WO2023196914A1

WO2023196914A1 - Influenza nucleic acid compositions and uses thereof

Info

Publication number: WO2023196914A1
Application number: PCT/US2023/065453
Authority: WO
Inventors: Raffael NACHBAGAUER; Carole Henry; Patricia JORQUERA
Original assignee: Modernatx, Inc.
Priority date: 2022-04-08
Filing date: 2023-04-06
Publication date: 2023-10-12

Abstract

The disclosure provides RNA vaccines for seasonal influenza virus as well as methods of using the vaccines.

Description

INFLUENZA NUCLEIC ACID COMPOSITIONS AND USES THEREOF

RELATED APPLICATION

This application claims the benefit of priority under 35 U.S.C. § 119(e) of U.S. Provisional Application Serial No. 63/329,068, filed on April 8, 2022; the entire contents of which are incorporated herein by reference.

REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

The contents of the electronic sequence listing (M137870240WO00-SEQ-JXV.xml; Size: 58,286 bytes; and Date of Creation: April 6, 2023) is herein incorporated by reference in its entirety.

BACKGROUND

Seasonal influenza is an acute respiratory infection caused by influenza viruses - influenza A and influenza B viruses - that circulate in all parts of the world. Seasonal influenza is characterized by a sudden onset of fever, cough (usually dry), headache, muscle and joint pain, severe malaise (feeling unwell), sore throat and a runny nose. In industrialized countries most deaths associated with influenza occur among people aged 65 or older. Epidemics can result in high levels of worker/school absenteeism and productivity losses. Clinics and hospitals can be overwhelmed during peak illness periods. The effects of seasonal influenza epidemics in developing countries are not fully known, but research estimates that 99% of deaths in children under 5 years of age with influenza related lower respiratory tract infections are found in developing countries.

Inactivated influenza vaccines are currently available and the most widely used method to prevent influenza outbreaks, particularly in high risk populations, such as the elderly. Vaccines elicit immune responses that attack the viral glycoprotein hemagglutinin (HA) and the viral enzyme neuraminidase (NA) found on the surface of the influenza virus. Antihemagglutinin antibodies neutralize viral infectivity, while anti-neuraminidase antibodies decrease the severity of disease. Because HA is the major influenza virus antigen recognized by neutralizing antibodies, this glycoprotein has been the focus of currently available influenza vaccines.

SUMMARY

Influenza vaccination only provides protection against outbreaks involving known viral strains. Because of its penchant to vary its antigenic components from year to year, vaccination against an influenza virus can prove ineffective. Provided herein, in some aspects, are messenger RNA (mRNA) vaccines against influenza virus infection that offer the advantages of high efficacy, speed of development, and production scalability and reliability. The mRNA vaccines of the present disclosure comprise mRNAs encoding unique combinations of HA and/or NA antigens, e.g., antigens from multiple seasonal influenza flu strains, in some embodiments, all formulated in a single lipid nanoparticle. In certain aspects, the mRNA vaccines of the present disclosure comprise mRNAs encoding unique combinations of HA antigens in combination with NA antigens. In certain aspects, the mRNA vaccines of the present disclosure comprise mRNAs encoding both HA and NA (e.g., enzymatically active or inactive) antigens from multiple seasonal influenza flu strains, in some embodiments, all formulated in a single lipid nanoparticle, thus offering a vaccine that not only neutralizes viral infectivity but also decreases the severity of disease.

As discussed in more detail below, due to the constant evolving nature of influenza viruses, the WHO Global Influenza Surveillance and Response System (GISRS) - a system of National Influenza Centers and WHO Collaborating Centers around the world - continuously monitors the influenza viruses circulating in humans and updates the recommended composition of influenza vaccines twice a year. To permit enough time to develop the standard inactivated virus vaccines, this recommendation is made six to seven months prior to the start of the influenza season, which unfortunately allows plenty of time for the influenza viruses to continue to evolve/mutate or change in prevalence. The mRNA vaccine technology provided herein offers the GISRS additional time to monitor circulating viruses and make its recommendation closer to the influenza season. This extension of the GISRS monitoring timeline should allow the GISRS predictions to be more accurate, resulting in more effective vaccines designed to target circulating viruses closer to the influenza season.

In some aspects, the disclosure provides a method comprising administering to a human subject a composition comprising a 25 |lg - 150 pg dose of: (a) a first messenger ribonucleic acid (mRNA) encoding a hemagglutinin (HA) antigen of a first influenza A virus and a second mRNA encoding an HA antigen of a second influenza A virus, wherein the influenza A HA antigens are of different subtypes; and (b) a third mRNA encoding an HA antigen of a first influenza B virus and a fourth mRNA encoding an HA antigen of a second influenza B virus, wherein the influenza B HA antigens are of different lineages; and (c) a fifth mRNA encoding neuraminidase (NA) antigen of the first influenza A virus and a sixth mRNA encoding an NA antigen of the second influenza A virus, wherein the influenza A NA antigens are of different subtypes; and (d) a seventh mRNA encoding an NA antigen of the first influenza B virus and an eighth mRNA encoding an NA antigen of the second influenza B virus, wherein the influenza B NA antigens are of different lineages, and wherein the mRNAs of (a), (b), (c), and (d) are in a lipid nanoparticle.

In some embodiments, the ratio of the first: second:third:fourth:fifth: sixth: seventh:eighth mRNAs is l:l:l:l:l:l:l:l. In some embodiments, the ratio of the first: second:third:fourth:fifth: sixth: seventh:eighth mRNAs is 3:3:3:3: 1 : 1 : 1 : 1.

In some embodiments, the dose is 25 |lg total mRNA. In some embodiments, the dose is 50 pg total mRNA. In some embodiments, the dose is 100 pg total mRNA. In some embodiments, the dose is 150 pg total mRNA.

In some embodiments, the composition further comprises Tris buffer. In some embodiments, the composition with Tris buffer further comprises sucrose and sodium acetate. In some embodiments, the composition comprises 10 mM - 30 mM Tris buffer comprising 75 mg/mL - 95 mg/mL sucrose, and 5 mM - 15 mM sodium acetate, optionally wherein the composition has a pH of 6-8. In some embodiments, the composition comprises about 20 mM Tris buffer comprising 87 mg/mL sucrose, and 10.7 mM sodium acetate, optionally wherein the composition has a pH of 7.5.

In some embodiments, the composition comprises about 0.5 mg/mL of the mRNA. In some embodiments, the composition is administered intramuscularly, optionally into a deltoid muscle of the subject’s arm.

In some embodiments, the lipid nanoparticle comprises: an ionizable amino lipid; a neutral lipid; a sterol; and a PEG-modified lipid. In some embodiments, the lipid nanoparticle comprises: 40-55 mol% ionizable amino lipid; 5-15 mol% neutral lipid; 35-45 mol% sterol; and 1-5 mol% PEG-modified lipid. In some embodiments, the lipid nanoparticle comprises:

47 mol% ionizable amino lipid; 11.5 mol% neutral lipid; 38.5 mol% sterol; and 3.0 mol% PEG-modified lipid;

48 mol% ionizable amino lipid; 11 mol% neutral lipid; 38.5 mol% sterol; and 2.5 mol% PEG-modified lipid;

49 mol% ionizable amino lipid; 10.5 mol% neutral lipid; 38.5 mol% sterol; and 2.0 mol% PEG-modified lipid;

50 mol% ionizable amino lipid; 10 mol% neutral lipid; 38.5 mol% sterol; and 1.5 mol% PEG-modified lipid; or

51 mol% ionizable amino lipid; 9.5 mol% neutral lipid; 38.5 mol% sterol; and 1.0 mol% PEG-modified lipid.

In some embodiments, the ionizable amino lipid is heptadecan-9-yl 8 ((2 hydroxy ethyl) (6 oxo 6-(undecyloxy)hexyl)amino)octanoate (Compound 1). In some embodiments, the neutral lipid is 1,2 distearoyl sn glycero-3 phosphocholine (DSPC). In some embodiments, the sterol is cholesterol. In some embodiments, the PEG-modified lipid is 1- monomethoxypolyethyleneglycol-2,3-dimyristylglycerol with polyethylene glycol of average molecular weight 2000 (PEG2000 DMG).

In some embodiments, the age of the subject is 18 to 75 years. In some embodiments, the age of the subject is 18 to 49 years of age. In some embodiments, the age of the subject is 50 to 75 years of age.

In some embodiments, the HA and NA antigens are recommended by or selected according to standardized criteria used by World Health Organization’s Global Influenza Surveillance and Response System (GISRS). In some embodiments, the HA and NA antigen(s) are selected using a hemagglutinin inhibition (HAI) assay to identify circulating influenza viruses that are antigenically similar to influenza viruses from a previous season’s vaccine, optionally wherein influenza viruses are considered to be antigenically similar if their HAI titers differ by two dilutions or less.

In some embodiments, the first mRNA encodes an influenza A HA antigen of the Hl subtype, and the second mRNA encodes an influenza A HA antigen of the H3 subtype. In some embodiments, the third mRNA encodes an influenza B HA antigen of the B/Yamagata lineage, and the fourth mRNA encodes an influenza B HA antigen of the B/Victoria lineage. In some embodiments, the fifth mRNA encodes an influenza A NA antigen of the N 1 subtype, and the sixth mRNA encodes an influenza A NA antigen of the N2 subtype. In some embodiments, the seventh mRNA encodes an influenza B NA antigen of the B/Yamagata lineage, and the eighth mRNA encodes an influenza B NA antigen of the B/Victoria lineage.

In some embodiments, the mRNA comprises a 5’ untranslated region (UTR), a 3’ UTR, and a polyA tail. In some embodiments, the mRNA comprises a 5’ cap analog. In some embodiments, the mRNA comprises a chemical modification. In some embodiments, the chemical modification is 1 -methylpseudouridine.

In some embodiments, the dose is in an effective amount to produce an immune response against at least one of the influenza antigens in the composition. In some embodiments, the dose is in an effective amount to produce an immune response against 2, 3, 4, 5, 6, 7, or 8 of the influenza antigens in the composition.

The disclosure, in some aspects, provides a composition comprising a dose of mRNA and a lipid nanoparticle, wherein the mRNA comprises: (a) a first messenger ribonucleic acid (mRNA) encoding a hemagglutinin (HA) antigen of a first influenza A virus and a second mRNA encoding an HA antigen of a second influenza A virus, wherein the influenza A HA antigens are of different subtypes; and (b) a third mRNA encoding an HA antigen of a first influenza B virus and a fourth mRNA encoding an HA antigen of a second influenza B virus, wherein the influenza B HA antigens are of different lineages; and (c) a fifth mRNA encoding neuraminidase (NA) antigen of the first influenza A virus and a sixth mRNA encoding an NA antigen of the second influenza A virus, wherein the influenza A NA antigens are of different subtypes; and (d) a seventh mRNA encoding an NA antigen of the first influenza B virus and an eighth mRNA encoding an NA antigen of the second influenza B virus, wherein the influenza B NA antigens are of different lineages, wherein the mRNAs of (a), (b), (c), and (d) are in a lipid nanoparticle; and wherein the dose is at least 25 pg and less than 200 pg.

In some embodiments, the dose is 25 pg total mRNA. In some embodiments, the dose is 50 pg total mRNA. In some embodiments, the dose is 100 pg total mRNA. In some embodiments, the dose is 150 pg total mRNA.

In some embodiments, the ratio of the first: second:third:fourth:fifth: sixth: seventh:eighth mRNAs is a mass ratio. In some embodiments, the ratio of the first: second:third:fourth:fifth: sixth: seventh:eighth mRNAs is a molar ratio.

In some embodiments, the N 1 neuraminidase inhibition (NAI) titer geometric mean foldrise (GMFR) is 1.5-3 at 29 days post-administration. In some embodiments, the N2 NAI titer GMFR is 3.5-10 at 29 days post-administration. In some embodiments, the B/Victoria NA NAI titer GMFR is 3.5-8 at 29 days post-administration. In some embodiments, the B/Yamagata NA NAI titer GMFR is 3.75-8 at 29 days post-administration.

BRIEF DESCRIPTION OF THE DRAWINGS

FIGs. 1A-1B show the hemagglutinin inhibition (HAI) geometric mean titers (FIG. 1A) and geometric mean fold-rise (GMFR) titers (FIG. IB) at 29 days after administration of mRNA-1010 (1: 1 : 1: 1 HA1:HA2:HA3:HA4), or FLUBLOK®, a licensed enhanced seasonal influenza vaccine comparator.

FIGs. 2A-2D show the neuraminidase inhibition (NAI) titer GMFR values for N 1 (FIG. 2A), N2 (FIG. 2B), B/Victoria NA (FIG. 2C), and B/Yamagata NA (FIG. 2D) in subjects administered FLUBOK®, mRNA-1010, mRNA- 1020 (4 hemagglutinin [HA] and 4 neuraminidase [NA] at 1:1 HA:NA mass ratio), or mRNA- 1030 (4 HA and 4 NA at 3:1 HA:NA mass ratio), 29 days post-administration. FIGs. 3A-3D show the NAI titer GMFR values for N1 (FIG. 3 A), N2 (FIG. 3B), B/Victoria NA (FIG. 3C), and B/Yamagata NA (FIG. 3D) in subjects aged 18-49 at 29 days post administration of FLUBOK®, mRNA-1010, mRNA-1020, or mRNA-1030.

FIGs. 4A-4D show the NAI titer GMFR values for N1 (FIG. 4A), N2 (FIG. 4B), B/Victoria NA (FIG. 4C), and B/Yamagata NA (FIG. 4D) in subjects aged 50-75 at 29 days post administration of FLUBOK®, mRNA-1010, mRNA-1020, or mRNA-1030.

FIGs. 5A-5D show the day 29 NAI GMFRs by NA component dose for N 1 (FIG. 5A), N2 (FIG. 5B), B/Victoria NA (FIG. 5C), and B/Yamagata NA (FIG. 5D) in subjects at 29 days post administration of FLUBOK®, mRNA-1010, mRNA-1020, or mRNA-1030.

FIGs. 6A-6D show the day 29 NAI GMFRs by NA component dose for N 1 (FIG. 6A), N2 (FIG. 6B), B/Victoria NA (FIG. 6C), and B/Yamagata NA (FIG. 6D) in subjects aged 18-49 at 29 days post administration of FLUBOK®, mRNA-1010, mRNA-1020, or mRNA-1030.

FIGs. 7A-7D show the day 29 NAI GMFRs by NA component dose for N 1 (FIG. 7A), N2 (FIG. 7B), B/Victoria NA (FIG. 7C), and B/Yamagata NA (FIG. 7D) in subjects aged 50-75 at 29 days post administration of FLUBOK®, mRNA-1010, mRNA-1020, or mRNA-1030.

FIGs. 8A-8D show the day 29 NAI GMFRs by HA component dose for H1N1 (FIG. 8A), H3N2 (FIG. 8B), B/Victoria NA (FIG. 8C), and B/Yamagata NA (FIG. 8D) in subjects at 29 days post administration of FLUBOK®, mRNA-1010, mRNA-1020, or mRNA-1030. The shaded bar denotes the 95% confidence interval range of mRNA-1010 at the 50 pg dose.

FIGs. 9A-9D show the day 29 NAI GMFRs by HA component dose for H1N1 (FIG. 9 A), H3N2 (FIG. 9B), B/Victoria NA (FIG. 9C), and B/Yamagata NA (FIG. 9D) in subjects aged 18-49 at 29 days post administration of FLUBOK®, mRNA-1010, mRNA-1020, or mRNA-1030. The shaded bar denotes the 95% confidence interval range of mRNA-1010 at the 50 pg dose.

FIGs. 10A-10D show the day 29 NAI GMFRs by HA component dose for H1N1 (FIG. 10A), H3N2 (FIG. 10B), B/Victoria NA (FIG. 10C), and B/Yamagata NA (FIG. 10D) in subjects aged 50-75 at 29 days post administration of FLUBOK®, mRNA-1010, mRNA-1020, or mRNA-1030. The shaded bar denotes the 95% confidence interval range of mRNA-1010 at the 50 pg dose.

DETAILED DESCRIPTION

Influenza can cause mild to severe respiratory illness, which can result in hospitalization or death. Older adults and young children are at an increased risk of serious flu complications. The disease burden remains high, as the annual effectiveness of licensed vaccines varies from approximately 30-50%, and there have been 140,000-810,000 hospitalizations and 12, GOO- 61, 000 deaths annually in the US from the flu since 2010.

The most effective way to prevent the influenza virus infection is vaccination. Immunity from influenza virus vaccination, however, wanes over time, so annual vaccination is recommended to protect against the virus. Vaccination is most effective when circulating viruses are well-matched with viruses used to develop the vaccines. Due to the constant evolving nature of influenza viruses, the WHO Global Influenza Surveillance and Response System (GISRS) - a system of National Influenza Centers and WHO Collaborating Centers around the world - continuously monitors the influenza viruses circulating in humans and updates the recommended composition of influenza vaccines twice a year. Surveillance is the foundation underpinning all efforts to understand, prevent, and control influenza, and global influenza surveillance - initiated in 1952 - has long provided annual information used to select the precise virus strains to be used as the basis of annual vaccines. Such surveillance activities also provide the vital information needed to establish the degree of seasonality of influenza in various parts of the world, and to estimate its impact and burden.

In addition, global influenza surveillance forms the primary line of defense against the occurrence of influenza pandemics by identifying emerging influenza virus strains that pose a potential threat. The importance of this has been demonstrated on numerous occasions, for example in 1997, 2003, and 2004 when influenza A(H5N1) viruses were detected in humans in China, Hong Kong Special Administrative Region (Hong Kong SAR); in 1999 when A(H9N2) was identified in Hong Kong SAR; in 2003 when A(H7N7) was detected in the Netherlands; in 2004 when A(H5N1) was detected in southeast Asia (with subsequent spread to other regions); and in 2009 with the emergence of the declared pandemic of A(H1N1) influenza.

Traditionally, WHO provides a recommendation on the composition of the vaccine that targets the three (3) most representative virus types in circulation (two subtypes of influenza A viruses and one influenza B virus) (a trivalent vaccine). Starting with the 2013-2014 northern hemisphere influenza season, a fourth component was recommended, supporting quadrivalent vaccine development. Quadrivalent vaccines include a second influenza B virus in addition to the viruses in trivalent vaccines and are thought to provide wider protection against influenza B virus infections.

The present disclosure provides vaccine composition and vaccination methods that elicit potent neutralizing antibodies against influenza antigens. In some embodiments, a composition includes messenger RNA (mRNA) encoding at least four hemagglutinin (HA) and four neuraminidase (NA) antigens formulated in a lipid nanoparticle (LNP). In some embodiments, the ratio of HA antigens to NA antigens is 1 : 1. In some embodiments, the ratio of HA antigens to NA antigens is 3:1.

Without wishing to be bound by theory, it is thought that the addition of NA to the vaccines described herein may provide additional protection during well-matched years and “fallback” protection during HA-drift years. Like HA, NA is a major surface glycoprotein, but it has lower antigenic drift than HA. The lack of NA in currently licensed vaccines is largely due to the difficulty of producing correctly folded protein using legacy manufacturing processes. These limitations do not apply to mRNA-based approaches. Vaccination with recombinant NA protein has been shown to protect mice from homologous and heterologous lethal influenza virus challenges within the same subtype (Wohlbold et al., mBio. 2015 Mar 10;6(2):e02556). N1 NA delivered as mRNA has been shown to protect against highly lethal viral challenges (up to 500xLD50) and to elicit protective immunity even when administered in doses as low as 50 ng (Freyn et al., Mol Ther. 2020 Jul 8;28(7): 1569- 1584). In guinea pigs, intranasal vaccination with recombinant NA has been shown to reduce transmission of influenza B viruses (McMahon et al., mBio 2019 May 21;10(3):e00560-19).

NA-based protection in humans has been investigated in human challenge studies in the 1970s either by challenge with a strain that expressed an HA to which the participants did not have measurable antibodies (Murphy et al., N Engl J Med. 1972 Jun 22;286(25): 1329-32), or by challenge after vaccination with a vaccine that was matched for the NA, but mismatched to the HA of the challenge strain (Couch et al., J Infect Dis. 1974 Apr;129(4):411-20). Both studies showed a reduction in illness associated with NA immunity. A more recent set of challenge studies performed at the NIH showed statistically significant correlation of NA inhibition titers (NAI) and protection (Memoli et al., mBio. 2016 Apr 19;7(2):e00417-16).

Observational studies have explored the contribution of NA-based immunity to protection. It has been found that anti-NA antibodies in serum and nasal secretions independently correlated with reducing H1N1 infections and serum NAI correlated with reduced illness in infected individuals (Couch et al., J Infect Dis. 2013 Mar 15;207(6):974-81) and that NAI independently correlated with protection from infection and further quantified that a 2-fold increase in NAI resulted in a 29% (95%CI: 16-41) increase in effectiveness (Monto et al., J Infect Dis. 2015 Oct 15;212(8): 1191-9).

Seasonal Influenza Virus

Seasonal influenza is an acute respiratory infection caused by influenza viruses that circulate in all parts of the world. Influenza viruses belong to the Orthomyxoviridae family and are divided into types A, B, and C. Influenza types A and B are responsible for epidemics of respiratory illness that are often associated with increased rates of hospitalization and death. Influenza type C is a milder infection that does not cause epidemics, and does not therefore have the severe public health impact of influenza types A and B .

All influenza viruses are negatives-strand RNA viruses with a segmented genome. Influenza type A and B viruses have 8 genes that code for 10 proteins, including the surface proteins hemagglutinin (HA) and neuraminidase (NA). In the case of influenza type A viruses, further subdivision can be made into different subtypes according to differences in these two surface proteins. To date, 16 HA subtypes and 9 NA subtypes have been identified. However, during the 20th century, the only influenza A subtypes that circulated extensively in humans were A(H1N1); A(H1N2); A(H2N2); and A(H3N2). All known subtypes of influenza type A viruses have been isolated from birds and can affect a range of mammal species. As with humans, the number of influenza A subtypes that have been isolated from other mammalian species is limited. Almost all influenza A pandemics have been caused by descendants of the 1918 virus, including “drifted” H1N1 viruses and reassorted H2N2 and H3N2 viruses. Influenza A comprises HA and NA proteins on the surface of its viral envelope. HA allows the virus's recognizing and binding to target cells, and also to infect the cell with viral RNA. NA is critical for the subsequent release of the daughter virus particles created within the infected cell so they can spread to other cells.

