WO2023194291A1 - Plantes présentant une résistance améliorée aux agents pathogènes - Google Patents

Plantes présentant une résistance améliorée aux agents pathogènes Download PDF

Info

Publication number
WO2023194291A1
WO2023194291A1 PCT/EP2023/058645 EP2023058645W WO2023194291A1 WO 2023194291 A1 WO2023194291 A1 WO 2023194291A1 EP 2023058645 W EP2023058645 W EP 2023058645W WO 2023194291 A1 WO2023194291 A1 WO 2023194291A1
Authority
WO
WIPO (PCT)
Prior art keywords
plant
pub17
tomato
suitably
allele
Prior art date
Application number
PCT/EP2023/058645
Other languages
English (en)
Inventor
Yuling BAI
Anna Maria Agnes Wolters
Ageeth VAN TUINEN
Johannes Arnoldus Laurentius Van Kan
Original Assignee
Syngenta Crop Protection Ag
Nunhems Netherlands B.V.
Rijk Zwaan Zaadteelt En Zaadhandel B.V.
Takii & Company Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Syngenta Crop Protection Ag, Nunhems Netherlands B.V., Rijk Zwaan Zaadteelt En Zaadhandel B.V., Takii & Company Limited filed Critical Syngenta Crop Protection Ag
Publication of WO2023194291A1 publication Critical patent/WO2023194291A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/12—Processes for modifying agronomic input traits, e.g. crop yield
    • A01H1/122—Processes for modifying agronomic input traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • A01H1/1245—Processes for modifying agronomic input traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, e.g. pathogen, pest or disease resistance
    • A01H1/1255—Processes for modifying agronomic input traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, e.g. pathogen, pest or disease resistance for fungal resistance
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H5/00—Angiosperms, i.e. flowering plants, characterised by their plant parts; Angiosperms characterised otherwise than by their botanic taxonomy
    • A01H5/08—Fruits
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H6/00—Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy
    • A01H6/82—Solanaceae, e.g. pepper, tobacco, potato, tomato or eggplant
    • A01H6/825—Solanum lycopersicum [tomato]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8282—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for fungal resistance

