WO2023203988A1

WO2023203988A1 - Plant with improved deep-rootedness

Info

Publication number: WO2023203988A1
Application number: PCT/JP2023/013277
Authority: WO
Inventors: 優作宇賀; 和彦杉本; 悠花桂田; 凌黒田
Original assignee: 国立研究開発法人農業・食品産業技術総合研究機構
Priority date: 2022-04-19
Filing date: 2023-03-30
Publication date: 2023-10-26

Abstract

The problem addressed by the present invention is to provide technology for improving the deep-rootedness of a plant. The present invention provides a plant with improved deep-rootedness which has a gene encoding a mutant qSOR1 protein including an amino acid substitution that improves deep-rootedness.

Description

Plants with improved deep roots

The present invention relates to a plant with improved deep rooting ability that has a gene encoding a mutant qSOR1 protein.

Currently, the world's population is increasing, mainly in developing countries, and it is essential to increase food production to feed this population. On the other hand, with recent global climate changes, extreme rainfall events such as droughts and heavy rains are occurring in many parts of the world. Furthermore, soil deterioration and salt accumulation due to years of over-cultivation have also become problems. In order to achieve stable and sustainable food production in such an unstable environment, it is necessary to develop crops that are resistant to environmental stress.

Roots are the only organ for plants to acquire and absorb nutrients and water from the soil, so root system morphology is extremely important for crop growth, but the root system morphology suitable for crop production differs depending on the soil environment. For example, the property that roots grow deeply (deep roots) is advantageous for drought tolerance, nitrogen absorption, avoidance of heavy metals, etc., while the property that roots grow shallowly (shallow roots) is resistant to phosphorus deficiency and oxygen deficiency in flooded conditions. It is advantageous for avoidance, phytoremediation of heavy metals, etc. Therefore, improving root system morphology to suit the soil environment is important for developing crops that are resistant to environmental stress.

Cross breeding is commonly used as a method for developing crops. However, cross breeding requires phenotypic selection, and when evaluating the morphology of the root system in the soil, it is usually necessary to dig up and investigate the roots, and root sampling requires a great deal of time and effort. In the case of grains, roots cannot be investigated until after the above-ground parts have been harvested, so there has been little progress in improving crop roots through cross-breeding.

On the other hand, in the model plant Arabidopsis thaliana, many genes involved in root morphogenesis and those involved in root morphogenesis under environmental stress have been identified through the analysis of mutants, and the mechanism of controlling root morphology has been elucidated. is progressing. For example, regarding tropism, which greatly affects root system morphology, a plurality of gravitropism genes (Non-Patent Document 1) and hydrotropism genes (Non-Patent Document 2) have been identified. Furthermore, in monocotyledonous plants including rice and maize, many genes involved in roots have been identified through mutant analysis. For example, in rice, DEFECTIVE IN OUTER CELL LAYER SPECIFICATION 1 (DOCS1) and OsPIN2 Mutants of LARGE ROOT ANGLE1, which encodes ANGLE1, develop shallow roots (Non-Patent Documents 3 and 4), and mutants of Rice Morphology Determinant (RMD), which encodes an actin-binding protein, develop shallow roots under low phosphate conditions. It has been reported that the roots become deep at the bottom (Non-patent Document 5). However, mutants often have abnormalities in morphology and physiological function compared to the original variety (wild type), and many of the genes identified from mutants are difficult to use directly as breeding materials. .

Under these circumstances, in recent years, quantitative trait locus (QTL) analysis using rice has revealed that the DRO1 (DEEPER ROOTING 1) gene and its homologous genes are QTL involved in root elongation angle. The qSOR1 (quantitative trait locus for SOIL SURFACE ROOTING 1) gene was isolated, and it was reported that these genes are involved in gravitropism (Patent Document 1, Non-Patent Documents 6 and 7).

It is known that homologous genes of the rice DRO1 gene and the rice qSOR1 gene exist widely in angiosperms and form a large gene group called the DRO1 family (Non-Patent Document 7). Furthermore, it is known that DRO1 family proteins have five domains that are highly conserved among plants (Non-patent Document 8), and research using Arabidopsis and rice revealed that the fifth domain (CCL domain) is known to be involved in the function of gravitropism (Non-patent Documents 6, 7, and 9).

Patent No. 5791049

Since the qSOR1 gene is widely present in both monocots and dicots, useful alleles of the qSOR1 gene are found not only in monocot crops such as wheat and maize, but also in the root systems of dicot crops such as soybean and rapeseed. It is thought that it can be widely used for improvements.
However, the number of qSOR1 gene alleles useful as breeding material is limited, and at present, technology for improving deep rooting ability of plants has not been sufficiently developed.

The present inventors searched for lines with non-synonymous substitutions in the qSOR1 gene from rice mutant lines into which random mutations were introduced, and examined the root phenotypes of the obtained mutant lines. As a result, surprisingly, deep rooting was found in the mutant line containing the gene encoding the mutant qSOR1 protein containing an amino acid substitution in the third domain (domain III), the function of which was unknown until now. It was found that it was improved compared to When these mutant lines were backcrossed to the original variety and the root morphology of the resulting lines was examined, it was proven that the improvement in deep rooting ability was due to the above amino acid substitution that occurred in the qSOR1 protein. Furthermore, we investigated the morphology of the roots of Arabidopsis transformants expressing Arabidopsis LZY3 protein (corresponding to rice qSOR1 protein, sometimes referred to as "qSOR1 protein" in this specification), which has similar amino acid substitutions. It was found that his perseverance was significantly improved.

The present inventors have completed the present invention based on the above findings. That is, the present invention includes the following.
[1] A deep-rooted protein that has a gene encoding a mutant qSOR1 (quantitative trait locus for SOIL SURFACE ROOTING 1) protein that contains an amino acid substitution in the sequence corresponding to positions 140 to 145 of the amino acid sequence shown in SEQ ID NO: 2. Plants with improved
[2] The amino acid substitution is an amino acid selected from the group consisting of proline at the position corresponding to the 140th position of the amino acid sequence shown in SEQ ID NO: 2 and leucine at the position corresponding to the 141st position of the amino acid sequence shown in SEQ ID NO: 2. The plant according to [1], which is a substitution.
[3] The amino acid substitution is a substitution of proline at the position corresponding to the 140th position of the amino acid sequence shown in SEQ ID NO: 2 to serine, or a substitution of leucine to phenylalanine at the position corresponding to the 141st position of the amino acid sequence shown in SEQ ID NO: 2. The plant according to [1] or [2], which is a substitution of.
[4] The mutant qSOR1 protein is
(i) A protein consisting of the amino acid sequence shown in SEQ ID NO: 4, 6, 14 or 16,
(ii) An amino acid that has 90% or more sequence identity with the amino acid sequence shown in SEQ ID NO: 2 or 12 and contains an amino acid substitution in the sequence corresponding to positions 140 to 145 of the amino acid sequence shown in SEQ ID NO: 2. a protein consisting of a sequence and exhibiting an activity of improving deep rooting of plants, or
(iii) Has an insertion, deletion, substitution, and/or addition of 1 to 10 amino acids in the amino acid sequence shown in SEQ ID NO: 2 or 12, and corresponds to positions 140 to 145 of the amino acid sequence shown in SEQ ID NO: 2. The plant according to any one of [1] to [3], which is a protein consisting of an amino acid sequence containing an amino acid substitution in the sequence at a position and exhibiting an activity of improving deep rooting of plants.
[5] The gene encoding the mutant qSOR1 protein,
(iv) the base sequence shown in SEQ ID NO: 3, 5, 13 or 15,
(v) A nucleotide mutation that has 90% or more sequence identity with the nucleotide sequence shown in SEQ ID NO: 1 or 11 and causes an amino acid substitution in the sequence corresponding to positions 140 to 145 of the amino acid sequence shown in SEQ ID NO: 2. a base sequence that encodes a protein that contains and exhibits an activity of improving deep rooting of plants, or
(vi) Has an insertion, deletion, substitution, and/or addition of 1 to 10 bases in the base sequence shown in SEQ ID NO: 1 or 11, and is in the 140th to 145th sequence of the amino acid sequence shown in SEQ ID NO: 2. a nucleotide sequence that contains a nucleotide mutation that causes an amino acid substitution and that encodes a protein that exhibits an activity to improve deep rooting ability of plants;
The plant according to any one of [1] to [4], comprising:
[6] The plant according to any one of [1] to [5], which is a monocot or a dicot.
[7] A step of introducing into the plant qSOR1 (quantitative trait locus for SOIL SURFACE ROOTING 1) gene a nucleotide mutation that causes an amino acid substitution in the sequence corresponding to positions 140 to 145 of the amino acid sequence shown in SEQ ID NO: 2. A method for producing plants with improved deep rooting.
[8] Plant a vector containing a gene encoding a mutant qSOR1 (quantitative trait locus for SOIL SURFACE ROOTING 1) protein containing an amino acid substitution in the sequence corresponding to positions 140 to 145 of the amino acid sequence shown in SEQ ID NO: 2. A method for producing plants with improved deep rooting, including the step of introducing the plant into a plant.
[9] A step of cross-breeding plants using the plants according to any one of [1] to [6] as breeding parents to obtain progeny plants, and a step in which the gene encoding the mutant qSOR1 protein is introduced. A method for producing plants with improved deep rooting, including a step of selecting descendant plants.
[10] Nucleic acid amplification of the whole or part of the qSOR1 gene using DNA from the test plant as a template, based on the results of the nucleic acid amplification, the position corresponding to positions 140 to 145 of the amino acid sequence shown in SEQ ID NO: 2. A method for selecting plants with improved deep rooting ability, the method comprising the step of identifying a plant having a gene encoding a mutant qSOR1 protein containing an amino acid substitution in the sequence.
This specification includes the disclosure content of Japanese Patent Application No. 2022-068983, which is the basis of the priority of this application.

According to the present invention, it is possible to provide a plant with improved deep rooting ability and a method for producing the same.