Influenza type B viruses almost exclusively infect humans. Influenza B viruses are not classified into subtypes but can be broken down into lineages. Currently circulating influenza type B viruses belong to either B/Yamagata (B/Yamagata/16/88-like) or B/Victoria (B/Victoria/2/87-like) lineage. Influenza virus B mutates at a rate 2 to 3 times slower than type A; however, it significantly impacts children and young adults annually. The influenza B virus capsid is enveloped while its virion consists of an envelope, a matrix protein, a nucleoprotein complex, a nucleocapsid, and a polymerase complex. It can be spherical or filamentous. Its 500 or so surface projections are made of HA and NA. The influenza B virus genome is 14,548 nucleotides long and consists of eight segments of linear negative-sense, single- stranded RNA. The multipartite genome is encapsidated, each segment in a separate nucleocapsid, and the nucleocapsids are surrounded by one envelope.

Virological Surveillance of Influenza

All national and international influenza surveillance systems - including those for monitoring clinical disease - depend fundamentally upon virological surveillance. Within countries, the National Information Center serves as the focal point for coordinating influenza virological surveillance. Some primarily collect specimens directly while others primarily receive virus isolates from other influenza laboratories. The data is then compiled and sent to international surveillance bodies, such as the WHO, for further analysis, as described in more detail below. The WHO then makes two annual recommendations regarding the influenza viruses to be included in the seasonal flu vaccine. The determination of which influenza viruses are included requires antigenic characterization and genetic characterization of the circulating viruses.

Antigenic Characterization

Hemagglutination Inhibition Assay

The hemagglutination inhibition (HAI) test is a classical laboratory procedure for the classification or subtyping of hemagglutinating viruses and further determining the antigenic characteristics of influenza viral isolates provided that the reference antisera used contain antibodies to currently circulating viruses (see, e.g., Pedersen JC Methods Mol Biol. 2014;1161:11-25). The antisera used are based on antigen preparations derived from either the wildtype strain or a high-growth reassortant made using the wild-type strain or an antigenically equivalent strain.

To perform the assay, a serial dilution of virus is prepared across the rows in a U or V- bottom shaped 96-well microtiter plate. As an example, the most concentrated sample in the first well may be diluted to be l/5x of the stock, and subsequent wells may be two-fold dilutions (1/10, 1/20, 1/40, etc.). The final well serves as a negative control with no virus. Each row of the plate typically has a different virus and the same pattern of dilutions. After serial dilutions, a standardized concentration of red blood cells (RBCs) is added to each well and mixed gently. The plate is incubated at room temperature. Following the incubation period, the assay can be analyzed to distinguish between agglutinated and non-agglutinated wells. The relative concentration, or titer, of the virus sample is based on the well with the last agglutinated appearance, immediately before a pellet is observed.

Serological methods such as the HAI test are essential for many epidemiological and immunological studies and for evaluation of the antibody response following vaccination. Serological methods are also very useful in situations where identification of the virus is not feasible (e.g. after viral shedding has stopped). The HAI test is used to identify circulating influenza viruses that are antigenically similar to influenza viruses from a previous season’s vaccine. As used herein “antigenically similar” refers to a virus having an HAI titer that differs by two dilutions or less.

In some embodiments, the HAI assay is used to measure the effectiveness of a candidate vaccine, such as those provided herein. In some embodiments, the mRNA vaccines have an HAI titer that is 2-, 3-, 4-, 5-, 6-, 7-, 8-, 9-, or 10-fold increased relative to a control (e.g., HAI titer from a subject administered a traditional seasonal flu vaccine, such as FLUB LOK®).

In some embodiments, an HA ELISA assay is performed to examine the HA antibody titers resulting from administration of a candidate vaccine (e.g., IgG antibody titers) (see, e.g., Examples 1, 2, 4, 7, and 8). In some embodiments, the mRNA vaccines have an HA IgG antibody titer that is 1-log, 2-log, 3-log, 4-log, 5-log, 6-log, 7-log, 8-log, 9-log, or 10-log increased relative to a control (e.g., PBS). In some embodiments, the control comprises the HA- reactive IgG antibody titer in a subject prior to administration of the composition (e.g., vaccine). In some embodiments, a candidate vaccine has an HA IgG antibody titer that is 1-, 2-, 3-, 4-, 5-, 6-, 7-, 8-, 9-, or 10-fold increased relative to a control.

Neuraminidase Inhibition Assay

The neuraminidase-inhibition (NAI) assay is a laboratory procedure for the identification of the neuraminidase (NA) glycoprotein subtype in influenza viruses or the NA subtype specificity of antibodies to influenza virus (see, e.g., Pedersen JC Methods Mol Biol. 2014;1161:27-36). A serological procedure for subtyping the NA glycoprotein is critical for the identification and classification of avian influenza (Al) viruses.

There are two basic forms of assay for influenza virus NA based on the use of different substrate molecules, a long-standing assay based on the use of a large substrate such as fetuin (e.g., the enzyme-linked lectin assay (ELLA)) and newer assays which utilize small substrate molecules. The fetuin-based method is used to determine the potency of the viral NA and thus the standardized NA dose for use in the NA inhibition (NAI) assay. Once determined, the standardized dose is added to serial dilutions of test antisera, negative control serum and reference anti-NA serum. Any inhibitory effect of the sera on NA activity can then be determined and the NAI titer calculated. The small substrate based method may be a fluorescence assay that uses the substrate 2-(4-methylumbelliferyl)-a-D-N-acetylneuraminic acid (MUNANA). The substrate is added to serially diluted test antisera and cleavage of the MUNANA substrate by NA releases the fluorescent product methylumbelliferone. The inhibitory effect of the sera on the influenza virus NA is determined based on the concentration of the sera that is required to reduce 50% of the NA activity, given as an IC50 value. The small substrate based method may, alternatively, be a chemiluminescence-based (CL) assay that uses a sialic acid 1,2-dioxetane derivative (NA-Star) substrate or a modified NA-XTD substrate. The CL assays provide an extended-glow chemiluminescent light signal and neuraminidase inhibitor IC50 values are achieved over a range of virus dilutions. In some embodiments, the mRNA vaccines have an NAI titer that is 2-, 3-, 4-, 5-, 6-, 7-, 8-, 9-, or 10-fold increased relative to a control. The control, in some embodiments, is a traditional seasonal influenza vaccine that only comprises HA antigens (e.g., does not comprise NA antigens). In some embodiments, the control is a NAI titer value for a wild-type NA. In some embodiments, the mRNA vaccine has an NAI titer that is at least 2-fold higher than a control value. In some embodiments, the NAI titer is measured 29 days after administration of the mRNA vaccine. In some embodiments, the NAI titer measured 29 days after administration of the mRNA vaccine is 2-, 3-, 4-, 5-, 6-, 7-, 8-, 9-, or 10-fold increased relative to a control (e.g., a traditional seasonal influenza vaccine that only comprises HA antigens). In some embodiments, the NAI titer measured 29 days after administration of the mRNA vaccine is 1.5- 20-fold, 2-20-fold, 2.5-20-fold, 3-20-fold, 3.5-20-fold, 4-20-fold, 4.5-20-fold, 5-20-fold, 5.5-20- fold, 6-20-fold, 6.5-20-fold, 7-20-fold, 7.5-20-fold, 8-20-fold, 9-20-fold 10-20-fold, 12-20-fold, 15-20-fold, 18-20-fold, 2-20-fold, 2.5-20-fold, 3-20-fold, 3.5-20-fold, 4-20-fold, 4.5-20-fold, 5- 20-fold, 5.5-20-fold, 1.5-15-fold, 2-15-fold, 2.5-15-fold, 3-15-fold, 3.5-15-fold, 4-15-fold, 4.5- 15-fold, 5-15-fold, 5.5-15-fold, 6-15-fold, 6.5-15-fold, 7-15-fold, 7.5-15-fold, 8-15-fold, 9-15- fold 10-15-fold, 12-15-fold, 1.5-10-fold, 2-10-fold, 2.5-10-fold, 3-10-fold, 3.5-10-fold, 4-10- fold, 4.5-10-fold, 5-10-fold, 5.5-10-fold, 6-10-fold, 6.5-10-fold, 7-10-fold, 7.5-10-fold, 8-10- fold, 9-10-fold, 1.5-8-fold, 2-8-fold, 2.5-8-fold, 3-8-fold, 3.5-8-fold, 4-8-fold, 4.5-8-fold, 5-8- fold, 5.5-8-fold, 6-8-fold, 6.5-8-fold, 7-8-fold, 7.5-8-fold, 1.5-6-fold, 2-6-fold, 2.5-6-fold, 3-6- fold, 3.5-6-fold, 4-6-fold, 4.5-6-fold, 5-6-fold, 5.5-6-fold, 1.5-5-fold, 2-5-fold, 2.5-5-fold, 3-5- fold, 3.5-5-fold, 4-5-fold, 4.5-5-fold, 1.5-4-fold, 2-4-fold, 2.5-4-fold, 3-4-fold, 3.5-4-fold, 1.5-3- fold, 2-3-fold, or 2.5-3-fold increased relative to a control (e.g., a traditional seasonal influenza vaccine that only comprises HA antigens). In some embodiments, the NAI titer measured 29 days after administration of the mRNA vaccine is 1.5-3-fold increased relative to a control, 3.5- 10-fold increased relative to a control, 3.5-8-fold increased relative to a control, or 3.75-8-fold increased relative to a control.

In some embodiments, the vaccine’s NAI value is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or at least 99% of a control (e.g., the NAI value of a wild-type NA).

In some embodiments, an NA ELISA assay is performed to examine the NA antibody titers resulting from administration of a candidate vaccine (e.g., IgG antibody titers) (see, e.g., Examples 1, 2, 4, 7, and 8). In some embodiments, the mRNA vaccines have an NA IgG antibody titer that is 1-log, 2-log, 3-log, 4-log, 5-log, 6-log, 7-log, 8-log, 9-log, or 10-log increased relative to a control (e.g., PBS). In some embodiments, the control comprises the NA- reactive IgG antibody titer in a subject prior to administration of the composition (e.g., vaccine). In some embodiments, a candidate vaccine has an NA IgG antibody titer that is 1-, 2-, 3-, 4-, 5-, 6-, 7-, 8-, 9-, or 10-fold increased relative to a control.

Vaccine Compositions

Provided herein are vaccine compositions for inducing a neutralizing antibody response to influenza antigens in a subject. The compositions provided herein can be used as therapeutically or prophy tactically.

In some embodiments, a composition containing a messenger RNA as described herein can be administered to a subject (e.g., a mammalian subject, such as a human subject), and the mRNA is translated in vivo to produce an antigenic polypeptide (antigen), such as an influenza HA or NA antigen.

In some embodiments, a vaccine composition comprises an approximately 25 pg to 150 pg dose of mRNA encoding influenza HA and NA proteins (e.g., four HA proteins and four NA proteins). In some embodiments, a vaccine composition comprises an approximately 25 pg dose of mRNA encoding four unique HA proteins (4.688 pg/HA protein) and four unique NA proteins (1.563 pg/NA protein). In some embodiments, a vaccine composition comprises an approximately 50 pg dose of mRNA encoding four unique HA proteins (6.25 pg/HA protein) and four unique NA proteins (6.25 pg/NA protein). In some embodiments, a vaccine composition comprises an approximately 50 pg dose of mRNA encoding four unique HA proteins (9.375 pg/HA protein) and four unique NA proteins (3.125 pg/NA protein). In some embodiments, a vaccine composition comprises an approximately 100 pg dose of mRNA encoding four unique HA proteins (12.5 pg/HA protein) and four unique NA proteins (12.5 pg/NA protein). In some embodiments, a vaccine composition comprises an approximately 100 pg dose of mRNA encoding four unique HA proteins (18.75 pg/HA protein) and four unique NA proteins (6.25 pg/NA protein). In some embodiments, a vaccine composition comprises an approximately 150 pg dose of mRNA encoding four unique HA proteins (18.75 pg/HA protein) and four unique NA proteins (18.75 pg/NA protein). A composition may further comprise a buffer, for example a Tris buffer. For example, a composition may comprise 10 mM - 30 mM, 10 mM - 20 mM, or 20 mM - 30 mM Tris buffer. In some embodiments, a composition comprises 10, 15, 20, 25, or 30 mM Tris buffer. In some embodiments, a composition comprises 20 mM Tris buffer.

In some embodiments, mRNA of a vaccine composition is formulated at a concentration of 0.1 - 1 mg/mL. In some embodiments, mRNA of a vaccine composition is formulated at a concentration of 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1 mg/mL. In some embodiments, mRNA of a vaccine composition is formulated at a concentration of 0.5 mg/mL.

In some embodiments, a composition comprises sucrose. For example, a composition may comprise 75 mg/mL - 95 mg/mL, 75 mg/mL - 85 mg/mL, or 85 mg/mL - 95 mg/mL sucrose. In some embodiments, a composition comprises 75, 80, 85, 86, 87, 88, 89, 90, or 95 mg/mL sucrose. In some embodiments, a composition comprises 87 mg/mL sucrose.

In some embodiments, a composition comprises sodium acetate. For example, a composition may comprise 5 mM - 15 mM, 5 mM - 10 mM, or 10 mM - 15 mM sodium acetate. In some embodiments, a composition comprises 5, 10, 11, 12, 13, 14, or 15 mM sodium acetate. In some embodiments, a composition comprises 10, 10.1, 10.2, 10.3, 10.4, 10.5, 10.6, 10.7, 10.8, 10.9, or 11 mM sodium acetate. In some embodiments, a composition comprises 10.7 mM sodium acetate.

A composition may have a pH value of 6-8. In some embodiments, a composition has a pH value of 6, 6.5, 7, 7.5, or 8. In some embodiments, a composition has a pH value of 7.5.

A composition, in some embodiments, is formulated to include mRNA at a concentration of 0.1 mg/mL - 1 mg/mL. In some embodiments, a composition comprises 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1 mg/mL mRNA. In some embodiments, a composition comprises 0.5 mg/mL mRNA.

In some embodiments, the composition further comprises a mixture of lipids. The mixture of lipids typically forms a lipid nanoparticle. The mRNA described herein, in some embodiments, is formulated with a lipid nanoparticle (e.g., for administration to a subject).

In some embodiments, the lipid mixture, and thus the lipid nanoparticle, comprises: an ionizable cationic lipid; a neutral lipid; a sterol; and a PEG-modified lipid. For example, the lipid mixture/lipid nanoparticle may comprise: 20-60 mol% ionizable cationic lipid; 5-25 mol% neutral lipid; 25-55 mol% sterol; and 0.5-15 mol% PEG-modified lipid. In some embodiments, the lipid nanoparticle comprises: 20-60 mol% ionizable cationic lipid; 5-25 mol% neutral lipid; 25-55 mol% sterol; and 0.5-15 mol% PEG-modified lipid. In some embodiments, the lipid nanoparticle comprises: 40-55 mol% ionizable cationic lipid; 5-15 mol% neutral lipid; 35-45 mol% sterol; and 1-5 mol% PEG-modified lipid. For example, the lipid nanoparticle may comprise: (a) 47 mol% ionizable cationic lipid; 11.5 mol% neutral lipid; 38.5 mol% sterol; and 3.0 mol% PEG-modified lipid; (b) 48 mol% ionizable cationic lipid; 11 mol% neutral lipid; 38.5 mol% sterol; and 2.5 mol% PEG-modified lipid; (c) 49 mol% ionizable cationic lipid; 10.5 mol% neutral lipid; 38.5 mol% sterol; and 2.0 mol% PEG-modified lipid; (d) 50 mol% ionizable cationic lipid; 10 mol% neutral lipid; 38.5 mol% sterol; and 1.5 mol% PEG-modified lipid; or (e) 51 mol% ionizable cationic lipid; 9.5 mol% neutral lipid; 38.5 mol% sterol; and 1.0 mol% PEG-modified lipid.

In some embodiments, the lipid mixture, and thus the lipid nanoparticle, comprises 20-55 mol%, 20-50 mol%, 20-45 mol%, 20-40 mol%, 25-60 mol%, 25-55 mol%, 25-50 mol%, 25-45 mol%, 25-40 mol%, 30-60 mol%, 30-55 mol%, 30-50 mol%, 30-45 mol%, 30-40 mol%, 35-60 mol%, 35-55 mol%, 35-50 mol%, 35-45 mol%, 35-40 mol%, 40-60 mol%, 40-55 mol%, 40-50 mol%, 40-45 mol%, 50-60 mol%, 50-55 mol%, or 55-60 mol% ionizable cationic lipid.

In some embodiments, the lipid mixture, and thus the lipid nanoparticle, comprises 5-20 mol%, 5-15 mol%, 5-10 mol%, 10-25 mol%, 10-20 mol%, 10-15 mol%, 15-25 mol%, 15-20 mol%, or 20-25 mol% neutral lipid.

In some embodiments, the lipid mixture, and thus the lipid nanoparticle, comprises 25-50 mol%, 25-45 mol%, 25-40 mol%, 25-35 mol%, 25-30 mol%, 30-55 mol%, 30-50 mol%, 30-45 mol%, 30-40 mol%, 30-35 mol%, 35-55 mol%, 35-50 mol%, 35-45 mol%, 35-40 mol%, 40-55 mol%, 40-50 mol%, 40-45 mol%, 45-55 mol%, 45-50 mol%, or 50-55 mol% sterol.

In some embodiments, the lipid mixture, and thus the lipid nanoparticle, comprises 0.5- 10 mol%, 0.5-5 mol%, 0.5-1 mol%, 1-15%, 1-10 mol%, 1-5 mol%, 1.5-15%, 1.5-10 mol%, 1.5- 5 mol%, 2-15%, 2-10 mol%, 2-5 mol%, 2.5-15%, 2.5-10 mol%, 2.5-5 mol%, 3-15%, 3-10 mol%, or 3-5 mol%, PEG-modified lipid.

In some embodiments, the lipid mixture comprises: 50 mol% ionizable cationic lipid; 10 mol% neutral lipid; 38.5 mol% sterol; and 1.5 mol% PEG-modified lipid.

In some embodiments, the ionizable cationic lipid is heptadecan-9-yl 8 ((2 hydroxy ethyl) (6 oxo 6-(undecyloxy)hexyl)amino)octanoate (Compound 1). In some embodiments, the neutral lipid is 1,2 distearoyl sn glycero-3 phosphocholine (DSPC). In some embodiments, the sterol is cholesterol. In some embodiments, the PEG-modified lipid is 1- monomethoxypolyethyleneglycol-2,3-dimyristylglycerol with polyethylene glycol of average molecular weight 2000 (PEG2000 DMG).

A composition may further include a pharmaceutically-acceptable excipient, inert or active. A pharmaceutically acceptable excipient, after administered to a subject, does not cause undesirable physiological effects. The excipient in the pharmaceutical composition must be “acceptable” also in the sense that it is compatible with mRNA and can be capable of stabilizing it. One or more excipients (e.g., solubilizing agents) can be utilized as pharmaceutical carriers for delivery of the mRNA. Examples of a pharmaceutically acceptable excipients include, but are not limited to, biocompatible vehicles (e.g., LNPs), carriers, adjuvants, additives, and diluents to achieve a composition usable as a dosage form. Examples of other excipients include colloidal silicon oxide, magnesium stearate, cellulose, and sodium lauryl sulfate. Additional suitable pharmaceutical excipients, as well as pharmaceutical necessities for their use, are described in Remington's Pharmaceutical Sciences.

In some embodiments, an mRNA is formulated using one or more excipients to: (1) increase stability; (2) increase cell transfection; (3) permit the sustained or delayed release (e.g., from a depot formulation); (4) alter the biodistribution (e.g., target to specific tissues or cell types); (5) increase the translation of encoded protein in vivo; and/or (6) alter the release profile of encoded protein (antigen) in vivo. In addition to traditional excipients such as any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, excipients can include, without limitation, lipidoids, liposomes, lipid nanoparticles, polymers, lipoplexes, core-shell nanoparticles, peptides, proteins, cells transfected with the RNA (e.g., for transplantation into a subject), hyaluronidase, nanoparticle mimics and combinations thereof.

In some embodiments, a composition comprising mRNA does not include an adjuvant (they are adjuvant free).

Vaccine compositions may be sterile, pyrogen-free or both sterile and pyrogen-free. General considerations in the formulation and/or manufacture of pharmaceutical agents, such as vaccine compositions, may be found, for example, in Remington: The Science and Practice of Pharmacy 21st ed., Lippincott Williams & Wilkins, 2005 (incorporated herein by reference in its entirety).

Formulations of the vaccine compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of bringing the mRNA into association with an excipient (e.g., a mixture of lipids and/or a lipid nanoparticle), and then, if necessary and/or desirable, dividing, shaping and/or packaging the product into a desired single- or multi-dose unit.

Relative amounts of the mRNA, the pharmaceutically-acceptable excipient, and/or any additional ingredients in a composition in accordance with the disclosure may vary, depending upon the identity, size, and/or condition of the subject treated and further depending upon the route by which the composition is to be administered.

Seasonal Influenza Virus

Genetic Characterization

Molecular Identification of Influenza Isolates

The direct molecular identification of influenza isolates is a rapid and powerful technique. The reverse-transcription polymerase chain reaction (RT-PCR) allows template viral RNA to be reverse transcribed producing complementary DNA (cDNA) which can then be amplified and detected. This method can be used directly on clinical samples and the rapid nature of the results can greatly facilitate investigation of outbreaks of respiratory illness (e.g., influenza). For example, genetic analysis of influenza virus genes (especially the HA and NA genes) can be used to identify an unknown influenza virus when the antigenic characteristics cannot be defined. Genetic analyses also can be used to monitor the evolution of influenza viruses and to determine the degree of relatedness between viruses from different geographical areas and those collected at different times of the year.

The hallmark of human influenza viruses is their ability to undergo antigenic change, which occurs in the following two ways: antigenic drift or antigenic shift.

