WO2023201332A1 - Dosing of muscle targeting complexes for treating myotonic dystrophy - Google Patents

Dosing of muscle targeting complexes for treating myotonic dystrophy Download PDF

Info

Publication number
WO2023201332A1
WO2023201332A1 PCT/US2023/065774 US2023065774W WO2023201332A1 WO 2023201332 A1 WO2023201332 A1 WO 2023201332A1 US 2023065774 W US2023065774 W US 2023065774W WO 2023201332 A1 WO2023201332 A1 WO 2023201332A1
Authority
WO
WIPO (PCT)
Prior art keywords
subject
complexes
tfrl
weeks
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2023/065774
Other languages
English (en)
French (fr)
Inventor
Stefano ZANOTTI
Tyler PICARIELLO
Oxana Beskrovnaya
John Davis
Tracy MCGREGOR
Clarence Edwin GARNER
Curtis JOHNSTON
Timothy Weeden
John NAJIM
Romesh R. SUBRAMANIAN
Mohammed T. QATANANI
Cody A. DESJARDINS
Kim TANG
Brendan QUINN
Scott Hilderbrand
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Dyne Therapeutics Inc
Original Assignee
Dyne Therapeutics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to CA3248684A priority Critical patent/CA3248684A1/en
Priority to CN202380040662.9A priority patent/CN119343373A/zh
Priority to AU2023252927A priority patent/AU2023252927A1/en
Priority to IL316206A priority patent/IL316206A/en
Priority to EP23789176.7A priority patent/EP4508092A1/en
Priority to JP2024560675A priority patent/JP2025512468A/ja
Application filed by Dyne Therapeutics Inc filed Critical Dyne Therapeutics Inc
Priority to KR1020247037614A priority patent/KR20250004771A/ko
Priority to US18/856,266 priority patent/US20250249117A1/en
Publication of WO2023201332A1 publication Critical patent/WO2023201332A1/en
Priority to MX2024012730A priority patent/MX2024012730A/es
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6801Drug-antibody or immunoglobulin conjugates defined by the pharmacologically or therapeutically active agent
    • A61K47/6803Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates
    • A61K47/6807Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates the drug or compound being a sugar, nucleoside, nucleotide, nucleic acid, e.g. RNA antisense
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6889Conjugates wherein the antibody being the modifying agent and wherein the linker, binder or spacer confers particular properties to the conjugates, e.g. peptidic enzyme-labile linkers or acid-labile linkers, providing for an acid-labile immuno conjugate wherein the drug may be released from its antibody conjugated part in an acidic, e.g. tumoural or environment
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • A61K47/6849Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a receptor, a cell surface antigen or a cell surface determinant
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00Drugs for disorders of the muscular or neuromuscular system
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2881Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against CD71
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111General methods applicable to biologically active non-coding nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y207/00Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/11Protein-serine/threonine kinases (2.7.11)
    • C12Y207/11001Non-specific serine/threonine protein kinase (2.7.11.1), i.e. casein kinase or checkpoint kinase
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/55Fab or Fab'
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/313Phosphorodithioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/323Chemical structure of the sugar modified ring structure
    • C12N2310/3231Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • C12N2310/334Modified C
    • C12N2310/33415-Methylcytosine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/341Gapmers, i.e. of the type ===---===
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/351Conjugate
    • C12N2310/3513Protein; Peptide
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/352Nature of the modification linked to the nucleic acid via a carbon atom
    • C12N2310/3525MOE, methoxyethoxy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/32Special delivery means, e.g. tissue-specific
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/33Alteration of splicing

