WO2023195807A1 - Composition pharmaceutique pour traiter le cancer, comprenant un inhibiteur de ron mutant et un anticorps anti-pd-1 - Google Patents

Composition pharmaceutique pour traiter le cancer, comprenant un inhibiteur de ron mutant et un anticorps anti-pd-1 Download PDF

Info

Publication number
WO2023195807A1
WO2023195807A1 PCT/KR2023/004682 KR2023004682W WO2023195807A1 WO 2023195807 A1 WO2023195807 A1 WO 2023195807A1 KR 2023004682 W KR2023004682 W KR 2023004682W WO 2023195807 A1 WO2023195807 A1 WO 2023195807A1
Authority
WO
WIPO (PCT)
Prior art keywords
alkyl
formula
alkoxy
cancer
halogen
Prior art date
Application number
PCT/KR2023/004682
Other languages
English (en)
Korean (ko)
Inventor
손혜진
이미소
김효진
김하나
이준형
신원화
Original Assignee
웰마커바이오 주식회사
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 웰마커바이오 주식회사 filed Critical 웰마커바이오 주식회사
Publication of WO2023195807A1 publication Critical patent/WO2023195807A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/4427—Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems
    • A61K31/444—Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems containing a six-membered ring with nitrogen as a ring heteroatom, e.g. amrinone
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47—Quinolines; Isoquinolines
    • A61K31/4709—Non-condensed quinolines and containing further heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/496—Non-condensed piperazines containing further heterocyclic rings, e.g. rifampin, thiothixene or sparfloxacin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/535—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one oxygen as the ring hetero atoms, e.g. 1,2-oxazines
    • A61K31/5375—1,4-Oxazines, e.g. morpholine
    • A61K31/5377—1,4-Oxazines, e.g. morpholine not condensed and containing further heterocyclic rings, e.g. timolol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/3955—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against proteinaceous materials, e.g. enzymes, hormones, lymphokines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D495/00—Heterocyclic compounds containing in the condensed system at least one hetero ring having sulfur atoms as the only ring hetero atoms
    • C07D495/02—Heterocyclic compounds containing in the condensed system at least one hetero ring having sulfur atoms as the only ring hetero atoms in which the condensed system contains two hetero rings
    • C07D495/04—Ortho-condensed systems
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2300/00—Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00