Antigenic Drift

Antigenic drift is a process of gradual and relatively continuous change in the viral HA and NA proteins. It results from the accumulation of point mutations in the HA and NA genes during viral replication. Both influenza type A and B viruses undergo antigenic drift, leading to new virus strains. The emergence of these new strains necessitates the frequent updating of influenza vaccine virus strains. Because antibodies to previous influenza infections may not provide full protection against the new strains resulting from antigenic drift, subjects can have many influenza infections over a lifetime.

Antigenic Shift

In addition to antigenic drift, influenza type A viruses can also undergo a more dramatic and abrupt type of change called antigenic shift. By definition, a shift has occurred when an influenza type A virus emerges among humans bearing either a HA protein or a combination of HA and NA proteins that have not been circulating among humans in recent years. There are at least three possible mechanisms by which antigenic shift can occur: (a) a virus bearing new HA and NA proteins can arise through the genetic reassortment of non-human and human influenza viruses; (b) an influenza virus from other animals (e.g. birds or pigs) can infect a human directly without undergoing genetic reassortment; or (c) a non-human virus may be passed from one type of animal (e.g. birds) through an intermediate animal host (such as a pig) to humans.

Whereas antigenic drift occurs continuously, antigenic shift occurs infrequently and unpredictably. Since antigenic shift results in the emergence of a new influenza virus, a large proportion (or even all) of the world’s population will have no antibodies against it. If the new strain is capable of causing illness in humans and sustained chains of human-to-human transmission leading to community-wide outbreaks then such a virus has the potential to spread worldwide, causing a pandemic.

Antigens

Antigens, as used herein, are proteins capable of inducing an immune response (e.g., causing an immune system to produce antibodies against the antigens). The vaccines of the present disclosure provide a unique advantage over traditional protein-based vaccination approaches in which protein antigens are purified or produced in vitro, e.g., recombinant protein production technologies. The vaccines of the present disclosure feature mRNA encoding the desired antigens, which when introduced into the body, i.e., administered to a mammalian subject (for example a human) in vivo, cause the cells of the body to express the desired antigens. In order to facilitate delivery of the mRNAs of the present disclosure to the cells of the body, the mRNAs are encapsulated in lipid nanoparticles (LNPs). Upon delivery and uptake by cells of the body, the mRNAs are translated in the cytosol and protein antigens are generated by the host cell machinery. The protein antigens are presented and elicit an adaptive humoral and cellular immune response. Neutralizing antibodies are directed against the expressed protein antigens and hence the protein antigens are considered relevant target antigens for vaccine development. Herein, use of the term “antigen” encompasses immunogenic proteins and immunogenic fragments (an immunogenic fragment that induces (or is capable of inducing) an immune response to a (at least one) influenza virus), unless otherwise stated. It should be understood that the term “protein” encompasses peptides and the term “antigen” encompasses antigenic fragments. Other molecules may be antigenic such as bacterial polysaccharides or combinations of protein and polysaccharide structures, but for the viral vaccines included herein, viral proteins, fragments of viral proteins and designed and or mutated proteins derived from the influenza virus are the antigens provided herein.

In some embodiments, the influenza antigen is hemagglutinin (HA) or neuraminidase (NA). Exemplary HA and NA antigens are known in the art and are publicly available, for example, NCBI’s Influenza Virus Resource (ncbi.nlm.nih.gov/genomes/FLU/Database/nph- select.cgi?go=database), Influenza Research Database fludb.org/brc/home. spg?decorator=influenza), and GISRS (gisaid.org/references/human- influenza- vaccine-composition/). In some embodiments, the vaccine comprises mRNA encoding at least one of the following antigens: A/Califomia/7/2009 (HlNl)pdmO9-like virus, A/Switzerland/9715293/2013 (H3N2)-like virus, B/Phuket/3073/2013-like virus, B/Brisbane/60/2008-like virus, A/Hong Kong/4801/2014 (H3N2)-like virus, A/Michigan/45/2015 (HlNl)pdmO9-like virus, A/Singapore/INFIMH- 16-0019/2016 (H3N2)- like virus, B/Colorado/06/2017-like virus (B/Victoria/2/87 lineage), A/Switzerland/8060/2017 (H3N2)-like virus, A/Brisbane/02/2018 (HlNl)pdmO9-like virus, A/Kansas/ 14/2017 (H3N2)- like virus, A/South Australia/34/2019 (H3N2)-like virus, B/Washington/02/2019-like (B/Victoria lineage) virus, A/Guangdong-Maonan/SWL1536/2019 (HlNl)pdmO9-like virus, A/Hong Kong/2671/2019 (H3N2)-like virus, A/Hawaii/70/2019 (HlNl)pdmO9-like virus, A/Victoria/2570/2019 (HlNl)pdmO9-like virus, A/Wisconsin/588/2019 (HlNl)pdmO9-like virus, and A/Cambodia/e0826360/2020 (H3N2)-like virus.

In some embodiments, the influenza antigen is a fragment of, a derivative of, or a modified HA or NA. For example, in some embodiments, the NA is a wild-type NA (e.g., is enzymatically active). In some embodiments, the NA is a modified NA, such as an enzymatically inactive NA. As used herein, “enzymatically inactive NA” refers to a NA that has been mutated such that it possesses no or minimal catalytic activity (see, e.g., Richard et al., J Clin Virol., 2008, 41(1): 20-24; Yen et al., J Virol., 2006, 80(17): 8787-8795). For example, in some embodiments, the enzymatically inactive NA possesses less than 30%, 25%, 20%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or 0% of the catalytic activity of the wild-type NA (e.g., in an enzymatic activity assay, as is known in the art). In some embodiments, at least one of Argl l8, Aspl51, Argl52, Arg224, Glu276, Arg292, Arg371 and Tyr406 is mutated relative to an influenza A or B neuraminidase wild type sequence. In some embodiments, 1, 2, 3, 4, 5, 6, 7, or all 8 amino acids are mutated. In some embodiments, at least one of Glul l9, Argl56, Trpl78, Serl79, Aspl98, Ile222, Glu227, His274, Glu277, Asn294, and Glu425 is mutated relative to an influenza A or B neuraminidase wild type sequence. In some embodiments, the mutation is R118K, D151G, or E227D. In some embodiments, the mutation is a deletion of the cytoplasmic tail (dcytT). In some embodiments, the mutation is a deletion of amino acids of the stalk region. In some embodiments, the mutation is a deletion of 15 amino acids of the stalk region (stalk_dl5). In some embodiments, the mutation is a deletion of 30 amino acids of the stalk region (stalk_d30). In some embodiments, the mutation is an insertion of amino acids of the stalk region. In some embodiments, the mutation is an insertion of 15 amino acids in the stalk region (stalk_insl5). In some embodiments, the mutant NA antigens are combined with HA antigens. In some embodiments, the enzymatically inactive NA comprises an influenza A NA antigen of the N 1 subtype. In some embodiments, the enzymatically inactive NA comprises an influenza A NA antigen of the N2 subtype. In some embodiments, the enzymatically inactive NA comprises an influenza A NA antigen of the N8 subtype. In some embodiments, the enzymatically inactive NA comprises an influenza B NA antigen of the B/Yamagata lineage. In some embodiments, the enzymatically inactive NA comprises an influenza B NA antigen of the B/Victoria lineage.

In some embodiments, the HA is a wild-type HA. In some embodiments, the HA is a modified HA. In some embodiments, the HA comprises at least one mutation. In some embodiments, at least one amino acid is mutated relative to an influenza A or B hemagglutination wild type sequence. In some embodiments, the mutation is T2191, H371Y, I494M, H504P, M362L, HAO, APB, TB, or VASP. In some embodiments, more than one amino acid is mutated. In some embodiments, the mutation is selected from the group consisting of creation of a disulfide in the HA stem to link neighboring protomers, deletion of a cleavage site, and replacement of polybasic cleavage site (HPAI) by an LPAI sequence. In some embodiments, the mutation is a disulfide in the HA stem to link neighboring protomers. In some embodiments, the mutation is the deletion of a cleavage site. In some embodiments, the mutation is replacement of polybasic cleavage site (HPAI) by an LPAI sequence.

In some embodiments, the mRNA vaccines of the present disclosure may comprise a combination of mRNAs encoding HA, or modified versions thereof, optionally in combination with mRNAs encoding NA antigens, or fragments, derivatives, or modified versions thereof. In some embodiments, the mRNA vaccine may comprise a combination of mRNAs encoding HA, or modified versions thereof, and mRNAs encoding NA antigens, or fragments, derivatives, or modified versions thereof. In some embodiments, the vaccine comprises mRNAs encoding 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 HA antigens and/or mRNAs encoding 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 NA antigens, or any combination thereof (e.g., 4 HA antigens, or 4 HA antigens and 4 NA antigens).

In some embodiments, the vaccine comprises mRNA encoding one HA antigen and mRNA encoding one NA antigen. In some embodiments, the vaccine comprises mRNAs encoding two HA antigens and mRNAs encoding two NA antigens. In some embodiments, the vaccine comprises mRNAs encoding three HA antigens and mRNAs encoding three NA antigens. In some embodiments, the vaccine comprises mRNAs encoding four HA antigens and mRNAs encoding four NA antigens. In some embodiments, the vaccine comprises mRNAs encoding five HA antigens and mRNAs encoding five NA antigens. In some embodiments, the vaccine comprises mRNAs encoding six HA antigens and mRNAs encoding six NA antigens. In some embodiments, the mRNAs encoding the antigens are present in the formulation in an equal amount (e.g., a 1:1 weight/weight ratio or a 1:1 molar ratio), for example, a 1:1 ratio of mRNAs encoding distinct HA and NA antigens. As used herein, a “weight/weight ratio” or wt/wt ratio or wt:wt ratio or “mass ratio” refers to the ratio between the weights (masses) of the different components. A “molar ratio” refers to the ratio between different components (e.g., the number of mRNA encoding each antigen). In some embodiments, the mRNA components of an influenza immunogenic composition (e.g., mRNA vaccine) are present in equal masses. In some embodiments, the mRNA components of an influenza immunogenic composition (e.g., mRNA vaccine) are not present in equal masses. In some embodiments, the mRNA components of an influenza immunogenic composition (e.g., mRNA vaccine) are present in equal molar ratios. In some embodiments, the mRNA components of an influenza immunogenic composition (e.g., mRNA vaccine) are not present in equal molar ratios.

In an exemplary vaccine comprising mRNAs encoding four different HA antigens and four different NA antigens, mRNAs at a “1:1 ratio” would include the mRNAs encoding the different HA antigens in a ratio of 1:1: 1:1 of the first, second, third and fourth mRNA, and would include mRNAs encoding the different NA antigens in a ratio of 1:1: 1:1 of the first, second, third and fourth mRNA.

In some embodiments, the ratio of mRNAs encoding the different HA antigens are equivalent to each other (e.g., 1:1: 1:1) and the ratio of mRNAs encoding the different NA antigens are equivalent to each other (e.g., 1:1: 1: 1); however, the ratio of the mRNAs encoding the HA antigens to mRNAs encoding the NA antigens is not 1:1. In an exemplary vaccine comprising mRNAs encoding four different HA antigens and four different NA antigens, mRNAs at a “3:1 ratio” would include the mRNAs encoding the different HA antigens in a ratio of 3:3:3:3 of the first, second, third and fourth mRNA, and would include mRNAs encoding the different NA antigens in a ratio of 1:1: 1:1 of the first, second, third and fourth mRNA In some embodiments, the HA:NA ratio is 1:1, 1:2, 1:3, 1:4, 2:1, 3:1, or 4:1. In each embodiment or aspect of the invention, it is understood that the featured vaccines include the mRNAs encapsulated within LNPs. While it is possible to encapsulate each unique mRNA in its own LNP, the mRNA vaccine technology enjoys the significant technological advantage of being able to encapsulate several mRNAs in a single LNP product. In some embodiments, a single LNP comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 different mRNA polynucleotides. In other embodiments, the mRNAs are each formulated in unique LNPs (e.g., a composition comprises 8 LNPs, each LNP comprising 1 of 8 different mRNA polynucleotides).

In other aspects, compositions of the disclosure comprise at least: an mRNA encoding a HA antigen from a first circulating influenza A virus, an mRNA encoding a HA antigen from a second circulating influenza A virus, an mRNA encoding a HA antigen from a first circulating influenza B virus, and an mRNA encoding a HA antigen from a second circulating influenza B virus; and an mRNA encoding a NA antigen from the first circulating influenza A virus, an mRNA encoding a NA antigen from the second circulating influenza A virus, an mRNA encoding a NA antigen from the first circulating influenza B virus, and an mRNA encoding a NA antigen from the second circulating influenza B virus, wherein the mRNAs are formulated in a lipid nanoparticle at a ratio of 1 : 1 : 1 : 1 : 1 : 1 : 1 : 1.

In yet other aspects, compositions of the disclosure comprise at least: an mRNA encoding a HA antigen from a first circulating influenza A virus, an mRNA encoding a HA antigen from a second circulating influenza A virus, an mRNA encoding a HA antigen from a first circulating influenza B virus, and an mRNA encoding a HA antigen from a second circulating influenza B virus; and an mRNA encoding a NA antigen from the first circulating influenza A virus, an mRNA encoding a NA antigen from the second circulating influenza A virus, an mRNA encoding a NA antigen from the first circulating influenza B virus, and an mRNA encoding a NA antigen from the second circulating influenza B virus., wherein the mRNAs are formulated in a lipid nanoparticle at a ratio of 3:3:3:3:1:1:1:1.

Circulating influenza A viruses include, for example, influenza A(HlNl)pdmO9, A(H3N2), and influenza type B viruses (B/Victoria/2/87 and B/Yamagata/16/88). In some embodiments, the influenza A(HlNl)pdmO9 viruses comprise haemagglutinin (HA) genes that belong to phylogenetic clade 6B.1A (e.g., subclades 5A, 5B, and 7). In some embodiments, the influenza A(H3N2) viruses comprise clade 3C.3a or clade 3C.2a and its subclades (e.g., 3C.2alb). In some embodiments, the influenza B virus of the B/Yamagata lineage belongs to genetic clade 3. In some embodiments, the influenza B virus of the B/Victoria lineage belongs to genetic clade 1A.

In some embodiments, the circulating influenza A(HlNl)pdmO9 virus is A/Califomia/07/2009, A/Michigan/45/2015, A/Brisbane/02/2018, A/Hawaii/70/2019, A/Idaho/07/2018, A/Maine/38/2018, A/Nebraska/15/2018, A/Nebraska/ 14/2019, A/Wisconsin/588/2019, A/Iowa/33/2019, A/Arkansas/28/2019, A/Virginia/41/2019, A/Minnesota/60/2019, A/Alabama/27/2019, or A/Guangdong-Maonan/SWLl 536/2019.

In some embodiments, the circulating influenza A(H3N2) virus is A/Iowa/60/2018, A/South Australia/34/2019, A/Hong Kong/45/2019, A/Hong Kong/2671/2019, A/Kansas/14/2017, A/Jamaica/60361/2019, A/Florida/ 130/2019, A/Laos/1789/2019, A/Vermont/25/2019, A/New Jersey/34/2019, A/Califomia/176/2019, A/Pennsylvania/1026/2019, A/Togo/634/2019, A/Kenya/130/2019, A/Togo/1307/2019, A/Ohio/30/2019, A/Guatemala/93/2019, A/Guatemala/10/2019, A/Hong Kong/4801/2014, or A/Singapore/INFIMH- 16-0019-2016.

In some embodiments, the circulating influenza B/Victoria lineage virus is B/Washington/02/2019, B/Colorado/06/2017, B/Brisbane/60/2008, or B/Colorado/06/2019.

In some embodiments, the influenza B/Yamagata lineage virus includes B/Phuket/3073/2013-like virus.

In some embodiments, a vaccine of the disclosure includes mRNAs encoding influenza A HA antigens of the Hl -Hl 8 subtype. As used herein, “subtype” refers to the specific HA and/or NA protein of an influenza A virus. There are 18 distinct subtypes of HA (Hl -Hl 8) and 11 distinct subtypes of NA (Nl-N 11) known in the art (CDC, “Types of Influenza Viruses”, 2019). In some embodiments, the vaccine comprises an mRNA encoding an influenza A HA antigen of the Hl subtype. In some embodiments, the vaccine comprises an mRNA encoding an influenza A HA antigen of the H3 subtype. In some embodiments, the vaccine comprises an mRNA encoding an influenza A of the H2 subtype. In some embodiments, the vaccine comprises an mRNA encoding an influenza A of the H5 subtype. In some embodiments, the vaccine comprises an mRNA encoding an influenza A of the H7 subtype. In some embodiments, the vaccine comprises an mRNA encoding an influenza A of the H9 subtype. In some embodiments, the vaccine comprises an mRNA encoding an Hl subtype antigen and an mRNA encoding an H3 subtype antigen.

In some embodiments, vaccine of the disclosure includes mRNAs encoding influenza A NA antigens of the Nl-Nl l subtype. In some embodiments, the vaccine comprises an mRNA encoding an influenza A NA of the N1 subtype. In some embodiments, the vaccine comprises an mRNA encoding an influenza A NA antigen of the N2 subtype. In some embodiments, the vaccine comprises an mRNA encoding an N1 subtype antigen and an mRNA encoding an N2 subtype antigen. In some embodiments, the vaccine comprises an mRNA encoding an influenza A NA antigen of the N8 subtype.

In some embodiments, a vaccine of the disclosure includes mRNAs encoding influenza B antigens. The influenza B antigens may be from any strain known in the art. Examples of influenza B strains include, but are not limited to, strains originating from Aichi, Akita, Alaska, Ann Arbor, Argentina, Bangkok, Beijing, Belgium, Bonn, Brazil, Buenos Aires, Canada, Chaco, Chiba, Chongqing, CNIC, Cordoba, Czechoslovakia, Daeku, Durban, Finland, Fujian, Fukuoka, Genoa, Guangdong, Guangzhou, Hannover, Harbin, Hawaii, Hebei, Henan, Hiroshima, Hong Kong, Houston, Hunan, Ibaraki, India, Israel, Johannesburg, Kagoshima, Kanagawa, Kansas, Khazkov, Kobe, Kouchi, Lazio, Lee, Leningrad, Lissabon, Los Angeles, Lusaka, Lyon, Malaysia, Maputo, Mar del Plata, Maryland, Memphis, Michigan, Mie, Milano, Minsk, Nagasaki, Nagoya, Nanchang, Nashville, Nebraska, The Netherlands, New York, NIB, Ningxia, Norway, Oman, Oregon, Osaka, Oslo, Panama, Paris, Parma, Perugia, Philippines, Pusan, Quebec, Rochester, Roma, Saga, Seoul, Shangdong, Shanghai, Shenzhen, Shiga, Shizuoka, Sichuan, Siena, Singapore, South Carolina, South Dakota, Spain, Stockholm, Switzerland, Taiwan, Texas, Tokushima, Tokyo, Trento, Trieste, United Kingdom, Ushuaia, USSR, Utah, Victoria, Vienna, Wuhan, Xuanwu, Yamagata, Yamanashi, Yunnan, hybrid subtypes, circulating recombinant forms, clinical and field isolates. Exemplary influenza B strains include, but are not limited to: Akita/27/2001, strain Akita/5/2001, strain Alaska/ 16/2000, strain Alaska/ 1777/2005, strain Argentina/69/2001, strain Arizona/ 146/2005, strain Arizona/ 148/2005, strain

Bangkok/ 163/90, strain Bangkok/34/99, strain Bangkok/460/03, strain Bangkok/54/99, strain Barcelona/215/03, strain Beijing/15/84, strain Beijing/184/93, strain Beijing/243/97, strain Beijing/43/75, strain Beijing/5/76, strain Beijing/76/98, strain Belgium/WV 106/2002, strain Belgium/WV 107/2002, strain Belgium/WV 109/2002, strain Belgium/WV 114/2002, strain Belgium/WV 122/2002, strain Bonn/43, strain Brazil/952/2001, strain Bucharest/795/03, strain Buenos Aires/161/00), strain Buenos Aires/9/95, strain Buenos Aires/SW 16/97, strain Buenos Aires/VL518/99, strain Canada/464/2001, strain Canada/464/2002, strain Chaco/366/00, strain Chaco/R 113/00, strain Cheju/3O3/O3, strain Chiba/447/98, strain Chongqing/3/2000, strain clinical isolate SAI Thailand/2002, strain clinical isolate SA10 Thailand/2002, strain clinical isolate SA100 Philippines/2002, strain clinical isolate SA101 Philippines/2002, strain clinical isolate SAHO Philippines/2002), strain clinical isolate SAI 12 Philippines/2002, strain clinical isolate SAI 13 Philippines/2002, strain clinical isolate SAI 14 Philippines/2002, strain clinical isolate SA2 Thailand/2002, strain clinical isolate SA20 Thailand/2002, strain clinical isolate SA38 Philippines/2002, strain clinical isolate SA39 Thailand/2002, strain clinical isolate SA99 Philippines/2002, strain CNIC/27/2001, strain Colorado/2597/2004, strain Cordoba/VA418/99, strain Czechoslovakia/16/89, strain Czechoslovakia/69/90, strain Daeku/10/97, strain Daeku/45/97, strain Daeku/47/97, strain Daeku/9/97, strain B/Du/4/78, strain B/Durban/39/98, strain Durban/43/98, strain Durban/44/98, strain B/Durban/52/98, strain Durban/55/98, strain Durban/56/98, strain England/1716/2005, strain England/2054/2005), strain England/23/04, strain Finland/154/2002, strain Finland/159/2002, strain Finland/160/2002, strain

Finland/ 161/2002, strain Finland/ 162/03, strain Finland/ 162/2002, strain Finland/ 162/91, strain Finland/ 164/2003, strain Finland/172/91, strain Finland/ 173/2003, strain Finland/ 176/2003, strain Finland/ 184/91, strain Finland/ 188/2003, strain Finland/ 190/2003, strain Finland/220/2003, strain Finland/WV5/2002, strain Fujian/36/82, strain Geneva/5079/03, strain Genoa/11/02, strain Genoa/2/02, strain Genoa/21/02, strain Genova/54/02, strain Genova/55/02, strain Guangdong/05/94, strain Guangdong/08/93, strain Guangdong/5/94, strain