Definitions

  • the present application relates to targeting complexes for delivering an effective amount of oligonucleotide molecular payloads to cells and uses thereof, particularly uses relating to treatment of disease.
  • Myotonic dystrophy is a dominantly inherited genetic disease that is characterized by myotonia, muscle loss or degeneration, diminished muscle function, insulin resistance, cardiac arrhythmia, smooth muscle dysfunction, and neurological abnormalities.
  • DM is the most common form of adult-onset muscular dystrophy, with a worldwide incidence of about 1 in 8000 people worldwide.
  • DM1 the more common form of the disease, results from a repeat expansion of a CTG trinucleotide repeat in the 3' noncoding region of DMPK on chromosome 19; DM2 results from a repeat expansion of a CCTG tetranucleotide repeat in the first intron of ZNF9 on chromosome 3.
  • the repeat expansion of a CTG trinucleotide repeat which may comprise greater than about 50 to about 3,000 or more total repeats, leads to generation of toxic RNA repeats capable of forming hairpin structures that bind essential intracellular proteins, e.g. muscleblind-like proteins, with high affinity resulting in protein sequestration and the loss-of-function phenotypes that are characteristic of the disease.
  • no effective therapeutic for DM1 is currently available.
  • the present disclosure provides methods (e.g., methods of delivering oligonucleotides to a subject, methods of administering complexes to a subject, methods of reducing expression or activity of DMPK in a subject, and/or methods of treating myotonic dystrophy (e.g., DM1) in a subject), the method comprising administering to the subject a composition comprising an effective amount of complexes comprising an antitransferrin receptor 1 (TfRl) antibody covalently linked to one or more oligonucleotides.
  • TfRl antitransferrin receptor 1
  • a method of reducing DMPK expression in a subject comprises administering to the subject a composition comprising an effective amount of complexes comprising an anti-transferrin receptor 1 (TfRl) antibody covalently linked to one or more oligonucleotides, wherein the effective amount provides to the subject 5 mg to 110 mg of the anti-TfRl antibody of the complexes per kg of the subject, wherein the antibody comprises: a heavy chain complementarity determining region 1 (CDR-H1) comprising a sequence as set forth in SEQ ID NOs: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising a sequence as set forth in SEQ ID NOs: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising a sequence as set forth in SEQ ID NOs: 3, 9, or 14, a light chain complementarity determining region 1 (CDR-L1) comprising a sequence as set forth in SEQ
  • the oligonucleotides of the complexes comprise a 5’-X-Y-Z-3’ configuration, wherein X and Z are flanking regions comprising one or more modified nucleosides and Y is a gap region comprising one or more 2’-deoxyribonucleosides.
  • each complex comprises a structure of formula (I): [R ⁇ ni-R 2 , wherein: each R 1 comprises a group of the formula (la):
  • R 3 comprises an oligonucleotide comprising a nucleobase sequence of CAGCGCCCACCAGUCA (SEQ ID NO: 21) and comprising a structure of +C*+A*oG*oC*dG*dC*dC*dC*dA*dC*dC*dA*oG*oU*+C*+A (SEQ ID NO: 21), wherein +N represents an LNA (2’ -4’ methylene bridge) ribonucleoside, dN represents a 2’- deoxyribonucleoside, oN represents a 2’ -MOE modified ribonucleoside, oC represents a 5- methyl-2’-MOE-cytidine, +C represents a 5-methyl-2’-4’-bicyclic-cytidine (2 ’-4’ methylene bridge), oU represents a 5-methyl-2’-MOE-uridine, and * represents a phosphorothioate intemucleo
  • each complex comprises a structure of formula (I): [R ⁇ ni-R 2 , wherein: in which +N represents an LNA (2’-4’ methylene bridge) ribonucleoside, dN represents a 2’ -deoxyribonucleoside, oN represents a 2’ -MOE modified ribonucleoside, oC represents a
  • oligonucleotide of R 1 comprises a nucleobase sequence of CAGCGCCCACCAGUCA (SEQ ID NO: 21); wherein R 2 comprises the anti-TfRl antibody; and wherein in each complex, nl is independently an integer of one or greater representing the number of instances of R 1 , wherein each instance of R 1 is covalently linked via attachment point A to a different lysine of the anti-TfRl antibody.
  • the average value of nl of the complexes of the composition is in the range of 0.5-5.
  • each complex comprises a structure of formula (I): [R ⁇ ni-R 2 , wherein: each R 1 comprises a group of the formula (Ic):
  • nl is independently an integer of one or greater representing the number of instances of R 1 , wherein each instance of R 1 is covalently linked via attachment point A to a different lysine of the anti-TfRl antibody.
  • the average value of nl of the complexes of the composition is in the range of 0.5-5.
  • each complex comprises a structure of the formula (Id):
  • +N represents an LNA (2’-4’ methylene bridge) ribonucleoside
  • dN represents a 2’ -deoxyribonucleoside
  • oN represents a 2’ -MOE modified ribonucleoside
  • oC represents a 5-methyl-2’-MOE-cytidine
  • +C represents a 5-methyl-2’-4’-bicyclic-cytidine (2 ’-4’ methylene bridge
  • oU represents a 5-methyl-2’-MOE-uridine
  • * represents a phosphorothioate intemucleoside linkage
  • the oligonucleotide of R 1 comprises a nucleobase sequence of CAGCGCCCACCAGUCA (SEQ ID NO: 21); wherein R 2 comprises the anti-TfRl antibody; and wherein in each complex, nl is independently an integer of one or greater representing the number of instances of R 1 , wherein each instance of R 1 is covalently linked via attachment point A to
  • the anti-TfRl antibody is a Fab fragment.
  • the anti-TfRl antibody comprises a heavy chain variable region (VH) comprising the amino acid sequence of SEQ ID NO: 17 and a light chain variable region (VL) comprising the amino acid sequence of SEQ ID NO: 18.
  • VH heavy chain variable region
  • VL light chain variable region
  • the anti-TfRl antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20.
  • the administration occurs one or more times.
  • the effective amount of each administration provides to the subject 10 mg to 110 mg of the anti-TfRl antibodies of the complexes per kg of the subject.
  • the effective amount of each administration provides to the subject 5 mg to 90 mg of the anti-TfRl antibodies of the complexes per kg of the subject.
  • the effective amount of each administration provides to the subject 10 mg to 20 mg of the anti-TfRl antibodies of the complexes per kg of the subject. [00018] In some embodiments, the effective amount of each administration provides to the subject 13 mg of the anti-TfRl antibodies of the complexes per kg of the subject.
  • the effective amount of each administration provides to the subject 18 mg to 36 mg of the anti-TfRl antibodies of the complexes per kg of the subject. [00020] In some embodiments, the effective amount of each administration provides to the subject 25 mg of the anti-TfRl antibodies of the complexes per kg of the subject.
  • the effective amount of each administration provides to the subject 36 mg to 72 mg of the anti-TfRl antibodies of the complexes per kg of the subject. [00022] In some embodiments, the effective amount of each administration provides to the subject 50 mg of the anti-TfRl antibodies of the complexes per kg of the subject.
  • the effective amount of each administration provides to the subject 55 mg to 110 mg of the anti-TfRl antibodies of the complexes per kg of the subject.
  • the effective amount of each administration provides to the subject 75 mg of the anti-TfRl antibodies of the complexes per kg of the subject.
  • the effective amount of each administration provides to the subject 6 mg to 12 mg of the anti-TfRl antibodies of the complexes per kg of the subject.
  • the effective amount of each administration provides to the subject 8 mg of the anti-TfRl antibodies of the complexes per kg of the subject.
  • the effective amount of each administration provides to the subject 11 mg to 22 mg of the anti-TfRl antibodies of the complexes per kg of the subject. [00028] In some embodiments, the effective amount of each administration provides to the subject 15 mg of the anti-TfRl antibodies of the complexes per kg of the subject.
  • the effective amount of each administration provides to the subject 22 mg to 44 mg of the anti-TfRl antibodies of the complexes per kg of the subject. [00030] In some embodiments, the effective amount of each administration provides to the subject 30 mg of the anti-TfRl antibodies of the complexes per kg of the subject. [00031] In some embodiments, the effective amount of each administration provides to the subject 44 mg to 88 mg of the anti-TfRl antibodies of the complexes per kg of the subject. [00032] In some embodiments, the effective amount of each administration provides to the subject 60 mg of the anti-TfRl antibodies of the complexes per kg of the subject.
  • the effective amount of each administration provides to the subject 20 mg to 43 mg of the anti-TfRl antibodies of the complexes per kg of the subject. In some embodiments, the effective amount of each administration provides to the subject 29 mg of the anti-TfRl antibodies of the complexes per kg of the subject.
  • the effective amount of each administration provides to the subject 26 mg to 53 mg of the anti-TfRl antibodies of the complexes per kg of the subject. [00035] In some embodiments, the effective amount of each administration provides to the subject 37 mg of the anti-TfRl antibodies of the complexes per kg of the subject.
  • the composition is administered once every 4 weeks, once every 8 weeks, or once every 12 weeks. In some embodiments, the period of administration is less than 10 years. In some embodiments, the period of administration is the remainder of the subject’s lifetime.
  • the composition is administered once every 4 weeks during a first period of administration, and subsequently administered once every 8 weeks during a second period of administration.
  • the first period of administration is 8-16 weeks
  • the second period of administration is 16 weeks to the remainder of the subject’s lifetime.
  • the composition is in the form of an aqueous solution and further comprises tris(hydroxymethyl)aminomethane and sucrose.
  • the tris(hydroxymethyl)aminomethane is present in the aqueous solution at a concentration of 25 mM
  • the sucrose is present in the aqueous solution at a concentration of 10 ⁇ IN%
  • the aqueous solution is at a pH of 7.5.
  • the complexes are present in the composition at a concentration in the range of 10 mg/mL to 50 mg/mL.
  • the administering reduces DMPK expression in a muscle cell of the subject.
  • reducing DMPK expression comprises reducing the amount of DMPK RNA in the muscle cell.
  • the DMPK RNA amount is reduced in the nucleus of the muscle cell.
  • reducing DMPK expression in the muscle cell comprises reducing the amount of DMPK protein in the muscle cell.
  • the subject is human.
  • the complex is administered systemically. In some embodiments, the complex is administered intravenously. In some embodiments, the complex is administered by infusion.
  • the composition further comprises one or more anti- TfRl antibodies that are not covalently linked to an oligonucleotide.
  • FIGs. 1A-1D show the amount of DMPK- targeting oligonucleotide (ASO) in the heart (FIG. 1A), diaphragm (FIG. IB), gastrocnemius (FIG. 1C), or tibialis anterior (FIG. ID), respectively, after administration of conjugates containing an anti-TfRl Fab covalently linked to the ASO.
  • ASO DMPK- targeting oligonucleotide
  • FIGs. 2A-2D show the ability of conjugates containing an anti-TfRl Fab conjugated to a DMPK-targeting oligonucleotide (ASO) to knock down human DMPK RNA in the heart (FIG. 2A), diaphragm (FIG. 2B), tibialis anterior (FIG. 2C) and gastrocnemius (FIG. 2D) of mice expressing both human TfRl and two copies of a mutant human DMPK transgene that harbors expanded CTG repeats.
  • ASO DMPK-targeting oligonucleotide
  • FIGs. 3A-3B show reduced DMPK foci in nuclei of cardiac muscle fibers in mice expressing both human TfRl and two copies of a mutant human DMPK transgene that harbors expanded CTG repeats and treated with anti-TfRl Fab conjugated to DMPK-targeting oligonucleotide (ASO).
  • FIG. 3A shows representative images of samples following in situ hybridization staining for DMPK foci and fluorescence staining of myofibers (inset panels). In the microscopy images shown in FIG. 3A, the light rounded shapes show cell nuclei, and the bright puncta within the nuclei show DMPK foci.
  • FIG. 3B shows quantification of DMPK foci.
  • FIG. 4 shows the splicing correction activity of conjugates containing an anti-TfRl Fab covalently linked to a DMPK-targeting oligonucleotide (ASO) in the heart of mice expressing both human TfRl and two copies of a mutant human DMPK transgene that harbors expanded CTG repeats (hTfRl/DMSXL mice).
  • ASO DMPK-targeting oligonucleotide
  • FIG. 5 shows the splicing correction activity of conjugates containing an anti-TfRl Fab covalently linked to a DMPK-targeting oligonucleotide (ASO) in the diaphragm of mice expressing both human TfRl and two copies of a mutant human DMPK transgene that harbors expanded CTG repeats (hTfRl/DMSXL mice).
  • ASO DMPK-targeting oligonucleotide
  • FIG. 6 shows the splicing correction activity of conjugates containing an anti-TfRl Fab covalently linked to a DMPK-targeting oligonucleotide (ASO) in the tibialis anterior of mice expressing both human TfRl and two copies of a mutant human DMPK transgene that harbors expanded CTG repeats (hTfRl/DMSXL mice).
  • ASO DMPK-targeting oligonucleotide
  • FIG. 7 shows the splicing correction activity of conjugates containing an anti-TfRl Fab covalently linked to a DMPK-targeting oligonucleotide (ASO) in the gastrocnemius of mice expressing both human TfRl and two copies of a mutant human DMPK transgene that harbors expanded CTG repeats (hTfRl/DMSXL mice).
  • ASO DMPK-targeting oligonucleotide
  • Composite splicing indices based on splicing of Mbnl2 exon 6, Nfix exon 7, and Tin exon 313 are shown for control mice treated with vehicle control (“hTfRl - PBS”), hTfRl/DMSXL mice treated with vehicle control (“hTfRl/DMSXL - PBS”), and hTfRl/DMSXL mice treated with anti-TfRl Fab-ASO conjugate (“hTfRl/DMSXL - Conjugate”).
  • FIG. 8 shows DMPK knockdown in DM1 patient myotubes and wild-type nonhuman primate (NHP) myotubes resulting from incubation with conjugates containing an anti- TfRl Fab covalently linked to a DMPK-targeting oligonucleotide (ASO).
  • FIGs. 9A-9D show DMPK expression in the heart (FIG. 9A), diaphragm (FIG. 9B), tibialis anterior (FIG. 9C), or gastrocnemius (FIG. 9D), respectively, of mice over 12 weeks after administration of conjugates containing an anti-TfRl Fab covalently linked to a DMPK-targeting ASO.
  • FIGs. 10A-10D show tissue DMPK expression in the heart (FIG. 10A), diaphragm (FIG. 10B), tibialis anterior (FIG. IOC), or gastrocnemius (FIG. 10D), respectively, of mice after administration of conjugates containing an anti-TfRl Fab covalently linked to a DMPK- targeting ASO.
  • the conjugates were administered as either one 10 mg/kg ASO-equivalent dose (“10”), two 5 mg/kg ASO-equivalent doses one week apart (“2 x 5 Weekly”), or two 5 mg/kg ASO-equivalent doses two weeks apart (“2 x 5 Every 2 weeks”).
  • FIGs. 11A-11D show DMPK expression in the heart (FIG. 11A), diaphragm (FIG. 11B), tibialis anterior (FIG. 11C), or gastrocnemius (FIG. 11D), respectively, of mice after administration of varying dosages of conjugates containing an anti-TfRl Fab covalently linked to a DMPK-targeting ASO.
  • the conjugates were administered as either one 5 mg/kg ASO- equivalent dose (“5”), one 10 mg/kg ASO-equivalent dose (“10”), or one 20 mg/kg ASO- equivalent dose (“20”), four weeks after which tissue DMPK levels were measured.
  • FIGs. 12A-12D show DMPK expression in the heart (FIG. 12A), diaphragm (FIG. 12B), tibialis anterior (FIG. 12C), or gastrocnemius (FIG. 12D), respectively, of mice after administration varying dosages of conjugates containing an anti-TfRl Fab covalently linked to a DMPK-targeting ASO.
  • the conjugates were administered as either two 5 mg/kg ASO- equivalent doses administered one week apart (“2 x 5”) or two 10 mg/kg ASO-equivalent doses administered one week apart (“2 x 10”).
  • Tissue DMPK levels were measured four weeks after administration of the first dose and are presented relative to vehicle-treated controls (“Vehicle”).
  • FIGs. 13A-13D show DMPK expression in the heart (FIG. 13A), diaphragm (FIG. 13B), tibialis anterior (FIG. 13C), or gastrocnemius (FIG. 13D), respectively, of mice after administration of varying dosages of conjugates containing an anti-TfRl Fab covalently linked to a DMPK-targeting ASO.
  • the conjugates were administered as four 5 mg/kg ASO- equivalent doses (“4 x 5”) or four 10 mg/kg ASO-equivalent doses (“4 x 10”), each dose administered four weeks apart (on days 0, 28, 56, and 84, respectively).
  • FIGs. 14A-14B show DMPK expression the gastrocnemius (FIG. 14A) and tibialis anterior (FIG. 14B), respectively, of non-human primates after administration of 10 mg/kg ASO-equivalent of conjugates containing an anti-TfRl Fab covalently linked to a DMPK- targeting ASO.
  • Tissue DMPK levels were measured 4, 8 and 12 weeks after administration of the conjugates and are presented relative to vehicle-treated controls. Data are shown as means ⁇ standard deviation. Statistics were calculated by unpaired t-test (*, P ⁇ 0.05).
  • FIGs. 15A-15D show DMPK expression the heart (FIG. 15A), diaphragm (FIG. 15B), tibialis anterior (FIG. 15C), or gastrocnemius (FIG. 15D), respectively, of non-human primates after administration of 5 mg/kg (“5”) or 10 mg/kg (“10”) ASO-equivalent of conjugates containing an anti-TfRl Fab covalently linked to a DMPK-targeting ASO.
  • tissue DMPK levels were measured after four weeks and are presented relative to vehicle-treated controls (“Vehicle”). Data are shown as means + standard deviation. Statistics were calculated by one-way ANOVA (*, P ⁇ 0.05; **, P ⁇ 0.01).
  • FIGs. 16A-16G show DMPK expression in the heart (FIG. 16A), diaphragm (FIG. 16B), tibialis anterior (FIG. 16C), gastrocnemius (FIG. 16D), masseter (FIG. 16E), esophagus (FIG. 16F), or duodenum (FIG. 16G) respectively, of non-human primates after administration of either two 5 mg/kg ASO-equivalent doses (“2 x 5”) or two 10 mg/kg ASO- equivalent doses (“2 x 10”) of conjugates containing an anti-TfRl Fab covalently linked to a DMPK-targeting ASO.
  • tissue DMPK levels were measured four weeks after the final dose and are presented relative to vehicle-treated controls (“Vehicle”). Data are shown as means + standard deviation. Statistics were calculated by one-way ANOVA followed by an uncorrected Fisher’s Least Significant Difference (LSD) test (*, P ⁇ 0.05; **, P ⁇ 0.01; ***, P ⁇ 0.001). DETAILED DESCRIPTION OF INVENTION
  • the present disclosure provides methods of reducing expression or activity of DMPK (e.g., reducing the level of a mutant or wild-type DMPK RNA) and/or methods of treating myotonic dystrophy (e.g., DM1) in a subject.
  • DMPK e.g., reducing the level of a mutant or wild-type DMPK RNA
  • myotonic dystrophy e.g., DM1
  • the methods described herein comprise administering to the subject a composition comprising an effective amount of muscle targeting complexes, each complex comprising an anti-transferrin receptor 1 (TfRl) antibody covalently linked to one or more oligonucleotides, wherein the effective amount provides to the subject 0.5 mg to 20 mg (e.g., about 1 mg to about 12 mg, about 1.8 mg, about 3.4 mg, about 6.8 mg, or about 10.2 mg) of the oligonucleotides of the complexes per kg of the subject. In some embodiments, the effective amount provides to the subject about 4 mg or about 5 mg of the oligonucleotides of the complexes per kg of the subject.
  • TfRl anti-transferrin receptor 1
  • the effective amount provides to the subject 2 mg to 220 mg (e.g., about 5 mg to about 110 mg, about 13 mg, about 25 mg, about 50 mg, or about 75 mg) of the anti-TfRl antibody (e.g., Fab) of the complexes per kg of the subject. In some embodiments, the effective amount provides to the subject about 29 mg or about 37 mg of the anti-TfRl antibody (e.g., Fab) of the complexes per kg of the subject. In some embodiments, the administration is once every two weeks to once every 12 weeks (e.g., once every two weeks, once every four weeks, once every 8 weeks, or once every 12 weeks). In some embodiments, the subject has a DMPK allele associated with DM1 (e.g., wherein the DMPK allele comprises a DM1 disease-associated repeat expansion).
  • Administering means to provide a complex to a subject in a manner that is physiologically and/or (e.g., and) pharmacologically useful (e.g., to treat a condition in the subject).
  • an antibody refers to a polypeptide that includes at least one immunoglobulin variable domain or at least one antigenic determinant, e.g., paratope that specifically binds to an antigen.
  • an antibody is a full- length antibody.
  • an antibody is a chimeric antibody.
  • an antibody is a humanized antibody.
  • an antibody is a Fab fragment, a Fab’ fragment, a F(ab')2 fragment, a Fv fragment or a scFv fragment.
  • an antibody is a nanobody derived from a camelid antibody or a nanobody derived from shark antibody.
  • an antibody is a diabody.
  • an antibody comprises a framework having a human germline sequence.
  • an antibody comprises a heavy chain constant domain selected from the group consisting of IgG, IgGl, IgG2, IgG2A, IgG2B, IgG2C, IgG3, IgG4, IgAl, IgA2, IgD, IgM, and IgE constant domains.
  • an antibody comprises a heavy (H) chain variable region (abbreviated herein as VH), and/or (e.g., and) a light (L) chain variable region (abbreviated herein as VL).
  • an antibody comprises a constant domain, e.g., an Fc region.
  • An immunoglobulin constant domain refers to a heavy or light chain constant domain. Human IgG heavy chain and light chain constant domain amino acid sequences and their functional variations are known.
  • the heavy chain of an antibody described herein can be an alpha (a), delta (A), epsilon (E), gamma (y) or mu (p) heavy chain.
  • the heavy chain of an antibody described herein can comprise a human alpha (a), delta (A), epsilon (E), gamma (y) or mu (p) heavy chain.
  • an antibody described herein comprises a human gamma 1 CHI, CH2, and/or (e.g., and) CH3 domain.
  • the amino acid sequence of the VH domain comprises the amino acid sequence of a human gamma (y) heavy chain constant region, such as any known in the art. Non-limiting examples of human constant region sequences have been described in the art, e.g., see U.S. Pat. No. 5,693,780 and Kabat E A et al., (1991) supra.
  • the VH domain comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or at least 99% identical to any of the variable chain constant regions provided herein.
  • an antibody is modified, e.g., modified via glycosylation, phosphorylation, sumoylation, and/or (e.g., and) methylation.
  • an antibody is a glycosylated antibody, which is conjugated to one or more sugar or carbohydrate molecules.
  • the one or more sugar or carbohydrate molecule are conjugated to the antibody via N-glycosylation, O-glycosylation, C-glycosylation, glypiation (GPI anchor attachment), and/or (e.g., and) phosphoglycosylation.
  • the one or more sugar or carbohydrate molecule are monosaccharides, disaccharides, oligosaccharides, or glycans. In some embodiments, the one or more sugar or carbohydrate molecule is a branched oligosaccharide or a branched glycan. In some embodiments, the one or more sugar or carbohydrate molecule includes a mannose unit, a glucose unit, an N-acetylglucosamine unit, an N-acetylgalactosamine unit, a galactose unit, a fucose unit, or a phospholipid unit.
  • an antibody is a construct that comprises a polypeptide comprising one or more antigen binding fragments of the disclosure linked to a linker polypeptide or an immunoglobulin constant domain.
  • Linker polypeptides comprise two or more amino acid residues joined by peptide bonds and are used to link one or more antigen binding portions. Examples of linker polypeptides have been reported (see e.g., Holliger, P., et al. (1993) Proc. Natl. Acad. Sci. USA 90:6444-6448; Poljak, R. J., et al. (1994) Structure 2: 1121-1123).
  • an antibody may be part of a larger immunoadhesion molecule, formed by covalent or noncovalent association of the antibody or antibody portion with one or more other proteins or peptides.
  • immunoadhesion molecules include use of the streptavidin core region to make a tetrameric scFv molecule (Kipriyanov, S. M., et al. (1995) Human Antibodies and Hybridomas 6:93-101) and use of a cysteine residue, a marker peptide and a C-terminal polyhistidine tag to make bivalent and biotinylated scFv molecules (Kipriyanov, S. M., et al. (1994) Mol. Immunol. 31:1047-1058).
  • CDR refers to the complementarity determining region within antibody variable sequences.
  • a typical antibody molecule comprises a heavy chain variable region (VH) and a light chain variable region (VL), which are usually involved in antigen binding.
  • VH and VL regions can be further subdivided into regions of hypervariability, also known as “complementarity determining regions” (“CDR”), interspersed with regions that are more conserved, which are known as “framework regions” (“FR”).
  • CDR complementarity determining regions
  • FR framework regions
  • Each VH and VL is typically composed of three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.
  • the extent of the framework region and CDRs can be precisely identified using methodology known in the art, for example, by the Kabat definition, the IMGT definition, the Chothia definition, the AbM definition, and/or (e.g., and) the contact definition, all of which are well known in the art. See, e.g., Kabat, E.A., et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No. 91-3242; IMGT®, the international ImMunoGeneTics information system® http://www.imgt.org, Lefranc, M.-P.
  • a CDR may refer to the CDR defined by any method known in the art. Two antibodies having the same CDR means that the two antibodies have the same amino acid sequence of that CDR as determined by the same method, for example, the IMGT definition.
  • CDR1 There are three CDRs in each of the variable regions of the heavy chain and the light chain, which are designated CDR1, CDR2 and CDR3, for each of the variable regions.
  • CDR set refers to a group of three CDRs that occur in a single variable region capable of binding the antigen. The exact boundaries of these CDRs have been defined differently according to different systems. The system described by Kabat (Kabat et al., Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, Md. (1987) and (1991)) not only provides an unambiguous residue numbering system applicable to any variable region of an antibody, but also provides precise residue boundaries defining the three CDRs.
  • CDRs may be referred to as Kabat CDRs.
  • Sub-portions of CDRs may be designated as LI, L2 and L3 or Hl, H2 and H3 where the "L” and the "H” designates the light chain and the heavy chains regions, respectively.
  • These regions may be referred to as Chothia CDRs, which have boundaries that overlap with Kabat CDRs.
  • Other boundaries defining CDRs overlapping with the Kabat CDRs have been described by Padlan (FASEB J. 9:133-139 (1995)) and MacCallum (J Mol Biol 262(5):732-45 (1996)).
  • CDR boundary definitions may not strictly follow one of the above systems, but will nonetheless overlap with the Kabat CDRs, although they may be shortened or lengthened in light of prediction or experimental findings that particular residues or groups of residues or even entire CDRs do not significantly impact antigen binding.
  • the methods used herein may utilize CDRs defined according to any of these systems. Examples of CDR definition systems are provided in Table 1. Table 1. CDR Definitions
  • Complementary refers to the capacity for precise pairing between two nucleotides or two sets of nucleotides.
  • complementary is a term that characterizes an extent of hydrogen bond pairing that brings about binding between two nucleotides or two sets of nucleotides. For example, if a base at one position of an oligonucleotide is capable of hydrogen bonding with a base at the corresponding position of a target nucleic acid (e.g., an mRNA), then the bases are considered to be complementary to each other at that position.
  • a target nucleic acid e.g., an mRNA
  • Base pairings may include both canonical Watson-Crick base pairing and non-Watson-Crick base pairing (e.g., Wobble base pairing and Hoogsteen base pairing).
  • adenosine-type bases are complementary to thymidine-type bases (T) or uracil- type bases (U)
  • cytosine-type bases are complementary to guanosine-type bases (G)
  • universal bases such as 3 -nitropyrrole or 5-nitroindole can hybridize to and are considered complementary to any A, C, U, or T.
  • Inosine (I) has also been considered in the art to be a universal base and is considered complementary to any A, C, U or T.
  • Covalently linked refers to a characteristic of two or more molecules being linked together via at least one covalent bond.
  • two molecules can be covalently linked together by a single bond, e.g., a disulfide bond or disulfide bridge, that serves as a linker between the molecules.
  • two or more molecules can be covalently linked together via a molecule that serves as a linker that joins the two or more molecules together through multiple covalent bonds.
  • a linker may be a cleavable linker.
  • a linker may be a non-cleavable linker.
  • Disease-associated-repeat refers to a repeated nucleotide sequence at a genomic location for which the number of units of the repeated nucleotide sequence is correlated with and/or (e.g., and) directly or indirectly contributes to, or causes, genetic disease.
  • Each repeating unit of a disease associated repeat may be 2, 3, 4, 5 or more nucleotides in length.
  • a disease associated repeat is a dinucleotide repeat.
  • a disease associated repeat is a trinucleotide repeat.
  • a disease associated repeat is a tetranucleotide repeat.
  • a disease associated repeat is a pentanucleotide repeat.
  • the disease-associated-repeat comprises CAG repeats, CTG repeats, CUG repeats, CGG repeats, CCTG repeats, or a nucleotide complement of any thereof.
  • a disease-associated-repeat is in a non-coding portion of a gene.
  • a disease-associated-repeat is in a coding region of a gene.
  • a disease-associated-repeat is expanded from a normal state to a length that directly or indirectly contributes to, or causes, genetic disease.
  • a disease-associated-repeat is in RNA (e.g., an RNA transcript). In some embodiments, a disease-associated-repeat is in DNA (e.g., a chromosome, a plasmid). In some embodiments, a disease-associated-repeat is expanded in a chromosome of a germline cell. In some embodiments, a disease-associated-repeat is expanded in a chromosome of a somatic cell. In some embodiments, a disease-associated-repeat is expanded to a number of repeating units that is associated with congenital onset of disease.
  • a disease- associated-repeat is expanded to a number of repeating units that is associated with childhood onset of disease. In some embodiments, a disease-associated-repeat is expanded to a number of repeating units that is associated with adult onset of disease.
  • the DMPK gene comprises a disease-associated repeat of CTG units.
  • DMPK refers to a gene that encodes myotonin-protein kinase (also known as myotonic dystrophy protein kinase or dystrophia myotonica protein kinase), a serine/threonine protein kinase. Substrates for this enzyme may include myogenin, the beta-subunit of the L-type calcium channels, and phospholemman.
  • DMPK may be a human (Gene ID: 1760), non-human primate (e.g., Gene ID: 456139, Gene ID: 715328, Gene ID: 102125829), or rodent gene (e.g., Gene ID: 13400).
  • DM1 myotonic dystrophy type I
  • multiple human transcript variants e.g., as annotated under GenBank RefSeq Accession Numbers: NM_001081563.2, NM_004409.4, NM_001081560.2, NM_001081562.2, NM_001288764.1, NM_001288765.1, and NM_001288766.1 have been characterized that encode different protein isoforms.
  • DMPK allele refers to any one of alternative forms (e.g., wild-type or mutant forms) of a DMPK gene.
  • a DMPK allele may encode for wild-type myotonin-protein kinase that retains its normal and typical functions.
  • a DMPK allele may comprise one or more disease- associated-repeat expansions.
  • normal subjects have two DMPK alleles comprising in the range of 5 to 37 repeat units.
  • the number of CTG repeat units in subjects having DM1 is in the range of about 50 to about 3,000 or more, with higher numbers of repeats leading to an increased severity of disease.
  • mildly affected DM1 subjects have at least one DMPK allele having in the range of 50 to 150 repeat units.
  • subjects with classic DM1 have at least one DMPK allele having in the range of 100 to 1,000 or more repeat units.
  • subjects having DM1 with congenital onset may have at least one DMPK allele comprising more than 2,000 repeat units.
  • Framework refers to the remaining sequences of a variable region minus the CDRs. Because the exact definition of a CDR sequence can be determined by different systems, the meaning of a framework sequence is subject to correspondingly different interpretations.
  • the six CDRs also divide the framework regions on the light chain and the heavy chain into four sub-regions (FR1, FR2, FR3 and FR4) on each chain, in which CDR1 is positioned between FR1 and FR2, CDR2 between FR2 and FR3, and CDR3 between FR3 and FR4.
  • a framework region represents the combined FRs within the variable region of a single, naturally occurring immunoglobulin chain.
  • a FR represents one of the four sub-regions, and FRs represents two or more of the four sub-regions constituting a framework region.
  • Human heavy chain and light chain acceptor sequences are known in the art. In one embodiment, the acceptor sequences known in the art may be used in the antibodies disclosed herein.
  • Human antibody is intended to include antibodies having variable and constant regions derived from human germline immunoglobulin sequences.
  • the human antibodies of the disclosure may include amino acid residues not encoded by human germline immunoglobulin sequences (e.g., mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo), for example in the CDRs and in particular CDR3.
  • the term "human antibody”, as used herein, is not intended to include antibodies in which CDR sequences derived from the germline of another mammalian species, such as a mouse, have been grafted onto human framework sequences.
  • Humanized antibody refers to antibodies which comprise heavy and light chain variable region sequences from a non-human species e.g., a mouse) but in which at least a portion of the VH and/or (e.g., and) VL sequence has been altered to be more "human-like", i.e., more similar to human germline variable sequences.
  • One type of humanized antibody is a CDR-grafted antibody, in which human CDR sequences are introduced into non-human VH and VL sequences to replace the corresponding nonhuman CDR sequences.
  • humanized anti-transferrin receptor antibodies and antigen binding portions are provided.
  • Such antibodies may be generated by obtaining murine anti-transferrin receptor monoclonal antibodies using traditional hybridoma technology followed by humanization using in vitro genetic engineering, such as those disclosed in Kasaian et al PCT publication No. WO 2005/123126 A2.
  • Kabat numbering The terms "Kabat numbering", “Kabat definitions and “Kabat labeling” are used interchangeably herein. These terms, which are recognized in the art, refer to a system of numbering amino acid residues which are more variable (i.e. hypervariable) than other amino acid residues in the heavy and light chain variable regions of an antibody, or an antigen binding portion thereof (Kabat et al. (1971) Ann. NY Acad, Sci. 190:382-391 and, Kabat, E. A., et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No. 91-3242).
  • the hypervariable region ranges from amino acid positions 31 to 35 for CDR1, amino acid positions 50 to 65 for CDR2, and amino acid positions 95 to 102 for CDR3.
  • the hypervariable region ranges from amino acid positions 24 to 34 for CDR1, amino acid positions 50 to 56 for CDR2, and amino acid positions 89 to 97 for CDR3.
  • Myotonic dystrophy refers to a genetic disease caused by mutations in the DMPK gene or CNBP (ZNF9) gene that is characterized by muscle loss, muscle weakening, and muscle function. Two types of the disease, myotonic dystrophy type 1 (DM1) and myotonic dystrophy type 2 (DM2), have been described. DM1 is associated with an expansion of a CTG trinucleotide repeat in the 3' non-coding region of DMPK. DM2 is associated with an expansion of a CCTG tetranucleotide repeat in the first intron of ZNF9.
  • DM1 and DM2 the nucleotide expansions lead to toxic RNA repeats capable of forming hairpin structures that bind critical intracellular proteins, e.g., muscleblind-like proteins, with high affinity.
  • Myotonic dystrophy the genetic basis for the disease, and related symptoms are described in the art (see, e.g. Thornton, C.A., “Myotonic Dystrophy” Neurol Clin. (2014), 32(3): 705-719.; and Konieczny et al. “Myotonic dystrophy: candidate small molecule therapeutics” Drug Discovery Today (2017), 22:11).
  • subjects are born with a variation of DM1 called congenital myotonic dystrophy.
  • DM1 is associated with Online Mendelian Inheritance in Man (OMIM) Entry # 160900.
  • DM2 is associated with OMIM Entry # 602668.
  • oligonucleotide refers to an oligomeric nucleic acid compound of up to 200 nucleotides in length.
  • oligonucleotides include, but are not limited to, RNAi oligonucleotides (e.g., siRNAs, shRNAs), microRNAs, gapmers, mixmers, phosphorodiamidate morpholinos, peptide nucleic acids, aptamers, guide nucleic acids (e.g., Cas9 guide RNAs), etc.
  • Oligonucleotides may be single- stranded or double-stranded.
  • an oligonucleotide may comprise one or more modified nucleosides (e.g., 2'-O-methyl sugar modifications, purine or pyrimidine modifications).
  • an oligonucleotide may comprise one or more modified intemucleoside linkage.
  • an oligonucleotide may comprise one or more phosphorothioate linkages, which may be in the Rp or Sp stereochemical conformation.
  • Region of complementarity refers to a nucleotide sequence, e.g., of an oligonucleotide, that is sufficiently complementary to a cognate nucleotide sequence, e.g., of a target nucleic acid, such that the two nucleotide sequences are capable of annealing to one another under physiological conditions (e.g., in a cell).
  • a region of complementarity is fully complementary to a cognate nucleotide sequence of target nucleic acid.
  • a region of complementarity is partially complementary to a cognate nucleotide sequence of target nucleic acid (e.g., at least 80%, 90%, 95% or 99% complementarity). In some embodiments, a region of complementarity contains 1, 2, 3, or 4 mismatches compared with a cognate nucleotide sequence of a target nucleic acid.
  • the term “specifically binds” refers to the ability of a molecule to bind to a binding partner with a degree of affinity or avidity that enables the molecule to be used to distinguish the binding partner from an appropriate control in a binding assay or other binding context.
  • the term, “specifically binds”, refers to the ability of the antibody to bind to a specific antigen with a degree of affinity or avidity, compared with an appropriate reference antigen or antigens, that enables the antibody to be used to distinguish the specific antigen from others, e.g., to an extent that permits preferential targeting to certain cells, e.g., muscle cells, through binding to the antigen, as described herein.
  • an antibody specifically binds to a target if the antibody has a KD for binding the target of at least about 10’ 4 M, 10’ 5 M, 10’ 6 M, IO’ 7 M, 10’ 8 M, 10’ 9 M, IO’ 10 M, 10’ 11 M, 10 12 M, 10’ 13 M, or less.
  • an antibody specifically binds to the transferrin receptor, e.g., an epitope of the apical domain of transferrin receptor.
  • Subject refers to a mammal.
  • a subject is non-human primate, or rodent.
  • a subject is a human.
  • a subject is a patient, e.g., a human patient that has or is suspected of having a disease.
  • the subject is a human patient who has or is suspected of having a disease resulting from a disease-associated-repeat expansion, e.g., in a DMPK allele.
  • Transferrin receptor As used herein, the term, “transferrin receptor” (also known as TFRC, CD71, p90, TFR, or TFR1) refers to an internalizing cell surface receptor that binds transferrin to facilitate iron uptake by endocytosis.
  • a transferrin receptor may be of human (NCBI Gene ID 7037), non-human primate (e.g., NCBI Gene ID 711568 or NCBI Gene ID 102136007), or rodent (e.g., NCBI Gene ID 22042) origin.
  • multiple human transcript variants have been characterized that encoded different isoforms of the receptor (e.g., as annotated under GenBank RefSeq Accession Numbers: NP_001121620.1, NP_003225.2, NP_001300894.1, and NP_001300895.1).
  • 2’-modified nucleoside As used herein, the terms “2’-modified nucleoside” and “2’ -modified ribonucleoside” are used interchangeably and refer to a nucleoside having a sugar moiety modified at the 2’ position. In some embodiments, the 2’ -modified nucleoside is a 2’-4’ bicyclic nucleoside, where the 2’ and 4’ positions of the sugar are bridged (e.g., via a methylene, an ethylene, or a (S)-constrained ethyl bridge).
  • the 2’- modified nucleoside is a non-bicyclic 2’-modified nucleoside, e.g., where the 2’ position of the sugar moiety is substituted.
  • Non-limiting examples of 2’-modified nucleosides include: 2’- deoxy, 2’-fluoro (2’-F), 2’-O-methyl (2’-0-Me), 2’-O-methoxyethyl (2’-M0E), 2’-O- aminopropyl (2’-O-AP), 2’-O-dimethylaminoethyl (2’-0-DMA0E), 2’-O- dimethylaminopropyl (2’-0-DMAP), 2’-O-dimethylaminoethyloxyethyl (2’-0-DMAE0E), 2’-
  • the 2’ -modified nucleosides described herein are high-affinity modified nucleotides and oligonucleotides comprising the 2’-modified nucleosides have increased affinity to a target sequences, relative to an unmodified oligonucleotide. Examples of structures of 2’-modified nucleosides are provided below:
  • a complex that comprise a targeting agent, e.g., an antibody, covalently linked to an oligonucleotide.
  • a complex comprises a muscle-targeting antibody covalently linked to one or more oligonucleotides.
  • the oligonucleotide is an antisense oligonucleotide that targets a DMPK RNA to reduce expression or activity of DMPK (e.g., reduce the level of a mutant or wild-type DMPK RNA, or the activity of a DMPK gene product).
  • Complexes described herein generally comprise a linker that covalently links an antibody (e.g., an anti-TfRl antibody) described herein to an oligonucleotide (e.g., an oligonucleotide comprising a 5’-X-Y-Z-3’ configuration).
  • a linker comprises at least one covalent bond.
  • complexes described herein comprise a structure of formula (I): [ R 1 ] >, i -R 2 , in which each R 1 independently comprises a compound comprising an oligonucleotide (e.g., an oligonucleotide comprising a 5’-X-Y-Z-3’ configuration) and R 2 comprises an antibody (e.g., an anti-TfRl antibody), and wherein in each complex nl is independently an integer (e.g., one or greater) representing the number of instances of R 1 in each complex.
  • each R 1 independently comprises a group comprising an oligonucleotide.
  • each R 1 independently comprises a group that comprises additional elements in addition to an oligonucleotide.
  • R 2 comprises an antibody (e.g., an anti-TfRl antibody) comprising a heavy chain comprising a heavy chain variable region (VH) and a heavy chain constant region, and a light chain comprising a light chain variable region (VL) and a light chain constant region.
  • each R 1 of a complex is independently covalently linked to a different amino acid residue (e.g., lysine or cysteine) of R 2 .
  • nl is independently an integer (e.g., one or greater).
  • the antibody comprises a sequence as set forth in Table 2.
  • the antibody comprises a heavy chain complementarity determining region 1 (CDR-H1) comprising a sequence as set forth in SEQ ID NOs: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising a sequence as set forth in SEQ ID NOs: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising a sequence as set forth in SEQ ID NOs: 3, 9, or 14; and/or comprises a light chain complementarity determining region 1 (CDR-L1) comprising a sequence as set forth in SEQ ID NOs: 4, 10, or 15, a light chain complementarity determining region 2 (CDR- L2) comprising a sequence as set forth in SEQ ID NOs: 5 or 11, and a light chain complementarity determining region 3 (CDR-H1) comprising a sequence as set forth in SEQ ID NOs: 1,
  • the antibody comprises a heavy chain variable region (VH) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 17 and/or comprises a light chain variable region (VL) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 18.
  • VH heavy chain variable region
  • VL light chain variable region