Definitions

  • the present invention is a pharmaceutical composition for preventing or treating cancer comprising a mutant RON inhibitor, or a pharmaceutically acceptable salt thereof, wherein the mutant RON inhibitor, or a pharmaceutically acceptable salt thereof is combined with an anti-PD-1 antibody. It relates to pharmaceutical compositions administered in combination and their uses.
  • Cancer cells evade attacks by immune cells by secreting substances that render T cells inactive, change the cancer microenvironment, divide rapidly, and can metastasize to other tissues beyond the tissue in which they originated. Do it as Meanwhile, cancer cells create their own blood vessels to obtain nutrients required for rapid growth and metastasis (Tumor angiogenesis).
  • Regulatory T cells are known to be the main cells involved in immune evasion of cancer cells, and several treatment strategies have been developed to reduce the number of regulatory T cells in cancer tissues.
  • anti-cancer immunotherapy drugs have the problem of causing side effects such as weight loss, which worsens the quality of life of the individual. Therefore, there is a need to develop new treatments that are effective in treating cancer or inhibiting the growth of cancer cells while having fewer side effects.
  • Non-patent Document 1 Wagh PK. et. al. Adv Cancer Res. 2008
  • the present inventors have found that the effect of treating cancer and/or inhibiting cancer cell growth is superior when administered in combination with a mutant RON inhibitor, or a pharmaceutically acceptable salt thereof, or with an anti-PD-1 antibody alone, compared to when administered alone. By confirming this point, the present invention was completed.
  • the present invention provides a pharmaceutical composition for preventing or treating cancer comprising a mutant RON inhibitor represented by Formula 1 or Formula 6 of the present invention, or a pharmaceutically acceptable salt thereof, wherein Formula 1
  • a pharmaceutical composition is provided in which a mutant RON inhibitor represented by Formula 6, or a pharmaceutically acceptable salt thereof, is administered in combination with an anti-PD-1 antibody.
  • the present invention provides a mutant RON inhibitor represented by Formula 1 or Formula 6 of the present invention, or a pharmaceutically acceptable salt thereof; and a pharmaceutical composition for preventing or treating cancer comprising an anti-PD-1 antibody.
  • the present invention includes a mutant RON inhibitor represented by Formula 1 or Formula 6 of the present invention, or a pharmaceutically acceptable salt thereof, and the mutant represented by Formula 1 or Formula 6
  • a kit for preventing or treating cancer including instructions for administering a type RON inhibitor, or a pharmaceutically acceptable salt thereof, in combination with an anti-PD-1 antibody.
  • the present invention provides a mutant RON inhibitor represented by Formula 1 or Formula 6 of the present invention, or a pharmaceutically acceptable salt thereof; and administering an anti-PD-1 antibody to the subject.
  • the present invention provides a drug for preventing or treating cancer comprising a mutant RON inhibitor represented by Formula 1 or Formula 6 of the present invention, or a pharmaceutically acceptable salt thereof, wherein Formula 1
  • the compound represented by Formula 6, or a pharmaceutically acceptable salt thereof is provided for preparing a medicament administered in combination with an anti-PD-1 antibody.
  • the mutant RON inhibitor represented by Formula 1 or Formula 6 of the present invention treats cancer and/or kills cancer cells. It is effective in inhibiting growth.
  • Figure 1 shows that U937 cell-derived M0 macrophages were treated with the compound of Example 1 and the expression of M1 macrophage markers (CD68 and CD86) and M2 macrophage marker (CD206) was confirmed through flow cytometry (left figure); ARG-1 and MRC-1 were confirmed to be M2 macrophage markers (right figure).
  • FIG. 2 confirms the expression of tumor infiltrating lymphocytes (TIL) in co-culture of SW620 colon cancer cell line spheroids and PBMC.
  • TIL tumor infiltrating lymphocytes
  • Figure 3a shows tumor formation when positive control (10 mg/kg) alone and positive control (10 mg/kg) + compound of Example 1 (3 mg/kg) were administered in an animal model using the human-derived colon cancer cell line SW620. The inhibitory ability was confirmed.
  • Figure 3b shows the degree of distribution of macrophages and the degree of cytokine secretion within the tumor in tumor tissue extracted after completion of the animal experiment in Experimental Example 3a, using a flow cytometry method and a cytokine multiplex analysis kit.
  • Figure 4a shows positive control (5 mg/kg) alone, the compound of Example 1 (5 mg/kg) alone, and positive control (5 mg/kg) + Example 1 in an animal model using the human-derived lung cancer cell line NCI-H358. The ability to inhibit tumor formation was confirmed when the compound (5 mg/kg) was administered.
  • Figure 4b shows the distribution of hCD45 cells confirmed by immunohistochemical staining after the tumor tissue was extracted after completion of the animal experiment in Experimental Example 4a.
  • Figure 5a shows positive control (10 mg/kg) alone, the compound of Example 1 (30 mg/kg) alone, and positive control (10 mg/kg) + compound of Example 1 in an animal model using the mouse colon cancer cell line CT26. The ability to inhibit tumor formation was confirmed when administered at (30 mg/kg).
  • Figure 5b shows the positive control (10 mg/kg) alone, the compound of Example 1 (30 mg/kg) alone, and the positive control (10 mg/kg) + the compound of Example 1 in an animal model using the mouse colon cancer cell line CT26.
  • the M1/M2 macrophage ratio and CD45+ tumor infiltrating lymphocytes (TIL) in tumor tissue were confirmed.
  • Figure 6a shows normal-type RON and variant analysis performed using RT-PCR and Sanger sequencing to analyze the RON genotype of macrophages from healthy normal people and lung cancer patients.
  • Figure 6b shows an M1 macrophage marker (CXCL10) and an M2 macrophage marker (ARG-1 and The expression of MRC-1) was confirmed by real-time PCR.
  • One aspect of the present invention is a pharmaceutical composition for preventing or treating cancer comprising a compound represented by Formula 1 or Formula 6 below, or a pharmaceutically acceptable salt thereof, comprising a compound represented by Formula 1 or Formula 6 below, or a pharmaceutically acceptable salt thereof. It relates to a pharmaceutical composition wherein a pharmaceutically acceptable salt is administered in combination with an anti-PD-1 antibody.
  • RON Recepteur d'origine nantais
  • MST1R Macrophage stimulating 1 receptor
  • RON is a protein receptor belonging to the c-MET family, and is a receptor for serum protein (Macrophage-stimulating protein (MSP)) that is secreted by the liver and regulates the actions of macrophages.
  • MSP Macrophage-stimulating protein
  • Ligand binding at the cell surface induces phosphorylation of RON in the intracellular domain, providing a docking site for downstream signaling molecules.
  • Signals from RON activate the wound healing response by promoting epithelial cell migration, proliferation, and survival at the wound site. It plays a role in the innate immune response by regulating the migration and phagocytic activity of macrophages. Additionally, RON can promote signals such as cell migration and proliferation in response to growth factors other than MST1 ligands.
  • mutant RON inhibitor refers to a substance that inhibits mutated RON, and may be a compound represented by Formula 1 or Formula 6 below.
  • the compound of Formula 1 used in the present invention is represented as follows.
  • R 1 and R 2 are each independently H, halogen, C 1-10 alkoxy, or haloC 1-10 alkyl;
  • R 3 and R 4 are each independently H, halogen, C 1-10 alkyl, or C 1-10 alkoxy;
  • R 5 is H, halogen, or C 1-10 alkyl
  • R 6 and R 7 together with the N atom to which they are attached form a 4- to 10-membered heterocycle, or R 6 is -C 2 H 4 -O-CH 3 and R 7 is H, methyl or t-part. It is toxycarbonyl;
  • the heterocycle may or may not have 1 or 2 heteroatoms selected from the group consisting of N, O, and S, and the heterocycle may contain halogen and C 1-6 It is substituted or unsubstituted with one or more selected from alkyl.
  • the C 1-10 alkyl may include C 1-6 alkyl, C 1-3 alkyl, C 3-10 alkyl, C 3-6 alkyl, C 6-10 alkyl, etc.
  • the C 1-10 alkoxy may include C 1-6 alkoxy, C 1-3 alkoxy, C 3-10 alkoxy, C 3-6 alkoxy, C 6-10 alkoxy, etc.
  • the 4 to 10 membered heterocycle may include a 4 to 7 membered heterocycle, a 4 to 6 membered heterocycle, a 5 to 7 membered heterocycle, a 5 or 6 membered heterocycle, etc.
  • R 1 and R 2 may each independently be H, halogen, methoxy, or -CF 3 .
  • the halogen may be F, Cl, Br or I.
  • R 3 and R 4 may each independently be H, halogen, methyl, methoxy, or ethoxy.
  • the halogen may be F, Cl, Br or I.
  • R 4 may be halogen, methyl, methoxy, or ethoxy.
  • the halogen may be F, Cl, Br or I.
  • R 5 may be H or halogen.
  • the halogen may be F, Cl, Br or I.
  • R 6 and R 7 together with the N atom to which they are bonded forming; where R a and R b are each independently C 1-3 alkylene; A is -N(-R 9 )- or -O-, and R 9 may be C 1-6 alkyl.
  • R 6 and R 7 together with the N atom to which they are bonded are azetidinyl, diazetidinyl, pyrrolidinyl, pyrrolyl, imidazolidinyl, imidazolyl, pyrazolidinyl, pyrazolyl, oxazoli Dinyl, oxazolyl, isoxazolidinyl, isoxazolyl, thiazolidinyl, thiazolyl, isothiazolidinyl, isothiazolyl, piperidinyl, pyridinyl, piperazinyl, diazinyl, morpholino, thiomo It may form polyno, azepanyl, diazepanyl, or a heterocycle group substituted with C 1-6 alkyl.