Guangdong/55/89, strain Guangdong/8/93, strain Guangzhou/7/97, strain Guangzhou/86/92, strain Guangzhou/87/92, strain Gy eonggi/592/2005, strain Hannover/2/90, strain Harbin/07/94, strain Hawaii/ 10/2001, strain Hawaii/1990/2004, strain Haw aii/38/2001, strain Hawaii/9/2001, strain Hebei/19/94, strain Hebei/3/94), strain Henan/22/97, strain Hiroshima/23/2001, strain Hong Kong/110/99, strain Hong Kong/11 15/2002, strain Hong Kong/ 112/2001, strain Hong Kong/ 123/2001, strain Hong Kong/1351/2002, strain Hong Kong/1434/2002, strain Hong Kong/147/99, strain Hong Kong/156/99, strain Hong Kong/157/99, strain Hong Kong/22/2001, strain Hong Kong/22/89, strain Hong Kong/336/2001, strain Hong Kong/666/2001, strain Hong Kong/9/89, strain Houston/1/91, strain Houston/1/96, strain Houston/2/96, strain Hunan/4/72, strain Ibaraki/2/85, strain ncheon/297/2005, strain India/3/89, strain India/77276/2001, strain Israel/95/03, strain Israel/WV 187/2002, strain Jap an/ 1224/2005, strain Jiangsu/ 10/03, strain Johannesburg/1/99, strain Johannesburg/96/01, strain Kadoma/1076/99, strain Kadoma/122/99, strain Kagoshima/15/94, strain Kansas/22992/99, strain Khazkov/224/91, strain Kobe/1/2002, strain, strain Kouchi/193/99, strain Lazio/1/02, strain Lee/40, strain Leningrad/129/91, strain Lissabon/2/90), strain Los Angeles/1/02, strain Lusaka/270/99, strain Lyon/1271/96, strain Malaysia/83077/2001, strain Maputo/1/99, strain Mar del Plata/595/99, strain Maryland/ 1/01, strain Memphis/1/01, strain Memphis/ 12/97-MA, strain Michigan/22572/99, strain Mie/1/93, strain Milano/1/01, strain Minsk/318/90, strain Moscow/3/03, strain Nagoya/20/99, strain Nanchang/1/00, strain Nashville/107/93, strain Nashville/45/91, strain Nebraska/2/01, strain Netherland/801/90, strain Netherlands/429/98, strain New York/1/2002, strain NIB/48/90, strain Ningxia/45/83, strain Norway/1/84, strain Oman/ 16299/2001, strain Os aka/ 1059/97, strain Osaka/983/97-V2, strain Oslo/1329/2002, strain Oslo/1846/2002, strain Panama/45/90, strain Paris/329/90, strain Parma/23/02, strain Perth/211/2001, strain Peru/ 1364/2004, strain Philippines/5072/2001, strain Pusan/270/99, strain Quebec/173/98, strain Quebec/465/98, strain Quebec/7/01, strain Roma/1/03, strain Saga/S 172/99, strain Seoul/13/95, strain Seoul/37/91, strain Shangdong/7/97, strain Shanghai/361/2002), strain Shiga/T30/98, strain Sichuan/379/99, strain Singapore/222/79, strain Spain/WV27/2002, strain Stockholm/10/90, strain Switzerland/5441/90, strain Taiwan/0409/00, strain Taiwan/0722/02, strain Taiwan/97271/2001, strain Tehran/80/02, strain Tokyo/6/98, strain Trieste/28/02, strain Ulan Ude/4/02, strain United Kingdom/34304/99, strain USSR/1OO/83, strain Victoria/103/89, strain Vienna/1/99, strain Wuhan/356/2000, strain WV194/2002, strain Xuanwu/23/82, strain Yamagata/1311/2003, strain Yamagata/K500/2001, strain Alaska/12/96, strain GA/86, strain NAGASAKI/1/87, strain Toky o/942/96, and strain Rochester/02/2001. Their sequences are known in the art and are available from GenBank.

In some embodiments, a vaccine of the disclosure includes mRNAs encoding an influenza B HA antigen, for example a B/Yamagata antigen or a B/Victoria antigen. In some embodiments, a vaccine of the disclosure includes mRNAs encoding an HA B/Yamagata antigen and an HA B/Victoria antigen. In some embodiments, a vaccine of the disclosure includes mRNAs encoding an influenza B NA antigen, for example an NA B/Yamagata antigen or an NA B/Victoria antigen. In some embodiments, a vaccine of the disclosure includes mRNAs encoding an NA B/Yamagata antigen and an NA B/Victoria antigen.

Therefore, in some embodiments, the vaccine comprises eight antigens: an Hl antigen, and H3 antigen, an N1 antigen, an N2 antigen, an HA B/Yamagata antigen, an HA B/Victoria antigen, an NA B/Yamagata antigen, and an NA B/Victoria antigen.

Exemplary sequences of the influenza virus antigens and the RNA encoding the influenza virus antigens of the compositions of the present disclosure are provided in Table 2. In some embodiments, the mRNA vaccines comprise a sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to an open reading frame (ORF) sequence selected from SEQ ID NOs: 6, 9, 12, 15, 18, 21, 24, or 27. In some embodiments, the mRNA vaccines encode a polypeptide that is 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or identical to a sequence selected from SEQ ID NOs: 7, 10, 13, 16, 19, 22, 25, or 28. In some embodiments, the mRNA vaccine comprises a sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to a sequence selected according to standardized criteria used by World Health Organization’s Global Influenza Surveillance and Response System (GISRS).

Nucleic Acids

The compositions of the present disclosure comprise a (at least one) messenger RNA (mRNA) having an open reading frame (ORF) encoding an influenza virus antigen. In some embodiments, the mRNA further comprises a 5' UTR, 3' UTR, a poly(A) tail and/or a 5' cap analog.

It should also be understood that the influenza virus vaccine of the present disclosure may include any 5' untranslated region (UTR) and/or any 3' UTR. Exemplary UTR sequences include SEQ ID NOs: 1-4; however, other UTR sequences may be used or exchanged for any of the UTR sequences described herein. In some embodiments, a 5' UTR of the present disclosure comprises a sequence selected from SEQ ID NO: 1 (GGGAAAUA AGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACC) and SEQ ID NO: 2 (GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGACCCCGGCGCCGC CACC). In some embodiments, a 3' UTR of the present disclosure comprises a sequence selected from SEQ ID NO: 3 (UGAUAAUAGGCUGGAGCCUCGGUGGCCAUGCUU CUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCG UGGUCUUUGAAUAAAGUCUGAGUGGGCGGC) and SEQ ID NO: 4 (UGAUAA UAGGCUGGAGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCC UCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGC GGC). UTRs may also be omitted from the RNA polynucleotides provided herein.

Nucleic acids comprise a polymer of nucleotides (nucleotide monomers). Thus, nucleic acids are also referred to as polynucleotides. Nucleic acids may be or may include, for example, deoxyribonucleic acids (DNAs), ribonucleic acids (RNAs), threose nucleic acids (TNAs), glycol nucleic acids (GNAs), peptide nucleic acids (PNAs), locked nucleic acids (LNAs, including LNA having a P-D-ribo configuration, a-LNA having an a-L-ribo configuration (a diastereomer of LNA), 2'-amino-LNA having a 2'-amino functionalization, and 2'-amino- a-LNA having a 2'- amino functionalization), ethylene nucleic acids (ENA), cyclohexenyl nucleic acids (CeNA) and/or chimeras and/or combinations thereof.

Messenger RNA (mRNA) is any RNA that encodes a (at least one) protein (a naturally- occurring, non-naturally-occurring, or modified polymer of amino acids) and can be translated to produce the encoded protein in vitro, in vivo, in situ, or ex vivo. The skilled artisan will appreciate that, except where otherwise noted, nucleic acid sequences set forth in the instant application may recite “T”s in a representative DNA sequence but where the sequence represents mRNA, the “T”s would be substituted for “U”s. Thus, any of the DNAs disclosed and identified by a particular sequence identification number herein also disclose the corresponding mRNA sequence complementary to the DNA, where each “T” of the DNA sequence is substituted with “U.”

An open reading frame (ORF) is a continuous stretch of DNA or RNA beginning with a start codon (e.g., methionine (ATG or AUG)) and ending with a stop codon (e.g., TAA, TAG or TGA, or UAA, UAG or UGA). An ORF typically encodes a protein. It will be understood that the sequences disclosed herein may further comprise additional elements, e.g., 5' and 3' UTRs, but that those elements, unlike the ORF, need not necessarily be present in an RNA polynucleotide of the present disclosure. Variants

In some embodiments, the compositions of the present disclosure include RNA that encodes an influenza virus antigen variant. Antigen variants or other polypeptide variants refers to molecules that differ in their amino acid sequence from a wild-type, native, or reference sequence. The antigen/polypeptide variants may possess substitutions, deletions, and/or insertions at certain positions within the amino acid sequence, as compared to a native or reference sequence. Ordinarily, variants possess at least 50% identity to a wild-type, native or reference sequence. In some embodiments, variants share at least 80%, or at least 90% identity with a wild-type, native, or reference sequence.

Variant antigens/polypeptides encoded by nucleic acids of the disclosure may contain amino acid changes that confer any of a number of desirable properties, e.g., that enhance their immunogenicity, enhance their expression, and/or improve their stability or PK/PD properties in a subject. Variant antigens/polypeptides can be made using routine mutagenesis techniques and assayed as appropriate to determine whether they possess the desired property. Assays to determine expression levels and immunogenicity are well known in the art and exemplary such assays are set forth in the Examples section. Similarly, PK/PD properties of a protein variant can be measured using art recognized techniques, e.g., by determining expression of antigens in a vaccinated subject over time and/or by looking at the durability of the induced immune response. The stability of protein(s) encoded by a variant nucleic acid may be measured by assaying thermal stability or stability upon urea denaturation or may be measured using in silico prediction. Methods for such experiments and in silico determinations are known in the art.

In some embodiments, a composition comprises an RNA or an RNA ORF that comprises a nucleotide sequence of any one of the sequences provided herein, or comprises a nucleotide sequence at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a nucleotide sequence of any one of the sequences provided herein.

The term “identity” refers to a relationship between the sequences of two or more polypeptides (e.g. antigens) or polynucleotides (nucleic acids), as determined by comparing the sequences. Identity also refers to the degree of sequence relatedness between or among sequences as determined by the number of matches between strings of two or more amino acid residues or nucleic acid residues. Identity measures the percent of identical matches between the smaller of two or more sequences with gap alignments (if any) addressed by a particular mathematical model or computer program (e.g., “algorithms”). Identity of related antigens or nucleic acids can be readily calculated by known methods. “Percent (%) identity” as it applies to polypeptide or polynucleotide sequences is defined as the percentage of residues (amino acid residues or nucleic acid residues) in the candidate amino acid or nucleic acid sequence that are identical with the residues in the amino acid sequence or nucleic acid sequence of a second sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent identity. Methods and computer programs for the alignment are well known in the art. It is understood that identity depends on a calculation of percent identity but may differ in value due to gaps and penalties introduced in the calculation. Generally, variants of a particular polynucleotide or polypeptide (e.g., antigen) have at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% but less than 100% sequence identity to that particular reference polynucleotide or polypeptide as determined by sequence alignment programs and parameters described herein and known to those skilled in the art. Such tools for alignment include those of the BLAST suite (Stephen F. Altschul, et al (1997), "Gapped BLAST and PSLBLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402). Another popular local alignment technique is based on the Smith- Waterman algorithm (Smith, T.F. & Waterman, M.S. (1981) “Identification of common molecular subsequences.” J. Mol. Biol. 147:195-197). A general global alignment technique based on dynamic programming is the Needleman-Wunsch algorithm (Needleman, S.B. & Wunsch, C.D. (1970) “A general method applicable to the search for similarities in the amino acid sequences of two proteins.” J. Mol. Biol. 48:443-453). More recently a Fast Optimal Global Sequence Alignment Algorithm (FOGSAA) has been developed that purportedly produces global alignment of nucleotide and protein sequences faster than other optimal global alignment methods, including the Needleman-Wunsch algorithm.

As such, polynucleotides encoding peptides or polypeptides containing substitutions, insertions and/or additions, deletions and covalent modifications with respect to reference sequences, in particular the polypeptide (e.g., antigen) sequences disclosed herein, are included within the scope of this disclosure. For example, sequence tags or amino acids, such as one or more lysines, can be added to peptide sequences (e.g., at the N-terminal or C-terminal ends). Sequence tags can be used for peptide detection, purification or localization. Lysines can be used to increase peptide solubility or to allow for biotinylation. Alternatively, amino acid residues located at the carboxy and amino terminal regions of the amino acid sequence of a peptide or protein may optionally be deleted providing for truncated sequences. Certain amino acids (e.g., C-terminal or N-terminal residues) may alternatively be deleted depending on the use of the sequence, as for example, expression of the sequence as part of a larger sequence which is soluble or linked to a solid support. In some embodiments, sequences for (or encoding) signal sequences, termination sequences, transmembrane domains, linkers, multimerization domains (such as, e.g., foldon regions) and the like may be substituted with alternative sequences that achieve the same or a similar function. In some embodiments, cavities in the core of proteins can be filled to improve stability, e.g., by introducing larger amino acids. In other embodiments, buried hydrogen bond networks may be replaced with hydrophobic resides to improve stability. In yet other embodiments, glycosylation sites may be removed and replaced with appropriate residues. Such sequences are readily identifiable to one of skill in the art. It should also be understood that some of the sequences provided herein contain sequence tags or terminal peptide sequences (e.g., at the N-terminal or C-terminal ends) that may be deleted, for example, prior to use in the preparation of an mRNA vaccine.

As recognized by those skilled in the art, protein fragments, functional protein domains, and homologous proteins are also considered to be within the scope of influenza virus antigens of interest. For example, provided herein is any protein fragment (meaning a polypeptide sequence at least one amino acid residue shorter than a reference antigen sequence but otherwise identical) of a reference protein, provided that the fragment is immunogenic and confers a protective immune response to the influenza virus. In addition to variants that are identical to the reference protein but are truncated, in some embodiments, an antigen includes 2, 3, 4, 5, 6, 7, 8, 9, 10, or more mutations, as shown in any of the sequences provided or referenced herein. Antigens/antigenic polypeptides can range in length from about 4, 6, or 8 amino acids to full length proteins.

Stabilizing Elements

Naturally-occurring eukaryotic mRNA molecules can contain stabilizing elements, including, but not limited to untranslated regions (UTR) at their 5 '-end (5' UTR) and/or at their 3'-end (3' UTR), in addition to other structural features, such as a 5'-cap structure or a 3'-poly(A) tail. Both the 5' UTR and the 3' UTR are typically transcribed from the genomic DNA and are elements of the premature mRNA. Characteristic structural features of mature mRNA, such as the 5 '-cap and the 3 '-poly (A) tail are usually added to the transcribed (premature) mRNA during mRNA processing.

In some embodiments, a composition includes an mRNA having an open reading frame encoding at least one antigenic polypeptide having at least one modification, at least one 5' terminal cap, and is formulated within a lipid nanoparticle. 5 '-capping of polynucleotides may be completed concomitantly during the in vztro-transcription reaction using the following chemical RNA cap analogs to generate the 5 '-guanosine cap structure according to manufacturer protocols: 3'-O-Mc-in7G(5')ppp(5') G [the ARCA cap];G(5')ppp(5')A; G(5')ppp(5')G; m7G(5')ppp(5')A; m7G(5')ppp(5')G (New England BioLabs, Ipswich, MA). 5'-capping of modified RNA may be completed post-transcriptionally using a Vaccinia Virus Capping Enzyme to generate the “Cap 0” structure: m7G(5')ppp(5')G (New England BioLabs, Ipswich, MA). Cap 1 structure may be generated using both Vaccinia Virus Capping Enzyme and a 2'-0 methyl-transferase to generate: m7G(5')ppp(5')G-2'-O-methyl. Cap 2 structure may be generated from the Cap 1 structure followed by the 2'-O-methylation of the 5 '-antepenultimate nucleotide using a 2'-0 methyl-transferase. Cap 3 structure may be generated from the Cap 2 structure followed by the 2'-O-methylation of the 5'-preantepenultimate nucleotide using a 2'-0 methyl- transferase. Enzymes may be derived from a recombinant source.

The 3'-poly(A) tail is typically a stretch of adenine nucleotides added to the 3 '-end of the transcribed mRNA. It can, in some instances, comprise up to about 400 adenine nucleotides. In some embodiments, the length of the 3'-poly(A) tail may be an essential element with respect to the stability of the individual mRNA.

In some embodiments, an mRNA includes a stabilizing element. Stabilizing elements may include for instance a histone stem-loop. A stem-loop binding protein (SLBP), a 32 kDa protein has been identified. It is associated with the histone stem-loop at the 3'-end of the histone messages in both the nucleus and the cytoplasm. Its expression level is regulated by the cell cycle; it peaks during the S-phase, when histone mRNA levels are also elevated. The protein has been shown to be essential for efficient 3'-end processing of histone pre-mRNA by the U7 snRNP. SLBP continues to be associated with the stem-loop after processing, and then stimulates the translation of mature histone mRNAs into histone proteins in the cytoplasm. The RNA binding domain of SLBP is conserved through metazoa and protozoa; its binding to the histone stem- loop depends on the structure of the loop. The minimum binding site includes at least three nucleotides 5’ and two nucleotides 3' relative to the stem-loop.

In some embodiments, an mRNA includes a coding region, at least one histone stemloop, and optionally, a poly(A) sequence or polyadenylation signal. The poly(A) sequence or polyadenylation signal generally should enhance the expression level of the encoded protein. The encoded protein, in some embodiments, is not a histone protein, a reporter protein (e.g. Luciferase, GFP, EGFP, P-Galactosidase, EGFP), or a marker or selection protein (e.g. alphaGlobin, Galactokinase and Xanthine:guanine phosphoribosyl transferase (GPT)).

In some embodiments, an mRNA includes the combination of a poly(A) sequence or polyadenylation signal and at least one histone stem-loop, even though both represent alternative mechanisms in nature, acts synergistically to increase the protein expression beyond the level observed with either of the individual elements. The synergistic effect of the combination of poly(A) and at least one histone stem-loop does not depend on the order of the elements or the length of the poly(A) sequence.

In some embodiments, an mRNA does not include a histone downstream element (HDE). “Histone downstream element” (HDE) includes a purine-rich polynucleotide stretch of approximately 15 to 20 nucleotides 3' of naturally occurring stem- loops, representing the binding site for the U7 snRNA, which is involved in processing of histone pre-mRNA into mature histone mRNA. In some embodiments, the nucleic acid does not include an intron.

An mRNA may or may not contain an enhancer and/or promoter sequence, which may be modified or unmodified or which may be activated or inactivated. In some embodiments, the histone stem- loop is generally derived from histone genes and includes an intramolecular base pairing of two neighbored partially or entirely reverse complementary sequences separated by a spacer, consisting of a short sequence, which forms the loop of the structure. The unpaired loop region is typically unable to base pair with either of the stem loop elements. It occurs more often in RNA, as is a key component of many RNA secondary structures but may be present in singlestranded DNA as well. Stability of the stem-loop structure generally depends on the length, number of mismatches or bulges, and base composition of the paired region. In some embodiments, wobble base pairing (non- Watson-Crick base pairing) may result. In some embodiments, the at least one histone stem- loop sequence comprises a length of 15 to 45 nucleotides.

In some embodiments, an mRNA has one or more AU-rich sequences removed. These sequences, sometimes referred to as AURES are destabilizing sequences found in the 3’UTR. The AURES may be removed from the RNA vaccines. Alternatively, the AURES may remain in an mRNA vaccine composition.

In some embodiments, an mRNA does not include a stabilizing element.

Signal Peptides

In some embodiments, a composition comprises an mRNA having an ORF that encodes a signal peptide fused to each influenza antigen. Signal peptides, comprising the N-terminal 15- 60 amino acids of proteins, are typically needed for the translocation across the membrane on the secretory pathway and, thus, universally control the entry of most proteins both in eukaryotes and prokaryotes to the secretory pathway. In eukaryotes, the signal peptide of a nascent precursor protein (pre-protein) directs the ribosome to the rough endoplasmic reticulum (ER) membrane and initiates the transport of the growing peptide chain across it for processing. ER processing produces mature proteins, wherein the signal peptide is cleaved from precursor proteins, typically by a ER-resident signal peptidase of the host cell, or they remain uncleaved and function as a membrane anchor. A signal peptide may also facilitate the targeting of the protein to the cell membrane.

A signal peptide may have a length of 15-60 amino acids. For example, a signal peptide may have a length of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 amino acids. In some embodiments, a signal peptide has a length of 20-60, 25-60, 30-60, 35- 60, 40-60, 45- 60, 50-60, 55-60, 15-55, 20-55, 25-55, 30-55, 35-55, 40-55, 45-55, 50-55, 15-50, 20-50, 25-50, 30-50, 35-50, 40-50, 45-50, 15-45, 20-45, 25-45, 30-45, 35-45, 40-45, 15-40, 20- 40, 25-40, 30-40, 35-40, 15-35, 20-35, 25-35, 30-35, 15-30, 20-30, 25-30, 15-25, 20-25, or 15- 20 amino acids.

Signal peptides from heterologous genes (which regulate expression of genes other than influenza antigens in nature) are known in the art and can be tested for desired properties and then incorporated into a nucleic acid of the disclosure.

Fusion Proteins

In some embodiments, a composition of the present disclosure includes an mRNA encoding an antigenic fusion protein. Thus, the encoded antigen or antigens may include two or more proteins (e.g., protein and/or protein fragment) joined together. Alternatively, the protein to which a protein antigen is fused does not promote a strong immune response to itself, but rather to the influenza antigen. Antigenic fusion proteins, in some embodiments, retain the functional property from each original protein.

Scaffold Moieties

The vaccine compositions as provided herein, in some embodiments, encode fusion proteins that comprise influenza antigens linked to scaffold moieties. In some embodiments, such scaffold moieties impart desired properties to an antigen encoded by a nucleic acid of the disclosure. For example, scaffold proteins may improve the immunogenicity of an antigen, e.g., by altering the structure of the antigen, altering the uptake and processing of the antigen, and/or causing the antigen to bind to a binding partner.