  • the antibody comprises a VH comprising the amino acid sequence of SEQ ID NO: 17 and/or comprises a VL comprising the amino acid sequence of SEQ ID NO: 18.
  • the antibody comprises a heavy chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 19 and/or comprises a light chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO:
  • the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and/or comprises a light chain comprising the amino acid sequence of SEQ ID NO: 20.
  • the antibody is a Fab fragment, a full- length IgG, a Fab' fragment, a F(ab')2 fragment, an scFv, or an Fv.
  • the antibody is a Fab fragment.
  • the value of nl of each or any complex is an integer up to the number of amino acid residues in the antibody to which conjugation is desired or targeted (e.g., the number of lysine residues).
  • the value of nl is independently selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,
  • compositions described herein comprise complexes that comprise a structure of formula (I): [R ⁇ ni-R 2 , wherein nl is 0.
  • the average value of nl of complexes of the composition is in the range of 0.5 to 5 (e.g., 0.5-5, 1-5, 1-4, 1-3, 3-5, 0.5-4, 0.5-3, 0.5-2, 0.5-1.5, 0.5-1, 0.7-1.5, 1-1.6, 1-1.5, 1-1.4, 1-1.3, 1-1.2, 1.1-1.5, 0.8-2, 0.8- 1.5, O.8-1.3, 0.8-1.2, 0.8-1.1, 0.9-3, 0.9-2, 0.9-1.8, 0.9-1.6, 0.9-1.5, 0.9-1.4, 0.9-1.3, or 0.9-1.2).
  • nl is independently an integer of one or greater representing the number of instances of R 1 in each complex of the complex type, and in which the different complex types of the composition are characterized by having different nl values (e.g., nl values in the range of 1-27, 1-26, 1-25, 1-20, 1-15, 1-10, 1-5, or 1-3).
  • compositions are provided (e.g., formulations comprising tris(hydroxymethyl)aminomethane and/or sucrose, as described herein) that comprise a plurality of different complexes.
  • the plurality of different complexes comprise a common targeting agent (e.g. an antibody) and a common oligonucleotide (e.g., an oligonucleotide comprising a 5’-X-Y-Z-3’ configuration, such as a DMPK-targeting oligonucleotide).
  • a common targeting agent e.g. an antibody
  • a common oligonucleotide e.g., an oligonucleotide comprising a 5’-X-Y-Z-3’ configuration, such as a DMPK-targeting oligonucleotide.
  • different complex types are characterized by having different numbers of oligonucleotides covalently linked to an antibody.
  • compositions comprise a plurality of complexes comprising a structure of formula (I): [R ⁇ ni-R 2 , in which each R 1 independently comprises a compound comprising an oligonucleotide (e.g., a DMPK-targeting oligonucleotide) and R 2 comprises an antibody (e.g., anti-TfRl antibody), and in which nl is an integer representing the number of instances of R 1 in a complex, and in which different complexes of the composition may have different nl values (e.g., nl values in the range of 1- 27, 1-26, 1-10, 1-5, or 1-3).
  • nl is an integer representing the number of instances of R 1 in a complex
  • different complexes of the composition may have different nl values (e.g., nl values in the range of 1- 27, 1-26, 1-10, 1-5, or 1-3).
  • nl is independently an integer.
  • the average value of nl of complexes of the composition is in the range of 0.5 to 5 (e.g., 0.5-5, 1-5, 1-4, 1-3, 3-5, 0.5-4, 0.5-3, 0.5-2, 0.5-
  • compositions described herein comprise complexes in which nl is 0.
  • a composition described herein comprises antibody that is not conjugated to an oligonucleotide (e.g., in trace amounts) and antibody conjugated to one or more oligonucleotides.
  • antibody that is not conjugated to an oligonucleotide may be referred to as a compound of the structure of formula (I): [R ⁇ ni-R 2 , for which nl is zero.
  • a composition for administration to a subject in the methods described herein comprises compounds (e.g., complexes) of the structure of formula (I): [R 'JHI-R 2 , for which each R 1 independently comprises a group comprising an oligonucleotide, R 2 comprises an antibody and nl is independently an integer of zero or greater that reflects the number of instances of R 1 in each compound (e.g., complex).
  • the fraction of compounds of the structure of formula (I): [R ⁇ ni-R 2 , in a composition, for which nl is zero, compared with all compounds of that structure in the composition for which nl is one or greater, is less than 10%, less than 5%, less than 1% less than 0.5%, less than 0.1%, less than 0.05%, or less than 0.01%.
  • the average value of nl of complexes in a composition disclosed herein is in the range of 0.5 to 5 (e.g., 0.5-5, 1-5, 1-4, 1-3, 3-5, 0.5-4, 0.5-3, 0.5-2, 0.5-1.5, 0.5-1, 0.7-1.5, 1-
  • each instance of R 1 in a complex is covalently linked to a different amino acid residue of the antibody.
  • an amino acid to which R 1 is covalently linked comprises an s-amino group (e.g., lysine, arginine).
  • an amino acid to which R 1 is covalently linked is a cysteine.
  • R 1 is directly covalently linked to an amino acid residue of the antibody.
  • R 1 is indirectly covalently linked to an amino acid of the antibody, e.g., covalently linked to a glycosylation site on the amino acid.
  • R 1 is not covalently linked to an amino acid residue residing in a CDR region of the antibody.
  • complexes provided herein comprise a structure of formula (I): [ R 1 J >, i -R 2 , in which each instance of R 1 independently comprises a group of the formula (la):
  • R 3 comprises an oligonucleotide, e.g., an oligonucleotide comprising a 5’-X-Y-Z-3’ configuration; and R 1 is covalently linked to R 2 at attachment point A.
  • R 2 comprises an antibody comprising a sequence as set forth in Table 2.
  • R 2 comprises an antibody comprising a heavy chain complementarity determining region 1 (CDR-H1) comprising a sequence as set forth in SEQ ID NOs: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising a sequence as set forth in SEQ ID NOs: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising a sequence as set forth in SEQ ID NOs: 3, 9, or 14; and/or comprising a light chain complementarity determining region 1 (CDR-L1) comprising a sequence as set forth in SEQ ID NOs: 4, 10, or 15, a light chain complementarity determining region 2 (CDR- L2) comprising a sequence as set forth in SEQ ID NOs: 5, or 11, and a light chain complementarity determining region 3 (CDR-L3) comprising a sequence as set forth in SEQ ID NO: 6 or 16.
  • CDR-H1 heavy chain complementarity determining region 1
  • CDR-H2 comprising a
  • R 2 comprises an antibody comprising a heavy chain variable region (VH) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 17 and/or comprising a light chain variable region (VL) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 18.
  • R 2 comprises an antibody comprising a VH comprising the amino acid sequence of SEQ ID NO: 17 and/or comprising a VL comprising the amino acid sequence of SEQ ID NO: 18.
  • R 2 comprises an antibody comprising a heavy chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 19 and/or comprising a light chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 20.
  • R 2 comprises an antibody comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and/or comprising a light chain comprising the amino acid sequence of SEQ ID NO: 20.
  • R 2 comprises an antibody that is a Fab fragment, a full-length IgG, a Fab' fragment, a F(ab')2 fragment, an scFv, or an Fv.
  • R 3 comprises an oligonucleotide comprising a nucleobase sequence of CAGCGCCCACCAGUCA (SEQ ID NO: 21). In some embodiments, R 3 comprises an oligonucleotide comprising a structure of +C*+A*oG*oC*dG*dC*dC*dC*dA*dC*dC*dA*oG*oU*+C*+A (SEQ ID NO: 21), wherein
  • +N represents an LNA (2’ -4’ methylene bridge) ribonucleoside
  • dN represents a 2’- deoxyribonucleoside
  • oN represents a 2’ -MOE modified ribonucleoside
  • oC represents a 5- methyl-2’-MOE-cytidine
  • +C represents a 5-methyl-2’-4’-bicyclic-cytidine (2 ’-4’ methylene bridge
  • oU represents a 5-methyl-2’-MOE-uridine
  • * represents a phosphorothioate intemucleoside linkage.
  • complexes provided herein comprise a structure of formula (I): [ R 1 J >, i -R 2 , in which each R 1 wherein +N represents an LNA (2’-4’ methylene bridge) ribonucleoside, dN represents a 2’- deoxyribonucleoside, oN represents a 2’-O-methoxyethyl (MOE) modified ribonucleoside, oC represents a 5-methyl-2’-MOE-cytidine, +C represents a 5-methyl-2’-4’-bicyclic-cytidine (2’- 4’ methylene bridge), oU represents a 5-methyl-2’-MOE-uridine, * represents a phosphorothioate internucleoside linkage, and wherein the oligonucleotide comprises a nucleobase sequence of CAGCGCCCACCAGUCA (SEQ ID NO:
  • R 2 comprises an antibody comprising a sequence as set forth in Table 2.
  • R 2 comprises an antibody comprising a heavy chain complementarity determining region 1 (CDR-H1) comprising a sequence as set forth in SEQ ID NOs: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising a sequence as set forth in SEQ ID NOs: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising a sequence as set forth in SEQ ID NOs: 3, 9, or 14; and/or comprising a light chain complementarity determining region 1 (CDR-L1) comprising a sequence as set forth in SEQ ID NOs: 4, 10, or 15, a light chain complementarity determining region 2 (CDR- L2) comprising a sequence as set forth in SEQ ID NOs: 5, or 11, and a light chain complementarity determining region 3 (CDR-L3) comprising a sequence as set forth in SEQ ID NO: 6 or
  • R 2 comprises an antibody comprising a heavy chain variable region (VH) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 17 and/or comprising a light chain variable region (VL) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 18.
  • R 2 comprises an antibody comprising a VH comprising the amino acid sequence of SEQ ID NO: 17 and/or comprising a VL comprising the amino acid sequence of SEQ ID NO: 18.
  • R 2 comprises an antibody comprising a heavy chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 19 and/or comprising a light chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 20.
  • R 2 comprises an antibody comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and/or comprising a light chain comprising the amino acid sequence of SEQ ID NO: 20.
  • R 2 comprises an antibody that is a Fab fragment, a full-length IgG, a Fab' fragment, a F(ab')2 fragment, an scFv, or an Fv.
  • complexes provided herein comprise a structure of formula (I): [ R 1 J >, i - R 2 , in which each R 1 comprises a group of the formula (Ic):
  • R 2 comprises an antibody comprising a sequence as set forth in Table 2.
  • R 2 comprises an antibody comprising a heavy chain complementarity determining region 1 (CDR-H1) comprising a sequence as set forth in SEQ ID NOs: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising a sequence as set forth in SEQ ID NOs: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising a sequence as set forth in SEQ ID NOs: 3, 9, or 14; and/or comprising a light chain complementarity determining region 1 (CDR-L1) comprising a sequence as set forth in SEQ ID NOs: 4, 10, or 15, a light chain complementarity determining region 2 (CDR- L2) comprising a sequence as set forth in SEQ ID NOs: 5, or 11, and a light chain complementarity determining region 3 (CDR-H1) comprising a sequence as set forth in SEQ ID NOs: 1, 7, or 12, a heavy chain complementarity
  • R 2 comprises an antibody comprising a heavy chain variable region (VH) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 17 and/or comprising a light chain variable region (VL) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 18.
  • R 2 comprises an antibody comprising a VH comprising the amino acid sequence of SEQ ID NO: 17 and/or comprising a VL comprising the amino acid sequence of SEQ ID NO: 18.
  • R 2 comprises an antibody comprising a heavy chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 19 and/or comprising a light chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 20.
  • R 2 comprises an antibody comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and/or comprising a light chain comprising the amino acid sequence of SEQ ID NO: 20.
  • R 2 comprises an antibody that is a Fab fragment, a full-length IgG, a Fab' fragment, a F(ab')2 fragment, an scFv, or an Fv.
  • complexes provided herein comprise a structure of the formula (Id):
  • oligonucleotide comprises a nucleobase sequence of CAGCGCCCACCAGUCA (SEQ ID NO: 21); wherein R 2 comprises an antibody comprising a sequence as set forth in Table 2; wherein nl is an integer (e.g., one or greater) representing the number of instances of the group enclosed by square brackets, wherein each
  • R 2 comprises an antibody comprising a heavy chain complementarity determining region 1 (CDR-H1) comprising a sequence as set forth in SEQ ID NOs: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising a sequence as set forth in SEQ ID NOs: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising a sequence as set forth in SEQ ID NOs: 3, 9, or 14; and/or comprising a light chain complementarity determining region 1 (CDR-L1) comprising a sequence as set forth in SEQ ID NOs: 4, 10, or 15, a light chain complementarity determining region 2 (CDR-L2) comprising a sequence as set forth in SEQ ID NOs: 5, or 11, and a light chain complementarity determining region 3 (CDR-L3) comprising a sequence as set forth in SEQ ID NO: 6 or 16.
  • CDR-H1 heavy chain complementarity determining region 1
  • CDR-H2 comprising a
  • R 2 comprises an antibody comprising a heavy chain variable region (VH) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 17 and/or comprising a light chain variable region (VL) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 18.
  • R 2 comprises an antibody comprising a VH comprising the amino acid sequence of SEQ ID NO: 17 and/or comprising a VL comprising the amino acid sequence of SEQ ID NO: 18.
  • R 2 comprises an antibody comprising a heavy chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 19 and/or comprising a light chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 20.
  • R 2 comprises an antibody comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and/or comprising a light chain comprising the amino acid sequence of SEQ ID NO: 20.
  • R 2 comprises an antibody that is a Fab fragment, a full-length IgG, a Fab' fragment, a F(ab')2 fragment, an scFv, or an Fv.
  • complexes described herein comprise a structure of formula (A):
  • a complex described herein comprises an anti-TfRl antibody (e.g., an anti-TfRl Fab) covalently linked via a lysine of the antibody to the 5’ end of an oligonucleotide (e.g., an oligonucleotide comprising a 5’-X-Y-Z-3’ configuration).
  • the antibody comprises a sequence as set forth in Table 2.
  • the antibody comprises a heavy chain complementarity determining region 1 (CDR-H1) comprising a sequence as set forth in SEQ ID NOs: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR- H2) comprising a sequence as set forth in SEQ ID NOs: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising a sequence as set forth in SEQ ID NOs: 3, 9, or 14; and/or comprises a light chain complementarity determining region 1 (CDR-L1) comprising a sequence as set forth in SEQ ID NOs: 4, 10, or 15, a light chain complementarity determining region 2 (CDR-L2) comprising a sequence as set forth in SEQ ID NOs: 5, or 11, and a light chain complementarity determining region 3 (CDR-L3) comprising a sequence as set forth in SEQ ID NO: 6 or 16.
  • CDR-H1 comprising a sequence as set forth in SEQ
  • the antibody comprises a heavy chain variable region (VH) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 17 and/or comprises a light chain variable region (VL) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 18.
  • VH heavy chain variable region
  • VL light chain variable region
  • the antibody comprises a VH comprising the amino acid sequence of SEQ ID NO: 17 and/or comprises a VL comprising the amino acid sequence of SEQ ID NO: 18.
  • the antibody comprises a heavy chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 19 and/or comprises a light chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 20.
  • the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and/or comprises a light chain comprising the amino acid sequence of SEQ ID NO: 20.
  • the antibody is a Fab fragment, a full-length IgG, a Fab' fragment, a F(ab')2 fragment, an scFv, or an Fv.
  • complexes described herein comprise an antibody that binds human transferrin receptor 1 (TfRl).
  • TfRl transferrin receptor 1
  • An example human TfRl amino acid sequence, corresponding to NCBI sequence NP_003225.2 (transferrin receptor protein 1 isoform 1, homo sapiens) is as follows:
  • Table 2 provides examples of sequences of an anti-TfRl antibody useful in the complexes provided herein.
  • the anti-TfRl antibody of the present disclosure comprises a heavy chain complementarity determining region 1 (CDR-H1) of SEQ ID NO: 1 (according to the IMGT definition system), a heavy chain complementarity determining region 2 (CDR-H2) of SEQ ID NO: 2 (according to the IMGT definition system), a heavy chain complementarity determining region 3 (CDR-H3) of SEQ ID NO: 3 (according to the IMGT definition system), a light chain complementarity determining region 1 (CDR-L1) of SEQ ID NO: 4 (according to the IMGT definition system), a light chain complementarity determining region 2 (CDR-L2) of SEQ ID NO: 5 (according to the IMGT definition system), and a light chain complementarity determining region 3 (CDR-L3) of SEQ ID NO: 6 (according to the IMGT definition system).
  • CDR-H1 heavy chain complementarity determining region 1
  • CDR-H2 heavy chain complementarity determining
  • the anti-TfRl antibody of the present disclosure comprises a heavy chain complementarity determining region 1 (CDR-H1) of SEQ ID NO: 7 (according to the Kabat definition system), a heavy chain complementarity determining region 2 (CDR-H2) of SEQ ID NO: 8 (according to the Kabat definition system), a heavy chain complementarity determining region 3 (CDR-H3) of SEQ ID NO: 9 (according to the Kabat definition system), a light chain complementarity determining region 1 (CDR-L1) of SEQ ID NO: 10 (according to the Kabat definition system), a light chain complementarity determining region 2 (CDR-L2) of SEQ ID NO: 11 (according to the Kabat definition system), and a light chain complementarity determining region 3 (CDR-L3) of SEQ ID NO: 6 (according to the Kabat definition system).
  • CDR-H1 heavy chain complementarity determining region 1
  • CDR-H2 heavy chain complementarity determining region 2
  • the anti-TfRl antibody of the present disclosure comprises a heavy chain complementarity determining region 1 (CDR-H1) of SEQ ID NO: 12 (according to the Chothia definition system), a heavy chain complementarity determining region 2 (CDR-H2) of SEQ ID NO: 13 (according to the Chothia definition system), a heavy chain complementarity determining region 3 (CDR-H3) of SEQ ID NO: 14 (according to the Chothia definition system), a light chain complementarity determining region 1 (CDR-L1) of SEQ ID NO: 15 (according to the Chothia definition system), a light chain complementarity determining region 2 (CDR-L2) of SEQ ID NO: 5 (according to the Chothia definition system), and a light chain complementarity determining region 3 (CDR-L3) of SEQ ID NO: 16 (according to the Chothia definition system).
  • CDR-H1 heavy chain complementarity determining region 1
  • CDR-H2 heavy chain complementarity determining
  • the anti-TfRl antibody of the present disclosure comprises a heavy chain variable region (VH) containing no more than 25 amino acid variations (e.g., no more than 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 amino acid variation) in the framework regions as compared with the VH comprising the amino acid sequence of SEQ ID NO: 17.
  • VH heavy chain variable region
  • the anti-TfRl antibody of the present disclosure comprises a light chain variable region (VL) containing no more than 25 amino acid variations (e.g., no more than 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 amino acid variation) in the framework regions as compared with the VL comprising the amino acid sequence of SEQ ID NO: 18.
  • VL light chain variable region
  • the anti-TfRl antibody of the present disclosure comprises a VH comprising an amino acid sequence that is at least 75% (e.g., 75%, 80%, 85%, 90%, 95%, 98%, or 99%) identical in the framework regions to the VH comprising the amino acid sequence of SEQ ID NO: 17.
  • the anti-TfRl antibody of the present disclosure comprises a VL comprising an amino acid sequence that is at least 75% (e.g., 75%, 80%, 85%, 90%, 95%, 98%, or 99%) identical in the framework regions to the VL comprising the amino acid sequence of SEQ ID NO: 18.
  • the anti-TfRl antibody of the present disclosure comprises a VH comprising the amino acid sequence of SEQ ID NO: 17.
  • the anti-TfRl antibody of the present disclosure comprises a VL comprising the amino acid sequence of SEQ ID NO: 18.
  • the anti-TfRl antibody of the present disclosure comprises a heavy chain comprising an amino acid sequence least 75% (e.g., 75%, 80%, 85%, 90%, 95%, 98%, or 99%) identical to the amino acid sequence of SEQ ID NO: 19.
  • the anti-TfRl antibody of the present disclosure comprises a light chain comprising an amino acid sequence least 75% (e.g., 75%, 80%, 85%, 90%, 95%, 98%, or 99%) identical to the amino acid sequence of SEQ ID NO: 20.
  • the anti-TfRl antibody of the present disclosure is a Fab that comprises a heavy chain comprising an amino acid sequence least 75% (e.g., 75%, 80%, 85%, 90%, 95%, 98%, or 99%) identical to the amino acid sequence of SEQ ID NO: 19.
  • the anti-TfRl antibody of the present disclosure is a Fab that comprises a light chain comprising an amino acid sequence least 75% (e.g., 75%, 80%, 85%, 90%, 95%, 98%, or 99%) identical to the amino acid sequence of SEQ ID NO: 20.
  • the anti-TfRl antibody of the present disclosure comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19.
  • the anti-TfRl antibody of the present disclosure comprises a light chain comprising the amino acid sequence of SEQ ID NO: 20.
  • the anti-TfRl antibody of the present disclosure is a Fab that comprises a heavy chain comprising an amino acid sequence of SEQ ID NO: 19.
  • the anti-TfRl antibody of the present disclosure is a Fab that comprises a light chain comprising the amino acid sequence of SEQ ID NO: 20.
  • the anti-TfRl antibody provided herein may have one or more post-translational modifications.
  • N-terminal cyclization also called pyroglutamate formation (pyro-Glu)
  • pyro-Glu N-terminal cyclization
  • Glu N-terminal Glutamate
  • Gin Glutamine residues during production.
  • an antibody specified as having a sequence comprising an N-terminal glutamate or glutamine residue encompasses antibodies that have undergone pyroglutamate formation resulting from a post-translational modification.
  • pyroglutamate formation occurs in a heavy chain sequence.
  • pyroglutamate formation occurs in a light chain sequence.
  • an oligonucleotide of the complexes described herein is a single stranded oligonucleotide.
  • the oligonucleotide is useful for targeting DMPK (e.g., for reducing expression or activity of a DMPK RNA, such as the level of a mutant or wild-type DMPK RNA).
  • an oligonucleotide that is useful for targeting DMPK RNAs e.g., for reducing expression or activity of a DMPK RNA, such as the level of a mutant or wild-type DMPK RNA).
  • the oligonucleotide comprises a region of complementarity to a DMPK RNA.
  • the oligonucleotide is useful for reducing levels of toxic DMPK having disease- associated repeat expansions, e.g., in a subject having or suspected of having myotonic dystrophy.
  • the oligonucleotide is designed to direct RNAse H mediated degradation of the target DMPK RNA residing in the nucleus of cells, e.g., muscle cells (e.g., myotubes) or cells of the nervous system (e.g., central nervous system (CNS) cells).
  • CNS central nervous system
  • the oligonucleotide is designed to have desirable bioavailability and/or serumstability properties. In some embodiments, the oligonucleotide is designed to have desirable binding affinity properties. In some embodiments, the oligonucleotide is designed to have desirable toxicity profiles. In some embodiments, the oligonucleotide is designed to have low- complement activation and/or cytokine induction properties.
  • DMPK-targeting oligonucleotides described herein are designed to caused RNase H mediated degradation of DMPK mRNA. It should be appreciated that, in some embodiments, oligonucleotides in one format (e.g., antisense oligonucleotides) may be suitably adapted to another format (e.g., siRNA oligonucleotides) by incorporating functional sequences (e.g., antisense strand sequences) from one format to the other format. [000110] Examples of oligonucleotides useful for targeting DMPK are provided in US
  • oligonucleotides may comprise a region of complementarity to a sequence set forth as follows, which is an example human DMPK gene sequence (Gene ID 1760; NM_001081560.2): AGGGGGGCTGGACCAAGGGGTGGGGAGAAGGGGAGGAGGCCTCGGCCGGCCGCA GAGAGAAGTGGCCAGAGAGGCCCAGGGGACAGCCAGGGACAGGCAGACATGCAG CCAGGGCTCCAGGGCCTGGACAGGGGCTGCCAGGCCCTGTGACAGGAGGACCCCG AGCCCCCGGCCCGGGGAGGGGCCATGGTGCTGCCTGTCCAACATGTCAGCCGAGG TGCGGCTGAGGCGGCTCCAGCAGCTGGTGTTGGACCCGGGCTTCCTGGGGCTGGA GCCCCTGCTCGACCTTCCTGGGCGTCCACCAGGAGCTGGGCGCCTCCGAACTGG CCCAGGACAAGTACGTGGCCGACTTCTTGCAGTGGGCGGAGCCCATCGTGGTGAG GCTGGACAAGTACGTGGCCGACT
  • oligonucleotides may comprise a region of complementarity to a sequence set forth as follows, which is an example mouse DMPK gene sequence (Gene ID 13400; NM_001190490.1).
  • an oligonucleotide may comprise a region of complementarity to DMPK gene sequences of multiple species, e.g., selected from human, mouse and non-human species (e.g., cynomolgus monkey).
  • the oligonucleotide may comprise a region of complementarity to a mutant form of DMPK, for example, a mutant form as reported in Botta A. et al. “The CTG repeat expansion size correlates with the splicing defects observed in muscles from myotonic dystrophy type 1 patients.” J Med Genet. 2008 Oct;45(10):639-46.; and Machuca-Tzili L. et al. “Clinical and molecular aspects of the myotonic dystrophies: a review.” Muscle Nerve. 2005 Jul;32(l): 1-18.; the contents of each of which are incorporated herein by reference in their entireties.
  • an oligonucleotide provided herein is an antisense oligonucleotide targeting DMPK.
  • the oligonucleotide targeting DMPK is any one of the antisense oligonucleotides targeting DMPK as described in US Patent Application Publication US20160304877A1, published on October 20, 2016, entitled “Compounds And Methods For Modulation Of Dystrophia Myotonica-Protein Kinase (DMPK) Expression,” incorporated herein by reference).
  • the DMPK targeting oligonucleotide targets a region of the DMPK gene sequence as set forth in Genbank accession No. NM_001081560.2 (SEQ ID NO: 24) or as set forth in Genbank accession No. NG_009784.1 (SEQ ID NO: 26).
  • a DMPK targeting oligonucleotide comprises a nucleotide sequence comprising a region complementary to a target region that is at least 8 continuous nucleotides (e.g., at least 8, at least 9, at least 10, at least 12, at least 14, at least 16, at least 18, at least 20 or more continuous nucleotides) of SEQ ID NO: 24.
  • a DMPK targeting oligonucleotide provided herein is 10-35 (e.g., 10-35, 10-30, 10-25, 10-20, 10-15, 15-35, 15-30, 15-25, 15-20, 20-35, 20-30, 13- 18, 14-17, 15-18, 20-30, 15-17, 27-30, 25-35, or 30-35) nucleotides in length.
  • a DMPK targeting oligonucleotide provided herein is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length, optionally 15-30, or 16 nucleotides in length.
  • a DMPK targeting oligonucleotide provided herein is 16 nucleotides in length.
  • a DMPK targeting oligonucleotide provided herein comprises a region of complementarity of at least 8 (e.g., at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more) consecutive nucleotides to a DMPK RNA.
  • a DMPK targeting oligonucleotide provided herein comprises a region of complementarity of at least 8 (e.g., at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more) consecutive nucleotides to a DMPK sequence as set forth in SEQ ID NO: 24 or 25.
  • a DMPK targeting oligonucleotide provided herein comprises a region of complementarity of at least 8 (e.g., at least 8, 9, 10, 11, 12, 13, 14, 15, or 16) consecutive nucleotides to a target sequence as set forth in SEQ ID NO: 22 (TGACTGGTGGGCGCTG).
  • an oligonucleotide useful for targeting DMPK comprises at least 8 (e.g., at least 8, 9, 10, 11, 12, 13, 14, 15, or 16) consecutive nucleotides of a sequence as set forth in SEQ ID NO: 21 (CAGCGCCCACCAGUCA).
  • an oligonucleotide useful for targeting DMPK comprises the nucleotide sequence of SEQ ID NO: 21.
  • the DMPK targeting oligonucleotide comprises a 5’-X- Y-Z-3’ configuration.
  • An oligonucleotide comprising a 5’-X-Y-Z-3’ configuration can refer to a chimeric antisense compound in which a gap region having a plurality of nucleosides that support RNase H cleavage is positioned between flanking regions having one or more nucleosides, wherein the nucleosides comprising the gap region are chemically distinct from the nucleoside or nucleosides comprising the flanking regions.
  • an oligonucleotide described herein comprises a 5'-X-Y-Z-3' configuration, with X and Z as flanking regions around a gap region Y.
  • the gap region Y comprises one or more 2’-deoxyribonucleosides.
  • each nucleoside in the gap region Y is a 2’ -deoxyribonucleoside, and neither the flanking region X nor the flanking region Z contains any 2’-deoxyribonucleosides.
  • the gap region Y comprises a continuous stretch of 6 or more 2’-deoxyribonucleosides, which are capable of recruiting an RNAse, such as RNAse H.
  • the oligonucleotide binds to the target nucleic acid, at which point an RNAse is recruited and can then cleave the target nucleic acid.
  • the flanking regions X and Z each comprise one or more modified nucleosides.
  • flanking regions X and Z each comprise one or more high-affinity modified nucleosides, e.g., one to six high-affinity modified nucleosides.
  • high affinity modified nucleosides include, but are not limited to, 2'-modified nucleosides (e.g., 2’ -MOE, 2'- O-Me, 2’-F) or 2’-4’ bicyclic nucleosides (e.g., LNA, cEt, ENA).
  • the flanking regions X and Z may be of 1-20 nucleotides, 1-8 nucleotides, or 1-5 nucleotides in length.
  • the flanking regions X and Z may be of similar length or of dissimilar lengths.
  • the gap region Y may comprise a nucleotide sequence of 5-20 nucleotides, 5-15 nucleotides, 5-12 nucleotides, or 6-10 nucleotides in length.
  • the gap region Y comprises one or more unmodified intemucleoside linkages.
  • one or both flanking regions X and Z each independently comprise phosphorothioate intemucleoside linkages (e.g., phosphorothioate intemucleoside linkages or other linkages) between at least two, at least three, at least four, at least five or more nucleotides.
  • the gap region Y and two flanking regions X and Z each independently comprise modified intemucleoside linkages (e.g., phosphorothioate intemucleoside linkages or other linkages) between at least two, at least three, at least four, at least five or more nucleotides.
  • the gap region Y in the gapmer is 5-20 nucleosides in length.
  • the gap region Y may be 5-20, 5-15, 5-10, 10-20, 10-15, or 15-20 nucleosides in length.
  • the gap region Y is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleosides in length.
  • each nucleoside in the gap region Y is a 2’ -deoxyribonucleoside. In some embodiments, all nucleosides in the gap region Y are 2 ’-deoxyribonucleosides. In some embodiments, one or more of the nucleosides in the gap region Y is a modified nucleoside (e.g., a 2’ modified nucleoside such as those described herein). In some embodiments, one or more cytosines in the gap region Y are optionally 5-methyl-cytosines. In some embodiments, each cytosine in the gap region Y is a 5-methyl-cytosine.
  • flanking region X of the oligonucleotide (X in the 5'- X-Y-Z-3' configuration) and the flanking region Z of the oligonucleotide (Z in the 5'-X-Y-Z-3' configuration) are independently 1-20 nucleosides long.
  • the flanking region X of the oligonucleotide and the flanking region Z of the oligonucleotide may be independently 1- 20, 1-15, 1-10, 1-7, 1-5, 1-3, 1-2, 2-5, 2-7, 3-5, 3-7, 5-20, 5-15, 5-10, 10-20, 10-15, or 15-20 nucleosides long.
  • flanking region X of the oligonucleotide and the flanking region Z of the oligonucleotide are independently 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleosides long. In some embodiments, the flanking region X of the oligonucleotide and the flanking region Z of the oligonucleotide are of the same length. In some embodiments, the flanking region X of the oligonucleotide and the flanking region Z of the oligonucleotide are of different lengths.
  • flanking region X of the oligonucleotide is longer than the flanking region Z of the oligonucleotide. In some embodiments, the flanking region X of the oligonucleotide is shorter than the flanking region Z of the oligonucleotide.
  • an oligonucleotide described herein comprises a 5'-X-Y-Z-3' configuration of 5-10-5, 4-12-4, 3-14-3, 2- 16-2, 1-18-1, 3-10-3, 2-10-2, 1-10-1, 2-8-2, 4-6-4, 3-6-3, 2-6-2, 4-7-4, 3-7-3, 2-7-2, 4-8-4, 3-8- 3, 2-8-2, 1-8-1, 2-9-2, 1-9-1, 2-10-2, 1-10-1, 1-12-1, 1-16-1, 2-15-1, 1-15-2, 1-14-3, 3-14-1, 2- 14-2, 1-13-4, 4-13-1, 2-13-3, 3-13-2, 1-12-5, 5-12-1, 2-12-4, 4-12-2, 3-12-3, 1-11-6, 6-11-1, 2-
  • the numbers indicate the number of nucleosides in X, Y, and Z regions, respectively, in an oligonucleotide comprising the 5’-X-Y-Z-3’ configuration.
  • one or more nucleosides in the flanking region X of the oligonucleotide (X in the 5'-X-Y-Z-3' configuration) or the flanking region Z of the oligonucleotide (Z in the 5'-X-Y-Z-3' configuration) are modified nucleosides (e.g., high- affinity modified nucleosides).
  • the modified nucleoside e.g., high- affinity modified nucleosides
  • the 2’- modified nucleoside is a 2’-4’ bicyclic nucleoside or a non-bicyclic 2’-modified nucleoside.
  • the high-affinity modified nucleoside is a 2’-4’ bicyclic nucleoside (e.g., LNA, cEt, or ENA) or a non-bicyclic 2’-modified nucleoside (e.g., 2’-fluoro (2’-F), 2’-O- methyl (2’-0-Me), 2’-O-methoxyethyl (2’-M0E), 2’-O-aminopropyl (2’-O-AP), 2’-O- dimethylaminoethyl (2’-O-DMAOE), 2’-O-dimethylaminopropyl (2’-O-DMAP), 2’-O- dimethylaminoethyloxyethyl (2’-O-DMAEOE), or 2
  • an oligonucleotide described herein comprises a 5'-X-Y-Z-3' configuration, wherein X and Z are independently 2-7 (e.g., 2, 3, 4, 5, 6, or 7) nucleosides in length and Y is 6-10 (e.g., 6, 7, 8, 9, or 10) nucleosides in length, wherein at least one but not all (e.g., 1, 2, 3, 4, 5, or 6) of positions 1, 2, 3, 4, 5, 6, or 7 in X (the 5’-most position is position 1) is a non-bicyclic 2’- modified nucleoside (e.g., 2’-M0E or 2’-0-Me), wherein the rest of the nucleosides in both X and Z are 2’-4’ bicyclic nucleosides (e.g., LNA or cEt), and wherein each nucleoside in
  • an oligonucleotide described herein (e.g., a DMPK targeting oligonucleotide described herein)comprises a 5'-X-Y-Z-3' configuration, wherein X and Z are independently 2-7 (e.g., 2, 3, 4, 5, 6, or 7) nucleosides in length and Y is 6-10 (e.g., 6, 7, 8, 9, or 10) nucleosides in length, wherein at least one but not all (e.g., 1, 2, 3, 4, 5, or 6) of positions 1, 2, 3, 4, 5, 6, or 7 in Z (the 5’-most position is position 1) is a non- bicyclic 2’-modified nucleoside (e.g., 2’-M0E or 2’-0-Me), wherein the rest of the nucleosides in both X and Z are 2’-4’ bicyclic nucleosides (e.g., LNA or cEt), and wherein each nucleoside in Y is a
  • an oligonucleotide described herein comprises a 5'-X- Y-Z-3' configuration, wherein X and Z are independently 2-7 (e.g., 2, 3, 4, 5, 6, or 7) nucleosides in length and Y is 6-10 (e.g., 6, 7, 8, 9, or 10) nucleosides in length, wherein at least one but not all (e.g., 1, 2, 3, 4, 5, or 6) of positions 1, 2, 3, 4, 5, 6, or 7 in X and at least one of positions but not all (e.g., 1, 2, 3, 4, 5, or 6) of positions 1, 2, 3, 4, 5, 6, or 7 in Z (the 5’- most position is position 1) is a non-bicyclic 2’-modified nucleoside (e.g., 2’-M0E or 2’-O- Me), wherein the rest of the nucleosides in both X and Z are 2’-4’
  • X and Z are independently 2-7 (e.g., 2, 3, 4, 5, 6, or 7) nucleoside
  • an oligonucleotide described herein is 10-20 nucleosides (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleosides) in length, comprises a region of complementarity to at least 8 consecutive nucleosides (e.g., at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or 16 consecutive nucleosides) of SEQ ID NO: 22 (TGACTGGTGGGCGCTG), and comprises a 5’-X-Y-Z-3’ configuration, wherein X comprises 3-5 (e.g., 3, 4, or 5) linked nucleosides, wherein at least one of the nucleosides in X is a 2’-modified nucleoside (e.g., 2’- MOE modified nucleoside, 2’-0-Me modified nucleoside, LNA, cEt
  • an oligonucleotide described herein comprises at least 8 consecutive nucleosides (e.g., at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or 16 consecutive nucleosides consecutive nucleosides) of the nucleotide sequence of SEQ ID NO: 21 (CAGCGCCCACCAGUCA), and comprises a 5’-X-Y-Z-3’ configuration, wherein X comprises 3-5 (e.g., 3, 4, or 5) linked nucleosides, wherein at least one of the nucleosides in X is a 2’ -modified nucleoside (e.g., 2’ -MOE modified nucleoside, 2’-0-Me modified nucleoside, LNA, cEt, or ENA); Y comprises 6-10 (e.g., 6, 7, 8, 9, or 10) linked
  • each thymine base (T) of the nucleotide sequence of the antisense oligonucleotide may independently and optionally be replaced with a uracil base (U), and each U may independently and optionally be replaced with a T.
  • an oligonucleotide described herein comprises the nucleotide sequence of SEQ ID NO: 21 and comprises a 5’-X-Y-Z-3’ configuration, wherein X comprises 3-5 (e.g., 3, 4, or 5) linked nucleosides, wherein at least one of the nucleosides in X is a 2’ -modified nucleoside (e.g., 2’-M0E modified nucleoside, 2’-0-Me modified nucleoside, LNA, cEt, or ENA); Y comprises 6-10 (e.g., 6, 7, 8, 9, or 10) linked 2’-deoxyribonucleosides, wherein each cytosine in Y is optionally and independently a 5-methyl-cytosine; and Z comprises 3-5 (e.g., 3, 4, or 5) linked nucleosides, wherein at least one
  • each thymine base (T) of the nucleotide sequence of the antisense oligonucleotide may independently and optionally be replaced with a uracil base (U), and each U may independently and optionally be replaced with a T.
  • X comprises at least one 2’ -4’ bicyclic nucleoside (e.g., LNA, cEt, or ENA) and at least one non-bicyclic 2’-modified nucleoside e.g., 2’-M0E modified nucleoside or 2’-0-Me modified nucleoside, and/or (e.g., and) Z comprises at least one 2’ -4’ bicyclic nucleoside (e.g., LNA, cEt, or ENA) and at least one non-bicyclic 2’- modified nucleoside (e.g., 2’-M0E modified nucleoside or 2’-0-Me modified nucleoside).
  • the 2’-4’ bicyclic nucleoside is selected from LNA, cEt, and ENA nucleosides.
  • the non-bicyclic 2’-modified nucleoside is a 2’- MOE modified nucleoside or a 2’-OMe modified nucleoside.
  • the nucleosides of the oligonucleotides are joined together by phosphorothioate intemucleoside linkages, phosphodiester intemucleoside linkages or a combination thereof.
  • the oligonucleotide comprises only phosphorothioate internucleoside linkages joining each nucleoside (i.e., the oligonucleotide comprises a fully phosphorothioate backbone).
  • the oligonucleotide comprises at least one phosphorothioate intemucleoside linkage.
  • the oligonucleotide comprises a mix of phosphorothioate and phosphodiester internucleoside linkages. In some embodiments, the oligonucleotide comprises only phosphorothioate intemucleoside linkages joining each pair of 2’ -deoxyribonucleosides and a mix of phosphorothioate and phosphodiester intemucleoside linkages joining the remaining nucleosides.
  • the oligonucleotide comprises a 5’-X-Y-Z-3’ configuration of LLEE-(D)s-EELL, wherein “E” is a 2’-M0E modified ribonucleoside; “L” is LNA; “D” is a 2’ -deoxy ribonucleoside; and “10” or “8” is the number of 2’- deoxyribonucleosides in Y, and wherein the oligonucleotide comprises phosphorothioate intemucleoside linkages, phosphodiester intemucleoside linkages or a combination thereof.
  • each cytidine (e.g., a 2’ -modified cytidine) in X and/or Z of the oligonucleotide is optionally and independently a 5-methyl-cytidine
  • each uridine (e.g., a 2’ -modified uridine) in X and/or Z is optionally and independently a 5-methyl-uridine.
  • an oligonucleotide described herein comprises a 5’-X-Y-Z-3’ configuration and comprises a nucleobase sequence of CAGCGCCCACCAGUCA (SEQ ID NO: 21).
  • an oligonucleotide described herein comprises a structure of +C*+A*oG*oC*dG*dC*dC*dA*dC*dC*dA*oG*oU*+C*+A (SEQ ID NO: 21), wherein +N represents an LNA (2’ -4’ methylene bridge) ribonucleoside, dN represents a 2’- deoxyribonucleoside, oN represents a 2’-O-methoxyethyl (MOE) modified ribonucleoside, oC represents a 5-methyl-2’-MOE-cytidine, +C represents a 5-methyl-2’-4’-bicyclic-cytidine (2’- 4’ methylene bridge), oU represents a 5-methyl-2’-MOE-uridine, * represents a phosphorothioate in
  • an oligonucleotide described herein e.g., a DMPK targeting oligonucleotide described herein
  • can be in salt form e.g., as sodium, potassium, or magnesium salts.
  • the 5’ or 3’ nucleoside (e.g., terminal nucleoside) of the oligonucleotide is conjugated to an amine group, optionally via a spacer.
  • the spacer comprises an aliphatic moiety.
  • the spacer comprises a polyethylene glycol moiety.
  • a phosphodiester linkage is present between the spacer and the 5’ or 3’ nucleoside of the oligonucleotide.
  • the 5’ or 3’ nucleoside of the oligonucleotide is conjugated to a compound of the formula -NH2-(CH2)n-, wherein n is an integer from 1 to 12. In some embodiments, n is 6, 7, 8, 9, 10, 11, or 12. In some embodiments, a phosphodiester linkage is present between the compound of the formula NH2-(CH2) n - and the 5’ or 3’ nucleoside of the oligonucleotide.
  • a compound of the formula NH2- (CH2)6- is conjugated to the oligonucleotide via a reaction between 6-amino-l -hexanol (NH2- (CH 2 ) 6 -OH) and the 5’ phosphate of the oligonucleotide.
  • the oligonucleotide is conjugated to a targeting agent, e.g., a muscle targeting agent such as an anti-TfRl antibody, e.g., via an amine group of a lysine of the targeting agent.
  • a targeting agent e.g., a muscle targeting agent such as an anti-TfRl antibody
  • nucleobase uracil at the C5 position forms thymine.
  • a nucleotide or nucleoside having a C5 methylated uracil (or 5-methyl-uracil) may be equivalently identified as a thymine nucleotide or nucleoside.
  • any one or more of the thymine bases (T’s) in any one of the oligonucleotides provided herein may independently and optionally be uracil bases (U’s), and/or any one or more of the U’s in the oligonucleotides provided herein (e.g., the oligonucleotide as set forth in SEQ ID NO: 21) may independently and optionally be T’s.
  • compositions comprising complexes are prepared in a manner suitable for the methods described herein.
  • compositions comprising muscle-targeting complexes are delivered to a subject in a manner that minimizes degradation, facilitates delivery and/or (e.g., and) uptake, or provides another beneficial property to the complexes in the composition.
  • compositions comprising complexes e.g., a plurality of complexes comprising an oligonucleotide covalently linked with a Fab
  • compositions comprising muscle-targeting complexes comprise tris(hydroxymethyl)aminomethane and/or sucrose in aqueous solutions.
  • compositions comprising a plurality of the complexes, tris(hydroxymethyl)aminomethane, and sucrose can be lyophilized (e.g., for storage).
  • the lyophilized composition may be reconstituted (e.g., with water) for administration to a subject.
  • the frozen composition may be thawed prior to administration to a subject, e.g., to produce an aqueous solution.
  • the compositions e.g., in aqueous solutions, in frozen compositions, or in lyophilized compositions
  • compositions for administration to a subject in the methods described herein comprise complexes (i.e., a plurality of complexes), each of which complex comprises an oligonucleotide (e.g., an oligonucleotide comprising a 5’-X-Y-Z-3’ configuration) covalently linked to an antibody.
  • complexes i.e., a plurality of complexes
  • each of which complex comprises an oligonucleotide (e.g., an oligonucleotide comprising a 5’-X-Y-Z-3’ configuration) covalently linked to an antibody.
  • compositions for administration to a subject in the methods described herein comprise complexes, in which each complex comprises an oligonucleotide (e.g., an oligonucleotide comprising a 5’-X-Y-Z-3’ configuration) covalently linked to an anti-TfRl antibody, optionally wherein the antibody of such complexes comprises a CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, and CDR-L3 as set forth in Table 2, and further, in some embodiments, wherein the composition further comprises tris(hydroxymethyl)aminomethane and sucrose.
  • the antibody is an anti- TfRl Fab.
