with any substitutes are envisioned.
  • the SCCH domains of UBA6 or UBA1 were constructed by introduction of PCR fragments containing amino acids 623-889 (UBA6) and 624-891 (UBA1) into plasmid pYB50 by Gibson assembly (lab collection).
  • UBA6 PCR fragments containing amino acids 623-889
  • UBA1 amino acids 624-891
  • UBA6 wild type and mutant UBA1 and UBA6 genes where subcloned into modified and improved vector pET28a 44 .
  • E2 USE1 (UBE2Z) expressing plasmids pcDNA3.1-His6-3xFlag-USEl was kindly provided by Dr. Annette Aichem
  • the putative Kozak sequence was first added to the USE1 gene, which was subcloned into pEGFP-Nl based plasmid resulting in plasmid pCMV-His6-3xFlag-USEl new Kozak used in this study.
  • the APolyAla region mutant where amino acids 47-56 of the USE1 gene were deleted, the 2A ⁇ 2R mutant where Alanine 49 and Alanine 52 were changed to Arginine respectively, the ALB mutant where amino acids 194- 197 comprising a Loop B 16 were deleted, and the C188A mutant were constructed by site-directed mutagenesis and Gibson assembly applying Q5® Site-Directed Mutagenesis Kit and NEBuilder® HiFi DNA Assembly respectively.
  • the USE1 wild type and mutant genes were subcloned into modified plasmid pET30-Hise-N-AviTag (Laboratory collection).
  • Hise-Ub plasmid for expression in E. coli of the His-tagged ubiquitin gene was described previously 45 .
  • the HA-ubiquitin plasmid for mammalian expression was a gift from Dr. Edward Yeh (Addgene plasmid # 18712 46 ).
  • the p4054 HA-E6AP isoform II was a gift from Dr. Peter Howley (Addgene plasmid # 8658 47 ).
  • pEGFP-Cl 19 Alanines and pEGFP-Cl 19 Alanines with nuclear localization sequence (NLS) constructs for expression in mammalian cells as well as HA- bovine PABPN1 wild type and HA-bovine PABPN1 mut +7 Ala mutant constructs were a gift of Dr. David Rubinsztein.
  • pEGFP-C119 Alanines and pEGFP-C119 Alanines with nuclear localization sequence (NLS) constructs for expression in mammalian cells as well as HA-bovine PABPN1 wild type and HA-bovine PABPN1 mut +7 Ala mutant constructs were a gift of Dr. David Rubinsztein.
  • the present inventors deleted the PolyA region from the wild type gene performing a site-directed mutagenesis applying Inverse PCR and Q5® Site-Directed Mutagenesis Kit (New England Biolabs, NEB). Then the HA-tagged delta Ala mutant bovine gene was humanized by changing amino acids Asp 95 and Ser 102 to Ser 95 and Pro 102 respectively, applying Q5® Site-Directed Mutagenesis Kit (NEB). Following humanization, 10 Ala (wild type) and 17 Ala (+7 mutant) regions were added using gene blocks (IDT) and Gibson assembly (NEBuilder® HiFi DNA Assembly kit, NEB).
  • the mouse H0XD13 bearing plasmids pcDNA3.1-Hoxdl3 wild type and pcDNA3.1- Hoxdl3 mut +10Ala were a gift of Dr. Denes Hnisz.
  • the Valine259 to Glutamate mutation was corrected in both constructs and then the wild type and the mutant Hoxdl3 genes were subcloned into pEGFP-N 1 derived vector whereas adding a putative Kozak sequence and the C- terminal HA-tag.
  • the PH0X2B carrying plasmids pcDNA3.0-HA-PHOX2B wild type and pcDNA3.0-HA- PH0X2B mut (+13 Ala) were kindly provided Dr. Diego Fornasari.
  • the PHOX2B genes were subcloned into lentiviral pLL3.7 vector bearing the Synapsin I promoter.
  • Plasmids bearing the HA-PHOX2B mut (+7 Ala) gene were constructed applying Gibson assembly and resulted in plasmids pcDNA3.0-HA-PHOX2B mut (+7 Ala), pLL3.7-hSyn-HA-PHOX2B mut (+7 Ala) and pLL3.7-hSyn-HA-PHOX2B mut (+7 Ala)- EGFP.
  • a lentiviral target vector bearing wild type UBA6-mCherry fusion protein under the control of pCMV promoter (SEQ ID NO: 59) was constructed by subcloning of the Nhel-Kpnl fragment from plasmid pLL3.7-hSyn-UBA6-mCherry into plasmid pLL3.7-pCMV-Kozak-HA- linker-EGFP (Lab collection).
  • SEQ ID NO: 59 A lentiviral target vector bearing wild type UBA6-mCherry fusion protein under the control of pCMV promoter
  • the PHOX2B mut (+13 Ala) gene was obtained by PCR from plasmid pET30-NAvitag-PHOX2B mut (+13), and introduced into N he]- Hind]]] sites of the plasmid pET43-Hise- TIG- TEV site-PHOX2B wild type.
  • Cell lines and transfection - Cell lines used in this study include human embryonic kidney cells, HEK293T (ATCC CRL-1573) and HEK293FT (Invitrogen, R70007).
  • the cells were authenticated by STR profiling and were routinely tested for mycoplasma contamination.
  • the cells were grown in Dulbecco’s modified Eagle’s medium (01-052-1 A, Sartorius) supplemented with 10% heat-inactivated fetal bovine serum (04-007-1 A, Sartorius), 10000 units/mL penicillin, and 10 mg/mL streptomycin (03-031- IB Sartorius) and 2 mM L-glutamine (G7513, Merck) at 37 °C with 5% CO2.
  • Transient transfection of indicated plasmids was accomplished using TransIT-LTl (Mirus, MIR 2300) according to the manufacturer’s protocol.
  • Vector and Mirus were mixed in a reduced serum medium (Opti-MEM® 10001865, Gibco) and incubated at room temperature for up to 30 min before being dripped gently onto the cell culture and incubated for 24 to 48 hours. Transfection efficiency was confirmed by western blot analysis.
  • RNA interference experiments cells were transfected 24 hours after seeding with 50-100 nM S 4/ 7'pool siRNAs (Dharmacon) for gene silencing and Lipofectamine 2000 (1000186, Invitrogen), with two rounds of knockdown for 5 days, according to the manufacturer's instructions (Invitrogen).
  • siRNAs and Lipofectamine were diluted separately in reduced serum medium Opti-MEM® (10001865, Gibco), then mixed for 15 minutes at room temperature and dripped gently onto the cell culture, which was then incubated at 37 °C for 4-6 hours, before restoration of full medium.
  • siRNA J-006403-09 UBA6 for the following target sequence: GUGUAGAAUUAGCAAGAUU (SEQ ID NO: 1); siRNA J-006403-10, UBA6 for the following target sequence: GCAUAGCUGUCCAAGUUAA (SEQ ID NO: 2); siRNA J-006403-11, UBA6 for the following target sequence: CAGUGUUGUAGGAGCAAUA (SEQ ID NO: 3); siRNA J-006403-12, UBA6 for the following target sequence: GGAAUUUGGUCAGGUUAU (SEQ ID NO: 4);
  • GenCRISPRTM gene editing technology was applied using a service from GenScript USA.
  • the gRNAs cleavage efficiency was tested by transient transfection and a gRNA with the highest cleavage efficiency was chosen (gRNA CCTGCCGGATGTGTGGGCGG; SEQ ID NO: 5) to generate the gene deletion resulted in the deletion of the domain located at position 47-56 of the UBE2Z/USE1 human protein comprising the polyalanine domain.
  • the sequence of donor is designed as below:
  • the editing materials were transfected in the HEK293T cells and the transfected cells were plated in 96-well plates by limiting dilution to generate isogenic single clones.
  • the clones were picked from wells and screened by PCR and Sanger sequencing screening to identify full allelic deletion clones.
  • dissociated neurons were resuspended and cultured at 37°C in a humidified incubator with 5% CO2 and 95% O2 in poly-D- lysine coated 6-well plates in neurobasal media (12349015, Gibco) supplemented with 1% GlutaMAXTM Supplement (35050-061, Thermofisher), 1% Sodium pyruvate (11360039, Gibco), 2% B27 supplement (17504044, Gibco) and 1% Penicillin- Streptomycin (O3-O31-1B, Sartorius). One-half of the culture media was changed every three days until treatment. Differentiated cortical neurons were infected with indicated lentiviral vectors after 5 days in culture.
  • Lentivirus production and infection - Third generation lentiviral vectors pLL3.7 (Addgene, #11795) that express shRNA under the mouse U6 promoter and CMV-EGFP or hSyn- EGFP reporter cassettes were obtained from the TAU Viral Core facility.
  • VSV G vesicular stomatitis virus envelope G
  • HEK-293FT packaging cells growing in 15 cm dishes were transfected with a mix of 7.8 pg helper vector pMDLg/pRRE, 3 pg helper vector pRSV-Rev, 4.2 pg envelope vector pCMV-VSVG, and 12 pg target vector pLL3.7-hSyn-PHOX2B-EGFP carrying the wild type or mutant PHOX2B gene, or CMV-mCherry UBA6.
  • PEI Polyethylenimine
  • the culture media was removed and replaced with fresh high-serum medium, which was harvested 48 h later and filtered through Amicon Ultra -15 (UFC910024) vials at 1500g for 30 minutes to obtain concentrated and purified lentiviruses for transduction.
  • UOC910024 Amicon Ultra -15
  • the culture medium was replaced by a 1: 1 mix of fresh and the conditioned medium that was collected previously. The neurons were then incubated for up to a week before being harvested for either western blot or immunostaining.
  • iPSCs - Fibroblast 10 6 cells were harvested using TrypLE Express (Gibco, 12604021) and electroporated with non-integrating episomal vectors using a Neon transfection system (Invitrogen, kit MPK10096). The cells were then plated on mouse embryonic fibroblast (MEF)-coated plates and cultured in DMEM with 15% FBS, 5 ng/ml basic fibroblast growth factor (bFGF, Peprotech 10018B) and 5 pM ROCK inhibitor (Enzo, ALX270333). After two days, the medium was replaced with NutriStem (BI) supplemented with 5 ng/ml bFGF, with fresh medium added every other day.
  • BI NutriStem
  • iPSC characterization - iPSCs were assessed for the expression of the pluripotency markers NANOG, SOX2, OCT3/4, TRA 1-60, and SSEA by immunocytochemistry and FACS analysis.
  • the differentiation potential was assessed by harvesting the iPSCs at confluency using TrypLE and resuspending the cells in NutriStem supplemented with 10 ng/ml bFGF and 7 pM ROCK inhibitor (Enzo, ALX270333).
  • Embryoid bodies (EBs) spontaneously formed after 2 days, at which time, the medium was replaced with EB medium (DMEM with 15% FBS, 1% Non- Essential Amino Acids and 0.1 mM P-mercaptoethanol, Gibco 31350010). After 4-7 days, the EBs were plated on 0.1% gelatin-coated plates and cultured for 21 days with EB medium replacement twice weekly.
  • iPSCs were supplemented with 100 ng/ml colcemid (Sartorius 120041D), incubated for 60 minutes, and harvested in Versene solution (Gibco 15040033). Cells were fixed in 1:3 glacial acetic acid:methanol (Biolabs- chemicals) solution and the G-banding karyotype was determined. Finally, all lines were tested for mycoplasma contamination using the Hy-mycoplasma PCR kit (Hylabs, KI5034I).
  • iPSCs Differentiation of iPSCs into autonomic neurons - The protocol was performed as previously described with modifications 48 .
  • iPSCs were cultured in Nutristem (Sartorius, 05-100- 1A) to a confluence of 1 million cells/well.
  • iPSCs washed with DPBS (Dulbecco's Phosphate-Buffered Saline), and a single cell suspension was prepared using Versene solution for 2 minutes (Gibco, 15040033), and then cells were transferred to T25 flasks coated with Poly-Hema (2-hydroxyethyl methacrylate) at a concentration of 350,000 cells/ml in neuromesodermal progenitor cell induction (NMP) medium containing Essential 6 medium (Gibco, A1516401), 1.5 mM CEUR (Tocris biotech, 4423), 10 pM SB (Tocris biotech, 431542), Penicillin-Streptomycin- Amphotericin B solution (PSA, Sartorius, 03-033- IB), supplemented with 10 pM ROCK inhibitor (ROCKi Enzo, ALX270333), where they formed aggregates.
  • NMP neuromesodermal progenitor cell induction
  • NMP neuromesodermal progenitor cell in
  • NMP neurotrophic
  • NMP nerve crest induction medium containing Essential 6 medium, 1.5 mM CHIR, 20 ng/ml bFGF (Peprotech 10018B), 50 ng/ml BMP4 (Prospec, Cyt-1093), 100 nM all trans retinoic acid (RA, Merck, R2625), and PSA.
  • NMP sympathetic neural crest induction medium containing Essential 6 medium, 1.5 mM CHIR, 20 ng/ml bFGF (Peprotech 10018B), 50 ng/ml BMP4 (Prospec, Cyt-1093), 100 nM all trans retinoic acid (RA, Merck, R2625), and PSA.
  • NCi sympathetic neural crest induction medium containing Essential 6 medium, 1.5 mM CHIR, 20 ng/ml bFGF (Peprotech 10018B), 50 ng/ml BMP4 (Prospec, Cyt-1093), 100 nM all trans retinoic acid (RA, Merck,
  • the culture was dissociated into single cells using Accutase (Gibco, Al 110501) for 4 min at 37°C, and cultured in sympathetic neuroblast induction and propagation (NCC) medium, containing neurobasal medium (Gibco, 21103049), 20 ng/ml bFGF, 50 ng/ml BMP4, 20 ng/ml EGF, 2 pg/ml heparin, B27 (Gibco, 17504044), N2 (Gibco, 17502048), GlutaMAX (Gibco, 35050038), PSA and 10 pM ROCKi.
  • NCC sympathetic neuroblast induction and propagation
  • NCC medium On day 11, half of the NCC medium was replaced with NCC medium without ROCKi and half of the medium was replaced every other day. On day 17, medium was replaced with sympathetic neuronal maturation medium (NMM medium) containing neurobasal medium, B27, N2, 10 ng/ml GDNF (Peprotech, 45010), 10 ng/ml BDNF (Peprotech 45002), 10 ng/ml NGF (R & D 256-GF), GlutaMAX, and PSA. One third of the medium was replaced every other day until day 31.
  • coverslips were incubated in poly- L- ornithine solution (Merck, P3655) overnight at 37°C followed by 3 washes with cell culture grade water and drying for 15 min. On seeding day, the coverslips were incubated in laminin (Merck, L2020) for 1 hour at 37°C before being washed with PBS. The neurospheres were harvested manually and seeded on the coverslips.
  • the cells on the coverslips were washed with Dulbecco's Phosphate-Buffered Saline (DPBS, Sartorius, 020231 A) and fixed in 4% paraformaldehyde at room temperature for 15 minutes.
  • the cells then were washed twice in DPBS, and blocked with DPBS containing 0.1% Triton X-100 (Merck, T8532) and 1% bovine serum albumin (blocking solution, Merck, A7906100G), for 1 hour at RT.
  • Primary antibodies were added to the blocking solution and incubated overnight at 4°C. Following three washes with blocking solution, the cells were incubated with fluorescent secondary antibodies for 2 h at room temperature.
  • DRAQ5 was used to stain the cell nuclei.
  • Flow cytometry - iPSCs were harvested and dissociated into single cells by incubation with TrypLE for 2 minutes at 37°C.
  • samples were incubated in fixation solution (Invitrogen, 00522356, 00512343) for 40 minutes at room temperature followed by washings withpermeabilization solution (Invitrogen, 00833356).
  • fixation solution Invitrogen, 00522356, 00512343
  • permeabilization solution Invitrogen, 00833356
  • the cells were washed once with 3% FBS in DPBS. In both cases, the samples were incubated with the appropriate primary antibodies for 2 hours at room temperature, then were washed twice and incubated for 1 hour with the relevant secondary antibody followed by three more washes.
  • Analysis was performed using a NovoCyte flow cytometer (ACEA). The first gating was SSC- H/FSC-H, and the entire cell population was selected (without cell debris) followed by FSC- H/FSC-A
  • TUNEL assay detecting DNA fragmentation the cells were fixed in 4% PFA for 20 minutes and then washed twice. TUNEL Assay Kit (Abeam, ab66108) was used according to the manufacturer’s instruction. The cells were washed twice with wash buffer followed by adding the DNA labeling solution for 1 hour at 37°C without agitation. The DNA labeling solution was removed, and the cells were washed twice with Rinse buffer followed by adding Propidium lodide/RNase A solution for 30 minutes. The Propidium lodide/RNase A solution was removed and the cells were washed twice with blocking solution and blocked for 1 hour at room temperature. The blocking solution was removed and primary anti-PHOX2B antibody was added overnight for immunostaining.
  • Annexin V-FETC apoptosis detection kit (Merck, CBA059) was used according to manufacturer’s protocol.
  • Annexin V-FITC solution containing 1: 100 Annexin: calcium buffer was prepared and was added to the neurons for 10 minutes at room temperature without agitation. Then, the cells were washed with calcium buffer and were fixed using 4% PFA for 20 minutes, washed with a blocking solution and blocked for 1 hour at room temperature. The blocking solution was removed and primary anti-P3-Tubulin antibody was added overnight for immunostaining.
  • the tissue biopsy was obtained from an OPMD patient undergoing cricopharyngeal myotomy (heterozygous polyalanine expansion mutation resulted in + 3 Ala in PABPN1).
  • the tissue was submerged by incubation with collagenase II solution (Merck, C0130). After the incubation, the tissue was transferred using a 5% BSA coated pipette tip into a 5% BSA pre-coated 10-cm plate filled with DMEM supplemented with 2.5% pen- strep-Nystatin (PSN). The tissue was further incubated for 30 minutes, and the muscle was then repeatedly pipetted to dissociate the myofibers.
  • the cells were lysed on ice in lysis buffer (20 mM Tris-HCl, pH 6.8, 137 mM NaCl, 1 mM EGTA, 1% Triton xlOO, 10% glycerol, and a protease inhibitors cocktail), centrifuged to discard the cell pellet and then the supernatant was added to Laemmli buffer at a ratio of 1: 1 without using beta-mercaptoethanol. Protein samples were boiled for 5 minutes at 95°C, separated by SDS-PAGE, transferred onto PVDF membranes, subjected to western blot analysis, and visualized using the ECL enhanced chemiluminescence reagent (CYANAGEN). Protein levels in each sample were evaluated by normalization to the housekeeping P-actin. The bands were quantified using ImageJ software.
  • IP immunoprecipitation
  • MG132 proteasome inhibitor
  • the beads were then discarded, and the cell lysates were incubated with antibody overnight as already described.
  • the different polyalanine constructs were expressed in HEK293T cells for 72 hours while the FLAG-USE1 was expressed in the cells for the last 24 hours.
  • sequences used in the experiments are as follows: Sequences of E6AP isoform II (GenBank Accession No. NP_000453.2) with the HA-tag as expressed in mammalian cells under control of the CMV promoter are provided in SEQ ID NOs: 63 (polypeptide) and 64 (polynucleotide encoding same);
  • Sequences of wild-type UBA6 with HA-tag as expressed in mammalian cells under control of the CMV promoter are provided in SEQ ID NOs: 65 (polypeptide) and 66 (polynucleotide encoding same);
  • sequences of the wild type 3x-FLAG-tagged USE1 (UBE2Z) as expressed in mammalian cells under control of the CMV promoter are provided in SEQ ID NOs: 69 (polypeptide) and 70 (polynucleotide encoding same);
  • sequences of the wild type Hise-AviTag-tagged USE1 (UBE2Z) as expressed in bacterial (E. coli) cells under control of the T7 promoter are provided in SEQ ID NO: 71 (polypeptide) and 72 (polynucleotide encoding same);
  • the sequences of the Hise-tagged SCCH domain of the UBA6 (UBE1L2) [amino acids (aa) 623-889] as expressed in bacterial (E. coli) cells under control of the T7 promoter are provided in SEQ ID NOs: 62 (polypeptide) and 61 (polynucleotide encoding same).
  • Fluorescein-5-Maleimide (AnaSpec) was attached to ubiquitin following the directions as previously described 45 . Briefly, proteins in 20 mM Tris (pH 7.5), 150 mM NaCl and 1 mM TCEP were incubated for 2 hours in the presence of the fluorophore at room temperature such that the label : protein ratio would be 4. To quench the reaction, beta-mercaptoethanol was added at a ratio of 10: 1 to fluorescein. Fluorescein-labeled ubiquitin was then separated from free dye on PD10 desalting columns (Cytiva) and was stored at 80 °C.
  • El and E2 loading assays All loading assays were performed at 32 °C in a buffer containing 20 mM HEPES (pH 7.5), 150 mM NaCl and 10% (w/v) glycerol. El and E2 loading assays were performed using 3 pM fluorescein ubiquitin, a range of 10 nM to 1 pM El, 1 pM E2, and 2.5 mM concentrations each of ATP and MgCL. Reactions were stopped using non-reducing SDS-PAGE loading buffer. Samples were separated on 4-20% Tris-Glycine NuPAGE gels (Thermo) in Tris-Glycine buffer.
  • the present inventors have constructed models for UBA6 using the Protein Homology/analogY Recognition Engine V 2.0 (PHYRE2) and the AlphaFold server 49, 50 . Further idealization of the geometry was achieved by five cycles of minimization with Refmac5. The model of full length USE1 was downloaded from the AlphaFold server 49, 50 . Structure visualization and figures preparations were performed with PyMOL (Molecular Graphics System, hypertexttransferprotocol://worldwideweb(dot)pymol(dot)org). The present inventors employed the continuum solvation method APBS (Adaptive Poisson-Boltzmann Solver) with the CHARMM force field to calculate the electro-potential surface of UBA1 and UBA6 51 .
  • APBS Adaptive Poisson-Boltzmann Solver
  • Microscopy - The cells were grown on coverslips, and then washed and fixed in 4% Paraformaldehyde for 10-15 minutes before being permeabilized with 0.1% Triton X-100.
  • a solution of, 1% BSA in PBS was used to block both primary and secondary antibodies.
  • the primary antibody was added at a ratio of 1: 100 and incubated for at least 1 hour at room temperature while the secondary antibody (1:300 Invitrogen) was allowed to incubate with the sample for 30 minutes at room temperature.
  • Neurons were permeabilized in 2% BSA + 0.1% Triton, and blocked with 2% BSA and the primary antibodies were incubated overnight at 4°C, at a ratio of 1: 150, with the secondary antibody incubated for 2 hours at room temperature at 1:500.
  • a Zeiss 710 confocal microscope was utilized for confocal imaging with a 63X oil-immersion lens. Nuclear staining was detected by staining with DRAQ5. For quantification, the operator was blinded to the outcome of the experiment when selecting suitably similar fields to image for subsequent computerized analysis.
  • the association of PHOX2B and UBA6 outside the nucleus was measured by selecting PHOX2B positive cells manually using Fiji, and excluding the nuclei by segmenting and removing the nuclear channel.
  • the colocalization between the channels of interest was then measured using the JACops plugin in Fiji with the default parameters, and Pearson’ s correlation coefficient was calculated.
  • the cytoplasmic intensity was measured for the channel of interest and the mean gray value was recorded after excluding the nuclei as already described.
  • the association of UBA6 with the cell body was examined by selecting the neuronal cell bodies manually using Fiji 52 .
  • the cell bodies were selected manually and removed.
  • Arc intensity in the neurons was measured by circulating the neuronal cell body together with the first neurite junction manually using Fiji.
  • the mean integrated value and the area for each neuron were recorded. The value of the mean divided by the area was used for statistical analysis.
  • FLIM imaging was performed using two-photon FLIM microscopy.
  • the cells were immunostained by mouse anti-USEl and rabbit anti-UBA6 primary antibodies, with secondary antibodies anti-mouse Alexa Fluor 488 and anti-rabbit Alexa Fluor 555, respectively.
  • the donor antibody Alexa Fluor 488) was excited with a Ti-sapphire laser (Chameleon, Coherent) at a wavelength of 920 nm and a power of 1.0-2.0 mW.
  • the images were acquired by Bergamo two- photon microscope (Thorlabs) equipped with a Time-Correlated Single Photon Counting board (Time Harp 260, Picoquant), thorough a 18x0.8na objective (Nikon).
  • the present inventors calculated the mean lifetime of multiple ROIs at each image using double exponent fitting.
  • the present inventors determined the lifetime of donor only samples (prepared with staining for USE1 only) and compared them with the mean lifetime of cells stained for donor and acceptor (USE1+ UBA6). Then, the present inventors subtracted donor- (donor/acceptor) lifetime, to compare the change in lifetime between groups.
  • RNA analysis by qRT-PCR - RNA purification was performed using the total RNA purification Micro kit (Norgen, 35300) according to manufacturer’s protocol. The concentration and quality of the RNA were measured by NanoDrop one (Thermo Fisher).
  • the cDNA generation was done by using a High capacity cDNA reverse transcription kit (Applied Biosystem, 4368814) with RNase inhibitor (Applied Biosystem, N8080119) as described in the kit protocol. Then, the cDNA was diluted in ultra-pure water in a ratio of 1:5 (each biological replicate was assessed in triplicates). Reaction solutions were prepared for each set of primers including the genes E6AP/UBE3A and two different sets of primers for P- Actin.
  • the reaction volume contained Fast SYBER green master mix (Applied Biosystem, 43856120), forward and reverse primers, ultra- pure water, and the cDNA template.
  • FSA Fast SYBER green master mix
  • forward and reverse primers the mean of two sets of primers for P- Actin was included as an endogenous control.
  • the data were analyzed using the AACT method.
  • the sequence of the primers used are provided in Table 3 below.
  • the supernatant was adjusted to 1% sarkosyl and incubated for 1 hour at 37 °C on orbital shaker followed by ultracentrifugation for 1 hour at 4°C.
  • the pellet (sarkosyl-insoluble fraction) was resuspended 50 pl TBSX1 for further analysis.
  • Bioinformatics analysis - USE1/UBE2Z human homologs were searched against the Uniprot (Pubmed id 29425356) and NCBI databases using BLAST (Pubmed id 2231712).
  • Prosite (Pubmed id 23161676) was used to scan for alanine residues motifs with between 6 and 10 continuous alanine residues in the BLAST results (a search for proteins containing polyalanine stretches in the ubiquitin cascades).
  • Alignments of the E2 family in vertebrates and across all databases were calculated using MAFFT (Pubmed id 28968734). The figures were generated using J al view (Pubmed id 19151095).
  • USE1 has both N- and C-terminal extensions as well as the ubiquitin-conjugating (UBC) core domain ( Figure 1A), classifying it as a class IV E2, which can be specifically loaded with ubiquitin by the El ubiquitin activating enzyme, UBA6, via a transthiolation reaction 7, 8 ’ 15 .
  • the polyalanine stretch of USE1 is located in the N-terminal extension and is well conserved in primates, several other mammals, and reptiles ( Figure 1A and Figure 5B).
  • the present inventors replaced two alanine residues in the stretch with arginine residues (the 2A— >2R mutant) .
  • a deletion mutant devoid of the polyalanine stretch has reduced ubiquitin loading compared to a wild type USE1 or a hyperactive mutant (deletion of Loop B) -
  • the present inventors constructed additional USE1 mutants including one with a deletion of the polyalanine stretch (USE1 APolyAla), and a deletion of Eoop B (USE1 AEB), which is hyperactive 16 ( Figure 1C).
  • the USE1 APolyAla mutant exhibits reduced ubiquitin loading compared to wild type USE1 or to USE1 ALB both in cells and in vitro with purified recombinant UBA6 ( Figure 1C, Figure ID and Figures 6A-B).
  • the present inventors have mutated the endogenous polyalanine stretch of USE1 by generating a knockout HEK293T cell line harboring a deletion of the polyalanine stretch in the UBE2Z alleles (USE1 APolyAla KO).
  • the endogenous USE1-UBA6 interaction in these cells was detected with Forster resonance energy transfer (FRET) based fluorescence lifetime imaging microscopy (FLIM).
  • FRET Forster resonance energy transfer
  • FLIM fluorescence lifetime imaging microscopy
  • E6AP/UBE3 A is a highly potent E3 ubiquitin ligase whose regulation is critical for proper development of the nervous system. Indeed, decreased activity of the ligase results in Angelman syndrome while increased activity causes autism spectrum disorders 14, 17, 18 .
  • Harper and coworkers identified a unique regulatory cascade by which UBA6-USE1 ubiquitinates E6AP for degradation in the proteasome 13 .
  • the present inventors have examined the stability of E6AP in the USE1 APolyAla KO cells. In control HEK293T cells, a cycloheximide chase experiment revealed that E6AP has an apparent half-life of approximately 10-14 hours ( Figure IE), which is consistent with previous reports in cultured cells 13 .
  • E6AP was stabilized in the USE1 APolyAla KO cells and showed a decrease in Lys48-linked polyubiquitination ( Figures IE and IF), suggesting that proteasome-mediated degradation of E6AP is inhibited in the USE1 APolyAla KO cells.
  • E6AP is monoubiquitinated and polyubiquitinated by the UBA6-USE1 cascade 13
  • the present inventors have further investigated the role of the polyalanine stretch of USE1 in E6AP ubiquitination by incubating purified E6AP with UBA6, USE1 WT and USE 1 mutants (APolyAla and C188A) in vitro.
  • UBA6 Identification of regions in UBA6 which determine specificity to USE1 -
  • the ubiquitin- activating El enzymes, UBA1 and UBA6 share 40% identity of protein sequence and a strong specificity for their cognate ubiquitin-like proteins 19-21 .
  • the ubiquitin fold domain of El interacts with the al helix of E2 and is responsible for determining the selectivity between E2s or different ubiquitin-like proteins 22 .
  • UBA1 and UBA6 assume the same domain architecture and folds. Therefore, to identify additional regions in UBA6 that are likely to determine the specificity to USE1, the present inventors compared the physico-chemical properties of UBA6 to those of UBA1 ( Figure 2A). Using AlphaFold the present inventors constructed a model of UB A6 (data is presented in Figure 2A). In addition, the crystal structures of UBA6 have been recently published 23,24 . These experimental data confirmed the AlphaFold model with very minor differences. Comparison of the models for the general structure containing 698 Ca atoms yielded an RMSD of 1.2A.
  • the SCCH domain of UBA6 and the polyAla stretch in USE1 affect the interaction between UBA6 and USE1 but not the mechanism of ubiquitin activation or transthiolation -
  • a biophysical analysis revealed that a peptide of 7 alanine residues interacts directly with the SCCH domain of UBA6, but has significantly weaker binding to the SCCH domain of UBA1 ( Figure 7B).
  • the present inventors have further constructed UBA6 mutants with the positive residues in the SCCH domain replaced by Ala (UBA6 mut 4Ala) or Asp (UBA6 mut 4Asp).
  • Polyalanine stretches which are expressedin the cytoplasm bind effectively to UBA6 and reduce loading of ubiquitin on USEl - Since UBA6 is mainly localized in the cytoplasm in HEK293T cells, the present inventors expressed the isolated GFP-19Ala stretches with or without a nuclear localization sequence (NFS) and monitored their binding to UBA6 (Figure 8A and Figure 3 A) as well as their ability to affect ubiquitin loading of USEl ( Figure 9A). The results show that polyalanine stretches bind UBA6 effectively when expressed in the cytoplasm without an NLS (Figure 3A), and reduce the ubiquitin loading of USEl (Figure 9A).
  • NLS nuclear localization sequence
  • Polyalanine stretches which are expressed in the nucleus do not bind UBA6 and do not affect USEl loading - In contrast to the cytoplasmic expression of the isolated polyAla stretches, when the isolated polyalanine stretches are expressed in the nucleus (due to the NLS) they do not bind UBA6 and they do not have any apparent effect on USE1 loading ( Figure 3 A, Figure 9A).
  • PH0X2B WT, +13 Ala, Figure 3B
  • RUNX2 WT, +6 Ala, +12 Ala, Figure 3C
  • H0XD13 WT, +10 Ala, Figure 3D
  • PABPN1 WT, +7 Ala, Figure 3E
  • mutant PHOX2B (+ 13 Ala) have further tested the effect of mutant PHOX2B (+ 13 Ala) on the binding between USE1 and UBA6. As shown in Figure 3F recombinant mutant PHOX2B (+ 13 Ala) competes with USE1 for binding to UBA6 in vitro.
  • mutant PHOX2B increases the levels of E6AP due to its stabilization in HEK293T cells ( Figure 3G, Figure 9C, Figure 10F).
  • mutant PHOX2B does not increase E6AP mRNA levels, indicating that the increased E6AP levels are not related to transcriptional effects ( Figure 10G). This correlates with a decrease in Eys48-linked polyubiquitination of E6AP ( Figure 3H, Figure 10H), suggesting that proteasome-mediated degradation of E6AP is inhibited by mutant PHOX2B in the cells.
  • mutant PH0X2B exhibit increased colocalization with UBA6, which correlates with increasing length of the polyalanine stretch ( Figure 31, Figure 11D).
  • expression of mutant PH0X2B with +7 Ala and +13 Ala increase the levels of E6AP in the primary neurons by 1.3 fold (Figure 3 J), which is consistent with physiological induction rates of E6AP protein levels in cultured neurons 28 .
  • the synaptic activity-regulated cytoskeleton-associated protein (Arc) is negatively regulated by E6AP 28, 29 , and accordingly, the increase in E6AP levels due to ectopic expression of the PH0X2B mutants with +7 Ala and +13 Ala decreases Arc levels in primary neurons (Figure 3 J, Figure 1 IF).
  • OMPD patient-derived cricopharyngeal myotubes and primary fibroblasts as well as non-affected control fibroblasts express PABPN1 both in the cytoplasm and in the nucleus ( Figures 12A-B), which could be related to the ability of PABPN1 to shuttle between the nucleus and the cytoplasm 31 . Accordingly, OPMD patient-derived fibroblasts have less interaction between UBA6 and USE1 than control fibroblasts ( Figures 12C-D). Endogenous PH0X2B is expressed in specific neuronal populations of the autonomic nervous system 32, 33 .
  • CCHS a rare and life-threatening condition with autonomic nervous system dysfunction 34, 35 .
  • the present inventors have previously described the generation of two induced pluripotent stem cells (iPSCs) from identical twins carrying a heterozygous PH0X2B +5 Ala expansion (lOliCCHS 20/25 and 102iCCHS 20/25) 36 .
  • the present inventors obtained skin punch biopsies from an additional CCHS patient bearing a heterozygous +7 Ala expansion (104iCCHS 20/27), as well as from their sex- matched healthy family relatives, which serve as controls (103iCTR 20/20 and 105iCTR 20/20) ( Figures 13A1-O5). These patients suffer from central sleep apnea with a more severe peripheral autonomic presentation in 104iCCHS 20/27, including Hirschsprung disease. Patient-derived fibroblasts were reprogrammed using non- integrating episomal plasmids as previously described 36 .
  • Characterization of the human autonomic neurons reveals expression of PHOX2B, the pan-neuronal marker piH-tubulin, the catecholaminergic marker tyrosine hydroxylase (TH), the peripheral neuronal marker peripherin, and atonal BHEH transcription factor 1 (ATOH1), which is associated with breathing and digestion ( Figure 4A).
  • a POLY-ALANINE PEPTIDE IS CAPABLE OF INCREASING POLY-UBIQUITINATION OF E6AP
  • E6AP copy number variations resulting in overexpression of E6AP are strongly associated with the development of autism spectrum disorders (ASDs) (Khatri Natasha et al., 2019. Front Mol Neurosci. 12: 109). In addition, it is known that E6AP undergoes poly-ubiquitination as part of its proteasome-mediated degradation (Lee P., 2013, Mol. Cell, 50: 172-184).
  • the present inventors have tested the ability of an agent, which increases activity of UB A6 to increase E6AP ubiquitination, for proteasome-mediated degradation.
  • E6AP purified from HEK293T cells was incubated in vitro with bacterially- produced UBA6, USE1, and ubiquitin with or without polyalanine peptide (cy5-7-Ala residues; SEQ ID NO: 22).
  • cy5-7-Ala residues SEQ ID NO: 22
  • the addition of a peptide of 7-Ala residues resulted in increased E6AP poly-ubiquitination.
  • Expansion mutations in stretches of repetitive DNA sequences that encode poly amino acids such as polyglutamine or polyalanine can cause various diseases. Although much progress has been made on determining the molecular mechanisms of polyglutamine diseases 9, 37, 38 , the consequences of polyalanine expansions remain more of an enigma.
  • the present inventors demonstrate how expanded polyalanine stretches can compete with the normal function of a shorter stretch to disrupt the specific interaction between the E2 ubiquitin- conjugating enzyme USE1 and the El ubiquitin- activating enzyme, UBA6. The results indicate that UBA6 interacts with polyalanine stretches, and that this interaction contributes to UBA6 recognition of USE1, but can be altered by different polyalanine disease-causing proteins.
  • UBA6 plays an important role in mouse embryonic development, neuronal function, and survival 13, 42 .
  • inhibition of UB A6 by sequestering the enzyme into soluble cytoplasmic polyalanine expansions may represent a deleterious mechanism for such mutations.
  • the correlation between disease severity and the length of the polyalanine expansion may be related to the greater tendency of mutants with longer polyalanine stretches to mislocalize to the cytoplasm and interact there with UBA6. The results provide evidence that cytoplasmic mislocalization of endogenous PHOX2B can occur in the neurons affected in CCHS, which may contribute to the neuronal dysfunction seen in this disease.
  • the study provides mechanistic insights into the long-standing question of the functional role of polyalanine stretches and demonstrates that they are relevant to the ubiquitin system and its dysregulation in disease states.