Figure 1A shows the qSOR1 proteins of monocotyledonous plants (rice qSOR1 protein, maize qSOR1 (ZmqSOR1) protein, sorghum qSOR1 (SbqSOR1) protein, wheat qSOR1 (TaqSOR1) protein, Minato chinensis qSOR1 (BdqSOR1) protein) and dicot. Amino acid sequence of qSOR1 protein (Arabidopsis LZY3 (AtLZY3) protein, soybean NGR2 (GmNGR2) protein, Lotus japonicum NGR (LjNGR) protein, Alfalfa NGR (MtNGR) protein, poplar NGR (PtNGR) protein, peach NGR (PpeNGR) protein) FIG. 3 is a diagram showing the results of comparison. Five domains (domains I to V) that are highly conserved among multiple plant species are each indicated by a square. This is a continuation of FIG. 1A. FIG. 2 is a diagram showing the amino acid sequence of Koshihikari qSOR1 protein. FIG. 3 is a diagram showing the locations of mutations in the qSOR1 protein amino acid sequences of four rice qSOR1 mutant lines from the original variety. FIG. 4 is a diagram showing the mutation locations of the qSOR1 gene CDS of four rice qSOR1 mutant lines from the original variety. FIG. 5 is a diagram showing the results of comparing the amino acid sequences of rice qSOR1 protein, Arabidopsis LZY2 protein, Arabidopsis LZY3 protein, and Medicago NGR protein. Five domains (domains I to V) that are highly conserved among multiple plant species are each indicated by a square. FIG. 6 is a diagram showing the root phenotypes of the original variety (Koshihikari) and the rice qSOR1 mutant line evaluated by the cup method. A is a representative photograph showing the roots of each line grown by the cup method. Scale bar indicates 1 cm. θrga indicates the root elongation angle. B is a graph showing the root elongation angle of each line grown by the cup method. Data are expressed as mean ± standard deviation. * (asterisk) indicates that there is a significant difference at the 0.1% level by Dunnett's test using the original variety (Koshihikari) as the control group. FIG. 7 is a diagram showing the root phenotypes of the original variety (Koshihikari) and the rice qSOR1 mutant line evaluated by the basket method. A is a representative photograph showing the roots of each line grown by the basket method. Scale bar indicates 1 cm. B is a graph showing the deep root rate of each line cultivated by the basket method. Data are expressed as mean ± standard deviation. * indicates a significant difference at the 0.1% level by Dunnett's test using the original variety (Koshihikari) as the control group. FIG. 8 is a diagram showing root bending angles of the original variety (Koshihikari) and the rice qSOR1 mutant line. A is a representative photograph showing the gravitropic response of each strain 4 hours after the square plate was rotated 90°. Scale bar indicates 5 mm. θrac indicates the root bending angle. g indicates the direction of gravity. B is a graph showing the root bending angle of each line. Data are expressed as mean ± standard deviation. * indicates that there is a significant difference at the 0.1% level compared to the original variety (Koshihikari) by Student's t-test. n indicates the number of individuals measured. FIG. 9 is a diagram showing a comparison of the yields of the original variety (Koshihikari) and the rice qSOR1 mutant line (strain name 2792M). Data are shown as the average of three replicates of the dry weight of chaff (total of 24 plants in one plot)±standard deviation. FIG. 10 is a diagram showing the amino acid sequence of Arabidopsis LZY3 protein. FIG. 11 is a diagram showing the locations of mutations from the wild type in the amino acid sequence of Arabidopsis LZY3 mutant proteins (dLZY3(P130S), dLZY3(L131F)). FIG. 12 is a diagram showing the locations of mutations from the wild type in the base sequence encoding Arabidopsis LZY3 mutant proteins (dLZY3(P130S), dLZY3(L131F)). FIG. 13 is a photograph showing the root phenotype of Arabidopsis wild type, lzy2 single mutant, lzy2lzy3 double mutant, dLZY3(P130S)/lzy2lzy3 mutant, and dLZY3(L131F)/lzy2lzy3 mutant. The root phenotype on day 14 after sowing for the wild type, lzy2 single mutant, and lzy2lzy3 double mutant, and 19 days after sowing for the dLZY3(P130S)/lzy2lzy3 mutant and dLZY3(L131F)/lzy2lzy3 mutant. Showing the root phenotype on day one. Scale bar indicates 5 mm. g indicates the direction of gravity.

Hereinafter, the present invention will be explained in detail.

(1) Plants with improved deep rooting ability The present invention provides a deep rooting plant with a gene encoding a mutant qSOR1 (quantitative trait locus for SOIL SURFACE ROOTING 1) protein (mutant qSOR1 gene) containing an amino acid substitution that improves deep rooting ability. The present invention relates to a plant with improved root strength (also referred to as "plant of the present invention").

As used herein, "deep rooting" refers to the property of roots extending in the direction of gravity (typically underground) at a deep angle with respect to the horizontal plane (typically the ground surface). Deep rootability can be evaluated using, for example, root elongation angle, deep root ratio, or degree of gravitropic response of roots as an index. As used herein, the term "root extension angle" refers to the angle at which roots extend toward the direction of gravity with respect to the horizontal plane. As used herein, "deep root ratio" means the ratio of the number of deep roots to the total number of roots. As used herein, "deep root" refers to a certain angle (e.g., an appropriate angle within the range of 20 degrees to 70 degrees, such as 20 degrees, 30 degrees, 40 degrees, 50 degrees, 60 degrees, or 70 degrees) with respect to the horizontal plane. ) means a root extending in the direction of gravity at an angle greater than As used herein, "gravitropic response" means that plants sense the direction of gravity and change the growth direction of roots to the direction of gravity, and change the growth direction of above-ground parts to the direction opposite to gravity. do.

As used herein, "deep rootability is improved" means that the deep rootability is improved compared to the original variety or original line of the plant (for example, a wild type plant). "Deep rooting has improved" means that the root elongation angle has increased (for example, the average value of the root elongation angle has increased by 10 degrees or more, or the root elongation angle has increased statistically significantly). ), the deep root ratio has increased (e.g., the average value of the deep root ratio has increased by 10% or more, or the deep root ratio has increased statistically significantly), and Included is an enhanced gravitropic response of the roots. As used herein, "original variety" and "original line" refer to the variety and line from which the plant of the present invention is derived. For example, if the mutant qSOR1 gene possessed by the plant of the present invention is one in which a nucleotide mutation that improves deep rooting has been introduced into the qSOR1 gene on the genome, it is considered to be the "original variety" or "original strain". ” may mean a variety or line before the above-mentioned nucleotide mutation that improves deep rooting is generated or introduced. When the mutant qSOR1 gene possessed by the plant of the present invention is a foreign gene, the "original variety" and "original line" may mean the variety or line before the mutant qSOR1 gene is introduced.

Whether or not a test plant (for example, a plant of the present invention) has improved deep rooting can be determined using, for example, the cup method (Uga Y. et al., Theoretical and Applied Genetics, 2012, 124: 75-86). This can be determined by evaluating the root elongation angle. Specifically, for example, seeds of the test plant and its original variety or line are sown in a cup-shaped container filled with soil, and cultivated for a predetermined period (for example, 3 weeks). Thereafter, the plant is removed from the cup, the roots are washed, and the root elongation angle of each root is measured using a protractor or the like. If the root elongation angle of the test plant is increased as described above compared to its original variety or original line, it can be determined that the test plant has improved deep rooting ability.

Whether or not the deep rooting ability of the test plants has improved can also be determined by evaluating the deep rooting ratio using the basket method (Patent No. 5791049; Kitomi Y. et al., Rice, 2015, 8: 16). Can be judged. Specifically, for example, seeds of the test plant and its original variety or strain are sown in a stainless steel mesh colander filled with soil, and cultivated in a hydroponic solution for a predetermined period of time (for example, about 1.5 months). . After that, the number of deep roots and the total number of roots are measured, and the deep root ratio is calculated. If the deep root rate of the test plant is increased as described above compared to its original variety or original line, it can be determined that the test plant has improved deep root ability.

Whether or not the deep rooting ability of the test plant has improved can also be determined by evaluating the gravitropic response of the roots. Specifically, for example, seeds of germinated test plants and their original varieties or original lines are sown on a plate containing agarose gel, and kept at a predetermined temperature for several days (for example, 2 days) with the sides of the plate facing down. Grow under dark conditions. Then, rotate the plate 90 degrees vertically, and measure the root bending angle (the angle between the direction of root elongation before bending and the direction of root elongation after bending) after several hours (for example, 4 hours). . The root flexion angle of the test plant is increased compared to its original variety or line (for example, the average value of the root flexion angle is increased by 5 degrees or more, preferably 10 degrees or more, or the root flexion angle is statistically (significantly increased), it can be determined that the test plant has enhanced root gravitropism response and has improved deep rooting ability.

In plants, roots first differentiate as radicles during embryonic development, and the radicles develop to become primary roots. In dicotyledonous plants, the primary root develops to become a taproot, from which lateral roots arise, forming a root system called the taproot system. On the other hand, in monocotyledonous plants, primary roots do not develop much, and many nodal roots arise from the nodes of the stem, forming a root system called a bearded root (mainly consisting of seed roots and nodal roots). The radicle and the roots derived from it are called fixed roots (seed roots), and the roots produced from parts other than the radicle (such as stems) are called adventitious roots. Adventitious roots that grow from the stems of rice, corn, etc. are called crown roots. In the present invention, the "root" may be any type of root, including, but not limited to, the above-mentioned fixed roots, adventitious roots, dicot roots (e.g., tap roots and lateral roots), monocot roots ( Examples include seed roots and nodal roots), crown roots, and the like.

In general, it is known that the deeper the roots, the better the drought tolerance. For example, compared to shallow-rooted paddy rice IR64, a quasi-isogenic line (Dro1-NIL) on the IR64 background into which the DRO1 gene derived from deep-rooted upland rice Kinandang Patong has been introduced has improved deep rooting, and IR64 and Dro1-NIL have improved deep rooting ability. It has been reported that the yield was significantly higher with Dro1-NIL than with IR64 when grown under the following conditions (Patent No. 5791049; Uga Y. et al., Nature Genetics, 2013, 45(9): 1097-1102 ).