Definitions

  • the present invention relates to novel tomato plants having improved resistance to lesion- forming pathogens.
  • the present invention further relates to plant parts and seeds derived from said tomato plants, and to methods of making said tomato plants or increasing resistance to lesion-forming pathogens in a tomato plant.
  • Further aspects of the invention relate to modified Pub17 nucleic acid and Pub17 protein sequences which are associated with such improved resistance to lesion-forming pathogens. BACKGROUND OF THE INVENTION Valuable crop plants such as tomatoes are hosts for more than 200 species of a wide variety of pests and pathogens.
  • R-genes cloned so far can be classified into two groups: (1) plasma membrane receptors including receptor-like kinase (RLK, (encoded by the I-3 gene) and receptor-like proteins (RLP, encoded by the Cf-genes and the Ve-1 gene); and (2) in most cases intracellular receptors representing proteins with nucleotide-binding site and leucine-rich repeat domains (NBS-LRR).
  • RLK receptor-like kinase
  • RLP receptor-like proteins
  • NBS-LRR leucine-rich repeat domains
  • S-genes are plant genes encoding proteins that are exploited by a pathogen for its own benefit during the infection process (Pavan et al., 2010).
  • S-genes can be classified in three groups (Van Schie and Takken 2014): (i) genes that allow basic plant-pathogen compatibility, that facilitate host recognition and penetration; (ii) genes that encode negative regulators of immune signalling; (iii) genes that allow sustained compatibility and pathogen proliferation, that fulfil metabolic or structural needs of the pathogen. When such a gene becomes dysfunctional due to mutation or loss of expression, it impedes a pathogen from colonizing the plant. Therefore, impaired S-genes mostly result in recessive resistance traits in contrast to recognition-based resistance governed by dominant R-genes. The strategy of using S-genes provides a fundamentally different opportunity to control diseases caused by lesion-forming microbes.
  • a tomato plant or plant material having reduced level, activity, or expression of a Pub17 protein conferring an increased resistance to a lesion-forming pathogen relative to a reference tomato plant or plant material.
  • the tomato plant or plant material has been modified to reduce the level, activity, or expression of a Pub17 protein.
  • the tomato plant or plant material which has been modified to reduce the level, activity, or expression of a Pub17 protein conferring an increased resistance to a lesion-forming pathogen relative to a reference tomato plant or plant material.
  • the tomato plant or plant material comprises a modified Pub17 allele.
  • the plant or plant material comprises a Pub17 allele having at least 70% identity with SEQ ID NO:1 (wild type Pub17 allele) or an orthologue or homologue thereof, wherein said Pub17 allele comprises a mutation.
  • the modified Pub17 allele confers an increased resistance to a lesion-forming pathogen relative to a reference tomato plant or plant material.
  • a tomato plant or plant material comprising a Pub17 allele having at least 70% identity with SEQ ID NO:1 (wild type Pub17 allele) or an orthologue or homologue thereof, wherein said Pub17 allele comprises a mutation resulting in reduced level, activity or expression of a Pub17 protein conferring an increased resistance to a lesion-forming pathogen relative to a reference tomato plant or plant material.
  • a method of increasing resistance of a tomato plant or plant material to a lesion-forming pathogen comprising reducing the level, activity or expression of a Pub17 protein in the tomato plant or plant material.
  • the method comprises modifying the tomato plant to reduce the level, activity or expression of a Pub17 protein in the tomato plant or plant material.
  • there is a method of increasing resistance of a tomato plant or plant material to a lesion-forming pathogen the method comprising modifying the tomato plant to reduce the level, activity or expression of a Pub17 protein in the tomato plant or plant material.
  • the method comprises obtaining a mutant population of tomato plants, and selecting a tomato plant comprising a modified Pub17 allele.
  • the method comprises selecting a tomato plant comprising a Pub17 allele having at least 70% identity with SEQ ID NO:1 (wild type Pub17 allele) or an orthologue or homologue thereof which comprises a mutation.
  • a method of increasing resistance of a tomato plant or plant material to a lesion-forming pathogen comprising obtaining a mutant population of tomato plants, and selecting a plant comprising a Pub17 allele having at least 70% identity with SEQ ID NO:1 (wild type Pub17 allele) or an orthologue or homologue thereof which comprises a mutation resulting in reduced level, activity or expression of Pub17 protein.
  • the increased resistance may be relative to a reference tomato plant or plant material.
  • a method of producing a tomato plant having increased resistance to a lesion-forming pathogen the method comprising reducing the level, activity or expression of a Pub17 protein in the tomato plant or plant material.
  • the method comprises modifying the tomato plant to reduce the level, activity or expression of a Pub17 protein in the tomato plant or plant material.
  • a method of producing a tomato plant having increased resistance to a lesion-forming pathogen comprising modifying the plant to reduce the level, activity or expression of a Pub17 protein in the tomato plant or plant material.
  • the method comprises obtaining a mutant population of tomato plants, and selecting a plant comprising a modified Pub17 allele.
  • the method comprises selecting a tomato plant comprising a Pub17 allele having at least 70% identity with SEQ ID NO:1 (wild type Pub17 allele) or an orthologue or homologue thereof which comprises a mutation.
  • a method of producing a tomato plant having increased resistance to a lesion-forming pathogen comprising obtaining a mutant population of tomato plants and selecting a modified tomato plant comprising a modified Pub17 allele having at least 70% identity with SEQ ID NO:1 (wild type Pub17 allele) or an orthologue or homologue thereof which comprises a mutation resulting in reduced level, activity or expression of Pub17 protein.
  • the increased resistance may be relative to a reference tomato plant or plant material.