  • R a and R b may each independently be -CH 2 -, -C 2 H 4 -, or -C 3 H 6 -.
  • R 9 may be methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, t-butyl, n-pentyl, i-pentyl, t-pentyl, sec-pentyl, neopentyl, hexyl, etc. there is.
  • R 1 and R 2 are each independently H, halogen, methoxy, or -CF 3 ;
  • R 3 and R 4 are each independently H, halogen, methyl, methoxy, or ethoxy;
  • R 5 is H or halogen;
  • R 6 is -C 2 H 4 -O-CH 3 and
  • R 7 is H, methyl or t-butoxycarbonyl, or R 6 and R 7 are combined with each other to form morpholino or methylpiperazinyl.
  • the halogen may be F, Cl, Br or I.
  • the compound of Formula 1 may be represented by the following Formula 2:
  • R 1 to R 7 are as defined in Formula 1.
  • R 1 and R 2 may each independently be H, halogen, or -CF 3 .
  • R 3 and R 4 may each independently be H, halogen, methyl, methoxy, or ethoxy, where R 3 and R 4 are not H at the same time.
  • R 5 may be H or halogen.
  • R 1 and R 2 are each independently H, halogen, or -CF 3 ;
  • R 3 and R 4 are each independently H, halogen, methyl, methoxy, or ethoxy;
  • R 5 is H or halogen;
  • R 6 is -C 2 H 4 -O-CH 3 and
  • R 7 may be H, methyl or t-butoxycarbonyl.
  • the compound of Formula 1 may be represented by the following Formula 3:
  • R 1 to R 7 are as defined in Formula 1.
  • R 1 and R 2 may each independently be H, halogen, or -CF 3 .
  • R 4 may be halogen, methyl, methoxy, or ethoxy.
  • R 5 may be H or halogen.
  • R 1 and R 2 are each independently H, halogen, or -CF 3 ;
  • R 4 is halogen, methyl, methoxy, or ethoxy;
  • R 5 is H or halogen;
  • R 6 is -C 2 H 4 -O-CH 3 ;
  • R 7 may be H, methyl or t-butoxycarbonyl.
  • the compound of Formula 1 may be represented by the following Formula 4:
  • R 1 to R 5 are as defined in Formula 1; R a and R b are each independently C 1-3 alkylene; A is -N(-R 9 )- or -O-, and R 9 may be C 1-6 alkyl.
  • R 1 and R 2 may each independently be H, halogen, or -CF 3 .
  • R 3 and R 4 may each independently be H, halogen, methyl, methoxy, or ethoxy, where R 3 and R 4 are not H at the same time.
  • R 5 may be H or halogen.
  • R a and R b together with N and A to which they are attached may form morpholino or methylpiperazinyl.
  • the compound of Formula 1 may be represented by Formula 5 below.
  • R 1 to R 5 are as defined in Formula 1; R a and R b are each independently C 1-3 alkylene; A is -N(-R 9 )- or -O-, and R 9 may be C 1-6 alkyl.
  • R 1 and R 2 may each independently be H, halogen, or -CF 3 .
  • R 4 may be halogen, methyl, methoxy, or ethoxy.
  • R 5 may be H or halogen.
  • R a and R b together with N and A to which they are attached may form morpholino or methylpiperazinyl.
  • the compound represented by Formula 1 is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl
  • the compound of Formula 1 used in the composition according to the present invention can be prepared by the method disclosed in Republic of Korea Patent No. 10-2221689, and can be prepared by other known methods and/or various methods based on technology in the field of organic synthesis. It can be manufactured by. Based on the above methods, various derivatives can be synthesized using an appropriate synthesis method depending on the type of substituent.
  • L is -NH- or -CH 2 -
  • R 1 to R 4 are each independently hydrogen, halogen, hydroxy, cyano, C 1-4 alkyl, C 1-4 alkoxy, C 1-4 haloalkyl, C 2-4 alkenyl, C 2-4 alkyl Nyl, C 3-7 cycloalkyl, C 6-10 aryl, 5- to 9-membered heteroaryl, or 3- to 9-membered heterocycloalkyl,
  • X is O, S, -CH(-Rx)- or -N(-Rx)-,
  • Rx is hydrogen, C 1-4 alkyl, C 1-4 alkoxy, C 1-4 haloalkyl, C 2-4 alkenyl, C 2-4 alkynyl , C 6-10 aryl, C 6-10 aryl-C 1-4 alkyl, or 3- to 9-membered heterocycloalkyl,
  • R 5 and R 6 are each independently hydrogen, amino, halogen, cyano, C 1-6 alkyl, C 1-6 haloalkyl, C 1-6 alkoxy, amino-C 1-6 alkoxy, aminocarbonyl, C 1-6 alkylaminocarbonyl, diC 1-6 alkylcarbonylamino, C 1-6 alkylcarbonylamino, C 1-6 alkylamino, or C 1-6 alkyl -amino-C 1-6 alkoxy,
  • R 5 and R 6 are each independently 3- to 9-membered cycloalkyl; or substituted or unsubstituted with 3- to 9-membered heterocycloalkyl,
  • the cycloalkyl or heterocycloalkyl is halogen, oxo, cyano, hydroxy, hydroxy-C 1-6 alkyl, amino, diC 1-6 alkylamino, C 1-6 alkyl, C 1-6 alkoxy, and With or without one or more substituents selected from the group consisting of C 1-6 alkoxy-C 1-6 alkyl,
  • the heterocycloalkyl contains 1 to 4 heteroatoms selected from the group consisting of N, O and S.
  • the C 1-6 alkyl may include C 1-3 alkyl, C 3-6 alkyl, etc. Additionally, the C 1-6 alkoxy may include C 1-3 alkoxy, C 3-6 alkoxy, etc.
  • R 1 to R 4 may each independently be hydrogen, C 1-4 haloalkyl, or halogen.
  • the halogen may be F, Cl, Br or I.
  • R 1 may be hydrogen, trifluoromethyl, or fluoro
  • R 2 may be hydrogen
  • R 3 may be fluoro
  • R 4 may be hydrogen.
  • X may be O or -CH(-Rx)-, and Rx may be hydrogen or C 1-6 alkyl.
  • R 5 and R 6 are each independently hydrogen, amino, halogen, cyano, C 1-6 alkyl, C 1-6 haloalkyl, C 1-6 alkoxy, amino -C 1-6 alkoxy, aminocarbonyl, C 1-6 alkylaminocarbonyl, diC 1-6 alkylcarbonylamino, C 1-6 alkylcarbonylamino, C 1-6 alkylamino, C 1-6 alkyl-amino-C 1-6 alkoxy, or 5- to 9-membered heteroaryl, where R 5 and R 6 are each independently C 1-6 alkyl; C 1-6 alkoxy-C 1-6 alkyl-amino, C 1-6 alkyl substituted with any of 3-9 membered cycloalkyl and 3-9 membered heterocycloalkyl or C 1-6 alkyl-amino -C 1-6 alkyl; 3- to 9-membered cycloalkyl; or substituted or unsubstituted
  • the heteroaryl is pyridinyl, imidazolyl, or pyrazolyl
  • the heterocycloalkyl is azetidinyl, pyrrolidinyl, tetrahydropyranyl, morpholino, morpholinyl, and dioxidothiomopoly. or, piperazinyl, piperidinyl, or oxetanyl
  • the cycloalkyl may be cyclobutyl, cyclopentyl, or cyclohexyl.
  • heteroaryl or heterocycloalkyl contains one or more N atoms
  • any one of them may be substituted at the N atom position, but there is no particular limitation.
  • R 1 and R 2 are hydrogen, C 1-4 haloalkyl, or halogen
  • R 3 and R 4 are hydrogen or halogen
  • X is O or -CH(- Rx) -
  • Rx is hydrogen or C 1-4 alkyl
  • A is quinoline, quinazoline, pyridine, pyrimidine, thienopyridine, pyrrolopyridine, pyrazolopyridine, imidazopyridine, pyrrolopyrimidine, di hydropyrrolopyrimidine, furopyridine, pyrazolopyrimidine, purine or indazole
  • R 5 and R 6 are each independently hydrogen, amino, halogen, cyano, C 1-6 alkyl, C 1-6 haloalkyl, C 1-6 alkoxy, amino-C 1-6 alkoxy, aminocarbonyl, C 1-6 alkylaminocarbonyl, diC 1-6 alkylcarbonylamino, C 1-6 alkylcarbonylamino, C 1-6 alky
  • R 5 and R 6 are each independently hydrogen, nitro, amino, halogen, hydroxy, cyano, C 1-6 alkyl, C 1-6 haloalkyl, C 1 -6 alkoxy, amino-C 1-6 alkoxy, aminocarbonyl, C 1-6 alkylaminocarbonyl, diC 1-6 alkylaminocarbonyl, C 1-6 alkylcarbonylamino, C 1-6 alkylamino , C 1-6 alkyl-amino-C 1-6 alkoxy, C 6-10 aryl, C 6-10 aryl-C 1-4 alkyl, or 5- to 9-membered heteroaryl, and the amino, the alkyl,
  • the alkoxy, the aryl, and the heteroaryl are each independently C 1-6 alkyl; C 1-6 alkoxy-C 1-6 alkylamino, C 1-6 alkyl substituted with any of 3-9 membered cycloalkyl and 3-9 membered heterocycloalkyl
  • R 5 and R 6 may not simultaneously be C 6-10 aryl, C 6-10 aryl-C 1-4 alkyl, or 5- to 9-membered heteroaryl. .
  • R 5 and R 6 are simultaneously C 1-6 alkyl or C 1 substituted with any one of 3- to 9-membered cycloalkyl and 3- to 9-membered heterocycloalkyl.
  • R 6 when R 5 includes rings such as aryl, heteroaryl, etc., R 6 may not include these rings at the same time. Additionally, when R 5 is substituted with a group containing rings such as cycloalkyl or heterocycloalkyl, R 6 may not be simultaneously substituted with a group containing these rings.
  • R 5 is C 6-10 aryl, C 6-10 aryl-C 1-4 alkyl, or 5- to 9-membered heteroaryl
  • R 6 is hydrogen, nitro, amino, halogen, hydroxy. , cyano, C 1-6 alkyl, C 1-6 haloalkyl, C 1-6 alkoxy, amino-C 1-6 alkoxy, aminocarbonyl, C 1-6 alkylaminocarbonyl, diC 1-6 alkyl It may be aminocarbonyl, C 1-6 alkylcarbonylamino, C 1-6 alkylamino, or C 1-6 alkyl-amino-C 1-6 alkoxy.
  • R 5 is C 1-6 alkyl; or C 1-6 alkoxy-C 1-6 alkylamino, C 1-6 alkyl substituted with any of 3-9 membered cycloalkyl and 3-9 membered heterocycloalkyl or C 1-6 alkylamino- It may or may not be substituted with C 1-6 alkyl. Additionally, R 6 may or may not be substituted with 3- to 9-membered cycloalkyl or 3- to 9-membered heterocycloalkyl.
  • the cycloalkyl or heterocycloalkyl is halogen, oxo, cyano, hydroxy, hydroxy-C 1-6 alkyl, amino, diC 1-6 alkylamino, C 1-6 alkyl, C 1-6 alkoxy, and C 1-6 alkoxy-C 1-6 alkyl, wherein the heteroaryl and heterocycloalkyl are each independently selected from the group consisting of N, O and S. It may contain one or more heteroatoms.
  • the compound represented by Formula 6 is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl
  • the compound of Formula 6 can be prepared by the method shown in the reaction formulas below, but is not limited to being produced by this method.
  • the compound of Formula 6 of the present invention can be prepared by various methods using well-known techniques in the art.
  • reaction equation shows the preparation method of the compound of Formula 6 in each manufacturing step, and various compounds of Formula 6 may be prepared by changing the reagents and solvents used in the following preparation steps or changing the reaction order.
  • the compound of Formula 6 can be prepared according to the procedures in Schemes 1 and 2 below.
  • R 1 , R 2 , and X are as defined in Formula 6 above.
  • carboxylic acid compound (6a) is prepared using lactone-based compound (2) as a starting material, which can be easily obtained commercially or prepared by a known method.
  • Step 1 the compound of formula (3) is prepared by formylation of compound (2), which can be easily commercially obtained, using dimethyldimethoxyacetal.