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Chemical & Material Sciences (AREA)
  • Hematology (AREA)
  • Cell Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Urology & Nephrology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Neurology (AREA)
  • Zoology (AREA)
  • General Physics & Mathematics (AREA)
  • Organic Chemistry (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Food Science & Technology (AREA)
  • Neurosurgery (AREA)
  • Physics & Mathematics (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Toxicology (AREA)
  • General Engineering & Computer Science (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)

Abstract

Provided are methods of treating a subject having a disease associated with a polyalanine expansion mutation, by administering to the subject a therapeutically effective amount of an agent capable of upregulating expression or activity of a ubiquitin like modifier activating enzyme 6 (UBA6) in nervous system cells of the subject. Also provided are methods of increasing ubiquitination of an E6AP polypeptide in a cell by an agent capable of specifically upregulating expression or activity of UBA6 and methods of screening for agent capable of specifically modulating expression or activity of UBA6.

Description

METHODS OF TREATING DISEASES ASSOCIATED WITH POLYALANINE EXPANSION MUTATIONS
RELATED APPUCATION/S
This application claims the benefit of priority of U.S. Provisional Patent Application No. 63/339,562 filed on 9 May 2022, the contents of which are incorporated herein by reference in their entirety.
Figure imgf000002_0001
The Sequence Listing file, entitled 95908. xml, created on 9 May 2023\, comprising 155,648 bytes, submitted concurrently with the filing of this application is incorporated herein by reference.
FIELD AND BACKGROUND OF THE INVENTION
The present invention, in some embodiments thereof, relates to methods of treating a subject having a disease associated with a polyalanine expansion mutation and, methods of increasing ubiquitination of E6AP.
Trinucleotide repeats present within coding regions of the genome encode stretches of the same amino acid9, and expansion mutations of such amino acid sequences have now been linked to a growing number of human diseases. The nine diseases caused by expansions of polyalanine tracts (stretches) are due to the expression of aberrant nuclear proteins (eight of the nine are transcription factors). Examples include mutant paired like homeobox 2B (mutant PHOX2B) in congenital central hypoventilation syndrome (CCHS)1, mutant RUNX family transcription factor
2 (mutant RUNX2) in cleidocranial dysplasia3, mutant homeobox D13 (mutant HOXD13) in synpolydactyly2, and mutant poly(A) binding protein nuclear 1 (mutant PABPN1) in oculopharyngeal muscular dystrophy (OPMD)5. The vast majority of cases are caused by de novo mutations and often involve congenital neurological abnormalities. The disease-causing expansions vary in length, according to the gene in question, with the severity of the associated clinical phenotype generally increasing with the length of the expanded tract9 11. Physiological polyalanine tracts are commonly found in proteins, although they usually do not exceed 20 residues. In contrast, disease-causing expansion mutations may contain up to 13 additional alanine residues and can result in protein misfolding9 11. The exact functional or structural role of the polyalanine stretches in normal proteins is unclear. Perturbations of ubiquitin activation, conjugation and transfer to target proteins via the El- E2-E3 enzymatic cascade have been linked to dysregulation of neuronal homeostasis and to a growing number of neurodevelopmental disorders12 14.
Lee Ji Yeon et al., 2015 (Behavioural Brain Research 281: 78-85) describe impairment of social behavior and communication in mice lacking the Uba6-dependent ubiquitin activation system, suggesting the UBA6 knockout mice as an animal model system to study autism spectrum disorders (ASDs).
Ubiquitin protein ligase E3A (UBE3A, also known as “E6-AP” or “E6AP”) is part of the ubiquitin protein degradation system, and interactions of UBE3A with the E6 protein of human papillomavirus (HPV) types 16 and 18 are known to result in ubiquitination and proteolysis of tumor protein p53. In addition, E6AP itself undergoes poly- ubiquitination as part of its proteasome-mediated degradation (Lee P., 2013, Mol. Cell, 50: 172-184). Maternally inherited deletions or point mutations in UBE3A cause Angelman Syndrome. On the other hand, copy number variations (CNVs) that result in the overexpression of E6AP are strongly associated with the development of autism spectrum disorders (ASDs) (Khatri Natasha et al., 2019. Front Mol Neurosci. 12: 109).
SUMMARY OF THE INVENTION
According to an aspect of some embodiments of the present invention there is provided a method of treating a subject having a disease associated with a polyalanine expansion mutation, the method comprising administering to the subject a therapeutically effective amount of an agent capable of upregulating expression or activity of a ubiquitin like modifier activating enzyme 6 (UBA6) in nervous system cells of the subject, thereby treating the subject.
According to an aspect of some embodiments of the present invention there is provided a therapeutically effective amount of an agent capable of upregulating expression or activity of a ubiquitin like modifier activating enzyme 6 (UBA6) in nervous system cells, for use in treating a disease associated with a polyalanine expansion mutation.
According to an aspect of some embodiments of the present invention there is provided a method of treating a subject diagnosed with autism spectrum disorders (ASDs), the method comprising administering to the subject a therapeutically effective amount of an agent capable of upregulating expression or activity of a ubiquitin like modifier activating enzyme 6 (UBA6) in nervous system cells of the subject, thereby treating the subject.
According to an aspect of some embodiments of the present invention there is provided a therapeutically effective amount of an agent capable of specifically upregulating expression or activity of a ubiquitin like modifier activating enzyme 6 (UBA6) in nervous system cells, for use in treating autism spectrum disorders (ASDs).
According to an aspect of some embodiments of the present invention there is provided a method of increasing ubiquitination of an E6AP polypeptide in a cell, the method comprising contacting the cell with a therapeutically effective amount of an agent capable of specifically upregulating expression or activity of a ubiquitin like modifier activating enzyme 6 (UBA6) in the cell, thereby increasing the ubiquitination of the E6AP polypeptide in the cell.
According to an aspect of some embodiments of the present invention there is provided a method of generating neurons with a polyalanine expansion mutation, the method comprising subjecting induced pluripotent stem cells (iPSCs) which comprise a genomic polyalanine expansion mutation to culture conditions suitable for differentiating said iPSCs into neurons, thereby generating the neurons with the Polyalanine expansion mutation.
According to an aspect of some embodiments of the present invention there is provided a method of screening for an agent capable of specifically modulating expression or activity of a ubiquitin like modifier activating enzyme 6 (UBA6), the method comprising:
(a) contacting neurons comprising a genomic polyalanine expansion mutation with a plurality of molecules,
(b) identifying at least one molecule of said plurality of molecules which modulates a complex formed by UBA6 and USE1, said at least one molecule being agent capable of specifically modulating expression or activity of the UBA6.
According to some embodiments of the invention, contacting is in the presence of a functional portion of said UBA6 comprising a second catalytic cysteine half (SCCH) domain.
According to some embodiments of the invention, identifying the at least one molecule of the plurality of molecules which modulates the complex formed by the UBA6 and USE1 is effected by monitoring ubiquitination level of a target polypeptide.
According to some embodiments of the invention, the target polypeptide is E6AP.
According to some embodiments of the invention, contacting is effected in vivo.
According to some embodiments of the invention, contacting is effected ex vivo.
According to some embodiments of the invention, the cell is a nervous system cell.
According to some embodiments of the invention, the cell is of a subject diagnosed with a disease characterized by abnormally high levels of an E6AP polypeptide.
According to some embodiments of the invention, the cell is of a subject diagnosed with autism spectrum disorders (ASDs). According to some embodiments of the invention, the polypeptide having said polyalanine expansion mutation has an aberrant cellular localization as compared to a corresponding wild-type polypeptide.
According to some embodiments of the invention, the polypeptide having said polyalanine expansion mutation is cytoplasmic.
According to some embodiments of the invention, the polyalanine expansion mutation occurs in a polypeptide selected from the group consisting of a paired like homeobox 2B (PH0X2B), aristaless related homeobox (ARX), SRY-box transcription factor 3 (SOX3), Zic family member 2 (ZIC2), forkhead box L2 (F0XL2), RUNX family transcription factor 2 (RUNX2), homeobox Al 3 (H0XA13), homeobox D13 (H0XD13), and poly(A) binding protein nuclear 1 (PABPN1).
According to some embodiments of the invention, the disease is selected from the group consisting of congenital central hypoventilation syndrome (CCHS), X-linked cognitive disability and epilepsy, X-linked cognitive disability with growth hormone deficiency, Holoprosencephaly type 5, Blepharophimosis syndrome, cleidocranial dysplasia (CCD), Hand-foot-genital syndrome, synpolydactyly, and oculopharyngeal muscular dystrophy (OPMD).
According to some embodiments of the invention, the agent upregulates expression level of said UBA6.
According to some embodiments of the invention, the agent is a polynucleotide encoding at least a functional portion of said UBA6 comprising a second catalytic cysteine half (SCCH) domain.
According to some embodiments of the invention, the polynucleotide is an mRNA molecule.
According to some embodiments of the invention, the polynucleotide is comprised in a nucleic acid construct suitable for in-vivo delivery into nervous system cells of the subject.
According to some embodiments of the invention, the agent stabilizes formation of a protein complex between said UBA6 and USE1.
According to some embodiments of the invention, the agent is a peptide of 5-10 alanine residues.
According to some embodiments of the invention, the SCCH domain of the UBA6 is set forth by SEQ ID NO: 25.
According to some embodiments of the invention, the neurons are peripheral autonomic neurons. According to some embodiments of the invention, the modulating is upregulating said expression or activity of said UBA6 in a cell of a nervous system
According to some embodiments of the invention, the modulating is downregulating said expression or activity of said UBA6 in a cell of a nervous system
According to some embodiments of the invention, the method further comprising synthesizing the identified agent.
According to some embodiments of the invention, the neurons are differentiated in vitro from induced pluripotent stem cells (iPSCs) comprising a genomic polyalanine expansion mutation.
According to some embodiments of the invention, subjecting said iPSCs to culture conditions suitable for differentiating the iPSCs into neurons comprises the steps of:
(a) culturing said iPSCs in a culture medium suitable for induction of iPSCs into neuromesodermal progenitor cells (NMPs);
(b) culturing said NMPs in a culture medium suitable for induction of sympathetic neural crest;
(c) culturing said sympathetic neural crest in a culture medium suitable for induction of sympathetic neuroblast crest; and
(d) culturing said sympathetic neuroblast crest in a culture medium which is suitable for maturation of sympathetic neurons.
According to some embodiments of the invention, the culture medium suitable for induction of iPSCs into neuromesodermal progenitor cells (NMPs) comprises a glycogen synthase kinase 3 (GSK-3) inhibitor and an ALK5 (activin receptor-like kinase 5) inhibitor.
According to some embodiments of the invention, the culture medium suitable for induction of said NMPs into sympathetic neural crest comprises basic fibroblast growth factor (bFGF), bone morphogenic protein 4 (BMP4) and retinoic acid (RA).
According to some embodiments of the invention, the culture medium suitable for induction of sympathetic neuroblast crest comprises basic fibroblast growth factor (bFGF), bone morphogenic protein 4 (BMP4) and epidermal growth factor (EGF).
According to some embodiments of the invention, the culture medium suitable for induction of sympathetic neuronal maturation comprises nerve growth factor (NFG), glial cell derived neurotrophic factor (GDNF) and brain derived neurotrophic factor (BDNF).
According to some embodiments of the invention, the method further comprising detecting presence of differentiated neurons following step (d) using an immunological detection method. According to some embodiments of the invention, the immunological detection method is performed with an antibody which specifically binds to a marker selected from the group consisting of: Tuj la, MAP2ab, Peripherin, AT0H1, PH0X2B, dopamine beta-hydroxylase (DBH) and Tyrosine hydroxylase (TH).
Unless otherwise defined, all technical and/or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and/or materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWING(S)
Some embodiments of the invention are herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of embodiments of the invention. In this regard, the description taken with the drawings makes apparent to those skilled in the art how embodiments of the invention may be practiced.
In the drawings:
FIGs. 1A-G depict that a polyalanine stretch in USE1 regulates UBA6-USE1 ubiquitin transfer. Figure 1A: Structure of the USE1 enzyme (PDB 5A4P) indicating the catalytic cysteine (Cysl88), loop B (LB) with Trpl95 masking Cysl88, and model of the C-and N-terminal extensions including the alanine repeats (created by AlphaFold). Figure IB: FLAG-wild type (WT) USE1, FLAG-USE 1 mutant with aberrations in the polyalanine (2A> 2R), and FLAG-USE 1 catalytic dead mutant (C188A) were co-expressed with HA-Ub (a ubiquitin molecule with HA tag) in control or UBA6-depleted (Uba6 small inhibitory RNA, siRNA) HEK293T cells. Cell lysates were incubated with or without P mercaptoethanol (PME) and analyzed for ubiquitin loading. Results are mean ± s.e.m normalized to control WT USE1. One-way ANOVA Dunnet’s test, n=4. Figure 1C: Time- dependent in vitro ubiquitin loading of WT and APolyAla USE1 by UBA6. A Representative blot is shown in Figure 6B. Quantification of USE 1 ubiquitin loading is presented as mean ± s.e.m Two-way ANOVA Sidak’s test, n=3. Figure ID: Quantification of UBA6-USE1 interaction in WT and USE1 APolyAla knockout (KO) HEK293T cells using FLIM-FRET. Representative 2pFLIM pseudo-colored images of WT cells and APolyAla KO cells, stained for USE1 and UBA6 using secondary antibodies as donor (Alexa 488) and acceptor (Alexa 555), respectively. Scale bar is 200 pm The comparison of the difference in lifetime (donor only to donor and acceptor lifetime) in nano seconds (ns) ofWT and APolyAla KO cells is shown as mean ± s.e.m (Control 0.099+0.006, KO 0.055+0.007) for n= 97 and 108 cells, respectively. Unpaired 2-tailed t- test. Figure IE: WT and APolyAla KO cells were treated with cycloheximide (CHX) at the indicated times, and were analyzed for E6AP levels. Results are mean + s.e.m normalized to t=0 for each type of cells. n=4, Two-way ANOVA Sidak’s post hoc test. Figure IF: WT and APolyAla KO cells were incubated for the last 6 hours with the proteasome inhibitor MG132 (10 pM), and E6AP was immunoprecipitated from cell lysates for ubiquitination analysis (under reducing conditions with PME). Figure 1G: E6AP purified from HEK293T cells was incubated with bacterially-produced UBA6, USE1 WT and USE1 mutants (APolyAla and C188A) for in vitro E6AP ubiquitination assay. E6AP ubiquitin conjugates (under reducing conditions with PME) was resolved by SDS-page (* indicates the mono-ubiquitin conjugate), ns non- significant, * P < 0.05, ** P < 0.01, ****P < 0.0001.
FIGs. 2A-D demonstrate that UBA6 interacts with polyalanine stretches. Figure 2A: Electrostatic surface representation of the UBA6 structural model in comparison to UBA1. The location of key Arg and Eys residues forming the positively charged patch in UBA6 is presented. Figures 2B-C: HA-tagged constructs of WT UBA1, WT UBA6, and UBA6 mutants with Ala or Asp substitution mutations in Lys628, Arg691, Eys709, and Lys714 (UBA6 mut 4Ala or UBA6 mut 4Asp) were co-transfected with FEAG-USE1 (Figure 2B) or empty GFP and GFP-polyAla (19Ala) (Figure 2C) into HEK293T cells. Cell lysates were immunoprecipitated with anti-HA antibodies and the immunocomplexes were analyzed with anti-FEAG, anti-HA, and anti-GFP antibodies. Results are mean + s.e.m. One-way ANOVA Dunnett’s test, n=3. Figure 2D: Representative gel of time-dependent in vitro ubiquitin loading of USE 1 by WT UBA6, UBA6 mut 4 Ala, and UBA6 mut 4Asp in the presence of fluorescein-labelled ubiquitin. Imaging of fluorescent ubiquitin conjugates was carried out with a laser scanner at 488 nm. Quantification of USE1 ubiquitin loading is presented as mean + s.e.m. Two-way ANOVA Tukey’s test, n=3. *P < 0.05, **P < 0.01, **** P < 0.0001.
FIGs. 3 A- J demonstrate that polyalanine-expanded disease proteins interact with UBA6 and inhibit E6AP degradation. Figures 3A-E: HEK293T cells were transfected with the indicated constructs and immunoprecipitated for endogenous UBA6. Figure 3A: Empty GFP, and GFP- polyAla with or without a nuclear localization sequence (NFS). Figure 3B: WT and mutant PHOX2B (+13Ala). Figure 3C: WT and mutant RUNX2 (+6Ala and +12Ala). Figure 3D: WT and mutant H0XD13 (+10Ala). Figure 3E: WT and mutant PABPN1 (+7 Ala). Figure 3F: Cell lysates of HEK293T cells expressing HA-UBA6 and FEAG-USE1 were incubated with recombinant TIG- mutant PH0X2B. Anti-HA beads were used to pulldown UBA6 (beads only were used as control). The bound USE1/UBA6 ratio is shown. n=3, Paired 2-tailed t-test. Figure 3G: Cells were transfected with mutant PH0X2B or empty vector. The cells were treated with cycloheximide (CHX) at the indicated times, and were analyzed for E6AP levels. Results are mean ± s.e.m normalized to t=0. n=3, Two-way ANOVA Sidak’ s post hoc test. A representative blot is presented shown in Figures 10F and 10H. Control and UBA6-depleted HEK293T cells were transfected with mutant PH0X2B or empty vector and incubated for the last 6 hours with the proteasome inhibitor MG132 (10 pM). Endogenous E6AP was immunoprecipitated from cell lysates for ubiquitination analysis. Figures 31- J: Mouse primary cortical neurons were transduced with lentiviral vectors expressing GFP-tagged WT PHOX2B or mutant PHOX2B (+7 Ala and +13Ala). Figure 31: Association of endogenous UBA6 (red) with GFP-PHOX2B (green). Scale bar 10 pm. Quantification is shown in Figure 11D. Figure 3 J: Analysis of E6AP and Arc levels in the WT and mutant PHOX2B-expressing neurons (n=5 and n=4, respectively). Results are mean ± s.e.m normalized to WT PHOX2B. One-way ANOVA Tukey’s test, ns non-significant, *P < 0.05, **P < 0.01, ***P < 0.001.
FIGs. 4A-G demonstrate that UBA6 overexpression rescues CCHS patient-derived autonomic neurons from neuronal death. Figure 4A: Characterization of iPSC-derived autonomic neurons at day 31 of differentiation from healthy controls and CCHS patients, hnmunocytochemistry of PHOX2B (green), piH-tubulin (TUBP3, red), tyrosine hydroxylase (TH, green) peripherin (PRPH, green), and atonal BHLH Transcription Factor 1 (ATOH1, green). Scale bar 200 pm. Figure 4B: Quantification of the association of endogenous UBA6 with endogenous PHOX2B (Pearson’s coefficient) in autonomic neurons from control and CCHS patients. Results are the average values from neurons in different imaged fields. Total number of neurons analyzed was 160 for 103iCTR 20/20, 350 for 102iCCHS 20/25, 380 for 105iCTR 20/20 and 550 for 104iCCHS 20/27. One-way ANOVA Tukey’s test. Images are shown in Figure 14D. Figure 4C: Representative 2pFLIM pseudo-colored images of control and CCHS patient-derived neurons, stained for USE1 and UBA6 using secondary antibodies as donor (Alexa 488) and acceptor (Alexa 555), respectively. Scale bar is 20 pm Comparison of the difference in lifetime for each group, for the subtraction of donor only to donor and acceptor fluorescence lifetime. Control neurons 0.253+0.012, patient neurons 0.025+0.007 (mean + s.e.m, n= 67 and 153 cells, respectively). Unpaired 2-tailed t-test. Figure 4D: Analysis of E6AP levels in control (105iCTR 20/20) and CCHS patients (102iCCHS 20/25 and 104iCCHS 20/27). Results are mean + s.e.m normalized to control from three independent differentiation days. Paired 2-tailed t-test. Figure 4E: Quantification of E6AP mRNA in the control and patient-derived autonomic neurons. Results are mean + s.e.m. Unpaired 2-tailed t-test. Figures 4F-G: Patient-derived autonomic neurons (102iCCHS 20/25) were transduced with mCherry-UBA6 cDNA lentiviral vectors. Figure 4F: Representative images of Annexin V signal (colored green and marked with arrows) of the transduced and non-transduced patient neurons. Scale bar 20 pm. Quantification of cell surface Annexin V intensity in different image fields as mean ± s.e.m (transduced n=80 cells, non-transduced n=92). Figure 4G: Representative images of TUNEL staining (colored green marked with arrows) of the transduced and non-transduced patient neurons. The percentage of the TUNEL positive PHOX2B expressing cells is shown as mean ± s.e.m. At least 1000 PHOX2B expressing cells were analyzed. Unpaired 2-tailed t-test. ns non- significant, *P < 0.05, ***P < 0.001, ****P < 0.0001.
FIGs. 5A-B depict an analysis of alanine repeats in the ubiquitin system. Figure 5 A: Analysis of alanine repeats domains in the human ubiquitin cascades comprising El, E2, and E3 enzymes. Figure 5B: A multiple sequence alignments of USE1 homologs from different vertebrates. Shown are partial sequences of the following polypeptides:
01_Human/l-354 - partial sequence of SEQ ID NO: 27 (GenBank Accession No. NP_075567);
02_Olive_Baboon/l-354 - partial sequence of SEQ ID NO: 73 (GenBank Accession No. XP_009188451.2);
03_Golden_Snub-nose_Monkey/l-354 - partial sequence of SEQ ID NO: 74 (GenBank Accession No. XP_030778512.1);
04_Crab_Eating_Maca uc/ 1-354 - partial sequence of SEQ ID NO: 75 (GenBank Accession No. XP_045230891.1);
05_ Grizzly_Bear/l-354 - partial sequence of SEQ ID NO:76 (GenBank Accession No. XP_026368861.1);
06_Cattle/ 1-356 - partial sequence of SEQ ID NO: 77 (GenBank Accession No. NP-001192415.1);
07_ Sheep/1-356 - partial sequence of SEQ ID NO: 78 (GenBank Accession No. XP_042111792);
08_Rat/l-356 - partial sequence of SEQ ID NO: 79 (GenBank Accession No. NP_001032732.2);
09_Mouse/ 1-356 partial sequence of SEQ ID NO: 80 (GenBank Accession No. NP_758504);
10_Central_Bearded_Dragon/l-288 - partial sequence of SEQ ID NO: 81 (GenBank Accession No. XP_020670386.1); l l_Common_Wall_Lizard/l-288 - partial sequence of SEQ ID NO: 82 (GenBank Accession No. XP_028558115.1);
12_Pit_Viper/l-290 - partial sequence of SEQ ID NO: 83 (GenBank Accession No. XP_015665913.2);
13_Tiger_Snake/ 1-290 - partial sequence of SEQ ID NO: 84 (GenBank Accession No. XP_026525519.1);
The alignment is colored according to sequence identity including the N-terminus containing the polyalanine stretch.
FIGs. 6A-C demonstrate that polyalanine stretches regulate UBA6-USE1 interaction and ubiquitin transfer. Figure 6A: FLAG-WT USE1, FLAG-USE1 APolyAla, FLAG-USE1 C188A, and FLAG-USE1 ALB were co-expressed with HA-Ub in HEK293T cells. Cell lysates were incubated with or without P mercaptoethanol (PME) and analyzed for ubiquitin loading. Results are mean ± s.e.m normalized to control WT USE1. One-way ANOVA Tukey’s test, n=4. Figure 6B: A representative blot for time-dependent in vitro ubiquitin loading of WT and APolyAla USE1 by UBA6 (quantification is presented in Figure 1C). Figure 6C: FLAG-WT USE1, empty GFP and GFP-polyAla (19Ala) constructs were transfected into HEK293T cells. Cell lysates were immunoprecipitated (IP) with anti-UBA6 antibodies and the immunocomplexes were analyzed with anti-FLAG, anti-UBA6 and anti-GFP antibodies. The bound USE1/UBA6 ratio is shown. These results demonstrate that isolated polyalanine stretches can interact with UBA6 and compete with USEl binding. Paired 2-tailed t-test, n=3. ** P < 0.01,
Figure imgf000011_0001
0.0001. “FLAG (LE)” = long exposure of the chemiluminescent signal; “FLAG (SE)” - short exposure of the chemiluminescent signal.
FIGs. 7A-B depict a biophysical analysis of the interaction between a polyalanine peptide and the SCCH domains of the canonical El ubiquitin- like activating enzymes. Figure 7A: AlphaFold models of UBA6 and UBA7 and the crystal structures of UBA1, UBA2 and UBA3 are shown. The structures were aligned and electrostatic potential was calculated as described in GENERAL MATERIALS AND EXPERIMENTAL METHODS below. The yellow arrows indicate the location of the groove within the SCCH domains. UBA6, UBA1 and UBA7 form an extended lobe within the SCCH, which is missing in UBA2 and UBA3. The groove in UBA7 is covered and do not exist in UBA2 and UBA3. The grooves in UBA1 and UBA6 are highly similar in terms of structure but present significantly different electro potential surfaces. The gradient from negative (red) to positive (blue) charge is shown. The Figure was prepared by PyMol. Figure 7B: Microscale thermophoresis interaction analysis of cy5-7Ala-peptide against UBA6 or UBA1 SCCH domain. The dose-response curve of cy5-7Ala-peptide titrated against increasing concentrations of the SCCH domain is presented. Results are mean ± s.e.m n=4, Two-way ANOVA, Sidak’ s post hoc test.
Figure imgf000012_0001
0.0001.
FIGs. 8A-E demonstrate that polyalanine expansion mutations cause cytoplasmic mislocalization of different nuclear proteins. HEK293T cells were transfected with the indicated constructs, and were subjected to immunostaining. Figure 8A: GFP- 19Ala with nuclear localization sequence (NLS, green) or GFP-19Ala, labeled for endogenous UBA6 (red). Figure 8B: HA- PHOX2B WT and HA-PHOX2B +13Ala. Figure 8C: HA-RUNX2 WT, HA-RUNX2 +6Ala, and HA-RUNX2+ 12Ala. Figure 8D: HA-HOXD13 WT and HA-HOXD13 +10Ala. Figure 8E: HA- PABPN1 WT and HA-PABPN1 +7 Ala. Image scale bar 20 pm. Quantification of the association of HA-tagged proteins (labeled in red) with the nucleus (labeled in blue, Pearson’s coefficient) is indicated as well as the cytoplasmic intensity. Results are the average values from cells in different imaged fields. Between 60-100 transfected cells were analyzed. Results are mean ± s.e.m. Unpaired 2-tailed t-test (Figures 8B, 8D and 8E) and one-way ANOVA Tukey’s test (Figure 8C). ns nonsignificant, *P < 0.05, **P< 0.01,
Figure imgf000012_0002
0.0001.
FIGs. 9A-D demonstrate that soluble isolated polyalanine stretches regulate USE1 ubiquitin loading and E6AP levels. Figure 9A: HEK293T cells were transfected with empty GFP, GFP- polyAla (19 Ala), and GFP-polyAla with a nuclear localization sequence (NLS). Endogenous USE1 ubiquitin loading was analyzed in pME-untreated cell lysates. Figure 9B: HEK293T cells were transfected with empty GFP or GFP-polyAla. The cell lysates were analyzed for the soluble and sarkosyl-insoluble fractions of GFP-polyAla. Figure 9C: Control and UBA6-depleted HEK293T cells were transfected with empty vector or mutant PHOX2B and analyzed for E6AP levels. Figure 9D: Cells were transfected with empty GFP, or GFP-polyAla with or without HA- UBA6, and analyzed for E6AP levels. Results are mean ± s.e.m. (Figure 9A) One-way ANOVA Tukey’s test, n=5 (Figure 9C) Unpaired 2-tailed t-test, n=6. (Figure 9D) One-way ANOVA, Tukey’s test, n=4. n.s not significant, *P < 0.05, **P< 0.01.
FIGs. 10A-H demonstrate that cytoplasmic polyalanine-expanded disease proteins interact with UBA6, decrease USE1 ubiquitin loading and stabilize E6AP levels. Figures 10A-D: HEK293T cells were transfected with the indicated constructs: Figure 10A - HA-mutant PHOX2B (+13Ala). Figure 10B - HA-mutant RUNX2 (+12Ala). Figure 10C - HA-mutant HOXD13 (+10Ala). Figure 10D - HA-mutant PABPN1 (+7 Ala). Endogenous UBA6 was immunoprecipitated from the nuclear fraction (Nuc, LaminBl enriched) or the cytoplasmic (Cyt, GAPDH enriched) fraction (unrelated IgG was used as a control). The immunocomplexes were analyzed with anti-HA antibodies. Figure 10E: HEK293T cells were transfected with constructs expressing different polyalanine-expanded disease proteins (mutant PHOX2B, mutant RUNX2, mutant H0XD13, and mutant PABPN1) together with FLAG-USE 1. Cell lysates were incubated without P mercaptoethanol and analyzed for ubiquitin loading. Results are mean ± s.e.m normalized to control (empty vector, no disease protein). Paired 2-tailed t test. n=3-6 experiments. Figure 10F: Representative blot of E6AP levels in CHX-treated cells that were transfected with mutant PH0X2B or empty vector. Quantification of E6AP levels is shown in Figure 3F. Figure 10G: Quantification of E6AP mRNA in the cells transfected with empty vector or mutant PH0X2B. Results are mean ± s.e.m n=5, Unpaired 2-tailed t-test. Figure 10H: Control and UBA6- depleted HEK293T cells were transfected with HA-Ub, mutant PH0X2B or empty vector and incubated for the last 6 hours with the proteasome inhibitor MG132 (10 pM). Endogenous E6AP was immunoprecipitated from cell lysates for ubiquitination analysis, ns non-significant, * P < 0.05, ** P < 0.01.
FIGs. 11A-F demonstrate an analysis of UBA6 and mutant PHOX2B association and effects on Arc levels in primary neurons. Figure 11 A: Mouse primary cortical neurons were labeled for endogenous UBA6 (red) and MAP2 (green). Quantification of the association of UBA6 with the neuronal nucleus, cell body, and neurites is shown (Pearson’s coefficient). Figure 11B: Mouse primary cortical neurons were transduced with lentiviral vectors expressing GFP-tagged WT PHOX2B (green) or mutant PHOX2B (+13 Ala, green), and were labeled for endogenous MAP2 (red) and TAU (red) (non-nuclear fraction of mutant PHOX2B marked with arrows). The quantification of the association of GFP-PHOX2B with the nucleus, MAP2, and TAU is shown (Pearson’s coefficient), as well as GFP-PHOX2B cytoplasmic intensity. Figure 11C: Mouse primary cortical neurons were transduced with lentiviral vectors expressing GFP-tagged WT PHOX2B or mutant PHOX2B (+13Ala), and were analyzed for the levels of PHOX2B in the soluble and sarkosyl-insoluble fractions. Figure 11D: Quantification of UBA6 association with WT and mutant (+7 Ala, +13 Ala) GFP-PHOX2B (Pearson’s coefficient) related to Figure 31. Figure HE: Analysis of UBA6 intensity in aggregated and non- aggregated GFP-mutant PHOX2B (+13Ala) expressing cortical neurons. The results represent further analysis of the GFP signal in the images of Figure 11D. Figure 11F: The primary neurons were transduced with the GFP- PHOX2B (green) lentiviral vectors and were labeled for Arc (red). The quantification of Arc intensity in the GFP-PHOX2B expressing neurons is presented (image scale bar 10 pm) as well as a blot showing Arc protein levels. Results are mean + s.e.m representing the average values from neurons in different imaged fields. (Figure 11A)
Figure imgf000013_0001
0.0001 One-way ANOVA Tukey’s test. n= 50 neurons analyzed. (Figure 11B) *** P < 0.001 unpaired 2-tailed t-test, n=30-50 neurons analyzed for WT PHOX2B and mutant PHOX2B +13Ala. (Figures 11D and E) *P < 0.05, 0.0001 One-way ANOVA Tukey’s test or unpaired 2-tailed t test. n=30, n=60, and n=90 neurons analyzed for WT PH0X2B, mutant PH0X2B +7 Ala and +13Ala, respectively. (Figure 11F) ns non-significant, **P < 0.01, ****P < 0.0001, one-way ANOVA Tukey’ s test. n=20, n=30 and n=100 neurons analyzed for WT PHOX2B, mutant PHOX2B +7 Ala and +13Ala, respectively.
FIGs. 12A-E demonstrate that OPMD-patient derived cells exhibit cytoplasmic presence of PABPN1 and reduced association between UBA6 and USE1. Figure 12A: OPMD patient-derived primary cricopharyngeal myotubes were stained for PABPN1, nuclei and myosin heavy chain (HC). Quantification of PABPN1 cytoplasmic intensity is presented as mean ± s.e.m (n=l l myotubes). Figure 12B: Control and OPMD patient-derived primary fibroblasts were stained for PABPN1 and nuclei. The quantification of PABPN1 cytoplasmic intensity indifferent image fields is presented as mean ± s.e.m (Control n=538 cells, OPMD n=108 cells). Figure 12C: Representative 2pFLIM pseudo colored images of control and OPMD fibroblasts, stained for USE 1 and UBA6 using secondary antibodies as donor (Alexa 488) and acceptor (Alexa 555), respectively. Scale bar is 200 pm Figure 12D: Comparison between donor only, and donor and acceptor lifetime in nano seconds (ns) for each group. For control, donor only- 3.002+0.005 ns, donor/acceptor- 2.621+0.005 ns (mean + s.e.m, n= 11 and 17 fields of view, respectively). For OPMD patient, donor only- 3.042+0.012 ns, donor/acceptor- 2.73+0.017 ns (mean + s.e.m, n= 13 and 19 fields of view, respectively). Figure 12E: Comparison of the difference in lifetime for each group, for the subtraction of donor only to donor and acceptor fluorescence lifetime. Control- 0.38+0.005, OPMD patient- 0.31+0.018 (mean + s.e.m, n= 17 and 19 fields of view respectively). Unpaired 2-tailed t test. ** P < 0.01,
Figure imgf000014_0001
0.0001.
FIGs. 13A1-13O5 depict generation and characterization of CCHS patient and family relative-derived iPSCs. Skin punch biopsies were collected from a 2-year-old female patient with CCHS who harbors a heterozygous 27 polyalanine expansion in PHOX2B (104iCCHS 20/27; data from this patient is referred by the number “2” in Figures 13A2- 13N2 and is also shown in Figures 1302-1304), and from her healthy sister (105iCTR 20/20; data from this subject is referred by the number “3” in Figures 13A3-13N3 and is also shown in 1305). A biopsy was also collected from the healthy father (103iCTR 20/20; data from this subject is referred by the number “1” in Figures 13A1-13O1) of the 4-year-old male patients who harbors a heterozygous 25 polyalanine expansion in PHOX2B (102iCCHS 20/25; data not shown). Patient- specific fibroblasts were electroporated with non-integrating reprogramming episomal plasmids. Figures 13A1-13E3: hnmunocytochemistry for pluripotency markers (NANOG, SOX2, OCT3/4 TRA-1-60, SSEA4). Figures 13F1-13J3: Flow cytometry analysis for pluripotency markers (red-NANOG, SOX2, OCT3/4 TRA-1-60, SSEA4). Figures 13K1-3: G-banding karyotype. Figures 13L1-13N3: Embryoid bodies (EBs) were generated and allowed to spontaneously differentiate for 21 days. Differentiated EBs express the ectoderm marker heavy chain neurofilament, the mesoderm marker a- smooth muscle actin SMA, and the endoderm marker a-fetoprotein. Figures 1301-1305 show the genetic analysis of the reprogrammed pluripotent stem cell lines to confirm the presence of a heterozygous expansion of seven alanine residues resulting in a 27 polyalanine stretch in PH0X2B . Figure 1301: sequence from subject 103iCTR 20/20; Figures 1302-1304: sequences from subject 104/CCHS 20/27, showing both alleles (Figure 1302), normal allele (Figure 1303), and mutant allele (Figure 1304, shown is a partial sequence of the mutant PH0X2B with a polyalanine expansion mutation; SEQ ID NO: 85). Figure 1305: sequence from subject 105iCTR 20/20). Sequencing of the 3rd PH0X2B exon confirms the heterozygous +7 polyalanine expansion in the CCHS patient, but not in the healthy controls. Image scale bars 100 pm