In some embodiments, the scaffold moiety is protein that can self-assemble into protein nanoparticles that are highly symmetric, stable, and structurally organized, with diameters of 10-150 nm, a highly suitable size range for optimal interactions with various cells of the immune system. In some embodiments, viral proteins or virus-like particles can be used to form stable nanoparticle structures. Examples of such viral proteins are known in the art. For example, in some embodiments, the scaffold moiety is a hepatitis B surface antigen (HBsAg). HBsAg forms spherical particles with an average diameter of ~22 nm and which lacked nucleic acid and hence are non-infectious (Lopez-Sagaseta, J. et al. Computational and Structural Biotechnology Journal 14 (2016) 58-68). In some embodiments, the scaffold moiety is a hepatitis B core antigen (HBcAg) self-assembles into particles of 24-31 nm diameter, which resembled the viral cores obtained from HBV-infected human liver. HBcAg produced in selfassembles into two classes of differently sized nanoparticles of 300 A and 360 A diameter, corresponding to 180 or 240 protomers. In some embodiments, the influenza antigen is fused to HBsAG or HBcAG to facilitate self-assembly of nanoparticles displaying the influenza antigen.

In some embodiments, bacterial protein platforms may be used. Non-limiting examples of these self-assembling proteins include ferritin, lumazine and encapsulin.

Ferritin is a protein whose main function is intracellular iron storage. Ferritin is made of 24 subunits, each composed of a four- alpha-helix bundle, that self-assemble in a quaternary structure with octahedral symmetry (Cho K.J. et al. J Mol Biol. 2009;390:83-98). Several high- resolution structures of ferritin have been determined, confirming that Helicobacter pylori ferritin is made of 24 identical protomers, whereas in animals, there are ferritin light and heavy chains that can assemble alone or combine with different ratios into particles of 24 subunits (Granier T. et al. J Biol Inorg Chem. 2003;8:105-111; Lawson D.M. et al. Nature. 1991;349:541-544). Ferritin self-assembles into nanoparticles with robust thermal and chemical stability. Thus, the ferritin nanoparticle is well-suited to carry and expose antigens.

Lumazine synthase (LS) is also well- suited as a nanoparticle platform for antigen display. LS, which is responsible for the penultimate catalytic step in the biosynthesis of riboflavin, is an enzyme present in a broad variety of organisms, including archaea, bacteria, fungi, plants, and eubacteria (Weber S.E. Flavins and Flavoproteins. Methods and Protocols, Series: Methods in Molecular Biology. 2014). The LS monomer is 150 amino acids long, and consists of beta- sheets along with tandem alpha-helices flanking its sides. A number of different quaternary structures have been reported for LS, illustrating its morphological versatility: from homopentamers up to symmetrical assemblies of 12 pentamers forming capsids of 150 A diameter. Even LS cages of more than 100 subunits have been described (Zhang X. et al. J Mol Biol. 2006;362:753-770).

Encapsulin, a novel protein cage nanoparticle isolated from thermophile Thermotoga maritima, may also be used as a platform to present antigens on the surface of self-assembling nanoparticles. Encapsulin is assembled from 60 copies of identical 31 kDa monomers having a thin and icosahedral T = 1 symmetric cage structure with interior and exterior diameters of 20 and 24 nm, respectively (Sutter M. et al. Nat Struct Mol Biol. 2008, 15: 939-947). Although the exact function of encapsulin in T. maritima is not clearly understood yet, its crystal structure has been recently solved and its function was postulated as a cellular compartment that encapsulates proteins such as DyP (Dye decolorizing peroxidase) and Flp (Ferritin like protein), which are involved in oxidative stress responses (Rahmanpour R. et al. FEBS J. 2013, 280: 2097-2104).

Linkers and Cleavable Peptides

In some embodiments, the mRNAs of the disclosure encode more than one polypeptide, referred to herein as fusion proteins. In some embodiments, the mRNA further encodes a linker located between at least one or each domain of the fusion protein. The linker can be, for example, a cleavable linker or protease- sensitive linker. In some embodiments, the linker is selected from the group consisting of F2A linker, P2A linker, T2A linker, E2A linker, and combinations thereof. This family of self-cleaving peptide linkers, referred to as 2A peptides, has been described in the art (see for example, Kim, J.H. et al. (2011) PLoS ONE 6:el8556). In some embodiments, the linker is an F2A linker. In some embodiments, the linker is a GGGS linker. In some embodiments, the fusion protein contains three domains with intervening linkers, having the structure: domain-linker-domain-linker-domain.

Cleavable linkers known in the art may be used in connection with the disclosure. Exemplary such linkers include: F2A linkers, T2A linkers, P2A linkers, E2A linkers (See, e.g., WO2017/127750). The skilled artisan will appreciate that other art-recognized linkers may be suitable for use in the constructs of the disclosure (e.g., encoded by the nucleic acids of the disclosure). The skilled artisan will likewise appreciate that other polycistronic constructs (mRNA encoding more than one antigen/polypeptide separately within the same molecule) may be suitable for use as provided herein.

Sequence Optimization

In some embodiments, an ORF encoding an antigen of the disclosure is codon optimized. Codon optimization methods are known in the art. For example, an ORF of any one or more of the sequences provided herein may be codon optimized. Codon optimization, in some embodiments, may be used to match codon frequencies in target and host organisms to ensure proper folding; bias GC content to increase mRNA stability or reduce secondary structures; minimize tandem repeat codons or base runs that may impair gene construction or expression; customize transcriptional and translational control regions; insert or remove protein trafficking sequences; remove/add post translation modification sites in encoded protein (e.g., glycosylation sites); add, remove or shuffle protein domains; insert or delete restriction sites; modify ribosome binding sites and mRNA degradation sites; adjust translational rates to allow the various domains of the protein to fold properly; or reduce or eliminate problem secondary structures within the polynucleotide. Codon optimization tools, algorithms and services are known in the art - non-limiting examples include services from GeneArt (Life Technologies), DNA2.0 (Menlo Park CA) and/or proprietary methods. In some embodiments, the open reading frame (ORF) sequence is optimized using optimization algorithms.

In some embodiments, a codon optimized sequence shares less than 95% sequence identity to a naturally-occurring or wild-type sequence ORF (e.g., a naturally-occurring or wildtype mRNA sequence encoding an influenza virus antigen). In some embodiments, a codon optimized sequence shares less than 90% sequence identity to a naturally-occurring or wild-type sequence (e.g., a naturally-occurring or wild-type mRNA sequence encoding an influenza virus antigen). In some embodiments, a codon optimized sequence shares less than 85% sequence identity to a naturally-occurring or wild-type sequence (e.g., a naturally-occurring or wild-type mRNA sequence encoding an influenza virus antigen). In some embodiments, a codon optimized sequence shares less than 80% sequence identity to a naturally-occurring or wild-type sequence (e.g., a naturally-occurring or wild-type mRNA sequence encoding an influenza virus antigen). In some embodiments, a codon optimized sequence shares less than 75% sequence identity to a naturally-occurring or wild-type sequence (e.g., a naturally-occurring or wild-type mRNA sequence encoding an influenza virus antigen).

In some embodiments, a codon optimized sequence shares between 65% and 85% (e.g., between about 67% and about 85% or between about 67% and about 80%) sequence identity to a naturally-occurring or wild-type sequence (e.g., a naturally-occurring or wild-type mRNA sequence encoding an influenza virus antigen). In some embodiments, a codon optimized sequence shares between 65% and 75% or about 80% sequence identity to a naturally-occurring or wild-type sequence (e.g., a naturally-occurring or wild-type mRNA sequence encoding an influenza virus antigen).

In some embodiments, a codon-optimized sequence encodes an antigen that is as immunogenic as, or more immunogenic than (e.g., at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 100%, or at least 200% more), than an influenza virus antigen encoded by a non-codon-optimized sequence.

When transfected into mammalian host cells, the modified mRNAs have a stability of between 12-18 hours, or greater than 18 hours, e.g., 24, 36, 48, 60, 72, or greater than 72 hours and are capable of being expressed by the mammalian host cells.

In some embodiments, a codon optimized RNA may be one in which the levels of G/C are enhanced. The G/C-content of nucleic acid molecules (e.g., mRNA) may influence the stability of the RNA. RNA having an increased amount of guanine (G) and/or cytosine (C) residues may be functionally more stable than RNA containing a large amount of adenine (A) and thymine (T) or uracil (U) nucleotides. As an example, WO02/098443 discloses a pharmaceutical composition containing an mRNA stabilized by sequence modifications in the translated region. Due to the degeneracy of the genetic code, the modifications work by substituting existing codons for those that promote greater RNA stability without changing the resulting amino acid. The approach is limited to coding regions of the RNA.

Chemically Unmodified Nucleotides

In some embodiments, an mRNA is not chemically modified and comprises the standard ribonucleotides consisting of adenosine, guanosine, cytosine and uridine. In some embodiments, nucleotides and nucleosides of the present disclosure comprise standard nucleoside residues such as those present in transcribed RNA (e.g. A, G, C, or U). In some embodiments, nucleotides and nucleosides of the present disclosure comprise standard deoxyribonucleosides such as those present in DNA (e.g. dA, dG, dC, or dT).

Chemical Modifications

The compositions of the present disclosure comprise, in some embodiments, an RNA having an open reading frame encoding an influenza virus antigen, wherein the nucleic acid comprises nucleotides and/or nucleosides that can be standard (unmodified) or modified as is known in the art. In some embodiments, nucleotides and nucleosides of the present disclosure comprise modified nucleotides or nucleosides. Such modified nucleotides and nucleosides can be naturally-occurring modified nucleotides and nucleosides or non-naturally occurring modified nucleotides and nucleosides. Such modifications can include those at the sugar, backbone, or nucleobase portion of the nucleotide and/or nucleoside as are recognized in the art.

In some embodiments, a naturally-occurring modified nucleotide or nucleotide of the disclosure is one as is generally known or recognized in the art. Non-limiting examples of such naturally occurring modified nucleotides and nucleotides can be found, inter alia, in the widely recognized MODOMICS database.

In some embodiments, a non-naturally occurring modified nucleotide or nucleoside of the disclosure is one as is generally known or recognized in the art. Non-limiting examples of such non-naturally occurring modified nucleotides and nucleosides can be found, inter alia, in published US application Nos. PCT/US2012/058519; PCT/US2013/075177;

PCT/US2014/058897; PCT/US2014/058891; PCT/US2014/070413; PCT/US2015/36773; PCT/US2015/36759; PCT/US2015/36771; or PCT/IB2017/051367 all of which are incorporated by reference herein.

Hence, nucleic acids of the disclosure (e.g., DNA nucleic acids and RNA nucleic acids, such as mRNA nucleic acids) can comprise standard nucleotides and nucleosides, naturally- occurring nucleotides and nucleosides, non-naturally-occurring nucleotides and nucleosides, or any combination thereof.

Nucleic acids of the disclosure (e.g., DNA nucleic acids and RNA nucleic acids, such as mRNA nucleic acids), in some embodiments, comprise various (more than one) different types of standard and/or modified nucleotides and nucleosides. In some embodiments, a particular region of a nucleic acid contains one, two or more (optionally different) types of standard and/or modified nucleotides and nucleosides.

In some embodiments, a modified RNA nucleic acid (e.g., a modified mRNA nucleic acid), introduced to a cell or organism, exhibits reduced degradation in the cell or organism, respectively, relative to an unmodified nucleic acid comprising standard nucleotides and nucleosides.

In some embodiments, a modified RNA nucleic acid (e.g., a modified mRNA nucleic acid), introduced into a cell or organism, may exhibit reduced immunogenicity in the cell or organism, respectively (e.g., a reduced innate response) relative to an unmodified nucleic acid comprising standard nucleotides and nucleosides.

Nucleic acids (e.g., RNA nucleic acids, such as mRNA nucleic acids), in some embodiments, comprise non-natural modified nucleotides that are introduced during synthesis or post-synthesis of the nucleic acids to achieve desired functions or properties. The modifications may be present on internucleotide linkages, purine or pyrimidine bases, or sugars. The modification may be introduced with chemical synthesis or with a polymerase enzyme at the terminal of a chain or anywhere else in the chain. Any of the regions of a nucleic acid may be chemically modified.

The present disclosure provides for modified nucleosides and nucleotides of a nucleic acid (e.g., RNA nucleic acids, such as mRNA nucleic acids). A “nucleoside” refers to a compound containing a sugar molecule (e.g., a pentose or ribose) or a derivative thereof in combination with an organic base (e.g., a purine or pyrimidine) or a derivative thereof (also referred to herein as “nucleobase”). A “nucleotide” refers to a nucleoside, including a phosphate group. Modified nucleotides may by synthesized by any useful method, such as, for example, chemically, enzymatically, or recombinantly, to include one or more modified or non-natural nucleosides. Nucleic acids can comprise a region or regions of linked nucleosides. Such regions may have variable backbone linkages. The linkages can be standard phosphodiester linkages, in which case the nucleic acids would comprise regions of nucleotides.

Modified nucleotide base pairing encompasses not only the standard adenosine-thymine, adenosine-uracil, or guanosine-cytosine base pairs, but also base pairs formed between nucleotides and/or modified nucleotides comprising non-standard or modified bases, wherein the arrangement of hydrogen bond donors and hydrogen bond acceptors permits hydrogen bonding between a non-standard base and a standard base or between two complementary non-standard base structures, such as, for example, in those nucleic acids having at least one chemical modification. One example of such non-standard base pairing is the base pairing between the modified nucleotide inosine and adenine, cytosine or uracil. Any combination of base/sugar or linker may be incorporated into nucleic acids of the present disclosure.

In some embodiments, modified nucleobases in nucleic acids (e.g., RNA nucleic acids, such as mRNA nucleic acids) comprise 1-methyl-pseudouridine (mly), 1-ethyl-pseudouridine (ely), 5-methoxy-uridine (mo5U), 5-methyl-cytidine (m5C), and/or pseudouridine (y). In some embodiments, modified nucleobases in nucleic acids (e.g., RNA nucleic acids, such as mRNA nucleic acids) comprise 5-methoxymethyl uridine, 5-methylthio uridine, 1-methoxymethyl pseudouridine, 5-methyl cytidine, and/or 5-methoxy cytidine. In some embodiments, the polyribonucleotide includes a combination of at least two (e.g., 2, 3, 4 or more) of any of the aforementioned modified nucleobases, including but not limited to chemical modifications.

In some embodiments, a mRNA of the disclosure comprises 1-methyl-pseudouridine (in h|/ substitutions at one or more or all uridine positions of the nucleic acid.

In some embodiments, a mRNA of the disclosure comprises 1-methyl-pseudouridine (in h|/) substitutions at one or more or all uridine positions of the nucleic acid and 5-methyl cytidine substitutions at one or more or all cytidine positions of the nucleic acid.

In some embodiments, a mRNA of the disclosure comprises pseudouridine (y) substitutions at one or more or all uridine positions of the nucleic acid.

In some embodiments, a mRNA of the disclosure comprises pseudouridine (y) substitutions at one or more or all uridine positions of the nucleic acid and 5-methyl cytidine substitutions at one or more or all cytidine positions of the nucleic acid.

In some embodiments, a mRNA of the disclosure comprises uridine at one or more or all uridine positions of the nucleic acid.

In some embodiments, mRNAs are uniformly modified (e.g., fully modified, modified throughout the entire sequence) for a particular modification. For example, a nucleic acid can be uniformly modified with 1-methyl-pseudouridine, meaning that all uridine residues in the mRNA sequence are replaced with 1-methyl-pseudouridine. Similarly, a nucleic acid can be uniformly modified for any type of nucleoside residue present in the sequence by replacement with a modified residue such as those set forth above.

The nucleic acids of the present disclosure may be partially or fully modified along the entire length of the molecule. For example, one or more or all or a given type of nucleotide (e.g., purine or pyrimidine, or any one or more or all of A, G, U, C) may be uniformly modified in a nucleic acid of the disclosure, or in a predetermined sequence region thereof (e.g., in the mRNA including or excluding the poly (A) tail). In some embodiments, all nucleotides X in a nucleic acid of the present disclosure (or in a sequence region thereof) are modified nucleotides, wherein X may be any one of nucleotides A, G, U, C, or any one of the combinations A+G, A+U, A+C, G+U, G+C, U+C, A+G+U, A+G+C, G+U+C or A+G+C.

The nucleic acid may contain from about 1% to about 100% modified nucleotides (either in relation to overall nucleotide content, or in relation to one or more types of nucleotide, i.e., any one or more of A, G, U or C) or any intervening percentage (e.g., from 1% to 20%, from 1% to 25%, from 1% to 50%, from 1% to 60%, from 1% to 70%, from 1% to 80%, from 1% to 90%, from 1% to 95%, from 10% to 20%, from 10% to 25%, from 10% to 50%, from 10% to 60%, from 10% to 70%, from 10% to 80%, from 10% to 90%, from 10% to 95%, from 10% to 100%, from 20% to 25%, from 20% to 50%, from 20% to 60%, from 20% to 70%, from 20% to 80%, from 20% to 90%, from 20% to 95%, from 20% to 100%, from 50% to 60%, from 50% to 70%, from 50% to 80%, from 50% to 90%, from 50% to 95%, from 50% to 100%, from 70% to 80%, from 70% to 90%, from 70% to 95%, from 70% to 100%, from 80% to 90%, from 80% to 95%, from 80% to 100%, from 90% to 95%, from 90% to 100%, and from 95% to 100%). It will be understood that any remaining percentage is accounted for by the presence of unmodified A, G, U, or C.

The mRNAs may contain at a minimum 1% and at maximum 100% modified nucleotides, or any intervening percentage, such as at least 5% modified nucleotides, at least 10% modified nucleotides, at least 25% modified nucleotides, at least 50% modified nucleotides, at least 80% modified nucleotides, or at least 90% modified nucleotides. For example, the nucleic acids may contain a modified pyrimidine such as a modified uracil or cytosine. In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90% or 100% of the uracil in the nucleic acid is replaced with a modified uracil (e.g., a 5-substituted uracil). The modified uracil can be replaced by a compound having a single unique structure or can be replaced by a plurality of compounds having different structures (e.g., 2, 3, 4 or more unique structures). In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90% or 100% of the cytosine in the nucleic acid is replaced with a modified cytosine (e.g., a 5-substituted cytosine). The modified cytosine can be replaced by a compound having a single unique structure or can be replaced by a plurality of compounds having different structures (e.g., 2, 3, 4 or more unique structures).

Untranslated Regions (UTRs)

The mRNAs of the present disclosure may comprise one or more regions or parts which act or function as an untranslated region. Where mRNAs are designed to encode at least one antigen of interest, the nucleic may comprise one or more of these untranslated regions (UTRs). Wild-type untranslated regions of a nucleic acid are transcribed but not translated. In mRNA, the 5' UTR starts at the transcription start site and continues to the start codon but does not include the start codon; whereas the 3' UTR starts immediately following the stop codon and continues until the transcriptional termination signal. There is growing body of evidence about the regulatory roles played by the UTRs in terms of stability of the nucleic acid molecule and translation. The regulatory features of a UTR can be incorporated into the polynucleotides of the present disclosure to, among other things, enhance the stability of the molecule. The specific features can also be incorporated to ensure controlled down-regulation of the transcript in case they are misdirected to undesired organs sites. A variety of 5 ’UTR and 3 ’UTR sequences are known and available in the art.

A 5' UTR is region of an mRNA that is directly upstream (5') from the start codon (the first codon of an mRNA transcript translated by a ribosome). A 5' UTR does not encode a protein (is non-coding). Natural 5'UTRs have features that play roles in translation initiation. They harbor signatures like Kozak sequences which are commonly known to be involved in the process by which the ribosome initiates translation of many genes. Kozak sequences have the consensus CCR(A/G)CCAUGG, where R is a purine (adenine or guanine) three bases upstream of the start codon (AUG), which is followed by another 'G'.5'UTR also have been known to form secondary structures which are involved in elongation factor binding.

In some embodiments of the disclosure, a 5’ UTR is a heterologous UTR, i.e., is a UTR found in nature associated with a different ORF. In another embodiment, a 5’ UTR is a synthetic UTR, i.e., does not occur in nature. Synthetic UTRs include UTRs that have been mutated to improve their properties, e.g., which increase gene expression as well as those which are completely synthetic. Exemplary 5’ UTRs include Xenopus or human derived a-globin or b- globin (8278063; 9012219), human cytochrome b-245 a polypeptide, and hydroxysteroid (17b) dehydrogenase, and Tobacco etch virus (US8278063, 9012219). CMV immediate-early 1 (IE1) gene (US20140206753, WO2013/185069), the sequence GGGAUCCUACC (SEQ ID NO: 29) (WO2014144196) may also be used. In another embodiment, 5' UTR of a TOP gene is a 5' UTR of a TOP gene lacking the 5' TOP motif (the oligopyrimidine tract) (e.g., WO/2015101414, W02015101415, WO/2015/062738, WO2015024667, WO2015024667; 5' UTR element derived from ribosomal protein Large 32 (L32) gene (WO/2015101414, W02015101415, WO/2015/062738), 5' UTR element derived from the 5'UTR of an hydroxysteroid (17-|3) dehydrogenase 4 gene (HSD17B4) (WO2015024667), or a 5' UTR element derived from the 5' UTR of ATP5A1 (WO2015024667) can be used. In some embodiments, an internal ribosome entry site (IRES) is used instead of a 5' UTR.

In some embodiments, a 5' UTR of the present disclosure comprises a sequence selected from SEQ ID NO: 1 and SEQ ID NO: 2.

A 3' UTR is region of an mRNA that is directly downstream (3') from the stop codon (the codon of an mRNA transcript that signals a termination of translation). A 3' UTR does not encode a protein (is non-coding). Natural or wild type 3' UTRs are known to have stretches of adenosines and uridines embedded in them. These AU rich signatures are particularly prevalent in genes with high rates of turnover. Based on their sequence features and functional properties, the AU rich elements (AREs) can be separated into three classes (Chen et al, 1995): Class I AREs contain several dispersed copies of an AUUUA motif within U-rich regions. C-Myc and MyoD contain class I AREs. Class II AREs possess two or more overlapping UUAUUUA(U/A)(U/A) nonamers. Molecules containing this type of AREs include GM-CSF and TNF-a. Class III ARES are less well defined. These U rich regions do not contain an AUUUA motif. c-Jun and Myogenin are two well-studied examples of this class. Most proteins binding to the AREs are known to destabilize the messenger, whereas members of the ELAV family, most notably HuR, have been documented to increase the stability of mRNA. HuR binds to AREs of all the three classes. Engineering the HuR specific binding sites into the 3' UTR of nucleic acid molecules will lead to HuR binding and thus, stabilization of the message in vivo.