Therefore, the plant of the present invention, which has improved deep rooting compared to the original variety or line, has higher drought tolerance than the original variety or line, and is particularly useful for cultivation under drought conditions. Conceivable.

As used herein, the term "mutant qSOR1 protein" refers to a protein that has an amino acid mutation (for example, an amino acid substitution that improves deep rootability) that alters protein function in the amino acid sequence of the wild-type qSOR1 protein. As used herein, "wild-type qSOR1 protein" means a qSOR1 protein that does not have the above-mentioned amino acid substitution that improves deep rooting ability. As used herein, "amino acid mutation" includes insertions, deletions, substitutions, additions, and the like.

As used herein, "qSOR1 protein" means a protein encoded by the qSOR1 gene. qSOR1 protein is a protein involved in gravitropism, especially root gravitropism, and corresponds to positions 1 to 12, 58 to 64, 140 to 145, and 224 to 241 of the amino acid sequence shown in SEQ ID NO: 2. It has highly conserved sequences (domains IV, respectively) at the same positions. The qSOR1 protein has the amino acid sequence PLDRFL in domain III in the wild type. Examples of the qSOR1 protein include, but are not limited to, rice qSOR1, maize qSOR1 (ZmqSOR1) protein, sorghum qSOR1 (SbqSOR1) protein, wheat qSOR1 (TaqSOR1) protein, Minato chinensis qSOR1 (BdqSOR1) protein, Arabidopsis LZY2 (AtLZY2) protein, These include Arabidopsis LZY3 (AtLZY3) protein, soybean NGR2 (GmNGR2) protein, Lotus japonicus NGR (LjNGR) protein, Alfalfa NGR (MtNGR) protein, poplar NGR (PtNGR) protein, and peach NGR (PpeNGR) protein (Figures 1 and Figure 5).

As used herein, the "qSOR1 gene" (gene encoding the qSOR1 protein) includes the rice qSOR1 gene (also referred to as the DRL1 gene or OsNGR2 gene) and its homologous genes. Homologues of the rice qSOR1 gene can be found in a wide range of plant species, including sorghum, maize, barley, wheat, monocots such as Albatross, Arabidopsis, Alfalfa, cucumber, lotus, tomato, poplar, soybean, Lotus japonicus, It is present in dicotyledonous plants such as peaches. Homologous genes of rice qSOR1 gene include, but are not limited to, sorghum qSOR1 gene (SbqSOR1; SORBI_3002G373700), maize qSOR1 gene (ZmqSOR1; Zm00001d022133), barley qSOR1 gene (HvqSOR1), wheat qSOR1 gene (TaAqSOR1, TaBqS OR1, TaDqSOR1) , qSOR1 genes such as B. thaliana qSOR1 gene (BdqSOR1), LZY genes such as Arabidopsis LZY2 gene (AtLZY2), Arabidopsis LZY3 gene (AtLZY3), Arabidopsis LZY4 gene (AtLZY4), Alfalfa NGR (NEGATIVE GRAVITROPIC RESPONSE OF RO) OTS) gene (MtNGR ) NGR genes such as soybean NGR2 (GmNGR2), Lotus japonicum NGR (LjNGR), poplar NGR (PtNGR), and peach NGR (PpeNGR), DRL1 gene, etc. are included.

The rice qSOR1 (quantitative trait locus for SOIL SURFACE ROOTING 1) gene is present in paddy rice Gemdjah Beton, which forms surface roots (a phenotype in which some crown roots become shallow and extend to the soil surface), and paddy rice Sasanishiki, which does not form surface roots. Through QTL analysis using a hybrid population, it was discovered on rice chromosome 7 as a QTL involved in root elongation angle (Uga Y. et al., Theoretical and Applied Genetics, 2012, 124: 75-86). It has been reported that rice qSOR1 protein is involved in gravitropism and controls root elongation angle. The amino acid sequence of the natural rice (Koshihikari) qSOR1 protein is shown in SEQ ID NO: 2, for example. Furthermore, a CDS encoding the natural rice (Koshihikari) qSOR1 protein is shown in SEQ ID NO: 1, for example.

It has been reported that Arabidopsis LZY4 protein is involved only in root gravitropism, and LZY2 and LZY3 proteins are involved in both shoot and root gravitropism (Taniguchi M. et al., The Plant Cell, 2017 , 29: 1984-1999). The amino acid sequences of the natural Arabidopsis LZY2 protein and LZY3 protein are shown, for example, in SEQ ID NOs: 17 and 12, respectively. Furthermore, the CDS encoding the natural Arabidopsis LZY3 protein is shown in SEQ ID NO: 11, for example.

It has been reported that Alfalfa NGR protein is also involved in root gravitropism (Ge L. and Chen R., Nature Plants, 2016, 2(11): 16155). The amino acid sequence of the natural Alfalfa NGR protein is shown, for example, in SEQ ID NO: 18.

In addition, natural maize qSOR1 (ZmqSOR1), sorghum qSOR1 (SbqSOR1), wheat qSOR1 (TaqSOR1), Minato chinensis qSOR1 (BdqSOR1), soybean NGR2 (GmNGR2), Lotus japonica NGR (LjNGR), poplar NGR (PtNGR), peach NGR ( The amino acid sequences of PpeNGR) are shown, for example, in SEQ ID NOs: 24 to 31, respectively.

Figures 1A and B show rice qSOR1 protein (SEQ ID NO: 2), maize qSOR1 (ZmqSOR1) protein (SEQ ID NO: 24), sorghum qSOR1 (SbqSOR1) protein (SEQ ID NO: 25), and wheat qSOR1 (TaqSOR1) protein (SEQ ID NO: 26). , Minato thaliana qSOR1 (BdqSOR1) protein (SEQ ID NO: 27), Arabidopsis LZY3 (AtLZY3) protein (SEQ ID NO: 12), soybean NGR2 (GmNGR2) protein (SEQ ID NO: 28), Lotus japonicum NGR (LjNGR) protein (SEQ ID NO: 29), The results of comparing the amino acid sequences of alfalfa NGR (MtNGR) protein (SEQ ID NO: 18), poplar NGR (PtNGR) protein (SEQ ID NO: 30), and peach NGR (PpeNGR) protein (SEQ ID NO: 31) are shown. FIG. 5 shows the results of comparing the amino acid sequences of rice qSOR1 protein (SEQ ID NO: 2), Arabidopsis LZY2 protein (SEQ ID NO: 17), Arabidopsis LZY3 protein (SEQ ID NO: 12), and Alfalfa NGR protein (SEQ ID NO: 18). As shown in Figures 1 and 5, the amino acid sequences of these qSOR1 proteins, especially the amino acid sequences of domains IV, have very high similarity. In particular, these qSOR1 proteins all have the amino acid sequence PLDRFL in domain III. Domain III is the 140th to 145th amino acid sequence shown in SEQ ID NO: 2, the 130th to 135th amino acid sequence shown in SEQ ID NO: 12, the 128th to 133rd amino acid sequence shown in SEQ ID NO: 17, and the amino acid sequence shown in SEQ ID NO: 18. 109th to 114th of the amino acid sequence shown in SEQ ID NO: 24, 127th to 132nd of the amino acid sequence shown in SEQ ID NO: 24, 131st to 136th of the amino acid sequence shown in SEQ ID NO: 25, 121st to 126th of the amino acid sequence shown in SEQ ID NO: 26, shown in SEQ ID NO: 27 122nd to 127th amino acid sequence, 111th to 116th amino acid sequence shown in SEQ ID NO: 28, 105th to 110th amino acid sequence shown in SEQ ID NO: 29, 112nd to 117th amino acid sequence shown in SEQ ID NO: 30, SEQ ID NO: 31 It is present at positions 110 to 115 of the amino acid sequence shown in .

As used herein, "gene" includes protein coding sequences (CDS). A gene may include an untranslated region (UTR), an exon and an intron, a promoter, an enhancer, an insulator, a terminator, and/or a polyA sequence, etc., depending on the case. A gene includes not only a double-stranded nucleic acid but also its constituent single strands such as the positive strand (sense strand) or complementary strand (antisense strand), and unless otherwise specified, it includes genomic DNA, DNA, Includes RNA, mRNA, cDNA, etc. A gene can be, for example, a polynucleotide encoding a protein. As used herein, "polynucleotide" includes both DNA and RNA, and in the case of DNA, it may be single-stranded or double-stranded.

In the present invention, examples of amino acid substitutions that improve deep-rootedness contained in the mutant qSOR1 protein include amino acid substitutions in the sequence corresponding to positions 140 to 145 of the amino acid sequence shown in SEQ ID NO: 2. As used herein, "amino acid substitution in the sequence corresponding to positions 140 to 145 of the amino acid sequence shown in SEQ ID NO: 2" refers to the sequence corresponding to positions 140 to 145 of the amino acid sequence shown in SEQ ID NO: 2. refers to the substitution of at least one amino acid (eg, 1, 2, 3, 4, 5, or 6 amino acids) in.

The above amino acid substitutions may be conservative amino acid substitutions or non-conservative amino acid substitutions. The above amino acid substitutions include, for example, proline at the position corresponding to the 140th position of the amino acid sequence shown in SEQ ID NO: 2, leucine at the position corresponding to the 141st position of the amino acid sequence shown in SEQ ID NO: 2, and leucine at the position corresponding to the 141st position of the amino acid sequence shown in SEQ ID NO: 2. Aspartic acid at the position corresponding to the 142nd position, arginine at the position corresponding to the 143rd position in the amino acid sequence shown in SEQ ID NO: 2, phenylalanine at the position corresponding to the 144th position in the amino acid sequence shown in SEQ ID NO: 2, and as shown in SEQ ID NO: 2. It may be a substitution of an amino acid selected from the group consisting of leucine at a position corresponding to position 145 of the amino acid sequence (for example, a non-conservative amino acid substitution). Examples of substitutions for proline at position 140 include polar uncharged amino acids (serine, threonine, glutamine, asparagine, or cysteine), aromatic amino acids (phenylalanine, tyrosine, or tryptophan), and acidic amino acids (glutamic acid or aspartic acid). , or a basic amino acid (lysine, arginine, or histidine), preferably substitution with serine, threonine, glutamine, asparagine, or cysteine, more preferably substitution with serine or threonine, most preferably substitution with serine, threonine, glutamine, asparagine, or cysteine. Preferred is substitution with serine. Substitutions for leucine at position 141 include, for example, polar uncharged amino acids (serine, threonine, glutamine, asparagine, or cysteine), aromatic amino acids (phenylalanine, tyrosine, or tryptophan), and acidic amino acids (glutamic acid or aspartic acid). or a basic amino acid (lysine, arginine, or histidine), preferably substitution with phenylalanine or tryptophan, more preferably substitution with phenylalanine.