FIGs. 14A-I depict patient-derived autonomic neurons showing cytoplasmic mislocalized soluble PH0X2B, and reduced Arc levels. Figures 14A-B: Quantification of the association of endogenous PH0X2B with the nucleus (Pearson’ s coefficient) in autonomic neurons from control and CCHS patients. Quantification is shown also for PH0X2B cytoplasmic intensity. Results are mean ± s.e.m *P < 0.05, **P<0.01, ***P < 0.001
Figure imgf000015_0001
0.0001 one-way ANOVA Tukey’ s test. The results represent additional analysis from the same neurons analyzed in Figure 4B. Figure 14C: Autonomic neurons from control and CCHS patients were analyzed for the levels of PHOX2B in the soluble and sarkosyl-insoluble fractions. Figure 14D: iPSC-derived human autonomic neurons from control and CCHS patients were labeled by nuclear staining (colored blue, abnormal nuclear morphology marked with arrows), and for endogenous PHOX2B (colored green) and endogenous UBA6 (colored red). Images indicate events of severe cytoplasmic mislocalization of PH0X2B (marked with arrows). Scalebar 10 pm. Figures 14E-F: Immunostaining of Arc (colored green) and TUBP3 (colored red) in autonomic neurons from control and CCHS patients. Scale bar 20pm. For quantification, Arc intensity was normalized to TUBP3 in different image fields. Results are mean ± s.e.m Number of neurons analyzed 105iCTR 20/20 n=105, 102iCCHS 20/25 n=220, 104iCCHS 20/27 n=166. One-way ANOVA Tukey’s test. Figure 14G: Analysis of Arc levels in the autonomic neurons from control and CCHS patient-derived neurons. Results are mean ± s.e.m normalized to control from three independent differentiation days. n=3, Paired 2-tailed t-test. Figure 14H: Analysis of shank3 levels in mouse primary cortical neurons and in autonomic neurons from control and CCHS patients. Figure 141: Quantification of the abundance of UBA6 cDNA in CCHS patient-derived neurons transduced with mCherry tagged-UBA6 lentiviral vectors. Representative images are presented for mCherry (colored red) and TUBP3 staining (colored blue) in the patient neurons (scale bar 20 pm). For quantification, the percentage of mCherry coverage from the TUBP3 staining was calculated in different image fields. Results are mean ± s.e.m (n=80 neurons).
FIG. 15 is aWestern Blot demonstrating an E6AP ubiquitination assay. E6AP purified from HEK293T cells was incubated in vitro for up to 1.5 hours with bacterially-produced UBA6, USE1, and ubiquitin with or without polyalanine peptides (cy5-7-Ala residues; SEQ ID NO: 22) for an E6AP ubiquitination assay. E6AP ubiquitin conjugates (under reducing conditions withpME) were resolved by SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis). The results show that the addition of a peptide of 7-Ala residues (cy5-7Ala residues; SEQ ID NO: 22) results in an increase in E6AP poly- ubiquitination.
FIG. 16 is a schematic illustration of the differentiation protocol according to some embodiments of the invention PSCs (e.g., iPSCs) into peripheral sympathetic neurons. “DoD” - refers to day of differentiation. “SB” = SB431542, an ALK5 inhibitor; “CHIR” = CHIR 99021, a glycogen synthase kinase 3 (GSK-3) inhibitor; “FGF2” - basic fibroblast growth factor; “BMP4” = bone morphogenic protein 4; “SHH” = sonic hedgehog; “RA” = retinoic acid; “EGF” = epidermal growth factor; “NGF” = nerve growth factor; “BDNF” = brain derived neurotrophic factor; “GDNF” = glial cell derived neurotrophic factor.
DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION
The present invention, in some embodiments thereof, relates to methods of treating a subject having a disease associated with a polyalanine expansion mutation and, methods of increasing ubiquitination of E6AP.
Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not necessarily limited in its application to the details set forth in the following description or exemplified by the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways.
Expansion mutations in polyalanine tracts (also referred to as “polyalanine stretches”) are known to be associated with a growing number of human diseases with common genotypes and similar phenotypes1-6. The present inventors have investigated the normal function of physiological polyalanine stretches, and whether a common molecular mechanism is involved in these diseases. The present inventors show that UBA6, an El ubiquitin- activating enzyme7, 8, recognizes a polyalanine stretch within its cognate E2 ubiquitin- conjugating enzyme, USEl. Aberrations in this polyalanine stretch reduce ubiquitin transfer to USEl and downstream target, the E3 ubiquitin ligase, E6AP. The present inventors have identified competition for the UBA6-USE1 interaction by various proteins with polyalanine expansion mutations in the disease state. In mouse primary neurons, the deleterious interactions of expanded polyalanine proteins with UBA6 alter the levels and ubiquitination- dependent degradation of E6AP, which in turn affects the levels of the synaptic protein, Arc. These effects were observed in induced pluripotent stem cell-derived autonomic neurons from patients with polyalanine expansion mutations, where the overexpression of UBA6 increases the neuronal resilience to cell death. The results presented in the Examples section which follow suggest a shared mechanism for such polyalanine expansion mutations that may contribute to the congenital malformations seen in the diseases associated with the polyalanine expansion mutations.
The present inventors have identified a polyalanine motif in the ubiquitin- conjugating E2 enzyme UBE2Z/USE1, which contributes to USE1 ubiquitin loading by the El ubiquitin activating enzyme, UBA6. The present inventors identified a domain in UBA6 that recognizes polyalanine- containing proteins and demonstrate that, under disease conditions, UBA6 preferentially interacts with different polyalanine-expanded proteins, thereby competing with USEl binding. In addition, similar effects were confirmed in neurons derived from patients with disease-causing polyalanine expansion mutations, thus suggesting a previously undescribed vulnerability caused by polyalanine expansion mutations.
According to an aspect of some embodiments of the invention, there is provided a method of treating a subject having a disease associated with a polyalanine expansion mutation, the method comprising administering to the subject a therapeutically effective amount of an agent capable of specifically upregulating expression or activity of a ubiquitin like modifier activating enzyme 6 (UBA6) in nervous system cells of the subject, thereby treating the subject.
According to an aspect of some embodiments of the invention, there is provided a therapeutically effective amount of an agent capable of specifically upregulating expression or activity of a ubiquitin like modifier activating enzyme 6 (UBA6) in nervous system cells, for use in treating a disease associated with a polyalanine expansion mutation.
The term “treating” refers to inhibiting, preventing or arresting the development of a pathology (disease, disorder or condition) and/or causing the reduction, remission, or regression of a pathology. Those of skill in the art will understand that various methodologies and assays can be used to assess the development of a pathology, and similarly, various methodologies and assays may be used to assess the reduction, remission or regression of a pathology.
According to some embodiments of the invention, treating is by rescuing neuronal cells from cell death that is associated with and/or caused by the polyalanine expansion mutation. According to some embodiments of the invention, the therapeutically effective amount of the agent causes a rescue of the neuronal cells from the cell death associated with and/or caused by the polyalanine expansion mutation.
As used herein the term “polyalanine” refers to a tract of at least 4 consecutive alanine residues in a polypeptide.
According to some embodiments of the polyalanine tract comprises at least 5, at least 6, at least?, at least 8, at least 9, e.g., at least 10, or more consecutive alanine residues in a polypeptide.
As used herein the phrase “polyalanine expansion mutation” refers to an increase in the number of alanine residues comprised in a polyalanine tract of a polypeptide as compared to the number of alanine residues comprised in a polyalanine tract of a corresponding wild-type polypeptide.
As used herein a “wild- type (WT)” form of a polypeptide-of-interest refers to a polypeptide encoded by a gene that predominates in a population of human beings, preferably in a population of healthy individuals of the same ethnic origin or genetic background.
According to some embodiments of the invention, the polypeptide with the polyalanine expansion mutation exhibits an identical amino acid sequence to the corresponding wild-type polypeptide, except for a change in the length of the polyalanine tract.
The level of identity between two amino acid sequences is determined typically by structure (identical amino acid or similar amino acid) and position in both the query and reference sequence, as determined by an alignment tool such as a global alignment tool, e.g., the EMBOSS - 6.0.1 Needleman- Wunsch algorithm using default parameters.
It should be noted that some wild-type polypeptides comprise more than one polyalanine tract, e.g., they may comprise 2, 3, 4 or more polyalanine tracts. In the case of more than one polyalanine tract, a person skilled in the art can distinguish and unequivocally define each polyalanine tract based on its amino acid concrete position within the polypeptide, and/or by the specific adjacent amino acid sequences of the polyalanine tract. For example, the ARX wild-type polypeptide (GenBank Accession No. NP_620689; SEQ ID NO: 14) comprises 4 polyalanine tracts at the following amino acid positions: (i) 100-115; (ii) 144-155; (iii) 275-281; and (iv) 432- 440, with respect to the wild-type polypeptide having the amino acid sequence set forth by SEQ ID NO: 14. In this specific case of ARX, polyalanine expansion mutations occurring in polyalanine tracts (i) (expansion by additional 2 or 7 alanine residues) or (ii) (expansion by additional 8 alanine residues) are associated with Mental retardation, Epilepsy, West syndrome and Partington syndrome. Thus, a person of ordinary skills in the relevant art, having the amino acid sequence of a polypeptide from a specific subject, can easily realize and identify the polyalanine expansion mutations as compared to the polyalanine tract(s) in a corresponding wild-type polypeptide.
As mentioned, the polyalanine expansion mutation is associated with a disease.
According to some embodiments of the invention, the disease is associated with neuronal death.
According to some embodiments of the invention, the disease is associated with death of neurons of the autonomic nervous system
For example, neuronal death was demonstrated in neurons, which were differentiated from iPSCs, having the genomic polyalanine expansion mutation in the PH0X2B gene associated with CCHS (Figures 4F, 4G, 14D).
According to some embodiments of the invention, a polyalanine expansion mutation, which is associated with a disease, causes a change in the secondary and/or tertiary structure of the polypeptide.
According to some embodiments of the invention, the change in the secondary and/or tertiary structure of the polypeptide affects the normal polypeptide’s cellular localization and/or function.
According to some embodiments of the invention, the polyalanine expansion mutation can result in altered cellular localization, protein-protein interactions, cell signaling, post-translational modifications (e.g., ubiquitination), proliferation, differentiation, and/or growth as compared to the corresponding wild-type polypeptides.
For example, various nuclear polypeptides (e.g., transcription factors), which exhibit polyalanine expansion mutations are found in the cytoplasm of the cell instead of the nucleus of the cell, and thus they are incapable of performing their normal function in the nucleus.
According to some embodiments of the invention, the polypeptide having the polyalanine expansion mutation has an aberrant cellular localization as compared to a corresponding wild-type polypeptide.
According to some embodiments of the invention, the polypeptide having the polyalanine expansion mutation is cytoplasmic.
According to some embodiments of the invention, a polyalanine tract in the polyalanine expansion mutation comprises at least one additional alanine residue as compared to a polyalanine tract of a corresponding wild-type polypeptide.
For example, as shown in Table 1 below, in the case of Oculopharyngeal muscular dystrophy (OPMD), a disease associated with a polyalanine expansion mutation in PABPN1, the phenotype of the disease is present in individuals having an autosomal recessive inheritance of a mutation involving the addition of a single alanine residue to the polyalanine tract of the corresponding wild-type polypeptide (NP_004634; SEQ ID NO: 21).
According to some embodiments of the invention, a polyalanine tract in the polyalanine expansion mutation comprises 1-14 additional alanine residues in the polyalanine tract as compared to number of alanine residues in the polyalanine tract of a corresponding wild-type polypeptide.
For example, as shown in Table 1 below, in the case of Synpolydactyly, a disease associated with a polyalanine expansion mutation in H0XD13, the phenotype of the disease is present in individuals having an autosomal dominant inheritance of a mutation involving the addition of 14 alanine residues to the polyalanine tract of the corresponding wild-type polypeptide (NP_000514; SEQ ID NO: 20).
Table 1 hereinbelow, provides a non-limiting description of polypeptides having polyalanine expansion mutations and the diseases associated with such expansion mutations.
Table 1 Polypeptides with polyalanine expansion mutations and diseases associated therewith
Figure imgf000020_0001
Figure imgf000021_0001
Table 1: Abbreviations of Gene Names: PH0X2B = paired mesoderm homeobox protein 2B; ARX = aristaless related homeobox; SOX3 = SRY-box transcription factor 3; ZIC2 = Zic family member 2; FOXL2 = forkhead box L2; RUNX2 = RUNX family transcription factor 2; H0XA13 = homeobox Al 3 ; H0XD13 = homeobox D13; PABPN1 = poly(A) binding protein nuclear 1; * autosomal dominant, ** autosomal recessive;
According to some embodiments of the invention, the polyalanine expansion mutation has an autosomal dominant mode of inheritance.
For example, polyalanine expansion mutations in FOXL2, ZIC2, PHOX2B, RUNX2, H0XA13 and H0XD13, as well as some of the polyalanine expansion mutations in PABPN1 (e.g.,
10 Alanine residues — 12-17 Alanine residues) exhibit an autosomal dominant mode of inheritance.
It should be noted that in many cases, the mutation occurs de novo in the genome of the affected individual and is absent from the genome of the parents of the affected individual. This is usually the case in mutations causing severe life-threatening conditions.
According to some embodiments of the invention, the polyalanine expansion mutation occurs de novo.
According to some embodiments of the invention, the polyalanine expansion mutation has an autosomal recessive mode of inheritance. For example, some of the polyalanine expansion mutations in PABPN1 (e.g., 10 Alanine residues — 11 Alanine residues) exhibit an autosomal recessive mode of inheritance.
According to some embodiments of the invention, the polyalanine expansion mutation has an X-linked recessive mode of inheritance. For example, polyalanine expansion mutations in ARX and SOX3 exhibit an X-linked recessive mode of inheritance.
According to some embodiments of the invention, the polyalanine expansion mutation occurs in a polypeptide selected from the group consisting of a paired like homeobox 2B (PH0X2B), aristaless related homeobox (ARX), SRY-box transcription factor 3 (SOX3), Zic family member 2 (ZIC2), forkhead box L2 (FOXL2), RUNX family transcription factor 2 (RUNX2), homeobox Al 3 (H0XA13), homeobox D13 (H0XD13), and poly(A) binding protein nuclear 1 (PABPN1).
According to some embodiments of the invention, the disease is congenital central hypoventilation syndrome (CCHS); X-linked cognitive disability and epilepsy, West syndrome, Partington syndrome; X-linked cognitive disability with growth hormone deficiency; Holoprosencephaly type 5 (HPE5); Blepharophimosis-epicanthus inversus syndactyly; cleidocranial dysplasia (CCD); Hand-foot-genital syndrome; synpolydactyly; or oculopharyngeal muscular dystrophy (OPMD).
The method of some embodiments of the invention is effected by administering to the subject a therapeutically effective amount of an agent capable of specifically upregulating expression or activity of a ubiquitin like modifier activating enzyme 6 (UBA6) in nervous system cells of the subject.
The phrase “ubiquitin like modifier activating enzyme 6 (UBA6)”, also known as “E1-L2”, “MOP-4” or “UBE1L2” refers to an El enzyme that initiates the activation and conjugation of ubiquitin-like proteins.
The human UBA6 polypeptide (GenBank Accession No. NP_060697.4, SEQ ID NO: 23) is encoded by a polynucleotide as set forth by SEQ ID NO: 24 (GenBank Accession No. NM_018227.6).
The phrase “upregulating expression of UBA6” as used herein, refers to increasing the level of the UBA6 polypeptide or the level of at least a functional portion thereof, which is capable of binding to USE1, e.g., which forms a complex with USEl.
The phrase “upregulating activity of UBA6” as used herein, refers to an El activity of UBA6 such as, without being bound by theory, increasing at least the ability of UBA6 to transfer ubiquitin molecule(s) to USEl.
The term “USEl” or “ubiquitin conjugating enzyme E2 Z (UBE2Z)”, which are interchangeably used herein, refers to an E2 enzyme which is part of the E1-E2-E3 ubiquitination process. UBE2Z ubiquitinates proteins which participate in signaling pathways and apoptosis. Exemplary amino acid and nucleic acid sequences for USEl polypeptide and polynucleotide are provided in GenBank Accession Nos. NP_075567 (SEQ ID NO: 27), and NM_023079.5 (SEQ ID NO: 28).
The present inventors have identified a polyalanine motif in USE1 (amino acids 47-52 of SEQ ID NO: 27), which contributes to USE1 ubiquitin loading by UBA6 (Figures 5B, IB, 1C, 6A, and 6B) and which is essential for ubiquitination of the target protein E6AP and the subsequent degradation thereof as is shown in Figure IE.
In addition, the present inventors have uncovered that the second catalytic cysteine half (SCCH) domain of UBA6 (as set forth by SEQ ID NO: 25), which includes a large groove of positively-charged amino acids such as Lys628, Arg691, Lys714, and Lys709 (Figure 2A, amino acid positions correspond to the UBA6 amino acid sequence set forth by SEQ ID NO: 23; GenBank Accession No. NP_060697.4) is essential for binding to USE1 (Figure 2D).
According to some embodiments of the invention, the functional portion of UBA6 comprises the SCCH domain of UBA6 (as set forth by SEQ ID NO: 25) or a functional homologous polypeptide thereof.
The phrase “functional homologue of SCCH”, refers to a polypeptide comprising an amino acid sequence having at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% global sequence identity to amino acids 1-267 of SEQ ID NO: 25, and which specifically binds to a USE1 polypeptide as set forth by SEQ ID NO: 27, or to a peptide consisting of a polyalanine tract of 7- alanine residues as set forth by SEQ ID NO: 22.
As used herein the phrase “global sequence identity” refers to an identity over the entire amino acid or nucleic acid sequences of the invention and not over portions thereof.
The degree of homology or identity between two or more sequences can be determined using various known sequence comparison tools. Following is a non- limiting description of such tools which can be used along with some embodiments of the invention .
Pairwise global alignment was defined by S. B. Needleman and C. D. Wunsch, "A general method applicable to the search of similarities in the amino acid sequence of two proteins" Journal of Molecular Biology, 1970, pages 443-53, volume 48. (
For example, when starting from a polypeptide sequence and comparing to other polypeptide sequences, the EMBOSS-6.0.1 Needleman- Wunsch algorithm (available from emboss(dot)sourceforge(dot)net/apps/cvs/emboss/apps/needle(dot)html) can be used to find the optimum alignment (including gaps) of two sequences along their entire length - a “Global alignment”. Default parameters for Needleman- Wunsch algorithm (EMBOSS-6.0.1) include: gapopen=10; gapextend=0.5; datafile= EBLOSUM62; brief=YES. According to some embodiments of the invention, the functional homologous polypeptide of UBA6 comprises lysine and arginine positively-charged amino acid residues at positions which correspond to the following amino acid positions in the wild-type UBA6 polypeptide (SEQ ID NO: 23): Lys628, Arg691, Lys714 and Lys709.
According to some embodiments of the invention, the agent upregulates expression level of the UBA6 polypeptide.
According to some embodiments of the invention, the agent is a polynucleotide encoding at least a functional portion of the UBA6 comprising the SCCH domain or a functional homologous polypeptide thereof.
For example, SEQ ID NO: 26 is an exemplary polynucleotide which encodes the SCCH domain of UBA6.
According to some embodiments of the invention, the agent is a polypeptide comprising at least a functional portion of UBA6 comprising the SCCH domain or a functional homologous polypeptide thereof.
According to some embodiments of the invention, the agent is capable of rescuing neuronal cells from cell death.
For example, the present inventors have shown that an agent such as a UBA6 polypeptide was capable of rescuing neuronal cells from cell death which was associated with the polyalanine expansion mutation in CCHS (Figures 4F, 4G, 14D).
Methods of qualifying agents for their ability to rescue cells (such as neuronal cells) from cell death include, for example, the TUNEE assay, which detects DNA fragmentation (e.g., using a TUNEL Assay Kit (e.g., Abeam, ab66108)) and an apoptosis assay, which detects cell surface exposure of phosphatidylserine using, e.g., the Annexin V-FETC apoptosis detection kit (e.g., Merck, CBA059).
Polypeptides comprising at least a functional portion of UBA6 comprising the SCCH domain or a functional homologous polypeptide thereof can be chemically synthesized using well- known protein synthesis methods, which are further described hereinbelow.
Additionally or alternatively, polypeptides comprising at least a functional portion of UBA6 comprising the SCCH domain or a functional homologous polypeptide thereof can be recombinantly expressed from a polynucleotide comprising at least the nucleic acid sequence set forth in SEQ ID NO: 26, or a nucleic acid sequence encoding a functional homologous polypeptide thereof. Suitable non-limiting polynucleotides include the nucleic acid sequences set forth by SEQ NO: 24 (UBA6 coding sequence) and/or SEQ ID NO: 26 (SCCH domain of UBA6 coding sequence). It will be appreciated for certain in vitro applications tagged polypeptides such as those encoded by as SEQ ID NO: 61 (SCCH domain of UBA6 with His-Tag, coding sequence), SEQ ID NO: 66 (UBA6 with HA-tag, coding sequence) or SEQ ID NO: 68 (UBA6 with Hise-tag, coding sequence) can be used. Methods producing of proteins by recombinant means are further described hereinbelow.
Upregulation of the UBA6 in a cell (e.g., a cell of the nervous system) can be also achieved by means of gene therapy as is further described hereinbelow.
As used herein the term “polynucleotide” refers to a single or double stranded nucleic acid sequence which is isolated and provided in the form of an RNA sequence, a complementary polynucleotide sequence (cDNA), a genomic polynucleotide sequence and/or a composite polynucleotide sequences (e.g., a combination of the above).
The term “isolated” refers to at least partially separated from the natural environment e.g., from a human body or a cell.
According to some embodiments of the invention, the polynucleotide is an mRNA molecule.
According to some embodiments of the invention, the polynucleotide is comprised in a nucleic acid construct suitable for in-vivo delivery into nervous system cells of the subject. Suitable nucleic acid constructs are provided hereinunder.
For example, the present inventors show gene delivery of UBA6 using a lentiviral vector transduction of CCHS patient-derived neurons (Figures 4F, 4G, and 141).
Qualifying the ability of the agent of some embodiments of the invention to upregulate expression or activity of UBA6 can be done by protein detection level (e.g., of UBA6) and/or activity assays (e.g., ubiquitination assays on target proteins; assessing stability of target proteins; and/or survival of neuronal cells).
Methods of detecting expression and/or activity of the polypeptides of some embodiments of the invention include, but are not limited to in-gel fluorescence assay (described in, e.g., han Attali et al., 2017. “Ubiquitylati on-dependent oligomerization regulates activity ofNedd4 ligases”. EMBO J. 36(4): 425-440; which is fully incorporated herein by reference in its entirety), Enzyme linked immunosorbent assay (ELISA); Western blot analysis; Radio-immunoassay (RIA); Fluorescence activated cell sorting (FACS); Immuno histochemical analysis; immunofluorescence analysis; in situ activity assay; and in vitro activity assays, all of which are well-known in the art.
Briefly, in-gel fluorescence assay is based on detecting interactions between a fluorescently-labeled polypeptide with a non-labeled counterpart (e.g., a substrate or a polypeptide), and/or between polypeptides and a fluorescently-labeled substrate. For example, an in-gel fluorescence assay can employ a fluorescently-labeled ubiquitin molecule and/or a fluorescently-labeled enzyme of the ubiquitin cascade (e.g., El, E2 or E3). Once the complexes are formed, they can be resolved by SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) and be further visualized using a laser scanner at a suitable wavelength, e.g., Ubiquitin conjugates which are labeled with fluorescein can be visualized in a Typhoon laser scanner at 488 nm An exemplary result of an in-gel fluorescence assay is demonstrated in Figure 2D.
In situ activity assay: According to this method, a chromogenic substrate is applied on the cells containing an active enzyme and the enzyme catalyzes a reaction in which the substrate is decomposed to produce a chromogenic product visible by a light or a fluorescent microscope.
In vitro activity assays: In these methods the activity of a particular enzyme is measured in a protein mixture extracted from the cells. The activity can be measured in a spectrophotometer well using colorimetric methods or can be measured in a non- denaturing acrylamide gel (z.e., activity gel). Following electrophoresis the gel is soaked in a solution containing a substrate and colorimetric reagents. The resulting stained band corresponds to the enzymatic activity of the protein of interest. If well calibrated and within the linear range of response, the amount of enzyme present in the sample is proportional to the amount of color produced. An enzyme standard is generally employed to improve quantitative accuracy.
According to some embodiments of the invention, the agent upregulates activity of the UBA6 polypeptide.
Determination of the activity of UBA6 can be performed by ubiquitination assays which are well known in the art and which are further described hereinbelow.
According to some embodiments of the invention, the agent capable of specifically upregulating expression or activity of UBA6 stabilizes and/or increases the level of a complex formed between at least a functional portion of UBA6 comprising the SCCH domain and USE1.
Methods of detecting presence or level of a complex between at least a functional portion of UBA6 comprising the SCCH domain and USE1 include Western blot, immunoprecipitation analyses, Forster resonance energy transfer (FRET; reviewed e.g., in Bram Prevo et al., 2014. “Forster resonance energy transfer and kinesin motor proteins”; Chem Soc Rev 43(4): 1144-55, which is fully incorporated herein by reference in its entirety), fluorescence lifetime imaging microscopy (FUM; reviewed in Hellen C Ishikawa- Ankerhold et al., 2012. “Advanced fluorescence microscopy techniques--FRAP, FLIP, FEAP, FRET and FUM”. Molecules 17(4):4047-132, which is fully incorporated herein by reference in its entirety), fluorescent polarization (described e.g., in Yuhong Du 2015. “Fluorescence polarization assay to quantify protein-protein interactions in an HTS format”. Methods Mol. Biol. 1278:529-44, which is fully incorporated herein by reference in its entirety), surface plasmon resonance (SPR; described e.g., in Badreddine Douzi 2017. “Protein-Protein Interactions: Surface Plasmon Resonance”. Methods Mol. Biol. 1615:257-275, which is fully incorporated herein by reference in its entirety), microscale thermophoresis (MST; described e.g., in Moran Jerabek- Willemsen 2012. “Molecular interaction studies using microscale thermophoresis”. Assay Drug Dev Technol. 9(4):342-53, which is fully incorporated herein by reference in its entirety), biophysical analysis of proteinprotein interactions (reviewed e.g., in Mahalakshmi Harish; et al. 2021. “Evolution of biophysical tools for quantitative protein interactions and drug discovery”. REVIEW ARTICLE. Emerging Topics in Life Science. (2021) 5 (1): 1-12; which is fully incorporated herein by reference in its entirety), which are well known in the art and are further exemplified in the Examples section which follows, e.g., in Figures ID, 4C, 12C-E, 7B.
Following is a non-limiting description of an immunoprecipitation (IP) assay which can be used to detect the presence and level of a complex between at least a functional portion of UBA6 and USE1.
For generation of a complex which comprise UBA6 and USE1 in vitro these polypeptides are produced by recombinant techniques to include a detectable moiety such as hemagglutinin (HA), FLAG, GST, and/or a histidine tag (His6), which are identifiable by their respective antibodies.
Prior to incubation with the relevant antibodies the cells are lysed on ice in immunoprecipitation (IP) buffer (e.g., 20 mM Tris-HCl, pH 7.2, 150 mM NaCl, 2 mM MgCL, 0.5% NP-40), supplemented with a protease inhibitors cocktail, and then whole-cell lysates are incubated with the antibodies overnight at 4°C, followed by shorter incubation (about 2 hours) with Protein A-Sepharose CL-4B (e.g., Cytiva, 17-0780-01). The immunocomplexes are then washed with the IP buffer, and boiled (e.g., at 95°C for 5 minutes in Laemmli sample buffer containing 5% beta- mercaptoethanol) before being separated by SDS-PAGE for Western blotting assays.
It should be note that for immunoprecipitation of polyubiquitination experiments, the cells can be treated with a proteasome inhibitor MG132 (e.g., 10 pM) during the last 6 hours before lysis with the IP buffer supplemented with a protease inhibitor (e.g., 1 mM PMSF) and/or with a cysteine protease inhibitor such as iodoacetamide.
The present inventors have uncovered that an agent which specifically upregulates the expression level or activity of UBA6 in cells of the nervous system can increase ubiquitination of a target protein of the UBA6-USE1 ubiquitination enzymes, e.g., E6AP (Example 6 of the Examples section which follows, and Figure 15), thus suggesting that such an agent can increase E6AP proteasome-mediated degradation.
According to some embodiments of the invention, the agent is capable of increasing ubiquitination of a UBA6 target protein.
According to some embodiments of the invention, the UBA6 target protein is E6AP.
According to some embodiments of the invention, the agent is a peptide of 5-10 alanine residues.
For example, the present inventors have shown that an agent such as a 7-Alanine residue peptide can increase ubiquitination of a UBA6 target protein, e.g., E6AP (Figure 15).
The term "peptide" as used herein encompasses native peptides (either degradation products, synthetically synthesized peptides or recombinant peptides) and peptidomimetics (typically, synthetically synthesized peptides), as well as peptoids and semipeptoids which are peptide analogs, which may have, for example, modifications rendering the peptides more stable while in a body or more capable of penetrating into cells. Such modifications include, but are not limited to N terminus modification, C terminus modification, peptide bond modification, backbone modifications, and residue modification. Methods for preparing peptidomimetic compounds are well known in the art and are specified, for example, in Quantitative Drug Design, C.A. Ramsden Gd., Chapter 17.2, F. Choplin Pergamon Press (1992), which is incorporated by reference as if fully set forth herein. Further details in this respect are provided hereinunder.
Peptide bonds (-CO-NH-) within the peptide may be substituted, for example, by N- methylated amide bonds (-N(CH3)-CO-), ester bonds (-C(=O)-O-), ketomethylene bonds (-CO- CH2-), sulfinylmethylene bonds (-S(=O)-CH2-), ot-aza bonds (-NH-N(R)-CO-), wherein R is any alkyl (e.g., methyl), amine bonds (-CH2-NH-), sulfide bonds (-CH2-S-), ethylene bonds (-CH2- CH2-), hydroxyethylene bonds (-CH(OH)-CH2-), thioamide bonds (-CS-NH-), olefinic double bonds (-CH=CH-), fluorinated olefinic double bonds (-CF=CH-), retro amide bonds (-NH-CO-), peptide derivatives (-N(R)-CH2-CO-), wherein R is the "normal" side chain, naturally present on the carbon atom.
These modifications can occur at any of the bonds along the peptide chain and even at several (2-3) bonds at the same time.
Natural aromatic amino acids, Trp, Tyr and Phe, may be substituted by non-natural aromatic amino acids such as l,2,3,4-tetrahydroisoquinoline-3-carboxylic acid (Tic), naphthylalanine, ring- methylated derivatives of Phe, halogenated derivatives of Phe or O-methyl- Tyr. The peptides of some embodiments of the invention may also include one or more modified amino acids or one or more non-amino acid monomers (e.g. fatty acids, complex carbohydrates etc.).