Introduction, removal or modification of 3' UTR AU rich elements (AREs) can be used to modulate the stability of nucleic acids (e.g., RNA) of the disclosure. When engineering specific nucleic acids, one or more copies of an ARE can be introduced to make nucleic acids of the disclosure less stable and thereby curtail translation and decrease production of the resultant protein. Likewise, AREs can be identified and removed or mutated to increase the intracellular stability and thus increase translation and production of the resultant protein. Transfection experiments can be conducted in relevant cell lines, using nucleic acids of the disclosure and protein production can be assayed at various time points post-transfection. For example, cells can be transfected with different ARE-engineering molecules and by using an ELISA kit to the relevant protein and assaying protein produced at 6 hour, 12 hour, 24 hour, 48 hour, and 7 days post-transfection.

Those of ordinary skill in the art will understand that 5’UTRs that are heterologous or synthetic may be used with any desired 3’ UTR sequence. For example, a heterologous 5’UTR may be used with a synthetic 3 ’UTR with a heterologous 3” UTR.

Non-UTR sequences may also be used as regions or subregions within a nucleic acid. For example, introns or portions of introns sequences may be incorporated into regions of nucleic acid of the disclosure. Incorporation of intronic sequences may increase protein production as well as nucleic acid levels.

Combinations of features may be included in flanking regions and may be contained within other features. For example, the ORF may be flanked by a 5' UTR which may contain a strong Kozak translational initiation signal and/or a 3' UTR which may include an oligo(dT) sequence for templated addition of a poly-A tail. 5' UTR may comprise a first polynucleotide fragment and a second polynucleotide fragment from the same and/or different genes such as the 5' UTRs described in US Patent Application Publication No.20100293625 and PCT/US2014/069155, herein incorporated by reference in its entirety.

It should be understood that any UTR from any gene may be incorporated into the regions of a nucleic acid. Furthermore, multiple wild-type UTRs of any known gene may be utilized. It is also within the scope of the present disclosure to provide artificial UTRs which are not variants of wild type regions. These UTRs or portions thereof may be placed in the same orientation as in the transcript from which they were selected or may be altered in orientation or location. Hence a 5' or 3' UTR may be inverted, shortened, lengthened, made with one or more other 5' UTRs or 3' UTRs. As used herein, the term “altered” as it relates to a UTR sequence, means that the UTR has been changed in some way in relation to a reference sequence. For example, a 3' UTR or 5' UTR may be altered relative to a wild-type or native UTR by the change in orientation or location as taught above or may be altered by the inclusion of additional nucleotides, deletion of nucleotides, swapping or transposition of nucleotides. Any of these changes producing an “altered” UTR (whether 3' or 5') comprise a variant UTR.

In some embodiments, a double, triple or quadruple UTR such as a 5' UTR or 3' UTR may be used. As used herein, a “double” UTR is one in which two copies of the same UTR are encoded either in series or substantially in series. For example, a double beta-globin 3' UTR may be used as described in US Patent publication 20100129877, the contents of which are incorporated herein by reference in its entirety. It is also within the scope of the present disclosure to have patterned UTRs. As used herein “patterned UTRs” are those UTRs which reflect a repeating or alternating pattern, such as AB AB AB or AABBAABBAABB or ABCABCABC or variants thereof repeated once, twice, or more than 3 times. In these patterns, each letter, A, B, or C represent a different UTR at the nucleotide level.

In some embodiments, flanking regions are selected from a family of transcripts whose proteins share a common function, structure, feature or property. For example, polypeptides of interest may belong to a family of proteins which are expressed in a particular cell, tissue or at some time during development. The UTRs from any of these genes may be swapped for any other UTR of the same or different family of proteins to create a new polynucleotide. As used herein, a “family of proteins” is used in the broadest sense to refer to a group of two or more polypeptides of interest which share at least one function, structure, feature, localization, origin, or expression pattern.

The untranslated region may also include translation enhancer elements (TEE). As a nonlimiting example, the TEE may include those described in US Application No.20090226470, herein incorporated by reference in its entirety, and those known in the art.

Non-coding Sequences

Aspects of the disclosure relate to multivalent RNA compositions which comprise mRNAs, e.g., 2-15 mRNA polynucleotides each comprising a distinct open reading frame (ORF) encoding an influenza virus antigenic polypeptide, wherein each mRNA polynucleotide comprises one or more non-coding sequences in an untranslated region (UTR) having unique identifier sequences (non-coding sequences). As used herein, “non-coding sequence” refers to a sequence of a biological molecule (e.g., nucleic acid, protein, etc.) that when combined with the sequence another biological molecule serves to identify the other biological molecule. Typically, a non-coding sequence is a heterologous sequence that is incorporated within or appended to a sequence of a target biological molecule and utilized as a reference in order to identify a target molecule of interest. In some embodiments, a non-coding sequence is a sequence of a nucleic acid (e.g., a heterologous or synthetic nucleic acid) that is incorporated within or appended to a target nucleic acid and utilized as a reference in order to identify the target nucleic acid. In some embodiments, a non-coding sequence is of the formula (N)n. In some embodiments, n is an integer in the range of 5 to 20, 5 to 10, 10 to 20, 7 to 20, or 7 to 30. In some embodiments, n is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more. In some embodiments, each N is a nucleotide that is independently selected from A, G, T, U, and C, or analogues thereof. Thus, some embodiments comprise nucleic acids (e.g., mRNAs) that (i) have a target sequence of interest (e.g., a coding sequence (e.g., that encodes an antigen protein or antigenic polypeptide)); and (ii) comprises a unique non-coding sequence.

In some embodiments, one or more in vitro transcribed mRNAs comprise one or more non-coding sequences in an untranslated region (UTR), such as a 5’ UTR or 3’ UTR. Inclusion of a non-coding sequence in the UTR of an mRNA prevents non-coding sequence from being translated into a peptide. In some embodiments, a non-coding sequence is positioned in a 3’ UTR of an mRNA. In some embodiments, the non-coding sequence is positioned upstream of the polyA tail of the mRNA. In some embodiments, the non-coding sequence is positioned downstream of (e.g., after) the polyA tail of the mRNA. In some embodiments, the non-coding sequence is positioned between the last codon of the ORF of the mRNA and the first “A” of the polyA tail of the mRNA. In some embodiments, a polynucleotide non-coding sequence positioned in a UTR comprises between 1 and 10 nucleotides (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides). In some embodiments, UTR comprising a polynucleotide non-coding sequence further comprises one or more (e.g., 1, 2, 3, or more) RNAse cleavage sites, such as RNase H cleavage sites. In some embodiments, each different RNA of a multivalent RNA composition comprises a different (e.g., unique) non-coding sequence. In some embodiments, RNAs of a multivalent RNA composition are detected and/or purified according to the polynucleotide noncoding sequences of the RNAs. In some embodiments, the mRNA non-coding sequences are used to identify the presence of mRNA or determine a relative ratio of different mRNAs in a sample (e.g., a reaction product or a drug product). In some embodiments, the mRNA noncoding sequences are detected using one or more of deep sequencing, PCR, and Sanger sequencing. Exemplary non-coding sequences include: AACGUGAU; AAACAUCG; ATGCCUAA; AGUGGUCA; ACCACUGU; ACAUUGGC; CAGAUCUG; CAUCAAGU; CGCUGAUC; ACAAGCUA; CUGUAGCC; AGUACAAG; AACAACCA; AACCGAGA; AACGCUUA; AAGACGGA; AAGGUACA; ACACAGAA; ACAGCAGA; ACCUCCAA; ACGCUCGA; ACGUAUCA; ACUAUGCA; AGAGUCAA; AGAUCGCA; AGCAGGAA; AGUCACUA; AUCCUGUA; AUUGAGGA; CAACCACA; GACUAGUA; CAAUGGAA; CACUUCGA; CAGCGUUA; CAUACCAA; CCAGUUCA; CCGAAGUA; ACAGUG; CGAUGU; UUAGGC; AUCACG; and UGACCA.

In some embodiments the multivalent RNA composition is produced by a method comprising:

(a) combining a linearized first DNA molecule encoding the first mRNA polynucleotide, a linearized second DNA molecule encoding the second mRNA polynucleotide, and a linearized third, fourth, fifth, sixth, seventh, eighth, ninth or tenth DNA molecule encoding the third, fourth, fifth, sixth, seventh, eighth, ninth or tenth mRNA polynucleotide into a single reaction vessel, wherein the first DNA molecule, the second DNA molecule, and the third, fourth, fifth, sixth, seventh, eighth, ninth or tenth DNA molecule are obtained from different sources; and

(b) simultaneously in vitro transcribing the linearized first DNA molecule, the linearized second DNA molecule and the linearized third, fourth, fifth, sixth, seventh, eighth, ninth or tenth DNA molecule to obtain a multivalent RNA composition. The different sources may be bacterial cell cultures which may not be co-cultured. In some embodiments the amounts of the first, second and third, fourth, fifth, sixth, seventh, eighth, ninth or tenth DNA molecules present in the reaction mixture prior to the start of the IVT have been normalized.

In vitro Transcription of RNA cDNA encoding the polynucleotides described herein may be transcribed using an in vitro transcription (IVT) system. In vitro transcription of RNA is known in the art and is described in International Publication WO 2014/152027, which is incorporated by reference herein in its entirety. In some embodiments, the RNA of the present disclosure is prepared in accordance with any one or more of the methods described in WO 2018/053209 and WO 2019/036682, each of which is incorporated by reference herein.

In some embodiments, the RNA transcript is generated using a non-amplified, linearized DNA template in an in vitro transcription reaction to generate the RNA transcript. In some embodiments, the template DNA is isolated DNA. In some embodiments, the template DNA is cDNA. In some embodiments, the cDNA is formed by reverse transcription of a RNA polynucleotide, for example, but not limited to influenza virus mRNA. In some embodiments, cells, e.g., bacterial cells, e.g., E. coli, e.g., DH-1 cells are transfected with the plasmid DNA template. In some embodiments, the transfected cells are cultured to replicate the plasmid DNA which is then isolated and purified. In some embodiments, the DNA template includes a RNA polymerase promoter, e.g., a T7 promoter located 5 ' to and operably linked to the gene of interest.

In some embodiments, an in vitro transcription template encodes a 5' untranslated (UTR) region, contains an open reading frame, and encodes a 3' UTR and a poly(A) tail. The particular nucleic acid sequence composition and length of an in vitro transcription template will depend on the mRNA encoded by the template.

A “5' untranslated region” (UTR) refers to a region of an mRNA that is directly upstream (z.e., 5') from the start codon (z.e., the first codon of an mRNA transcript translated by a ribosome) that does not encode a polypeptide. When RNA transcripts are being generated, the 5’ UTR may comprise a promoter sequence. Such promoter sequences are known in the art. It should be understood that such promoter sequences will not be present in a vaccine of the disclosure.

A “3' untranslated region” (UTR) refers to a region of an mRNA that is directly downstream (z.e., 3') from the stop codon (z.e., the codon of an mRNA transcript that signals a termination of translation) that does not encode a polypeptide.

An “open reading frame” is a continuous stretch of DNA beginning with a start codon (e.g., methionine (ATG)), and ending with a stop codon (e.g., TAA, TAG or TGA) and encodes a polypeptide.

A “poly(A) tail” is a region of mRNA that is downstream, e.g., directly downstream (z.e., 3'), from the 3' UTR that contains multiple, consecutive adenosine monophosphates. A poly(A) tail may contain 10 to 300 adenosine monophosphates. For example, a poly(A) tail may contain 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290 or 300 adenosine monophosphates. In some embodiments, a poly(A) tail contains 50 to 250 adenosine monophosphates. In a relevant biological setting (e.g., in cells, in vivo) the poly(A) tail functions to protect mRNA from enzymatic degradation, e.g., in the cytoplasm, and aids in transcription termination, and/or export of the mRNA from the nucleus and translation.

In some embodiments, a nucleic acid includes 200 to 3,000 nucleotides. For example, a nucleic acid may include 200 to 500, 200 to 1000, 200 to 1500, 200 to 3000, 500 to 1000, 500 to 1500, 500 to 2000, 500 to 3000, 1000 to 1500, 1000 to 2000, 1000 to 3000, 1500 to 3000, or 2000 to 3000 nucleotides).

An in vitro transcription system typically comprises a transcription buffer, nucleotide triphosphates (NTPs), an RNase inhibitor and a polymerase.

The NTPs may be manufactured in house, may be selected from a supplier, or may be synthesized as described herein. The NTPs may be selected from, but are not limited to, those described herein including natural and unnatural (modified) NTPs.

Any number of RNA polymerases or variants may be used in the method of the present disclosure. The polymerase may be selected from, but is not limited to, a phage RNA polymerase, e.g., a T7 RNA polymerase, a T3 RNA polymerase, a SP6 RNA polymerase, and/or mutant polymerases such as, but not limited to, polymerases able to incorporate modified nucleic acids and/or modified nucleotides, including chemically modified nucleic acids and/or nucleotides. Some embodiments exclude the use of DNase. In some embodiments, the RNA transcript is capped via enzymatic capping. In some embodiments, the RNA comprises 5' terminal cap, for example, 7mG(5’)ppp(5’)NlmpNp.

Chemical Synthesis

Solid-phase chemical synthesis. Nucleic acids the present disclosure may be manufactured in whole or in part using solid phase techniques. Solid-phase chemical synthesis of nucleic acids is an automated method wherein molecules are immobilized on a solid support and synthesized step by step in a reactant solution. Solid-phase synthesis is useful in site-specific introduction of chemical modifications in the nucleic acid sequences.

Liquid Phase Chemical Synthesis. The synthesis of nucleic acids of the present disclosure by the sequential addition of monomer building blocks may be carried out in a liquid phase.

Combination of Synthetic Methods. The synthetic methods discussed above each has its own advantages and limitations. Attempts have been conducted to combine these methods to overcome the limitations. Such combinations of methods are within the scope of the present disclosure. The use of solid-phase or liquid-phase chemical synthesis in combination with enzymatic ligation provides an efficient way to generate long chain nucleic acids that cannot be obtained by chemical synthesis alone.

Ligation of Nucleic Acid Regions or Subregions

Assembling nucleic acids by a ligase may also be used. DNA or RNA ligases promote intermolecular ligation of the 5’ and 3’ ends of polynucleotide chains through the formation of a phosphodiester bond. Nucleic acids such as chimeric polynucleotides and/or circular nucleic acids may be prepared by ligation of one or more regions or subregions. DNA fragments can be joined by a ligase catalyzed reaction to create recombinant DNA with different functions. Two oligodeoxynucleotides, one with a 5’ phosphoryl group and another with a free 3’ hydroxyl group, serve as substrates for a DNA ligase.

Purification

Purification of the nucleic acids described herein may include, but is not limited to, nucleic acid clean-up, quality assurance and quality control. Clean-up may be performed by methods known in the arts such as, but not limited to, AGENCOURT® beads (Beckman Coulter Genomics, Danvers, MA), poly-T beads, LNATM oligo-T capture probes (EXIQON® Inc, Vedbaek, Denmark) or HPLC based purification methods such as, but not limited to, strong anion exchange HPLC, weak anion exchange HPLC, reverse phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC-HPLC). The term “purified” when used in relation to a nucleic acid such as a “purified nucleic acid” refers to one that is separated from at least one contaminant. A “contaminant” is any substance that makes another unfit, impure or inferior. Thus, a purified nucleic acid (e.g., DNA and RNA) is present in a form or setting different from that in which it is found in nature, or a form or setting different from that which existed prior to subjecting it to a treatment or purification method.

A quality assurance and/or quality control check may be conducted using methods such as, but not limited to, gel electrophoresis, UV absorbance, or analytical HPLC.

In some embodiments, the nucleic acids may be sequenced by methods including, but not limited to reverse-transcriptase-PCR.

Quantification

In some embodiments, the nucleic acids of the present disclosure may be quantified in exosomes or when derived from one or more bodily fluid. Bodily fluids include peripheral blood, serum, plasma, ascites, urine, cerebrospinal fluid (CSF), sputum, saliva, bone marrow, synovial fluid, aqueous humor, amniotic fluid, cerumen, breast milk, broncheoalveolar lavage fluid, semen, prostatic fluid, cowper's fluid or pre-ejaculatory fluid, sweat, fecal matter, hair, tears, cyst fluid, pleural and peritoneal fluid, pericardial fluid, lymph, chyme, chyle, bile, interstitial fluid, menses, pus, sebum, vomit, vaginal secretions, mucosal secretion, stool water, pancreatic juice, lavage fluids from sinus cavities, bronchopulmonary aspirates, blastocyl cavity fluid, and umbilical cord blood. Alternatively, exosomes may be retrieved from an organ selected from the group consisting of lung, heart, pancreas, stomach, intestine, bladder, kidney, ovary, testis, skin, colon, breast, prostate, brain, esophagus, liver, and placenta.

Assays may be performed using construct specific probes, cytometry, qRT-PCR, realtime PCR, PCR, flow cytometry, electrophoresis, mass spectrometry, or combinations thereof while the exosomes may be isolated using immunohistochemical methods such as enzyme linked immunosorbent assay (ELISA) methods. Exosomes may also be isolated by size exclusion chromatography, density gradient centrifugation, differential centrifugation, nanomembrane ultrafiltration, immunoabsorbent capture, affinity purification, microfluidic separation, or combinations thereof.

These methods afford the investigator the ability to monitor, in real time, the level of nucleic acids remaining or delivered. This is possible because the nucleic acids of the present disclosure, in some embodiments, differ from the endogenous forms due to the structural or chemical modifications.

In some embodiments, the nucleic acid may be quantified using methods such as, but not limited to, ultraviolet visible spectroscopy (UV/Vis). A non-limiting example of a UV/Vis spectrometer is a NANODROP® spectrometer (ThermoFisher, Waltham, MA). The quantified nucleic acid may be analyzed in order to determine if the nucleic acid may be of proper size, check that no degradation of the nucleic acid has occurred. Degradation of the nucleic acid may be checked by methods such as, but not limited to, agarose gel electrophoresis, HPLC based purification methods such as, but not limited to, strong anion exchange HPLC, weak anion exchange HPLC, reverse phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC- HPLC), liquid chromatography-mass spectrometry (LCMS), capillary electrophoresis (CE) and capillary gel electrophoresis (CGE).

Lipid Nanoparticles (LNPs)

In some embodiments, the RNA (e.g., mRNA) of the disclosure is formulated in a lipid nanoparticle (LNP). Lipid nanoparticles typically comprise ionizable cationic lipid, non-cationic lipid, sterol and PEG lipid components along with the nucleic acid cargo of interest. The lipid nanoparticles of the disclosure can be generated using components, compositions, and methods as are generally known in the art, see for example PCT/US2016/052352; PCT/US2016/068300; PCT/US2017/037551; PCT/US2015/027400; PCT/US2016/047406; PCT/US2016/000129; PCT/US2016/014280; PCT/US2016/014280; PCT/US2017/038426; PCT/US2014/027077; PCT/US2014/055394; PCT/US2016/052117; PCT/US2012/069610; PCT/US2017/027492; PCT/US2016/059575 and PCT/US2016/069491 all of which are incorporated by reference herein in their entirety.

Vaccine compositions of the present disclosure are typically formulated in lipid nanoparticle. In some embodiments, the lipid nanoparticle comprises at least one ionizable cationic lipid, at least one non-cationic lipid/neutral lipid, at least one sterol, and/or at least one polyethylene glycol (PEG)-modified lipid.

In some embodiments, the lipid nanoparticle comprises 20-60 mol% ionizable cationic lipid or 40-55 mol% ionizable cationic lipid. For example, the lipid nanoparticle may comprise 20-50 mol%, 20-40 mol%, 20-30 mol%, 30-60 mol%, 30-50 mol%, 30-40 mol%, 40-60 mol%, 40-50 mol%, or 50-60 mol% ionizable cationic lipid. In some embodiments, the lipid nanoparticle comprises 20 mol%, 30 mol%, 40 mol%, 50, or 60 mol% ionizable cationic lipid.

In some embodiments, the lipid nanoparticle comprises 5-25 mol% non-cationic lipid/neutral lipid or 5-15 mol% non-cationic lipid/neutral lipid. For example, the lipid nanoparticle may comprise 5-20 mol%, 5-15 mol%, 5-10 mol%, 10-25 mol%, 10-20 mol%, 10- 25 mol%, 15-25 mol%, 15-20 mol%, or 20-25 mol% non-cationic lipid/neutral lipid. In some embodiments, the lipid nanoparticle comprises 5 mol%, 10 mol%, 15 mol%, 20 mol%, or 25 mol% non-cationic lipid/neutral lipid. In some embodiments, the lipid nanoparticle comprises 25-55 mol% sterol or 35-45 mol% sterol. For example, the lipid nanoparticle may comprise 25-50 mol%, 25-45 mol%, 25-40 mol%, 25-35 mol%, 25-30 mol%, 30-55 mol%, 30-50 mol%, 30-45 mol%, 30-40 mol%, 30-35 mol%, 35-55 mol%, 35-50 mol%, 35-45 mol%, 35-40 mol%, 40-55 mol%, 40-50 mol%, 40-45 mol%, 45-55 mol%, 45-50 mol%, or 50-55 mol% sterol. In some embodiments, the lipid nanoparticle comprises 25 mol%, 30 mol%, 35 mol%, 40 mol%, 45 mol%, 50 mol%, or 55 mol% sterol.

In some embodiments, the lipid nanoparticle comprises 0.5-15 mol% PEG-modified lipid or 1-5 mol% PEG-modified lipid. For example, the lipid nanoparticle may comprise 0.5-10 mol%, 0.5-5 mol%, 1-15 mol%, 1-10 mol%, 1-5 mol%, 2-15 mol%, 2-10 mol%, 2-5 mol%, 5-15 mol%, 5-10 mol%, or 10-15 mol%. In some embodiments, the lipid nanoparticle comprises 0.5 mol%, 1 mol%, 2 mol%, 3 mol%, 4 mol%, 5 mol%, 6 mol%, 7 mol%, 8 mol%, 9 mol%, 10 mol%, 11 mol%, 12 mol%, 13 mol%, 14 mol%, or 15 mol% PEG-modified lipid.