As used herein, "the position corresponding to the 140th position of the amino acid sequence shown in SEQ ID NO: 2" means any amino acid sequence (amino acid sequence of any qSOR1 protein) aligned with the amino acid sequence shown in SEQ ID NO: 2. refers to the position of the amino acid aligned with proline located at position 140 of the amino acid sequence shown in SEQ ID NO:2. In addition, similar expressions such as "the position corresponding to the "x"th position of the amino acid sequence shown in SEQ ID NO: 2" and "the position corresponding to the 140th to 145th positions of the amino acid sequence shown in SEQ ID NO: 2" are also interpreted in the same way. .
In one embodiment, the present invention provides a plant with improved deep rooting ability that expresses a mutant qSOR1 protein comprising the above-described amino acid substitutions that improve deep rooting ability.

In the present invention, a gene encoding a mutant qSOR1 protein (mutant qSOR1 gene) is one in which a nucleotide mutation that improves deep rootability has occurred in the endogenous qSOR1 gene in the genome, or has been introduced (for example, artificially) into the endogenous qSOR1 gene. It may be something like that. As used herein, "a nucleotide mutation that improves deep rootability" refers to a nucleotide mutation that causes an amino acid substitution that improves deep rootability. As used herein, the term "nucleotide mutation" contained in the qSOR1 gene refers to a mutation in the base sequence of the wild-type qSOR1 gene, and includes nucleotide insertions, deletions, substitutions, additions, and the like.

In the present invention, the mutant qSOR1 gene may also be a foreign gene. As used herein, the term "exogenous" gene refers to a gene that is artificially introduced into a host plant through genetic manipulation such as transformation.

The amino acid sequence of the mutant qSOR1 protein shown in SEQ ID NO: 4 is an amino acid sequence in which proline at position 140 of the amino acid sequence shown in SEQ ID NO: 2 (the amino acid sequence of the original qSOR1 protein) is replaced with serine. The amino acid sequence of the mutant qSOR1 protein shown in SEQ ID NO: 6 is the amino acid sequence in which leucine at position 141 of the amino acid sequence shown in SEQ ID NO: 2 is replaced with phenylalanine. The amino acid sequence of the mutant LZY3 protein shown in SEQ ID NO: 14 is such that proline at position 130 (corresponding to position 140 of the amino acid sequence shown in SEQ ID NO: 2) of the amino acid sequence of SEQ ID NO: 12 (the amino acid sequence of wild-type LZY3 protein) is This is an amino acid sequence substituted with serine. The amino acid sequence of the mutant LZY3 protein shown in SEQ ID NO: 16 is an amino acid sequence in which leucine at position 131 in the amino acid sequence shown in SEQ ID NO: 12 (corresponding to position 141 in the amino acid sequence shown in SEQ ID NO: 2) is replaced with phenylalanine.

In the present invention, the mutant qSOR1 protein may be, for example, a protein consisting of the amino acid sequence shown in SEQ ID NO: 4, 6, 14, or 16. The mutant qSOR1 protein also has at least 40%, at least 60%, at least 70%, at least 80%, at least 90% of the amino acid sequence shown in any one of SEQ ID NOs: 2, 12, 17, 18, and 24-31. , a sequence having sequence identity of 95% or more, 96% or more, 97% or more, 98% or more, 99%, or 99.5% or more and corresponding to positions 140 to 145 of the amino acid sequence shown in SEQ ID NO: 2. It may also be a protein that consists of an amino acid sequence that includes amino acid substitutions and that exhibits an activity for improving deep rooting of plants. The mutant qSOR1 protein also has 1 to 50, 1 to 25, 1 to 10, 1 to 5, In the sequence having an insertion, deletion, substitution, and/or addition of 1 to 3, 1 to 2, or 1 amino acid and corresponding to positions 140 to 145 of the amino acid sequence shown in SEQ ID NO: 2. It may also be a protein that consists of an amino acid sequence that includes an amino acid substitution, and that exhibits an activity for improving deep rooting of plants.

The base sequences shown in SEQ ID NOs: 3, 5, 13, and 15 are CDSs encoding the mutant qSOR1 proteins shown in SEQ ID NOs: 4, 6, 14, and 16 above, respectively. Specifically, the base sequence shown in SEQ ID NO: 3 is a base sequence in which the 418th to 420th codon CCG of the base sequence shown in SEQ ID NO: 1 (CDS encoding the original variety qSOR1 protein) is replaced with TCG. The base sequence shown in SEQ ID NO: 5 is a base sequence in which the 421st to 423rd codons CTC of the base sequence shown in SEQ ID NO: 1 are replaced with TTC. The base sequence shown in SEQ ID NO: 13 is a base sequence in which the 388th to 390th codons CCT of the base sequence shown in SEQ ID NO: 11 (CDS encoding wild-type LZY3 protein) are replaced with TCT. The base sequence shown in SEQ ID NO: 15 is a base sequence in which the 391st to 393rd codons TTG of the base sequence shown in SEQ ID NO: 11 are replaced with TTC.

In the present invention, the gene encoding the mutant qSOR1 protein may include the base sequence shown in SEQ ID NO: 3, 5, 13, or 15. The gene encoding the mutant qSOR1 protein also has 40% or more, 60% or more, 70% or more, 80% or more, 90% or more, 95% or more, 96% or more, 97% or more of the base sequence shown in SEQ ID NO: 1 or 11. % or more, 98% or more, 99%, or 99.5% or more, and contains a nucleotide mutation that causes an amino acid substitution in the sequence corresponding to positions 140 to 145 of the amino acid sequence shown in SEQ ID NO: 2. , and may contain a base sequence encoding a protein that exhibits an activity of improving deep rooting ability of plants. The gene encoding the mutant qSOR1 protein also has 1 to 100, 1 to 50, 1 to 25, 1 to 10, 1 to 5, and 1 to 3 in the base sequence shown in SEQ ID NO: 1 or 11. , 1 to 2, or 1 base insertion, deletion, substitution, and/or addition, and an amino acid substitution in the sequence corresponding to positions 140 to 145 of the amino acid sequence shown in SEQ ID NO: 2. It may also contain a nucleotide mutation that causes a nucleotide mutation and a base sequence that encodes a protein that exhibits the activity of improving deep rooting ability of plants.

The plants used in the present invention are typically, but not limited to, angiosperms. The plants may be either annual plants or perennial plants, and may be monocotyledonous plants or dicotyledonous plants. Examples of monocotyledonous plants include, but are not limited to, plants of the Poaceae, Liliaceae, Pineapple family, Arocaceae, Araceae, Zingiberaceae, Orchidaceae, and the like. Dicotyledonous plants include, but are not limited to, Cucurbitaceae, Brassicaceae, Fabaceae, Asteraceae, Lamiaceae, Solanaceae, Rosaceae, Apiaceae, Convolvulaceae, Lotus family, and Salicaceae.

The plants may be agricultural crops such as ornamental flower plants and edible vegetables and fruits. Examples of ornamental flower plants include morning glory, sunflower, cosmos, sweet pea, marigold, pansy, viola, daisy, snapdragon, gerbera, bellflower, clematis, canna, cyclamen, chrysanthemum, tulip, rose, carnation, petunia, and gypsophila. , lily, orchid, etc. Examples of agricultural crops include rice, wheat, barley, rye, oats, adlay, corn, millet, millet, millet, millet, sorghum, finger millet, pearl millet, teff, sugar cane, Arabidopsis, rapeseed, cabbage, komatsuna, radish, Chinese cabbage, broccoli, Examples include soybeans, kidney beans, broad beans, green onions, rapeseed, cabbage, lettuce, tobacco, tomatoes, strawberries, eggplants, carrots, potatoes, cotton, onions, garlic, potatoes, taro, yams, sweet potatoes, cucumbers, lotus, peaches, and the like. The plants may also be plants used as street trees, such as poplars, plane trees, weeping willows, locusts, cherry blossoms, and sycamores.

The plant used in the present invention is preferably a plant of the Poaceae family, Brassicaceae family, or Fabaceae family. Plants of the Poaceae family include, but are not limited to, rice, wheat, barley, rye, oat, adlay, corn, millet, millet, millet, sorghum, finger millet, pearl millet, teff, sugarcane, timothy, Kentucky bluegrass, and orchard. Grass, Italian ryegrass, perennial ryegrass, tall fescue, bahiagrass, and minato ryegrass. Examples of plants belonging to the Cruciferae family include, but are not limited to, Arabidopsis, rapeseed, cabbage, Japanese radish, Japanese radish, Chinese cabbage, broccoli, and the like. Examples of plants belonging to the leguminous family include, but are not limited to, soybean, kidney bean, fava bean, adzuki bean, pea, alfalfa, Lotus japonicus, and the like.

The plant used in the present invention is more preferably rice. As used herein, "rice" means any plant belonging to the genus Poaceae of the family Poaceae. Rice includes cultivated rice and wild rice. Examples of cultivated rice include Asian rice (Oryza sativa) and African rice (Oryza glaberrima), and examples of Asian rice include japonica (Oryza sativa subsp. japonica) and indica (Oryza sativa subsp. indica). Examples of Japonica varieties include Koshihikari, Toyomeki, Momiroman, Hokuriku 193, Yamadawara, and Sasanishiki, and examples of Indica varieties include IR64.
In the present specification, a plant includes the whole plant or a part thereof (leaves, stems, roots, shoot tips, anthers, pollen, embryos, callus, cells, etc.), seeds, and the like.