The term "amino acid" or "amino acids" is understood to include the 20 naturally occurring amino acids; those amino acids often modified post-translationally in vivo, including, for example, hydroxyproline, phosphoserine and phospho threonine; and other unusual amino acids including, but not limited to, 2-aminoadipic acid, hydroxylysine, isodesmosine, nor-valine, nor-leucine and ornithine. Furthermore, the term "amino acid" includes both D- and L-amino acids.
Table 2 below lists non- conventional or modified amino acids (e.g., synthetic, Table 1) which can be used with some embodiments of the invention.
Table 2
Figure imgf000029_0001
Figure imgf000030_0001
Figure imgf000031_0001
Figure imgf000032_0001
Table 2.
The peptides of some embodiments of the invention are preferably utilized in a linear form, although it will be appreciated that in cases where cyclicization does not severely interfere with peptide characteristics, cyclic forms of the peptide can also be utilized.
The peptides of some embodiments of the invention are preferably utilized in a linear form, although it will be appreciated that in cases where cyclicization does not severely interfere with peptide characteristics, cyclic forms of the peptide can also be utilized.
According to some embodiments of the invention, the agent is a peptide of 5-9 alanine residues.
According to some embodiments of the invention, the agent is a peptide of 5-8 alanine residues.
According to some embodiments of the invention, the agent is a peptide of 5-7 alanine residues. Non-limiting exemplary peptide sequences are provided in SEQ ID NOs: 22, 29 and 30. According to some embodiments of the invention, the agent is a peptide of 5-6 alanine residues.
According to some embodiments of the invention, the agent is a peptide of 5 alanine residues.
According to some embodiments of the invention, the peptide stabilizes the protein complex formed between the UBA6 and USE1.
The present inventors have uncovered that the agent of some embodiments of the invention, which is capable of specifically upregulating expression or activity of UBA6, and as such increases ubiquitination of E6AP, can be used to reduce the level of E6AP in a subject having autism spectrum disorders (ASDs) associated with abnormally high levels of E6AP.
According to an aspect of some embodiments of the invention there is provided a method of treating a subject diagnosed with autism spectrum disorders (ASDs), the method comprising administering to the subject a therapeutically effective amount of an agent capable of upregulating expression or activity of a ubiquitin like modifier activating enzyme 6 (UBA6) in nervous system cells of the subject, thereby treating the subject.
According to an aspect of some embodiments of the invention there is provided a therapeutically effective amount of an agent capable of upregulating expression or activity of a ubiquitin like modifier activating enzyme 6 (UBA6) in nervous system cells, for use in treating autism spectrum disorders (ASDs).
According to some embodiments of the invention, the ASD is associated with increased levels of E6AP in the nervous system cells.
For example, Figure 15 demonstrates that a peptide of 7-alanine residues (SEQ ID NO: 22) can increase E6AP poly- ubiquitination.
According to some embodiments of the invention, the agent for treating the ASD is a peptide having a polyalanine tract of 5-10 alanine residues, e.g., having a polyalanine tract of 5-9 alanine residues, e.g., having a polyalanine tract of 5-8 alanine residues, e.g., having a polyalanine tract of 5-7 alanine residues, e.g., having a polyalanine tract of 5-6 alanine residues.
According to some embodiments of the invention, the agent for treating the ASD is a peptide having a polyalanine tract of 5-alanine residues. According to some embodiments of the invention, the agent for treating ASD, which is associated with increased levels of E6AP in the nervous system cells, is a peptide comprising an amino acid sequence consisted of SEQ ID NO: 29.
According to some embodiments of the invention, the agent for treating the ASD is a peptide having a polyalanine tract of 6-alanine residues. According to some embodiments of the invention, the agent for treating ASD, which is associated with increased levels of E6AP in the nervous system cells, is a peptide comprising an amino acid sequence consisted of SEQ ID NO: 30.
According to some embodiments of the invention, the agent for treating the ASD is a peptide having a polyalanine tract of 7 alanine residues. According to some embodiments of the invention, the agent for treating ASD, which is associated with increased levels of E6AP in the nervous system cells, is a peptide comprising an amino acid sequence consisted of SEQ ID NO: 22.
According to an aspect of some embodiments of the invention there is provided a method of increasing ubiquitination of an E6AP polypeptide in a cell, the method comprising contacting the cell with a therapeutically effective amount of an agent capable of upregulating expression or activity of a ubiquitin like modifier activating enzyme 6 (UBA6) in the cell, thereby increasing the ubiquitination of the E6AP polypeptide in the cell.
According to some embodiments of the invention, contacting is effected ex vivo.
According to some embodiments of the invention, the cell is a nervous system cell.
According to some embodiments of the invention, the cell is of peripheral nervous system.
According to some embodiments of the invention, the cell is an autonomous neuron of the peripheral nervous system
According to some embodiments of the invention, the cell is obtained from a subject diagnosed with a disease characterized by abnormally high levels of an E6AP polypeptide.
According to some embodiments of the invention, the cell is obtained from a subject diagnosed with autism spectrum disorders (ASDs).
According to some embodiments of the invention, contacting is effected in vivo.
According to some embodiments of the invention, when the method of increasing ubiquitination level of the E6AP in a cell is performed in vivo, contacting of the agent with the cell is achieved by administering the agent to the subject in need thereof.
According to some embodiments of the invention, the subject is diagnosed with a disease characterized by abnormally high levels of an E6AP polypeptide.
According to some embodiments of the invention, the subject is diagnosed with autism spectrum disorders (ASDs).
According to an aspect of some embodiments of the invention there is provided a method of generating neurons with a polyalanine expansion mutation, the method comprising subjecting induced pluripotent stem cells (iPSCs) which comprise a genomic polyalanine expansion mutation to culture conditions suitable for differentiating the iPSCs into neurons, thereby generating the neurons with the polyalanine expansion mutation.
The phrase “pluripotent stem cells” refers to cells which can differentiate into all three embryonic germ layers, z.e., ectoderm, endoderm and mesoderm or remaining in an undifferentiated state. The pluripotent stem cells include embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs).
Induced pluripotent stem cells (iPSCs; embryonic-like stem cells), are cells obtained by de-differentiation of adult somatic cells, which are endowed with pluripotency (z.e., being capable of differentiating into the three embryonic germ cell layers, i.e., endoderm, ectoderm and mesoderm).
According to some embodiments of the invention, such cells are obtained from a differentiated tissue (e.g., a somatic tissue such as skin) and undergo de-differentiation by genetic manipulation which re-program the cell to acquire embryonic stem cells characteristics.
For example, iPSCs can be obtained by retroviral transduction of somatic cells such as skin cells, fibroblasts, hepatocytes, gastric epithelial cells with transcription factors such as Oct-3/4, Sox2, c-Myc, and KEF4 [Yamanaka S, Cell Stem Cell. 2007, l(l):39-49; Aoi T, et al., Generation of Pluripotent Stem Cells from Adult Mouse Liver and Stomach Cells. Science. 2008 Feb 14. (Epub ahead of print); IH Park, Zhao R, West JA, et al. Reprogramming of human somatic cells to pluripotency with defined factors. Nature 2008;451: 141-146; K Takahashi, Tanabe K, Ohnuki M, et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 2007;131:861-872],
According to some embodiments of the invention, the induced pluripotent stem cells are formed by inducing the expression of Oct-4, Sox2, Kfl4 and c-Myc in a somatic stem cell.
According to some embodiments of the invention, the culture conditions are suitable for differentiating the iPSCs into peripheral autonomic neurons.
According to some embodiments of the invention, the iPSCs are generated by de- differentiation of a skin biopsy of a subject having the genomic polyalanine expansion mutation.
According to some embodiments of the invention, the genomic polyalanine expansion mutation is endogenous to the cells used to generate the iPSCs.
According to some embodiments of the invention, subjecting the iPSCs, which comprise a genomic polyalanine expansion mutation, to culture conditions suitable for differentiating the iPSCs into neurons comprises the steps of:
(a) culturing the iPSCs in a culture medium suitable for induction of iPSCs into neuromesodermal progenitor cells (NMPs); (b) culturing the NMPs in a culture medium suitable for induction of sympathetic neural crest;
(c) culturing the sympathetic neural crest in a culture medium suitable for induction of sympathetic neuroblast crest; and
(d) culturing the sympathetic neuroblast crest in a culture medium which is suitable for maturation of sympathetic neurons.
According to some embodiments of the invention, culturing in step (a) is performed for 2- 4 days, e.g., about 3 days.
According to some embodiments of the invention, the culture medium suitable for induction of iPSCs into neuromesodermal progenitor cells (NMPs) comprises glycogen synthase kinase 3 (GSK-3) inhibitor (e.g., CHIR 99021) and an ALK5 (activin receptor-like kinase 5) inhibitor (e.g., SB431542).
According to some embodiments of the invention, the CHIR 99021 is provided at a concentration of 0.5-5 mM, e.g., about 1.5 mM.
According to some embodiments of the invention, the SB431542 is provided at a concentration ofl-100 pM, e.g., about 10 pM.
According to some embodiments of the invention, culturing in step (b) is performed for 6- 8 days, e.g., about 7 days.
According to some embodiments of the invention, the culture medium suitable for induction of NMPs into sympathetic neural crest comprises basic fibroblast growth factor (FGF2, bFGF), bone morphogenic protein 4 (BMP4) and retinoic acid (RA).
According to some embodiments of the invention, the culture medium comprises Sonic hedgehog (SHH) instead of BMP4.
According to some embodiments of the invention, the culture medium suitable for induction of NMPs into sympathetic neural crest comprises basic fibroblast growth factor (FGF2, bFGF), Sonic hedgehog (SHH) and retinoic acid (RA).
According to some embodiments of the invention, the bFGF is provided at a concentration of 10-200 ng/ml, e.g., about 20 ng/ml.
According to some embodiments of the invention, the BMP4 is provided at a concentration of 10-200 ng/ml, e.g., about 50 ng/ml.
According to some embodiments of the invention, the SHH is provided at a concentration of 50-200 ng/ml, e.g., 100 ng/ml.
According to some embodiments of the invention, the retinoic acid (RA) is provided at a concentration of 10-1000 nM, e.g., about 100 nM. According to some embodiments of the invention, culturing in step (c) is performed for 6- 8 days, e.g., about 7 days.
According to some embodiments of the invention, the culture medium suitable for induction of sympathetic neuroblast crest comprises basic fibroblast growth factor (FGF2, bFGF), bone morphogenic protein 4 (BMP4) and epidermal growth factor (EGF).
According to some embodiments of the invention, the culture medium suitable for induction of sympathetic neuroblast crest comprises basic fibroblast growth factor (FGF2, bFGF), Sonic hedgehog (SHH) and epidermal growth factor (EGF).
According to some embodiments of the invention, the EGF is provided at a concentration of 10-1000 ng/ml, e.g., about 20 ng/ml.
According to some embodiments of the invention, culturing in step (c) is performed for 12-16 days, e.g., about 14 days.
According to some embodiments of the invention, the culture medium suitable for induction of sympathetic neuronal maturation comprises nerve growth factor (NFG), glial cell derived neurotrophic factor (GDNF) and brain derived neurotrophic factor (BDNF).
It should be noted that prior to the differentiation initiation the iPSCs are separated to single cell suspensions (suspensions in which the cells are single cells and not cell clusters) using for example, a Versene solution (Gibco, 15040033), Accutase (StemPro, Thermofisher), TrypleE or trypsin.
Evaluation of differentiation into the neuronal cells is performed using immunocytochemistry or FACS analysis using the pan neuronal marker Tuj la, the dendritic marker MAP2ab, the peripheral neuronal marker Peripherin, the chemosensitive markers ATOH1 and PHOX2B, the sympathetic markers dopamine beta-hydroxylase (DBH) and/or Tyrosine hydroxylase (TH).
Following is a non-limiting description of a differentiation method for differentiating pluripotent stem cells (PSCs), such as induced pluripotent stem cells (iPSCs), which comprise the genomic polyalanine expansion mutation, into neurons, e.g., into peripheral autonomic neurons.
Prior to initiation of differentiation, the PSCs are cultured on MATRIGEL or mouse embryonic fibroblasts (MEFs) in a pluripotent stem cells culture medium such as Nutristem (Sartorius, 05- 100-1 A) or mTeSR/mTeSRl (Stemcell technologies), or knockout serum based ‘homebrewed’ medium preferably to a confluence of about 1 million cells/well. The PSCs are washed with a phosphate buffered saline (PBS) and single cell suspensions are prepared (e.g., using Versene solution (Gibco, 15040033), Accutase (StemPro, Thermofisher), TrypleE or trypsin for about 2 minutes), and then the single cell PSCs are transferred to Poly-Hema (2-hydroxyethyl methacrylate)-coated flasks (e.g., T25 flasks) or commercially available low adherent flasks at a concentration of about 350,000 cells/ml. The single cell PSCs are cultured in a neuromesodermal progenitor cell induction (NMP) medium for the formation of aggregates. Preferably, the NMP medium comprises an Essential 6 medium (Gibco) or DMEM:F12 medium, and several inhibitors, such as CHIR 99021 (e.g., at a concentration of 0.5-5 mM, e.g., about 1.5 mM), SB431542 (e.g., at a concentration of 1-100 pM, e.g., about 10 pM), ROCK inhibitor (e.g., at a concentration of 1-20 pM, e.g., about 10 pM) and preferably also a Penicillin-Streptomycin-Amphotericin B solution (PSA, Sartorius). On the following day, half of the medium is replaced with NMP without ROCKi. At day 3, the medium is replaced with sympathetic (NCi) neural crest induction medium containing an Essential 6 medium or DMEM:F12 medium, supplemented with CHIR 99021 (e.g., at a concentration of 0.5-5 mM, e.g., about 1.5 mM), bFGF (basic fibroblast growth factor) (e.g., at a concentration of 10-200 ng/ml, e.g., about 20 ng/ml), bone morphogenetic protein 4 (BMP4) or BMP2; at a concentration of 10-200 ng/ml, e.g., about 50 ng/ml), retinoic acid (e.g., all trans retinoic acid at a concentration of 10- 1000 nM, e.g., about 100 nM), and preferably also PSA. On day 10, the culture is dissociated into single cells using Versene solution (Gibco, 15040033), Accutase (StemPro, Thermofisher), TrypleE or trypsin for about 2 minutes) (e.g., by incubation for about 4 minutes at 37°C), and the cells are cultured in sympathetic neuroblast induction and propagation (NCC) medium, comprising neurobasal medium or DMEM:F12, supplemented with bFGF (e.g., at a concentration of 10-1000 ng/ml, e.g., about 20 ng/ml), BMP4 or BMP2 (e.g., at a concentration of 10-200 ng/ml, e.g., about 50 ng/ml), EGF (epidermal growth factor) (e.g., at a concentration of 10-1000 ng/ml, e.g., about 20 ng/ml), heparin (e.g., at a concentration of 1-10 pg/ml, e.g., about 2 pg/ml), B27, N2, GlutaMAX or glutamine, ROCKi (at a concentration of 1- 20 pM, e.g., about 10 pM), and preferably also PSA. On day 11, half or all of the NCC medium is replaced with NCC medium without ROCKi and half of the medium is replaced every other day. On day 17, medium is preferably replaced with sympathetic neuronal maturation medium (NMM medium) comprising neurobasal medium, B27, N2, GDNF (glial cell derived neurotrophic factor) (e.g., at a concentration of 1-100 ng/ml, e.g., about 10 ng/ml), BDNF (brain derived neurotrophic factor, e.g., at a concentration of 1-100 ng/ml, e.g., about 10 ng/ml), NGF (nerve growth factor; e.g., at a concentration of 1-100 ng/ml, e.g., about 10 ng/ml), GlutaMAX or glutamine, and preferably PSA. One third- all of the medium is replaced every other day until day 31.
According to an aspect to some embodiments of the invention there is provided a method of screening for an agent capable of modulating expression or activity of a ubiquitin like modifier activating enzyme 6 (UBA6), the method comprising: (a) contacting neurons comprising a genomic polyalanine expansion mutation with a plurality of molecules,
(b) identifying at least one molecule of the plurality of molecules which modulates a complex formed by UBA6 and USE1, the at least one molecule being agent capable of specifically modulating expression or activity of the UBA6.
According to some embodiments of the invention, the neurons are differentiated in vitro from induced pluripotent stem cells (iPSCs) comprising a genomic polyalanine expansion mutation.
According to some embodiments of the invention, contacting is in the presence of a functional portion of the UBA6 comprising a second catalytic cysteine half (SCCH) domain or a functional homologous polypeptide thereof.
It should be noted that formation of a complex between UBA6 and USE1 can affect the ubiquitination level of a target polypeptide.
According to some embodiments of the invention, identifying the at least one molecule of the plurality of molecules which modulates the complex formed by the UBA6 and USE1 is effected by monitoring ubiquitination level of a target polypeptide.
According to some embodiments of the invention, the target polypeptide is E6AP.
Ubiquitin protein ligase E3A (UBE3A, also known as “E6-AP” or “E6AP”) is part of the ubiquitin protein degradation system, and interactions of UBE3A with the E6 protein of human papillomavirus types 16 and 18 are known to result in ubiquitination and proteolysis of tumor protein p53. Maternally inherited deletions or point mutations in UBE3A cause Angelman Syndrome. On the other hand, copy number variations (CNVs) that result in the overexpression of E6AP are strongly associated with the development of autism spectrum disorders (ASDs) (Khatri Natasha et al., 2019. Front Mol Neurosci. 12: 109).
Several isoforms and variants of E6AP are known in the art and can be used by the method of some embodiments of the invention. For example, the sequences provided in the following GenBank Accession Nos can be used: NP_000453.2 (SEQ ID NO: 31), NP_001341434.1 (SEQ ID NO: 32), NP_001341435.1 (SEQ ID NO: 33), NP_001341436.1 (SEQ ID NO: 34), NP_001341437.1 (SEQ ID NO: 35), NP_001341438.1 (SEQ ID NO: 36), NP_001341440.1 (SEQ ID NO: 37), NP_001341441.1 (SEQ ID NO: 38), NP_001341442.1 (SEQ ID NO: 39), NP_001341452.1 (SEQ ID NO: 40), NP_001341455.1 (SEQ ID NO: 41), NP_001341467.1 (SEQ ID NO: 42), NP_001341468.1 (SEQ ID NO: 43), NP_001341469.1 (SEQ ID NO: 44), NP_001341470.1 (SEQ ID NO: 45), NP_001341471.1 (SEQ ID NO: 46), NP_001341472.1 (SEQ ID NO: 47), NP_001341473.1 (SEQ ID NO: 48), NP_001341474.1 (SEQ ID NO: 49), NP_001341475.1 (SEQ ID NO: 50), NP_001341476.1 (SEQ ID NO: 51), NP_001341477.1 (SEQ ID NO: 52), NP_001341478.1 (SEQ ID NO: 53), NP_001341479.1 (SEQ ID NO: 54), NP_001341480.1 (SEQ ID NO: 55), NP_001361390.1 (SEQ ID NO: 56), NP_570853.1 (SEQ ID NO: 57), or NP.570854.1 (SEQ ID NO: 58).
According to some embodiments of the invention, the E6AP polypeptide which is used by the method, for monitoring ubiquitination level thereof, is the polypeptide set forth by SEQ ID NO: 31.
It should be noted that for in vitro applications tagged polypeptides can be used, such as HA-tagged E6AP isoform II as set forth by SEQ ID NO: 63 (e.g., encoded by SEQ ID NO: 64).
According to some embodiments of the invention, contacting is effected in vivo.
According to some embodiments of the invention, contacting is effected ex vivo.
According to some embodiments of the invention, the cell is a nervous system cell.
According to some embodiments of the invention, modulating is upregulating the expression or activity of the UBA6 in a cell, such as a cell of the nervous system
According to some embodiments of the invention, modulating is downregulating the expression or activity of the UBA6 in in a cell, such as a cell of the nervous system
According to some embodiments of the invention, the method further comprising synthesizing the identified agent.
According to some embodiments of the invention, the identified agent, which is capable of upregulating the expression or activity of the UBA6 in a cell (e.g., in a cell of the nervous system) is used for treating a disorder of the autism spectrum disorders (ASDs) associated with abnormally high levels of the E6AP in neuronal cells of the subject.
According to some embodiments of the invention, the identified agent, which is capable of downregulating the expression or activity of the UBA6 in a cell (e.g., in a cell of the nervous system), can be used for treating a disorder associated with abnormally low levels of the E6AP in neuronal cells of the subject (such as Angelman syndrome that is caused by loss of function of E6AP).
An agent capable of upregulating expression of a UBA6 may be an exogenous polynucleotide sequence designed and constructed to express UBA6 or at least a functional portion thereof comprising the SCCH domain as described hereinabove. Accordingly, the exogenous polynucleotide sequence may be a DNA or RNA sequence encoding UB A6 or at least a functional portion thereof comprising the SCCH domain, capable of binding to USE1 and/or increasing the ability of UBA6 to transfer ubiquitin molecule(s) to USEl. To express exogenous UBA6 or at least a functional portion thereof comprising the SCCH domain in mammalian cells, a polynucleotide sequence encoding a UBA6 (GenBank Accession number NP_060697.4 (SEQ ID NO: 23)) or at least a functional portion thereof comprising the SCCH domain (SEQ ID NO: 25) is preferably ligated into a nucleic acid construct suitable for mammalian cell expression. Such a nucleic acid construct includes a promoter sequence for directing transcription of the polynucleotide sequence in the cell in a constitutive or inducible manner.
It will be appreciated that the nucleic acid construct of some embodiments of the invention can also utilize UBA6 homologues which exhibit the desired activity (such as binding to USE1 , and/or increasing ability of UBA6 to transfer ubiquitin molecule(s) to USE1). Such homologues may exhibit, for example, at least 60%, at least 65%, at least 70%, at least 75%, at least 80 %, at least 81 % , at least 82 % , at least 83 % , at least 84 % , at least 85 % , at least 86 % , at least 87 % , at least 88 %, at least 89 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100 % sequence identity (e.g., global sequence identity) to SEQ ID NO:23 or 26, as determined using the BestFit software of the Wisconsin sequence analysis package, utilizing the Smith and Waterman algorithm, where gap weight equals 50, length weight equals 3, average match equals 10 and average mismatch equals -9.
Constitutive promoters suitable for use with some embodiments of the invention are promoter sequences which are active under most environmental conditions and most types of cells such as the cytomegalovirus (CMV) and Rous sarcoma virus (RSV). Inducible promoters suitable for use with some embodiments of the invention include for example inducible promoters such as the tetracycline- inducible promoter (Zabala M, et al., Cancer Res. 2004, 64(8): 2799-804).
According to some embodiments of the invention, the promoter is a cytomegalovirus (CMV).
The nucleic acid construct (also referred to herein as an "expression vector") of some embodiments of the invention includes additional sequences which render this vector suitable for replication and integration in prokaryotes, eukaryotes, or preferably both (e.g., shuttle vectors). In addition, a typical cloning vectors may also contain a transcription and translation initiation sequence, transcription and translation terminator and a polyadenylation signal. By way of example, such constructs will typically include a 5' LTR, a tRNA binding site, a packaging signal, an origin of second-strand DNA synthesis, and a 3' LTR or a portion thereof.
The nucleic acid construct of some embodiments of the invention typically includes a signal sequence for secretion of the peptide from a host cell in which it is placed. Preferably the signal sequence for this purpose is a mammalian signal sequence or the signal sequence of the polypeptide variants of some embodiments of the invention.
Eukaryotic promoters typically contain two types of recognition sequences, the TATA box and upstream promoter elements. The TATA box, located 25-30 base pairs upstream of the transcription initiation site, is thought to be involved in directing RNA polymerase to begin RNA synthesis. The other upstream promoter elements determine the rate at which transcription is initiated.
Preferably, the promoter utilized by the nucleic acid construct of some embodiments of the invention is active in the specific cell population transformed. For example, neuron- specific promoters include the neurofilament promoter [Byrne et al. (1989) Proc. Natl. Acad. Sci. USA 86:5473-5477], human Synapsin I promoter (Thiel G., et al., 1991; Proc Natl Acad Sci USA 88(8):3431-5), human calmodulin- dependent kinase (CaMKII) promoter (Joana E Coelho et al., 2014. Front Psychiatry. 5:67), and Nestin promoter (Hirokazu Kambara 2005; Cancer Res. 65(7):2832-9).
Enhancer elements can stimulate transcription up to 1,000 fold from linked homologous or heterologous promoters. Enhancers are active when placed downstream or upstream from the transcription initiation site. Many enhancer elements derived from viruses have a broad host range and are active in a variety of tissues. For example, the SV40 early gene enhancer is suitable for many cell types. Other enhancer/promoter combinations that are suitable for some embodiments of the invention include those derived from polyoma virus, human or murine cytomegalovirus (CMV), the long-term repeat from various retroviruses such as murine leukemia virus, murine or Rous sarcoma virus and HIV. See, Enhancers and Eukaryotic Expression, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. 1983, which is incorporated herein by reference.
In the construction of the expression vector, the promoter is preferably positioned approximately the same distance from the heterologous transcription start site as it is from the transcription start site in its natural setting. As is known in the art, however, some variation in this distance can be accommodated without loss of promoter function .
Polyadenylation sequences can also be added to the expression vector in order to increase the efficiency of UBA6 mRNA translation. Two distinct sequence elements are required for accurate and efficient polyadenylation: GU or U rich sequences located downstream from the polyadenylation site and a highly conserved sequence of six nucleotides, AAUAAA, located 11- 30 nucleotides upstream. Termination and polyadenylation signals that are suitable for some embodiments of the invention include those derived from SV40 . In addition to the elements already described, the expression vector of some embodiments of the invention may typically contain other specialized elements intended to increase the level of expression of cloned nucleic acids or to facilitate the identification of cells that carry the recombinant DNA. For example, a number of animal viruses contain DNA sequences that promote the extra chromosomal replication of the viral genome in permissive cell types. Plasmids bearing these viral replicons are replicated episomally as long as the appropriate factors are provided by genes either carried on the plasmid or with the genome of the host cell .
The vector may or may not include a eukaryotic replicon. If a eukaryotic replicon is present, then the vector is amplifiable in eukaryotic cells using the appropriate selectable marker. If the vector does not comprise a eukaryotic replicon, no episomal amplification is possible. Instead, the recombinant DNA integrates into the genome of the engineered cell, where the promoter directs expression of the desired nucleic acid.
The expression vector of some embodiments of the invention can further include additional polynucleotide sequences that allow, for example, the translation of several proteins from a single mRNA such as an internal ribosome entry site (IRES) and sequences for genomic integration of the promoter- chimeric polypeptide.
Introduction of nucleic acids by viral infection offers several advantages over other methods such as lipofection and electroporation, since higher transfection efficiency can be obtained due to the infectious nature of viruses .
It will be appreciated that the individual elements comprised in the expression vector can be arranged in a variety of configurations. For example, enhancer elements, promoters and the like, and even the polynucleotide sequence(s) encoding a UBA6 can be arranged in a "head-to- tail" configuration, may be present as an inverted complement, or in a complementary configuration, as an anti-parallel strand.
Examples for mammalian expression vectors include, but are not limited to, pcDNA3, pcDNA3.1 (+/-), pGL3, pZeoSV2(+/-), pSecTag2, pDisplay, pEF/myc/cyto, pCMV/myc/cyto, pCR3.1, pSinRep5, DH26S, DHBB, pNMTl, pNMT41, pNMT81, which are available from Invitrogen, pCI which is available from Promega, pMbac, pPbac,pBK-RSV and pBK-CMV which are available from Strategene, pTRES which is available from Clontech, and their derivatives.
Expression vectors containing regulatory elements from eukaryotic viruses such as retroviruses can be also used. SV40 vectors include pSVT7 and pMT2. Vectors derived from bovine papilloma virus include pB V- 1MTHA, and vectors derived from Epstein Bar virus include pHEBO, and p2O5. Other exemplary vectors include pMSG, pAV009/A+, pMTO10/A+, pMAMneo-5, baculovirus pDSVE, and any other vector allowing expression of proteins under the direction of the SV-40 early promoter, SV-40 later promoter, metallothionein promoter, murine mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters shown effective for expression in eukaryotic cells.
Currently preferred in vivo nucleic acid transfer techniques include transfection with viral or non- viral constructs, such as adenovirus, lentivirus, Herpes simplex I virus, or adeno-associated virus (AAV), naked polynucleotides (e.g., naked DNA or naked mRNA) and lipid-based systems .
According to some embodiments of the invention, the nucleic acid construct is encapsulated in a particle (e.g., a viral particle, a lipid-based particle).
As described above, viruses are very specialized infectious agents that have evolved, in many cases, to elude host defense mechanisms. Typically, viruses infect and propagate in specific cell types. The targeting specificity of viral vectors utilizes its natural specificity to specifically target predetermined cell types and thereby introduce a recombinant gene into the infected cell. Thus, the type of vector used by some embodiments of the invention will depend on the cell type transformed. The ability to select suitable vectors according to the cell type transformed is well within the capabilities of the ordinary skilled artisan and as such no general description of selection consideration is provided herein.
Recombinant viral vectors are useful for in vivo expression of UBA6 since they offer advantages such as lateral infection and targeting specificity. Lateral infection is inherent in the life cycle of, for example, retrovirus and is the process by which a single infected cell produces many progeny virions that bud off and infect neighboring cells. The result is that a large area becomes rapidly infected, most of which was not initially infected by the original viral particles. This is in contrast to vertical-type of infection in which the infectious agent spreads only through daughter progeny. Viral vectors can also be produced that are unable to spread laterally. This characteristic can be useful if the desired purpose is to introduce a specified gene into only a localized number of targeted cells .
Viral vectors offer several advantages including higher efficiency of transformation, and targeting to, and propagation in, specific cell types. Viral vectors can also be modified with specific receptors or ligands to alter target specificity through specific cell receptors, such as neuronal cell receptors (for example, refer to Kaspar BK. et al., 2002. Mol Ther. 5:50-6). Non-limiting examples of viral vectors which can be used include, adenoviruses, the recombinant adeno-associated virus 2 (AAV), SV40-based [Kimchi-Sarfaty C, and Gottesman MM, 2004, Curr. Pharm Biotechnol. 5: 451-8]; retroviruses such as Molony murine leukemia virus (Mo-MuLV); and lentiviruses [Amado RG, Chen IS., 1999, Science. 285: 674-6]. The most preferred constructs for use in gene therapy are viruses, most preferably adenoviruses, AAV, lentiviruses, or retroviruses.
A viral construct such as a retroviral construct includes at least one transcriptional promoter/enhancer or locus-defining elements), or other elements that control gene expression by other means such as alternate splicing, nuclear RNA export, or post-translational modification of messenger. Such vector constructs also include a packaging signal, long terminal repeats (LTRs) or portions thereof, and positive and negative strand primer binding sites appropriate to the virus used, unless it is already present in the viral construct. In addition, such a construct typically includes a signal sequence for secretion of the peptide from a host cell in which it is placed. Preferably, the signal sequence for this purpose is a mammalian signal sequence or the signal sequence of the polypeptide variants of some embodiments of the invention. Optionally, the construct may also include a signal that directs polyadenylation, as well as one or more restriction sites and a translation termination sequence. By way of example, such constructs will typically include a 5' LTR, a tRNA binding site, a packaging signal, an origin of second-strand DNA synthesis, and a 3' LTR or a portion thereof. Other vectors can be used that are non-viral, such as cationic lipids, polylysine, and dendrimers.