In some embodiments, the lipid nanoparticle comprises 20-60 mol% ionizable cationic lipid, 5-25 mol% non-cationic lipid, 25-55 mol% sterol, and 0.5-15 mol% PEG-modified lipid.

In some embodiments, an ionizable cationic lipid of the disclosure comprises heptadecan-9-yl 8 ((2 hydroxyethyl)(6 oxo 6-(undecyloxy)hexyl)amino)octanoate. Thus, in some embodiments, an ionizable cationic lipid of the disclosure comprises a compound having structure:

(Compound 1).

In some embodiments, an ionizable cationic lipid of the disclosure comprises a compound having structure:

(Compound 2).

In some embodiments, a non-cationic lipid of the disclosure comprises 1,2-distearoyl-sn- glycero-3-phosphocholine (DSPC), l,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), l,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-gly cero- phosphocholine (DMPC), l,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl- sn-glycero-3-phosphocholine (DPPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1- palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), l,2-di-O-octadecenyl-sn-glycero-3- phosphocholine (18:0 Diether PC), l-oleoyl-2 cholesterylhemisuccinoyl-sn-glycero-3- phosphocholine (OChemsPC), l-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2- dilinolenoyl-sn-glycero-3-phosphocholine,l,2-diarachidonoyl-sn-glycero-3-phosphocholine, l,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, l,2-diphytanoyl-sn-glycero-3- phosphoethanolamine (ME 16.0 PE), l,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2- dilinoleoyl-sn-glycero-3-phosphoethanolamine, l,2-dilinolenoyl-sn-glycero-3- phosphoethanolamine, 1 ,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1 ,2- didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, l,2-dioleoyl-sn-glycero-3-phospho-rac- (1-glycerol) sodium salt (DOPG), sphingomyelin, and mixtures thereof.

In some embodiments, a PEG modified lipid of the disclosure comprises a PEG-modified phosphatidylethanolamine, a PEG-modified phosphatidic acid, a PEG-modified ceramide, a PEG-modified dialkylamine, a PEG-modified diacylglycerol, a PEG-modified dialkylglycerol, and mixtures thereof. In some embodiments, the PEG-modified lipid is DMG-PEG, PEG-c- DOMG (also referred to as PEG-DOMG), PEG-DSG and/or PEG-DPG.

In some embodiments, a sterol of the disclosure comprises cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, ursolic acid, alphatocopherol, and mixtures thereof.

In some embodiments, a LNP of the disclosure comprises an ionizable cationic lipid of Compound 1, wherein the non-cationic lipid is DSPC, the structural lipid that is cholesterol, and the PEG lipid is DMG-PEG.

In some embodiments, the lipid nanoparticle comprises 45 - 55 mole percent (mol%) ionizable cationic lipid. For example, lipid nanoparticle may comprise 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, or 55 mol% ionizable cationic lipid.

In some embodiments, the lipid nanoparticle comprises 5 - 15 mol% DSPC. For example, the lipid nanoparticle may comprise 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 mol% DSPC.

In some embodiments, the lipid nanoparticle comprises 35 - 40 mol% cholesterol. For example, the lipid nanoparticle may comprise 35, 36, 37, 38, 39, or 40 mol% cholesterol.

In some embodiments, the lipid nanoparticle comprises 1 - 2 mol% DMG-PEG. For example, the lipid nanoparticle may comprise 1, 1.5, or 2 mol% DMG-PEG.

In some embodiments, the lipid nanoparticle comprises 50 mol% ionizable cationic lipid, 10 mol% DSPC, 38.5 mol% cholesterol, and 1.5 mol% DMG-PEG.

In some embodiments, a LNP of the disclosure comprises an N:P ratio of from about 2:1 to about 30:1. In some embodiments, a LNP of the disclosure comprises an N:P ratio of about 6:1.

In some embodiments, a LNP of the disclosure comprises an N:P ratio of about 3:1.

In some embodiments, a LNP of the disclosure comprises a wt/wt ratio of the ionizable cationic lipid component to the RNA of from about 10:1 to about 100:1.

In some embodiments, a LNP of the disclosure comprises a wt/wt ratio of the ionizable cationic lipid component to the RNA of about 20:1.

In some embodiments, a LNP of the disclosure comprises a wt/wt ratio of the ionizable cationic lipid component to the RNA of about 10:1.

In some embodiments, a LNP of the disclosure has a mean diameter from about 50 nm to about 150 nm.

In some embodiments, a LNP of the disclosure has a mean diameter from about 70 nm to about 120 nm.

Multivalent Vaccines

The compositions, as provided herein, may include RNA or multiple RNAs encoding two or more antigens of the same or different species. In some embodiments, composition includes an RNA or multiple RNAs encoding two or more influenza virus antigens. In some embodiments, the RNA may encode 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more influenza virus antigens.

In some embodiments, two or more different mRNA encoding antigens may be formulated in the same lipid nanoparticle (e.g., the four NA antigens and the four HA antigens are formulated in a single lipid nanoparticle). In other embodiments, two or more different RNA encoding antigens may be formulated in separate lipid nanoparticles (each RNA formulated in a single lipid nanoparticle). The lipid nanoparticles may then be combined and administered as a single vaccine composition (e.g., comprising multiple RNA encoding multiple antigens) or may be administered separately.

Combination Vaccines

The compositions, as provided herein, may include an RNA or multiple RNAs encoding two or more antigens of the same or different viral strains. Also provided herein are combination vaccines that include RNA encoding one or more influenza virus and one or more antigen(s) of a different organism. Thus, the vaccines of the present disclosure may be combination vaccines that target one or more antigens of the same strain/species, or one or more antigens of different strains/species, e.g., antigens which induce immunity to organisms which are found in the same geographic areas where the risk of influenza virus infection is high or organisms to which an individual is likely to be exposed to when exposed to an influenza virus.

Vaccination Methods

Provided herein are vaccine compositions and methods for inducing a neutralizing antibody response to at least one influenza protein (e.g., HA and/or or NA) in a subject. A subject may be any mammal, including anon-human primate and human subjects. Typically, a subject is a human subject.

Vaccine compositions herein (e.g., mRNA encoding influenza HA and NA formulated in a lipid nanoparticle) can be used as therapeutic composition, prophylactic compositions, or both therapeutic and prophylactic compositions. In some embodiments, the compositions are used in the priming of immune effector cells, for example, to activate peripheral blood mononuclear cells (PBMCs) ex vivo, which are then infused (re-infused) into a subject. The mRNAs encoding the influenza proteins is expressed and translated in vivo to produce the antigens, which then stimulates an immune response in the subject.

The compositions provided herein are administered, in some embodiments, in “effective amounts,” for example, therapeutically-effective and/or prophylactically-effective amounts. In some embodiments, an effective amount of a composition induces an influenza antigen- specific immune response. An effective amount of a composition (e.g., comprising RNA) is based, at least in part, on the target tissue, target cell type, means of administration, physical characteristics of the RNA (e.g., length, nucleotide composition, and/or extent of modified nucleosides), other components of the vaccine, and other determinants, such as age, body weight, height, sex and general health of the subject. Typically, an effective amount of a composition provides an induced or boosted immune response as a function of antigen production in the cells of the subject.

In some embodiments, an effective amount of the composition comprising mRNA having at least one chemical modification are more efficient than a composition containing a corresponding unmodified polynucleotide encoding the same antigen or a peptide antigen. Increased antigen production may be demonstrated by increased cell transfection (the percentage of cells transfected with an RNA composition), increased protein translation and/or expression from the RNA, decreased nucleic acid degradation (as demonstrated, for example, by increased duration of protein translation from a modified polynucleotide), or altered antigen specific immune response of the host cell.

In some embodiments, the compositions (comprising polynucleotides and their encoded polypeptides) in accordance with the present disclosure may be administered prophylactic ally or therapeutically as part of an active immunization scheme to healthy individuals or early in infection during the incubation phase or during active infection after onset of symptoms. In some embodiments, the amount of RNA provided to a cell, a tissue or a subject may be an amount effective for immune prophylaxis.

A method of eliciting an immune response in a subject against multiple influenza antigens is provided in aspects of the present disclosure. In some embodiments, a method involves administering to the subject a composition comprising mRNA having open reading frames encoding influenza proteins (e.g., influenza HA and NA proteins), thereby inducing in the subject an immune response specific to the influenza proteins, wherein an anti-HA protein antibody titer in the subject is increased following vaccination relative to an anti-HA protein antibody titer in an unvaccinated subject who has not been infected with influenza or who has been infected by has recovered and/or wherein an anti-NA protein antibody titer in the subject is increased following vaccination relative to an anti-NA protein antibody titer in an unvaccinated subject who has not been infected with influenza or who has been infected by has recovered. An “anti-HA protein antibody” is a serum antibody the binds specifically to an influenza HA protein. An “anti-NA protein antibody” is a serum antibody the binds specifically to an influenza NA protein.

A vaccine composition may be administered by any route that results in a therapeutically effective outcome. These include, but are not limited, to intradermal, intramuscular, intranasal, and/or subcutaneous administration. In some embodiments, a composition is administered intramuscularly (e.g., into a deltoid muscle).

The present disclosure provides methods comprising administering vaccine compositions to a subject in need thereof. The exact amount required may vary from subject to subject, depending on the species, age, and general condition of the subject, the severity of the disease, the particular composition, its mode of administration, its mode of activity, and the like. The mRNA is typically formulated in dosage unit form for ease of administration and uniformity of dosage. It will be understood, however, that the total daily usage of the mRNA may be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective, prophylactically effective, or appropriate imaging dose level for any particular subject may depend upon a variety of factors including the disorder being treated and the severity of the disorder; the activity of the specific compound employed; the specific composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, and rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidental with the specific compound employed; and like factors well known in the medical arts.

The effective amount of the RNA, as provided herein, may range from about 25 pg - 500 pg, administered as a single dose. In some embodiments, a total amount of mRNA administered to a subject is about 25 pg, 50 pg, about 100 pg, about 150 pg, about 200 pg, about 250 pg, or about 500 pg mRNA. In some embodiments, a total amount of mRNA administered to a subject is about 25 pg. In some embodiments, a total amount of mRNA administered to a subject is about 50 pg. In some embodiments, a total amount of mRNA administered to a subject is about 100 pg. . In some embodiments, a total amount of mRNA administered to a subject is about 150 pg. In some embodiments, a total amount of mRNA administered to a subject is about 200 pg. In some embodiments, a total amount of mRNA administered to a subject is about 250 pg. In some embodiments, a total amount of mRNA administered to a subject is about 500 pg.

The mRNA described herein can be formulated into a dosage form described herein, such as an intranasal, intratracheal, or injectable (e.g., intravenous, intraocular, intravitreal, intramuscular, intradermal, intracardiac, intraperitoneal, and subcutaneous). In some embodiments, the mRNA vaccines described herein are administered intramuscularly.

Vaccine Efficacy

The vaccine compositions as provided herein are administered in effective amounts to induce an immune response to influenza.

As used herein, an immune response to a vaccine composition is the development in a subject of a humoral and/or a cellular immune response to a (one or more) influenza protein(s) present in the composition. For purposes of the present disclosure, a “humoral” immune response refers to an immune response mediated by antibody molecules, including, e.g., secretory (IgA) or IgG molecules, while a “cellular” immune response is one mediated by T- lymphocytes (e.g., CD4⁺ helper and/or CD8⁺ T cells (e.g., CTLs) and/or other white blood cells. One important aspect of cellular immunity involves an antigen- specific response by cytolytic T- cells (CTLs). CTLs have specificity for peptide antigens that are presented in association with proteins encoded by the major histocompatibility complex (MHC) and expressed on the surfaces of cells. CTLs help induce and promote the destruction of intracellular microbes or the lysis of cells infected with such microbes. Another aspect of cellular immunity involves and antigenspecific response by helper T-cells. Helper T-cells act to help stimulate the function, and focus the activity nonspecific effector cells against cells displaying peptide antigens in association with MHC molecules on their surface. A cellular immune response also leads to the production of cytokines, chemokines, and other such molecules produced by activated T-cells and/or other white blood cells including those derived from CD4+ and CD8+ T-cells.

In some embodiments, an immune response is assessed by determining [protein] antibody titer in the subject. In some embodiments, the ability of serum or antibody from an immunized subject is tested for its ability to neutralize viral uptake or reduce viral transformation of human B lymphocytes. In some embodiments, the ability to promote a robust T cell response(s) is measured.

In some embodiments, an antigen- specific immune response is characterized by measuring an anti-antigen antibody titer produced in a subject administered a composition as provided herein, wherein the antigen is an influenza protein (e.g., an influenza HA and/or NA protein). An antibody titer is a measurement of the amount of antibodies within a subject, for example, antibodies that are specific to a particular antigen or epitope of an antigen. Antibody titer is typically expressed as the inverse of the greatest dilution that provides a positive result.

A variety of serological tests can be used to measure antibody against encoded antigen of interest, for example, influenza virus or an influenza viral antigen, e.g., influenza HA protein or influenza NA protein. These tests include the hemagglutination-inhibition test, complement fixation test, fluorescent antibody test, enzyme-linked immunosorbent assay (ELISA), and plaque reduction neutralization test (PRNT). Each of these tests measures different antibody activities. In exemplary embodiments, a plaque reduction neutralization test, or PRNT (e.g., PRNT50 or PRNT80) is used as a serological correlate of protection. PRNT measures the biological parameter of in vitro virus neutralization and is the most serologically virus -specific test among certain classes of viruses, correlating well to serum levels of protection from virus infection.

The basic design of the PRNT allows for virus-antibody interaction to occur in a test tube or microtiter plate, and then measuring antibody effects on viral infectivity by plating the mixture on virus-susceptible cells, preferably cells of mammalian origin. The cells are overlaid with a semi-solid media that restricts spread of progeny virus. Each virus that initiates a productive infection produces a localized area of infection (a plaque), that can be detected in a variety of ways. Plaques are counted and compared back to the starting concentration of virus to determine the percent reduction in total virus infectivity. In PRNT, the serum sample being tested is usually subjected to serial dilutions prior to mixing with a standardized amount of virus. The concentration of virus is held constant such that, when added to susceptible cells and overlaid with semi-solid media, individual plaques can be discerned and counted. In this way, PRNT end-point titers can be calculated for each serum sample at any selected percent reduction of virus activity.

In functional assays intended to assess vaccinal immunogenicity, the serum sample dilution series for antibody titration should ideally start below the “seroprotective” threshold titer. Regarding influenza neutralizing antibodies, the seropositivity threshold of 1:10 can be considered a seroprotection threshold in certain embodiments.

PRNT end-point titers are expressed as the reciprocal of the last serum dilution showing the desired percent reduction in plaque counts. The PRNT titer can be calculated based on a 50% or greater reduction in plaque counts (PRNT50). A PRNT50 titer is preferred over titers using higher cut-offs (e.g., PRNT80) for vaccine sera, providing more accurate results from the linear portion of the titration curve.

There are several ways to calculate PRNT titers. The simplest and most widely used way to calculate titers is to count plaques and report the titer as the reciprocal of the last serum dilution to show >50% reduction of the input plaque count as based on the back-titration of input plaques. Use of curve fitting methods from several serum dilutions may permit calculation of a more precise result. There are a variety of computer analysis programs available for this (e.g., SPSS or GraphPad Prism).

In some embodiments, an antibody titer is used to assess whether a subject has had an infection or to determine whether immunizations are required. In some embodiments, an antibody titer is used to determine the strength of an autoimmune response, to determine whether a booster immunization is needed, to determine whether a previous vaccine was effective, and to identify any recent or prior infections. In accordance with the present disclosure, an antibody titer may be used to determine the strength of an immune response induced in a subject by a vaccine composition.

In some embodiments, an anti-antigen antibody titer produced in a subject is increased by at least 1 log relative to a control. For example, anti-antigen antibody titer produced in a subject may be increased by at least 1.5, at least 2, at least 2.5, or at least 3 log relative to a control. In some embodiments, the anti-antigen antibody titer produced in the subject is increased by 1, 1.5, 2, 2.5 or 3 log relative to a control. In some embodiments, the anti-antigen antibody titer produced in the subject is increased by 1-3 log relative to a control. For example, the anti-antigen antibody titer produced in a subject may be increased by 1-1.5, 1-2, 1-2.5, 1-3, 1.5-2, 1.5-2.5, 1.5-3, 2-2.5, 2-3, or 2.5-3 log relative to a control.

In some embodiments, the anti-antigen antibody titer produced in a subject is increased at least 2 times relative to a control. For example, the anti-antigen antibody titer produced in a subject may be increased at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, or at least 10 times relative to a control. In some embodiments, the anti-antigen antibody titer produced in the subject is increased 2, 3, 4, 5, 6, 7, 8, 9, or 10 times relative to a control. In some embodiments, the anti-antigen antibody titer produced in a subject is increased 2-10 times relative to a control. For example, the anti-antigen antibody titer produced in a subject may be increased 2-10, 2-9, 2-8, 2-7, 2-6, 2-5, 2-4, 2-3, 3- 10, 3-9, 3-8, 3-7, 3-6, 3-5, 3-4, 4-10, 4-9, 4-8, 4-7, 4-6, 4-5, 5-10, 5-9, 5-8, 5-7, 5-6, 6-10, 6-9, 6- 8, 6-7, 7-10, 7-9, 7-8, 8-10, 8-9, or 9-10 times relative to a control.

In some embodiments, antibody-mediated immunogenicity in a subject is assessed at one or more time points (e.g., Day 1, Day 29, Day 57, Day 119, Day 209, and Day 394). Methods of assessing antibody-mediated immunogenicity are known and include geometric mean concentration (GMC) of antibody to antigen, geometric mean fold rise (GMFR) in serum antibody, geometric mean titer (GMT), median, minimum, maximum, 95% confidence interval (CI), geometric mean ratio (GMR) of post-baseline / baseline titers, and seroconversion rate.

The GMC is the average antibody concentration for a group of subjects calculated by multiplying all values and taking the nth root of this number, where n is the number of subjects with available data. GMT is the average antibody titer for a group of subjects calculated by multiplying all values and taking the nth root of this number, where n is the number of subjects with available data.

A control, in some embodiments, is an anti-antigen antibody titer produced in a subject who has not been administered a vaccine composition, or who has been administered a saline placebo (an unvaccinated subject). In some embodiments, a control is an anti-antigen antibody titer produced in a subject administered a recombinant or purified protein vaccine (e.g., protein subunit vaccine). Recombinant protein vaccines typically include protein antigens that either have been produced in a heterologous expression system (e.g., bacteria or yeast) or purified from large amounts of the pathogenic organism. A control may be, for example, a subject administered a live attenuated viral vaccine or an inactivated viral vaccine.

In some embodiments, the ability of a vaccine composition to be effective is measured in a rodent (e.g., murine or rabbit model). For example, a composition may be administered to a rodent model and the murine model assayed for induction of neutralizing antibody titers. Viral challenge studies may also be used to assess the efficacy of a composition of the present disclosure. For example, a composition may be administered to a rodent model, the rodent model challenged with virus, and the rodent model assayed for survival and/or immune response (e.g., neutralizing antibody response, T cell response (e.g., cytokine response)). Vaccine efficacy may be assessed using standard analyses (see, e.g., Weinberg et al., J Infect Dis. 2010 Jun 1 ;201(l 1): 1607-10). For example, vaccine efficacy may be measured by double-blind, randomized, clinical controlled trials. Vaccine efficacy may be expressed as a proportionate reduction in disease attack rate (AR) between the unvaccinated (ARU) and vaccinated (ARV) study cohorts and can be calculated from the relative risk (RR) of disease among the vaccinated group with use of the following formulas:

Efficacy = (ARU - ARV)/ARU x 100; and

Efficacy = (1-RR) x 100.

Likewise, vaccine effectiveness may be assessed using standard analyses (see, e.g., Weinberg et al., J Infect Dis. 2010 Jun 1 ;201(l 1): 1607-10). Vaccine effectiveness is an assessment of how a vaccine (which may have already proven to have high vaccine efficacy) reduces disease in a population. This measure can assess the net balance of benefits and adverse effects of a vaccination program, not just the vaccine itself, under natural field conditions rather than in a controlled clinical trial. Vaccine effectiveness is proportional to vaccine efficacy (potency) but is also affected by how well target groups in the population are immunized, as well as by other non- vaccine-related factors that influence the ‘real-world’ outcomes of hospitalizations, ambulatory visits, or costs. For example, a retrospective case control analysis may be used, in which the rates of vaccination among a set of infected cases and appropriate controls are compared. Vaccine effectiveness may be expressed as a rate difference, with use of the odds ratio (OR) for developing infection despite vaccination:

Effectiveness = (1 - OR) x 100.

In some embodiments, efficacy of a vaccine composition is at least 60% relative to unvaccinated control subjects. For example, efficacy of a vaccine composition may be at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 95%, at least 98%, or 100% relative to unvaccinated control subjects.

Sterilizing Immunity. Sterilizing immunity refers to a unique immune status that prevents effective pathogen infection into the host. In some embodiments, the effective amount of a composition of the present disclosure is sufficient to provide sterilizing immunity in the subject for at least 1 year. For example, the effective amount of a composition of the present disclosure is sufficient to provide sterilizing immunity in the subject for at least 2 years, at least 3 years, at least 4 years, or at least 5 years. In some embodiments, the effective amount of a composition of the present disclosure is sufficient to provide sterilizing immunity in the subject at an at least 5-fold lower dose relative to control. For example, the effective amount may be sufficient to provide sterilizing immunity in the subject at an at least 10-fold lower, 15-fold, or 20-fold lower dose relative to a control.

Detectable Antigen. In some embodiments, the effective amount of a composition of the present disclosure is sufficient to produce detectable levels of influenza antigen as measured in serum of the subject at 1-72 hours post administration.

Titer. An antibody titer is a measurement of the amount of antibodies within a subject, for example, antibodies that are specific to a particular antigen (e.g., an anti-influenza antigen). Antibody titer is typically expressed as the inverse of the greatest dilution that provides a positive result. Enzyme-linked immunosorbent assay (ELISA) is a common assay for determining antibody titers, for example.