  • the reaction can be performed at high temperature, but it has the disadvantage of requiring a long reaction time, so the reaction is performed using a microwave reactor.
  • step 2 compound (4) is prepared using the lactone compound (3) formalized in step 1 and triethyloxonium tetrafluoroborate, which can be easily obtained commercially.
  • This reaction is performed under anhydrous conditions and is preferably performed using a solvent such as N,N-dichloromethane or chloroform that does not adversely affect the reaction.
  • the reaction temperature is generally carried out at room temperature.
  • Step 3 the compound (4) prepared in Step 2 is reacted with an ethyl-3-amino-3-oxopropionate compound prepared by a known method in the presence of sodium ethoxide to perform cyclization.
  • Compound (5) is prepared. This reaction is preferably carried out using an ethanol solvent that does not adversely affect the reaction.
  • the reaction temperature is not particularly limited, but generally the reaction can be performed under cold to warm temperatures, and is preferably performed at room temperature.
  • a lactone-based compound (2) which can be easily obtained commercially, is used as a starting material in the presence of titanium tetrachloride and pyridine according to a known method.
  • Compound (6) can be prepared by reacting with the ethyl-3-amino-3-oxopropionate compound prepared by. This reaction is preferably carried out using dichloromethane, which does not adversely affect the reaction.
  • the reaction temperature is not particularly limited, but generally the reaction can be carried out at cold to room temperature, and is preferably started at cold temperature. Perform at room temperature.
  • step 5 compound (5) is prepared by formylation and circularization of compound (6) prepared in step 4 using dimethyldimethoxyacetal.
  • the reaction can be performed under elevated and high temperatures, but is preferably performed under elevated temperatures.
  • the carboxylic acid compound (6a) is prepared through a hydrolysis reaction of the circularized compound (5) prepared in Steps 3 and 5 above.
  • the hydrolysis reaction is performed using a basic aqueous solution such as an aqueous sodium hydroxide solution or an aqueous lithium hydroxide solution.
  • This reaction is performed using solvents such as ethanol, methanol, tetrahydrofuran, etc., which do not adversely affect the reaction, in the presence of an aqueous lithium hydroxide solution that can be used in the hydrolysis reaction.
  • the reaction temperature is not particularly limited, and in general, the reaction can be performed at room temperature or at elevated temperature, but is preferably performed at elevated temperature to prepare carboxylic acid compound (6a).
  • R 1 to R 6 , X and Y are as defined in Formula 6, and W is a leaving group.
  • the above Scheme 2 specifically shows each step for preparing the target compound (10) of the present invention, and the compound (10) illustrates the case where L is -NH- in the above formula (6).
  • step 1 a monocyclic or bicyclic compound (7), which can be easily obtained commercially or prepared by a known method, is reacted with a nitrophenol compound, which can be easily obtained commercially, in the presence of a base such as potassium carbonate to produce phenoxy.
  • Compound (8) is prepared.
  • This reaction is generally an ether formation reaction of a phenol compound and is carried out in the presence of a base that can be used in the ether formation reaction.
  • bases that can be used for this purpose include sodium hydrate (NaH), potassium carbonate, sodium carbonate, cesium carbonate, sodium or potassium alkoxide.
  • the reaction is preferably carried out in the presence of a solvent that does not adversely affect the reaction, such as dichloromethane, chloroform, tetrahydrofuran, diethyl ether, toluene, N,N-dimethylformamide, acetonitrile, or diphenyl.
  • a solvent such as ether.
  • the reaction temperature is not particularly limited, but generally, the reaction can be performed at room temperature to elevated temperature, and is preferably performed under elevated temperature.
  • Step 2 the nitrophenol compound (8) prepared in Step 1 is reduced in the presence of iron and ammonium chloride to prepare the amine compound (9).
  • This reaction is generally a reduction reaction of a nitro compound to an amine and can be carried out using various reducing agents such as hydrogen, iron, tin ( ⁇ chloride, zinc, etc.).
  • the reaction is preferably a reaction.
  • Solvents that do not adversely affect the reaction such as dichloromethane, ethyl acetate, methanol, ethanol, tetrahydrofuran, or N,N-dimethylformamide, are used, and depending on the reaction, water is used as a co-solvent to perform the reaction.
  • the temperature is not particularly limited, but generally the reaction can be carried out at room temperature or at elevated temperature, and is preferably carried out at elevated temperature.
  • Step 3 a general amidation reaction is performed in which the amine compound (9) prepared in Step 2 and the carboxylic acid compound (6a) prepared in Scheme 1 are reacted using a coupling reagent.
  • a coupling reagent include 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide (EDC), 1,3-dicyclohexyl carboimide (DCC), and 1,1, which are readily available commercially.
  • the target compounds produced in the above reaction scheme can be separated and purified using conventional methods, such as column chromatography and recrystallization.
  • halogen means F, Cl, Br or I unless otherwise specified.
  • alkyl refers to a linear or branched, saturated hydrocarbon moiety.
  • C 1-10 alkyl means alkyl with a skeleton of 1 to 10 carbons. Specifically, C 1-10 alkyl is methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, t-butyl, n-pentyl, i-pentyl, t-pentyl, sec-pentyl, neopentyl. , hexyl, heptyl, octyl, nonyl, decyl, etc.
  • haloalkyl means alkyl substituted with one or more halogens. Specifically, haloalkyl may be an alkyl substituted with two or more halogens of the same type or with two or more types of halogens substituted.
  • alkoxy refers to a group having the formula -O-alkyl, wherein an alkyl group as previously defined is attached to the parent compound through an oxygen atom.
  • the alkyl portion of the alkoxy group may have 1 to 20 carbon atoms (i.e., C 1 -C 20 alkoxy), 1 to 12 carbon atoms (i.e., C 1 -C 12 alkoxy), or 1 to 6 carbon atoms (i.e., C 1 -C 6 alkoxy).
  • alkoxy groups examples include methoxy (-O-CH 3 or -OMe), ethoxy (-OCH 2 CH 3 or -OEt), t-butoxy (-OC(CH 3 ) 3 or -O-tBu). etc.
  • aryl refers to an aromatic hydrocarbon radical derived by removing one hydrogen atom from the carbon atom constituting the parent aromatic ring system.
  • an aryl group can have 6 to 20 carbon atoms, 6 to 14 carbon atoms, or 6 to 10 carbon atoms.
  • cycloalkyl refers to a saturated monocycle or polycycle containing only carbon atoms in the ring. Cycloalkyls can have 3 to 7 carbon atoms as a monocycle, 7 to 12 carbon atoms as a bicycle, and up to about 20 carbon atoms as a polycycle.
  • heteroaryl refers to an aromatic heterocyclyl having one or more heteroatoms in the ring.
  • Non-limiting examples of heteroaryls include pyridinyl, pyrrolyl, oxazolyl, indolyl, isoindolyl, purinyl, furanyl, thienyl, benzofuranyl, benzothiophenyl, carbazolyl, imidazolyl, and thia.
  • heterocycle refers to an oriented or non-oriented ring having one or more heteroatoms, which may be saturated or unsaturated, and which may be monocyclic or polycyclic.
  • heterocycle means a heterocycle whose skeleton consists of a total of 4 to 10 atoms, including heteroatoms and carbon atoms.
  • the 4- to 10-membered heterocycle is azetidine, diazetidine, pyrrolidine, pyrrole, imidazolidine, imidazole, pyrazolidine, pyrazole, oxazolidine, oxazole, isoxazolidine, It may include isoxazole, thiazolidine, thiazole, isothiazolidine, isothiazole, piperidine, pyridine, piperazine, diazine, morpholine, thiomorpholine, azepane, diazepane, etc.
  • heterocycloalkyl refers to a non-aromatic heterocyclyl having one or more heteroatoms in the ring. Heterocycloalkyl may have one or more carbon-carbon double bonds or carbon-hetero atom double bonds in the ring to the extent that the ring is not aromatic due to the presence of the double bond.
  • Non-limiting examples of heterocycloalkyls include azetidinyl, aziridinyl, pyrrolidinyl, piperidinyl, piperazinyl, homopiperazinyl, morpholino, thiomorpholino, tetrahydrofuranyl, tetrahydrothio. furanyl, tetrahydropyranyl, pyranyl (which may have one or more substituents on the ring), etc.
  • heteroatom refers to an atom other than carbon (C), and may specifically be a nitrogen (N), oxygen (O), or sulfur (S) atom.
  • the heteroaryl and heterocycloalkyl mentioned above contain one or more heteroatoms, for example, may contain 1, 1 to 2, 1 to 3, or 1 to 4 heteroatoms.
  • substitution refers to the replacement of a hydrogen atom in a molecular structure with a substituent such that a chemically stable compound results from such substitution without exceeding the valence on the designated atom.
  • group A is substituted by substituent B” or “group A has substituent B” means that the hydrogen atom bonded to an atom such as carbon constituting the skeleton of group A is replaced by substituent B, thereby forming a group. It may mean that A and substituent B form a covalent bond.
  • the pharmaceutical composition of the present invention contains a pharmaceutically acceptable salt of the compound represented by Formula 1 or Formula 6 above as an active ingredient.