Retroviral vectors represent one class of vectors suitable for use with some embodiments of the invention. Defective retroviruses are routinely used in transfer of genes into mammalian cells [reviewed in Miller, A.D. Blood 76: 271 (1990)]. A recombinant retrovirus including a polynucleotide encoding UBA6 of some embodiments of the invention can be constructed using well known molecular techniques. Portions of the retroviral genome can be removed to render the retrovirus replication defective and the replication defective retrovirus can then packaged into virions, which can be used to infect target cells through the use of a helper virus and while employing standard techniques. Protocols for producing recombinant retroviruses and for infecting cells in-vitro or in-vivo with such viruses can be found in, for example, Ausubel et al., [eds, Current Protocols in Molecular Biology, Greene Publishing Associates, (1989)]. Retroviruses have been used to introduce a variety of genes into many different cell types, including neuronal cells, epithelial cells endothelial cells, lymphocytes, myoblasts, hepatocytes and bone marrow cells.
Another suitable expression vector may be an adenovirus vector. The adenovirus is an extensively studied and routinely used gene transfer vector. Key advantages of an adenovirus vector include relatively high transduction efficiency of dividing and quiescent cells, natural tropism to a wide range of epithelial tissues and easy production of high titers [Russel, W.C. [J. Gen. Virol. 81: 57-63 (2000)]. The adenovirus DNA is transported to the nucleus, but does not integrate thereinto. Thus the risk of mutagenesis with adenoviral vectors is minimized, while short term expression may be suitable.
A suitable viral expression vector may also be a chimeric adenovirus/retrovirus vector which combines retroviral and adenoviral components. Such vectors may be more efficient than traditional expression vectors for transducing tumor cells [Pan et al., Cancer Letters 184: 179-188 (2002)].
A specific example of a suitable viral vector for introducing and expressing the polynucleotide sequence of some embodiments of the invention in an individual is the adenovirus- derived vector Ad-TK. This vector expresses a herpes virus thymidine kinase (TK) gene for either positive or negative selection and includes an expression cassette for desired recombinant sequences. This vector can be used to infect cells that have an adenovirus receptor which includes most cancers of epithelial origin (Sandmair et al., 2000. Hum Gene Ther. 11:2197-2205).
Features that limit expression to particular cell types can also be included. Such features include, for example, promoter and regulatory elements that are specific for the desired cell type. Secretion signals generally contain a short sequence (7-20 residues) of hydrophobic amino acids. Secretion signals are widely available and are well known in the art, refer, for example to von Heijne [J. Mol. Biol. 184:99-105 (1985)] and Lej et al., [J. Bacteriol. 169: 4379 (1987)].
The recombinant vector can be administered in several ways. If viral vectors are used the procedure can take advantage of their target specificity and consequently, such vectors do not have to be administered locally. However, local administration can provide a quicker and more effective treatment. Administration of viral vectors can also be performed by, for example, intravenous or subcutaneous injection into a subject. Following injection, the viral vectors will circulate until they recognize host cells with appropriate target specificity for infection.
An agent capable of upregulating UBA6 or at least a functional portion thereof comprising the SCCH domain may be the mRNA molecule itself which encodes the UBA6 or at least a functional portion thereof comprising the SCCH domain. mRNAs therapies are advantageous as they utilize a cell’ s translational machinery to code production of the desired protein in vivo, saving time and expense on purification procedures.
Methods of stabilizing mRNA are known in the art and include modulation of the length of the polyadenine tail found at the 3” end of the mRNA transcript. Alternatively, or additionally, the mRNA cap found at the molecule’s 5’ end can be modified. The naturally occurring cap structure typical in mammalian cells has a tendency to be improperly incorporated into mRNAs synthesized in vitro, rendering them less effective. Synthetic “anti-reverse cap analogs” (e.g. those commercially available at Thermo Fisher Scientific) can prevent this misincorporation, which results in more stable mRNA with improved translational efficiency. In order to reduce immunogenicity, substitution of particular nucleotides can be exchanged with chemically modified alternatives such as 5-methylcytosine or pseudoruidine. Such substitutions can mute the immune response whilst also bolstering the stability of the mRNA and efficiency of translation. Other exemplary chemically modified nucleotides are described herein above. In certain cases, particular nucleotides can be incorporated into the mRNA to increase immunogenicity. This may be particularly relevant for vaccine therapy.
Alternatively, or additionally, the mRNA may be encapsulated in lipid-based particles to enhance fusion with the lipid cell membrane.
Naked DNA [e.g., naked plasmid DNA (pDNA)] is an attractive simple, non- viral vector which can easily be produced in bacteria and manipulated using standard recombinant DNA techniques. It does not induce antibody response against itself (i.e., no anti-DNA antibodies generated) and enables long-term gene expression even without chromosome integration. Naked UBA6 DNA can be introduced by intravascular and electroporation techniques as described in Wolff JA, Budker V, 2005, Adv. Genet. 54: 3-20. Alternatively, naked UBA6 DNA can be administered in vivo by jet injection essentially as described in Walther W, et al., 2004, Mol. Biotechnol. 28: 121-8. Still alternatively, naked UBA6 DNA can be administered into epidermis cells via DNA-coated gold particles as described in Dean HJ, 2005, Expert Opin Drug Deliv. 2: 227-36. Still alternatively, naked UBA6 DNA can be administered to cells via cavitation bubbles which induce transient membrane permeabilization (sonoporation) on a single cell level [using low frequency sonication (kilohertz frequencies), lithotripter shockwaves, HIFU, and even diagnostic ultrasound (megahertz frequencies)]. Cavitation initiation and control can be enhanced by cavitation nucleation agents, such as an ultrasound contrast agent [for further details see Miller DL, et al., 2002, Somat Cell Mol. Genet. 27: 115-34; using e.g., the Sonitron 2000 sonoporation system (Sonidel Limited, Dublin, Republic Ireland).
Liposome delivery system - Liposomes can be used for in vivo delivery of UBA6 polynucleotides to target cells. For example, the cationic lipid formulation 3 beta [N-(N',N'- Dimethylaminoethane)-Carbamoyl] Cholesterol (DC-Chol) is a non-viral delivery agent which can be used to target of UBA6 or at least a functional portion thereof into cells of interest (e.g., cells of the nervous system). For example, allogeneic and xenogeneic MHC DNA-liposome complexes were successfully employed in a phase I study of immunotherapy of cutaneous metastases of human carcinoma using the DC-Chol/DOPE cationic liposomes (see for example, Hui KM, Ang PT, Huang L, Tay SK., 1997, Gene Ther. 1997, 4(8):783-90; Serikawa T., et al., 2006, Journal of Controlled Release, 2006 Apr 26; [Epub ahead of print]). Useful lipids for lipid-mediated transfer of the gene are, for example, DOTMA, DOPE, and DC-Chol [Tonkinson et al., 1996. Cancer Investigation 14(1): 54-65].
The UBA6 liposomes can be administered directly into the cells of the nervous system or can be administered intravenously and be directed to the cells-of-interest using a cell specific recognition moiety such as a ligand, antibody or receptor capable of specifically binding to the cell-of-interest. Additionally or alternatively, targeting of the liposome to specific cells can be performed by antibodies essentially as described in Dass CR. and Choong PF, J Control Release. 2006 May 9; [Epub ahead of print].
As mentioned, the polypeptide can be produced by recombinant means. For production of a recombinant polypeptide, the polynucleotide of some embodiments of the invention can be introduced into cells by any one of a variety of known methods within the art. Such methods can be found generally described in Sambrook et al., [Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York (1989, 1992)]; Ausubel et al., [Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Maryland (1989)]; Chang et al., [Somatic Gene Therapy, CRC Press, Ann Arbor, MI (1995)] ; Vega et al., [Gene Targeting, CRC Press, Ann Arbor MI (1995)]; Vectors [A Survey of Molecular Cloning Vectors and Their Uses, Butterworths, Boston MA (1988)] and Gilboa et al. [Biotechniques 4 (6): 504-512 (1986)] and include, for example, stable or transient transfection, lipofection, electroporation and infection with recombinant viral vectors. United States patent 4,866,042 discloses vectors involving the central nervous system and United States patents 5,464,764 and 5,487,992 for positive-negative selection methods for inducing homologous recombination.
Other than containing the necessary elements for the transcription and translation of the inserted coding sequence, the expression construct of some embodiments of the invention can also include sequences engineered to enhance stability, production, purification, yield or toxicity of the expressed peptide. For example, the expression of a fusion protein or a cleavable fusion protein comprising the UBA6 protein of some embodiments of the invention and a heterologous protein can be engineered. Such a fusion protein can be designed so that the fusion protein can be readily isolated by affinity chromatography; e.g., by immobilization on a column specific for the heterologous protein. Where a cleavage site is engineered between the UBA6 protein and the heterologous protein, the UBA6 protein can be released from the chromatographic column by treatment with an appropriate enzyme or agent that disrupts the cleavage site [e.g., see Booth et al. (1988) Immunol. Lett. 19:65-70; and Gardella et al., (1990) J. Biol. Chem 265: 15854-15859].
As mentioned hereinabove, a variety of prokaryotic or eukaryotic cells can be used as hostexpression systems to express the polypeptides of some embodiments of the invention. These include, but are not limited to, microorganisms, such as bacteria transformed with a recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vector containing the coding sequence; yeast transformed with recombinant yeast expression vectors containing the coding sequence; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors, such as Ti plasmid, containing the coding sequence. Mammalian expression systems can also be used to express the polypeptides of some embodiments of the invention .
Recovery of the recombinant polypeptide is effected following an appropriate time in culture. The phrase "recovering the recombinant polypeptide” refers to collecting the whole fermentation medium containing the polypeptide and need not imply additional steps of separation or purification. Notwithstanding the above, polypeptides of some embodiments of the invention can be purified using a variety of standard protein purification techniques, such as, but not limited to, affinity chromatography, ion exchange chromatography, filtration, electrophoresis, hydrophobic interaction chromatography, gel filtration chromatography, reverse phase chromatography, concanavalin A chromatography, chromatofocusing and differential solubilization.
Additionally or alternatively, the polypeptide or the peptide of some embodiments of the invention may be synthesized by any techniques that are known to those skilled in the art of peptide synthesis. For solid phase peptide synthesis, a summary of the many techniques may be found in J. M. Stewart and J. D. Young, Solid Phase Peptide Synthesis, W. H. Freeman Co. (San Francisco), 1963 and J. Meienhofer, Hormonal Proteins and Peptides, vol. 2, p. 46, Academic Press (New York), 1973. For classical solution synthesis see G. Schroder and K. Lupke, The Peptides, vol. 1, Academic Press (New York), 1965.
In general, these methods comprise the sequential addition of one or more amino acids or suitably protected amino acids to a growing peptide chain. Normally, either the amino or carboxyl group of the first amino acid is protected by a suitable protecting group. The protected or derivatized amino acid can then either be attached to an inert solid support or utilized in solution by adding the next amino acid in the sequence having the complimentary (amino or carboxyl) group suitably protected, under conditions suitable for forming the amide linkage. The protecting group is then removed from this newly added amino acid residue and the next amino acid (suitably protected) is then added, and so forth. After all the desired amino acids have been linked in the proper sequence, any remaining protecting groups (and any solid support) are removed sequentially or concurrently, to afford the final peptide compound. By simple modification of this general procedure, it is possible to add more than one amino acid at a time to a growing chain, for example, by coupling (under conditions which do not racemize chiral centers) a protected tripeptide with a properly protected dipeptide to form, after deprotection, a pentapeptide and so forth. Further description of peptide synthesis is disclosed in U.S. Pat. No. 6,472,505.
A preferred method of preparing the peptide compounds of some embodiments of the invention involves solid phase peptide synthesis.
Large scale peptide synthesis is described by Andersson Biopolymers 2000; 55(3):227-50.
The agent which is capable of specifically upregulating expression or activity of UBA6 of some embodiments of the invention can be administered to an organism per se, or in a pharmaceutical composition where it is mixed with suitable carriers or excipients.
As used herein a "pharmaceutical composition" refers to a preparation of one or more of the active ingredients described herein with other chemical components such as physiologically suitable carriers and excipients. The purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism.
Herein the term "active ingredient" refers to the agent which is capable of specifically upregulating expression or activity of UBA6 in a cell accountable for the biological effect.
Hereinafter, the phrases "physiologically acceptable carrier" and "pharmaceutically acceptable carrier" which may be interchangeably used refer to a carrier or a diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound. An adjuvant is included under these phrases.
Herein the term "excipient" refers to an inert substance added to a pharmaceutical composition to further facilitate administration of an active ingredient. Examples, without limitation, of excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols.
Techniques for formulation and administration of drugs may be found in “Remington’ s Pharmaceutical Sciences,” Mack Publishing Co., Easton, PA, latest edition, which is incorporated herein by reference.
Suitable routes of administration may, for example, include oral, rectal, transmucosal, especially transnasal, intestinal or parenteral delivery, including intramuscular, subcutaneous and intramedullary injections as well as intrathecal, direct intraventricular, intracardiac, e.g., into the right or left ventricular cavity, into the common coronary artery, intravenous, inrtaperitoneal, intranasal, or intraocular injections.
Conventional approaches for drug delivery to the central nervous system (CNS) include: neurosurgical strategies (e.g., intracerebral injection or intracerebroventricular infusion); molecular manipulation of the agent (e.g., production of a chimeric fusion protein that comprises a transport peptide that has an affinity for an endothelial cell surface molecule in combination with an agent that is itself incapable of crossing the BBB) in an attempt to exploit one of the endogenous transport pathways of the BBB; pharmacological strategies designed to increase the lipid solubility of an agent (e.g., conjugation of water-soluble agents to lipid or cholesterol carriers); and the transitory disruption of the integrity of the BBB by hyperosmotic disruption (resulting from the infusion of a mannitol solution into the carotid artery or the use of a biologically active agent such as an angiotensin peptide). However, each of these strategies has limitations, such as the inherent risks associated with an invasive surgical procedure, a size limitation imposed by a limitation inherent in the endogenous transport systems, potentially undesirable biological side effects associated with the systemic administration of a chimeric molecule comprised of a carrier motif that could be active outside of the CNS, and the possible risk of brain damage within regions of the brain where the BBB is disrupted, which renders it a suboptimal delivery method.
Alternately, one may administer the pharmaceutical composition in a local rather than systemic manner, for example, via injection of the pharmaceutical composition directly into a tissue region of a patient.
The term “tissue” refers to part of an organism consisting of cells designed to perform a function or functions. Examples include, but are not limited to, brain tissue, retina, skin tissue, hepatic tissue, pancreatic tissue, bone, cartilage, connective tissue, blood tissue, muscle tissue, cardiac tissue brain tissue, vascular tissue, renal tissue, pulmonary tissue, gonadal tissue, hematopoietic tissue.
Pharmaceutical compositions of some embodiments of the invention may be manufactured by processes well known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee- making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.
Pharmaceutical compositions for use in accordance with some embodiments of the invention thus may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into preparations which, can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.
For injection, the active ingredients of the pharmaceutical composition may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank’s solution, Ringer’s solution, or physiological salt buffer. For transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art. For oral administration, the pharmaceutical composition can be formulated readily by combining the active compounds with pharmaceutically acceptable carriers well known in the art. Such carriers enable the pharmaceutical composition to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for oral ingestion by a patient. Pharmacological preparations for oral use can be made using a solid excipient, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carbomethylcellulose; and/or physiologically acceptable polymers such as polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.
Dragee cores are provided with suitable coatings. For this purpose, concentrated sugar solutions may be used which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, titanium dioxide, lacquer solutions and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.
Pharmaceutical compositions which can be used orally, include push-fit capsules made of gelatin as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules may contain the active ingredients in admixture with filler such as lactose, binders such as starches, lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active ingredients may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added. All formulations for oral administration should be in dosages suitable for the chosen route of administration.
For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner.
For administration by nasal inhalation, the active ingredients for use according to some embodiments of the invention are conveniently delivered in the form of an aerosol spray presentation from a pressurized pack or a nebulizer with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro-tetrafluoroethane or carbon dioxide. In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of, e.g., gelatin for use in a dispenser may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
The pharmaceutical composition described herein may be formulated for parenteral administration, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multidose containers with optionally, an added preservative. The compositions may be suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
Pharmaceutical compositions for parenteral administration include aqueous solutions of the active preparation in water-soluble form Additionally, suspensions of the active ingredients may be prepared as appropriate oily or water based injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acids esters such as ethyl oleate, triglycerides or liposomes. Aqueous injection suspensions may contain substances, which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the active ingredients to allow for the preparation of highly concentrated solutions.
Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile, pyrogen- free water based solution, before use.
The pharmaceutical composition of some embodiments of the invention may also be formulated in rectal compositions such as suppositories or retention enemas, using, e.g., conventional suppository bases such as cocoa butter or other glycerides.
Pharmaceutical compositions suitable for use in context of some embodiments of the invention include compositions wherein the active ingredients are contained in an amount effective to achieve the intended purpose. More specifically, a therapeutically effective amount means an amount of active ingredients (the agent which is capable of specifically upregulating expression or activity of UBA6 of some embodiments of the invention) effective to prevent, alleviate or ameliorate symptoms of a disorder (e.g., a disease associated with polyalanine expansion mutation, or autism spectrum disorders) or prolong the survival of the subject being treated.
Determination of a therapeutically effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.
For any preparation used in the methods of the invention, the therapeutically effective amount or dose can be estimated initially from in vitro and cell culture assays. For example, a dose can be formulated in animal models to achieve a desired concentration or titer. Such information can be used to more accurately determine useful doses in humans.
Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals. The data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in human. The dosage may vary depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See e.g., Fingl, et al., 1975, in "The Pharmacological Basis of Therapeutics", Ch. 1 P-l).
Dosage amount and interval may be adjusted individually to provide levels of the active ingredient in the nervous system cells which are sufficient to induce or suppress the biological effect (minimal effective concentration, MEC). The MEC will vary for each preparation, but can be estimated from in vitro data. Dosages necessary to achieve the MEC will depend on individual characteristics and route of administration. Detection assays can be used to determine plasma concentrations.
Depending on the severity and responsiveness of the condition to be treated, dosing can be of a single or a plurality of administrations, with course of treatment lasting from several days to several weeks or until cure is effected or diminution of the disease state is achieved.
The amount of a composition to be administered will, of course, be dependent on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc.
Compositions of some embodiments of the invention may, if desired, be presented in a pack or dispenser device, such as an FDA approved kit, which may contain one or more unit dosage forms containing the active ingredient. The pack may, for example, comprise metal or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration. The pack or dispenser may also be accommodated by a notice associated with the container in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the compositions or human or veterinary administration. Such notice, for example, may be of labeling approved by the U.S. Food and Drug Administration for prescription drugs or of an approved product insert. Compositions comprising a preparation of the invention formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition, as is further detailed above. The term "antibody" as used in this invention includes intact molecules as well as functional fragments thereof (that are capable of binding to an epitope of an antigen) .
As used herein, the term "epitope" refers to any antigenic determinant on an antigen to which the paratope of an antibody binds. Epitopic determinants usually consist of chemically active surface groupings of molecules such as amino acids or carbohydrate side chains and usually have specific three dimensional structural characteristics, as well as specific charge characteristics.
According to a specific embodiment, the antibody fragments include, but are not limited to, single chain, Fab, Fab’ and F(ab')2 fragments, Fd, Fcab, Fv, dsFv, scFvs, diabodies, minibodies, nanobodies, Fab expression library or single domain molecules such as VH and VE that are capable of binding to an epitope of the antigen in an HEA restricted manner.
Suitable antibody fragments for practicing some embodiments of the invention include a complementarity-determining region (CDR) of an immunoglobulin light chain (referred to herein as “light chain”), a complementarity-determining region of an immunoglobulin heavy chain (referred to herein as “heavy chain”), a variable region of a light chain, a variable region of a heavy chain, a light chain, a heavy chain, an Fd fragment, and antibody fragments comprising essentially whole variable regions of both light and heavy chains such as an Fv, a single chain Fv (scFv), a disulfide-stabilized Fv (dsFv), an Fab, an Fab’, and an F(ab’)2, or antibody fragments comprising the Fc region of an antibody.
As mentioned, antibodies for detection of the level of UBA6, USE1, E6AP, and/or ubiquitinated (or poly-ubiquitinated) forms thereof can be conjugated to a functional moiety such as a detectable moiety, and can be used in methods of some embodiments of the invention.
Various types of detectable or reporter moieties may be conjugated to the antibody of the invention. These include, but not are limited to, a radioactive isotope (such as [125]iodine), a phosphorescent chemical, a chemiluminescent chemical, a fluorescent chemical (fluorophore), an enzyme, a fluorescent polypeptide, an affinity tag, and molecules (contrast agents) detectable by Positron Emission Tomography (PET) or Magnetic Resonance Imaging (MRI).
Examples of suitable fluorophores include, but are not limited to, phycoerythrin (PE), fluorescein isothiocyanate (FETC), Cy-chrome, rhodamine, green fluorescent protein (GFP), blue fluorescent protein (BFP), Texas red, PE-Cy5, and the like. For additional guidance regarding fluorophore selection, methods of linking fluorophores to various types of molecules see Richard P. Haugland, “Molecular Probes: Handbook of Fluorescent Probes and Research Chemicals 1992- 1994”, 5th ed., Molecular Probes, Inc. (1994); U.S. Pat. No. 6,037,137 to Oncoimmunin Inc.; Hermanson, “Bioconjugate Techniques”, Academic Press New York, N.Y. (1995); Kay M. et al., 1995. Biochemistry 34:293; Stubbs et al., 1996. Biochemistry 35:937; Gakamsky D. et al., “Evaluating Receptor Stoichiometry by Fluorescence Resonance Energy Transfer,” in “Receptors: A Practical Approach,” 2nd ed., Stanford C. and Horton R. (eds.), Oxford University Press, UK. (2001); US. Pat. No. 6,350,466 to Targesome, Inc.]. Fluorescence detection methods which can be used to detect the antibody when conjugated to a fluorescent detectable moiety include, for example, fluorescence activated flow cytometry (FACS), immunofluorescence confocal microscopy, fluorescence in-situ hybridization (FISH) and fluorescence resonance energy transfer (FRET).
Numerous types of enzymes may be attached to the antibody of the invention [e.g., horseradish peroxidase (HPR), beta-galactosidase, and alkaline phosphatase (AP)] and detection of enzyme- conjugated antibodies can be performed using EEISA (e.g., in solution), enzyme-linked immunohistochemical assay (e.g., in a fixed tissue), enzyme-linked chemiluminescence assay (e.g., in an electrophoretic ally separated protein mixture) or other methods known in the art [see e.g., Khatkhatay MI. and Desai M., 1999. J Immunoassay 20: 151-83; Wisdom GB., 1994. Methods Mol Biol. 32:433-40; Ishikawa E. et al., 1983. J Immunoassay 4:209-327; Oellerich M., 1980. J Clin Chem Clin Biochem 18: 197-208; Schuurs AH. and van Weemen BK., 1980. J Immunoassay 1:229-49).
The affinity tag (or a member of a binding pair) can be an antigen identifiable by a corresponding antibody [e.g., digoxigenin (DIG) which is identified by an anti-DIG antibody) or a molecule having a high affinity towards the tag [e.g., streptavidin and biotin]. The antibody or the molecule which binds the affinity tag can be fluorescently labeled or conjugated to enzyme as described above.
Various methods, widely practiced in the art, may be employed to attach a streptavidin or biotin molecule to the antibody of the invention. For example, a biotin molecule may be attached to the antibody of the invention via the recognition sequence of a biotin protein ligase (e.g., BirA) as described in the Examples section which follows and in Denkberg, G. et al., 2000. Eur. J. Immunol. 30:3522-3532. Alternatively, a streptavidin molecule may be attached to an antibody fragment, such as a single chain Fv, essentially as described in Cloutier SM. et al. , 2000. Molecular Immunology 37: 1067-1077; Dubel S. et al., 1995. J Immunol Methods 178:201; Huston JS. et al., 1991. Methods in Enzymology 203:46; Kipriyanov SM. et al., 1995. Hum Antibodies Hybridomas 6:93; Kipriyanov SM. et al., 1996. Protein Engineering 9:203; Pearce LA. et al., 1997. Biochem Molec Biol Inti 42: 1179-1188).
Functional moieties, such as fluorophores, conjugated to streptavidin are commercially available from essentially all major suppliers of immunofluorescence flow cytometry reagents (for example, Pharmingen or Becton- Dickinson). The functional moiety (e.g., the detectable moiety of the invention) may be attached or conjugated to the antibody of the invention in various ways, depending on the context, application and purpose.
When the functional moiety is a polypeptide, the immunoconjugate may be produced by recombinant means. For example, the nucleic acid sequence encoding a fluorescent protein [e.g., green fluorescent protein (GFP), red fluorescent protein (RFP) or yellow fluorescent protein (YFP)] may be ligated in-frame with the nucleic acid sequence encoding the antibody and be expressed in a host cell to produce a recombinant conjugated antibody. Alternatively, the functional moiety may be chemically synthesized by, for example, the stepwise addition of one or more amino acid residues in defined order such as solid phase peptide synthetic techniques.
A functional moiety may also be attached to the antibody of the invention using standard chemical synthesis techniques widely practiced in the art [see e.g., hypertexttransferprotocol://worldwideweb (dot) chemistry (dot) org/portal/Chemistry)], such as using any suitable chemical linkage, director indirect, as via a peptide bond (when the functional moiety is a polypeptide), or via covalent bonding to an intervening linker element, such as a linker peptide or other chemical moiety, such as an organic polymer. Chimeric peptides may be linked via bonding at the carboxy (C) or amino (N) termini of the peptides, or via bonding to internal chemical groups such as straight, branched or cyclic side chains, internal carbon or nitrogen atoms, and the like. Description of fluorescent labeling of antibodies is provided in details in U.S. Pat. Nos. 3,940,475, 4,289,747, and 4,376,110.
Exemplary methods for conjugating peptide moieties to the antibody of the invention include, but are not limited to SPDP conjugation (e.g., as described in Cumber et al. (1985, Methods of Enzymology 112: 207-224); glutaraldehyde conjugation (e.g., as described in G.T. Hermanson (1996, "Antibody Modification and Conjugation, in Bioconjugate Techniques, Academic Press, San Diego); carbodiimide conjugation [e.g., as describedin J. March, Advanced Organic Chemistry: Reaction's, Mechanism, and Structure, pp. 349-50 & 372-74 (3d ed.), 1985; B. Neises et al. (1978), Angew Chem, Int. Ed. Engl. 17:522; A. Hassner et al. (1978, Tetrahedron Lett. 4475); E.P. Boden et al. (1986, J. Org. Chem 50:2394) and L.J. Mathias (1979, Synthesis 561)].
As used herein the term “about” refers to ± 10%.
The terms "comprises", "comprising", "includes", "including", “having” and their conjugates mean "including but not limited to".
The term “consisting of’ means “including and limited to”. The term "consisting essentially of means that the composition, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.
As used herein, the singular form "a", "an" and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a compound" or "at least one compound" may include a plurality of compounds, including mixtures thereof.
Throughout this application, various embodiments of this invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.
Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases “ranging/ranges between” a first indicate number and a second indicate number and “ranging/ranges from” a first indicate number “to” a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween.
As used herein the term "method" refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.
When reference is made to particular sequence listings, such reference is to be understood to also encompass sequences that substantially correspond to its complementary sequence as including minor sequence variations, resulting from, e.g., sequencing errors, cloning errors, or other alterations resulting in base substitution, base deletion or base addition, provided that the frequency of such variations is less than 1 in 50 nucleotides, alternatively, less than 1 in 100 nucleotides, alternatively, less than 1 in 200 nucleotides, alternatively, less than 1 in 500 nucleotides, alternatively, less than 1 in 1000 nucleotides, alternatively, less than 1 in 5,000 nucleotides, alternatively, less than 1 in 10,000 nucleotides. It is understood that any Sequence Identification Number (SEQ ID NO) disclosed in the instant application can refer to either a DNA sequence or a RNA sequence, depending on the context where that SEQ ID NO is mentioned, even if that SEQ ID NO is expressed only in a DNA sequence format or a RNA sequence format. For example, SEQ ID NO: 24 is expressed in a DNA sequence format (e.g., reciting T for thymine), but it can refer to either a DNA sequence that corresponds to an UBA6 nucleic acid sequence, or the RNA sequence of an RNA molecule nucleic acid sequence. Similarly, though some sequences are expressed in a RNA sequence format (e.g., reciting U for uracil), depending on the actual type of molecule being described, it can refer to either the sequence of a RNA molecule comprising a dsRNA, or the sequence of a DNA molecule that corresponds to the RNA sequence shown. In any event, both DNA and RNA molecules having the sequences disclosed with any substitutes are envisioned.