In some embodiments, the effective amount of a composition of the present disclosure is sufficient to produce a 1,000-10,000 neutralizing antibody titer produced by neutralizing antibody against the influenza antigen as measured in serum of the subject at 1-72 hours post administration. In some embodiments, the effective amount is sufficient to produce a 1,000- 5,000 neutralizing antibody titer produced by neutralizing antibody against the influenza antigen as measured in serum of the subject at 1-72 hours post administration. In some embodiments, the effective amount is sufficient to produce a 5,000-10,000 neutralizing antibody titer produced by neutralizing antibody against the influenza virus antigen as measured in serum of the subject at 1-72 hours post administration.

In some embodiments, the neutralizing antibody titer is at least 100 NT50. For example, the neutralizing antibody titer may be at least 200, 300, 400, 500, 600, 700, 800, 900 or 1000 NT50. In some embodiments, the neutralizing antibody titer is at least 10,000 NT50.

In some embodiments, the neutralizing antibody titer is at least 100 neutralizing units per milliliter (NU/mL). For example, the neutralizing antibody titer may be at least 200, 300, 400, 500, 600, 700, 800, 900 or 1000 NU/mL. In some embodiments, the neutralizing antibody titer is at least 10,000 NU/mL.

In some embodiments, an anti-antigen antibody titer produced in the subject is increased by at least 1 log relative to a control. For example, an anti-antigen antibody titer produced in the subject may be increased by at least 2, 3, 4, 5, 6, 7, 8, 9 or 10 log relative to a control.

In some embodiments, an anti-antigen antibody titer produced in the subject is increased at least 2 times relative to a control. For example, an anti-influenza antigen antibody titer produced in the subject is increased by at least 3, 4, 5, 6, 7, 8, 9 or 10 times relative to a control. In some embodiments, a geometric mean, which is the nth root of the product of n numbers, is generally used to describe proportional growth. Geometric mean, in some embodiments, is used to characterize antibody titer produced in a subject.

EXAMPLES

Example 1. Phase I/II Clinical Trial

Study Design and Methodology

The study will be a Phase 1/2, randomized, observer-blind, dose-ranging study to evaluate the safety, reactogenicity, and immunogenicity of mRNA-1020 (4 hemagglutinin [HA] and 4 neuraminidase [NA] at 1:1 HA:NA mass ratio) and mRNA-1030 (4 HA and 4 NA at 3:1 HA:NA mass ratio) in healthy adults 18 to 75 years of age.

The vaccines to be tested in the proposed Phase 1/2 study contain mRNAs encoding for the surface glycoproteins of the strains recommended by the World Health Organization (WHO) for 2021/22 Northern Hemisphere cell- or recombinant-based vaccines (see Table 2 for sequences):

• A/Wisconsin/588/2019 (HlNl)pdmO9

• A/Cambodia/e0826360/2020 (H3N2)

• B/W ashington/02/2019 (B/Victoria lineage)

• B/Phuket/3073/2013 (B/Yamagata lineage)

Immunizations for the study are planned during the Northern Hemisphere spring, when influenza infection rates are typically low or declining. Approximately 560 participants will be randomized to one of 8 study arms to receive a single dose of either one of the 2 next-generation candidate vaccines (mRNA-1020 or mRNA-1030) at different dose levels, a single dose of the first-generation candidate vaccine (mRNA-1010; 1 : 1: 1 : 1 HA1:HA2:HA3:HA4), or FLUBLOK®, a licensed enhanced seasonal influenza vaccine comparator (8 study arms total). Three different dose levels (50, 100, and 150 pg total mRNA) of the 1:1 HA:NA mass ratio vaccine (mRNA-1020), 3 different dose levels (25, 50, and 100 pg total mRNA) of the 3:1 HA:NA mass ratio vaccine (mRNA-1030), and a single dose level of mRNA-1010 (50 pg total mRNA) will be assessed. The number of participants in each arm and the randomization ratio can be found in the table below. Table 1: Treatment Arms

Abbreviations: HA = hemagglutinin; mRNA = messenger RNA; NA = neuraminidase.

Study visits will consist of a Screening Visit (up to 28 days before the Day 1 visit), Vaccination Visit at Day 1, and subsequent study visits on Day 4, Day 8, Day 29 (Month 1), and Day 181/end of study (EoS; Month 6), with up to 7 months of study participation. Unscheduled visits for potential influenza-like illness (ILI) symptoms will include testing with a multiplex respiratory infection panel.

Objectives

A primary objective was to the humoral immunogenicity of mRNA 1020, mRNA- 1030, and mRNA-1010 against vaccine matched influenza A and B strains at Day 29. This will be accomplished through measuring the geometric mean titer (GMT) and geometric mean fold rise (GMFR), comparing Day 29 to Day 1 (baseline), and percentage of participants with seroconversion, defined as a Day 29 titer > 1:40 if baseline is < 1:10 or a 4 fold or greater rise if baseline is > 1:10 in anti HA antibodies measured by HAI assay, as well as the GMT and GMFR of anti-NA measured by NAI assay at Day 1 and Day 29 and percentage of participants with a change in the Day 29 titer of at least 2-/3-/4-fold rise, defined as > 2-/3-/4-fold of the lower limit of quantification (EEOQ) if the Day 1 titer is < EEOQ; or > 2-/3-/4-fold of the Day 1 titer if the Day 1 titer is > EEOQ.

The secondary endpoint is the evaluation of the humoral immunogenicity of mRNA 1020, mRNA- 1030, and mRNA-1010 against vaccine matched influenza A and B strains at all evaluable humoral immunogenicity time points, which will be assessed through the GMT and GMFR (compared to Day 1) of anti HA or anti-NA antibodies as measured by HAI, NAI, and/or microneutralization assays.

Exploratory endpoints include the following: (1) evaluation of the humoral immunogenicity against vaccine mismatched influenza A and B strains; (2) evaluation of cellular immunogenicity in a subset of participants; (3) further characterization of antibody responses, for example, Fc mediated function, avidity, or epitope specificity; (4) assessment of the occurrence of clinical influenza in study participants and characterize their immune response to infection and viral isolates; and (5) collection of samples to perform passive transfer studies in preclinical animal models. These endpoints will be examined as follows: GMT and GMFR (compared to Day 1) of anti HA or anti-NA antibodies as measured by HAI, NAI, and/or microneutralization assays against vaccine-mismatched strains, frequency, magnitude, and phenotype of virus-specific T-cell and B-cell responses measured by flow cytometry or other methods, and to perform targeted repertoire analysis of T-cells and B-cells after vaccination, frequency of clinical influenza and immune responses, and transfer of human sera into mice with subsequent influenza virus challenge to observe protection from morbidity and mortality conferred by NA-specific antibodies.

Vaccine Formulation and Route of Administration

The mRNA-1020, mRNA-1030, and mRNA-1010 investigational products (Ips) are lipid nanoparticle (ENP) dispersions encoding the seasonal influenza vaccine antigens, HA and NA (mRNA 1020 and mRNA 1030), or HA only (mRNA 1010) from influenza strains A/Wisconsin/588/2019(H 1 N 1 )pdm09, A/Cambodia/e0826360/2020(H3N2) , B/Washington/02/2019 (B/Victoria lineage), and B/Phuket/3073/2013 (B/Yamagata lineage). mRNA 1020 contains a 1:1 mass ratio of HA and NA; mRNA-1030 contains a 3:1 mass ratio of HA and NA, and mRNA 1010 contains HA only. The LNP comprises four (4) lipids (50 mol% ionizable lipid heptadecan-9-yl 8 ((2 hydroxy ethyl) (6 oxo 6-(undecyloxy)hexyl)amino)octanoate (Compound 1); 10 mol% 1,2 distearoyl sn glycero-3 phosphocholine (DSPC); 38.5 mol% cholesterol; and 1.5 mol% l-monomethoxypolyethyleneglycol-2,3-dimyristylglycerol with polyethylene glycol of average molecular weight 2000 (PEG2000 DMG)). The mRNA vaccines are provided as a sterile liquid for injection, white to off white dispersion in appearance, at a concentration of 0.5 mg/mL in 20 mM trometamol (Tris) buffer containing 87 mg/mL sucrose and 10.7 mM sodium acetate, at pH 7.5. mRNA-1020, mRNA-1030, mRNA-1010, and FLUB LOK® will be administered as single intramuscular injections. Immunogenicity Assessments

Blood samples for immunogenicity assessments will be collected at the time points indicated above. The following assessments are planned: (1) serum antibody level as measured by HAI assay (primary, secondary, and exploratory endpoints); (2) NA-specific antibody levels as measured by NAI assay (primary, secondary, and exploratory endpoints); (3) serum neutralizing antibody level as measured by microneutralization (MN) assay or similar method (secondary or exploratory endpoint); and (4) cellular immunogenicity (exploratory endpoint for subset only).

Immunogenicity analyses will be reported based on the per-protocol (PP) Set and provided by vaccination group, unless otherwise specified.

For the immunogenicity endpoints, geometric mean of specific antibody titers with corresponding 95% CI at each time point and geometric mean fold rise (GMFR) of specific antibody titers with corresponding 95% CI at each postbaseline time point over preinjection baseline at Day 1 will be provided by vaccination group. Descriptive summary statistics including median, minimum, and maximum will also be provided. Geometric mean titer (GMT) and GMFR might be adjusted for baseline titer and/or age group.

For summarizations of geometric mean titers, antibody titers reported as below lower limit of quantification (LLOQ) will be replaced by 0.5 x LLOQ. Values that are greater than the upper limit of quantification (ULOQ) will be converted to the ULOQ.

For HA, rate of seroconversion is defined as the proportion of participants with either a pre vaccination HI titer < 1:10 and a postvaccination HI titer > 1:40 or a pre-vaccination HI titer > 1:10 and a minimum 4-fold rise in postvaccination HI antibody titer. For NA, an endpoint of interest is the percentage of participants with a change in the Day 29 titer of at least 2-/3 -/4-fold rise, defined as > 2-/3-/4-fold of the LLOQ if the Day 1 titer is < LLOQ; or > 2-/3-/4-fold of the Day 1 titer if the Day 1 titer is > LLOQ.

Seroconversion rate from baseline will be provided with a 2-sided 95% CI using the Clopper Pearson method at each postbaseline time point. For NA, the number and percentage of participants with a > 2 , > 3 , and > 4 fold rise of serum titers from baseline will be provided with 2-sided 95% CI using the Clopper-Pearson method at each postbaseline time point.

Day 29 Immunogenicity Data

Interim samples were taken at Day 29, as described above. It was found that mRNA- 1010 elicited similar antibody responses to Flublok for influenza A strains and lower titers against influenza B strains, as shown by HAI geometric mean titers (FIG. 1A) and HAI geometry mean fold-rise (GMFR) (FIG. IB).

Neuraminidase inhibition (NAI) titers were also measured. It was found that mRNA- 1020 and mRNA-1030 elicit functional antibodies against the NA antigen at all tested dose levels and a dose response was observed for all NA subtypes regardless of age stratification (FIGs. 2A-2D, 3A-3D, and 4A-4D). Next, the NAI GMFR data was analyzed by NA component dose, to determine whether there was an indication of interference between the HA and NA components of the mRNA-1020 and mRNA-1030 vaccines. As shown in FIGs. 5A-5D, at a similar dose level of the NA component, mNRA-1020 trended to higher NAI titer rises as compared to mRNA-1030 (except for N2). There was no difference with respect to different age groups (FIGs. 6A-6D and 7A-7D). Finally, the HAI GMFR data was analyzed by HA component dose, to determine whether there was an indication of interference between the HA and NA components. As can be seen in FIGs. 8A-8D, 9A-9D, and 10A-10D, no interference was observed. It is noted that mRNA-1020 (50 pg dose) was found to elicit similar HAI foldrises as mRNA-1010 (4 HA antigens) at the 50 pg dose level, despite only comprising half of the effective HA dose level.

SEQUENCE LISTING

It should be understood that any of the mRNA sequences described herein may include a 5’ UTR and/or a 3’ UTR. The UTR sequences may be selected from the following sequences, or other known UTR sequences may be used. It should also be understood that any of the mRNA constructs described herein may further comprise a poly(A) tail and/or cap (e.g., 7mG(5’)ppp(5’)NlmpNp). Further, while many of the mRNAs and encoded antigen sequences described herein include a signal peptide and/or a peptide tag (e.g., C-terminal His tag), it should be understood that the indicated signal peptide and/or peptide tag may be substituted for a different signal peptide and/or peptide tag, or the signal peptide and/or peptide tag may be omitted.

5’ UTR: GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACC ( SEQ ID NO : 1 ) 5’ UTR: GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGACCCCGGCGCCGCCACC ( SEQ ID NO : 2 )

3’ UTR: UGAUAAUAGGCUGGAGCCUCGGUGGCCAUGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCA CCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC ( SEQ ID NO : 3 )

3’ UTR:

UGAUAAUAGGCUGGAGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCA

CCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC ( SEQ ID NO : 4 ) Table 2.

EQUIVALENTS

All references, patents and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may encompass the entirety of the document.

The indefinite articles “a” and “an,” as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean “at least one.” It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.

In the claims, as well as in the specification above, all transitional phrases such as “comprising,” “including,” “carrying,” “having,” “containing,” “involving,” “holding,” “composed of,” and the like are to be understood to be open-ended,

to mean including but not limited to. Only the transitional phrases “consisting of’ and “consisting essentially of’ shall be closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03.

The terms “about” and “substantially” preceding a numerical value mean ±10% of the recited numerical value.

Where a range of values is provided, each value between and including the upper and lower ends of the range are specifically contemplated and described herein.

Claims

CLAIMS What is claimed is:

1. A method comprising administering to a human subject a composition comprising a 25 pg - 150 pg dose of:

(a) a first messenger ribonucleic acid (mRNA) encoding a hemagglutinin (HA) antigen of a first influenza A virus and a second mRNA encoding an HA antigen of a second influenza A virus, wherein the influenza A HA antigens are of different subtypes; and

(b) a third mRNA encoding an HA antigen of a first influenza B virus and a fourth mRNA encoding an HA antigen of a second influenza B virus, wherein the influenza B HA antigens are of different lineages;

(c) a fifth mRNA encoding neuraminidase (NA) antigen of the first influenza A virus and a sixth mRNA encoding an NA antigen of the second influenza A virus, wherein the influenza A NA antigens are of different subtypes; and

(d) a seventh mRNA encoding an NA antigen of the first influenza B virus and an eighth mRNA encoding an NA antigen of the second influenza B virus, wherein the influenza B NA antigens are of different lineages, and wherein the mRNAs of (a), (b), (c), and (d) are in a lipid nanoparticle.

2. The method of claim 1, wherein the ratio of the first: second:third:fourth:fifth: sixth: seventh:eighth mRNAs is 1:1:1:1:1:1:1:1.

3. The method of claim 1, wherein the ratio of the first: second:third:fourth:fifth: sixth: seventh:eighth mRNAs is 3:3:3:3: 1 : 1 : 1 : 1.

4. The method of any one of claims 1-3, wherein the dose is 25 pg total mRNA.

5. The method of any one of claims 1-3, wherein the dose is 50 pg total mRNA.

6. The method of any one of claims 1-3, wherein the dose is 100 pg total mRNA.

7. The method of any one of claims 1-3, wherein the dose is 150 pg total mRNA.

8. The method of any one of the preceding claims, wherein the composition further comprises Tris buffer.

9. The method of claim 8, wherein the composition with Tris buffer further comprises sucrose and sodium acetate.

10. The method of claim 9, wherein the composition comprises 10 mM - 30 mM Tris buffer comprising 75 mg/mL - 95 mg/mL sucrose, and 5 mM - 15 mM sodium acetate, optionally wherein the composition has a pH of 6-8.

11. The method of claim 10, wherein the composition comprises about 20 mM Tris buffer comprising 87 mg/mL sucrose, and 10.7 mM sodium acetate, optionally wherein the composition has a pH of 7.5.

12. The method of any one of claims 1-11, wherein the composition comprises about 0.5 mg/mL of the mRNA.

13. The method of any one of the preceding claims, wherein the composition is administered intramuscularly, optionally into a deltoid muscle of the subject’s arm.

14. The method of any one of the preceding claims, wherein the lipid nanoparticle comprises: an ionizable amino lipid; a neutral lipid; a sterol; and a PEG-modified lipid.

15. The method of claim 14, wherein the lipid nanoparticle comprises: 40-55 mol% ionizable amino lipid; 5-15 mol% neutral lipid; 35-45 mol% sterol; and 1-5 mol% PEG-modified lipid.

16. The method of claim 15, wherein the lipid nanoparticle comprises:

49 mol% ionizable amino lipid; 10.5 mol% neutral lipid; 38.5 mol% sterol; and 2.0 mol% PEG-modified lipid; 50 mol% ionizable amino lipid; 10 mol% neutral lipid; 38.5 mol% sterol; and 1.5 mol% PEG-modified lipid; or

17. The method of any one of claims 14-16, wherein the ionizable amino lipid is heptadecan- 9-yl 8 ((2 hydroxyethyl)(6 oxo 6-(undecyloxy)hexyl)amino)octanoate (Compound 1).

18. The method of any one of claims 14-17, wherein the neutral lipid is 1,2 distearoyl sn glycero-3 phosphocholine (DSPC).

19. The method of any one of claims 14-18, wherein the sterol is cholesterol.

20. The method of any one of claims 14-19, wherein the PEG-modified lipid is 1- monomethoxypolyethyleneglycol-2,3-dimyristylglycerol with polyethylene glycol of average molecular weight 2000 (PEG2000 DMG).

21. The method of any one of the preceding claims, wherein the age of the subject is 18 to 75 years.

22. The method of any one of the preceding claims, wherein the HA and NA antigens are recommended by or selected according to standardized criteria used by World Health Organization’s Global Influenza Surveillance and Response System (GISRS).

23. The method of any one of the preceding claims, wherein the HA and NA antigen(s) are selected using a hemagglutinin inhibition (HAI) assay to identify circulating influenza viruses that are antigenically similar to influenza viruses from a previous season’s vaccine, optionally wherein influenza viruses are considered to be antigenically similar if their HAI titers differ by two dilutions or less.

24. The method of any one of the preceding claims, wherein the first mRNA encodes an influenza A HA antigen of the Hl subtype, and the second mRNA encodes an influenza A HA antigen of the H3 subtype.

25. The method of any one of the preceding claims, wherein the third mRNA encodes an influenza B HA antigen of the B/Yamagata lineage, and the fourth mRNA encodes an influenza B HA antigen of the B /Victoria lineage.

26. The method any one of the preceding claims, wherein the fifth mRNA encodes an influenza A NA antigen of the N1 subtype, and the sixth mRNA encodes an influenza A NA antigen of the N2 subtype.

27. The method of any one of the preceding claims, wherein the seventh mRNA encodes an influenza B NA antigen of the B/Yamagata lineage, and the eighth mRNA encodes an influenza B NA antigen of the B /Victoria lineage.

28. The method of any one of the preceding claims, wherein the mRNA comprises a 5’ untranslated region (UTR), a 3’ UTR, and a polyA tail.

29. The method of any one of the preceding claims, wherein the mRNA comprises a 5’ cap analog.

30. The method of any one of the preceding claims, wherein the mRNA comprises a chemical modification.

31. The method of any one of the preceding claims, wherein the chemical modification is 1- methy Ip seudouridine .

32. The method of any one of the preceding claims, wherein the dose is in an effective amount to produce an immune response against at least one of the influenza antigens in the composition.

33. A composition comprising a dose of mRNA and a lipid nanoparticle, wherein the mRNA comprises:

(a) a first messenger ribonucleic acid (mRNA) encoding a hemagglutinin (HA) antigen of a first influenza A virus and a second mRNA encoding an HA antigen of a second influenza A virus, wherein the influenza A HA antigens are of different subtypes; and (b) a third mRNA encoding an HA antigen of a first influenza B virus and a fourth mRNA encoding an HA antigen of a second influenza B virus, wherein the influenza B HA antigens are of different lineages;

(d) a seventh mRNA encoding an NA antigen of the first influenza B virus and an eighth mRNA encoding an NA antigen of the second influenza B virus, wherein the influenza B NA antigens are of different lineages, and wherein the mRNAs of (a), (b), (c), and (d) are in a lipid nanoparticle; and wherein the dose is at least 25 pg and less than 200 pg.

34. The composition of claim 33, wherein the ratio of the first: second:third:fourth:fifth: sixth: seventh:eighth mRNAs is

35. The composition of claim 33, wherein the ratio of the first: second:third:fourth:fifth: sixth: seventh:eighth mRNAs is 3:3:3:3: 1 : 1 : 1 : 1.

36. The composition of any one of claims 33-35, wherein the dose is 25 pg total mRNA.

37. The composition of any one of claims 33-35, wherein the dose is 50 pg total mRNA.

38. The composition of any one of claims 33-35, wherein the dose is 100 pg total mRNA.

39. The composition of any one of claims 33-35, wherein the dose is 150 pg total mRNA.

40. The method of any one of claims 1-32, wherein the ratio of the first: second:third:fourth:fifth: sixth: seventh:eighth mRNAs is a mass ratio.

41. The composition of any one of claims 33-39, wherein the ratio of the first: second:third:fourth:fifth: sixth: seventh:eighth mRNAs is a mass ratio.

42. The method of any one of claims 1-32, wherein the N1 neuraminidase inhibition (NAI) titer geometric mean fold-rise (GMFR) is 1.5-3 at 29 days post-administration.

43. The method of any one of claims 1-32 and 42, wherein the N2 NAI titer GMFR is 3.5-10 at 29 days post-administration.

44. The method of any one of claims 1-32, 42, and 43, wherein the B/Victoria NA NAI titer

GMFR is 3.5-8 at 29 days post-administration.

45. The method of any one of claims 1-32 and 42-44, wherein the B/Yamagata NA NAI titer GMFR is 3.75-8 at 29 days post-administration.

46. The method of any one of claims 1-32 and 42-45, wherein the subject is 18-49 years of age.

47. The method of any one of claims 1-32 and 42-45, wherein the subject is 50-75 years of age.