  • the term "pharmaceutically acceptable” means a substance that is not biological or otherwise undesirable, i.e., does not cause any undesirable biological effect or interact in a deleterious manner with any other ingredient of the pharmaceutical composition in which it is contained. refers to a substance that can be administered to a subject along with the composition.
  • the pharmaceutically acceptable salt should have low toxicity to humans and should not have any negative effect on the biological activity and physicochemical properties of the parent compound.
  • the pharmaceutically acceptable salt may be an acid addition salt formed with a pharmaceutically acceptable free acid.
  • the free acid may be an inorganic acid or an organic acid.
  • the inorganic acid may be hydrochloric acid, sulfuric acid, nitric acid, phosphoric acid, perchloric acid, hydrobromic acid, etc.
  • the organic acid may be acetic acid, methanesulfonic acid, ethanesulfonic acid, p-toluene sulfuric acid, etc. It may be fonic acid, fumaric acid, maleic acid, malonic acid, phthalic acid, succinic acid, lactic acid, citric acid, gluconic acid, tartaric acid, salicylic acid, malic acid, oxalic acid, benzoic acid, embonic acid, aspartic acid, glutamic acid, etc.
  • the acid addition salt can be prepared by a conventional method, for example, by dissolving the compound of Formula 1 or Compound 6 in an excessive amount of acid aqueous solution, and dissolving this salt in a water-miscible organic solvent, such as methanol, ethanol, acetone, or acetonitrile. It can be manufactured by precipitation.
  • a water-miscible organic solvent such as methanol, ethanol, acetone, or acetonitrile. It can be manufactured by precipitation.
  • the pharmaceutically acceptable salt may be an alkali metal salt (sodium salt, etc.) or an alkaline earth metal salt (potassium salt, etc.).
  • the alkali metal salt or alkaline earth metal salt can be prepared by, for example, dissolving the compound of Formula 1 or Compound 6 in an excessive amount of alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the undissolved compound salt, and then evaporating and drying the filtrate. You can get it.
  • the compounds of the present invention may have a chiral carbon center and therefore may exist as R or S isomers, racemic compounds, individual enantiomers or mixtures, individual diastereomers or mixtures, all of which are stereoisomers. and mixtures thereof may fall within the scope of the present invention.
  • the compounds of the present invention may include hydrates and solvates of the compounds of Formula 1 or Formula 6.
  • the hydrates and solvates can be prepared using known methods, and are preferably non-toxic and water-soluble.
  • the hydrate and solvate may be a combination of 1 to 5 molecules of water and an alcoholic solvent (particularly, ethanol, etc.), respectively.
  • the pharmaceutical composition of the present invention contains, as an active ingredient, a compound represented by Formula 1 or Formula 6, or a pharmaceutically acceptable salt thereof, in an amount of about 0.1% to about 90% by weight, specifically about 0.1% by weight, based on the total weight of the composition. It may contain from 0.5% by weight to about 75% by weight, more specifically from about 1% by weight to about 50% by weight.
  • the compound represented by Formula 1 or Formula 6 of the present invention may be administered in combination with an anti-PD-1 antibody.
  • PD-1 programmed cell death protein 1
  • CD279 is a protein expressed on the surface of activated T cells. It reacts with PD-L1 (B7-H1) and PD-L2 (B7-DC), proteins on the surface of cancer cells, and inhibits T-cell activation, growth factors, and cytokine production mediated by TCR (T cell receptor) and CD28. This induces voice signal transmission.
  • a PD-1 inhibitor may be a neutralizing antibody or antigen-binding fragment thereof that binds to PD-1, an aptamer, or a fusion protein containing an antibody capable of binding to PD-1, or a small molecule compound that inhibits the function of PD-1. However, it is not limited to this.
  • the term "anti-PD-1 antibody” specifically binds to PD-1, thereby reducing signal transduction resulting from the interaction between PD-1 and its binding partner, PD-L1 or PD-L2. refers to an antibody that has an inhibitory, and/or interfering effect.
  • Anti-PD-1 antibodies include, for example, AMP-224 (Amplimmune, GlaxoSmith Klein), AMP-514 (MEDI0680, Amplimmune, GlaxoSmith Klein), Nivolumab (Opdivo, Bristol Myers Squibb), Pembrolizumab, Keytruda, Merck), Cemiplimab (Libtayo, Sanofi), Spartalizumab (Novartis), Dostarlimab (Jemperli, GlaxoSmith Klein), Pidilizumab (Cure Tech), Pimivali Pimivalimab (Jounce Therapeutics), Camrelizumab (Jiangsu Hengrui Medicine), Sintilimab (Innovent Biologics), Tislelizumab (BeiGene), Toripalimab (Shanghai Junshi Biosciences), BGB -A317 (BeiGene, Celgene), PF-06801591 (Pfizer), PDR001 (Novartis
  • the compound represented by Formula 1 or Formula 6, or a pharmaceutically acceptable salt thereof is administered in combination with an anti-PD-1 antibody, thereby administering the compound represented by Formula 1 or Formula 6, or a pharmaceutically acceptable salt thereof.
  • This can increase the effect of treating cancer or inhibiting cancer cell growth compared to the single administration of an acceptable salt.
  • the compound represented by Formula 1 or Formula 6, or a pharmaceutically acceptable salt thereof alone or the anti-PD-1 antibody alone the compound represented by Formula 1 or Formula 6, or its
  • a pharmaceutically acceptable salt is administered in combination with an anti-PD-1 antibody
  • the expression level of all cytokines increases, allowing effective treatment of cancer.
  • the cytokines whose expression level increases in combined administration compared to single administration may be TNF- ⁇ , Granzyme B, and/or INF- ⁇ , but are not limited thereto.
  • the compound or composition of the present invention can be administered to a patient in a therapeutically effective amount or a pharmaceutically effective amount.
  • the term "therapeutically effective amount” or “pharmaceutically effective amount” refers to the amount of a compound or composition effective in preventing or treating a target disease, and is used to treat the disease with a reasonable benefit/risk ratio applicable to medical treatment. This means an amount that is sufficient and does not cause side effects.
  • the compound represented by Formula 1 or Formula 6, or a pharmaceutically acceptable salt thereof, and the anti-PD-1 antibody may be administered at the same dose or at different doses, and the preferred dose is varies depending on the individual's condition and weight, severity, drug form, administration route and period, but may be appropriately selected by a person skilled in the art.
  • the dosage ratio of the compound represented by Formula 1 or Formula 6, or a pharmaceutically acceptable salt thereof: the anti-PD-1 antibody may be 1:1 to 5:1.
  • the dosage ratio of the compound represented by Formula 1 or Formula 6, or a pharmaceutically acceptable salt thereof: anti-PD-1 antibody is 1:1, 2:1, 3:1, 4:1, or 5. :1.
  • the compound represented by Formula 1 or Formula 6, or a pharmaceutically acceptable salt thereof is administered in combination with an anti-PD-1 antibody once, twice, or three or more times per day.
  • an anti-PD-1 antibody once, twice, or three or more times per day.
  • it is not limited thereto, and when administered individually, their administration cycles may be different from each other.
  • the term “administration” means introducing a given drug into an individual by any appropriate method, and the route of administration of the substance may be any general route as long as the drug can reach the target tissue.
  • the compound represented by Formula 1 or Formula 6, or a pharmaceutically acceptable salt thereof, and an anti-PD-1 antibody are each independently administered topically, parenterally, orally. , may be administered to a subject intravenously, intramuscularly, subcutaneously, or by aerosol, but is not limited thereto.
  • the compound represented by Formula 1 or Formula 6, or a pharmaceutically acceptable salt thereof, and the anti-PD-1 antibody may be administered orally or intravenously independently of each other.
  • the term “pharmaceutical composition” encompasses a product comprising the specified ingredients in predetermined amounts or proportions, as well as any product resulting directly or indirectly from combining the specified ingredients in the specified amounts.
  • composition according to the present invention may comprise conventional, non-toxic pharmaceutically acceptable additives, which are blended into preparations according to conventional methods.
  • pharmaceutical composition may further include a pharmaceutically acceptable carrier, diluent, or excipient.
  • additives used in the composition according to the present invention include sweeteners, binders, solvents, solubilizers, wetting agents, emulsifiers, isotonic agents, absorbents, disintegrants, antioxidants, preservatives, lubricants, glidants, fillers, flavoring agents, etc. can do.
  • the additives include lactose, dextrose, sucrose, mannitol, sorbitol, cellulose, glycine, silica, talc, stearic acid, stearin, magnesium stearate, magnesium aluminosilicate, starch, gelatin, gum tragacanth, It may contain alginic acid, sodium alginate, methylcellulose, sodium carboxymethylcellulose, agar, water, ethanol, polyethylene glycol, polyvinylpyrrolidone, sodium chloride, calcium chloride, orange essence, strawberry essence, vanilla flavor, etc.
  • composition according to the invention can be formulated in various formulation forms for oral administration (e.g. tablets, pills, powders, capsules, syrups or emulsions) or parenteral administration (e.g. intramuscular, intravenous or subcutaneous injection). .