  • compositions for administration to a subject in the methods described herein comprise complexes (i.e., a plurality of complexes) comprising a structure of formula (I): [R ⁇ ni-R 2 , in which each R 1 independently comprises a compound comprising an oligonucleotide (e.g., an oligonucleotide comprising a 5’-X-Y-Z-3’ configuration) and is covalently linked to R 2 , wherein R 2 comprises an antibody (e.g., anti-TfRl antibody), and in which in each complex nl is independently an integer of one or greater representing the number of instances of R 1 in each complex.
  • complexes i.e., a plurality of complexes
  • each R 1 independently comprises a compound comprising an oligonucleotide (e.g., an oligonucleotide comprising a 5’-X-Y-Z-3’ configuration) and is covalently linked to R 2 , wherein R 2 comprises
  • the value of nl of each complex in the composition is independently and optionally an integer from one up to the number of amino acid residues to which conjugation is desired or targeted (e.g., the number of lysine residues) in the antibody (R 2 ).
  • the value of nl of each complex in the composition is independently and optionally selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, and 27.
  • the value of nl of each complex in the composition is independently and optionally selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 and 26.
  • the value of nl of each complex in the composition is independently selected and optionally from an integer in the range of 1 to 27, 1 to 26, 1 to 10, 1 to 5, or 1 to 3. In some embodiments, the average value of nl of complexes of the composition is in the range of 1 to 2, 1 to 3, 1 to 5, 1 to 10, 1 to 26, or 1 to 27.
  • a composition for administration to a subject in the methods described herein comprises unconjugated antibody (e.g., in trace amounts) and antibody conjugated to one or more oligonucleotides.
  • unconjugated antibody may be referred to as a compound comprising a structure of formula (I): [R ⁇ ni-R 2 , for which nl is zero.
  • a composition for administration to a subject in the methods described herein comprises compounds (e.g., complexes) comprising a structure of formula (I): [R 'JHI-R 2 , for which each R 1 independently comprises a group comprising an oligonucleotide, R 2 comprises an antibody and nl is independently an integer of zero or greater that reflects the number of instances of R 1 in each compound (e.g., complex).
  • the fraction of compounds comprising a structure of formula (I): [R ⁇ ni- R 2 , in a composition, for which nl is zero, compared with all compounds of that structure in the composition for which nl is one or greater, is less than 10%, less than 5%, less than 1% less than 0.5%, less than 0.1%, less than 0.05%, or less than 0.01%.
  • the average value of nl of complexes in a composition disclosed herein is in the range of 0.5 to 5 (e.g., 0.5-5, 1-5, 1-4, 1-3, 3-5, 0.5-4, 0.5-3, 0.5-2, 0.5-1.5, 0.5-1, 0.7-1.5, 1- 1.6, 1-1.5, 1-1.4, 1-1.3, 1-1.2, 1.1-1.5, 0.8-2, 0.8-1.5, O.8-1.3, 0.8-1.2, 0.8-1.1, 0.9-3, 0.9-2, 0.9- 1.8, 0.9-1.6, 0.9-1.5, 0.9-1.4, 0.9-1.3, or 0.9-1.2).
  • 0.5-5, 1-5, 1-4, 1-3, 3-5, 0.5-4, 0.5-3, 0.5-2 0.5-1.5, 0.5-1, 0.7-1.5, 1- 1.6, 1-1.5, 1-1.4, 1-1.3, 1-1.2, 1.1-1.5, 0.8-2, 0.8-1.5, O.8-1.3, 0.8-1.2, 0.8-1.1, 0.9-3, 0.9
  • each instance of R 1 in a complex herein is conjugated to a different amino acid residue of the antibody.
  • each different amino acid comprises an s-amino group (e.g., lysine, arginine).
  • each different amino acid to which R 1 is covalently linked is a cysteine.
  • R 1 is directly covalently linked to an amino acid residue of the antibody.
  • R 1 is indirectly covalently linked to an amino acid of the antibody, e.g., covalently linked to a glycosylation site on the amino acid.
  • compositions are provided in which complexes for which R 1 is covalently linked to an amino acid residue residing in a CDR region of the antibody are present in only trace amounts, or in undetectable amount, or not at all. In some embodiments, compositions are provided in which complexes for which R 1 is covalently linked to an amino acid residue residing in a CDR region of the antibody are not detectable in the composition using standard detection techniques.
  • R 3 comprises an oligonucleotide, e.g., an oligonucleotide comprising a 5’-X-Y-Z-3’ configuration; and R 1 is covalently linked to R 2 at attachment point A.
  • R 2 comprises an antibody comprising a sequence as set forth in Table 2.
  • R 2 comprises an antibody comprising a heavy chain complementarity determining region 1 (CDR-H1) comprising a sequence as set forth in SEQ ID NOs: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising a sequence as set forth in SEQ ID NOs: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising a sequence as set forth in SEQ ID NOs: 3, 9, or 14; and/or comprising a light chain complementarity determining region 1 (CDR-L1) comprising a sequence as set forth in SEQ ID NOs: 4, 10, or 15, a light chain complementarity determining region 2 (CDR- L2) comprising a sequence as set forth in SEQ ID NOs: 5, or 11, and a light chain complementarity determining region 3 (CDR-L3) comprising a sequence as set forth in SEQ ID NO: 6 or 16.
  • CDR-H1 heavy chain complementarity determining region 1
  • CDR-H2 comprising a
  • R 2 comprises an antibody comprising a heavy chain variable region (VH) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 17 and/or comprising a light chain variable region (VL) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 18.
  • R 2 comprises an antibody comprising a VH comprising the amino acid sequence of SEQ ID NO: 17 and/or comprising a VL comprising the amino acid sequence of SEQ ID NO: 18.
  • R 2 comprises an antibody comprising a heavy chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 19 and/or comprising a light chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 20.
  • R 2 comprises an antibody comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and/or comprising a light chain comprising the amino acid sequence of SEQ ID NO: 20.
  • R 2 comprises an antibody that is a Fab fragment, a full-length IgG, a Fab' fragment, a F(ab')2 fragment, an scFv, or an Fv.
  • R 3 comprises an oligonucleotide comprising a nucleobase sequence of CAGCGCCCACCAGUCA (SEQ ID NO: 21). In some embodiments, R 3 comprises an oligonucleotide comprising a structure of +C*+A*oG*oC*dG*dC*dC*dC*dA*dC*dC*dA*oG*oU*+C*+A (SEQ ID NO: 21), wherein +N represents an LNA (2’ -4’ methylene bridge) ribonucleoside, dN represents a 2’- deoxyribonucleoside, oN represents a 2’ -MOE modified ribonucleoside, oC represents a 5- methyl-2’-MOE-cytidine, +C represents a 5-methyl-2’-4’-bicyclic-cytidine (2 ’-4’ methylene bridge), oU represents a 5-methyl-2’-MOE-uridine, and
  • compositions for administration to a subject in the methods described herein further comprise complexes in which nl is 0.
  • compositions for administration to a subject in the methods described herein comprise complexes that comprise a structure of formula (I): [R ⁇ ni-R 2 , in which each instance of R 1 in a complex of a composition provided herein comprises a group of the formula (lb): wherein +N represents an LNA (2’-4’ methylene bridge) ribonucleoside, dN represents a 2’- deoxyribonucleoside, oN represents a 2’-O-methoxyethyl (MOE) modified ribonucleoside, oC represents a 5-methyl-2’-MOE-cytidine, +C represents a 5-methyl-2’-4’-bicyclic-cytidine (2’- 4’ methylene bridge), oU represents a 5-methyl-2’-MOE-uridine, * represents a phosphorothioate internucleoside linkage, and wherein the
  • R 2 comprises an antibody comprising a sequence as set forth in Table 2.
  • R 2 comprises an antibody comprising a heavy chain complementarity determining region 1 (CDR-H1) comprising a sequence as set forth in SEQ ID NOs: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising a sequence as set forth in SEQ ID NOs: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising a sequence as set forth in SEQ ID NOs: 3, 9, or 14; and/or comprising a light chain complementarity determining region 1 (CDR-L1) comprising a sequence as set forth in SEQ ID NOs: 4, 10, or 15, a light chain complementarity determining region 2 (CDR- L2) comprising a sequence as set forth in SEQ ID NOs: 5, or 11, and a light chain complementarity determining region 3 (CDR-L3) comprising a sequence as set forth in SEQ ID NO: 6 or
  • R 2 comprises an antibody comprising a heavy chain variable region (VH) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 17 and/or comprising a light chain variable region (VL) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 18.
  • R 2 comprises an antibody comprising a VH comprising the amino acid sequence of SEQ ID NO: 17 and/or comprising a VL comprising the amino acid sequence of SEQ ID NO: 18.
  • R 2 comprises an antibody comprising a heavy chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 19 and/or comprising a light chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 20.
  • R 2 comprises an antibody comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and/or comprising a light chain comprising the amino acid sequence of SEQ ID NO: 20.
  • R 2 comprises an antibody that is a Fab fragment, a full-length IgG, a Fab' fragment, a F(ab')2 fragment, an scFv, or an Fv.
  • R 2 comprises an antibody that is a Fab fragment.
  • nl is independently an integer (e.g., an integer in the range of 1-27, 1-26, 1-10, 1-5, or 1-3).
  • compositions for administration to a subject in the methods described herein further comprise complexes in which nl is 0.
  • R 2 comprises an antibody comprising a sequence as set forth in Table 2.
  • R 2 comprises an antibody comprising a heavy chain complementarity determining region 1 (CDR-H1) comprising a sequence as set forth in SEQ ID NOs: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising a sequence as set forth in SEQ ID NOs: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising a sequence as set forth in SEQ ID NOs: 3, 9, or 14; and/or comprising a light chain complementarity determining region 1 (CDR-L1) comprising a sequence as set forth in SEQ ID NOs: 4, 10, or 15, a light chain complementarity determining region 2 (CDR- L2) comprising a sequence as set forth in SEQ ID NOs: 5, or 11, and a light chain complementarity determining region 3 (CDR-H1) comprising a sequence as set forth in SEQ ID NOs: 1, 7, or 12, a heavy chain complementarity
  • R 2 comprises an antibody comprising a heavy chain variable region (VH) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 17 and/or comprising a light chain variable region (VL) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 18.
  • R 2 comprises an antibody comprising a VH comprising the amino acid sequence of SEQ ID NO: 17 and/or comprising a VL comprising the amino acid sequence of SEQ ID NO: 18.
  • R 2 comprises an antibody comprising a heavy chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 19 and/or comprising a light chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 20.
  • R 2 comprises an antibody comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and/or comprising a light chain comprising the amino acid sequence of SEQ ID NO: 20.
  • R 2 comprises an antibody that is a Fab fragment, a full-length IgG, a Fab' fragment, a F(ab')2 fragment, an scFv, or an Fv.
  • R 2 comprises an antibody that is a Fab fragment.
  • nl is independently an integer (e.g., an integer in the range of 1-27, 1-26, 1-10, 1-5, or 1-3).
  • compositions for administration to a subject in the methods described herein further comprise complexes in which nl is 0.
  • compositions for administration to a subject in the methods described herein comprise complexes that comprise a structure of the formula (Id):
  • oligonucleotide comprises a nucleobase sequence of CAGCGCCCACCAGUCA (SEQ ID NO: 21); wherein R 2 comprises an antibody comprising a sequence as set forth in Table 2; wherein nl is an integer (e.g., one or greater) representing the number of instances of the group enclosed by square brackets, wherein each
  • R 2 comprises an antibody comprising a heavy chain complementarity determining region 1 (CDR-H1) comprising a sequence as set forth in SEQ ID NOs: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising a sequence as set forth in SEQ ID NOs: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising a sequence as set forth in SEQ ID NOs: 3, 9, or 14; and/or comprising a light chain complementarity determining region 1 (CDR-L1) comprising a sequence as set forth in SEQ ID NOs: 4, 10, or 15, a light chain complementarity determining region 2 (CDR-L2) comprising a sequence as set forth in SEQ ID NOs: 5, or 11, and a light chain complementarity determining region 3 (CDR-L3) comprising a sequence as set forth in SEQ ID NO: 6 or 16.
  • CDR-H1 heavy chain complementarity determining region 1
  • CDR-H2 comprising a
  • R 2 comprises an antibody comprising a heavy chain variable region (VH) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 17 and/or comprising a light chain variable region (VL) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 18.
  • R 2 comprises an antibody comprising a VH comprising the amino acid sequence of SEQ ID NO: 17 and/or comprising a VL comprising the amino acid sequence of SEQ ID NO: 18.
  • R 2 comprises an antibody comprising a heavy chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 19 and/or comprising a light chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 20.
  • R 2 comprises an antibody comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and/or comprising a light chain comprising the amino acid sequence of SEQ ID NO: 20.
  • R 2 comprises an antibody that is a Fab fragment, a full-length IgG, a Fab' fragment, a F(ab')2 fragment, an scFv, or an Fv.
  • R 2 comprises an antibody that is a Fab fragment.
  • nl is independently an integer (e.g., an integer in the range of 1-27, 1-26, 1-10, 1-5, or 1-3).
  • compositions for administration to a subject in the methods described herein further comprise complexes in which nl is 0.
  • compositions for administration to a subject in the methods described herein comprise a structure of formula (A):
  • a complex described herein comprises an anti-TfRl antibody (e.g., an anti-TfRl Fab) covalently linked via a lysine of the antibody to the 5’ end of an oligonucleotide (e.g., an oligonucleotide comprising a 5’-X-Y-Z-3’ configuration).
  • the antibody comprises a sequence as set forth in Table 2.
  • the antibody comprises a heavy chain complementarity determining region 1 (CDR-H1) comprising a sequence as set forth in SEQ ID NOs: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR- H2) comprising a sequence as set forth in SEQ ID NOs: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising a sequence as set forth in SEQ ID NOs: 3, 9, or 14; and/or comprises a light chain complementarity determining region 1 (CDR-L1) comprising a sequence as set forth in SEQ ID NOs: 4, 10, or 15, a light chain complementarity determining region 2 (CDR-L2) comprising a sequence as set forth in SEQ ID NOs: 5, or 11, and a light chain complementarity determining region 3 (CDR-L3) comprising a sequence as set forth in SEQ ID NO: 6 or 16.
  • CDR-H1 comprising a sequence as set forth in SEQ
  • the antibody comprises a heavy chain variable region (VH) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 17 and/or comprises a light chain variable region (VL) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 18.
  • VH heavy chain variable region
  • VL light chain variable region
  • the antibody comprises a VH comprising the amino acid sequence of SEQ ID NO: 17 and/or comprises a VL comprising the amino acid sequence of SEQ ID NO: 18.
  • the antibody comprises a heavy chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 19 and/or comprises a light chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 20.
  • the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and/or comprises a light chain comprising the amino acid sequence of SEQ ID NO: 20.
  • the antibody is a Fab fragment, a full-length IgG, a Fab' fragment, a F(ab')2 fragment, an scFv, or an Fv.
  • the antibody is a Fab fragment.
  • a composition is formulated to be compatible with its intended route of administration.
  • routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, administration.
  • the route of administration is intravenous or subcutaneous.
  • complexes comprising an anti-TfRl antibody (e.g., Fab) covalently linked to a molecular payload (e.g., a DMPK-targeting oligonucleotide) as described herein are effective in treating a subject having a myotonic dystrophy, e.g., DM1.
  • a molecular payload e.g., a DMPK-targeting oligonucleotide
  • complexes comprise a molecular payload that is an oligonucleotide, e.g., an oligonucleotide that facilitates reduced expression or activity of DMPK (e.g., reduced level of a mutant or wild-type DMPK RNA) in a subject (e.g., a subject having DM1).
  • a subject may be a human subject, a non-human primate subject (e.g., cynomolgus monkey), a rodent subject, or any suitable mammalian subject.
  • the subject is human.
  • the subject is a neonatal or young pediatric human subject (e.g., a human subject that is less than 4 years old, less than 3 years old, less than 2 years old, less than 1 year old, about 11 months old, about 10 months old, about 9 months old, about 8 months old, about 7 months old, about 6 months old, about 5 months old, about 4 months old, about 3 months old, about 2 months old, or about 1 month old).
  • the subject is a human subject that is between 2 and 60 (e.g., 2-60, 2-50, 2-40, 2-30, 2-20, 2-10) years old. In some embodiments, the subject is a human subject that is between 5 and 30 (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) years old.
  • 2 and 60 e.g., 2-60, 2-50, 2-40, 2-30, 2-20, 2-10) years old.
  • the subject is a human subject that is between 5 and 30 (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) years old.
  • the subject is a human subject that is between 18 and 50 (e.g., 18-50, 18-45, 18-40, 18-35, 18-30, 18-25, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) years old.
  • the subject is a human subject that is 60 years old or older (e.g., about 60 years old, about 65 years old, about 70 years old, about 75 years old, or about 80 years old).
  • the subject is a human subject that is between 5 and 12 (e.g., 5, 6, 7, 8, 9, 10, 11, or 12) years old.
  • the subject is a human subject that is 4-16 (e.g., 4-16, 5-16, 6-16, 7-16, 8-16, 9-16, 10-16, 11-16, 12-16, 13-16, 14-16, 15-16, 4-15, 5-15, 6-15, 7-15, 8-15, 9-15, 10-15, 11-15, 12-15, 13-15, 14- 15, 4-14, 5-14, 6-14, 7-14, 8-14, 9-14, 10-14, 11-14, 12-14, 13-14, 4-13, 5-13, 6-13, 7-13, 8- 13, 9-13, 10-13, 11-13, 12-13, 4-12, 5-12, 6-12, 7-12, 8-12, 9-12, 10-12, 11-12, 4-11, 5-11, 6- 11, 7-11, 8-11, 9-16, 10-11, 4-10, 5-10, 6-10, 7-10, 8-10, 9-10, 4-9, 5-9, 6-9, 7-9, 8-9, 4-9, 5-9, 6-9, 7-9, 8-9, 4-8, 5-8, 6-8, 7-8, 4-7,
  • a subject may have myotonic dystrophy, such as DM1.
  • a subject has a DMPK allele, which may optionally contain a disease- associated repeat, e.g., a CTG trinucleotide repeat expansion.
  • a subject may have a DMPK allele with an expanded disease-associated-repeat that comprises about 2- 10 repeat units, about 2-50 repeat units, about 2-100 repeat units, about 50-1,000 repeat units, about 50-500 repeat units, about 50-250 repeat units, about 50-100 repeat units, about 500- 10,000 repeat units, about 500-5,000 repeat units, about 500-2,500 repeat units, about 500- 1,000 repeat units, or about 1,000-10,000 repeat units.
  • a subject is suffering from symptoms of DM1, e.g. muscle atrophy, muscle loss, excessive daytime sleepiness or cognitive delay. In some embodiments, a subject is not suffering from symptoms of DM1. In some embodiments, subjects have congenital myotonic dystrophy. In some embodiments, a subject is ambulant. In some embodiments, a subject is non-ambulant.
  • symptoms of DM1 e.g. muscle atrophy, muscle loss, excessive daytime sleepiness or cognitive delay.
  • a subject is not suffering from symptoms of DM1.
  • subjects have congenital myotonic dystrophy.
  • a subject is ambulant. In some embodiments, a subject is non-ambulant.
  • An aspect of the disclosure includes methods involving administering to a subject an effective amount of a composition (e.g., aqueous solution) comprising complexes as described herein.
  • a composition e.g., aqueous solution
  • an effective amount of a composition e.g., aqueous solution
  • that comprises complexes comprising an anti-TfRl antibody (e.g., Fab) described herein covalently linked to an oligonucleotide (e.g., a DMPK-targeting oligonucleotide) described herein can be administered to a subject in need of treatment.
  • a composition e.g., aqueous solution
  • a pharmaceutical composition comprising complexes as described herein may be administered by a suitable route, which may include intravenous administration, e.g., as a bolus or by continuous infusion over a period of time. In some embodiments, administration may be performed by intravenous, intramuscular, intraperitoneal, intracerebrospinal, subcutaneous, intra- articular, intrasynovial, or intrathecal routes. In some embodiments, a composition (e.g., aqueous solution) comprising complexes as described herein is administered by infusion (e.g., intravenous infusion).
  • infusion e.g., intravenous infusion
  • a composition comprising a plurality of complexes described herein may be in solid form, aqueous form, or a liquid form.
  • an aqueous or liquid form may be nebulized or lyophilized.
  • a lyophilized form may be reconstituted with an aqueous or liquid solution (e.g., prior to administration, such as by intravenous infusion).
  • DMPK allele associated with myotonic dystrophy comprising administering to the subject a composition comprising a complex or plurality of complexes described herein with an effective amount of the complexes.
  • methods of and/or uses for reducing the expression or activity of DMPK e.g., reducing the level of a mutant or wild-type DMPK RNA, or the activity of a DMPK gene product
  • the methods comprising contacting the cell with the composition comprising a plurality of complexes described herein with an effective amount of the complex(es).
  • the method comprises administering a lyophilized form (e.g., lyophilized powder) of a composition comprising a plurality of complexes described herein, comprising reconstituting a lyophilized form of the composition in an aqueous solution, and administering the aqueous solution to a subject in need thereof.
  • a lyophilized form e.g., lyophilized powder
  • a lyophilized form of the composition comprising a complex or plurality of complexes is shipped and/or stored in the lyophilized form, reconstituted in an aqueous solution at a location (e.g., healthcare provider location) for administration, and administered in the reconstituted form (e.g., as an aqueous solution) by injection or intravenously, e.g., by infusion.
  • the subject has a DMPK allele, which may optionally contain a disease- associated repeat, e.g., a CTG trinucleotide repeat expansion.
  • a composition is administered via site-specific or local delivery techniques.
  • these techniques include implantable depot sources of the complex, local delivery catheters, site specific carriers, direct injection, or direct application.
  • methods of reducing expression or activity of DMPK e.g., reducing the level of a mutant or wild-type DMPK RNA, or the activity of a DMPK gene product
  • methods of treating myotonic dystrophy e.g., DM1
  • methods provided herein comprise administering to the subject a composition comprising an effective amount of complexes, each complex comprising an anti-transferrin receptor 1 (TfRl) antibody (e.g., a Fab) covalently linked to one or more oligonucleotides, wherein the antibody comprises: a heavy chain complementarity determining region 1 (CDR-H1) comprising a sequence as set forth in SEQ ID NOs: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR- H2) comprising a sequence as set forth in SEQ ID NOs: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising a sequence as set forth in SEQ ID NOs: 3, 9, or 14, a light chain complementarity determining region 1 (CDR-L1) comprising a sequence as set forth in SEQ ID NOs: 4, 10, or 15, a light chain complementarity determining region 2 (CDR-L2) comprising a sequence as set forth in SEQ ID
  • methods provided herein comprise administering to the subject a composition comprising an effective amount of complexes, wherein each complex comprises a structure of formula (I): [R x ]nl-R 2 , wherein each instance of R 1 in a complex of a composition provided herein comprises a group of the formula (la):
  • R 3 comprises an oligonucleotide comprising a nucleobase sequence of CAGCGCCCACCAGUCA (SEQ ID NO: 21), optionally wherein R 3 comprises an oligonucleotide comprising a structure of +C*+A*oG*oC*dG*dC*dC*dC*dA*dC*dC*dA*oG*oU*+C*+A (SEQ ID NO: 21), wherein +N represents an LNA (2’ -4’ methylene bridge) ribonucleoside, dN represents a 2’- deoxyribonucleoside, oN represents a 2’ -MOE modified ribonucleoside, oC represents a 5- methyl-2’-MOE-cytidine, +C represents a 5-methyl-2’-4’-bicyclic-cytidine (2 ’-4’ methylene bridge), oU represents a 5-methyl-2’-MOE-uridine, and *
  • compositions for administration to a subject in the methods described herein further comprise complexes that comprise a structure of formula (I): [R ⁇ ni-R 2 , wherein nl is 0.
  • the average value of nl of complexes in a composition disclosed herein is in the range of 0.5 to 5 (e.g., 0.5-5, 1-5, 1-4, 1-3, 3-5, 0.5-4, 0.5-3, 0.5-2, 0.5-1.5, 0.5-1, 0.7- 1.5, 1-1.6, 1-1.5, 1-1.4, 1-1.3, 1-1.2, 1.1-1.5, 0.8-2, 0.8-1.5, O.8-1.3, 0.8-1.2, 0.8-1.1, 0.9-3, 0.9- 2, 0.9-1.8, 0.9-1.6, 0.9-1.5, 0.9-1.4, 0.9-1.3, or 0.9-1.2).
  • 0.5-5, 1-5, 1-4, 1-3, 3-5, 0.5-4, 0.5-3, 0.5-2 0.5-1.5, 0.5-1, 0.7- 1.5, 1-1.6, 1-1.5, 1-1.4, 1-1.3, 1-1.2, 1.1-1.5, 0.8-2, 0.8-1.5, O.8-1.3, 0.8-1.2, 0.8-1.1, 0.9-3, 0.9- 2,
  • methods provided herein comprise administering to the subject a composition comprising an effective amount of complexes, wherein each complex comprises a structure of formula (I): [R ⁇ ni-R 2 , wherein each instance of R 1 in a complex of a composition provided herein comprises a group of the formula (lb): wherein +N represents an LNA (2’-4’ methylene bridge) ribonucleoside, dN represents a 2’- deoxyribonucleoside, oN represents a 2’-O-methoxyethyl (MOE) modified ribonucleoside, oC represents a 5-methyl-2’-MOE-cytidine, +C represents a 5-methyl-2’-4’-bicyclic-cytidine (2’- 4’ methylene bridge), oU represents a 5-methyl-2’-MOE-uridine, * represents a phosphorothioate internucleoside linkage, and wherein the oligonucle
  • compositions for administration to a subject in the methods described herein further comprise complexes that comprise a structure of formula (I): [R ⁇ ni-R 2 , wherein nl is 0.
  • the average value of nl of complexes in a composition disclosed herein is in the range of 0.5 to 5 (e.g., 0.5-5, 1-5, 1-4, 1-3, 3-5, 0.5-4, 0.5-3, 0.5-2, 0.5-1.5, 0.5-1, 0.7- 1.5, 1-1.6, 1-1.5, 1-1.4, 1-1.3, 1-1.2, 1.1-1.5, 0.8-2, 0.8-1.5, O.8-1.3, 0.8-1.2, 0.8-1.1, 0.9-3, 0.9-
  • methods provided herein comprise administering to the subject a composition comprising an effective amount of complexes, wherein each complex comprises a structure of formula (I): [R ⁇ ni-R 2 , wherein each R 1 of the complexes comprises a group of the formula (Ic):
  • R 2 comprises an anti-TfRl antibody (e.g., Fab) comprising: a heavy chain complementarity determining region 1 (CDR-H1) comprising a sequence as set forth in SEQ ID NOs: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising a sequence as set forth in SEQ ID NOs: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising a sequence as set forth in SEQ ID NOs: 3, 9, or 14, a light chain complementarity determining region 1 (CDR-L1) comprising a sequence as set forth in SEQ ID NOs: 4, 10, or 15, a light chain complementarity determining region 2 (CDR-L2) comprising a sequence as set forth in SEQ ID NOs: 5 or 11, and a light chain complementarity determining region 3 (CDR-L3) comprising a sequence as set forth in SEQ ID NOs: 6 or 16, optionally wherein the antibody (e.g., Fab) compris
  • compositions for administration to a subject in the methods described herein further comprise complexes that comprise a structure of formula (I): [R ⁇ ni-R 2 , wherein nl is 0.
  • the average value of nl of complexes in a composition disclosed herein is in the range of 0.5 to 5 (e.g., 0.5-5, 1-5, 1-4, 1-3, 3-5, 0.5-4, 0.5-3, 0.5-2, 0.5-1.5, 0.5- 1, 0.7-1.5, 1-1.6, 1-1.5, 1-1.4, 1-1.3, 1-1.2, 1.1-1.5, 0.8-2, 0.8-1.5, O.8-1.3, 0.8-1.2, 0.8-1.1, 0.9- 3, 0.9-2, 0.9-1.8, 0.9-1.6, 0.9-1.5, 0.9-1.4, 0.9-1.3, or 0.9-1.2).
  • 0.5-5, 1-5, 1-4, 1-3, 3-5, 0.5-4, 0.5-3, 0.5-2 0.5-1.5, 0.5- 1, 0.7-1.5, 1-1.6, 1-1.5, 1-1.4, 1-1.3, 1-1.2, 1.1-1.5, 0.8-2, 0.8-1.5, O.8-1.3, 0.8-1.2, 0.8-1.1, 0.9- 3, 0.9-2,
  • methods provided herein comprise administering to the subject a composition comprising an effective amount of muscle targeting complexes, wherein each complex comprises a group of the formula (Id): wherein +N represents an LNA (2’-4’ methylene bridge) ribonucleoside, dN represents a 2’ -deoxyribonucleoside, oN represents a 2’-O-methoxyethyl (MOE) modified ribonucleoside, oC represents a 5-methyl-2’-MOE-cytidine, +C represents a 5-methyl-2’-4’- bicyclic-cytidine (2 ’-4’ methylene bridge), oU represents a 5-methyl-2’-MOE-uridine, * represents a phosphorothioate internucleoside linkage, and wherein the oligonucleotide comprises a nucleobase sequence of CAGCGCCCACCAGUCA (SEQ ID NO: 21); wherein R 2 comprises an anti-
  • compositions for administration to a subject in the methods described herein further comprise complexes in which nl is 0.
  • the average value of nl of complexes in a composition disclosed herein is in the range of 0.5 to 5 (e.g., 0.5-5, 1-5, 1-4, 1-3, 3-5, 0.5-4, 0.5-3, 0.5-2, 0.5-1.5, 0.5- 1, 0.7-1.5, 1-1.6, 1-1.5, 1-1.4, 1-1.3, 1-1.2, 1.1-1.5, 0.8-2, 0.8-1.5, O.8-1.3, 0.8-1.2, 0.8-1.1, 0.9- 3, 0.9-2, 0.9-1.8, 0.9-1.6, 0.9-1.5, 0.9-1.4, 0.9-1.3, or 0.9-1.2).
  • the composition in an aqueous solution and further comprises tris(hydroxymethyl)aminomethane and sucrose, wherein the tris(hydroxymethyl)aminomethane is present in the aqueous solution at a concentration of 5 mM to 50 mM, the sucrose is present in the aqueous solution at a concentration of 5 ⁇ IN% to 15 ⁇ IN%.
  • the composition in an aqueous solution and further comprises tris(hydroxymethyl)aminomethane and sucrose, wherein the tris(hydroxymethyl)aminomethane is present in the aqueous solution at a concentration of or about 25 mM, the sucrose is present in the aqueous solution at a concentration of or about 10 ⁇ IN%, and the composition is at a pH of or about 7.5.
  • the complexes are present in the composition at a concentration in the range of 10 mg/mL to 50 mg/mL (e.g., 10 mg/mL, 15 mg/mL, 20 mg/mL, 25 mg/mL, 30 mg/mL, 35 mg/mL, 40 mg/mL, 45 mg/mL, 50 mg/mL).
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes comprising a structure of formula (I): [R ⁇ ni -R 2 as described herein (e.g., comprising a group of the formula (la), (lb), (Ic), or (Id)).
  • an effective amount of the complexes provides to the subject an amount of the anti-TfRl antibody (e.g., Fab) of the complexes per kg of the subject, and the amount of oligonucleotides of the complexes provided to the subject per kg of the subject can be derived using the equation (Equation A) below:
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes comprising a structure of formula (I): [R ⁇ ni -R 2 as described herein (e.g., comprising a group of the formula (la), (lb), (Ic), or (Id)).
  • an effective amount of the complexes provides an amount of the oligonucleotides of the complexes to the subject per kg of the subject, and the amount of the anti-TfRl antibody (e.g., Fab) of the complexes provided to the subject per kg of the subject can be derived using the equation (Equation B) below: in which “MW” indicates molecular weight (g/mol), and “average value of nl” indicates the average value of nl of the complexes of the composition.
  • the average value of nl need not be an integer and can be a decimal. In some embodiments, the present disclosure contemplates variation in the average value of nl of up to 30% (e.g., ⁇ up to 30%, ⁇ up to 25%, ⁇ up to 20%, ⁇ up to 15%, ⁇ up to 10%, ⁇ up to 5%, ⁇ up to 3 %, or ⁇ up to 1%).
  • the average value of nl of the complexes of the composition is in the range of 0.5 to 5 (e.g., 0.5-5, 0.5-4.5, 0.5-4, 0.5-3.5, 0.5-3, 0.5-2.5, 0.5-2, 0.5-1.5, 0.5-1, 1-5, 1-4.5, 1-4, 1-3.5, 1-3, 1-2.5, 1-2, 1-1.5, 1.5-5,
  • up to 30% e.g., ⁇ up to 30%, ⁇ up to 25%, ⁇ up to 20%, ⁇ up to 15%, ⁇ up to 10%, ⁇ up to 5%, ⁇ up to 3 %, or ⁇ up to 1%.
  • a method provided herein comprises administering to the subject a composition comprising an effective amount of complexes comprising a structure of formula (I): [R 1 ] n i-R 2 as described herein (e.g., comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the average value of nl of the complexes of the composition is in the range of 0.5 to 5 (e.g., 0.5-5, 0.5-4.5, 0.5-4, 0.5-3.5, 0.5-3, 0.5-2.5, 0.5-2, 0.5-1.5, 0.5-1, 1-5, 1-4.5, 1-4, 1-3.5, 1-3, 1-2.5, 1-2, 1-1.5,
  • a method provided herein comprises administering to the subject a composition comprising an effective amount of complexes comprising a structure of formula (I): [R 1 ] n i-R 2 as described herein (e.g., comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the average value of nl of the complexes of the composition is about 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, 0.95, 1, 1.05, 1.1, 1.15, 1.2, 1.25, 1.3, 1,35, 1.4, 1.45, or 1.5, with a variation of up to 30% (e.g., ⁇ up to 30%, ⁇ up to 25%, ⁇ up to 20%, ⁇ up to 15%, ⁇ up to 10%, ⁇ up to 5%, ⁇ up to 3 %, or ⁇ up to 1%).
  • a composition comprising an effective amount of complexes comprising a structure of formula (I):
  • a method provided herein comprises administering to the subject a composition comprising an effective amount of complexes comprising a structure of formula (I): [R ⁇ ni-R 2 as described herein (e.g., comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the average value of nl of the complexes of the composition is about 1.1 or 1.15, with a variation of up to 30% (e.g., ⁇ up to 30%, ⁇ up to 25%, ⁇ up to 20%, ⁇ up to 15%, ⁇ up to 10%, ⁇ up to 5%, ⁇ up to 3 %, or ⁇ up to 1%).
  • a composition comprising an effective amount of complexes comprising a structure of formula (I): [R ⁇ ni-R 2 as described herein (e.g., comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the average value of nl of the complexes of the
  • any amount of anti-TfRl antibody (e.g., Fab) provided herein can be represented as an amount of oligonucleotide (e.g., DMPK-targeting oligonucleotide) according to Equation A.
  • oligonucleotide e.g., DMPK-targeting oligonucleotide
  • description herein relating to providing any amount of anti-TfRl antibody (e.g., Fab) alternatively can be understood as providing oligonucleotide (e.g., DMPK-targeting oligonucleotide) of a corresponding amount according to Equation A.
  • any amount of oligonucleoside e.g., DMPK-targeting oligonucleotide
  • an amount of anti-TfRl antibody e.g., Fab
  • description herein relating to providing any amount of oligonucleoside alternatively can be understood as providing anti-TfRl antibody (e.g., Fab) of a corresponding amount according to Equation B.
  • a method provided herein comprises administering to the subject a composition comprising an effective amount of complexes comprising a structure of formula (I): [R ⁇ ni -R 2 as described herein (e.g., comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount of complexes provides to the subject an amount of the anti-TfRl antibody (e.g., Fab) of the complexes per kg of the subject, and wherein the amount of oligonucleotides provided to the subject per kg of the subject is derived using Equation A provided herein based on the average value of nl of the complexes of the composition and the amount of anti-TfRl antibody (e.g., Fab) of the complexes provided to the subject per kg of the subject.
  • the effective amount of complexes provides to the subject an amount of the anti-TfRl antibody (e.g., Fab) of the complexes per kg of the subject, and
  • the amount of oligonucleotide varies up to 30% from the amount derived from Equation A (e.g., ⁇ up to 30%, ⁇ up to 25%, ⁇ up to 20%, ⁇ up to 15%, ⁇ up to 10%, ⁇ up to 5%, ⁇ up to 3 %, or ⁇ up to 1%).
  • a method provided herein comprises administering to the subject a composition comprising an effective amount of complexes comprising a structure of formula (I): [R ⁇ ni -R 2 as described herein, wherein the composition comprises an amount of the oligonucleotides of the complexes per kg of the subject, and wherein the amount of anti-TfRl antibody (e.g., Fab) provided to the subject per kg of the subject is derived using Equation B provided herein based on the average value of nl of the complexes of the composition and the amount of oligonucleotides of the complexes provided to the subject per kg of the subject.
  • Fab anti-TfRl antibody
  • the amount of anti-TfRl antibody varies up to 45% from the amount derived from Equation B (e.g., ⁇ up to 45%, ⁇ up to 40%, ⁇ up to 35%, ⁇ up to 30%, ⁇ up to 25%, ⁇ up to 20%, ⁇ up to 15%, ⁇ up to 10%, ⁇ up to 5%, ⁇ up to 3 %, or ⁇ up to 1%).
  • the oligonucleotide is represented by the structure of: which corresponds to a molecular weight of 5,667 g/mol.
  • an anti-TfRl Fab (e.g., an anti-TfRl Fab comprising a heavy chain and a light chain provided in Table 2) of a complex used in the methods described herein has a molecular weight of 47,986 g/mol.
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes comprising a structure of formula (I): [R ⁇ ni-R 2 as described herein (e.g., comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount of complexes provides to the subject an amount of the anti-TfRl Fab of the complexes per kg of the subject, and an amount of oligonucleotide per kg of the subject, wherein the amount of oligonucleotide is:
  • oligonucleotide amount (mg) I - - — I * 1.15 * 5667 , ⁇ s[), provid ,ed , , t,hat ,
  • the amount of oligonucleotide varies up to 30% from the amount derived from Equation A (e.g., ⁇ up to 30%, ⁇ up to 25%, ⁇ up to 20%, ⁇ up to 15%, ⁇ up to 10%, ⁇ up to 5%, ⁇ up to 3 %, or ⁇ up to 1%).
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes comprising a structure of formula (I): [R ⁇ ni -R 2 as described herein (e.g., comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount of complexes provides to the subject an amount of the anti-TfRl Fab of the complexes per kg of the subject, and an amount of oligonucleotide per kg of the subject, wherein the amount of oligonucleotide is:
  • anti-TfRl antibody amount (mg) ⁇ , r- z g ⁇ • , i . i . oligonucleotide amount (mg) I - - — I * 1.15 * 5667 (J ⁇ J), provided that
  • the amount of oligonucleotide varies up to 30% from the amount derived from Equation A (e.g., ⁇ up to 30%, ⁇ up to 25%, ⁇ up to 20%, ⁇ up to 15%, ⁇ up to 10%, ⁇ up to 5%, ⁇ up to 3 %, or ⁇ up to 1%).
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes comprising a structure of formula (I): [R ⁇ ni -R 2 as described herein, wherein the effective amount of complexes provides to the subject an amount of the oligonucleotides of the complexes per kg of the subject, and an amount of anti-TfRl Fab per kg of the subject, wherein the amount of anti-TfRl Fab is: * 47986 ( ⁇ ), provided that the average value of nl of the complexes of the composition is 1.15.
  • the amount of anti-TfRl antibody varies up to 45% from the amount derived from Equation B (e.g., ⁇ up to 45%, ⁇ up to 40%, ⁇ up to 35%, ⁇ up to 30%, ⁇ up to 25%, ⁇ up to 20%, ⁇ up to 15%, ⁇ up to 10%, ⁇ up to 5%, ⁇ up to 3 %, or ⁇ up to 1%).
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes comprising a structure of formula (I): [R ⁇ ni -R 2 as described herein, wherein the effective amount of complexes provides to the subject an amount of the oligonucleotides of the complexes per kg of the subject, and an amount of anti-TfRl Fab per kg of the subject, wherein the amount of anti-TfRl Fab is: provided that the average value of nl of the complexes of the composition is 1.15.
  • the amount of anti-TfRl antibody varies up to 45% from the amount derived from Equation B (e.g., ⁇ up to 45%, ⁇ up to 40%, ⁇ up to 35%, ⁇ up to 30%, ⁇ up to 25%, ⁇ up to 20%, ⁇ up to 15%, ⁇ up to 10%, ⁇ up to 5%, ⁇ up to 3 %, or ⁇ up to l%).
  • the administration occurs one or more times.
  • the subject is administered a single dose of any one of the compositions comprising an effective amount of the complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni- R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)).
  • the subject is administered multiple doses of any one of the compositions comprising an effective amount of the complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)).
  • a method described herein comprises administering to the subject a composition comprising an effective amount of the complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)) once a week to once every 16 weeks.
  • an effective amount of the complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • a method described herein comprises administering to the subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)) once a week, once every 2 weeks, once every 3 weeks, once every 4 weeks, once every 5 weeks, once every 6 weeks, once every 7 weeks, once every 8 weeks, once every 9 weeks, once every 10 weeks, once every 11 weeks, once every 12 weeks, once every 13 weeks, once every 14 weeks, once every 15 weeks, or once every 16 weeks.
  • complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • a composition is administered to a subject during a period of administration.
  • a period of administration is 1-24 (e.g., 1-24, 2-24, 3-24, 4-24, 5-24, 6-24, 7-24, 8-24, 9-24, 10-24, 11-24, 12-24, 13-24, 14-24, 15-24, 16-24, 17-24, 18-24, 1-18, 1-12, 1-8, 1- 6, 1-5, 1-4, 1-3, 1-2, 2-18, 2-12, 2-8, 2-6, 2-4, 4-18, 4-12, 4-8, 4-6, 6-18, 6-12, 6-8, 8-18, 8-12, or 12-18) months.
  • a period of administration is less than 1 month, less than 2 months, less than 3 months, less than 4 months, less than 5 months, less than 6 months, less than 7 months, less than 8 months, less than 9 months, less than 10 months, less than 11 months, less than 12 months, less than 13 months, less than 14 months, less than 15 months, less than 16 months, less than 17 months, or less than 18 months.
  • a period of administration is 1-20 (e.g., 1-20, 2-20, 3-20, 4-20, 5-20, 6-20, 7-20, 8-20, 9-20, 10- 20, 11-20, 12-20, 13-20, 14-20, 15-20, 16-20, 17-20, 18-20, 19-20, 2-18, 2-12, 2-10, 2-5, 4-18, 4-12, 4-8, 6-18, 6-12, or 6-8) years.
  • a period of administration is less than 1 year, less than 2 years, less than 3 years, less than 4 years, less than 5 years, less than 6 years, less than 7 years, less than 8 years, less than 9 years, less than 10 years, less than 11 years, less than 12 years, less than 13 years, less than 14 years, less than 15 years, less than 16 years, less than 17 years, less than 18 years, less than 19 years, or less than 20 years.
  • a period of administration is at least 1 year, at least 2 years, at least 3 years, at least 4 years, at least 5 years, at least 6 years, at least 7 years, at least 8 years, at least 9 years, at least 10 years, at least 11 years, at least 12 years, at least 13 years, at least 14 years, at least 15 years, at least 16 years, at least 17 years, at least 18 years, at least 19 years, or at least 20 years.
  • a period of administration is 1-50 years (e.g., 1-50 years, 2-50 years, 3-50 years, 4-50 years, 5-50 years, 6-50 years, 7-50 years, 8-50 years, 9-50 years, 10-50 years, 20-50 years, 30-50 years, 40-50 years, 10-20 years, 10-30 years, 10-40 years, 20-30 years, 20-40 years, or 30-40 years). In some embodiments, a period of administration is the remainder of the subject’s life.
  • a method described herein comprises administering to the subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)) once a week, once every 2 weeks, once every 3 weeks, once every 4 weeks, once every 5 weeks, once every 6 weeks, once every 7 weeks, once every 8 weeks, once every 9 weeks, once every 10 weeks, once every 11 weeks, once every 12 weeks, once every 13 weeks, once every 14 weeks, once every 15 weeks, or once every 16 weeks for the remainder of the subject’s lifetime.
  • complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • a method described herein comprises administering to the subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)) once every 4 weeks for the remainder of the subject’s lifetime.
  • complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • a method described herein comprises administering to the subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)) once every 8 weeks for the remainder of the subject’s lifetime.
  • complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • a method described herein comprises administering to the subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)) once every 12 weeks for the remainder of the subject’s lifetime.
  • complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • a method described herein comprises administering to the subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)) once a week to once every four weeks (e.g., once a week, once every 2 weeks, once every 3 weeks, or once every 4 weeks) during a first period of administration, followed by administering to the subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)) once every 4 weeks to once every 16 weeks (e.g., once every 4 weeks, once every 5 weeks, once every 6 weeks, once every 7 weeks, once every 8 weeks, once