It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.
Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.
EXAMPLES
Reference is now made to the following examples, which together with the above descriptions illustrate some embodiments of the invention in a non limiting fashion.
GENERAL MATERIALS AND EXPERIMENTAL METHODS
Ethics statement - All mouse experiments were reviewed and approved by the Institutional Animal Care and Use Committee of Tel Aviv University. All cell lines and protocols related to human stem cell research in the present study, and the analysis of patient biopsies were used in accordance with guidelines approved by the Institutional Review Board (Sheba Medical Center, Hilel Yafe Medical Center and Tel Aviv University). Informed consent was obtained from all donors.
Antibodies - The following antibodies were used in this study: mouse anti-HA (Biolegend 901501); rabbit anti-HA (Cell signaling 3724); rabbit anti- Actin (Merck A2066); mouse anti- E6- AP (Santa Cruz 166689); mouse anti-FLAG (Merck F1804); rabbit anti-UBA6 (Cell signaling 13386); rabbit anti-K48 polyUb (Cell signaling 8O81S); rabbit anti-UBE2Z (USE1, (Abeam 254700); rabbit anti-GFP (Abeam 6556), mouse anti-PHOX2B (Santa Cruz 376997); mouse anti- mCherry (Abeam 125096); mouse anti-Tau (Santa Cruz 58860); rabbit anti-MAP2ab (synaptic systems 188003); mouse anti-Arc (BD Transduction Laboratories 612602); rabbit anti-Arc (Abeam 183183); Alexa Fluor 555 (Abeam 150114) conjugated goat anti-mouse secondary antibody, Alexa Fluor® 555 (Abeam 150078) conjugated goat anti-rabbit secondary antibody, goat anti-mouse (Abeam 6789) and goat anti-rabbit (Abeam 6721); horseradish peroxidase (HRP)- conjugated secondary antibodies, mouse anti-MATH-1 (Santa Cruz 136173), mouse anti-PRPH (Santa Cruz 377093); mouse anti-TH (Santa Cruz 25269); mouse anti-SOXlO (Abeam 155279); rabbit anti-P-Tubulin IH (Merck T2200); mouse anti-OCT3/4 (Santa Cruz 5279); mouse anti-TRA 1-60 (R & D MAB4770); mouse anti-SSEA-4 (Santa Cruz 21740); mouse anti-IgG3 Isotype (Biolegend 330405); rabbit anti-SOX2 (Abeam 97959); rabbit anti-NANOG (Abeam 21624); rabbit anti- 68kDa Neurofilament (Abeam 52989); rabbit anti -a- Fetoprotein (ScyTek A00058); rabbit anti- a-smooth muscle actin (Abeam 32575); mouse anti-myosin heavy chain (BioTest MAB4470- SP); Alexa Fluor 488-conjugated anti-mouse secondary antibody (Jackson ImmunoResearch 715545150); Alexa Fluor 488-conjugated anti-mouse secondary antibody (Thermo Fisher Scientific, A- 11034); Alexa Fluor 488-conjugated anti-rabbit secondary antibody (Molecular Probes, A- 11029); Alexa Fluor 594-conjugated anti-rabbit secondary antibody (Jackson ImmunoResearch 711585152); Alexa Fluor 568-conjugated anti-rabbit secondary antibody (Abeam 175471); and Alexa Fluor 647 -conjugated anti-rabbit secondary antibody (Abeam 150079).
Cloning and constructs - El constructs for mammalian cell expression, namely pcDNA3.1 -HA- tagged UBA1 wild type and pcDNA3.1 -HA- tagged UBA6 (UBE1L2) wild type, were kindly provided by Dr. Marcus Groettrup. pcDNA3.1-HA-UBA6 mut (4Ala) and pcDNA3.1- HA-UBA6 mut (4Asp) where Lysine 628, 709,714 and Arginine 691 were changed to amino acids Alanine and Aspartate respectively, were constructed by Gibson assembly using the DNA gene blocks. The SCCH domains of UBA6 or UBA1 were constructed by introduction of PCR fragments containing amino acids 623-889 (UBA6) and 624-891 (UBA1) into plasmid pYB50 by Gibson assembly (lab collection). For E. coli expression as a Hise-tagged proteins, the wild type and mutant UBA1 and UBA6 genes where subcloned into modified and improved vector pET28a44.
E2 USE1 (UBE2Z) expressing plasmids pcDNA3.1-His6-3xFlag-USEl was kindly provided by Dr. Annette Aichem For expression in mammalian cells, the putative Kozak sequence was first added to the USE1 gene, which was subcloned into pEGFP-Nl based plasmid resulting in plasmid pCMV-His6-3xFlag-USEl new Kozak used in this study. The APolyAla region mutant, where amino acids 47-56 of the USE1 gene were deleted, the 2A^2R mutant where Alanine 49 and Alanine 52 were changed to Arginine respectively, the ALB mutant where amino acids 194- 197 comprising a Loop B16 were deleted, and the C188A mutant were constructed by site-directed mutagenesis and Gibson assembly applying Q5® Site-Directed Mutagenesis Kit and NEBuilder® HiFi DNA Assembly respectively. For E.coli expression as biotinylated Hise-tagged proteins, the USE1 wild type and mutant genes were subcloned into modified plasmid pET30-Hise-N-AviTag (Laboratory collection).
Hise-Ub plasmid for expression in E. coli of the His-tagged ubiquitin gene was described previously 45. The HA-ubiquitin plasmid for mammalian expression was a gift from Dr. Edward Yeh (Addgene plasmid # 18712 46). The p4054 HA-E6AP isoform II was a gift from Dr. Peter Howley (Addgene plasmid # 865847). pEGFP-Cl 19 Alanines and pEGFP-Cl 19 Alanines with nuclear localization sequence (NLS) constructs for expression in mammalian cells as well as HA- bovine PABPN1 wild type and HA-bovine PABPN1 mut +7 Ala mutant constructs were a gift of Dr. David Rubinsztein. pEGFP-C119 Alanines and pEGFP-C119 Alanines with nuclear localization sequence (NLS) constructs for expression in mammalian cells as well as HA-bovine PABPN1 wild type and HA-bovine PABPN1 mut +7 Ala mutant constructs were a gift of Dr. David Rubinsztein. As a first step toward deletion of the EGFP gene and insertion of the C- terminal HA tag, the present inventors deleted the PolyA region from the wild type gene performing a site-directed mutagenesis applying Inverse PCR and Q5® Site-Directed Mutagenesis Kit (New England Biolabs, NEB). Then the HA-tagged delta Ala mutant bovine gene was humanized by changing amino acids Asp 95 and Ser 102 to Ser 95 and Pro 102 respectively, applying Q5® Site-Directed Mutagenesis Kit (NEB). Following humanization, 10 Ala (wild type) and 17 Ala (+7 mutant) regions were added using gene blocks (IDT) and Gibson assembly (NEBuilder® HiFi DNA Assembly kit, NEB).
Human RUNX2 carrying plasmids pcDNA3.2/GW/D-TOPO RUNX2 wild type, pcDNA 6.2/C-EmGFP-DEST-RUNX2 mut (+6 Ala) and pcDNA 6.2/C-EmGFP-DEST- RUNX2 mut (+12 Ala) were kindly provided by Dr. Yoshihito Tokita. In this study, in all aforementioned plasmids, the EmGFP gene was deleted and HA-tag was introduced onto the C-terminus of the RUNX2 genes. The mouse H0XD13 bearing plasmids pcDNA3.1-Hoxdl3 wild type and pcDNA3.1- Hoxdl3 mut +10Ala were a gift of Dr. Denes Hnisz. First, the Valine259 to Glutamate mutation was corrected in both constructs and then the wild type and the mutant Hoxdl3 genes were subcloned into pEGFP-N 1 derived vector whereas adding a putative Kozak sequence and the C- terminal HA-tag.
The PH0X2B carrying plasmids pcDNA3.0-HA-PHOX2B wild type and pcDNA3.0-HA- PH0X2B mut (+13 Ala) were kindly provided Dr. Diego Fornasari. To express the PH0X2B genes alone and as fusion with EGFP in neuronal cells under control of the human Synapsin I promoter (SEQ ID NO: 60), the PHOX2B genes were subcloned into lentiviral pLL3.7 vector bearing the Synapsin I promoter. Plasmids bearing the HA-PHOX2B mut (+7 Ala) gene were constructed applying Gibson assembly and resulted in plasmids pcDNA3.0-HA-PHOX2B mut (+7 Ala), pLL3.7-hSyn-HA-PHOX2B mut (+7 Ala) and pLL3.7-hSyn-HA-PHOX2B mut (+7 Ala)- EGFP.
A lentiviral target vector bearing wild type UBA6-mCherry fusion protein under the control of pCMV promoter (SEQ ID NO: 59) was constructed by subcloning of the Nhel-Kpnl fragment from plasmid pLL3.7-hSyn-UBA6-mCherry into plasmid pLL3.7-pCMV-Kozak-HA- linker-EGFP (Lab collection). For E. coli expression of the His-tagged trigger factor (TIG)-TEV site-PHOX2B mut (+13 Ala) fusion protein, the PHOX2B mut (+13 Ala) gene was obtained by PCR from plasmid pET30-NAvitag-PHOX2B mut (+13), and introduced into N he]- Hind]]] sites of the plasmid pET43-Hise- TIG- TEV site-PHOX2B wild type.
The integrity of every construct used in this study was verified by the sequencing analysis and the detailed explanations of cloning procedures will be provided upon request.
Cell lines and transfection - Cell lines used in this study include human embryonic kidney cells, HEK293T (ATCC CRL-1573) and HEK293FT (Invitrogen, R70007). The cells were authenticated by STR profiling and were routinely tested for mycoplasma contamination. The cells were grown in Dulbecco’s modified Eagle’s medium (01-052-1 A, Sartorius) supplemented with 10% heat-inactivated fetal bovine serum (04-007-1 A, Sartorius), 10000 units/mL penicillin, and 10 mg/mL streptomycin (03-031- IB Sartorius) and 2 mM L-glutamine (G7513, Merck) at 37 °C with 5% CO2. Cells were seeded and cultured for approximately 24 hours until they grew to 50- 60% confluence before transfection. In some experiments, the cells were treated with cycloheximide (Merck, 01810) at a final concentration of 50 pg/ml in different incubation times for analysis of protein degradation rates. Transient transfection of indicated plasmids, was accomplished using TransIT-LTl (Mirus, MIR 2300) according to the manufacturer’s protocol. Vector and Mirus were mixed in a reduced serum medium (Opti-MEM® 10001865, Gibco) and incubated at room temperature for up to 30 min before being dripped gently onto the cell culture and incubated for 24 to 48 hours. Transfection efficiency was confirmed by western blot analysis. In RNA interference experiments, cells were transfected 24 hours after seeding with 50-100 nM S 4/ 7'pool siRNAs (Dharmacon) for gene silencing and Lipofectamine 2000 (1000186, Invitrogen), with two rounds of knockdown for 5 days, according to the manufacturer's instructions (Invitrogen). For this purpose, the siRNAs and Lipofectamine were diluted separately in reduced serum medium Opti-MEM® (10001865, Gibco), then mixed for 15 minutes at room temperature and dripped gently onto the cell culture, which was then incubated at 37 °C for 4-6 hours, before restoration of full medium. The following oligonucleotides (ON-TARGETplus SMARTpool, Dharmacon L-006403-01-0005) were used for UBA6 depletion: siRNA J-006403-09, UBA6 for the following target sequence: GUGUAGAAUUAGCAAGAUU (SEQ ID NO: 1); siRNA J-006403-10, UBA6 for the following target sequence: GCAUAGCUGUCCAAGUUAA (SEQ ID NO: 2); siRNA J-006403-11, UBA6 for the following target sequence: CAGUGUUGUAGGAGCAAUA (SEQ ID NO: 3); siRNA J-006403-12, UBA6 for the following target sequence: GGAAUUUGGUCAGGUUAU (SEQ ID NO: 4);
To generate the USE1 APolyAla KO cell line, the GenCRISPR™ gene editing technology was applied using a service from GenScript USA. The gRNAs cleavage efficiency was tested by transient transfection and a gRNA with the highest cleavage efficiency was chosen (gRNA CCTGCCGGATGTGTGGGCGG; SEQ ID NO: 5) to generate the gene deletion resulted in the deletion of the domain located at position 47-56 of the UBE2Z/USE1 human protein comprising the polyalanine domain. The sequence of donor is designed as below:
Ctggtgttgttggc gttagc ggcagc ggc ggc gggttc gggccgcc tttcctgcc ggatgtgtggggccc ggggagc ggcctggctcc g ctgcccgggct (SEQ ID NO: 6);
The editing materials were transfected in the HEK293T cells and the transfected cells were plated in 96-well plates by limiting dilution to generate isogenic single clones. The clones were picked from wells and screened by PCR and Sanger sequencing screening to identify full allelic deletion clones.
Isolation and culture of mouse primary cortical neurons - Primary cortical neurons were isolated from wild-type C57BL/6J mouse embryos at E17. Brains were harvested and placed in ice-cold HBSS under a dissection microscope. Cerebral cortices were dissected and incubated in HBSS. After mechanical dissociation using sterile micropipette tips, dissociated neurons were resuspended and cultured at 37°C in a humidified incubator with 5% CO2 and 95% O2 in poly-D- lysine coated 6-well plates in neurobasal media (12349015, Gibco) supplemented with 1% GlutaMAX™ Supplement (35050-061, Thermofisher), 1% Sodium pyruvate (11360039, Gibco), 2% B27 supplement (17504044, Gibco) and 1% Penicillin- Streptomycin (O3-O31-1B, Sartorius). One-half of the culture media was changed every three days until treatment. Differentiated cortical neurons were infected with indicated lentiviral vectors after 5 days in culture.
Lentivirus production and infection - Third generation lentiviral vectors pLL3.7 (Addgene, #11795) that express shRNA under the mouse U6 promoter and CMV-EGFP or hSyn- EGFP reporter cassettes were obtained from the TAU Viral Core facility. Helper plasmids pMDLg/pRRE, pRSV-Rev, and pCMV-VSVG that carry HIV regulatory protein genes as well as the pseudotyped envelope protein gene from vesicular stomatitis virus envelope G (VSV G), were obtained from the same facility.
Briefly, HEK-293FT packaging cells growing in 15 cm dishes were transfected with a mix of 7.8 pg helper vector pMDLg/pRRE, 3 pg helper vector pRSV-Rev, 4.2 pg envelope vector pCMV-VSVG, and 12 pg target vector pLL3.7-hSyn-PHOX2B-EGFP carrying the wild type or mutant PHOX2B gene, or CMV-mCherry UBA6. Polyethylenimine (PEI), (Merck 408727) was used as a transfection reagent. At 16 hours’ post-transfection, the culture media was removed and replaced with fresh high-serum medium, which was harvested 48 h later and filtered through Amicon Ultra -15 (UFC910024) vials at 1500g for 30 minutes to obtain concentrated and purified lentiviruses for transduction. On the day of transduction, half the culture media was removed from primary cultured cortical neurons and was stored for later use (conditioned media), and then viral particles were added and incubated for 15 hours. At the end of this time, the culture medium was replaced by a 1: 1 mix of fresh and the conditioned medium that was collected previously. The neurons were then incubated for up to a week before being harvested for either western blot or immunostaining.
Generation of patient-specific fibroblasts - Skin biopsies were collected from a 2-year- old female CCHS patient who carries a 2QI 1 Ala PHOX2B genotype as well as from her healthy sister and from the healthy father of two previously reported identical 4-year-old twin males with CCHS who carry 20/25 Ala stretches36. The biopsies were dissected and cultured for two weeks in 6-well plates under a coverslip in DMEM (Sartorius 011701 A) with 20% FBS and with half the media replaced every other day.
Reprogramming of iPSCs - Fibroblast, 106 cells were harvested using TrypLE Express (Gibco, 12604021) and electroporated with non-integrating episomal vectors using a Neon transfection system (Invitrogen, kit MPK10096). The cells were then plated on mouse embryonic fibroblast (MEF)-coated plates and cultured in DMEM with 15% FBS, 5 ng/ml basic fibroblast growth factor (bFGF, Peprotech 10018B) and 5 pM ROCK inhibitor (Enzo, ALX270333). After two days, the medium was replaced with NutriStem (BI) supplemented with 5 ng/ml bFGF, with fresh medium added every other day. On day 22, six colonies were transferred to new MEF-coated plates and cultured in NutriStem with 5 ng/ml bFGF. Three colonies were selected from each line and manually transferred to MATRIGEL (Corning)-coated plates and cultured in NutriStem, which was replaced daily and with weekly passage. iPSC characterization - iPSCs were assessed for the expression of the pluripotency markers NANOG, SOX2, OCT3/4, TRA 1-60, and SSEA by immunocytochemistry and FACS analysis. The differentiation potential was assessed by harvesting the iPSCs at confluency using TrypLE and resuspending the cells in NutriStem supplemented with 10 ng/ml bFGF and 7 pM ROCK inhibitor (Enzo, ALX270333). Embryoid bodies (EBs) spontaneously formed after 2 days, at which time, the medium was replaced with EB medium (DMEM with 15% FBS, 1% Non- Essential Amino Acids and 0.1 mM P-mercaptoethanol, Gibco 31350010). After 4-7 days, the EBs were plated on 0.1% gelatin-coated plates and cultured for 21 days with EB medium replacement twice weekly. On day 21, the cells were fixed and stained for heavy chain neurofi lament, a-SMA, or a- fetoprotein as ectodermal, mesodermal and endodermal markers, respectively. G-banding karyotype analysis was used to exclude any chromosomal abnormalities that may have occurred during the reprogramming process. Briefly, iPSCs were supplemented with 100 ng/ml colcemid (Sartorius 120041D), incubated for 60 minutes, and harvested in Versene solution (Gibco 15040033). Cells were fixed in 1:3 glacial acetic acid:methanol (Biolabs- chemicals) solution and the G-banding karyotype was determined. Finally, all lines were tested for mycoplasma contamination using the Hy-mycoplasma PCR kit (Hylabs, KI5034I).
Differentiation of iPSCs into autonomic neurons - The protocol was performed as previously described with modifications48. iPSCs were cultured in Nutristem (Sartorius, 05-100- 1A) to a confluence of 1 million cells/well. At day 0, iPSCs washed with DPBS (Dulbecco's Phosphate-Buffered Saline), and a single cell suspension was prepared using Versene solution for 2 minutes (Gibco, 15040033), and then cells were transferred to T25 flasks coated with Poly-Hema (2-hydroxyethyl methacrylate) at a concentration of 350,000 cells/ml in neuromesodermal progenitor cell induction (NMP) medium containing Essential 6 medium (Gibco, A1516401), 1.5 mM CEUR (Tocris biotech, 4423), 10 pM SB (Tocris biotech, 431542), Penicillin-Streptomycin- Amphotericin B solution (PSA, Sartorius, 03-033- IB), supplemented with 10 pM ROCK inhibitor (ROCKi Enzo, ALX270333), where they formed aggregates. On the following day, half of the medium was replaced with NMP without ROCKi. At day 3, the medium was replaced with sympathetic (NCi) neural crest induction medium containing Essential 6 medium, 1.5 mM CHIR, 20 ng/ml bFGF (Peprotech 10018B), 50 ng/ml BMP4 (Prospec, Cyt-1093), 100 nM all trans retinoic acid (RA, Merck, R2625), and PSA. On day 10, the culture was dissociated into single cells using Accutase (Gibco, Al 110501) for 4 min at 37°C, and cultured in sympathetic neuroblast induction and propagation (NCC) medium, containing neurobasal medium (Gibco, 21103049), 20 ng/ml bFGF, 50 ng/ml BMP4, 20 ng/ml EGF, 2 pg/ml heparin, B27 (Gibco, 17504044), N2 (Gibco, 17502048), GlutaMAX (Gibco, 35050038), PSA and 10 pM ROCKi. On day 11, half of the NCC medium was replaced with NCC medium without ROCKi and half of the medium was replaced every other day. On day 17, medium was replaced with sympathetic neuronal maturation medium (NMM medium) containing neurobasal medium, B27, N2, 10 ng/ml GDNF (Peprotech, 45010), 10 ng/ml BDNF (Peprotech 45002), 10 ng/ml NGF (R & D 256-GF), GlutaMAX, and PSA. One third of the medium was replaced every other day until day 31.
Immunocytochemistry for iPSCs- derived autonomic neurons - In order to prepare for the culture, coverslips were incubated in poly- L- ornithine solution (Merck, P3655) overnight at 37°C followed by 3 washes with cell culture grade water and drying for 15 min. On seeding day, the coverslips were incubated in laminin (Merck, L2020) for 1 hour at 37°C before being washed with PBS. The neurospheres were harvested manually and seeded on the coverslips. After 5-4 days, the cells on the coverslips were washed with Dulbecco's Phosphate-Buffered Saline (DPBS, Sartorius, 020231 A) and fixed in 4% paraformaldehyde at room temperature for 15 minutes. The cells then were washed twice in DPBS, and blocked with DPBS containing 0.1% Triton X-100 (Merck, T8532) and 1% bovine serum albumin (blocking solution, Merck, A7906100G), for 1 hour at RT. Primary antibodies were added to the blocking solution and incubated overnight at 4°C. Following three washes with blocking solution, the cells were incubated with fluorescent secondary antibodies for 2 h at room temperature. DRAQ5 was used to stain the cell nuclei.
Flow cytometry - iPSCs were harvested and dissociated into single cells by incubation with TrypLE for 2 minutes at 37°C. For the detection of intracellular markers, samples were incubated in fixation solution (Invitrogen, 00522356, 00512343) for 40 minutes at room temperature followed by washings withpermeabilization solution (Invitrogen, 00833356). For surface markers, the cells were washed once with 3% FBS in DPBS. In both cases, the samples were incubated with the appropriate primary antibodies for 2 hours at room temperature, then were washed twice and incubated for 1 hour with the relevant secondary antibody followed by three more washes. Analysis was performed using a NovoCyte flow cytometer (ACEA). The first gating was SSC- H/FSC-H, and the entire cell population was selected (without cell debris) followed by FSC- H/FSC-A gating and single cell selection. The final analysis is presented as counts (%)/FITC-H.
Analysis of cell death markers in CCHS neurons - On day 31 of differentiation the neurons were washed twice and detached using Accutase for 4 minutes at 37°C. Cells were gently mixed every minute during incubation time. The cells were then washed and were seeded l-2xl06 on coverslips withNMM medium and 10 pM ROCKi. One day post seeding, 0.5 ml of fresh NMM medium was added. On the next day, the neurons were infected with lentivirus expressing CMV mCherry-UBA6 overnight or kept in normal NMM medium The medium containing the virus was discarded and replaced by conditioned and fresh NMM. Cells were cultured for an additional week and were analyzed for cell death markers.
For TUNEL assay detecting DNA fragmentation, the cells were fixed in 4% PFA for 20 minutes and then washed twice. TUNEL Assay Kit (Abeam, ab66108) was used according to the manufacturer’s instruction. The cells were washed twice with wash buffer followed by adding the DNA labeling solution for 1 hour at 37°C without agitation. The DNA labeling solution was removed, and the cells were washed twice with Rinse buffer followed by adding Propidium lodide/RNase A solution for 30 minutes. The Propidium lodide/RNase A solution was removed and the cells were washed twice with blocking solution and blocked for 1 hour at room temperature. The blocking solution was removed and primary anti-PHOX2B antibody was added overnight for immunostaining.
For detecting cell surface exposure of phosphatidylserine, the Annexin V-FETC apoptosis detection kit (Merck, CBA059) was used according to manufacturer’s protocol. Annexin V-FITC solution containing 1: 100 Annexin: calcium buffer was prepared and was added to the neurons for 10 minutes at room temperature without agitation. Then, the cells were washed with calcium buffer and were fixed using 4% PFA for 20 minutes, washed with a blocking solution and blocked for 1 hour at room temperature. The blocking solution was removed and primary anti-P3-Tubulin antibody was added overnight for immunostaining.
Generation of OPMD patient-derived cells - The tissue biopsy was obtained from an OPMD patient undergoing cricopharyngeal myotomy (heterozygous polyalanine expansion mutation resulted in + 3 Ala in PABPN1). The tissue was submerged by incubation with collagenase II solution (Merck, C0130). After the incubation, the tissue was transferred using a 5% BSA coated pipette tip into a 5% BSA pre-coated 10-cm plate filled with DMEM supplemented with 2.5% pen- strep-Nystatin (PSN). The tissue was further incubated for 30 minutes, and the muscle was then repeatedly pipetted to dissociate the myofibers. Using a fire- polished Pasteur pipette coated with 5% BSA, all visible myofibers were transferred to a 6- well plate coated with 5% BSA and filled with DMEM 2.5% PSN and then to another well coated with MATRIGEL (Corning, 354234) and filled with BIOAMF 1% (Sartorius, 01- 194-1 A) PSN. The connective tissue was transferred to another well coated with MATRIGEL and filled with BIOAMF 1% to extract fibroblasts. Western blotting assay - Cells were washed with PBS and harvested in Laemmli buffer containing 5% beta-mercaptoethanol. For the ubiquitin loading assays, the cells were lysed on ice in lysis buffer (20 mM Tris-HCl, pH 6.8, 137 mM NaCl, 1 mM EGTA, 1% Triton xlOO, 10% glycerol, and a protease inhibitors cocktail), centrifuged to discard the cell pellet and then the supernatant was added to Laemmli buffer at a ratio of 1: 1 without using beta-mercaptoethanol. Protein samples were boiled for 5 minutes at 95°C, separated by SDS-PAGE, transferred onto PVDF membranes, subjected to western blot analysis, and visualized using the ECL enhanced chemiluminescence reagent (CYANAGEN). Protein levels in each sample were evaluated by normalization to the housekeeping P-actin. The bands were quantified using ImageJ software.
Immunoprecipitation and ubiquitination assays - Cells were lysed on ice in immunoprecipitation (IP) buffer (20 mM Tris-HCl, pH 7.2, 150 mM NaCl, 2 mM MgCL, 0.5% NP-40), supplemented with a protease inhibitors cocktail before use. In IP experiments performed in separated cell fractions, cells were lysed in IP buffer containing 0.1% NP40. Supernatant was kept as a cytoplasmic fraction and the nuclear pellet was dispersed with IP buffer and passed through 25 and 27 gauge needle then sonicated to ensure extraction of nuclear proteins. For polyubiquitination experiments, cells were treated with a proteasome inhibitor MG132 (10 pM) during the last 6 hours before lysis with the IP buffer supplemented with 1 mM PMSF and 10 mM iodoacetamide.
Whole-cell lysates obtained by centrifugation were incubated with 2-5 pg of antibody overnight at 4°C, followed by 2 hours incubation with Protein A-Sepharose CL-4B (Cytiva, 17- 0780-01). The immunocomplexes were then washed three times with IP buffer, and boiled at 95°C for 5 minutes in Laemmli sample buffer containing 5% beta-mercaptoethanol, before being separated by SDS-PAGE for Western blotting assays. For experiments to examine the binding of isolated polyalanine stretches, a pre-clearing step was performed by incubating the whole cell lysates with 25 pl beads for 2 hours at 4°C. The beads were then discarded, and the cell lysates were incubated with antibody overnight as already described. For experiments analyzing ubiquitin load on USE1 under expression of polyalanine disease proteins, the different polyalanine constructs were expressed in HEK293T cells for 72 hours while the FLAG-USE1 was expressed in the cells for the last 24 hours.
Protein expression, purification, and labeling - All proteins used in this study were overexpressed in Rosetta (DE3, pLysS) Escherichia coli (Merck) cells using 0.4 mM isopropyl 1- thio-D-galactopyranoside (Inalco Pharmaceuticals) induction overnight at 18 °C.
The sequences used in the experiments are as follows: Sequences of E6AP isoform II (GenBank Accession No. NP_000453.2) with the HA-tag as expressed in mammalian cells under control of the CMV promoter are provided in SEQ ID NOs: 63 (polypeptide) and 64 (polynucleotide encoding same);
Sequences of wild-type UBA6 with HA-tag as expressed in mammalian cells under control of the CMV promoter are provided in SEQ ID NOs: 65 (polypeptide) and 66 (polynucleotide encoding same);
Sequences of wild type Hise-tagged UBA6 (UBE1L2) as expressed in bacterial (E. coli) cells under control of the T7 promoter are provided in SEQ ID NOs: 67 (polypeptide) and 68 (polynucleotide encoding same);
The sequences of the wild type 3x-FLAG-tagged USE1 (UBE2Z) as expressed in mammalian cells under control of the CMV promoter are provided in SEQ ID NOs: 69 (polypeptide) and 70 (polynucleotide encoding same);
The sequences of the wild type Hise-AviTag-tagged USE1 (UBE2Z) as expressed in bacterial (E. coli) cells under control of the T7 promoter are provided in SEQ ID NO: 71 (polypeptide) and 72 (polynucleotide encoding same);
The sequences of the Hise-tagged SCCH domain of the UBA6 (UBE1L2) [amino acids (aa) 623-889] as expressed in bacterial (E. coli) cells under control of the T7 promoter are provided in SEQ ID NOs: 62 (polypeptide) and 61 (polynucleotide encoding same).
Purification of proteins was performed on Ni Sepharose 6 Fast Flow sepharose (Cytiva) in 50 mM HEPES (pH 7.5), 300 mM NaCl, 1 mM TCEP, 10 mM imidazole and 10% (w/v) glycerol and eluted using 250 mM imidazole (pH 7.5) in the same buffer. UBA6 and E2 variants were further desalted using PD- 10 Columns (Cytiva) into loading buffer containing 20 mM HEPES (pH 7.5), 150mM NaCl, and 10% (w/v) glycerol. Concentrated protein aliquots were stored at 80 °C. All protein concentrations indicated correspond to total protein and are based on UV absorbance at 280 nm
Fluorescein-5-Maleimide (AnaSpec) was attached to ubiquitin following the directions as previously described45. Briefly, proteins in 20 mM Tris (pH 7.5), 150 mM NaCl and 1 mM TCEP were incubated for 2 hours in the presence of the fluorophore at room temperature such that the label : protein ratio would be 4. To quench the reaction, beta-mercaptoethanol was added at a ratio of 10: 1 to fluorescein. Fluorescein-labeled ubiquitin was then separated from free dye on PD10 desalting columns (Cytiva) and was stored at 80 °C.
El and E2 loading assays - All loading assays were performed at 32 °C in a buffer containing 20 mM HEPES (pH 7.5), 150 mM NaCl and 10% (w/v) glycerol. El and E2 loading assays were performed using 3 pM fluorescein ubiquitin, a range of 10 nM to 1 pM El, 1 pM E2, and 2.5 mM concentrations each of ATP and MgCL. Reactions were stopped using non-reducing SDS-PAGE loading buffer. Samples were separated on 4-20% Tris-Glycine NuPAGE gels (Thermo) in Tris-Glycine buffer. Band detection in El and E2 loading assays was performed using an Alliance Q9 imager (Uvitec Cambridge). The different qualitative end-point assays were performed using freshly thawed protein aliquots, and the results obtained were reproducible across at least three different protein batches. All constructs and conditions were carried out in triplicate. For in vitro experiments of E6AP ubiquitination (resolved under reducing conditions), the HA- E6AP isoform II (a gift from Peter Howley47, Addgene plasmid #8658) was purified from HEK293T cells using HA-beads (900801, Biolegend), and IP buffer containing 0.5% NP40. The HA peptide (1 mg/ml) was used for elution in elusion buffer (50mM Tris-HCL PH 7.2, 50mM NaCl, ImM EDTA) (931401, Biolegend).
In silico structural analysis - The present inventors have constructed models for UBA6 using the Protein Homology/analogY Recognition Engine V 2.0 (PHYRE2) and the AlphaFold server49, 50. Further idealization of the geometry was achieved by five cycles of minimization with Refmac5. The model of full length USE1 was downloaded from the AlphaFold server 49, 50. Structure visualization and figures preparations were performed with PyMOL (Molecular Graphics System, hypertexttransferprotocol://worldwideweb(dot)pymol(dot)org). The present inventors employed the continuum solvation method APBS (Adaptive Poisson-Boltzmann Solver) with the CHARMM force field to calculate the electro-potential surface of UBA1 and UBA651.
Biophysical interaction studies with polyalanine peptides - Microscale thermophoresis (MST) analyses of the SCCH domain : polyalanine peptide interaction were carried out using our Monolith NT.115 (Nano Temper Technologies; Wienken et al, 2010). A peptide containing a tandem of 7 alanine residues was labeled with Cy5 (GL Biochem Shanghai Ltd.), and was used at constant final concentration of 100 nM. The labeled peptide was mixed with the ligand, a purified recombinant unlabeled UBA6 (623-889) or UBA1 (624-891) SCCH domains. 1:2 serial dilutions of the ligands from 200 pM to 1.56 pM final concentration were assayed. After a short incubation, the samples were loaded into premium glass capillaries before data collection. All MSTs were performed twice at Excitation Power 30% of the LED and MST power of 20% and 40%.
Microscopy - The cells were grown on coverslips, and then washed and fixed in 4% Paraformaldehyde for 10-15 minutes before being permeabilized with 0.1% Triton X-100. A solution of, 1% BSA in PBS was used to block both primary and secondary antibodies. The primary antibody was added at a ratio of 1: 100 and incubated for at least 1 hour at room temperature while the secondary antibody (1:300 Invitrogen) was allowed to incubate with the sample for 30 minutes at room temperature. Neurons were permeabilized in 2% BSA + 0.1% Triton, and blocked with 2% BSA and the primary antibodies were incubated overnight at 4°C, at a ratio of 1: 150, with the secondary antibody incubated for 2 hours at room temperature at 1:500. A Zeiss 710 confocal microscope was utilized for confocal imaging with a 63X oil-immersion lens. Nuclear staining was detected by staining with DRAQ5. For quantification, the operator was blinded to the outcome of the experiment when selecting suitably similar fields to image for subsequent computerized analysis.
For the colocalization experiments, the association of PHOX2B and UBA6 outside the nucleus was measured by selecting PHOX2B positive cells manually using Fiji, and excluding the nuclei by segmenting and removing the nuclear channel. The colocalization between the channels of interest was then measured using the JACops plugin in Fiji with the default parameters, and Pearson’ s correlation coefficient was calculated. The cytoplasmic intensity was measured for the channel of interest and the mean gray value was recorded after excluding the nuclei as already described. For the localization experiments related to UBA6 in neurons, the association of UBA6 with the cell body was examined by selecting the neuronal cell bodies manually using Fiji52. For the localization of UBA6 with neurites, the cell bodies were selected manually and removed. Arc intensity in the neurons was measured by circulating the neuronal cell body together with the first neurite junction manually using Fiji. The mean integrated value and the area for each neuron were recorded. The value of the mean divided by the area was used for statistical analysis.
For UBA6 intensity measurements in aggregated vs. non- aggregated forms of mutant GFP- PHOX2B in primary cortical neurons, cell bodies were manually selected, and clusters were detected in the GFP signal with a minimum diameter of 0.25 pm2. The “Red” intensity (UBA6) was then measured in the area of the clusters (cluster intensity). For cytoplasmic intensity, the “red” intensity was measured in the cell body area excluding the clusters and the nucleus (segmented from the nuclei signal). The intensity was recorded as integrated density.