  • the composition according to the present invention can be formulated into a formulation for oral administration, and additives used in this case include cellulose, calcium silicate, corn starch, lactose, sucrose, dextrose, calcium phosphate, stearic acid, and magnesium stearate. , calcium stearate, gelatin, talc, surfactants, suspending agents, emulsifiers, diluents, etc. may be included.
  • examples of lubricants include colloidal silicon dioxide, magnesium silicate, etc.;
  • examples of diluents include Microcrystalline Cellulose, Lactose Fast Flo (registered trademark) Lactose Anhydrous, Lactose Monohydrate, Silicified MCC HD 90, etc., and disintegrants.
  • examples of (Disintegrant) include Croscarmellose Sodium, Crospovidone, etc.;
  • examples of lubricants include Magnesium Stearate, Sodium Lauryl Sulfate, and Stearic Acid.
  • liquid preparations for oral administration include suspensions, emulsions, syrups, etc., and in addition to the commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, preservatives, etc. may be included.
  • preparations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, and suppositories.
  • Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate.
  • injectables may contain conventional additives such as solubilizers, isotonic agents, suspending agents, emulsifiers, stabilizers, preservatives, etc.
  • cancer refers to cells characterized by uncontrolled or unregulated cell proliferation, reduced cell differentiation, inappropriate ability to invade surrounding tissues, and/or the ability to establish new growth at ectopic sites. It refers to a disorder and is used synonymously with “tumor,” which is the target disease of the present invention.
  • cancer includes, but is not limited to, solid tumors and blood-borne tumors, and further includes diseases of the skin, tissues, organs, bones, cartilage, blood and blood vessels, as well as primary and metastatic tumors. do.
  • the cancers include breast cancer, lung cancer, non-small cell lung cancer, bladder cancer, bone cancer, blood cancer, melanoma, thyroid cancer, parathyroid cancer, bone marrow cancer, rectal cancer, throat cancer, larynx cancer, esophagus cancer, tongue cancer, brain tumor, gallbladder cancer, biliary tract cancer, oral cancer, It may be selected from the group consisting of anal cancer, colon cancer, stomach cancer, prostate cancer, uterine cancer, ovarian cancer, kidney cancer, pancreatic cancer, liver cancer, colon cancer, skin cancer, head and neck cancer, thyroid cancer, and central nervous system tumor.
  • prevention refers to all actions that suppress cancer or delay the onset of cancer
  • treatment refers to all actions that improve or beneficially change the symptoms of cancer.
  • the term “individual” is used synonymously with subject, and the subject may be a mammal, for example, a human, cow, horse, pig, dog, sheep, goat, or cat.
  • an individual in need of treatment of cancer or inhibition of cancer cell growth may be an individual who develops cancer recurrence or is at risk of experiencing cancer recurrence, and an individual in need of treatment of cancer or inhibition of cancer cell growth may include surgery,
  • the subject may be an individual who has been treated with one or more anti-cancer treatments selected from radiation and chemotherapy, but is not limited thereto.
  • Another aspect of the present invention is a compound represented by Formula 1 or Formula 6, or a pharmaceutically acceptable salt thereof; and a pharmaceutical composition for preventing or treating cancer comprising an anti-PD-1 antibody.
  • the pharmaceutical composition according to the present invention includes a compound represented by Formula 1 or Formula 6, or a pharmaceutically acceptable salt thereof; and an anti-PD-1 antibody, wherein the compound represented by Formula 1 or Formula 6, or a pharmaceutically acceptable salt thereof, type of anti-PD-1 antibody, type of cancer, subject, dosage and the administration method are as described above.
  • Another aspect of the present invention includes a compound represented by Formula 1 or Formula 6, or a pharmaceutically acceptable salt thereof, and a compound represented by Formula 1 or Formula 6, or a pharmaceutically acceptable salt thereof. It relates to a kit for preventing or treating cancer, including instructions for administration in combination with this anti-PD-1 antibody.
  • the compound represented by Formula 1 or Formula 6, or a pharmaceutically acceptable salt thereof, the type of anti-PD-1 antibody, the type of cancer, the subject, the dosage, and the method of administration are as described above.
  • Another aspect of the present invention is a compound represented by Formula 1 or Formula 6, or a pharmaceutically acceptable salt thereof; and administering an anti-PD-1 antibody to the subject.
  • the compound represented by Formula 1 or Formula 6, or a pharmaceutically acceptable salt thereof, or the anti-PD-1 antibody may be administered to the individual simultaneously or sequentially, and in this case, the compound represented by Formula 1 or Formula 6
  • the compound, or pharmaceutically acceptable salt thereof, type of anti-PD-1 antibody, type of cancer, subject, dosage and administration method are as described above.
  • Another aspect of the present invention is a drug for preventing or treating cancer comprising a compound represented by Formula 1 or Formula 6, or a pharmaceutically acceptable salt thereof, comprising the compound represented by Formula 1 or Formula 6, or It relates to the use of pharmaceutically acceptable salts thereof for preparing a medicament administered in combination with an anti-PD-1 antibody.
  • the compound represented by Formula 1 or Formula 6, or a pharmaceutically acceptable salt thereof, the type of anti-PD-1 antibody, the type of cancer, the subject, the dosage, and the method of administration are as described above.
  • Step 2 Synthesis of 3-((dimethylamino)methylene)-2-(3H)-dihydrofuranylidene ethyl oxonium tetrafluoroborate
  • step 1 The compound obtained in step 1 (1.085 g, 7.68 mmol) was dissolved in 8 ml of chloroform, triethyloxonium tetrafluoroborate (1.729 g, 7.68 mmol) was added, and the mixture was stirred under nitrogen at room temperature for more than 1 day.
  • the reaction mixture was concentrated under reduced pressure, and it was confirmed using nuclear magnetic resonance that the starting material and product material were produced in a ratio of about 15:85, and the next reaction was performed without purification.
  • Step 3 Synthesis of ethyl 5-(4-fluorophenyl)-6-oxo-2,3,5,6,-tetrahydrofuro[3,2-c]pyridine-7-carboxylate
  • step 3 The compound (0.9 g, 2.97 mmol) obtained in step 3 was dissolved in 10 mL of ethanol and 5 mL of distilled water, then lithium hydroxide monohydrate (249 mg, 5.94 mmol) was added and heated to 50°C for more than 4 hours. It was stirred. The reaction mixture was concentrated under reduced pressure and extracted with water and dichloromethane. A 1N hydrochloric acid solution was added to the separated water layer, and then extracted with water and dichloromethane. The separated organic layer was dried over anhydrous magnesium sulfate, filtered, and concentrated under reduced pressure. The concentrated residue was filtered by precipitating a solid with a small amount of dichloromethane and diethyl ether, and the filtered solid was dried to obtain the title compound (680 mg, yield: 84%, off-white solid).
  • Example 1 4-Ethoxy-N-[3-fluoro-4-( ⁇ 2-[5-(morpholinomethyl)pyridin-2-yl]thieno[3,2-b]pyridine-7 -yl ⁇ oxy)phenyl]-1-(4-fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxamide hydrochloride
  • the title compound was synthesized by the method described in Example 31 of Republic of Korea Patent No. 10-2221689.
  • the title compound was synthesized by the method described in Example 1 of Korean Patent No. 10-2221689.
  • the title compound was synthesized by the method described in Example 78 of Korean Patent Publication No. 10-2021-0015730.
  • the title compound was synthesized by the method described in Example 88 of Korean Patent Publication No. 10-2021-0015730.
  • the positive control compound is pembrolizumab.
  • 2x10 4 cells of U937 cells were plated on a 24-well plate (Eppendorf), stimulated with 150 nM PMA (Invitrogen), and differentiated into macrophages in a carbon dioxide incubator at 37°C for 48 hours. After 48 hours, the supernatant was carefully removed, and the compound of Example 1 was stimulated at 50 nM along with the new culture medium.
  • PMA Invitrogen
  • the cell line medium After reaction in a carbon dioxide incubator at 37°C for 48 hours, the cell line medium is removed, washed once with PBS, and treated with 2 ml of 0.25% trypsin-EDTA. The removed cells were diluted with 8 ml of PBS (hereinafter referred to as FACS buffer) containing 2% FBS and 0.05% sodium aside, then centrifuged at 1200 rpm for 1 minute to remove the supernatant. To block non-specific antibody reactions, 2 ⁇ g of anti-human Fc block (BD, cat. #564219) was added to the separated cells and reacted at room temperature for 10 minutes.
  • CD68, CD86, and CD206 antibodies were added to each sample and reacted at 4°C for 30 minutes with light blocked. After reaction, 1 ml of Stain Buffer was added and washed, centrifuged at 1200 rpm for 3 minutes, supernatant was removed, cells were collected, 200 ⁇ l of Stain Buffer was added and analyzed with a BD LSRFortessaTM Flow Cytometer.
  • CD206 a representative marker of M2 macrophages, decreased when treated with the compound of Example 1 ( Figure 1).
  • colon cancer cell spheroids 2x10 4 cells of SW620 colon cancer cells were inoculated into a U-Bottom 96-well plate (Nunc, 174925) and cultured in a carbon dioxide incubator at 37°C for 72 hours. PBMC were centrifuged at 1200 rpm for 10 minutes to remove the supernatant, and resuspended in PBS. 18 ⁇ l of DMSO was added to CFSE (Invitrogen, C34554) to make a concentration of 5 mM, and then diluted in PBS to a concentration of 1 mM.