  • the first period of administration is 2-24 weeks (e.g., 2-24, 2-20, 2-26, 2-12, 2-8, 2-4, 4-24, 4-20, 4-16, 4-12, 4-8, 8-24, 8-20, 8-16, 8-12, 12-24, 12-20, 12-16, 16-24, 16-20, or 20-24 weeks). In some embodiments, the first period of administration is 2, 3, 4, 5, 6 ,7, 8, 9, 10, 11, 12, 13 ,14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 weeks.
  • the second period of administration is 4 weeks to the remainder of the subject’s lifetime (e.g., 4, 8, 12, 16, 18, 20, 22, 24, 28, 32, 36, 40, 44, 48, 52, 56, 60, 64, 68, 72, 76, 80, 84, 88, 92, 96 weeks or longer to the remainder of the subject’s lifetime).
  • the first period of administration is 8 weeks
  • the second period of administration is 16 weeks.
  • the first period of administration is 8 weeks
  • the second period of administration is the remainder of the subject’s lifetime.
  • each administration during the first period of administration provides the subject with a same amount of complexes (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)) as each administration during the second period of administration.
  • each administration during the first period of administration provides the subject with a different amount of complexes (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)) from each administration during the second period of administration.
  • a method described herein comprises administering to the subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)) once every 4 weeks during a first period of administration of 8 weeks, 12 weeks, or 16 weeks, followed by administering to the subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)) once every 8 weeks during a second period of administration of 16 weeks, 24 weeks, 32 weeks, 40 weeks, 48 weeks, 56 weeks, 64 weeks, 72 weeks, 80 weeks, 88 weeks, 96 weeks, 104 weeks, 112 weeks, 120 weeks, 128 weeks,
  • a method described herein comprises administering to the subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)) once every 4 weeks during a first period of administration of 8 weeks, 12 weeks, or 16 weeks, followed by administering to the subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)) once every 8 weeks during a second period of administration of 16 weeks, 24 weeks, 32 weeks, 40 weeks, 48 weeks, 56 weeks, 64 weeks, 72 weeks, 80 weeks, 88 weeks, 96 weeks, 104 weeks, 112 weeks, 120 weeks, 128 weeks,
  • additional administrations maybe given to the subject during any period of administration.
  • the effective amount of complexes provides to the subject 2 mg to 220 mg (e.g., 2 mg to 220 mg, 5 mg to 220 mg, 5 mg to 210 mg, 5 mg to 200 mg, 5 mg to 190 mg, 5 mg to 180 mg, 5 mg to 170 mg, 5 mg to 160 mg, 5 mg to 150 mg, 5 mg to 140 mg, 5 mg to 130 mg, 5 mg to 120 mg, 5 mg to 110 mg, 5 mg to 100 mg, 5 mg to 90 mg, 5 mg to 80 mg, 5 mg to 75 mg, 5 mg to 70 mg, 5 mg to 60 mg, 5 mg to 50 mg, 5 mg to 40 mg, 5 mg to 30 mg, 5 mg to 20 mg, 5 mg to 10 mg, 8 mg to 220 mg, 8
  • the effective amount of complexes provides to the subject about 5 mg, 6 mg, 7 mg, 8 mg, 9 mg, 10 mg, 11 mg, 12 mg, 13 mg, 14 mg, 15 mg, 16 mg, 17 mg, 18 mg, 19 mg, 20 mg, 21 mg, 22 mg, 23 mg, 24 mg, 25 mg, 26 mg, 27 mg, 28 mg, 29 mg, 30 mg, 31 mg, 32 mg, 33 mg, 34 mg, 35 mg, 36 mg, 37 mg, 38 mg, 39 mg, 40 mg, 41 mg, 42 mg, 43 mg, 44 mg, 45 mg, 46 mg, 47 mg, 48 mg, 49 mg, 50 mg, 51 mg, 52 mg, 53 mg, 54 mg, 55 mg, 56 mg, 57 mg, 58 mg, 59 mg, 60 mg,
  • the values can vary by up to 45% (e.g., ⁇ up to 45%, ⁇ up to 40%, ⁇ up to 35%, ⁇ up to 30%, ⁇ up to 25%, ⁇ up to 20%, ⁇ up to 15%, ⁇ up to 10%, ⁇ up to 5%, ⁇ up to 3 %, or ⁇ up to 1%).
  • up to 45% e.g., ⁇ up to 45%, ⁇ up to 40%, ⁇ up to 35%, ⁇ up to 30%, ⁇ up to 25%, ⁇ up to 20%, ⁇ up to 15%, ⁇ up to 10%, ⁇ up to 5%, ⁇ up to 3 %, or ⁇ up to 1%).
  • the effective amount of complexes provides to the subject 0.5 mg to 20 mg (e.g., 0.5 mg to 20 mg, 1 mg to 20 mg, 1 mg to 15 mg, 1 mg to 12 mg, 1 mg to 10 mg, 1 mg to 9 mg, 1 mg to 8 mg, 1 mg to 7 mg, 1 mg to 6 mg, 1 mg to 5 mg, 1 mg to 4 mg, 1 mg to 3 mg, 1 mg to 2 mg, 2 mg to 20 mg, 2 mg to 15 mg, 2 mg to 12 mg, 2 mg to 10 mg, 2 mg to 9 mg, 2 mg to 8 mg, 2 mg to 7 mg, 2 mg to 6 mg, 2 mg to 5 mg, 2 mg to 4 mg, 2 mg to 3 mg, 1 mg to 2 mg, 2 mg to 20 mg, 2 mg to 15 mg, 2 mg to 12 mg, 2 mg to 10 mg, 2 mg to 9 mg, 2 mg to 8 mg, 2 mg to 7 mg, 2 mg to 6 mg, 2 mg to 5 mg, 2 mg to 4 mg, 2 mg to 3 mg, 3 mg to 20 mg, 3 mg to 15 mg
  • the effective amount of complexes (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)) provides to the subject about 0.5 mg, 1 mg, 1.1 mg, 1.5 mg, 1.8 mg, 2 mg, 2.5 mg, 3 mg, 3.4 mg, 3.5 mg, 4 mg, 4.1 mg, 4.5 mg, 5 mg, 5.5 mg, 6 mg, 6.5 mg, 6.8 mg, 7 mg, 7.5 mg, 8 mg, 8.2 mg, 8.5 mg, 9 mg, 9.5 mg, 10 mg, 10.2 mg, 10.5 mg, 11 mg, 11.5 mg, 12 mg, 12.5 mg, 13 mg, 13.5 mg, 14 mg, 14.5 mg, 15 mg, 15.5 mg, 16 mg, 16.5 mg, 17 mg, 17.5 mg, 18 mg, 18.5 mg, 19 mg, 19.5 mg, or 20 mg of the oligonu
  • the values can vary by up to 30% (e.g., ⁇ up to 30%, ⁇ up to 25%, ⁇ up to 20%, ⁇ up to 15%, ⁇ up to 10%, ⁇ up to 5%, ⁇ up to 3 %, or ⁇ up to 1%).
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject 10 mg to 110 mg (e.g., 10 mg to 110 mg, 10 mg to 100 mg, 10 mg to 90 mg, 10 mg to 80 mg, 10 mg to 70 mg, 10 mg to 60 mg, 10 mg to 50 mg, 10 mg to 40 mg, 10 mg to 30 mg, 10 mg to 20 mg, 20 mg to 110 mg, 20 mg to 100 mg, 20 mg to 90 mg, 20 mg to 80 mg, 20 mg to 70 mg, 20 mg to 60 mg, 20 mg to 50 mg, 20 mg to 40 mg, 20 mg to 30 mg, 30 mg to 110 mg, 30 mg to 100 mg, 30 mg to 90 mg,
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject about 13 mg, about 25 mg, about 50 mg, or about 75 mg of the anti-TfRl antibodies of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • the effective amount e.g., of each administration
  • the effective amount (e.g., of each administration) provides to the subject about 29 mg or about 37 mg of the anti-TfRl antibodies of the complexes per kg of the subject.
  • the values can vary by up to 45% (e.g., ⁇ up to 45%, ⁇ up to 40%, ⁇ up to 35%, ⁇ up to 30%, ⁇ up to 25%, ⁇ up to 20%, ⁇ up to 15%, ⁇ up to 10%, ⁇ up to 5%, ⁇ up to 3 %, or ⁇ up to 1%).
  • the composition is administered once every 4 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 8 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 12 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 4 weeks during a first period of administration (e.g., 8 weeks, 12 weeks, or 16 weeks), and subsequently administered once every 8 weeks during a second period of administration (e.g., 16 weeks to the remainder of the subject’s lifetime).
  • a first period of administration e.g., 8 weeks, 12 weeks, or 16 weeks
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject 10 mg to 20 mg (e.g., 10 mg to 20 mg, 10.5 mg to 18 mg, 11 mg to 16 mg, 11.5 mg to 15 mg, 12 mg to 14 mg, or 12.5 mg to 13 mg) of the anti-TfRl antibodies of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • the effective amount e.g., of each
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject about 13 mg of the anti-TfRl antibodies of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • the effective amount e.g., of each administration
  • the values can vary by up to 45% (e.g., ⁇ up to 45%, ⁇ up to 40%, ⁇ up to 35%, ⁇ up to 30%, ⁇ up to 25%, ⁇ up to 20%, ⁇ up to 15%, ⁇ up to 10%, ⁇ up to 5%, ⁇ up to 3 %, or ⁇ up to 1%).
  • the composition is administered once every 4 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 8 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime).
  • the composition is administered once every 12 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 4 weeks during a first period of administration (e.g., 8 weeks, 12 weeks, or 16 weeks), and subsequently administered once every 8 weeks during a second period of administration (e.g., 16 weeks to the remainder of the subject’s lifetime).
  • a first period of administration e.g., 8 weeks, 12 weeks, or 16 weeks
  • a second period of administration e.g., 16 weeks to the remainder of the subject’s lifetime.
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject 18 mg to 36 mg (e.g., 18 mg to 36 mg, 19 mg to 33 mg, 20 mg to 30 mg, 22 mg to 27 mg, or 23 mg to 26 mg) of the anti-TfRl antibodies of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • the effective amount e.g., of each administration
  • the effective amount provides to the
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject about 25 mg of the anti-TfRl antibodies of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • the effective amount e.g., of each administration
  • the values can vary by up to 45% (e.g., ⁇ up to 45%, ⁇ up to 40%, ⁇ up to 35%, ⁇ up to 30%, ⁇ up to 25%, ⁇ up to 20%, ⁇ up to 15%, ⁇ up to 10%, ⁇ up to 5%, ⁇ up to 3 %, or ⁇ up to 1%).
  • the composition is administered once every 4 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 8 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime).
  • the composition is administered once every 12 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 4 weeks during a first period of administration (e.g., 8 weeks, 12 weeks, or 16 weeks), and subsequently administered once every 8 weeks during a second period of administration (e.g., 16 weeks to the remainder of the subject’s lifetime).
  • a first period of administration e.g., 8 weeks, 12 weeks, or 16 weeks
  • a second period of administration e.g., 16 weeks to the remainder of the subject’s lifetime.
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject 20 mg to 43 mg (e.g., 20 mg to 43 mg, 22 mg to 40 mg, 24 mg to 34 mg, 26 mg to 32 mg, or 28 mg to 30 mg) of the anti-TfRl antibodies of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • the effective amount e.g., of each administration
  • the effective amount provides to the
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject about 29 mg of the anti-TfRl antibodies of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • the effective amount e.g., of each administration
  • the values can vary by up to 45% (e.g., ⁇ up to 45%, ⁇ up to 40%, ⁇ up to 35%, ⁇ up to 30%, ⁇ up to 25%, ⁇ up to 20%, ⁇ up to 15%, ⁇ up to 10%, ⁇ up to 5%, ⁇ up to 3 %, or ⁇ up to 1%).
  • the composition is administered once every 4 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 8 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime).
  • the composition is administered once every 12 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 4 weeks during a first period of administration (e.g., 8 weeks, 12 weeks, or 16 weeks), and subsequently administered once every 8 weeks during a second period of administration (e.g., 16 weeks to the remainder of the subject’s lifetime).
  • a first period of administration e.g., 8 weeks, 12 weeks, or 16 weeks
  • a second period of administration e.g., 16 weeks to the remainder of the subject’s lifetime.
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject 26 mg to 53 mg (e.g., 26 mg to 53 mg, 29 mg to 50 mg, 31 mg to 45 mg, 33 mg to 41 mg, or 35 mg to 40 mg) of the anti-TfRl antibodies of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • the effective amount e.g., of each administration
  • the effective amount provides to the
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject about 37 mg of the anti-TfRl antibodies of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • the effective amount e.g., of each administration
  • the values can vary by up to 45% (e.g., ⁇ up to 45%, ⁇ up to 40%, ⁇ up to 35%, ⁇ up to 30%, ⁇ up to 25%, ⁇ up to 20%, ⁇ up to 15%, ⁇ up to 10%, ⁇ up to 5%, ⁇ up to 3 %, or ⁇ up to 1%).
  • the composition is administered once every 4 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 8 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime).
  • the composition is administered once every 12 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 4 weeks during a first period of administration (e.g., 8 weeks, 12 weeks, or 16 weeks), and subsequently administered once every 8 weeks during a second period of administration (e.g., 16 weeks to the remainder of the subject’s lifetime).
  • a first period of administration e.g., 8 weeks, 12 weeks, or 16 weeks
  • a second period of administration e.g., 16 weeks to the remainder of the subject’s lifetime.
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject 36 mg to 72 mg (e.g., 36 mg to 72 mg, 37 mg to 69 mg, 38 mg to 66 mg, 39 mg to 63 mg, 40 mg to 60 mg, 41 mg to 57 mg, 42 mg to 54 mg, or 45 mg to 51 mg) of the anti-TfRl antibodies of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject about 50 mg of the anti-TfRl antibodies of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • the effective amount e.g., of each administration
  • the values can vary by up to 45% (e.g., ⁇ up to 45%, ⁇ up to 40%, ⁇ up to 35%, ⁇ up to 30%, ⁇ up to 25%, ⁇ up to 20%, ⁇ up to 15%, ⁇ up to 10%, ⁇ up to 5%, ⁇ up to 3 %, or ⁇ up to 1%).
  • the composition is administered once every 4 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 8 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime).
  • the composition is administered once every 12 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 4 weeks during a first period of administration (e.g., 8 weeks, 12 weeks, or 16 weeks), and subsequently administered once every 8 weeks during a second period of administration (e.g., 16 weeks to the remainder of the subject’s lifetime).
  • a first period of administration e.g., 8 weeks, 12 weeks, or 16 weeks
  • a second period of administration e.g., 16 weeks to the remainder of the subject’s lifetime.
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject 55 mg to 110 mg (e.g., 55 mg to 110 mg, 58 mg to 100 mg, 61 mg to 95 mg, 64 mg to 90 mg, 67 mg to 85 mg, or 70 mg to 80 mg, or 73 mg to 76 mg) of the anti-TfRl antibodies of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject about 75 mg of the anti-TfRl antibodies of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • the effective amount e.g., of each administration
  • the values can vary by up to 45% (e.g., ⁇ up to 45%, ⁇ up to 40%, ⁇ up to 35%, ⁇ up to 30%, ⁇ up to 25%, ⁇ up to 20%, ⁇ up to 15%, ⁇ up to 10%, ⁇ up to 5%, ⁇ up to 3 %, or ⁇ up to 1%).
  • the composition is administered once every 4 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 8 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime).
  • the composition is administered once every 12 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 4 weeks during a first period of administration (e.g., 8 weeks, 12 weeks, or 16 weeks), and subsequently administered once every 8 weeks during a second period of administration (e.g., 16 weeks to the remainder of the subject’s lifetime).
  • a first period of administration e.g., 8 weeks, 12 weeks, or 16 weeks
  • a second period of administration e.g., 16 weeks to the remainder of the subject’s lifetime.
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject 5 mg to 90 mg (e.g., 5 mg to 90 mg, 5 mg to 80 mg, 5 mg to 70 mg, 5 mg to 60 mg, 5 mg to 50 mg, 5 mg to 40 mg, 5 mg to 30 mg, 5 mg to 20 mg, 5 mg to 10 mg, 10 mg to 90 mg, 10 mg to 80 mg, 10 mg to 70 mg, 10 mg to 60 mg, 10 mg to 50 mg, 10 mg to 40 mg, 10 mg to 30 mg, 10 mg to 20 mg, 20 mg to 90 mg, 20 mg to 80 mg, 20 mg to 70 mg, 20 mg to 60 mg, 10 mg to 50 mg, 10 mg to 40 mg, 10 mg
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject about 8 mg, about 15 mg, about 30 mg, or about 60 mg of the anti-TfRl antibodies of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • the effective amount e.g., of each administration
  • the values can vary by up to 45% (e.g., ⁇ up to 45%, ⁇ up to 40%, ⁇ up to 35%, ⁇ up to 30%, ⁇ up to 25%, ⁇ up to 20%, ⁇ up to 15%, ⁇ up to 10%, ⁇ up to 5%, ⁇ up to 3 %, or ⁇ up to 1%).
  • the composition is administered once every 4 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 8 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime).
  • the composition is administered once every 12 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 4 weeks during a first period of administration (e.g., 8 weeks, 12 weeks, or 16 weeks), and subsequently administered once every 8 weeks during a second period of administration (e.g., 16 weeks to the remainder of the subject’s lifetime).
  • a first period of administration e.g., 8 weeks, 12 weeks, or 16 weeks
  • a second period of administration e.g., 16 weeks to the remainder of the subject’s lifetime.
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject 6 mg to 12 mg (e.g., 6 mg to 12 mg, 6.5 mg to 11 mg, 7 mg to 10 mg, 7.5 mg to 9 mg, or 8 mg to 8.5 mg) of the anti-TfRl antibodies of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • the effective amount e.g., of each administration
  • the effective amount
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject about 8 mg of the anti-TfRl antibodies of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • the effective amount e.g., of each administration
  • the values can vary by up to 45% (e.g., ⁇ up to 45%, ⁇ up to 40%, ⁇ up to 35%, ⁇ up to 30%, ⁇ up to 25%, ⁇ up to 20%, ⁇ up to 15%, ⁇ up to 10%, ⁇ up to 5%, ⁇ up to 3 %, or ⁇ up to 1%).
  • the composition is administered once every 4 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 8 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime).
  • the composition is administered once every 12 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 4 weeks during a first period of administration (e.g., 8 weeks, 12 weeks, or 16 weeks), and subsequently administered once every 8 weeks during a second period of administration (e.g., 16 weeks to the remainder of the subject’s lifetime).
  • a first period of administration e.g., 8 weeks, 12 weeks, or 16 weeks
  • a second period of administration e.g., 16 weeks to the remainder of the subject’s lifetime.
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject 11 mg to 22 mg (e.g., 11 mg to 22 mg, 11.5 mg to 20 mg, 12 mg to 19 mg, 12.5 mg to 18 mg, 13 mg to 17 mg, 14 mg to 16 mg) of the anti-TfRl antibodies of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • the effective amount e.g., of each administration
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject about 15 mg of the anti-TfRl antibodies of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • the effective amount e.g., of each administration
  • the values can vary by up to 45% (e.g., ⁇ up to 45%, ⁇ up to 40%, ⁇ up to 35%, ⁇ up to 30%, ⁇ up to 25%, ⁇ up to 20%, ⁇ up to 15%, ⁇ up to 10%, ⁇ up to 5%, ⁇ up to 3 %, or ⁇ up to 1%).
  • the composition is administered once every 4 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 8 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime).
  • the composition is administered once every 12 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 4 weeks during a first period of administration (e.g., 8 weeks, 12 weeks, or 16 weeks), and subsequently administered once every 8 weeks during a second period of administration (e.g., 16 weeks to the remainder of the subject’s lifetime).
  • a first period of administration e.g., 8 weeks, 12 weeks, or 16 weeks
  • a second period of administration e.g., 16 weeks to the remainder of the subject’s lifetime.
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject 22 mg to 44 mg (e.g., 22 mg to 44 mg, 23 mg to 42 mg, 24 mg to 40 mg, 25 mg to 38 mg, 26 mg to 36 mg, 27 mg to 34 mg, 28 mg to 32 mg, or 29 mg to 31 mg) of the anti-TfRl antibodies of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject about 30 mg of the anti-TfRl antibodies of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • the effective amount e.g., of each administration
  • the values can vary by up to 45% (e.g., ⁇ up to 45%, ⁇ up to 40%, ⁇ up to 35%, ⁇ up to 30%, ⁇ up to 25%, ⁇ up to 20%, ⁇ up to 15%, ⁇ up to 10%, ⁇ up to 5%, ⁇ up to 3 %, or ⁇ up to 1%).
  • the composition is administered once every 4 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 8 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime).
  • the composition is administered once every 12 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 4 weeks during a first period of administration (e.g., 8 weeks, 12 weeks, or 16 weeks), and subsequently administered once every 8 weeks during a second period of administration (e.g., 16 weeks to the remainder of the subject’s lifetime).
  • a first period of administration e.g., 8 weeks, 12 weeks, or 16 weeks
  • a second period of administration e.g., 16 weeks to the remainder of the subject’s lifetime.
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject 44 mg to 88 mg (e.g., 44 mg to 88 mg, 46 mg to 84 mg, 48 mg to 80 mg, 50 mg to 76 mg, 52 mg to 72 mg, 54 mg to 68 mg, 56 mg to 64 mg, or 58 mg to 62 mg) of the anti-TfRl antibodies of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject about 60 mg of the anti-TfRl antibodies of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • the effective amount e.g., of each administration
  • the values can vary by up to 45% (e.g., ⁇ up to 45%, ⁇ up to 40%, ⁇ up to 35%, ⁇ up to 30%, ⁇ up to 25%, ⁇ up to 20%, ⁇ up to 15%, ⁇ up to 10%, ⁇ up to 5%, ⁇ up to 3 %, or ⁇ up to 1%).
  • the composition is administered once every 4 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 8 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime).
  • the composition is administered once every 12 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 4 weeks during a first period of administration (e.g., 8 weeks, 12 weeks, or 16 weeks), and subsequently administered once every 8 weeks during a second period of administration (e.g., 16 weeks to the remainder of the subject’s lifetime).
  • a first period of administration e.g., 8 weeks, 12 weeks, or 16 weeks
  • a second period of administration e.g., 16 weeks to the remainder of the subject’s lifetime.
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject 36.8 mg to 58.9 mg (e.g., 36.8 mg to 58.9 mg, 36.8 mg to 51.5 mg, 36.8 mg to 44.2 mg, 44.2 mg to 58.9 mg, 44.2 mg to 51.5 mg, or 51.5 mg to 58.9 mg) of the anti- TfRl antibodies of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject about 36.8 mg of the anti-TfRl antibodies of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • the effective amount e.g., of each administration
  • the values can vary by up to 30% (e.g., ⁇ up to 30%, ⁇ up to 25%, ⁇ up to 20%, ⁇ up to 15%, ⁇ up to 10%, ⁇ up to 5%, ⁇ up to 3 %, or ⁇ up to 1%).
  • the composition is administered once every 4 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 8 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime).
  • the composition is administered once every 12 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 4 weeks during a first period of administration (e.g., 8 weeks, 12 weeks, or 16 weeks), and subsequently administered once every 8 weeks during a second period of administration (e.g., 16 weeks to the remainder of the subject’s lifetime).
  • a first period of administration e.g., 8 weeks, 12 weeks, or 16 weeks
  • a second period of administration e.g., 16 weeks to the remainder of the subject’s lifetime.
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject 1 mg to 14 mg (e.g., 1 mg to 14 mg, 1 mg to 13 mg, 1 mg to 12 mg, 1 mg to 11 mg, 1 mg to 10 mg, 1 mg to 9 mg, 1 mg to 8 mg, 1 mg to 7 mg, 1 mg to 6 mg, 1 mg to 5 mg, 1 mg to 4 mg, 1 mg to 3 mg, 1 mg to 2 mg, 2 mg to 14 mg, 2 mg to 13 mg, 2 mg to 12 mg, 2 mg to 11 mg, 2 mg to 10 mg, 2 mg to 9 mg, 2 mg to 8 mg, 2 mg to 7 mg, 2 mg to 6 mg, 1 mg to 5 mg, 1 mg
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject about 1.8 mg, about 3.4 mg, about 6.8 mg, or about 10.2 mg of the oligonucleotides of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • the effective amount e.g., of each administration
  • the effective amount (e.g., of each administration) provides to the subject about 4 mg or about 5 mg of the oligonucleotides of the complexes per kg of the subject.
  • the values can vary by up to 30% (e.g., ⁇ up to 30%, ⁇ up to 25%, ⁇ up to 20%, ⁇ up to 15%, ⁇ up to 10%, ⁇ up to 5%, ⁇ up to 3 %, or ⁇ up to 1%).
  • the composition is administered once every 4 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime).
  • the composition is administered once every 8 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 12 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 4 weeks during a first period of administration (e.g., 8 weeks, 12 weeks, or 16 weeks), and subsequently administered once every 8 weeks during a second period of administration (e.g., 16 weeks to the remainder of the subject’s lifetime).
  • a first period of administration e.g., 8 weeks, 12 weeks, or 16 weeks
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject 1.2 mg to 2.4 mg (e.g., 1.2 mg to 2.4 mg, 1.1 mg to 2.3 mg, 1.2 mg to
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject about 1.8 mg of the oligonucleotides of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • the effective amount e.g., of each administration
  • the values can vary by up to 30% (e.g., ⁇ up to 30%, ⁇ up to 25%, ⁇ up to 20%, ⁇ up to 15%, ⁇ up to 10%, ⁇ up to 5%, ⁇ up to 3 %, or ⁇ up to 1%).
  • the composition is administered once every 4 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 8 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime).
  • the composition is administered once every 12 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 4 weeks during a first period of administration (e.g., 8 weeks, 12 weeks, or 16 weeks), and subsequently administered once every 8 weeks during a second period of administration (e.g., 16 weeks to the remainder of the subject’s lifetime).
  • a first period of administration e.g., 8 weeks, 12 weeks, or 16 weeks
  • a second period of administration e.g., 16 weeks to the remainder of the subject’s lifetime.
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject 2.2 mg to 4.5 mg (e.g., 2.2 mg to 4.5 mg, 2.4 mg to 4.4 mg, 2.5 mg to
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject about 3.4 mg of the oligonucleotides of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • the effective amount e.g., of each administration
  • the values can vary by up to 30% (e.g., ⁇ up to 30%, ⁇ up to 25%, ⁇ up to 20%, ⁇ up to 15%, ⁇ up to 10%, ⁇ up to 5%, ⁇ up to 3 %, or ⁇ up to 1%).
  • the composition is administered once every 4 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 8 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime).
  • the composition is administered once every 12 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 4 weeks during a first period of administration (e.g., 8 weeks, 12 weeks, or 16 weeks), and subsequently administered once every 8 weeks during a second period of administration (e.g., 16 weeks to the remainder of the subject’s lifetime).
  • a first period of administration e.g., 8 weeks, 12 weeks, or 16 weeks
  • a second period of administration e.g., 16 weeks to the remainder of the subject’s lifetime.
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject 2.7 mg to 5.3 mg (e.g., 2.7 mg to 5.3 mg, 2.8 mg to 5.8 mg, 3 mg to 5.5 mg, 3.2 mg to 5 mg, or 3.8 mg to 4.2 mg) of the oligonucleotides of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • the effective amount e.g.,
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject about 4 mg of the oligonucleotides of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • the effective amount e.g., of each administration
  • the values can vary by up to 30% (e.g., ⁇ up to 30%, ⁇ up to 25%, ⁇ up to 20%, ⁇ up to 15%, ⁇ up to 10%, ⁇ up to 5%, ⁇ up to 3 %, or ⁇ up to 1%).
  • the composition is administered once every 4 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 8 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime).
  • the composition is administered once every 12 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 4 weeks during a first period of administration (e.g., 8 weeks, 12 weeks, or 16 weeks), and subsequently administered once every 8 weeks during a second period of administration (e.g., 16 weeks to the remainder of the subject’s lifetime).
  • a first period of administration e.g., 8 weeks, 12 weeks, or 16 weeks
  • a second period of administration e.g., 16 weeks to the remainder of the subject’s lifetime.
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject 3 mg to 7 mg (e.g., 3 mg to 7 mg, 3.5 mg to 6.6 mg, 4 mg to 6 mg, 4.2 mg to 5.8 mg, or 4.8 mg to 5.2 mg) of the oligonucleotides of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • the effective amount e.g., of each administration
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject about 5 mg of the oligonucleotides of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • the effective amount e.g., of each administration
  • the values can vary by up to 30% (e.g., ⁇ up to 30%, ⁇ up to 25%, ⁇ up to 20%, ⁇ up to 15%, ⁇ up to 10%, ⁇ up to 5%, ⁇ up to 3 %, or ⁇ up to 1%).
  • the composition is administered once every 4 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 8 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime).
  • the composition is administered once every 12 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 4 weeks during a first period of administration (e.g., 8 weeks, 12 weeks, or 16 weeks), and subsequently administered once every 8 weeks during a second period of administration (e.g., 16 weeks to the remainder of the subject’s lifetime).
  • a first period of administration e.g., 8 weeks, 12 weeks, or 16 weeks
  • a second period of administration e.g., 16 weeks to the remainder of the subject’s lifetime.
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject 4.5 mg to 9 mg (e.g., 4.5 mg to 9 mg, 4.7 mg to 8.8 mg, 4.9 mg to 8.6 mg, 5.1 mg to 8.4 mg, 5.3 mg to 8.2 mg, 5.5 mg to 8 mg, 5.7 mg to 7.8 mg, 5.9 mg to 7.6 mg, 6.1 mg to 7.4 mg, 6.3 mg to 7.2 mg, 6.5 mg to 7 mg, or 6.6 mg to 6.8 mg) of the oligonucleotides of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject about 6.8 mg of the oligonucleotides of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • the effective amount e.g., of each administration
  • the values can vary by up to 30% (e.g., ⁇ up to 30%, ⁇ up to 25%, ⁇ up to 20%, ⁇ up to 15%, ⁇ up to 10%, ⁇ up to 5%, ⁇ up to 3 %, or ⁇ up to 1%).
  • the composition is administered once every 4 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 8 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime).
  • the composition is administered once every 12 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 4 weeks during a first period of administration (e.g., 8 weeks, 12 weeks, or 16 weeks), and subsequently administered once every 8 weeks during a second period of administration (e.g., 16 weeks to the remainder of the subject’s lifetime).
  • a first period of administration e.g., 8 weeks, 12 weeks, or 16 weeks
  • a second period of administration e.g., 16 weeks to the remainder of the subject’s lifetime.
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject 7 mg to 14 mg (e.g., 7 mg to 14 mg, 7.5 mg to 13.5 mg, 8 mg to 13 mg, 8.5 mg to 12.5 mg, 9 mg to 12 mg, 9.5 mg to 11.5 mg, or 10 mg to 11 mg) of the oligonucleotides of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject about 10.2 mg of the oligonucleotides of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • the effective amount e.g., of each administration
  • the values can vary by up to 30% (e.g., ⁇ up to 30%, ⁇ up to 25%, ⁇ up to 20%, ⁇ up to 15%, ⁇ up to 10%, ⁇ up to 5%, ⁇ up to 3 %, or ⁇ up to 1%).
  • the composition is administered once every 4 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 8 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime).
  • the composition is administered once every 12 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 4 weeks during a first period of administration (e.g., 8 weeks, 12 weeks, or 16 weeks), and subsequently administered once every 8 weeks during a second period of administration (e.g., 16 weeks to the remainder of the subject’s lifetime).
  • a first period of administration e.g., 8 weeks, 12 weeks, or 16 weeks
  • a second period of administration e.g., 16 weeks to the remainder of the subject’s lifetime.
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject 0.5 mg to 12 mg (e.g., 0.5 mg to 12 mg, 0.5 mg to 12 mg, 0.5 mg to 11 mg, 0.5 mg to 10 mg, 0.5 mg to 9 mg, 0.5 mg to 8 mg, 0.5 mg to 7 mg, 0.5 mg to 6 mg, 0.5 mg to 5 mg, 0.5 mg to 4 mg, 0.5 mg to 3 mg, 0.5 mg to 2 mg, 0.5 mg to 1 mg, 1 mg to 12 mg, 1 mg to 11 mg, 1 mg to 10 mg, 1 mg to 9 mg, 1 mg to 8 mg, 1 mg to 7 mg, 1 mg to 6 mg, 0.5 mg to 5 mg
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject about 1.1 mg, about 2 mg, about 4.1 mg, or about 8.2 mg of the oligonucleotides of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • the effective amount e.g., of each administration
  • the values can vary by up to 30% (e.g., ⁇ up to 30%, ⁇ up to 25%, ⁇ up to 20%, ⁇ up to 15%, ⁇ up to 10%, ⁇ up to 5%, ⁇ up to 3 %, or ⁇ up to 1%).
  • the composition is administered once every 4 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 8 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime).
  • the composition is administered once every 12 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 4 weeks during a first period of administration (e.g., 8 weeks, 12 weeks, or 16 weeks), and subsequently administered once every 8 weeks during a second period of administration (e.g., 16 weeks to the remainder of the subject’s lifetime).
  • a first period of administration e.g., 8 weeks, 12 weeks, or 16 weeks
  • a second period of administration e.g., 16 weeks to the remainder of the subject’s lifetime.
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject 0.7 mg to 1.5 mg (e.g., 0.7 mg to 1.5 mg, 0.8 mg to 1.4 mg, 0.9 mg to 1.3 mg, or 1 mg to 1.2 mg) of the oligonucleotides of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • the effective amount e.g., of each administration
  • the effective amount
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject about 1.1 mg of the oligonucleotides of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • the effective amount e.g., of each administration
  • the values can vary by up to 30% (e.g., ⁇ up to 30%, ⁇ up to 25%, ⁇ up to 20%, ⁇ up to 15%, ⁇ up to 10%, ⁇ up to 5%, ⁇ up to 3 %, or ⁇ up to 1%).
  • the composition is administered once every 4 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 8 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime).
  • the composition is administered once every 12 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 4 weeks during a first period of administration (e.g., 8 weeks, 12 weeks, or 16 weeks), and subsequently administered once every 8 weeks during a second period of administration (e.g., 16 weeks to the remainder of the subject’s lifetime).
  • a first period of administration e.g., 8 weeks, 12 weeks, or 16 weeks
  • a second period of administration e.g., 16 weeks to the remainder of the subject’s lifetime.
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject 1.4 mg to 2.7 mg (e.g., 1.4 mg to 2.7 mg, 1.5 mg to 2.6 mg, 1.6 mg to 2.5 mg, 1.7 mg to 2.4 mg, 1.8 mg to 2.3 mg, 1.9 mg to 2.2 mg, or 1.95 mg to 2.1 mg) of the oligonucleotides of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic),
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject about 2 mg of the oligonucleotides of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • the effective amount e.g., of each administration
  • the values can vary by up to 30% (e.g., ⁇ up to 30%, ⁇ up to 25%, ⁇ up to 20%, ⁇ up to 15%, ⁇ up to 10%, ⁇ up to 5%, ⁇ up to 3 %, or ⁇ up to 1%).
  • the composition is administered once every 4 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 8 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime).
  • the composition is administered once every 12 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 4 weeks during a first period of administration (e.g., 8 weeks, 12 weeks, or 16 weeks), and subsequently administered once every 8 weeks during a second period of administration (e.g., 16 weeks to the remainder of the subject’s lifetime).
  • a first period of administration e.g., 8 weeks, 12 weeks, or 16 weeks
  • a second period of administration e.g., 16 weeks to the remainder of the subject’s lifetime.
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject 2.7 mg 5.4 mg (e.g., 2.7 mg to 5.4 mg, 2.9 mg to 5.2 mg, 3.1 mg to 5 mg, 3.3 mg to 4.8 mg, 3.5 mg to 4.6 mg, 3.7 mg to 4.3 mg, 3.9 mg to 4.2 mg, or 4 mg to 4.15 mg) of the oligonucleotides of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject about 4.1 mg of the oligonucleotides of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • the effective amount e.g., of each administration
  • the values can vary by up to 30% (e.g., ⁇ up to 30%, ⁇ up to 25%, ⁇ up to 20%, ⁇ up to 15%, ⁇ up to 10%, ⁇ up to 5%, ⁇ up to 3 %, or ⁇ up to 1%).
  • the composition is administered once every 4 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 8 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime).
  • the composition is administered once every 12 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 4 weeks during a first period of administration (e.g., 8 weeks, 12 weeks, or 16 weeks), and subsequently administered once every 8 weeks during a second period of administration (e.g., 16 weeks to the remainder of the subject’s lifetime).
  • a first period of administration e.g., 8 weeks, 12 weeks, or 16 weeks
  • a second period of administration e.g., 16 weeks to the remainder of the subject’s lifetime.
  • a method described herein comprises administering to a subject a composition an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject 5 mg to 11 mg (e.g., 5 mg to 11 mg, 5.5 mg to 10.5 mg, 6 mg to 10 mg, 6.5 mg to 9.5 mg, 7 mg to 9 mg, 7.5 mg to 8.5 mg, or 8 mg to 8.3 mg) of the oligonucleotides of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject about 8.2 mg of the oligonucleotides of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • the effective amount e.g., of each administration
  • the values can vary by up to 30% (e.g., ⁇ up to 30%, ⁇ up to 25%, ⁇ up to 20%, ⁇ up to 15%, ⁇ up to 10%, ⁇ up to 5%, ⁇ up to 3 %, or ⁇ up to 1%).
  • the composition is administered once every 4 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 8 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime).
  • the composition is administered once every 12 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 4 weeks during a first period of administration (e.g., 8 weeks, 12 weeks, or 16 weeks), and subsequently administered once every 8 weeks during a second period of administration (e.g., 16 weeks to the remainder of the subject’s lifetime).
  • a first period of administration e.g., 8 weeks, 12 weeks, or 16 weeks
  • a second period of administration e.g., 16 weeks to the remainder of the subject’s lifetime.
  • once every 4 weeks is substantially similar to once a month
  • once every 8 weeks is substantially similar to once every two months
  • once every 12 weeks is substantially similar to once every three months
  • once every 16 weeks is substantially similar to once every four months.
  • once every 4 weeks can mean once a month; once every 8 weeks can mean once every two months; once every 12 weeks can mean once every three months; and once every 16 weeks can mean once every four months.
  • once every 4 weeks can mean 12 times per year; once every 8 weeks can mean 6 times per year; and once every 12 weeks can mean 4 times per year.
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject 5 mg to 8 mg (e.g., 5 mg to 8 mg, 5 mg to 7 mg, 5 mg to 6 mg, 6 mg to 8 mg, 6 mg to 7 mg, or 7 mg to 8 mg) of the oligonucleotides of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • the effective amount e.g., of each administration
  • a method described herein comprises administering to a subject a composition comprising an effective amount of complexes described herein (e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)), wherein the effective amount (e.g., of each administration) provides to the subject about 5 mg of the oligonucleotides of the complexes per kg of the subject.
  • an effective amount of complexes described herein e.g., complexes comprising a structure of formula (I): [R ⁇ ni-R 2 such as one comprising a group of the formula (la), (lb), (Ic), or (Id)
  • the effective amount e.g., of each administration
  • the values can vary by up to 30% (e.g., ⁇ up to 30%, ⁇ up to 25%, ⁇ up to 20%, ⁇ up to 15%, ⁇ up to 10%, ⁇ up to 5%, ⁇ up to 3 %, or ⁇ up to 1%).
  • the composition is administered once every 4 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 8 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime).
  • the composition is administered once every 12 weeks (e.g., for a period of time such as the remainder of the subject’s lifetime). In some embodiments, the composition is administered once every 4 weeks during a first period of administration (e.g., 8 weeks, 12 weeks, or 16 weeks), and subsequently administered once every 8 weeks during a second period of administration (e.g., 16 weeks to the remainder of the subject’s lifetime).
  • a first period of administration e.g., 8 weeks, 12 weeks, or 16 weeks
  • a second period of administration e.g., 16 weeks to the remainder of the subject’s lifetime.
  • a method described herein comprises administering intravenously (e.g., via intravenous infusion) an effective amount of a composition comprising complexes (e.g., in an aqueous solution), wherein each complex comprises a structure of formula (I): [R ⁇ ni-R 2 , wherein each R 1 comprises a group of the formula (la):
  • R 3 comprises an oligonucleotide comprising a nucleobase sequence of CAGCGCCCACCAGUCA (SEQ ID NO: 21), optionally wherein R 3 comprises an oligonucleotide comprising a structure of +C*+A*oG*oC*dG*dC*dC*dC*dA*dC*dC*dA*oG*oU*+C*+A (SEQ ID NO: 21), wherein +N represents an LNA (2’ -4’ methylene bridge) ribonucleoside, dN represents a 2’- deoxyribonucleoside, oN represents a 2’ -MOE modified ribonucleoside, oC represents a 5- methyl-2’-MOE-cytidine, +C represents a 5-methyl-2’-4’-bicyclic-cytidine (2 ’-4’ methylene bridge), oU represents a 5-methyl-2’-MOE-uridine, and *
  • each different amino acid residue is a lysine
  • nl is independently an integer of one or greater representing the number of instances of R 1 , optionally wherein the average value of nl of the complexes of the composition is in the range of 1 to 5; and wherein the effective amount of each administration provides to the subject 5 mg to 110 mg (e.g., 8 mg to 60 mg or 13 mg to 75 mg) of the anti-TfRl antibody (e.g., Fab) of the complexes per kg of the subject.
  • the effective amount of each administration provides to the subject about 13 mg, about 25 mg, about 50 mg, or about 75 mg of the anti-TfRl antibody (e.g., Fab) of the complexes per kg of the subject. In some embodiments, the effective amount of each administration provides to the subject about 5 mg, about 15 mg, about 30 mg, or about 60 mg of the anti-TfRl antibody (e.g., Fab) of the complexes per kg of the subject. In some embodiments, the subject is administered the composition once every four weeks or once every eight weeks.
  • a composition comprising complexes for administration to a subject in the methods described herein further comprises complexes that comprise a structure of formula (I): [R ⁇ ni-R 2 , wherein nl is 0.
  • the average value of nl of complexes in a composition disclosed herein is in the range of 0.5 to 5 (e.g., 0.5-5, 1-5, 1-4, 1-3, 3-5, 0.5-4, 0.5-3, 0.5-2, 0.5-1.5, 0.5-1, 0.7- 1.5, 1-1.6, 1-1.5, 1-1.4, 1-1.3, 1-1.2, 1.1-1.5, 0.8-2, 0.8-1.5, O.8-1.3, 0.8-1.2, 0.8-1.1, 0.9-3, 0.9- 2, 0.9-1.8, 0.9-1.6, 0.9-1.5, 0.9-1.4, 0.9-1.3, or 0.9-1.2).
  • 0.5-5, 1-5, 1-4, 1-3, 3-5, 0.5-4, 0.5-3, 0.5-2 0.5-1.5, 0.5-1, 0.7- 1.5, 1-1.6, 1-1.5, 1-1.4, 1-1.3, 1-1.2, 1.1-1.5, 0.8-2, 0.8-1.5, O.8-1.3, 0.8-1.2, 0.8-1.1, 0.9-3, 0.9- 2,
  • a method described herein comprises administering intravenously (e.g., via intravenous infusion) an effective amount of a composition comprising complexes (e.g., in an aqueous solution), wherein each complex comprises a structure of formula (I): [R ⁇ ni-R 2 , wherein each R 1 comprises a group of the formula (lb): (Ib), wherein +N represents an LNA (2’-4’ methylene bridge) ribonucleoside, dN represents a 2’- deoxyribonucleoside, oN represents a 2’-O-methoxyethyl (MOE) modified ribonucleoside, oC represents a 5-methyl-2’-MOE-cytidine, +C represents a 5-methyl-2’-4’-bicyclic-cytidine (2’- 4’ methylene bridge), oU represents a 5-methyl-2’-MOE-uridine, * represents a phosphoroth
  • each different amino acid residue is a lysine
  • nl is independently an integer of one or greater representing the number of instances of R 1 , optionally wherein the average value of nl of the complexes of the composition is in the range of 1 to 5; wherein the effective amount of each administration provides to the subject 5 mg to 110 mg (e.g., 8 mg to 60 mg or 13 mg to 75 mg) of the anti-TfRl antibody (e.g., Fab) of the complexes per kg of the subject.