Plants may have multiple genomes. For example, wild species of rice include allotetraploids, which have two types of genomes, genome B and genome C. The plant of the present invention may have the mutant qSOR1 gene described above on at least one genome. The plant of the present invention may also have the above-mentioned mutant qSOR1 gene homozygous or heterozygous on at least one genome.

Generally, when mutations are introduced into plant genes to improve stress tolerance (including drought tolerance, etc.) of plants, this may have an adverse effect on yield, plant type, etc. We found that even if we introduced the above-mentioned nucleotide mutation that improves deep rooting ability into the qSOR1 gene of the plant, the yield did not decrease compared to the original variety, but rather tended to increase, and the plant type did not change.

Therefore, the plant of the present invention may have an unchanged grass type. As used herein, "the plant type has not changed" means that the plant type has not changed compared to the original variety or original line. As used herein, "grass type" refers to the general shape of the above-ground part of a plant, which is defined by characteristics such as stem and branching. For example, when the plant of the present invention is rice, the grass type includes the height of the rice, the number of panicles, the length of the panicle, the length of the cob, the number of primary branches per panicle, and the number of secondary branches per panicle. It can be evaluated by the number of stalks, the number of seeds per panicle, etc.

The plant of the present invention may have a maintained or increased yield, especially when it is a cultivated plant (crop). As used herein, "yield is maintained" means that the yield is maintained compared to the original variety or line (for example, the yield is increased or decreased by less than 5%). As used herein, "yield is increased" means that the yield is increased compared to the original variety or original line (for example, the yield is increased by 5% or more). For example, when the plant of the present invention is rice, the amount of refined rice dry matter can be measured as the yield.

(2) Method for producing mutated plants The plants of the present invention can be produced, for example, by introducing the above-mentioned nucleotide mutations that improve deep rooting into the qSOR1 gene on the genome of the plant. Therefore, the present invention provides a method for producing a plant with improved deep rooting ability (plant of the present invention), which includes the step of introducing a nucleotide mutation that improves deep rooting ability into the qSOR1 gene of the plant (hereinafter referred to as ``the mutation of the present invention''). (also referred to as "method for producing introduced plants").

In the above-mentioned method for producing a mutated plant of the present invention, terms such as "plant,""qSOR1gene,""nucleotide mutation that improves deep rooting ability," and "improved deep rooting ability" are used to describe the plant of the present invention. As defined in . In the above-mentioned method for producing a mutated plant of the present invention, the target plant to which the mutation is introduced may be a plant (for example, a wild-type plant) that does not have a nucleotide mutation that improves deep rooting in the qSOR1 gene, or It may also be a plant that has a nucleotide mutation that improves deep rooting ability. The plant may be, for example, a monocot or a dicotyledon, such as a member of the Poaceae or Brassicaceae family, such as rice. In the method for producing mutagenized plants of the present invention, the nucleotide mutation that improves deep rooting ability is, for example, a nucleotide mutation that causes an amino acid substitution in the sequence corresponding to positions 140 to 145 of the amino acid sequence shown in SEQ ID NO: 2, for example, A nucleotide mutation that causes the substitution of proline with serine at the position corresponding to position 140 of the amino acid sequence shown in SEQ ID NO: 2, or the substitution of leucine with phenylalanine at the position corresponding to position 141 of the amino acid sequence shown in SEQ ID NO: 2. obtain. In the method for producing mutagenized plants of the present invention, the mutant qSOR1 gene produced by introducing a nucleotide mutation that improves deep rooting ability is, for example,
(i) A protein consisting of the amino acid sequence shown in SEQ ID NO: 4, 6, 14 or 16,
(ii) having 90% or more sequence identity with the amino acid sequence shown in any one of SEQ ID NO: 2, 12, 17, 18, and 24 to 31, and positions 140 to 145 of the amino acid sequence shown in SEQ ID NO: 2; or
(iii) has an insertion, deletion, substitution, and/or addition of 1 to 10 amino acids in the amino acid sequence shown in any one of SEQ ID NOs: 2, 12, 17, 18, and 24 to 31; It may consist of an amino acid sequence containing an amino acid substitution in the sequence corresponding to positions 140 to 145 of the amino acid sequence shown in No. 2, and may encode a protein that exhibits an activity for improving deep rooting ability of plants.

In the above-mentioned method for producing a mutated plant of the present invention, the introduction of nucleotide mutations that improve deep rooting ability can be carried out by, for example, introducing random mutations into the genome of the plant, and selecting nucleotide mutations that improve deep rooting ability from among the resulting mutants. This can be carried out by selecting mutants that have introduced or accumulated . Random mutations can be caused by, for example, irradiation with radiation such as x-rays or gamma rays, mutagenic chemicals (nitroso compounds (e.g., nitrosoguanidine), base-like compounds (e.g., bromodeoxyuridine), alkylating agents (e.g., ethyl It can be introduced by treatment with nitrosourea (ENU), ethyl methanesulfonate (EMS), etc.).

Introduction of nucleotide mutations that improve deep rooting ability can also be carried out by introducing site-specific mutations into the plant genome. Site-directed mutagenesis can be performed using, for example, site-directed mutagenesis based on homologous recombination such as the Gateway ^(R) method, site-directed mutagenesis based on PCR, or transcription activator-like effector nuclease (TALEN) (specifically Table 2012-514976 Publication, Special Table 2013-513389 Publication), Zinc Finger Nuclease (Patent No. 4350907, Patent No. 4555292), CRISPR/Cas9 (Jinek et al. A programmable dual-RNA-guided DNA endonuclease) This can be done by various site-directed mutagenesis techniques such as genome editing techniques using in adaptive bacterial immunity. Science 337, 816-821. (2012)).

The above-mentioned method for producing a mutated plant of the present invention may include the step of selecting a mutant in which the above-mentioned nucleotide mutation that improves deep rooting ability has been introduced or accumulated. Selection of mutants can be carried out, for example, by determining the base sequence of the qSOR1 gene and selecting mutants in which the determined base sequence contains the above-mentioned nucleotide mutation that improves deep-rootedness.

(3) Method for producing transformed plants The plants of the present invention can also be produced by transformation. Therefore, the present invention involves the step of introducing into the plant a vector containing a gene encoding a mutant qSOR1 protein containing an amino acid substitution that improves deep rooting ability, to create a plant with improved deep rooting ability (plant of the present invention). A method (hereinafter also referred to as "method for producing a transformed plant of the present invention") is provided. The present invention also provides the above genes and vectors used in such methods for producing transformed plants.
In the above-mentioned method for producing a transformed plant of the present invention, terms such as "amino acid substitution that improves deep rooting", "mutant qSOR1 protein", "gene", "improved deep rooting", and "plant" are used herein. As defined in the description of the plants of the invention. In the above-described method for producing a transformed plant of the present invention, the target plant into which the vector is introduced may be a plant into which the vector has not been introduced (for example, a wild-type plant). The plant may be, for example, a monocot or a dicotyledon, such as a member of the Poaceae or Brassicaceae family, such as rice. In the method for producing a transformed plant of the present invention, amino acid substitutions that improve deep rooting ability include, for example, amino acid substitutions in the sequence corresponding to positions 140 to 145 of the amino acid sequence shown in SEQ ID NO: 2; It may be a substitution of proline at the position corresponding to position 140 of the amino acid sequence shown in SEQ ID NO: 2 with serine, or a substitution of leucine at the position corresponding to position 141 of the amino acid sequence shown in SEQ ID NO: 2 with phenylalanine.
In the above method for producing a transformed plant of the present invention, the mutant qSOR1 protein is
(i) A protein consisting of the amino acid sequence shown in SEQ ID NO: 4, 6, 14 or 16,
(ii) having 90% or more sequence identity with the amino acid sequence shown in any one of SEQ ID NO: 2, 12, 17, 18, and 24 to 31, and positions 140 to 145 of the amino acid sequence shown in SEQ ID NO: 2; or
(iii) has an insertion, deletion, substitution, and/or addition of 1 to 10 amino acids in the amino acid sequence shown in any one of SEQ ID NOs: 2, 12, 17, 18, and 24 to 31; It can be a protein consisting of an amino acid sequence containing an amino acid substitution in the sequence corresponding to positions 140 to 145 of the amino acid sequence shown in No. 2, and exhibiting an activity for improving deep rooting ability of plants.
In the above-mentioned method for producing a transformed plant of the present invention, a selection marker gene can be appropriately incorporated into the vector in addition to the above-mentioned mutant qSOR1 gene.

The vector may be introduced into plants using any technique commonly used in the art, such as the Agrobacterium method, particle gun method, electroporation method, etc. The plant used for vector introduction may be a plant body, a plant organ, or a piece of plant tissue, or a callus or protoplast may be prepared and used.

The above method for producing a transformed plant of the present invention may include a step of selecting a transformed plant into which the above vector has been introduced.

Plants into which the vector has been introduced can be selected, for example, based on the presence or absence of expression of the selectable marker gene incorporated into the vector. The selection marker gene is not particularly limited, but for example, antibiotic resistance genes commonly used in the art can be suitably used. Examples of antibiotic resistance genes that can be suitably used include, but are not limited to, kanamycin resistance genes, neomycin resistance genes, ampicillin resistance genes, hygromycin resistance genes, and the like.

Introduction of the vector into plants can also be confirmed by PCR, Southern hybridization, Northern hybridization, Western blotting, etc.

(4) Method for producing plants with improved deep rooting ability by hybridization The present invention also includes a step of hybridizing plants using the plants of the present invention as breeding parents to obtain progeny plants, and a step encoding the mutant qSOR1 protein. To provide a method for producing a plant (plant of the present invention) with improved deep rooting ability (also referred to as "breeding method of the present invention"), which includes the step of selecting progeny plants into which a gene has been introduced.