  • CFSE Invitrogen, C34554
  • 1 ⁇ l of 1mM CFSE was added per 1x106 cell/ml, and then stained for 10 minutes in a carbon dioxide incubator at 37°C.
  • a medium containing FBS in an amount five times the amount of PBS was added to the stained PBMC, and then reacted in a carbon dioxide incubator at 37°C for 5 minutes.
  • the supernatant was removed by centrifugation at 1200 rpm for 10 minutes and resuspended in the medium.
  • the formed spheroids were transferred to an ultra-low adhesion 96-well plate (Corning, CLS3474), 2 well each, and CFSE-stained PBMCs were seeded at 1x10 5 cells and co-cultured in a carbon dioxide incubator at 37°C for 24 hours.
  • Tumor infiltrating lymphocytes TIL were observed through a fluorescence microscope, the size of the spheroids was photographed using an optical microscope, and the area was measured using image J.
  • the formed spheroids and the surrounding supernatant are collected in a tube and centrifuged at 1200 rpm for 2 minutes to remove the supernatant.
  • the cell pellet was treated with 500 ⁇ l of 0.25% trypsin-EDTA to form single cells, diluted with 2 ml of PBS (hereinafter referred to as FACS buffer) containing 2% FBS and 0.05% NaN 3 , and then incubated at 1200 rpm. Centrifuge for 3 minutes and remove the supernatant.
  • the cell pellet was resuspended in 200 ⁇ l of FACS buffer, then CD45 antibody (BD) was added and stained at 4°C for 30 minutes.
  • BD CD45 antibody
  • the extracted tumor tissue was taken and reacted with collagenase B (Roche, cat. #11088815001) at 37°C for more than 2 hours until the tumor was decomposed.
  • collagenase B (Roche, cat. #11088815001)
  • the tumor tissue was completely decomposed into cells, it was mixed well with a 1 ml pipette and separated into single cells.
  • the cells were transferred to a 50 ml tube (SPL, cat. #50050), then 20 ml of PBS was added and washed. Centrifuge at 1200 rpm for 3 minutes, remove the supernatant, add Dnase I (Roche, cat. #11284932001), and react at 37°C for 20 minutes.
  • the supernatant of the separated tumor tissue was collected in a 1.5 ml ep-tube and the amount of cytokine secretion was measured through CBA assay.
  • Capture beads and PE detection reagent were mixed to match the number of samples, and then 50 ⁇ l each was added to the assay tube.
  • 50 ⁇ l of each sample was placed in an assay tube and reacted at RT for 1 hour in the dark.
  • 50 ⁇ l of PE detection reagent was added at a time, mixed well, and reacted for another 2 hours without additional washing.
  • the reaction was washed with 1 ml of wash buffer, then 200 ⁇ l of buffer was added and analyzed with a BD LSRFortessaTM Flow Cytometer. Meanwhile, Vehicle is a negative control group.
  • M2 macrophages infiltrating the tumor tissues of mice treated in combination with pembrolizumab and the compound of Example 1 were reduced, and pro-inflammatory cytokines TNF ⁇ , GranzymeB, and IFN ⁇ were increased (FIG. 3b).
  • a 16-week-old female CD34+ humanized mouse (Gem biosciences) was purchased and acclimatized for 1 week. Then, NCI-H358 cell line , a human lung cancer cell line (5 ⁇ l) was injected. When the size of the tumor reached about 100 mm 3 , negative control group, positive control group (5 mg/kg) alone, compound of Example 1 (5 mg/kg) alone, and positive control group (5 mg/kg) + Example 1 A compound (5 mg/kg) was administered in combination. The positive control group was administered intraperitoneally twice a week, and the compound of Example 1 was administered orally once a day for 3 weeks. Tumor size and body weight were measured twice a week.
  • the section of tumor tissue extracted was deparaffinized and rehydrated, then soaked in target recovery buffer to recover the heat-induced epitope, placed in a microwave oven, and heated for 15 minutes. Next, they were placed in target recovery buffer for an additional 30 minutes. After washing three times in Tris-buffered saline-0.05% Tween 20 (TBS-T), blocking was performed with blocking solution, and after 60 minutes, IGSF1 (Santacruz, sc-393786) was mixed 1:100 and incubated overnight at 4°C. I ordered it.
  • a 5-week - old female BALB/c mouse was purchased and acclimatized for 1 week. Then, the mouse colon cancer cell line CT26 (2.5 When the size of the tumor reached an average of 50 to 100 mm 3 , the negative control group, the compound of Example 1 (30 mg/kg) alone, the positive control group (10 mg/kg) alone, and the compound of Example 1 (30 mg/kg) ) + positive control group (10 mg/kg) was administered in combination. The compound of Example 1 was administered orally once a day, and the positive control group was administered intraperitoneally once a day for 17 days. Tumor size and body weight were measured twice a week.
  • Tumor tissue from an animal model using the mouse colon cancer cell line CT26 was cut into small pieces, placed in a culture medium containing collagenase B (2.4 mg/ml) and 5% fetal bovine serum, and cultured at 37°C for 2 to 4 hours. After 2 to 4 hours, centrifugation was performed at 1200 rpm for 3 minutes and the supernatant was removed. The supernatant was removed, physiological saline was added to the remaining pellet, mixed with a pipette, and then centrifuged at room temperature for 7 minutes at a speed of 300 x g.
  • collagenase B 2.4 mg/ml
  • fetal bovine serum fetal bovine serum
  • the supernatant was removed, and the culture solution containing 0.3 mg/ml Dnase I was added to the remaining pellet, mixed with a pipette, and cultured in a shaking incubator at a temperature of 37°C. Afterwards, the solution was resuspended in phosphate-buffered saline solution and centrifuged at room temperature for 7 minutes at a speed of 300 x g to remove the supernatant. After removing the supernatant, Trypsin-EDTA solution was added to the remaining pellet and mixed with a pipette to separate cells in the tumor tissue. Afterwards, it was filtered through a 70 uM filter to obtain single cells within the tumor tissue.
  • the obtained single cells were blocked by treatment with mouse Fc Block for 10 minutes, and then treated with mouse CD45-Brilliant Violet 786 antibody, mouse Inos-Alexafluor 488, and mouse Arginase 1-Alexafluor 700 antibody by blocking light for 30 minutes. Afterwards, the M1/M2 macrophage ratio and CD45+ leukocytes in tumor tissue were analyzed using an LTR Fortessa TM flow cytometer.
  • the positive control group (10 mg/kg) alone, the compound of Example 1 (30 mg/kg) alone, and the positive control group (10 mg/kg) + the compound of Example 1 (30 mg/kg) were administered in combination.
  • the ratio of M1/M2 macrophages in the tumor tissue of the combination treatment group increased compared to the single treatment, and CD45+ tumor infiltrating lymphocytes (TIL) infiltrating the tumor tissue were also confirmed to increase in the combination treatment group compared to the single treatment ( Figure 5b) .
  • TIL tumor infiltrating lymphocytes
  • PBMCs obtained from healthy individuals (8 cases) and lung cancer patients (17 cases) were cultured in RPMI-1640 culture medium containing 1% penicillin/streptomycin and 10% fetal bovine serum and 50 ng/ml human M-CSF in a 24-well plate. and 20 ng/ml IL-4 were added to induce macrophage differentiation through culture for 10 days, and then the macrophage cell pellet was harvested.
  • Total RNA was extracted from each cell pellet using trizol and chlorofor, and the concentration and quality of RNA were measured using a nano-drop device.
  • cDNA was synthesized from 1 ⁇ g of total RNA using AccuPower® RT PreMix. RT-PCR was performed in a Veriti 96well Thermal cycler (Applied Biosystems).
  • RNA sequences of the RON primers used were forward: ATCTGTGGCCAGCATCTAAC, reverse: CTTGGTATCCTGCTGCCTTT, and the GAPDH primer sequences were forward: GGACTGAGGCTCCCACCTTT, reverse: CCTGCAGCGTACTCCCCACA (Table 1), and GAPDH was used as a loading control.
  • the RT-PCR product was confirmed by electrophoresis on a 1% agarose gel, purified using a PCR purification kit, and the RON genotype was analyzed through Sanger sequencing.
  • sequence number name Sequence (5' to 3') One RON forward primer ATCTGTGGCCAGCATCTAAC 2 RON Reverse Primer CTTGGTATCCTGCTGCCTTT 3 GAPDH forward primer GGACTGAGGCTCCCCACCTTTT 4 GAPDH reverse primer CCTGCAGCGTACTCCCCACA
  • Experimental Example 6B was performed to determine whether the compound of Example 1 affects the differentiation of M1 macrophages or M2 macrophages depending on the presence or absence of MSP in normal RON macrophages and RON mutant macrophages.
  • Real-time PCR was performed on a LightCycler® 480, and for template amplification, 10 ⁇ l of SFCgreen® Fast qPCR Master Mix 2X, 2 ⁇ l of cDNA, 1 ⁇ l each of forward and reverse primers, and 6 ⁇ l of distilled water were added to make a total volume of 20. It was set to ⁇ l.
  • the ARG-1 primer sequence used is forward: GTGAAGAACCCACCACGGTCTGT, reverse direction: GCCAGAGAGAGAGAGAGAGAGAGAGAGACTCTCGG, MRC-1 primer sequence is forward: AGCCACACAGCTCCTCAAGA, reverse direction: CAAACGCGCTGTGT CCA, CXCL10 primer sequence is a forward: gaagcagtagtagcaagaagaaggtc, reverse direction: atgtagggaagtgatgagagg and GAPDH primer sequence : GGACTGAGGCTCCCACCTTT, Reverse: CCTGCAGCGTACTCCCCACA (Table 2), and all expression amplification levels were corrected by the GAPDH amplification value in each sample.
  • Real-time PCR quantification was performed using the LightCycler® 480 system and related software.
  • M2 macrophage markers increased and M1 macrophage markers decreased in a MSP-dependent manner, and the compound of Example 1 decreased M2 macrophage markers and increased M1 macrophage markers.
  • the M2 macrophage marker was decreased and the M1 macrophage marker was increased by the compound of Example 1, regardless of MSP (FIG. 6b).