  • the effective amount of each administration provides to the subject about 13 mg, about 25 mg, about 50 mg, or about 75 mg of the anti-TfRl antibody (e.g., Fab) of the complexes per kg of the subject. In some embodiments, the effective amount of each administration provides to the subject about 5 mg, about 15 mg, about 30 mg, or about 60 mg of the anti-TfRl antibody (e.g., Fab) of the complexes per kg of the subject. In some embodiments, the subject is administered the composition once every four weeks or once every eight weeks.
  • a composition comprising complexes for administration to a subject in the methods described herein further comprises complexes that comprise a structure of formula (I): [Rl]nl-R2, wherein nl is 0.
  • the average value of nl of complexes in a composition disclosed herein is in the range of 0.5 to 5 (e.g., 0.5-5, 1-5, 1-4, 1-3, 3-5, 0.5-4, 0.5-3, 0.5-2, 0.5-1.5, 0.5-1, 0.7- 1.5, 1-1.6, 1-1.5, 1-1.4, 1-1.3, 1-1.2, 1.1-1.5, 0.8-2, 0.8-1.5, O.8-1.3, 0.8-1.2, 0.8-1.1, 0.9-3, 0.9- 2, 0.9-1.8, 0.9-1.6, 0.9-1.5, 0.9-1.4, 0.9-1.3, or 0.9-1.2).
  • 0.5-5, 1-5, 1-4, 1-3, 3-5, 0.5-4, 0.5-3, 0.5-2 0.5-1.5, 0.5-1, 0.7- 1.5, 1-1.6, 1-1.5, 1-1.4, 1-1.3, 1-1.2, 1.1-1.5, 0.8-2, 0.8-1.5, O.8-1.3, 0.8-1.2, 0.8-1.1, 0.9-3, 0.9- 2,
  • a method described herein comprises administering intravenously (e.g., via intravenous infusion) an effective amount of a composition comprising complexes (e.g., in an aqueous solution), wherein each complex comprises a structure of formula (I): [R ⁇ ni-R 2 , wherein each R 1 of the complexes comprises a group of the formula (Ic):
  • R 2 comprises an anti-TfRl antibody (e.g., Fab) comprising: a heavy chain complementarity determining region 1 (CDR-H1) comprising a sequence as set forth in SEQ ID NOs: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising a sequence as set forth in SEQ ID NOs: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising a sequence as set forth in SEQ ID NOs: 3, 9, or 14, a light chain complementarity determining region 1 (CDR-L1) comprising a sequence as set forth in SEQ ID NOs: 4, 10, or 15, a light chain complementarity determining region 2 (CDR-L2) comprising a sequence as set forth in SEQ ID NOs: 5 or 11, and a light chain complementarity determining region 3 (CDR-L3) comprising a sequence as set forth in SEQ ID NOs: 6 or 16, optionally wherein the antibody (e.g., Fab) compris
  • each different amino acid residue is a lysine
  • nl is independently an integer of one or greater representing the number of instances of R 1 , optionally wherein the average value of nl of the complexes of the composition is in the range of 1 to 5; wherein the effective amount of each administration provides to the subject 5 mg to 110 mg (e.g., 8 mg to 60 mg or 13 mg to 75 mg) of the anti-TfRl antibody (e.g., Fab) of the complexes per kg of the subject.
  • the effective amount of each administration provides to the subject about 13 mg, about 25 mg, about 50 mg, or about 75 mg of the anti-TfRl antibody (e.g., Fab) of the complexes per kg of the subject. In some embodiments, the effective amount of each administration provides to the subject about 5 mg, about 15 mg, about 30 mg, or about 60 mg of the anti-TfRl antibody (e.g., Fab) of the complexes per kg of the subject. In some embodiments, the subject is administered the composition once every four weeks or once every eight weeks.
  • a composition comprising complexes for administration to a subject in the methods described herein further comprises complexes that comprise a structure of formula (I): [R ⁇ ni-R 2 , wherein nl is 0.
  • the average value of nl of complexes in a composition disclosed herein is in the range of 0.5 to 5 (e.g., 0.5-5, 1-5, 1-4, 1-3, 3-5, 0.5-4, 0.5-3, 0.5-2, 0.5-1.5, 0.5-1, 0.7- 1.5, 1-1.6, 1-1.5, 1-1.4, 1-1.3, 1-1.2, 1.1-1.5, 0.8-2, 0.8-1.5, O.8-1.3, 0.8-1.2, 0.8-1.1, 0.9-3, 0.9- 2, 0.9-1.8, 0.9-1.6, 0.9-1.5, 0.9-1.4, 0.9-1.3, or 0.9-1.2).
  • 0.5-5, 1-5, 1-4, 1-3, 3-5, 0.5-4, 0.5-3, 0.5-2 0.5-1.5, 0.5-1, 0.7- 1.5, 1-1.6, 1-1.5, 1-1.4, 1-1.3, 1-1.2, 1.1-1.5, 0.8-2, 0.8-1.5, O.8-1.3, 0.8-1.2, 0.8-1.1, 0.9-3, 0.9- 2,
  • a method described herein comprises administering intravenously (e.g., via intravenous infusion) an effective amount of a composition comprising complexes (e.g., in an aqueous solution), wherein each complex comprises a group of formula (Id):
  • oligonucleotide comprises a nucleobase sequence of CAGCGCCCACCAGUCA (SEQ ID NO: 21); wherein R 2 comprises an anti-TfRl antibody (e.g., Fab) comprising: a heavy chain complementarity determining region 1 (CDR-H1) comprising a sequence as set forth in SEQ ID NO: 21;
  • the effective amount of each administration provides to the subject about 13 mg, about 25 mg, about 50 mg, or about 75 mg of the anti-TfRl antibody (e.g., Fab) of the complexes per kg of the subject. In some embodiments, the effective amount of each administration provides to the subject about 5 mg, about 15 mg, about 30 mg, or about 60 mg of the anti-TfRl antibody (e.g., Fab) of the complexes per kg of the subject. In some embodiments, the subject is administered the composition once every four weeks or once every eight weeks.
  • a composition comprising complexes for administration to a subject in the methods described herein further comprises complexes that comprise a structure of formula (I): [R ⁇ ni-R 2 , wherein nl is 0.
  • the average value of nl of complexes in a composition disclosed herein is in the range of 0.5 to 5 (e.g., 0.5-5, 1-5, 1-4, 1-3, 3-5, 0.5-4, 0.5-3, 0.5-2, 0.5-1.5, 0.5-1, 0.7- 1.5, 1-1.6, 1-1.5, 1-1.4, 1-1.3, 1-1.2, 1.1-1.5, 0.8-2, 0.8-1.5, O.8-1.3, 0.8-1.2, 0.8-1.1, 0.9-3, 0.9- 2, 0.9-1.8, 0.9-1.6, 0.9-1.5, 0.9-1.4, 0.9-1.3, or 0.9-1.2).
  • 0.5-5, 1-5, 1-4, 1-3, 3-5, 0.5-4, 0.5-3, 0.5-2 0.5-1.5, 0.5-1, 0.7- 1.5, 1-1.6, 1-1.5, 1-1.4, 1-1.3, 1-1.2, 1.1-1.5, 0.8-2, 0.8-1.5, O.8-1.3, 0.8-1.2, 0.8-1.1, 0.9-3, 0.9- 2,
  • a method described herein comprises administering intravenously (e.g., via intravenous infusion) an effective amount of a composition comprising complexes (e.g., in an aqueous solution), wherein each complex comprises a group of the formula (la), (lb), (Ic), or (Id), wherein the effective amount of each administration provides to the subject 0.5 mg to 20 mg (e.g., 1 mg to 14 mg or 0.5 mg to 12 mg) of the oligonucleotides of the complexes per kg of the subject.
  • the effective amount of each administration provides to the subject about 1.8 mg, about 3.4 mg, about 6.8 mg, or about 10.2 mg of the oligonucleotides of the complexes per kg of the subject. In some embodiments, the effective amount of each administration provides to the subject about 1.1 mg, about 2 mg, about 4.1 mg, or about 8.2 mg of the oligonucleotides of the complexes per kg of the subject. In some embodiments, the subject is administered the composition once every four weeks or once every eight weeks. In some embodiments, a composition comprising complexes (e.g., in aqueous solutions) for administration to a subject in the methods described herein further comprises complexes wherein nl is 0.
  • the average value of nl of complexes in a composition disclosed herein is in the range of 0.5 to 5 (e.g., 0.5-5, 1-5, 1-4, 1-3, 3-5, 0.5-4, 0.5-3, 0.5-2, 0.5-1.5, 0.5-1, 0.7-1.5, 1-1.6, 1-1.5, 1-1.4, 1-1.3, 1-1.2, 1.1-1.5, 0.8-2, 0.8-1.5, O.8-1.3, 0.8-1.2, 0.8-1.1, 0.9-3, 0.9-2, 0.9-1.8, 0.9-1.6, 0.9-1.5, 0.9-1.4, 0.9-1.3, or 0.9- 1.2).
  • administration of a composition comprising an effective amount of complexes according to any one of the methods described herein reduces expression or activity of DMPK (e.g., reduces the level of a mutant or wild-type DMPK RNA, or reduces the activity of a DMPK gene product) in a subject (e.g., a subject having DM1).
  • DMPK e.g., reduces the level of a mutant or wild-type DMPK RNA, or reduces the activity of a DMPK gene product
  • administration of a composition comprising an effective amount of complexes according to any one of the methods described herein results in a reduction in expression or activity of DMPK (e.g., the level of a mutant or wild-type DMPK RNA, or the activity of a DMPK gene product) of at least 1% (e.g., at least 1%, at least 2%, at least 3%, at least 4%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%) in the subject relative to a control.
  • DMPK e.g., the level of a mutant or wild-type DMPK RNA, or the activity of a DMPK gene product
  • control is DMPK expression or activity level in a healthy subject (e.g., a subject that does not have myotonic dystrophy). In some embodiments, the control is DMPK expression or activity level in a subject that does not have a mutated DMPK RNA. In some embodiments, the control is DMPK expression or activity level in the subject prior to administration of the composition comprising the effective amount of complexes to the subject.
  • any one of the methods described here may further comprise additional steps of administering compositions comprising the complexes described herein to the subject.
  • Example 1 In vivo tissue distribution of conjugates containing anti-TfRl Fab conjugated to a DMPK-targeting oligonucleotide in DM1 mouse model
  • Conjugates comprising an anti-TfRl Fab conjugated to a DMPK-targeting oligonucleotide (ASO) were tested in a mouse model that expresses both human TfRl and a human DMPK mutant that harbors expanded CUG repeats.
  • the anti-TfRl Fab used has the VH/VL sequences provided in Table 2.
  • the Fab was covalently linked (through lysine conjugation) via a linker comprising a valine-citrulline sequence to a DMPK targeting oligonucleotide comprising a nucleobase sequence of SEQ ID NO: 21.
  • the conjugate comprises a structure of formula (Id):
  • +N represents an LNA (2’ -4’ methylene bridge) ribonucleoside
  • dN represents a 2’-deoxyribonucleoside
  • oN represents a 2’-O-methoxyethyl (MOE) modified ribonucleoside
  • oC represents a 5-methyl-2’-MOE-cytidine
  • +C represents a 5-methyl-2’-4’-bicyclic-cytidine (2’-4’ methylene bridge)
  • oU represents a 5-methyl-2’-MOE-uridine
  • * represents a phosphorothioate internucleoside linkage
  • the oligonucleotide comprises a nucleobase sequence of CAGCGCCCACCAGUCA (SEQ ID NO: 21), and in which R 2 comprises the anti-TfRl antibody provided in Table 2, and wherein in each conjugate nl is independently an integer of 1-3.
  • FIGs. 1A, IB, 1C, and ID show the amount of ASO in the heart, diaphragm, gastrocnemius, or tibialis anterior, respectively, two weeks after the first injection.
  • conjugates comprising an anti-TfRl antibody (e.g., an anti-TfRl Fab having the VH and VL sequences provided in Table 2) are capable of delivering an oligonucleotide (e.g., a DMPK- targeting ASO) to various muscle tissues following intravenous administration.
  • an anti-TfRl antibody e.g., an anti-TfRl Fab having the VH and VL sequences provided in Table 2
  • an oligonucleotide e.g., a DMPK- targeting ASO
  • Example 2 Sustained knockdown of toxic human DMPK in hTfRl/DMSXL homozygous mice at 4 weeks after repeat dosing of anti-TfRl Fab-ASO conjugates
  • Conjugates (labeled in this Example as “Anti-TfRl Fab-ASO conjugate”) as described in Example 1, containing an anti-TfRl Fab covalently linked to a DMPK-targeting oligonucleotide (ASO) were tested in a mouse model that expresses both human TfRl and two copies of a mutant human DMPK transgene that harbors expanded CUG repeats (hTfRl/DMSXL mice). Mice were administered either vehicle control (PBS) or 10 mg/kg ASO-equivalent dose of anti-TfRl Fab-ASO conjugate at days 0 and 7.
  • PBS vehicle control
  • ASO-equivalent dose of anti-TfRl Fab-ASO conjugate at days 0 and 7.
  • FIG. 2A shows that anti-TfRl Fab-ASO conjugate knocked down DMPK expression in heart by 49% relative to PBS-treated mice.
  • FIG. 2B shows that anti-TfRl Fab- ASO conjugate knocked down DMPK expression in diaphragm by 40% relative to PBS-treated mice.
  • FIG. 2C shows that anti-TfRl Fab-ASO conjugate knocked down DMPK expression in tibialis anterior by 49% relative to PBS-treated mice.
  • FIG. 2D shows that anti-TfRl Fab-ASO conjugate knocked down DMPK expression in gastrocnemius by 44% relative to PBS-treated mice.
  • FIGs. 3A and 3B show that anti-TfRl Fab-ASO conjugate reduced DMPK foci within nuclei of myofibers.
  • FIG. 3 A shows reduced DMPK foci by in situ hybridization
  • Conjugates (labeled in this Example as “Anti-TfRl Fab-ASO conjugate”) as described in Example 1, containing an anti-TfRl Fab covalently linked to a DMPK-targeting oligonucleotide (ASO) were tested in a mouse model (“hTfRl/DMSXL”) that expresses both human TfRl and two copies of a mutant human DMPK transgene that harbors expanded CUG repeats. These mice are known to display splicing defects that are consistent with those observed in patients afflicted with DM1 (Huguet, et al. (2012) PLOS Genetics 8(11): el003043).
  • mice were administered either vehicle control (“hTfRl/DMSXL - PBS”) or 10 mg/kg ASO-equivalent dose of anti-TfRl Fab-ASO conjugate (“hTfRl/DMSXL - Conjugate”) on days 0 and 7.
  • Mice expressing only the human TfRl but not the mutant human DMPK transgene (hTfRl mice) and treated with PBS (“hTfRl - PBS”) were used as another control to define the extent of the splicing phenotype in hTfRl/DMSXL mice and assess the magnitude of the effect of the conjugate on splicing.
  • RT-qPCR Reverse transcription-quantitative polymerase chain reaction
  • Exon inclusion was calculated as normalized percent spliced in (PSI) for each splicing RNA marker, and composite splicing indices were calculated using the normalized PSI values from splicing markers in heart (FIG. 4), diaphragm (FIG. 5), tibialis anterior (FIG. 6), and gastrocnemius (FIG. 7).
  • Composite splicing indices were calculated as previously described (Tanner MK, et al. (2021) Nucleic Acids Res. 49:2240-2254), and are shown as mean +/- standard deviation. [000233] FIG.
  • Bini El l, Dtna E12, Insr El l, and Mbnl2 E5 were not included because their normalized PSI values in heart tissue were not changed in hTfRl/DMSXL mice relative to hTfRl mice under the experimental conditions tested.
  • FIG. 5 shows that anti-TfRl Fab-ASO conjugate corrected splicing in diaphragm tissue of hTfRl/DMSXL mice, as demonstrated by composite splicing index data.
  • the normalized PSI values used to generate the composite splicing index data showed correction of Bini El l, Insr El l, Ldb3 El l and Nfix E7 splicing in diaphragm tissue of hTfRl/DMSXL mice by treatment with anti-TfRl Fab-ASO conjugate.
  • FIG. 6 shows that anti-TfRl Fab-ASO conjugate corrected splicing in tibialis anterior tissue of hTfRl/DMSXL mice, as demonstrated by composite splicing index data.
  • the normalized PSI values used to generate the composite splicing index data showed correction of Bini El l, Ldb3 El l, and Nfix E7 splicing in tibialis anterior tissue of hTfRl/DMSXL mice by treatment with anti-TfRl Fab-ASO conjugate, but did not show correction of Mbnl2 E6 splicing.
  • FIG. 7 shows that anti-TfRl Fab-ASO conjugate corrected splicing in gastrocnemius tissue of hTfRl/DMSXL mice, as demonstrated by composite splicing index data.
  • the normalized PSI values used to generate the composite splicing index data showed correction of Mbnl2 E6, Nfix E7, and Ttn E313 splicing in gastrocnemius tissue of hTfRl/DMSXL mice by treatment with anti-TfRl Fab-ASO conjugate.
  • Bini El l, Dtna E12, Insr El l, Ldb3 El l, and Mbnl2 E5 were not included because their normalized PSI values in gastrocnemius tissue were not changed in hTfRl/DMSXL mice relative to hTfRl mice under the experimental conditions tested.
  • Example 4 DMPK knockdown in non-human primate and DM1 patient myotubes
  • Conjugates (labeled in this Example as “Anti-TfRl Fab-ASO conjugate”) as described in Example 1, containing an anti-TfRl Fab covalently linked to a DMPK-targeting oligonucleotide (ASO) were tested in human DM1 patient myotubes (32F cells) and in non- human primate (NHP) myotubes.
  • the DM1 patient myotubes used express both a mutant DMPK mRNA containing 380 CUG repeats and a wild-type DMPK mRNA.
  • the NHP myotubes used express only wild-type DMPK.
  • DM1 patient cells or NHP cells were seeded at a density of 50,000 cells per well in 96 well plates in growth medium and were allowed to recover overnight. The following day, the growth medium was changed to a low-serum differentiation medium and the cells were treated with conjugates at a concentration equivalent to 125 nM, 250 nM, or 500 nM ASO. The cells were incubated for ten days, then cDNA was synthesized using the Cells-to-Ct kit with crude cell lysates as the source of total RNA.
  • the anti-TfRl Fab-ASO conjugates achieved knockdown of DMPK expression in both normal NHP myotubes and DM1 patient myotubes, with greater knockdown of DMPK expression in DM1 patient cells (expressing both DMPK mRNA containing 380 CUG repeats and wild-type DMPK mRNA) compared to NHP cells (expressing only wild-type DMPK mRNA) when treated at physiologically relevant concentrations (FIG. 8).
  • the conjugates achieved approximately 40% DMPK knockdown relative to vehicle-only control in NHP myotubes, and approximately 65% DMPK knockdown in DM1 patient myotubes.
  • the conjugates achieved approximately 45% DMPK knockdown relative to vehicle-only control in NHP myotubes, and approximately 80% DMPK knockdown in DM1 patient myotubes.
  • the conjugates achieved approximately 60% DMPK knockdown relative to vehicle-only control in NHP myotubes, and approximately 90% DMPK knockdown in DM1 patient myotubes.
  • conjugates containing anti-TfRl Fab covalently linked to a DMPK-targeting oligonucleotide can achieve greater knockdown of DMPK in human myotubes expressing both wild-type DMPK mRNA and mutant DMPK mRNA (with expanded CUG repeats) relative to cynomolgus monkey myotubes expressing wild-type DMPK.
  • Mutant human DMPK expression was monitored in various tissues for twelve weeks after intravenous administration via tail vein to the mice. Mice were administered conjugates at a 20 mg/kg ASO-equivalent dose.
  • Heart, diaphragm, gastrocnemius, and tibialis anterior tissues were collected. Mutant human DMPK knockdown was measured by quantitative PCR (qPCR) for expression of DMPK mRNA.
  • DMPK expression in various tissues was assessed four weeks after treatment with the same dosage of anti-TfRl Fab-ASO conjugates, administered either in a single dose or in two separate doses. Mice received either a single dose of the conjugates equivalent to 10 mg/kg of ASO, or two doses of the conjugates, each dose equivalent to 5 mg/kg of ASO. Mice receiving two 5 mg/kg doses received the doses either one week apart or two weeks apart. Four weeks (28 days) after administration of the final dose (either the 10 mg/kg dose or the second of two 5 mg/kg doses), DMPK knockdown and ASO levels were assessed in various muscle tissues.
  • FIGs. 10A, 10B, 10C, and 10D show DMPK expression in heart, diaphragm, tibialis anterior, and gastrocnemius tissues, respectively, of treated mice, relative to control (vehicle-treated) mice. Mice treated with all dosing regimens sustained knockdown of toxic human DMPK for up to 4 weeks. Splitting the 10 mg/kg dose into two separate 5 mg/kg doses improved DMPK knockdown in some tested muscle tissues.
  • the single 10 mg/kg dose resulted in 39% knockdown in heart, 50% knockdown in diaphragm, 38% knockdown in tibialis anterior, and 31% knockdown in gastrocnemius; the two 5 mg/kg doses administered one week apart resulted in 51% knockdown in heart, 45% knockdown in diaphragm, 46% knockdown in tibialis anterior, and 50% knockdown in gastrocnemius; and the two 5 mg/kg doses administered two weeks apart resulted in 55% knockdown in heart, 35% knockdown in diaphragm, 47% knockdown in tibialis anterior, and 40% knockdown in gastrocnemius, as measured 28 days after administration of the final dose of complexes.
  • DMPK expression was assessed in various tissues of the mice after treatment with the conjugates, relative to expression in the tissues of control (vehicle-treated) mice.
  • FIGs. 11A, 1 IB, 11C, and 1 ID show mutant human DMPK expression in heart, diaphragm, tibialis anterior, and gastrocnemius tissues, respectively, of mice treated with either one 5 mg/kg ASO-equivalent dose, one 10 mg/kg ASO-equivalent dose, or one 20 mg/kg ASO-equivalent dose of the conjugates.
  • DMPK knockdown was assessed 28 days after administration of the conjugates. A dose-dependent trend of toxic human DMPK knockdown was observed, with approximately the same effect at the 10 mg/kg and 20 mg/kg doses tested at the 28-day timepoint.
  • the 5 mg/kg dose resulted in 30% knockdown in heart, 26% knockdown in diaphragm, 39% knockdown in tibialis anterior, and 19% knockdown in gastrocnemius; the 10 mg/kg dose resulted in 46% knockdown in heart, 51% knockdown in diaphragm, 46% knockdown in tibialis anterior, and 42% knockdown in gastrocnemius; and the 20 mg/kg dose resulted in 41% knockdown in heart, 47% knockdown in diaphragm, 53% knockdown in tibialis anterior, and 40% knockdown in gastrocnemius, as measured 28 days after administration of the complexes. Data are presented as means + standard deviation.
  • FIGs. 12A, 12B, 12C, and 12D show human mutant DMPK expression in heart, diaphragm, tibialis anterior, and gastrocnemius tissues, respectively, of mice treated with two 5 mg/kg ASO-equivalent doses (10 mg/kg total) or with two 10 mg/kg ASO-equivalent doses (20 mg/kg total) of the conjugates.
  • the two 5 mg/kg ASO-equivalent doses and the two 10 mg/kg ASO-equivalent doses were administered one week apart.
  • DMPK knockdown was assessed 28 days after administration of the first dose to mice (i.e., 21 days after the second dose was administered). A dose-dependent effect on DMPK knockdown was observed in all assayed tissues.
  • the anti-TfRl Fab-ASO conjugates were also tested in hTfRl/DMSXL hemizygous mice after administration of four monthly doses of the conjugates to the mice.
  • Conjugates were administered four 5 mg/kg ASO-equivalent doses or four 10 mg/kg ASO- equivalent doses of the conjugates, each administration 4 weeks apart (on days 0, 28, 56, and 84, respectively).
  • DMPK knockdown was assessed in various tissues 112 days (16 weeks) after administration of the first dose to mice.
  • FIGs. 13A, 13B, 13C, and 13D show human mutant DMPK expression in heart, diaphragm, tibialis anterior, and gastrocnemius tissues, respectively, of mice treated with the conjugates.
  • DMPK knockdown was observed in all tissues tested, and both tibialis anterior and gastrocnemius showed statistically significant increase in knockdown in the mice administered four 10 mg/kg ASO-equivalent doses relative to those that received four 5 mg/kg doses.
  • Example 8 DMPK knockdown in non-human primates following administration of anti- TfRl Fab-ASO conjugates
  • 14A and 14B show DMPK expression in gastrocnemius and tibialis anterior tissues, respectively, of NHPs treated with an approximately 10 mg/kg ASO- equivalent dose of the conjugates, measured 4, 8, and 12 weeks after intravenous infusion of the conjugates. Expression is shown relative to that in vehicle-only control animals. Expression in animals administered the conjugates was decreased relative to the controls at each time point tested (relative expression in gastrocnemius of 0.54, 0.47, and 0.61 at 4, 8, and 12 weeks postdose, respectively; relative expression in tibialis anterior of 0.75, 0.48, and 0.72 at 4, 8, and 12 weeks post-dose, respectively). Data are presented as means +/- standard deviation. Significance was determined by unpaired t-test.
  • FIGs. 15A, 15B, 15C, and 15D show DMPK expression in heart, diaphragm, tibialis anterior, and gastrocnemius tissues, respectively, of NHPs treated with either a 5 mg/kg or a 10 mg/kg ASO-equivalent dose of the conjugates, relative to control (vehicle-treated) animals.
  • DMPK knockdown was assessed four weeks after administration of the conjugates. A dose-dependent effect of the conjugates on DMPK knockdown in cardiac and skeletal muscle was observed.
  • the 5 mg/kg dose resulted in 21% knockdown in heart, 43% knockdown in diaphragm, 22% knockdown in tibialis anterior, and 25% knockdown in gastrocnemius; and the 10 mg/kg dose resulted in 38% knockdown in heart, 60% knockdown in diaphragm, 30% knockdown in tibialis anterior, and 35% knockdown in gastrocnemius at the assayed time.
  • FIGs. 16A, 16B, 16C, 16D, 16E, 16F, and 16G show DMPK expression in heart, diaphragm, tibialis anterior, gastrocnemius, masseter, esophagus, and duodenum tissues, respectively, of NHPs treated with either two 5 mg/kg or two 10 mg/kg ASO-equivalent doses of the conjugates, with the two doses administered four weeks (28 days) apart.
  • DMPK knockdown was assessed 8 weeks after administration of the first dose of the conjugates.
  • Monthly administration of anti-TfRl Fab-ASO conjugates led to sustained DMPK knockdown across all assayed tissues.
  • a method of reducing DMPK expression in a subject comprising administering to the subject a composition comprising an effective amount of complexes comprising an antitransferrin receptor 1 (TfRl) antibody covalently linked to one or more oligonucleotides, wherein the effective amount provides to the subject 5 mg to 110 mg of the anti-TfRl antibody of the complexes per kg of the subject, wherein the antibody comprises: a heavy chain complementarity determining region 1 (CDR-H1) comprising a sequence as set forth in SEQ ID NOs: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising a sequence as set forth in SEQ ID NOs: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising a sequence as set forth in SEQ ID NOs: 3, 9, or 14, a light chain complementarity determining region 1 (CDR-L1) comprising a sequence as set forth in SEQ ID NOs: 4, 10, or 15, a light chain
  • a method of treating myotonic dystrophy in a subject comprising administering to the subject a composition comprising an effective amount of complexes comprising an antitransferrin receptor 1 (TfRl) antibody covalently linked to one or more oligonucleotides, wherein the effective amount provides to the subject 5 mg to 110 mg of the anti-TfRl antibody of the complexes per kg of the subject, wherein the antibody comprises: a heavy chain complementarity determining region 1 (CDR-H1) comprising a sequence as set forth in SEQ ID NOs: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising a sequence as set forth in SEQ ID NOs: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising a sequence as set forth in SEQ ID NOs: 3, 9, or 14, a light chain complementarity determining region 1 (CDR-L1) comprising a sequence as set forth in SEQ ID NOs: 4, 10, or 15,
  • a method of reducing DMPK expression in a subject comprising administering to the subject a composition comprising an effective amount of complexes comprising an antitransferrin receptor 1 (TfRl) antibody covalently linked to one or more oligonucleotides, wherein the effective amount provides to the subject 1 mg to 12 mg of the oligonucleotides of the complexes per kg of the subject, wherein the antibody comprises: a heavy chain complementarity determining region 1 (CDR-H1) comprising a sequence as set forth in SEQ ID NOs: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising a sequence as set forth in SEQ ID NOs: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising a sequence as set forth in SEQ ID NOs: 3, 9, or 14, a light chain complementarity determining region 1 (CDR-L1) comprising a sequence as set forth in SEQ ID NOs: 4, 10, or 15, a
  • a method of treating myotonic dystrophy in a subject comprising administering to the subject a composition comprising an effective amount of complexes comprising an antitransferrin receptor 1 (TfRl) antibody covalently linked to one or more oligonucleotides, wherein the effective amount provides to the subject 1 mg to 12 mg of the oligonucleotides of the complexes per kg of the subject, wherein the antibody comprises: a heavy chain complementarity determining region 1 (CDR-H1) comprising a sequence as set forth in SEQ ID NOs: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising a sequence as set forth in SEQ ID NOs: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising a sequence as set forth in SEQ ID NOs: 3, 9, or 14, a light chain complementarity determining region 1 (CDR-L1) comprising a sequence as set forth in SEQ ID NOs: 4, 10, or 15,
  • oligonucleotides of the complexes comprise a 5’-X-Y-Z-3’ configuration, wherein X and Z are flanking regions comprising one or more modified nucleosides and Y is a gap region comprising one or more 2 ’ -deoxyribonucleosides .
  • each complex comprises a structure of formula (I): [R ⁇ ni-R 2 , wherein: each R 1 comprises a group of the formula (lb): in which +N represents an LNA (2’-4’ methylene bridge) ribonucleoside, dN represents a 2’- deoxyribonucleoside, oN represents a 2’ -MOE modified ribonucleoside, oC represents a 5- methyl-2’-MOE-cytidine, +C represents a 5-methyl-2’-4’-bicyclic-cytidine (2 ’-4’ methylene bridge), oU represents a 5-methyl-2’-MOE-uridine, and * represents a phosphorothioate intemucleoside linkage, and the oligonucleotide of R 1 comprises a nucleobase sequence of CAGCGCCCACCAGUCA (SEQ ID NO: 21);
  • R 2 comprises the anti-TfRl antibody; and in each complex, nl is independently an integer of one or greater representing the number of instances of R 1 , wherein each instance of R 1 is covalently linked via attachment point A to a different lysine of the anti-TfRl antibody, optionally wherein the average value of nl of the complexes of the composition is in the range of 0.5-5. 7. The method of any one of embodiments 1-5, wherein each complex comprises a structure of formula (I): [R ⁇ ni-R 2 , wherein: each R 1 comprises a group of the formula (Ic):
  • R 2 comprises the anti-TfRl antibody
  • nl is independently an integer of one or greater representing the number of instances of R 1 , wherein each instance of R 1 is covalently linked via attachment point A to a different lysine of the anti-TfRl antibody, optionally wherein the average value of nl of the complexes of the composition is in the range of 0.5-5.
  • the anti-TfRl antibody comprises a heavy chain variable region (VH) comprising the amino acid sequence of SEQ ID NO: 17 and a light chain variable region (VL) comprising the amino acid sequence of SEQ ID NO: 18.
  • VH heavy chain variable region
  • VL light chain variable region
  • the anti-TfRl antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20.
  • composition is administered once every 12 weeks.
  • reducing DMPK expression comprises reducing the amount of DMPK RNA in the muscle cell, optionally wherein the DMPK RNA amount is reduced in the nucleus of the muscle cell.
  • reducing DMPK expression in the muscle cell comprises reducing the amount of DMPK protein in the muscle cell.
  • a method of reducing DMPK expression or treating myotonic dystrophy in a subject comprising administering intravenously an effective amount of a composition comprising complexes comprising a structure of formula (I): [R ⁇ ni-R 2 , wherein: each R 1 comprises a group of the formula (la):
  • R 3 comprises an oligonucleotide comprising a nucleobase sequence of CAGCGCCCACCAGUCA (SEQ ID NO: 21) and comprising a structure of +C*+A*oG*oC*dG*dC*dC*dC*dA*dC*dC*dA*oG*oU*+C*+A (SEQ ID NO: 21), wherein +N represents an LNA (2’ -4’ methylene bridge) ribonucleoside, dN represents a 2’- deoxyribonucleoside, oN represents a 2’ -MOE modified ribonucleoside, oC represents a 5- methyl-2’-MOE-cytidine, +C represents a 5-methyl-2’-4’-bicyclic-cytidine (2 ’-4’ methylene bridge), oU represents a 5-methyl-2’-MOE-uridine, and * represents a phosphorothioate intemucleo
  • R 2 comprises an anti-TfRl Fab comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20; and in each complex, nl is independently an integer of one or greater representing the number of instances of R 1 , wherein each instance of R 1 is covalently linked via attachment point A to a different lysine of the anti-TfRl antibody, optionally wherein the average value of nl of the complexes of the composition is in the range of 0.5-5; wherein the effective amount provides to the subject 5 mg to 110 mg of the anti-TfRl antibody of the complexes per kg of the subject, optionally wherein the effective amount provides to the subject 8 mg to 60 mg or 13 mg to 75 mg of the anti-TfRl antibody of the complexes per kg of the subject.
  • a method of reducing DMPK expression or treating myotonic dystrophy in a subject comprising administering intravenously an effective amount of a composition comprising complexes comprising a structure of formula (I): [R ⁇ ni-R 2 , wherein: each R 1 comprises a group of the formula (lb): in which +N represents an LNA (2’-4’ methylene bridge) ribonucleoside, dN represents a 2’- deoxyribonucleoside, oN represents a 2’ -MOE modified ribonucleoside, oC represents a 5- methyl-2’-MOE-cytidine, +C represents a 5-methyl-2’-4’-bicyclic-cytidine (2 ’-4’ methylene bridge), oU represents a 5-methyl-2’-MOE-uridine, and * represents a phosphorothioate intemucleoside linkage, and the oligonucleotide of R 1 comprises a nucleo
  • R 2 comprises an anti-TfRl Fab comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20; and in each complex, nl is independently an integer of one or greater representing the number of instances of R 1 , wherein each instance of R 1 is covalently linked via attachment point A to a different lysine of the anti-TfRl antibody, optionally wherein the average value of nl of the complexes of the composition is in the range of 0.5-5; wherein the effective amount provides to the subject 5 mg to 110 mg of the anti-TfRl antibody of the complexes per kg of the subject, optionally wherein the effective amount provides to the subject 8 mg to 60 mg or 13 mg to 75 mg of the anti-TfRl antibody of the complexes per kg of the subject.
  • a method of reducing DMPK expression or treating myotonic dystrophy in a subject comprising administering intravenously an effective amount of a composition comprising complexes comprising a structure of formula (I): [R ⁇ ni-R 2 , wherein: each R 1 comprises a group of the formula (Ic):
  • (+N represents an LNA (2’-4’ methylene bridge) ribonucleoside
  • dN represents a 2’- deoxyribonucleoside
  • oN represents a 2’ -MOE modified ribonucleoside
  • oC represents a 5- methyl-2’-MOE-cytidine
  • +C represents a 5-methyl-2’-4’-bicyclic-cytidine (2 ’-4’ methylene bridge
  • oU represents a 5-methyl-2’-MOE-uridine
  • * represents a phosphorothioate intemucleoside linkage
  • the oligonucleotide of R 1 comprises a nucleobase sequence of CAGCGCCCACCAGUCA (SEQ ID NO: 21);
  • R 2 comprises an anti-TfRl Fab comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20; and in each complex, nl is independently an integer of one or greater representing the number of instances of R 1 , wherein each instance of R 1 is covalently linked via attachment point A to a different lysine of the anti-TfRl antibody, optionally wherein the average value of nl of the complexes of the composition is in the range of 0.5-5; wherein the effective amount provides to the subject 5 mg to 110 mg of the anti-TfRl antibody of the complexes per kg of the subject, optionally wherein the effective amount provides to the subject 8 mg to 60 mg or 13 mg to 75 mg of the anti-TfRl antibody of the complexes per kg of the subject.
  • a method of reducing DMPK expression or treating myotonic dystrophy in a subject comprising administering intravenously an effective amount of a composition comprising complexes comprising a structure of the formula (Id):
  • +N represents an LNA (2’-4’ methylene bridge) ribonucleoside
  • dN represents a 2’- deoxyribonucleoside
  • oN represents a 2’ -MOE modified ribonucleoside
  • oC represents a 5- methyl-2’-MOE-cytidine
  • +C represents a 5-methyl-2’-4’-bicyclic-cytidine (2 ’-4’ methylene bridge
  • oU represents a 5-methyl-2’-MOE-uridine
  • * represents a phosphorothioate intemucleoside linkage
  • the oligonucleotide of R 1 comprises a nucleobase sequence of CAGCGCCCACCAGUCA (SEQ ID NO: 21);
  • R 2 comprises an anti-TfRl Fab comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20; and in each complex, nl is independently an integer of one or greater representing the number of instances of R 1 , wherein each instance of R 1 is covalently linked via attachment point A to a different lysine of the anti-TfRl antibody, optionally wherein the average value of nl of the complexes of the composition is in the range of 0.5-5; wherein the effective amount provides to the subject 5 mg to 110 mg of the anti-TfRl antibody of the complexes per kg of the subject, optionally wherein the effective amount provides to the subject 8 mg to 60 mg or 13 mg to 75 mg of the anti-TfRl antibody of the complexes per kg of the subject.
  • a method of reducing DMPK expression or treating myotonic dystrophy in a subject comprising administering intravenously an effective amount of a composition comprising complexes comprising a structure of formula (I): [R ⁇ ni-R 2 , wherein: each R 1 comprises a group of the formula (la): in which R 3 comprises an oligonucleotide comprising a nucleobase sequence of CAGCGCCCACCAGUCA (SEQ ID NO: 21) and comprising a structure of +C*+A*oG*oC*dG*dC*dC*dC*dA*dC*dC*dA*oG*oU*+C*+A (SEQ ID NO: 21), wherein +N represents an LNA (2’ -4’ methylene bridge) ribonucleoside, dN represents a 2’- deoxyribonucleoside, oN represents a 2’ -MOE modified ribonucleoside, oC represents a
  • R 2 comprises an anti-TfRl Fab comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20; and in each complex, nl is independently an integer of one or greater representing the number of instances of R 1 , wherein each instance of R 1 is covalently linked via attachment point A to a different lysine of the anti-TfRl antibody, optionally wherein the average value of nl of the complexes of the composition is in the range of 0.5-5; wherein the effective amount provides to the subject 1 mg to 12 mg of the oligonucleotides of the complexes per kg of the subject, optionally wherein the effective amount provides to the subject 1.8 mg to 10.2 mg or 1.1 mg to 8.2 mg of the oligonucleotides of the complexes per kg of the subject.
  • a method of reducing DMPK expression or treating myotonic dystrophy in a subject comprising administering intravenously an effective amount of a composition comprising complexes comprising a structure of formula (I): [R ⁇ ni-R 2 , wherein:
  • +N represents an LNA (2’-4’ methylene bridge) ribonucleoside
  • dN represents a 2’- deoxyribonucleoside
  • oN represents a 2’ -MOE modified ribonucleoside
  • oC represents a 5- methyl-2’-MOE-cytidine
  • +C represents a 5-methyl-2’-4’-bicyclic-cytidine (2 ’-4’ methylene bridge
  • oU represents a 5-methyl-2’-MOE-uridine
  • * represents a phosphorothioate intemucleoside linkage
  • the oligonucleotide of R 1 comprises a nucleobase sequence of CAGCGCCCACCAGUCA (SEQ ID NO: 21);
  • R 2 comprises an anti-TfRl Fab comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20; and in each complex, nl is independently an integer of one or greater representing the number of instances of R 1 , wherein each instance of R 1 is covalently linked via attachment point A to a different lysine of the anti-TfRl antibody, optionally wherein the average value of nl of the complexes of the composition is in the range of 0.5-5; wherein the effective amount provides to the subject 1 mg to 12 mg of the oligonucleotides of the complexes per kg of the subject, optionally wherein the effective amount provides to the subject 1.8 mg to 10.2 mg or 1.1 mg to 8.2 mg of the oligonucleotides of the complexes per kg of the subject.
  • a method of reducing DMPK expression or treating myotonic dystrophy in a subject comprising administering intravenously an effective amount of a composition comprising complexes comprising a structure of formula (I): [R ⁇ ni-R 2 , wherein: each R 1 comprises a group of the formula (Ic):
  • oligonucleotide of R 1 comprises a nucleobase sequence of CAGCGCCCACCAGUCA (SEQ ID NO: 21);
  • R 2 comprises an anti-TfRl Fab comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20; and in each complex, nl is independently an integer of one or greater representing the number of instances of R 1 , wherein each instance of R 1 is covalently linked via attachment point A to a different lysine of the anti-TfRl antibody, optionally wherein the average value of nl of the complexes of the composition is in the range of 0.5-5; wherein the effective amount provides to the subject 1 mg to 12 mg of the oligonucleotides of the complexes per kg of the subject, optionally wherein the effective amount provides to the subject 1.8 mg to 10.2 mg or 1.1 mg to 8.2 mg of the oligonucleotides of the complexes per kg of the subject. 58. A method of reducing DMPK expression or treating myotonic dystrophy in a subject, comprising administering intravenously an
  • +N represents an LNA (2’-4’ methylene bridge) ribonucleoside
  • dN represents a 2’- deoxyribonucleoside
  • oN represents a 2’ -MOE modified ribonucleoside
  • oC represents a 5- methyl-2’-MOE-cytidine
  • +C represents a 5-methyl-2’-4’-bicyclic-cytidine (2 ’-4’ methylene bridge
  • oU represents a 5-methyl-2’-MOE-uridine
  • * represents a phosphorothioate intemucleoside linkage
  • the oligonucleotide of R 1 comprises a nucleobase sequence of CAGCGCCCACCAGUCA (SEQ ID NO: 21);
  • R 2 comprises an anti-TfRl Fab comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20; and in each complex, nl is independently an integer of one or greater representing the number of instances of R 1 , wherein each instance of R 1 is covalently linked via attachment point A to a different lysine of the anti-TfRl antibody, optionally wherein the average value of nl of the complexes of the composition is in the range of 0.5-5; wherein the effective amount provides to the subject 1 mg to 12 mg of the oligonucleotides of the complexes per kg of the subject, optionally wherein the effective amount provides to the subject 1.8 mg to 10.2 mg or 1.1 mg to 8.2 mg of the oligonucleotides of the complexes per kg of the subject.
  • composition is in the form of an aqueous solution and wherein the aqueous solution is at a pH of 7.5 and comprises tris(hydroxymethyl)aminomethane at a concentration of 25 mM, sucrose at a concentration of 10 ⁇ IN%, and the complexes at a concentration in the range of 10 mg/mL to 50 mg/mL.
  • composition is administered once every 4 weeks, once every 8 weeks, or once every 12 weeks for a period of time.
  • a method comprising administering to a subject a composition comprising complexes comprising an anti-transferrin receptor 1 (TfRl) antibody covalently linked to one or more oligonucleotides, wherein composition provides to the subject the anti-TfRl antibody of the complexes in an amount in the range of 5 mg to 110 mg antibody per kg of the subject, wherein the antibody comprises: a heavy chain complementarity determining region 1 (CDR- Hl) comprising a sequence as set forth in SEQ ID NOs: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising a sequence as set forth in SEQ ID NOs: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising a sequence as set forth in SEQ ID NOs: 3, 9, or 14, a light chain complementarity determining region 1 (CDR-L1) comprising a sequence as set forth in SEQ ID NOs: 4, 10, or 15, a light chain complementarity determining region 1
  • a method comprising administering to the subject a composition comprising complexes comprising an anti-transferrin receptor 1 (TfRl) antibody covalently linked to one or more oligonucleotides, wherein the composition provides to the subject the oligonucleotides of the complexes in an amount in the range of 1 mg to 12 mg oligonucleotide per kg of the subject, wherein the antibody comprises: a heavy chain complementarity determining region 1 (CDR-H1) comprising a sequence as set forth in SEQ ID NOs: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising a sequence as set forth in SEQ ID NOs: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising a sequence as set forth in SEQ ID NOs: 3, 9, or 14, a light chain complementarity determining region 1 (CDR-L1) comprising a sequence as set forth in SEQ ID NOs: 4, 10, or 15, a light chain
  • composition further comprises one or more anti-TfRl antibodies that are not covalently linked to an oligonucleotide.
  • sequences presented in the sequence listing may be referred to in describing the structure of an oligonucleotide or other nucleic acid.
  • the actual oligonucleotide or other nucleic acid may have one or more alternative nucleotides (e.g., an RNA counterpart of a DNA nucleotide or a DNA counterpart of an RNA nucleotide) and/or (e.g., and) one or more modified nucleotides and/or (e.g., and) one or more modified intemucleoside linkages and/or (e.g., and) one or more other modification compared with the specified sequence while retaining essentially same or similar complementary properties as the specified sequence.
  • alternative nucleotides e.g., an RNA counterpart of a DNA nucleotide or a DNA counterpart of an RNA nucleotide
  • modified nucleotides and/or e.g., and one or more modified intemucleoside linkages and/or (e.g., and) one or more other modification compared with the specified sequence while retaining essentially same or similar complementary properties as the specified sequence.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biotechnology (AREA)
  • Epidemiology (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Virology (AREA)
  • Neurology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicinal Preparation (AREA)
PCT/US2023/065774 2022-04-15 2023-04-14 Dosing of muscle targeting complexes for treating myotonic dystrophy Ceased WO2023201332A1 (en)