"Mating plants using the plants of the present invention as breeding parents" refers to breeding the plants of the present invention with each other, or the plants of the present invention with plants of the same or closely related species. Mating may be carried out once or repeatedly. For example, a plant of the present invention may be crossed with a plant of the same or closely related species (recurrent parent), the progeny plant may be crossed with the recurrent parent (backcrossing), and the progeny plant may be further crossed with the recurrent parent, which are repeated. Good (continuous backcrossing). Alternatively, the plants of the present invention may be crossed with plants of the same or related species, and the progeny plants may be crossed with other plants of the same or related species.

Selection of progeny plants into which the gene encoding the mutant qSOR1 protein has been introduced can be carried out by the method described for the method for producing a mutated plant and the method for producing a transformed plant of the present invention.

(5) Method for selecting plants with improved deep rooting ability Provided is a method for selecting plants with improved deep rooting ability (also referred to as the "selection method of the present invention"), which includes the step of identifying a plant that has a gene encoding a mutant qSOR1 protein containing an amino acid substitution that improves.

In the selection method of the present invention, the "test plant" means a plant that is subjected to the selection method of the present invention. In the selection method of the present invention, the "plant" is as defined in the above description of the plant of the present invention. The plant may be, for example, a monocot or a dicotyledon, such as a member of the Poaceae or Brassicaceae family, such as rice. In the selection method of the present invention, test plants include, for example, mutants obtained by introducing random mutations into plants, progeny plants obtained by crossbreeding plants using the plants of the present invention as breeding parents, etc. It can be. In the selection method of the present invention, terms such as "DNA", "qSOR1 gene", "amino acid substitution that improves deep rooting ability", "mutant qSOR1 protein", "gene", "improved deep rooting ability", etc. as defined in the description of the plants of the present invention. In the selection method of the present invention, amino acid substitutions that improve deep rooting ability include, for example, amino acid substitutions in the sequence corresponding to positions 140 to 145 of the amino acid sequence shown in SEQ ID NO: 2; This may be a substitution of proline with serine at the position corresponding to position 140 of the amino acid sequence shown in SEQ ID NO: 2, or a substitution of phenylalanine with leucine at the position corresponding to position 141 of the amino acid sequence shown in SEQ ID NO:2.
In the above method for producing a transformed plant of the present invention, the mutant qSOR1 protein is
(i) A protein consisting of the amino acid sequence shown in SEQ ID NO: 4, 6, 14 or 16,
(ii) having 90% or more sequence identity with the amino acid sequence shown in any one of SEQ ID NO: 2, 12, 17, 18, and 24 to 31, and positions 140 to 145 of the amino acid sequence shown in SEQ ID NO: 2; or
(iii) has an insertion, deletion, substitution, and/or addition of 1 to 10 amino acids in the amino acid sequence shown in any one of SEQ ID NOs: 2, 12, 17, 18, and 24 to 31; It can be a protein consisting of an amino acid sequence containing an amino acid substitution in the sequence corresponding to positions 140 to 145 of the amino acid sequence shown in No. 2, and exhibiting an activity for improving deep rooting ability of plants.

In the present invention, nucleic acid amplification techniques include polymerase chain reaction (PCR) method, LAMP (Loop-Mediated Isothermal Amplification) method, TMA (Transcription Mediated Amplification) method, NASBA (Nucleic Acid Sequence-Based Amplification) method, LCR Any method such as the (Ligase Chain Reaction) method can be used.

In the selection method of the present invention, the template for nucleic acid amplification may be genomic DNA or cDNA derived from a test plant. In the selection method of the present invention, the primer used for nucleic acid amplification may have a length of 15 bases or more, or 20 bases or more, and may have a length of 50 bases or less or 30 bases or less. The primers may also be, for example, 15-50 bases long, 20-50 bases long, or 20-30 bases long.

In the selection method of the present invention, "part of the qSOR1 gene" is a region containing the nucleotide sequence encoding domain III of the qSOR1 protein (sequence corresponding to positions 140 to 145 of the amino acid sequence shown in SEQ ID NO: 2). Good to have.

The selection method of the present invention includes, for example, direct sequencing using the Sanger method, HRM (High Resolution Melting) method, KASP ^TM (Kompetitive Allele Specific PCR) genotyping assay (LGC Biosearch Technologies), dCAPS (derived amplified polymorphic sequence) method, etc. This can be done using

The selection method of the present invention may further include the step of evaluating the root elongation angle, deep root ratio, or gravitropism of the test plant. The methods for evaluating root elongation angle, deep root ratio, or gravitropism are as described for the plants of the present invention.

In one embodiment of the selection method of the present invention, nucleic acid amplification is performed using genomic DNA derived from a test plant as a template.
(i) A forward primer containing a base sequence of at least 15 consecutive bases on the base sequence shown in SEQ ID NO: 19, and
(ii) A primer set including a reverse primer containing at least 15 consecutive bases of the base sequence shown in SEQ ID NO: 20 or 21 may be used.

The above primer set is, for example,
(i) A forward primer containing the base sequence shown in SEQ ID NO: 19, and
(ii) It may contain a reverse primer containing the base sequence shown in SEQ ID NO: 20 or 21.

The nucleotide sequence shown in SEQ ID NO: 19 corresponds to the nucleotide sequence on the second intron of the rice qSOR1 gene (positions 629 to 652 of the nucleotide sequence in SEQ ID NO: 23), and the nucleotide sequences shown in SEQ ID NO: 20 and 21 correspond to the nucleotide sequence on the second intron of the rice qSOR1 gene. Corresponds to the nucleotide sequence on the third intron of the qSOR1 gene (respectively, positions 1453 to 1478 and 1301 to 1327 of the base sequence of SEQ ID NO: 23). Therefore, by performing nucleic acid amplification using the above primer set, the region including the third exon (including the region encoding domain III of the qSOR1 protein) is amplified.

After nucleic acid amplification using the above primer set, the nucleotide sequence of the amplified product is determined by the Sanger method or the like to determine whether or not the qSOR1 gene has a nucleotide mutation that improves deep rootability. A plant determined to have a nucleotide mutation that improves deep rooting ability in the qSOR1 gene can be identified as a plant that has a gene encoding a mutant qSOR1 protein containing an amino acid substitution that improves deep rooting ability.

The primer used for nucleic acid amplification in the selection method of the present invention preferably contains the base sequence defined above at its 3' end.

The selection method of the present invention may include a step of preparing a test plant before the step of performing nucleic acid amplification. The step of preparing a test plant includes, for example, a step of introducing a nucleotide mutation that improves deep rooting ability into the qSOR1 gene of the plant to make it a test plant, and a step of introducing a gene encoding a mutant qSOR1 protein containing an amino acid substitution that improves deep rooting ability. This may be a step of introducing a vector containing the vector into a plant to obtain a test plant, or a step of cross-breeding the plants using the plant of the present invention as a breeding parent to obtain a progeny plant as a test plant. These steps were performed as described in "(2) Method for producing mutated plants," "(3) Method for producing transformed plants," and "(4) Method for producing plants with improved deep rooting ability by hybridization." It can be carried out.

The selection method of the present invention can be used, for example, in the method of producing a mutated plant, the method of producing a transformed plant, or the breeding method of the present invention.

Hereinafter, the present invention will be explained in more detail using Examples. However, the technical scope of the present invention is not limited to these Examples.

<Example 1. Identification of qSOR1 mutant lines from rice mutant lines>
Among the rice mutant lines, we searched for lines with nonsynonymous substitutions in the qSOR1 gene.
Genomic DNA of a rice mutant line (M1 generation, n=3,072) obtained by treating rice (Oryza sativa) cultivar Koshihikari with ethylnitrosourea (ENU) using the fertilized egg method was used as a template, and the forward primer qSOR1-p1 was used as a template. -F1 (5'- tggatatattttgcatggtttttg -3') (SEQ ID NO: 19) and reverse primer qSOR1-p1-R1 (5'- caacatctacgacgtcaaattagtct -3') (SEQ ID NO: 20) were used to target exon 3 of the qSOR1 gene (Os07g0614400). The region between the two was amplified by polymerase chain reaction (PCR). Prime STAR GXL DNA polymerase (Takara Bio) was used for amplification by PCR method.

The obtained PCR product was heated to 98°C and cooled to dissociate and reassociate the double-stranded DNA, and then treated with Cel-I nuclease extracted from celery and subjected to agarose electrophoresis. Since Cel-I nuclease cleaves double-stranded DNA at mismatch sites, strains in which cleavage fragments were detected in the agarose electrophoresis described above can be determined to be strains with substitution mutations in the qSOR1 gene.

For the strains in which cleavage fragments were detected in the above agarose electrophoresis, forward primer qSOR1-p1-F1 (5'- tggatatattttgcatggtttttg -3') (SEQ ID NO: 19) and reverse primer qSOR1-p1-R2 (5'- gaaatggagtgagtagatgataacttg -3') (SEQ ID NO: 21) to determine the nucleotide sequence of the qSOR1 gene. Analysis of the determined nucleotide sequences revealed four strains with non-synonymous substitutions in the qSOR1 gene. The CDS of the qSOR1 gene determined for these four qSOR1 mutant lines (

strain names

0951M, 2792M, 0909M, and 2574M) are shown in SEQ ID NOs: 3, 5, 7, and 9, respectively. Furthermore, the amino acid sequences encoded by these are shown in SEQ ID NOs: 4, 6, 8, and 10, respectively. As a result of comparing the CDS of the qSOR1 gene of these four qSOR1 mutant lines with the CDS of the qSOR1 gene of the original variety (Koshihikari) (SEQ ID NO: 2), it was revealed that they had the following mutations (Figure 3 and (see 4). Strain name 0951M; A mutation (missense mutation) resulting in the substitution of proline at position 140 with serine (P140S) has occurred. Strain name 2792M; A mutation resulting in the substitution of leucine at position 141 with phenylalanine (L141F) has occurred. Strain name 0909M; A mutation has occurred that results in the substitution of cysteine for arginine at position 204 (R204C). Strain name 2574M; A mutation resulting in the substitution of arginine at position 204 with histidine (R204H) has occurred. Here, the positions of the above amino acid substitutions are numbered according to the amino acid sequence of SEQ ID NO: 2. The same applies to Examples 1 to 5 below.