FLIM imaging was performed using two-photon FLIM microscopy. The cells were immunostained by mouse anti-USEl and rabbit anti-UBA6 primary antibodies, with secondary antibodies anti-mouse Alexa Fluor 488 and anti-rabbit Alexa Fluor 555, respectively. The donor antibody (Alexa Fluor 488) was excited with a Ti-sapphire laser (Chameleon, Coherent) at a wavelength of 920 nm and a power of 1.0-2.0 mW. The images were acquired by Bergamo two- photon microscope (Thorlabs) equipped with a Time-Correlated Single Photon Counting board (Time Harp 260, Picoquant), thorough a 18x0.8na objective (Nikon). Images were acquired at 128*128 or 256*256 pixel size, and averaged across 24 frames. For FLIM analysis, the present inventors calculated the mean lifetime of multiple ROIs at each image using double exponent fitting. For each group, the present inventors determined the lifetime of donor only samples (prepared with staining for USE1 only) and compared them with the mean lifetime of cells stained for donor and acceptor (USE1+ UBA6). Then, the present inventors subtracted donor- (donor/acceptor) lifetime, to compare the change in lifetime between groups. The analysis was performed using a custom software written with C+ (FLIMage, Florida Lifetime Imaging). mRNA analysis by qRT-PCR - RNA purification was performed using the total RNA purification Micro kit (Norgen, 35300) according to manufacturer’s protocol. The concentration and quality of the RNA were measured by NanoDrop one (Thermo Fisher). The cDNA generation was done by using a High capacity cDNA reverse transcription kit (Applied Biosystem, 4368814) with RNase inhibitor (Applied Biosystem, N8080119) as described in the kit protocol. Then, the cDNA was diluted in ultra-pure water in a ratio of 1:5 (each biological replicate was assessed in triplicates). Reaction solutions were prepared for each set of primers including the genes E6AP/UBE3A and two different sets of primers for P- Actin. The reaction volume contained Fast SYBER green master mix (Applied Biosystem, 43856120), forward and reverse primers, ultra- pure water, and the cDNA template. To calculate relative RNA expression, the mean of two sets of primers for P- Actin was included as an endogenous control. The data were analyzed using the AACT method. The sequence of the primers used are provided in Table 3 below.
Table 3
Figure imgf000072_0001
Table 3.
Analysis of detergent-insoluble aggregates in cells - For extraction of soluble protein fraction, cells were lysed with buffer 1 (25 mM Tris pH 7.4, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, supplemented with Protease Inhibitor Cocktail, 1 mM PMSF, phosphatase inhibitor cocktail II & IH) and ultracentrifuged for 15 minutes. The supernatant was kept as the soluble fraction and the pellet was re-homogenize in high salt/sucrose buffer (10 mM Tris pH 7.4, 0.8 M NaCl, 10% Sucrose, 1 mM EGTA supplemented with 1 mM PMSF), and ultracentrifuge for 15 minutes. The supernatant was adjusted to 1% sarkosyl and incubated for 1 hour at 37 °C on orbital shaker followed by ultracentrifugation for 1 hour at 4°C. The pellet (sarkosyl-insoluble fraction) was resuspended 50 pl TBSX1 for further analysis.
Bioinformatics analysis - USE1/UBE2Z human homologs were searched against the Uniprot (Pubmed id 29425356) and NCBI databases using BLAST (Pubmed id 2231712). Prosite (Pubmed id 23161676) was used to scan for alanine residues motifs with between 6 and 10 continuous alanine residues in the BLAST results (a search for proteins containing polyalanine stretches in the ubiquitin cascades). Alignments of the E2 family in vertebrates and across all databases were calculated using MAFFT (Pubmed id 28968734). The figures were generated using J al view (Pubmed id 19151095).
Statistics - Basic data handling was performed in Microsoft Excel. For single comparisons, the statistical significance of the difference between experimental groups was determined using two-tailed Student’s t-test with the Prism GraphPad software v.9. Comparisons of multiple means were made by one-way or two-way analysis of variance (ANOVA) followed by the Tukey’ s, Dunnett’s and Sidak’s post hoc tests to determine statistical significance. Differences were considered statistically significant for P < 0.05. Sample sizes were chosen based on extensive experience with the assays the present inventors have performed. The experiments were appropriately randomized. For primary neurons transduced with lentiviral vectors, the present inventors used independent cultures prepared from brains of mouse embryos taken from different females. For iPSC-derived neurons, three independent cultures from different differentiation days were considered for analysis, and for cell-line based experiments, replicates performed in different days were considered. Errors bars shown in the figures are standard errors of the mean (s.e.m).
Data availability - Available protein structures were from PDB code 4112, 6DC6, 1Y8Q, 2NVU, and 7PYV. Structural analysis was supported by AlphaFold Protein Structure Database, protein sequences were from UniProt.
EXAMPLE 1
POLY ALANINE STRETCH CONTRIBUTES TO THE RECOGNITION OF USE1 BY UBA6
A search for proteins containing polyalanine stretches in the ubiquitin cascades identified a small subset of E3 ubiquitin ligases and the E2 ubiquitin-conjugating enzyme, USE1 (Figures 5A-B). USE1 has both N- and C-terminal extensions as well as the ubiquitin-conjugating (UBC) core domain (Figure 1A), classifying it as a class IV E2, which can be specifically loaded with ubiquitin by the El ubiquitin activating enzyme, UBA6, via a transthiolation reaction7, 815. The polyalanine stretch of USE1 is located in the N-terminal extension and is well conserved in primates, several other mammals, and reptiles (Figure 1A and Figure 5B).
In order to examine the role of the alanine stretch in USE1 ubiquitin loading, the present inventors replaced two alanine residues in the stretch with arginine residues (the 2A— >2R mutant) .
The difference in ubiquitin loading between the wild type and 2A—>2R USE1 is dependent on UBA6 activity - When transfected into HEK293T cells, the ubiquitin loading of the USE1 2A^2R mutant was significantly reduced in comparison to wild type USE1 (Figure IB). Exposure of cell lysates to the reducing agent P-mercaptoethanol, abolished USE1 loading under all examined conditions, suggesting that the additional band observed is ubiquitin conjugated via a thiolation reaction, similarly to a catalytic dead enzyme (USE1 C188A) that cannot be loaded with ubiquitin (Figure IB). Under non- reducing conditions, the ubiquitin loading of wild type USE1 and USE1 2A^2R was abolished in UBA6-siRNA depleted cells (Figure IB) suggesting that the difference in ubiquitin loading between the wild type and 2A^2R USE1 is dependent on UBA6 activity.
A deletion mutant devoid of the polyalanine stretch has reduced ubiquitin loading compared to a wild type USE1 or a hyperactive mutant (deletion of Loop B) - The present inventors constructed additional USE1 mutants including one with a deletion of the polyalanine stretch (USE1 APolyAla), and a deletion of Eoop B (USE1 AEB), which is hyperactive16 (Figure 1C). The USE1 APolyAla mutant exhibits reduced ubiquitin loading compared to wild type USE1 or to USE1 ALB both in cells and in vitro with purified recombinant UBA6 (Figure 1C, Figure ID and Figures 6A-B). The present inventors have mutated the endogenous polyalanine stretch of USE1 by generating a knockout HEK293T cell line harboring a deletion of the polyalanine stretch in the UBE2Z alleles (USE1 APolyAla KO). The endogenous USE1-UBA6 interaction in these cells was detected with Forster resonance energy transfer (FRET) based fluorescence lifetime imaging microscopy (FLIM). The results indicate less binding between UBA6 and USE1 in the USE1 APolyAla KO cells compared to control cells (Figure ID).
E6AP/UBE3 A is a highly potent E3 ubiquitin ligase whose regulation is critical for proper development of the nervous system. Indeed, decreased activity of the ligase results in Angelman syndrome while increased activity causes autism spectrum disorders14, 17, 18. Harper and coworkers identified a unique regulatory cascade by which UBA6-USE1 ubiquitinates E6AP for degradation in the proteasome13. The present inventors have examined the stability of E6AP in the USE1 APolyAla KO cells. In control HEK293T cells, a cycloheximide chase experiment revealed that E6AP has an apparent half-life of approximately 10-14 hours (Figure IE), which is consistent with previous reports in cultured cells13. In contrast, E6AP was stabilized in the USE1 APolyAla KO cells and showed a decrease in Lys48-linked polyubiquitination (Figures IE and IF), suggesting that proteasome-mediated degradation of E6AP is inhibited in the USE1 APolyAla KO cells. Since E6AP is monoubiquitinated and polyubiquitinated by the UBA6-USE1 cascade13, the present inventors have further investigated the role of the polyalanine stretch of USE1 in E6AP ubiquitination by incubating purified E6AP with UBA6, USE1 WT and USE 1 mutants (APolyAla and C188A) in vitro. The results indicate that the incubation with the USE1 APolyAla decreased the polyubiquitination of E6AP but not the monoubiquitin conjugate, similarly to the effects of the USE1 C188A catalytically dead mutant (Figure 1G). These findings provide further support that the polyalanine stretch contributes to the recognition of USE1 by UBA6.
EXAMPLE 2
CHARACTERIZATION OF UBA6 AND USE1 BINDING
An isolated polyalanine stretch competes with USE1 - In order to examine whether isolated polyalanine stretches (19 Ala residues) interact with UBA6 in mammalian cells, the present inventors transfected HEK293T cells with GFP-19Ala, and monitored the binding to UBA6, or its possible competition with USEl. The results indicated that the polyAla stretch binds UBA6 and that this interaction decreases the USE1-UBA6 binding (Figure IE and Figure 6C).
Identification of regions in UBA6 which determine specificity to USE1 - The ubiquitin- activating El enzymes, UBA1 and UBA6 share 40% identity of protein sequence and a strong specificity for their cognate ubiquitin-like proteins19-21. The ubiquitin fold domain of El interacts with the al helix of E2 and is responsible for determining the selectivity between E2s or different ubiquitin-like proteins22.
UBA1 and UBA6 assume the same domain architecture and folds. Therefore, to identify additional regions in UBA6 that are likely to determine the specificity to USE1, the present inventors compared the physico-chemical properties of UBA6 to those of UBA1 (Figure 2A). Using AlphaFold the present inventors constructed a model of UB A6 (data is presented in Figure 2A). In addition, the crystal structures of UBA6 have been recently published23,24. These experimental data confirmed the AlphaFold model with very minor differences. Comparison of the models for the general structure containing 698 Ca atoms yielded an RMSD of 1.2A. For the second catalytic cysteine half (SCCH) domain alone (168 Ca), which assumed a slightly different orientation compared with the enzyme core, the RMSD was 0.78A. Interestingly, comparison of the structures of UBA1 and UBA6 at the interface with the E2-al as well as the E2-al helices themselves appear to be very similar. However, a projection of calculated electro-potential properties on the surfaces of the two enzymes revealed significant differences within the second catalytic cysteine half (SCCH) domains. In place of the negative groove seen in UBA1, UBA6 contains a large positively charged groove that is formed by the key residues Lys628, Arg691, Lys714, and Lys709 (Figure 2A). Similarly, a structural comparison of the canonical El enzymes UBA1, 2, 3, 6 and 721-22-25-26 reveals significant differences in the SCCH domains (Figure 7A). Moreover, a recent study demonstrated that replacing the SCCH domain of UBA1 with the one of UBA2 allows the engineered UBA1 to load ubiquitin onto the E2 of SUMO (UBC9)27.
The SCCH domain of UBA6 and the polyAla stretch in USE1 affect the interaction between UBA6 and USE1 but not the mechanism of ubiquitin activation or transthiolation - A biophysical analysis revealed that a peptide of 7 alanine residues interacts directly with the SCCH domain of UBA6, but has significantly weaker binding to the SCCH domain of UBA1 (Figure 7B). The present inventors have further constructed UBA6 mutants with the positive residues in the SCCH domain replaced by Ala (UBA6 mut 4Ala) or Asp (UBA6 mut 4Asp). The USE1 binding of both these mutants in HEK293T cells is indeed significantly reduced compared to wild type of UBA6 (Figure 2B) as is the interaction of both mutants with isolated polyalanine stretches (Figure 2C). In vitro, the ability of both recombinant UBA6 mut 4Ala and UBA6 mut 4Asp to load USE1 with ubiquitin is lower than that displayed by wild type UBA6 (Figure 2D). Interestingly, neither mutations in the positive groove of UBA6 nor aberrations in the polyAla sequence in USE1 are sufficient to abrogate ubiquitin transfer from UBA6 to USEl. This suggests that while these two regions are important for specificity they are not essential for the general mechanism of ubiquitin activation (/'.<?. adenylation) or transthiolation.
EXAMPLE 3 DISEASE-CAUSING POLY ALANINE EXPANSIONS IN PROTEINS INTERACT WITH UBA6
Polyalanine stretches which are expressedin the cytoplasm bind effectively to UBA6 and reduce loading of ubiquitin on USEl - Since UBA6 is mainly localized in the cytoplasm in HEK293T cells, the present inventors expressed the isolated GFP-19Ala stretches with or without a nuclear localization sequence (NFS) and monitored their binding to UBA6 (Figure 8A and Figure 3 A) as well as their ability to affect ubiquitin loading of USEl (Figure 9A). The results show that polyalanine stretches bind UBA6 effectively when expressed in the cytoplasm without an NLS (Figure 3A), and reduce the ubiquitin loading of USEl (Figure 9A).
Polyalanine stretches which are expressed in the nucleus do not bind UBA6 and do not affect USEl loading - In contrast to the cytoplasmic expression of the isolated polyAla stretches, when the isolated polyalanine stretches are expressed in the nucleus (due to the NLS) they do not bind UBA6 and they do not have any apparent effect on USE1 loading (Figure 3 A, Figure 9A).
The effect of polyalanine expansion mutations on interaction with UBA6 - Biochemical analysis of the GFP-19Ala could not detect a sarkosyl-insoluble fraction, suggesting that the soluble polyalanine stretches can interact with UBA6 (Figure 9B). To explore pathological UBA6 interactions, the present inventors expressed various disease-causing proteins with polyalanine expansion mutations in cells (Figures 8B-E) and compared their interactions with UBA6 to those of the wild type protein (Figures 3B-E). These include PH0X2B (WT, +13 Ala, Figure 3B), RUNX2 (WT, +6 Ala, +12 Ala, Figure 3C), H0XD13 (WT, +10 Ala, Figure 3D), and PABPN1 (WT, +7 Ala, Figure 3E).
These pathological interactions are measurable because although UBA6 is mainly localized to the cytoplasm and, as expected, wild type PHOX2B, RUNX2, H0XD13, and PABPN1 are primarily localized to the nucleus, the mutant proteins with polyalanine expansions are partially mislocalized to the cytoplasm where they can interact with endogenous UBA6 (Figures 8B-E, Figures 3B-E). Consequently, the interactions between UBA6 and the mutant proteins (PHOX2B +13 Ala, RUNX2 +12 Ala, H0XD13 +10 Ala, and PABPN1 +7 Ala) are measurable in the cytoplasmic but not in the nuclear fraction of the cells (Figures 10A-D), which reduces the USE1 ubiquitin loading (Figure 10E). These results demonstrate the ability of different disease causing proteins with polyalanine expansions to modulate the UBA6 ubiquitin cascade.
EXAMPLE 4
INHIBITION OF UBA6-DEPNDENT E6AP DEGRADATION BY POLY ALANINE EXPANSIONS
The present inventors have further tested the effect of mutant PHOX2B (+ 13 Ala) on the binding between USE1 and UBA6. As shown in Figure 3F recombinant mutant PHOX2B (+ 13 Ala) competes with USE1 for binding to UBA6 in vitro.
To test the effects on E6AP degradation, the present inventors have measured the stability and ubiquitination of E6AP in mutant PHOX2B -expressing HEK293T cells. Mutant PHOX2B increases the levels of E6AP due to its stabilization in HEK293T cells (Figure 3G, Figure 9C, Figure 10F). However, mutant PHOX2B does not increase E6AP mRNA levels, indicating that the increased E6AP levels are not related to transcriptional effects (Figure 10G). This correlates with a decrease in Eys48-linked polyubiquitination of E6AP (Figure 3H, Figure 10H), suggesting that proteasome-mediated degradation of E6AP is inhibited by mutant PHOX2B in the cells. Moreover, the increase in E6AP levels seen in the polyalanine-expressing cells, could be reversed by UBA6 overexpression (Figure 9D), which is compatible with a model in which the polyalanine stretch impairs the regulation of E6AP levels by competing with USE1 on UBA6.
In order to test this model in neuronal cells, the present inventors used mouse primary cortical neurons. Similarly, UBA6 was predominantly detected in the cell body and in neurites, with only a small fraction located in the nucleus (Figure 11A). Transduction of the neurons with lentiviruses expressing GFP-tagged wild type or mutant PH0X2B (+13 Ala) resulted in a significant difference in subcellular localization and expression pattern. While most of the wild type PH0X2B could be detected in the nucleus, mutant PH0X2B (+13 Ala) is also present in the cell body and in neurites, where the GFP fluorescence imaging and biochemical analysis revealed both non- aggregated and aggregated patterns (Figures 11B and 11C). Neurons expressing mutant PH0X2B exhibit increased colocalization with UBA6, which correlates with increasing length of the polyalanine stretch (Figure 31, Figure 11D). Moreover, expression of mutant PH0X2B with +7 Ala and +13 Ala increase the levels of E6AP in the primary neurons by 1.3 fold (Figure 3 J), which is consistent with physiological induction rates of E6AP protein levels in cultured neurons28. The synaptic activity-regulated cytoskeleton-associated protein (Arc) is negatively regulated by E6AP28, 29, and accordingly, the increase in E6AP levels due to ectopic expression of the PH0X2B mutants with +7 Ala and +13 Ala decreases Arc levels in primary neurons (Figure 3 J, Figure 1 IF). These results demonstrate that the perturbations in E6AP caused by the expression of polyalanine - expanded PH0X2B are sufficient to affect E6AP targets, exemplified here by the synaptic protein, Arc.
EXAMPLE 5 UBA6 DY SPECULATION IN FIBROBLASTS AND NEURONS OF PATIENTS WITH POLYALANINE EXPANSIONS
In order to investigate the mechanisms underlying cellular vulnerabilities caused by the polyalanine expansion mutations in humans, the present inventors sought to assess the associations between endogenous polyalanine expansions and UBA6.
The cricopharyngeal muscle of OPMD patients is vulnerable to the polyalanine expansion mutations in the PABPN1 gene30. OMPD patient-derived cricopharyngeal myotubes and primary fibroblasts as well as non-affected control fibroblasts, express PABPN1 both in the cytoplasm and in the nucleus (Figures 12A-B), which could be related to the ability of PABPN1 to shuttle between the nucleus and the cytoplasm31. Accordingly, OPMD patient-derived fibroblasts have less interaction between UBA6 and USE1 than control fibroblasts (Figures 12C-D). Endogenous PH0X2B is expressed in specific neuronal populations of the autonomic nervous system32, 33. In humans, polyalanine expansion mutations within the PH0X2B gene cause CCHS, a rare and life-threatening condition with autonomic nervous system dysfunction34, 35. The present inventors have previously described the generation of two induced pluripotent stem cells (iPSCs) from identical twins carrying a heterozygous PH0X2B +5 Ala expansion (lOliCCHS 20/25 and 102iCCHS 20/25)36. Here, the present inventors obtained skin punch biopsies from an additional CCHS patient bearing a heterozygous +7 Ala expansion (104iCCHS 20/27), as well as from their sex- matched healthy family relatives, which serve as controls (103iCTR 20/20 and 105iCTR 20/20) (Figures 13A1-O5). These patients suffer from central sleep apnea with a more severe peripheral autonomic presentation in 104iCCHS 20/27, including Hirschsprung disease. Patient-derived fibroblasts were reprogrammed using non- integrating episomal plasmids as previously described36. All generated iPSC lines expressed the pluripotency markers NANOG, SOX2, OCT3/4 TRA-1-60, and SSEA4 (Figures 13A1-J3), and spontaneously differentiated into the three germ layers (Figures 13E1-N3). All lines possess a normal karyotype, and genetic analysis confirms the presence of a heterozygous expansion of seven alanine residues resulting in a 27 polyalanine stretch in PHOX2B (Figures 13K1-3 and 1301-5). In order to obtain endogenous PHOX2B -expressing cells, the present inventors differentiated the iPSCs to neural crest progenitor cells that were further differentiated into autonomic neuroblast cells, and finally to peripheral autonomic neurons (Figure 4A). Characterization of the human autonomic neurons reveals expression of PHOX2B, the pan-neuronal marker piH-tubulin, the catecholaminergic marker tyrosine hydroxylase (TH), the peripheral neuronal marker peripherin, and atonal BHEH transcription factor 1 (ATOH1), which is associated with breathing and digestion (Figure 4A).
Analysis of the PHOX2B localization revealed a decrease in the nuclear fraction of PHOX2B in the mutant 20/25 and 20/27 neurons, as compared to healthy control neurons (Figures 14A-B). The cytoplasmic PHOX2B is soluble, and predominantly perinuclear without visible aggregates (Figures 14C-D). In addition, there was an increased association between UBA6 and PHOX2B in the CCHS patient neurons (Figure 4B), accompanied by a decrease in the interaction between UBA6 and USE1 (Figure 4C). Some CCHS neurons exhibited severe PHOX2B cytoplasmic mislocalization, with apoptotic nuclear morphology (1.9% and 3.9% of the 20/25 and the 20/27 mutations, respectively) (Figure 14D). In accordance with the mouse data, the levels of E6AP protein are higher in the patient neurons (Figure 4D), although no change in E6AP mRNA was detected (Figure 4E). Moreover, Arc levels were lower in the CCHS neurons with the 20/25 mutation than in control cells with the levels further reduced in CCHS neurons with the 20/27 mutation (Figure 14E-G). In addition to E6AP, the UBA6-USE1 cascade has been shown to regulate the levels of the synaptic protein shank313. It is noted that no endogenous expression of shank3 was detected in the human autonomic neurons (Figure 14H), thereby precluding the analysis of UBA6-USE1 effects on shank3 in these neurons.
Over-expression ofUBA6 rescues CCHS neurons from death - To investigate how does UBA6 affects polyalanine expanded protein-associated toxicity, and in view of the observed apoptotic nuclear morphology in the CCHS patient neurons (Figure 14D), the present inventors attempted to rescue the cell death in CCHS neurons by their transduction with lentiviruses expressing the cDNA of UBA6 (Figure 4F and 4G), which resulted in robust UBA6 expression in both cell body and neurites (Figure 141). Interestingly, the overexpression of UBA6 significantly reduced the number of CCHS neurons positive to terminal deoxynucleotidyl transferase dUTP nick end labelling (TUNEL) (Figure 4G), and also decreased the amounts of phosphatidylserine on the extracellular surface as detected by Annexin V binding (Figure 4F). These results demonstrate that overexpression of UBA6 in the CCHS neurons rescues them from neuronal death.
EXAMPLE 6
A POLY-ALANINE PEPTIDE IS CAPABLE OF INCREASING POLY-UBIQUITINATION OF E6AP
E6AP copy number variations resulting in overexpression of E6AP are strongly associated with the development of autism spectrum disorders (ASDs) (Khatri Natasha et al., 2019. Front Mol Neurosci. 12: 109). In addition, it is known that E6AP undergoes poly-ubiquitination as part of its proteasome-mediated degradation (Lee P., 2013, Mol. Cell, 50: 172-184).
The present inventors have tested the ability of an agent, which increases activity of UB A6 to increase E6AP ubiquitination, for proteasome-mediated degradation.
Thus, E6AP purified from HEK293T cells was incubated in vitro with bacterially- produced UBA6, USE1, and ubiquitin with or without polyalanine peptide (cy5-7-Ala residues; SEQ ID NO: 22). As shown in Figure 15, the addition of a peptide of 7-Ala residues (cy5-7Ala residues; SEQ ID NO: 22) resulted in increased E6AP poly-ubiquitination. These results suggest that the cy5-7-Ala residue peptide directly increase UBA6-dependent ubiquitination of E6AP.
Analysis and Discussion
Expansion mutations in stretches of repetitive DNA sequences that encode poly amino acids such as polyglutamine or polyalanine can cause various diseases. Although much progress has been made on determining the molecular mechanisms of polyglutamine diseases9, 37, 38, the consequences of polyalanine expansions remain more of an enigma. Here, the present inventors demonstrate how expanded polyalanine stretches can compete with the normal function of a shorter stretch to disrupt the specific interaction between the E2 ubiquitin- conjugating enzyme USE1 and the El ubiquitin- activating enzyme, UBA6. The results indicate that UBA6 interacts with polyalanine stretches, and that this interaction contributes to UBA6 recognition of USE1, but can be altered by different polyalanine disease-causing proteins.
UBA6 plays an important role in mouse embryonic development, neuronal function, and survival 13, 42. Without being bound by any theory, inhibition of UB A6 by sequestering the enzyme into soluble cytoplasmic polyalanine expansions may represent a deleterious mechanism for such mutations. Without being bound by any theory, the correlation between disease severity and the length of the polyalanine expansion may be related to the greater tendency of mutants with longer polyalanine stretches to mislocalize to the cytoplasm and interact there with UBA6. The results provide evidence that cytoplasmic mislocalization of endogenous PHOX2B can occur in the neurons affected in CCHS, which may contribute to the neuronal dysfunction seen in this disease.
In summary, the study provides mechanistic insights into the long-standing question of the functional role of polyalanine stretches and demonstrates that they are relevant to the ubiquitin system and its dysregulation in disease states.
Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.
It is the intent of the Applicant(s) that all publications, patents and patent applications referred to in this specification are to be incorporated in their entirety by reference into the specification, as if each individual publication, patent or patent application was specifically and individually noted when referenced that it is to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting. In addition, any priority documents) of this application is/are hereby incorporated herein by reference in its/their entirety. CITED REFERENCES ADDITIONAL REFERENCES ARE CITED IN TEXT Amiel, J. et al. Polyalanine expansion and frameshift mutations of the paired- 1 ike homeobox gene PHOX2B in congenital central hypoventilation syndrome. Nat Genet 33, 459-461 (2003). Muragaki, Y., Mundlos, S., Upton, J. & Olsen, B.R. Altered growth and branching patterns in synpolydactyly caused by mutations in HOXD13. Science 272, 548-551 (1996). Mundlos, S. et al. Mutations involving the transcription factor CBFA1 cause cleidocranial dysplasia. Cell 89, 773-779 (1997). Laumonnier, F. et al. Transcription factor SOX3 is involved inX-linked mental retardation with growth hormone deficiency. Am J Hum Genet 71, 1450-1455 (2002). Richard, P. et al. Correlation between PABPN1 genotype and disease severity in oculopharyngeal muscular dystrophy. Neurology 88, 359-365 (2017). Brown, L.Y. et al. Holoprosencephaly due to mutations in ZIC2: alanine tract expansion mutations may be caused by parental somatic recombination. Hum Mol Genet 10, 791-796 (2001). Jin, J., Li, X., Gygi, S.P. & Harper, J.W. Dual El activation systems for ubiquitin differentially regulate E2 enzyme charging. Nature 447 , 1135-1138 (2007). Pelzer, C. et al. UBE1L2, a novel El enzyme specific for ubiquitin. J Biol Chem 282, 23010-23014 (2007). Usdin, K. The biological effects of simple tandem repeats: lessons from the repeat expansion diseases. Genome Res 18, 1011-1019 (2008). Albrecht, A. & Mundlos, S. The other trinucleotide repeat: polyalanine expansion disorders. Curr Opin Genet Dev 15, 285-293 (2005). Amiel, J., Trochet, D., Clement-Ziza, M., Munnich, A. & Lyonnet, S. Polyalanine expansions in human. Hum Mol Genet 13 Spec No 2, R235-243 (2004). Amer-Sarsour, F., Kordonsky, A., Berdichevsky, Y., Prag, G. & Ashkenazi, A. Deubiquitylating enzymes in neuronal health and disease. Cell Death Dis 12, 120 (2021). Lee, P.C. et al. Altered social behavior and neuronal development in mice lacking the Uba6-Usel ubiquitin transfer system Mol Cell 50, 172-184 (2013). Matsuura, T. et al. De novo truncating mutations in E6-AP ubiquitin-protein ligase gene (UBE3A) in Angelman syndrome. Nat Genet 15, 74-77 (1997). Ye, Y. & Rape, M. Building ubiquitin chains: E2 enzymes at work. Nat Rev Mol Cell Biol 10, 755-764 (2009). Schelpe, J., Monte, D., Dewitte, F., Sixma, T.K. & Rucktooa, P. Structure of UBE2Z Enzyme Provides Functional Insight into Specificity in the FAT10 Protein Conjugation Machinery. J Biol Chem 291, 630-639 (2016). Kishino, T., Lalande, M. & Wagstaff, J. UBE3A/E6-AP mutations cause Angelman syndrome. Nat Genet 15, 70-73 (1997). Glessner, J.T. et al. Autism genome-wide copy number variation reveals ubiquitin and neuronal genes. Nature 459, 569-573 (2009). Bohnsack, R.N. & Haas, A.L. Conservation in the mechanism of Nedd8 activation by the human AppBpl-Uba3 heterodimer. J Biol Chem 278, 26823-26830 (2003). Whitby, F.G., Xia, G., Pickart, C.M. & Hill, C.P. Crystal structure of the human ubiquitin- like protein NEDD8 and interactions with ubiquitin pathway enzymes. J Biol Chem 273, 34983-34991 (1998). Schulman, B.A. & Harper, J.W. Ubiquitin-like protein activation by El enzymes: the apex for downstream signalling pathways. Nat Rev Mol Cell Biol 10, 319-331 (2009). Lee, I. & Schindelin, H. Structural insights into El-catalyzed ubiquitin activation and transfer to conjugating enzymes. Cell 134, 268-278 (2008). Yuan, L. et al. Crystal structures reveal catalytic and regulatory mechanisms of the dualspecificity ubiquitin/F AT 10 El enzyme Uba6. Nat Commun 13, 4880 (2022). Truongvan, N., Li, S., Misra, M., Kuhn, M. & Schindelin, H. Structures of UBA6 explain its dual specificity for ubiquitin and FAT10. Nat Commun 13, 4789 (2022). Huang, D.T. et al. Basis for a ubiquitin- like protein thioester switch toggling E1-E2 affinity. Nature 445, 394-398 (2007). Lois, L.M. & Lima, C.D. Structures of the SUMO El provide mechanistic insights into SUMO activation and E2 recruitment to EL EMBO J 24, 439-451 (2005). Akimoto, G., Fernandes, A.P. & Bode, J.W. Site-Specific Protein Ubiquitylation Using an Engineered, Chimeric El Activating Enzyme and E2 SUMO Conjugating Enzyme Ubc9. ACS Cent Sci 8, 275-281 (2022). Greer, P.L. et al. The Angelman Syndrome protein Ube3A regulates synapse development by ubiquitinating arc. Cell 140, 704-716 (2010). Kuhnle, S., Mothes, B., Matentzoglu, K. & Scheffner, M. Role of the ubiquitin ligase E6AP/UBE3A in controlling levels of the synaptic protein Arc. Proc Natl Acad Sci U SA 110, 8888-8893 (2013). Brais, B. et al. Short GCG expansions in the PABP2 gene cause oculopharyngeal muscular dystrophy. Nat Genet 18, 164-167 (1998). Calado, A., Kutay, U., Kuhn, U., Wahle, E. & Carmo-Fonseca, M. Deciphering the cellular pathway for transport of poly( A) -binding protein II. RNA 6, 245-256 (2000). Dauger, S. et al. Phox2b controls the development of peripheral chemoreceptors and afferent visceral pathways. Development 130, 6635-6642 (2003). Pattyn, A., Morin, X., Cremer, H., Goridis, C. & Brunet, J.F. The homeobox gene Phox2b is essential for the development of autonomic neural crest derivatives. Nature 399, 366- 370 (1999). Vanderlaan, M., Holbrook, C.R., Wang, M., Tuell, A. & Gozal, D. Epidemiologic survey of 196 patients with congenital central hypoventilation syndrome. Pediatr Pulmonol 37 ,
(2004). Trang, H. et al. Proceedings of the fourth international conference on central hypoventilation. Orphanet J Rare Dis 9, 194 (2014). Falik, D. et al. Generation and characterization of iPSC lines (BGUi004-A, BGUi005-A) from two identical twins with polyalanine expansion in the paired-like homeobox 2B (PHOX2B) gene. Stem Cell Res 48, 101955 (2020). Ashkenazi, A. et al. Polyglutamine tracts regulate beclin 1 -dependent autophagy. Nature 545, 108-111 (2017). Paulson, H.L., Shakkottai, V.G., Clark, H.B. & Orr, H.T. Polyglutamine spinocerebellar ataxias - from genes to potential treatments. Nat Rev Neurosci 18, 613-626 (2017). Dubreuil, V. et al. A human mutation in Phox2b causes lack of CO2 chemosensitivity, fatal central apnea, and specific loss of parafacial neurons. Proc Natl Acad Sci USA 105, 1067- 1072 (2008). Ramanantsoa, N. et al. Ventilatory response to hyperoxia in newborn mice heterozygous for the transcription factor Phox2b. Am J Physiol Regul Integr Comp Physiol 290, R1691- 1696 (2006). Basu, S. et al. Unblending of Transcriptional Condensates in Human Repeat Expansion Disease. Cell 181, 1062-1079 el030 (2020). Chen, Z. et al. Down-regulation of UBA6 exacerbates brain injury by inhibiting the activation of Notch signaling pathway to promote cerebral cell apoptosis in rat acute cerebral infarction model. Mol Cell Probes 53, 101612 (2020). Li, L., Ng, N.K., Koon, A.C. & Chan, H.Y. Expanded polyalanine tracts function as nuclear export signals and promote protein mislocalization via eEFlAl factor. J Biol Chem 292, 5784-5800 (2017). Shilling, P.J. et al. Improved designs for pET expression plasmids increase protein production yield in Escherichia coli. Commun Biol 3, 214 (2020). Keren-Kaplan, T. et al. Synthetic biology approach to reconstituting the ubiquitylation cascade in bacteria. EMBO J 31, 378-390 (2012). Kamitani, T., Kito, K., Nguyen, H.P. & Yeh, E.T. Characterization of NEDD8, a developmentally down-regulated ubiquitin- like protein. J Biol Chem Til, 28557-28562 (1997). Kao, W.H., Beaudenon, S.L., Talis, A.L., Huibregtse, J.M. & Howley, P.M. Human papillomavirus type 16 E6 induces self-ubiquitination of the E6AP ubiquitin- protein ligase. J Virol l , 6408-6417 (2000). Kirino, K., Nakahata, T., Taguchi, T. & Saito, M.K. Efficient derivation of sympathetic neurons from human pluripotent stem cells with a defined condition. Sci Rep 8, 12865 (2018). Kelley, L.A., Mezulis, S., Yates, C.M., Wass, M.N. & Sternberg, M.J. The Phyre2 web portal for protein modeling, prediction and analysis. Nat Protoc 10, 845-858 (2015). Jumper, J. et al. Highly accurate protein structure prediction with AlphaFold. Nature 596, 583-589 (2021). Baker, N.A., Sept, D., Joseph, S., Holst, M.J. & McCammon, J.A. Electrostatics of nanosystems: application to microtubules and the ribosome. Proc Natl Acad Sci U SA 98, 10037-10041 (2001). Schindelin, J. et al. Fiji: an open-source platform for biological-image analysis. Nat Methods 9, 676-682 (2012).