Priority Applications (9)

Application Number Priority Date Filing Date Title
CN202380040662.9A CN119343373A (zh) 2022-04-15 2023-04-14 用于治疗强直性肌营养不良的肌肉靶向复合物的给药
AU2023252927A AU2023252927A1 (en) 2022-04-15 2023-04-14 Dosing of muscle targeting complexes for treating myotonic dystrophy
IL316206A IL316206A (en) 2022-04-15 2023-04-14 Dosage of muscle targeting complexes for the treatment of myotonic dystrophy
EP23789176.7A EP4508092A1 (en) 2022-04-15 2023-04-14 Dosing of muscle targeting complexes for treating myotonic dystrophy
JP2024560675A JP2025512468A (ja) 2022-04-15 2023-04-14 筋緊張性ジストロフィーを処置するための筋標的化複合体の投薬
CA3248684A CA3248684A1 (en) 2022-04-15 2023-04-14 DOSAGE OF MUSCLE-TARGETING COMPLEXES FOR THE TREATMENT OF MYOTONIC DYSTROPHY
KR1020247037614A KR20250004771A (ko) 2022-04-15 2023-04-14 근긴장성 이영양증을 치료하기 위한 근육 표적화 복합체의 투여
US18/856,266 US20250249117A1 (en) 2022-04-15 2023-04-14 Dosing of muscle targeting complexes for treating myotonic dystrophy
MX2024012730A MX2024012730A (es) 2022-04-15 2024-10-14 Dosis de complejos dirigidos a musculos para el tratamiento de la distrofia miotonica