When predicting the three-dimensional structure of the qSOR1 protein using I-TASSER, the arginine at position 204 forms a salt bridge with aspartic acid at position 17 and glutamic acid at position 226, which contributes to stabilizing the three-dimensional structure of the qSOR1 protein. It was expected that there might be a possibility that In particular, strain name 0909M, in which the basic amino acid arginine was replaced with the neutral amino acid cysteine at position 204, was expected to show a change in root phenotype compared to the original variety. On the other hand, the amino acid substitutions of P140S and L141F did not change the structure of the qSOR1 protein and were not expected to affect the root phenotype.

The amino acid sequences (SEQ ID NOs: 2, 17, 12, 18, respectively) encoded by the rice (Koshihikari) qSOR1 gene and the isolated homologous genes, the Arabidopsis LZY2 gene, the Arabidopsis LZY3 gene, and the Taruuma alfalfa NGR gene. As a result of comparison, proline at position 140 and leucine at position 141 were found to be present in domain III, whose amino acid sequence is highly conserved among different species. On the other hand, arginine at position 204 was conserved in rice and alfalfa, but it was a different amino acid in Arabidopsis (Figure 5).

<Example 2. Root phenotype of qSOR1 mutant line＞
In order to investigate whether the root elongation angle of the qSOR1 mutant line obtained in Example 1 had changed compared to the original variety (Koshihikari), the root elongation angle was measured by the cup method.

Fill a plastic cup with a diameter of 3.7 cm and a height of 4 cm with a hole drilled in the bottom for water supply, and fill it with synthetic granular soil until it reaches its full capacity. Seeds homozygous for the gene mutation were sown. The cup containing the seeds was placed on a stainless steel tray, and fertilizer-free soil was spread over the cup so that the entire cup was covered, and the seeds were cultivated for about 3 weeks. Twenty individuals of each of the original variety and four qSOR1 mutant lines were grown. At the end of the cultivation period, the plants were removed from the cups, the roots were washed away, and the root elongation angle was measured using a protractor.

The results are shown in Figure 6. As expected in Example 1, the root elongation angle of strain 0909M was significantly lower than that of the original variety. In addition, the root elongation angle of strain 2574M was similar to that of the original variety. On the other hand, the root elongation angles of line 0951M and line 2792M, which were thought to have no effect on the phenotype, were significantly increased compared to the original variety.

These results show that the R204C substitution in the rice qSOR1 amino acid sequence has the effect of shallowing rice roots, and that the P140S and L141F substitutions (substitutions in domain III) surprisingly have the effect of deepening rice roots. It was suggested that the

<Example 3. Effect of mutations in the qSOR1 gene on root phenotype>
Since the qSOR1 mutant strain used in the cup method described above was created by mutagen treatment, it is possible that it has mutations other than the above mutations in its genome. Therefore, in order to further prove that the changes in root phenotype found by the cup method were caused by mutations in the qSOR1 gene, we conducted the following experiment.

The qSOR1 mutant lines (

strain names

0909M, 0951M, and 2792M) with changes in root elongation angle in Example 2 were each backcrossed to the original variety three times and selfed. It was confirmed by direct sequencing that the three BC3F3 lines obtained (quasi-isogenic lines with Koshihikari background) maintained the above-mentioned mutation in the qSOR1 gene.

The root phenotypes of these three BC3F3 lines were investigated using a modified basket method using a stainless steel mesh colander. A custom-made stainless steel colander with a diameter of 7.5 cm was filled with fertilizer-free culture soil, and sterilized seeds of the original variety or BC3F3 strain were sown and cultivated in hydroponic solution for about a month and a half. After the cultivation period ended, roots that extended downward at an angle exceeding 30 degrees to the ground surface were considered deep roots, and the number of deep roots and the total number of roots were measured. The number of deep roots divided by the total number of roots was calculated as the deep root ratio (RDR30; Ratio of Deeper Root than 30 degrees). The larger the value of the deep root ratio, the deeper the root. The deep root rate was investigated for 20 individuals each of the original variety and three BC3F3 lines.

The results are shown in Figure 7. The deep root percentage of the 0909M-derived BC3F3 line was significantly decreased compared to the original variety, whereas the deep root percentage of the 0951M and 2792M-derived BC3F3 lines was significantly increased compared to the original variety. . These results were consistent with those obtained by the cup method.

From the above results, the change in the root phenotype of the qSOR1 mutant line is due to the mutation that occurred in the qSOR1 gene, that is, the R204C substitution in the amino acid sequence of the rice qSOR1 protein has the effect of shallowing the roots of rice. Contrary to predictions from the original amino acid sequence, the P140S and L141F substitutions (substitutions in domain III) were shown to have the effect of deepening the roots of rice.

<Example 4. Effect of mutations in the qSOR1 gene on gravitropism>
Since qSOR1 is a gene involved in gravitropism, we investigated the effects of the above mutations in the qSOR1 gene on gravitropic responses.

For each of the three BC3F3 lines and the original variety (Koshihikari) obtained in Example 3, the rice husks were removed from 30 seeds to obtain brown rice. After washing the brown rice three times with 10 ml of sterilized water, it was placed in a petri dish containing 10 ml of a medium containing 1% PPM (PLANT PRESERVATIVE MIXTURE ^TM , Plant Cell Technology) as a disinfectant, and allowed to stand at 30°C for 1 day. Germinated seeds were sown on square plates containing 0.4% agarose gel and left standing in the dark at 28°C for 2 days. Thereafter, the square plate was rotated 90 degrees, and after 4 hours, the roots were photographed and the bending angle of the roots was measured.

The results are shown in Figure 8. Compared to the original variety, the root bending angle of the 0909M-derived BC3F3 line was significantly smaller, and the root bending angle of the 0951M- and 2792M-derived BC3F3 lines was significantly larger.

From these results, rice that has the gene encoding the qSOR1 protein containing the R204C substitution has shallower roots due to a weaker gravitropic response than the original variety, and the P140S and L141F substitutions (substitutions in domain III). Rice that has the gene encoding the qSOR1 protein has been shown to have deeper roots due to a stronger gravitropic response than the original variety.

<Example 5. Effect of substitutions in domain III of qSOR1 protein on yield>
In order to clarify whether the substitution in domain III of the rice qSOR1 protein has a negative effect on agronomic traits such as yield, we investigated the 2792M-derived BC3F3 line obtained in Example 3 and its original variety (Koshihikari) in 2020 and 2021. A yield survey was conducted for two years.

Both lines were cultivated in rice fields within the National Agriculture and Food Research Organization in Tsukuba City, Ibaraki Prefecture in 2020 and 2021. Each line was individually planted at a density of 22.2 plants per 1 ^m2 (15 cm x 30 cm). Germinated seeds were sown in April, grown in paddy seedlings for one month, and then transplanted to paddy fields. The field design was three replicates with 42 plants (6 x 7) randomly arranged per plot for each line. As chemical fertilizers, 12 g m ^-2 of P ₂ O ₅ , 9 g m ^-2 of K ₂ O, and 12 g m ^-2 of N were applied to the rice fields according to the conventional method.

The heading dates of the original variety and the 2792M-derived BC3F3 line in 2020 (the date when 50% of individuals in each plot started heading) were August 6th to 7th in all three plots, and the heading dates of both lines were almost simultaneous. Ta. The heading date of the original variety in 2021 was July 30th to 31st in all three plots, and the heading date of the 2792M-derived BC3F3 line in 2021 was July 28th in all three plots. Because the summer temperature in 2021 was higher than in 2020, it is thought that the heading date in 2021 was about one week earlier than the heading date in 2020 for both lines. The difference between lines in heading date was smaller than this difference between years.

After the cultivation period ended, 24 plants were harvested from each plot, dried naturally, and then threshed. Next, after sorting the ripened paddy by wind selection (2020) or water selection (2021), the selected paddy was air-dried in a dryer at 80°C for 3 days, and the dry weight of the refined paddy was measured.

The results are shown in Figure 9. The dry weight of wheat of the BC3F3 line derived from 2792M increased by 6.7% in 2020 and 12.7% in 2021 compared to the original variety. These results showed that substitutions in domain III of the rice qSOR1 amino acid sequence did not adversely affect yield, but rather resulted in an increase in yield. The plant type of the 2792M-derived BC3F3 line was similar to the original variety, and no particular abnormality was observed.

<Example 6. Effect of Arabidopsis LZY3 mutant protein with substitution in domain III on root phenotype>
In this example, in order to investigate whether substitution in domain III of Arabidopsis thaliana LZY3 protein has the effect of deepening roots in Arabidopsis, we replaced proline at position 130 of SEQ ID NO: 12 with serine (P130S). and the effect of LZY3 mutant proteins (dLZY3(P130S) and dLZY3(L131F), respectively) having the substitution of leucine at position 131 with phenylalanine (L131F) on the root phenotype was evaluated (FIGS. 10 to 12). The amino acid sequences of the dLZY3(P130S) and dLZY3(L131F) mutant proteins are shown in SEQ ID NOs: 14 and 16, respectively, and the nucleotide sequences encoding them are shown in SEQ ID NOs: 13 and 15, respectively.

LZY3p:LZY3-mCherry, a vector that expresses a fusion protein of LZY3 protein and mCherry (red fluorescent protein) under the LZY3 promoter (Taniguchi M. et al., The Plant Cell, 2017, 29:1984-1999, University Joint Use The nucleotide sequence of the construct contained in the vector, which was provided by the National Institute for Basic Biology of the National Institutes of Natural Sciences, is shown in SEQ ID NO: 22), by substituting C at position 388 of the LZY3 gene with T A vector (LZY3p:dLZY3(P130S)-mCherry) expressing a fusion protein of the (P130S) mutant protein and mCherry under the LZY3 promoter was created. In addition, in the above LZY3p:LZY3-mCherry vector, by substituting the 393rd G of the LZY3 gene with C, a vector (LZY3p: dLZY3(L131F)-mCherry) was produced.