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Organic Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Endocrinology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Heterocyclic Carbon Compounds Containing A Hetero Ring Having Oxygen Or Sulfur (AREA)

Abstract

La présente invention concerne une composition pharmaceutique pour la prévention ou le traitement du cancer, comprenant un inhibiteur de RON mutant ou un sel pharmaceutiquement acceptable de celui-ci, et une composition pharmaceutique et une utilisation de celle-ci, la composition pharmaceutique étant administrée en ayant un inhibiteur de RON mutant ou un sel pharmaceutiquement acceptable de celui-ci combiné à un anticorps anti-PD-1.
PCT/KR2023/004682 2022-04-06 2023-04-06 Composition pharmaceutique pour traiter le cancer, comprenant un inhibiteur de ron mutant et un anticorps anti-pd-1 WO2023195807A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20220042907 2022-04-06
KR10-2022-0042907 2022-04-06

Publications (1)

Publication Number Publication Date
WO2023195807A1 true WO2023195807A1 (fr) 2023-10-12

Family

ID=88243262

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/004682 WO2023195807A1 (fr) 2022-04-06 2023-04-06 Composition pharmaceutique pour traiter le cancer, comprenant un inhibiteur de ron mutant et un anticorps anti-pd-1

Country Status (2)

Country Link
KR (1) KR20230144484A (fr)
WO (1) WO2023195807A1 (fr)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20190043162A (ko) * 2016-08-30 2019-04-25 다나-파버 캔서 인스티튜트 인크. 약물 전달 조성물 및 그의 용도
KR20210142553A (ko) * 2020-05-18 2021-11-25 웰마커바이오 주식회사 Ron 돌연변이와 관련된 소세포 폐암 예방 또는 치료용 약학 조성물 및 이를 이용한 방법
KR20210142554A (ko) * 2020-05-18 2021-11-25 웰마커바이오 주식회사 Ron 돌연변이와 관련된 비소세포 폐암 예방 또는 치료용 약학 조성물 및 이를 이용한 방법
KR20210142555A (ko) * 2020-05-18 2021-11-25 웰마커바이오 주식회사 Ron 돌연변이와 관련된 췌장암 예방 또는 치료용 약학 조성물 및 이를 이용한 방법
KR20220013511A (ko) * 2020-07-23 2022-02-04 의료법인 성광의료재단 암 치료를 위한 면역체크포인트 억제제의 병용 요법

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20190043162A (ko) * 2016-08-30 2019-04-25 다나-파버 캔서 인스티튜트 인크. 약물 전달 조성물 및 그의 용도
KR20210142553A (ko) * 2020-05-18 2021-11-25 웰마커바이오 주식회사 Ron 돌연변이와 관련된 소세포 폐암 예방 또는 치료용 약학 조성물 및 이를 이용한 방법
KR20210142554A (ko) * 2020-05-18 2021-11-25 웰마커바이오 주식회사 Ron 돌연변이와 관련된 비소세포 폐암 예방 또는 치료용 약학 조성물 및 이를 이용한 방법
KR20210142555A (ko) * 2020-05-18 2021-11-25 웰마커바이오 주식회사 Ron 돌연변이와 관련된 췌장암 예방 또는 치료용 약학 조성물 및 이를 이용한 방법
KR20220013511A (ko) * 2020-07-23 2022-02-04 의료법인 성광의료재단 암 치료를 위한 면역체크포인트 억제제의 병용 요법

Also Published As

Publication number Publication date
KR20230144484A (ko) 2023-10-16

Similar Documents

Publication Publication Date Title
WO2021158071A1 (fr) Composition pharmaceutique pour la prévention ou le traitement des cancers associés à une mutation de kras
WO2021194320A1 (fr) Composés dérivés de pyrazolo quinazoline induisant une dégradation sélective de plk1
WO2021025407A1 (fr) Dérivé d'oxo-pyridine à cycle condensé et composition pharmaceutique le comprenant
AU2021257373B2 (en) Pyridopyrimidinone derivatives and their use as Aryl hydrocarbon receptor modulators
WO2020149723A1 (fr) Dérivé de pyrrolopyrimidine et composition pharmaceutique pour la prévention ou le traitement d'une maladie liée à la protéine kinase le comprenant en tant que principe actif
WO2023018236A1 (fr) Nouveau composé induisant la dégradation de plk1
WO2021235811A1 (fr) Composition pharmaceutique pour la prévention ou le traitement du cancer du poumon à petites cellules associé à des mutants de ron et méthode l'utilisant
WO2021235812A1 (fr) Composition pharmaceutique pour la prévention ou le traitement du cancer du poumon non à petites cellules associé à une mutation ron, et méthode l'utilisant
AU2017256488B2 (en) Quinazoline derivative or its salt and pharmaceutical composition comprising the same
WO2016093554A2 (fr) Nouveau dérivé de 4-(aryl)-n-(2-alkoxythiéno[3,2-b]pyrazin-3-yl)-pipérazine-1-carboxamide et effet antiprolifératif de celui-ci
EP3166945A2 (fr) Nouveaux dérivés triazolopyrimidinone ou triazolopyridinone et leur utilisation
WO2017034245A1 (fr) Inhibiteur sélectif de la janus kinase 1 et utilisation pharmaceutique associée
WO2021235813A1 (fr) Composition pharmaceutique pour la prévention ou le traitement du cancer du pancréas associé à une mutation ron et méthode l'utilisant
WO2018169360A1 (fr) Dérivé de quinoléine-5,8-dione comme inhibiteur de la tgase (2), et composition pharmaceutique le comprenant
WO2023195807A1 (fr) Composition pharmaceutique pour traiter le cancer, comprenant un inhibiteur de ron mutant et un anticorps anti-pd-1
WO2023195773A1 (fr) Dérivé hétéroaryle et son utilisation
EP4110781A1 (fr) Composés dérivés de 1,3,4-oxadiazole utilisés comme inhibiteurs d'histone désacétylase 6, et composition pharmaceutique les comprenant
WO2016006974A2 (fr) Nouveaux dérivés triazolopyrimidinone ou triazolopyridinone et leur utilisation
WO2020262998A1 (fr) Nouveau dérivé de quinazoline ayant une activité antitumorale et composition pharmaceutique le comprenant
WO2023195803A1 (fr) Composition pharmaceutique pour prévenir ou traiter le cancer de la tête et du cou associé à une mutation ron
WO2022235063A1 (fr) Composition pharmaceutique pour la prévention ou le traitement du cancer des voies biliaires associé à une mutation de ron
WO2013015657A2 (fr) Nouveau composé ayant une activité inhibitrice de l'angiogenèse, procédé de préparation de ce composé et composition pharmaceutique comprenant ce composé
WO2024215130A1 (fr) Nouveau dégradeur de gspt1 et son utilisation
WO2023177233A1 (fr) Nouveau composé et son utilisation pour inhiber la kinase de point de contrôle 2
WO2023068852A1 (fr) Composé dérivé de benzothiophène-1,1-dioxyde utilisé en tant qu'inhibiteur de stat3 et son utilisation

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23785031

Country of ref document: EP

Kind code of ref document: A1