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US202263331733P 2022-04-15 2022-04-15
US63/331,733 2022-04-15
US202263368691P 2022-07-18 2022-07-18
US63/368,691 2022-07-18

Publications (1)

Publication Number Publication Date
WO2023201332A1 true WO2023201332A1 (en) 2023-10-19

Family

ID=88330392

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2023/065774 Ceased WO2023201332A1 (en) 2022-04-15 2023-04-14 Dosing of muscle targeting complexes for treating myotonic dystrophy

Country Status (10)

Country Link
US (1) US20250249117A1 (https=)
EP (1) EP4508092A1 (https=)
JP (1) JP2025512468A (https=)
KR (1) KR20250004771A (https=)
CN (1) CN119343373A (https=)
AU (1) AU2023252927A1 (https=)
CA (1) CA3248684A1 (https=)
IL (1) IL316206A (https=)
MX (1) MX2024012730A (https=)
WO (1) WO2023201332A1 (https=)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11911484B2 (en) 2018-08-02 2024-02-27 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating myotonic dystrophy
US11931421B2 (en) 2022-04-15 2024-03-19 Dyne Therapeutics, Inc. Muscle targeting complexes and formulations for treating myotonic dystrophy
US11969475B2 (en) 2021-07-09 2024-04-30 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating facioscapulohumeral muscular dystrophy
US11986537B2 (en) 2021-07-09 2024-05-21 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US12005124B2 (en) 2018-08-02 2024-06-11 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US12012460B2 (en) 2018-08-02 2024-06-18 Dyne Therapeutics, Inc. Muscle-targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide
US12018087B2 (en) 2018-08-02 2024-06-25 Dyne Therapeutics, Inc. Muscle-targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide and methods of delivering oligonucleotide to a subject
US12097263B2 (en) 2018-08-02 2024-09-24 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating myotonic dystrophy
US12128109B2 (en) 2021-07-09 2024-10-29 Dyne Therapeutics, Inc. Muscle targeting complexes and formulations for treating dystrophinopathies
US12329825B1 (en) 2018-08-02 2025-06-17 Dyne Therapeutics, Inc. Muscle targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide and method of use thereof to induce exon skipping of exon 44 of dystrophin in a subject
US12370264B1 (en) 2018-08-02 2025-07-29 Dyne Therapeutics, Inc. Complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide and method of delivering oligonucleotide to a subject

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20210130486A1 (en) * 2018-12-21 2021-05-06 Avidity Biosciences, Inc. Anti-transferrin receptor antibodies and uses thereof
WO2022026152A2 (en) * 2020-07-23 2022-02-03 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating myotonic dystrophy

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20210130486A1 (en) * 2018-12-21 2021-05-06 Avidity Biosciences, Inc. Anti-transferrin receptor antibodies and uses thereof
WO2022026152A2 (en) * 2020-07-23 2022-02-03 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating myotonic dystrophy

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
BARFIELD ROBYN M., KIM YUN CHEOL, CHUPRAKOV STEPAN, ZHANG FANGJIU, BAUZON MAXINE, OGUNKOYA AYODELE O., YEO DOMINICK, HICKLE COLIN,: "A Novel HER2-targeted Antibody–drug Conjugate Offers the Possibility of Clinical Dosing at Trastuzumab-equivalent Exposure Levels", MOLECULAR CANCER THERAPEUTICS, AMERICAN ASSOCIATION FOR CANCER RESEARCH, US, vol. 19, no. 9, 1 September 2020 (2020-09-01), US , pages 1866 - 1874, XP093102027, ISSN: 1535-7163, DOI: 10.1158/1535-7163.MCT-20-0190 *

Cited By (32)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11911484B2 (en) 2018-08-02 2024-02-27 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating myotonic dystrophy
US12370264B1 (en) 2018-08-02 2025-07-29 Dyne Therapeutics, Inc. Complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide and method of delivering oligonucleotide to a subject
US12478687B2 (en) 2018-08-02 2025-11-25 Dyne Therapeutics, Inc. United states
US12460011B2 (en) 2018-08-02 2025-11-04 Dyne Therapeutics, Inc. Complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide and method of delivering an oligonucleotide to a subject
US12005124B2 (en) 2018-08-02 2024-06-11 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US12012460B2 (en) 2018-08-02 2024-06-18 Dyne Therapeutics, Inc. Muscle-targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide
US12018087B2 (en) 2018-08-02 2024-06-25 Dyne Therapeutics, Inc. Muscle-targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide and methods of delivering oligonucleotide to a subject
US12097263B2 (en) 2018-08-02 2024-09-24 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating myotonic dystrophy
US12496352B2 (en) 2018-08-02 2025-12-16 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating myotonic dystrophy
US12319743B2 (en) 2018-08-02 2025-06-03 Dyne Therapeutics, Inc. Complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide and method of delivering oligonucleotide to a subject
US12428487B2 (en) 2018-08-02 2025-09-30 Dyne Therapeutics, Inc. Complexes comprising an anti-transferrin receptor antibody linked to an oligonicleotide and method of delivering oligonucleotide to a subject
US12357703B2 (en) 2018-08-02 2025-07-15 Dyne Therapeutics, Inc. Muscle-targeting complexes comprising an anti-transferin receptor antibody linked to an oligonucleotide and method of use thereof to induce exon skipping
US12173079B2 (en) 2018-08-02 2024-12-24 Dyne Therapeutics, Inc. Muscle-targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide
US12173078B2 (en) 2018-08-02 2024-12-24 Dyne Therapeutics, Inc. Complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide
US12329825B1 (en) 2018-08-02 2025-06-17 Dyne Therapeutics, Inc. Muscle targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide and method of use thereof to induce exon skipping of exon 44 of dystrophin in a subject
US12325753B2 (en) 2018-08-02 2025-06-10 Dyne Therapeutics, Inc. Method of using an anti-transferrin receptor antibody to deliver an oligonucleotide to a subject having facioscapulohumeral muscular dystrophy
US12263225B2 (en) 2018-08-02 2025-04-01 Dyne Therapeutics, Inc. Muscle-targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide and methods of use thereof to target dystrophin and to treat Duchenne muscular dystrophy
US12280122B2 (en) 2018-08-02 2025-04-22 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating myotonic dystrophy
US12102687B2 (en) 2021-07-09 2024-10-01 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating myotonic dystrophy
US12403203B2 (en) 2021-07-09 2025-09-02 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US12239717B2 (en) 2021-07-09 2025-03-04 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US12329824B1 (en) 2021-07-09 2025-06-17 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US12144868B2 (en) 2021-07-09 2024-11-19 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US12144867B2 (en) 2021-07-09 2024-11-19 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US12397062B2 (en) 2021-07-09 2025-08-26 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US12239716B2 (en) 2021-07-09 2025-03-04 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US12128109B2 (en) 2021-07-09 2024-10-29 Dyne Therapeutics, Inc. Muscle targeting complexes and formulations for treating dystrophinopathies
US11969475B2 (en) 2021-07-09 2024-04-30 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating facioscapulohumeral muscular dystrophy
US12440575B2 (en) 2021-07-09 2025-10-14 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US11986537B2 (en) 2021-07-09 2024-05-21 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US12440574B2 (en) 2022-04-15 2025-10-14 Dyne Therapeutics, Inc. Muscle targeting complexes and formulations for treating myotonic dystrophy
US11931421B2 (en) 2022-04-15 2024-03-19 Dyne Therapeutics, Inc. Muscle targeting complexes and formulations for treating myotonic dystrophy

Also Published As

Publication number Publication date
AU2023252927A1 (en) 2024-10-10
CN119343373A (zh) 2025-01-21
KR20250004771A (ko) 2025-01-08
JP2025512468A (ja) 2025-04-17
MX2024012730A (es) 2025-01-09
IL316206A (en) 2024-12-01
US20250249117A1 (en) 2025-08-07
CA3248684A1 (en) 2023-10-19
EP4508092A1 (en) 2025-02-19

Similar Documents

Publication Publication Date Title
US20250249117A1 (en) Dosing of muscle targeting complexes for treating myotonic dystrophy
US20250249116A1 (en) Muscle targeting complexes and uses thereof for treating myotonic dystrophy
US12440574B2 (en) Muscle targeting complexes and formulations for treating myotonic dystrophy
JP7804685B2 (ja) 筋緊張性ジストロフィーを処置するための筋標的化複合体およびその使用
WO2023201318A1 (en) Muscle targeting complexes and formulations for treating myotonic dystrophy
CA3226301A1 (en) Muscle targeting complexes and uses thereof for treating myotonic dystrophy
CN120282986A (zh) 肌肉靶向复合物及其用于跳读dmd基因的外显子45的用途
WO2025147541A1 (en) Methods and compositions for treating myotonic dystrophy
JP2024532964A (ja) 筋標的化複合体および筋緊張性ジストロフィーを処置するためのその使用

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23789176

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 814934

Country of ref document: NZ

Ref document number: AU2023252927

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 316206

Country of ref document: IL

ENP Entry into the national phase

Ref document number: 2023252927

Country of ref document: AU

Date of ref document: 20230414

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: MX/A/2024/012730

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 2024560675

Country of ref document: JP

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112024021085

Country of ref document: BR

WWE Wipo information: entry into national phase

Ref document number: 11202406540X

Country of ref document: SG

WWE Wipo information: entry into national phase

Ref document number: 202417085999

Country of ref document: IN

ENP Entry into the national phase

Ref document number: 20247037614

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 1020247037614

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 202492673

Country of ref document: EA

WWE Wipo information: entry into national phase

Ref document number: 2023789176

Country of ref document: EP

Ref document number: 202380040662.9

Country of ref document: CN

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2023789176

Country of ref document: EP

Effective date: 20241115

ENP Entry into the national phase

Ref document number: 112024021085

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20241010

WWP Wipo information: published in national office

Ref document number: 202380040662.9

Country of ref document: CN

WWP Wipo information: published in national office

Ref document number: 18856266

Country of ref document: US