Using Agrobacterium GV3101 strain, LZY3p:dLZY3(P130S)-mCherry and LZY3p:dLZY3(L131F)-mCherry were isolated from Arabidopsis lzy2lzy3 double mutant (Arabidopsis Columbia strain in which LZY2 and LZY3 genes are deleted). mutant). Seeds of the T1 generation of the obtained transformed plants were sown on a 1/2MS agar medium containing 20 μg/ml of hygromycin, and plants showing resistance to hygromycin were selected. The selected plants were newly transplanted onto a 1/2 MS agar medium, grown on the agar medium vertically, and the morphology of the root system was observed.

As controls, Arabidopsis Columbia strain (wild type), Arabidopsis Columbia strain mutant in which the LZY2 gene has been deleted (lzy2 single mutant), and Arabidopsis Columbia strain in which the LZY2 and LZY3 genes have been deleted (lzy2lzy3 double mutant) After sowing the seeds of the mutant) on an agar medium, the agar medium was grown vertically and the morphology of the root system was observed.

The results are shown in Figure 13. The roots of the wild type and the lzy2 single mutant had similar morphology, and the lateral roots of the lzy2lzy3 double mutant extended upward compared to the wild type. This was consistent with the results of a previous study (Taniguchi M. et al., The Plant Cell, 2017, 29:1984-1999). On the other hand, the lzy2lzy3 double mutant (dLZY3(P130S)/lzy2lzy3 mutant) into which LZY3p:dLZY3(P130S)-mCherry was introduced and the lzy2lzy3 double mutant into which LZY3p:dLZY3(L131F)-mCherry was introduced ( dLZY3(L131F)/lzy2lzy3 mutant) all had roots elongated downward compared to the original line, the lzy2lzy3 double mutant, and complemented the phenotype of the lzy2lzy3 double mutant. . Furthermore, the roots of the dLZY3(P130S)/lzy2lzy3 mutant and the dLZY3(L131F)/lzy2lzy3 mutant significantly elongate downward, even compared to the wild type and lzy2 single mutant that express the wild-type LZY3 protein. Was.

These results indicate that the LZY3 mutant protein with a substitution in domain III has the effect of deepening roots compared to the wild-type LZY3 protein, that is, the substitution in domain III of the LZY3 protein also has the effect of deepening roots in Arabidopsis. Show that something is true.

From the above, it was shown that mutations in domain III of the qSOR1 protein have the effect of deepening roots not only in monocotyledonous plants such as rice but also in dicotyledonous plants such as Arabidopsis.

In addition, in Figure 13, the roots of the dLZY3(P130S)/lzy2lzy3 mutant and dLZY3(L131F)/lzy2lzy3 mutant appear to be slightly shorter than those of the wild type, lzy2 single mutant, and lzy2lzy3 double mutant; This is considered to be an effect of hygromycin in the medium. Furthermore, the grass types of the above-mentioned dLZY3(P130S)/lzy2lzy3 mutant and dLZY3(L131F)/lzy2lzy3 mutant were not significantly changed compared to the lzy2lzy3 double mutant.

Sequence SEQ ID NO: 1 CDS encoding Koshihikari qSOR1 protein
SEQ ID NO: 2 Koshihikari qSOR1 protein amino acid sequence SEQ ID NO: 3 CDS encoding 0951M strain qSOR1 protein
SEQ ID NO: 4 Amino acid sequence of qSOR1 protein of 0951M strain SEQ ID NO: 5 CDS encoding qSOR1 protein of 2792M strain
SEQ ID NO: 6 Amino acid sequence of 2792M strain qSOR1 protein SEQ ID NO: 7 CDS encoding 0909M strain qSOR1 protein
SEQ ID NO: 8 Amino acid sequence of qSOR1 protein of 0909M strain SEQ ID NO: 9 CDS encoding qSOR1 protein of 2574M strain
SEQ ID NO: 10 Amino acid sequence of 2574M strain qSOR1 protein SEQ ID NO: 11 CDS encoding Arabidopsis LZY3 protein
SEQ ID NO: 12 Amino acid sequence of Arabidopsis LZY3 protein SEQ ID NO: 13 Base sequence encoding dLZY3(P130S) mutant protein SEQ ID NO: 14 Amino acid sequence of dLZY3(P130S) mutant protein SEQ ID NO: 15 Encoding dLZY3(L131F) mutant protein Base sequence SEQ ID NO: 16 Amino acid sequence of dLZY3(L131F) mutant protein SEQ ID NO: 17 Amino acid sequence of Arabidopsis LZY2 protein SEQ ID NO: 18 Amino acid sequence of Alfalfa NGR protein SEQ ID NO: 19 Forward primer qSOR1-p1-F1
SEQ ID NO: 20 Reverse primer qSOR1-p1-R1
SEQ ID NO: 21 Reverse primer qSOR1-p1-R2
SEQ ID NO: 22 Base sequence of construct (including promoter and polynucleotide encoding the fusion protein) contained in LZY3p:LZY3-mCherry vector SEQ ID NO: 23 Genomic DNA sequence of Koshihikari qSOR1 gene SEQ ID NO: 24 Amino acids of maize qSOR1 (ZmqSOR1) protein Sequence SEQ ID NO: 25 Amino acid sequence of sorghum qSOR1 (SbqSOR1) protein SEQ ID NO: 26 Amino acid sequence of wheat qSOR1 (TaqSOR1) protein SEQ ID NO: 27 Amino acid sequence of Minato chinensis qSOR1 (BdqSOR1) protein SEQ ID NO: 28 Amino acid sequence of soybean NGR2 (GmNGR2) protein SEQ ID NO: 29 Amino acid sequence of Lotus japonicus NGR (LjNGR) protein SEQ ID NO: 30 Amino acid sequence of Poplar NGR (PtNGR) protein SEQ ID NO: 31 Amino acid sequence of Peach NGR (PpeNGR) protein All publications, patents and patents cited herein The application is hereby incorporated by reference in its entirety.

Claims

It has improved deep rooting ability and has a gene encoding a mutant qSOR1 (quantitative trait locus for SOIL SURFACE ROOTING 1) protein that contains an amino acid substitution in the sequence corresponding to positions 140 to 145 of the amino acid sequence shown in SEQ ID NO: 2. plant.
The amino acid substitution is a substitution of an amino acid selected from the group consisting of proline at the position corresponding to the 140th position of the amino acid sequence shown in SEQ ID NO: 2 and leucine at the position corresponding to the 141st position of the amino acid sequence shown in SEQ ID NO: 2. , the plant according to claim 1.
The amino acid substitution is a substitution of proline at the position corresponding to the 140th position of the amino acid sequence shown in SEQ ID NO: 2 with serine, or a substitution of leucine at the position corresponding to the 141st position of the amino acid sequence shown in SEQ ID NO: 2 with phenylalanine. The plant according to claim 1.
The mutant qSOR1 protein is
(i) A protein consisting of the amino acid sequence shown in SEQ ID NO: 4, 6, 14 or 16,
(ii) An amino acid that has 90% or more sequence identity with the amino acid sequence shown in SEQ ID NO: 2 or 12 and contains an amino acid substitution in the sequence corresponding to positions 140 to 145 of the amino acid sequence shown in SEQ ID NO: 2. a protein consisting of a sequence and exhibiting an activity of improving deep rooting of plants, or
(iii) Has an insertion, deletion, substitution, and/or addition of 1 to 10 amino acids in the amino acid sequence shown in SEQ ID NO: 2 or 12, and corresponds to positions 140 to 145 of the amino acid sequence shown in SEQ ID NO: 2. 2. The plant according to claim 1, which is a protein consisting of an amino acid sequence containing an amino acid substitution in the sequence at a position, and which exhibits an activity of improving deep rooting ability of plants.
The gene encoding the mutant qSOR1 protein is
(iv) the base sequence shown in SEQ ID NO: 3, 5, 13 or 15,
(v) A nucleotide mutation that has 90% or more sequence identity with the nucleotide sequence shown in SEQ ID NO: 1 or 11 and causes an amino acid substitution in the sequence corresponding to positions 140 to 145 of the amino acid sequence shown in SEQ ID NO: 2. a base sequence that encodes a protein that contains and exhibits an activity of improving deep rooting of plants, or
(vi) Has an insertion, deletion, substitution, and/or addition of 1 to 10 bases in the base sequence shown in SEQ ID NO: 1 or 11, and is in the 140th to 145th sequence of the amino acid sequence shown in SEQ ID NO: 2. a nucleotide sequence that contains a nucleotide mutation that causes an amino acid substitution and that encodes a protein that exhibits an activity to improve deep rooting ability of plants;
The plant according to claim 1, comprising:
The plant according to claim 1, which is a monocot or a dicot.
A deep method that involves introducing into the plant qSOR1 (quantitative trait locus for SOIL SURFACE ROOTING 1) gene a nucleotide mutation that causes an amino acid substitution in the sequence corresponding to positions 140 to 145 of the amino acid sequence shown in SEQ ID NO: 2. A method for producing plants with improved roots.
A vector containing a gene encoding a mutant qSOR1 (quantitative trait locus for SOIL SURFACE ROOTING 1) protein containing an amino acid substitution in the sequence corresponding to positions 140 to 145 of the amino acid sequence shown in SEQ ID NO: 2 is introduced into plants. A method for producing plants with improved deep rooting, including a process.
A step of crossbreeding plants using the plant according to any one of claims 1 to 6 as a breeding parent to obtain a progeny plant, and a progeny plant into which the gene encoding the mutant qSOR1 protein has been introduced. A method for producing plants with improved deep rooting, including a selection process.
A step of performing nucleic acid amplification on the whole or part of the qSOR1 gene using DNA derived from the test plant as a template, and based on the results of the nucleic acid amplification, the sequence corresponding to positions 140 to 145 of the amino acid sequence shown in SEQ ID NO: 2. A method for selecting plants with improved deep rooting ability, the method comprising the step of identifying a plant having a gene encoding a mutant qSOR1 protein containing an amino acid substitution.