Claims

WHAT IS CLAIMED IS:
1. A method of treating a subject having a disease associated with a polyalanine expansion mutation, the method comprising administering to the subject a therapeutically effective amount of an agent capable of upregulating expression or activity of a ubiquitin like modifier activating enzyme 6 (UBA6) in nervous system cells of the subject, thereby treating the subject.
2. A therapeutically effective amount of an agent capable of upregulating expression or activity of a ubiquitin like modifier activating enzyme 6 (UBA6) in nervous system cells, for use in treating a disease associated with a polyalanine expansion mutation.
3. A method of treating a subject diagnosed with autism spectrum disorders (ASDs), the method comprising administering to the subject a therapeutically effective amount of an agent capable of upregulating expression or activity of a ubiquitin like modifier activating enzyme 6 (UBA6) in nervous system cells of the subject, thereby treating the subject.
4. A therapeutically effective amount of an agent capable of specifically upregulating expression or activity of a ubiquitin like modifier activating enzyme 6 (UBA6) in nervous system cells, for use in treating autism spectrum disorders (ASDs).
5. A method of increasing ubiquitination of an E6AP polypeptide in a cell, the method comprising contacting the cell with a therapeutically effective amount of an agent capable of specifically upregulating expression or activity of a ubiquitin like modifier activating enzyme 6 (UBA6) in the cell, thereby increasing the ubiquitination of the E6AP polypeptide in the cell.
6. A method of generating neurons with a polyalanine expansion mutation, the method comprising subjecting induced pluripotent stem cells (iPSCs) which comprise a genomic polyalanine expansion mutation to culture conditions suitable for differentiating said iPSCs into neurons, thereby generating the neurons with the Polyalanine expansion mutation.
7. A method of screening for an agent capable of specifically modulating expression or activity of a ubiquitin like modifier activating enzyme 6 (UBA6), the method comprising:
(a) contacting neurons comprising a genomic polyalanine expansion mutation with a plurality of molecules, (b) identifying at least one molecule of said plurality of molecules which modulates a complex formed by UBA6 and USE1, said at least one molecule being agent capable of specifically modulating expression or activity of the UBA6.
8. The method of claim 7, wherein said contacting is in the presence of a functional portion of said UBA6 comprising a second catalytic cysteine half (SCCH) domain.
9. The method of claim 7 or 8, wherein said identifying said at least one molecule of said plurality of molecules which modulates said complex formed by said UBA6 and USE1 is effected by monitoring ubiquitination level of a target polypeptide.
10. The method of claim 9, wherein said target polypeptide is E6AP.
11. The method of claim 5, wherein said contacting is effected in vivo.
12. The method of claim 5, wherein said contacting is effected ex vivo.
13. The method of claim 5, 11 or 12, wherein the cell is a nervous system cell.
14. The method of any one of claims 5 and 11-13, wherein the cell is of a subject diagnosed with a disease characterized by abnormally high levels of an E6AP polypeptide.
15. The method of claim 14, wherein the cell is of a subject diagnosed with autism spectrum disorders (ASDs).
16. The method of any one of claims 1, 7-10, or the agent of claim 2, wherein said polypeptide having said polyalanine expansion mutation has an aberrant cellular localization as compared to a corresponding wild-type polypeptide.
17. The method of any one of claims 1, 7-10 and 16, or the agent of any one of claims 2 and 16, wherein said polypeptide having said polyalanine expansion mutation is cytoplasmic.
18. The method of any one of claims 1, 7-10 and 16, or the agent of any one of claims 2 and 16, wherein said polyalanine expansion mutation occurs in a polypeptide selected from the group consisting of a paired like homeobox 2B (PHOX2B), aristaless related homeobox (ARX), SRY-box transcription factor 3 (SOX3), Zic family member 2 (ZIC2), forkhead box L2 (F0XL2), RUNX family transcription factor 2 (RUNX2), homeobox Al 3 (H0XA13), homeobox D13 (H0XD13), and poly(A) binding protein nuclear 1 (PABPN1).
19. The method of any one of claims 1, 7-10 and 16, or the agent of any one of claims 2 and 16, wherein said disease is selected from the group consisting of congenital central hypoventilation syndrome (CCHS), X-linked cognitive disability and epilepsy, X-linked cognitive disability with growth hormone deficiency, Holoprosencephaly type 5, Blepharophimosis syndrome, cleidocranial dysplasia (CCD), Hand-foot-genital syndrome, synpolydactyly, and oculopharyngeal muscular dystrophy (OPMD).
20. The method of any one of claims 1, and 16-19 when depending on claim 1, or the agent of any one of claims 2 and 16-19 when depending on claim 2, wherein said agent upregulates expression level of said UBA6.
21. The method or the agent of claim 20, wherein said agent is a polynucleotide encoding at least a functional portion of said UBA6 comprising a second catalytic cysteine half (SCCH) domain.
22. The method of claim 21, wherein said polynucleotide is an mRNA molecule.
23. The method of one of claims 21-22, wherein said polynucleotide is comprised in a nucleic acid construct suitable for in-vivo delivery into nervous system cells of the subject.
24. The method of any one of claims 1, and 16-23 when depending on claim 1, or the agent of any one of claims 2 and 16-23 when depending on claim 2, wherein said agent stabilizes formation of a protein complex between said UBA6 and USE1.
25. The method of any one of claims 1, and 16-23 when depending on claim 1, or the agent of any one of claims 2 and 16-23 when depending on claim 2, wherein said agent is a peptide of 5-10 alanine residues.
26. The method of any one of claims 8-10 and 21, wherein said SCCH domain of said UBA6 is set forth by SEQ ID NO: 25.
27. The method of any one of claims 7-10 and 16-26, wherein said neurons are peripheral autonomic neurons.
28. The method of any one of claims 7-10 and 16-27, wherein said modulating is upregulating said expression or activity of said UBA6 in a cell of a nervous system.
29. The method of any one of claims 7-10 and 16-27, wherein said modulating is downregulating said expression or activity of said UBA6 in a cell of a nervous system.
30. The method of any one of claims 7-10 and 16-29, further comprising synthesizing the identified agent.
31. The method of any one of claims 7-10, and 16-30, wherein said neurons are differentiated in vitro from induced pluripotent stem cells (iPSCs) comprising a genomic polyalanine expansion mutation.
32. The method of claim 6, wherein said subjecting said iPSCs to culture conditions suitable for differentiating the iPSCs into neurons comprises the steps of:
(a) culturing said iPSCs in a culture medium suitable for induction of iPSCs into neuromesodermal progenitor cells (NMPs);
(b) culturing said NMPs in a culture medium suitable for induction of sympathetic neural crest;
(c) culturing said sympathetic neural crest in a culture medium suitable for induction of sympathetic neuroblast crest; and
(d) culturing said sympathetic neuroblast crest in a culture medium which is suitable for maturation of sympathetic neurons.
33. The method of claim 32, wherein said culture medium suitable for induction of iPSCs into neuromesodermal progenitor cells (NMPs) comprises a glycogen synthase kinase 3 (GSK-3) inhibitor and an ALK5 (activin receptor-like kinase 5) inhibitor.
34. The method of claim 32, wherein said culture medium suitable for induction of said NMPs into sympathetic neural crest comprises basic fibroblast growth factor (bFGF), bone morphogenic protein 4 (BMP4) and retinoic acid (RA).
35. The method of claim 32, wherein said culture medium suitable for induction of sympathetic neuroblast crest comprises basic fibroblast growth factor (bFGF), bone morphogenic protein 4 (BMP4) and epidermal growth factor (EGF).
36. The method of claim 32, wherein said culture medium suitable for induction of sympathetic neuronal maturation comprises nerve growth factor (NFG), glial cell derived neurotrophic factor (GDNF) and brain derived neurotrophic factor (BDNF).
37. The method of any one of claims 6 and 32-36, further comprising detecting presence of differentiated neurons following step (d) using an immunological detection method.
38. The method of claim 37, wherein said immunological detection method is performed with an antibody which specifically binds to a marker selected from the group consisting of: Tuj la, MAP2ab, Peripherin, AT0H1, PH0X2B, dopamine beta-hydroxylase (DBH) and Tyrosine hydroxylase (TH).
PCT/IL2023/050474 2022-05-09 2023-05-09 Methods of treating diseases associated with polyalanine expansion mutations Ceased WO2023218453A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202263339562P 2022-05-09 2022-05-09
US63/339,562 2022-05-09

Publications (1)

Publication Number Publication Date
WO2023218453A1 true WO2023218453A1 (en) 2023-11-16

Family

ID=88729845

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IL2023/050474 Ceased WO2023218453A1 (en) 2022-05-09 2023-05-09 Methods of treating diseases associated with polyalanine expansion mutations

Country Status (1)

Country Link
WO (1) WO2023218453A1 (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008089329A2 (en) * 2007-01-18 2008-07-24 President And Fellows Of Harvard College Novel activation and transfer cascade for ubiquitin

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008089329A2 (en) * 2007-01-18 2008-07-24 President And Fellows Of Harvard College Novel activation and transfer cascade for ubiquitin

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
FALIK DANIEL; RABINSKI TATIANA; ZLOTNIK DOR; ESHEL REUT; ZORSKY MESHI; GARIN-SHKOLNIK TALI; OFIR RIVKA; ADATO AVITAL; ASHKENAZI AV: "Generation and characterization of iPSC lines (BGUi004-A, BGUi005-A) from two identical twins with polyalanine expansion in the paired-like homeobox 2B (PHOX2B) gene", STEM CELL RESEARCH, ELSEVIER, NL, vol. 48, 14 August 2020 (2020-08-14), NL , XP086293936, ISSN: 1873-5061, DOI: 10.1016/j.scr.2020.101955 *
LEE JI YEON; KWAK MINSEOK; LEE PETER C.W.: "Impairment of social behavior and communication in mice lacking the Uba6-dependent ubiquitin activation system", BEHAVIOURAL BRAIN RESEARCH., ELSEVIER, AMSTERDAM., NL, vol. 281, 15 December 2014 (2014-12-15), NL , pages 78 - 85, XP029133285, ISSN: 0166-4328, DOI: 10.1016/j.bbr.2014.12.019 *
LEONARDO D’AIUTO, YUN ZHI, DHANJIT KUMAR DAS, MADELEINE R WILCOX, JON W JOHNSON, LORA MCCLAIN, MATTHEW L MACDONALD, ROBERTO : "Large-scale generation of human iPSC-derived neural stem cells/early neural progenitor cells and their neuronal differentiation", ORGANOGENESIS, LANDES BIOSCIENCE,, US, vol. 10, no. 4, 2 October 2014 (2014-10-02), US , pages 365 - 377, XP055242556, ISSN: 1547-6278, DOI: 10.1080/15476278.2015.1011921 *
MATTISKE TESSA, LEE KRISTIE, GECZ JOZEF, FRIOCOURT GAELLE, SHOUBRIDGE CHERYL: "Embryonic forebrain transcriptome of mice with polyalanine expansion mutations in the ARX homeobox gene", HUMAN MOLECULAR GENETICS, OXFORD UNIVERSITY PRESS, GB, vol. 25, no. 24, 25 October 2016 (2016-10-25), GB , pages 5433 - 5443, XP093107404, ISSN: 0964-6906, DOI: 10.1093/hmg/ddw360 *
WANG FENGTING, ZHAO BO: "UBA6 and Its Bispecific Pathways for Ubiquitin and FAT10", INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES, MOLECULAR DIVERSITY PRESERVATION INTERNATIONAL (MDPI), BASEL, CH, vol. 20, no. 9, 7 May 2019 (2019-05-07), Basel, CH , pages 2250, XP093107399, ISSN: 1422-0067, DOI: 10.3390/ijms20092250 *

Similar Documents

Publication Publication Date Title
Mahul-Mellier et al. Alix, making a link between apoptosis-linked gene-2, the endosomal sorting complexes required for transport, and neuronal death in vivo
US20170014491A1 (en) Methods, compositions and screens for therapeutics for the treatment of synovial sarcoma
Ueda et al. Rac GEF Dock4 interacts with cortactin to regulate dendritic spine formation
JP2016008217A (en) Supercharged proteins for cell penetration
EP3655013B1 (en) Targeting synaptogyrin-3 in tauopathy treatment
US20200407726A1 (en) Methods and pharmaceutical compositions for treating tubulin carboxypeptidases associated diseases
Garcia-Montojo et al. TDP-43 proteinopathy in ALS is triggered by loss of ASRGL1 and associated with HML-2 expression
Amer-Sarsour et al. Disease-associated polyalanine expansion mutations impair UBA6-dependent ubiquitination
WO2020136240A1 (en) Polyphenol-peptide conjugates for nuclear-targeted delivery
EP3890771B1 (en) Method of reducing neuronal microtubule binding protein tau (tau) levels
CN103191412B (en) PA200 and acetylation mediate core histones to degrade by proteasome
CN113209303B (en) WWP1 degradation oncoprotein MUC1 inhibition tumor through lysosome approach and application thereof
EP2758077B1 (en) Compounds for use in the treatment of alzheimer&#39;s disease
EP3647426A1 (en) Fusion protein
Wei et al. DRAM1 deficiency affects the organization and function of the Golgi apparatus
CN119816598A (en) Modified fusion proteins and nucleic acid constructs
US12403184B2 (en) Compositions and methods for treating neurodegenerative disroders
Leguay et al. Interactome of FMRP-N-tat therapeutic unveils key interactions for cellular function in Fragile X neurons
Mooradally et al. Phosphorylation-dependent control of Arc protein by synaptic plasticity regulator TNIK
US20240238385A1 (en) Isolated or artificial nucleotide sequences for use in neurodegenerative diseases
Seddighi Characterization of TDP-43-related de novo proteins in ALS/FTD
WO2023130592A1 (en) Chaperones as an autophagy receptors for clearances of protein aggregates and/or aggregation-prone proteins
WO2019116376A1 (en) Cop9 signalosome (csn) complex modulators and uses thereof
Amer-Sarsour et al. Polyalanine disease mutations impair UBA6-dependent ubiquitination
Giuliano et al. Glucocerebrosidase is imported into mito-chondria and preserves complex I integrity and energy metabolism

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23803164

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 23803164

Country of ref document: EP

Kind code of ref document: A1