  • a method of enhancing the growth of a tomato plant by increasing resistance of the tomato plant or plant material to a lesion-forming pathogen comprising reducing the level, activity or expression of a Pub17 protein in the tomato plant or plant material.
  • the method comprises modifying the tomato plant to reduce the level, activity or expression of Pub17 protein in the tomato plant or plant material.
  • there is a method of enhancing the growth of a tomato plant by increasing resistance of the tomato plant or plant material to a lesion-forming pathogen the method comprising modifying the tomato plant to reduce the level, activity or expression of a Pub17 protein in the tomato plant or plant material.
  • the method comprises obtaining a mutant population of tomato plants, and selecting a plant comprising a modified Pub17 allele. In one embodiment, the method comprises selecting a tomato plant comprising a Pub17 allele having at least 70% identity with SEQ ID NO:1 (wild type Pub17 allele) or an orthologue or homologue thereof which comprises a mutation.
  • a method of enhancing the growth of a tomato plant by increasing resistance of the tomato plant or plant material to a lesion-forming pathogen comprising obtaining a mutant population of tomato plants, and selecting a modified plant comprising a modified Pub17 allele having at least 70% identity with SEQ ID NO:1 (wild type Pub17 allele) or an orthologue or homologue thereof which comprises a mutation resulting in reduced level, activity or expression of Pub17 protein.
  • the increased resistance may be relative to a reference tomato plant or plant material.
  • a method of identifying a tomato plant having increased resistance to a lesion forming pathogen relative to a reference tomato plant or plant material comprising: determining the level, activity, or expression of a Pub17 protein in one or more tomato plant/s and comparing this to the level, activity, or expression of a Pub17 protein in a reference tomato plant, selecting a tomato plant having a reduction in the level, activity, or expression of the Pub17 protein relative to the reference tomato plant, wherein a reduction in the level, activity, or expression of the Pub17 protein is indicative of increased resistance to a lesion forming pathogen relative to the reference tomato plant.
  • the method comprises a step of obtaining a mutant population of tomato plants.
  • a method of identifying a tomato plant having increased resistance to a lesion forming pathogen relative to a reference tomato plant or plant material comprising: obtaining a mutant population of tomato plants, determining the level, activity, or level of expression of a Pub17 protein in one or more tomato plants of the population of tomato plants and comparing this to the level, activity, or expression of a Pub17 protein in a reference tomato plant, selecting a plant having a reduction in the level, activity, or expression of the Pub17 protein relative to the reference tomato plant, wherein a reduction in the level, activity, or expression of the Pub17 protein is indicative of increased resistance to a lesion forming pathogen relative to the reference tomato plant.
  • the method comprises obtaining a mutant population of tomato plants, and screening for tomato plants comprising a modified Pub17 allele. In one embodiment, the method comprises screening for a tomato plant comprising a Pub17 allele having at least 70% identity with SEQ ID NO:1 (wild type Pub17 allele) or an orthologue or homologue thereof which comprises a mutation.
  • a method of identifying a tomato plant having increased resistance to a lesion forming pathogen relative to a reference tomato plant or plant material comprising: obtaining a mutant population of tomato plants, screening said population of tomato plants for the presence of a Pub17 allele having at least 70% identity with SEQ ID NO:1 (wild type Pub17 allele) or an orthologue or homologue thereof which comprises a mutation resulting in reduced level, activity or expression of a Pub17 protein, selecting a tomato plant having said Pub17 allele.
  • a plant part obtained from the tomato plant of the first aspect In one embodiment, the plant part is a fruit. In one embodiment, the plant part comprises a modified Pub17 allele.
  • the plant part comprises a Pub17 allele having at least 70% identity with SEQ ID NO:1 (wild type Pub17 allele) or an orthologue or homologue thereof which comprises a mutation.
  • a seed capable of producing a tomato plant of the first aspect comprises a modified Pub17 allele.
  • the seed comprises a Pub17 allele having at least 70% identity with SEQ ID NO:1 (wild type Pub17 allele) or an orthologue or homologue thereof which comprises a mutation.
  • an isolated polynucleotide sequence having at least 70% identity with SEQ ID NO:1 (wild type) or an orthologue or homologue thereof, wherein the sequence comprises a mutation at position 1477 of SEQ ID NO:1 or a position corresponding thereto.
  • the isolated polynucleotide comprises or consists of a sequence according to SEQ ID NO:2.
  • the isolated polynucleotide sequence is capable of conferring an increased resistance to a lesion-forming pathogen.
  • it is capable of conferring an increased resistance to a lesion-forming pathogen when expressed in a plant or plant material.
  • an isolated polypeptide sequence encoded by the polynucleotide sequence of the eighth aspect consists of an amino acid sequence according to SEQ ID NO:4 (truncated protein sequence) or a portion thereof, or an amino acid sequence having at least 70% identity thereto.
  • the isolated polypeptide sequence is capable of conferring an increased resistance to a lesion-forming pathogen.
  • a vector or expression construct comprising the polynucleotide sequence of the eighth aspect.
  • a host cell comprising a polynucleotide sequence according to the eighth aspect, a vector according to the tenth aspect, or a polypeptide according to the ninth aspect.
  • a method of producing hybrid seed comprising crossing a first tomato plant of the first aspect with a second tomato plant and obtaining seed therefrom.
  • kits for detecting a lesion-forming pathogen resistant Pub17 allele in a tomato plant comprising a PCR oligonucleotide primer pair wherein the primer pair comprises: a forward primer of SEQ ID NO:25 and a reverse primer of SEQ ID NO:24; or a first forward primer of SEQ ID NO:31, a second forward primer of SEQ ID NO:30, and a reverse primer of SEQ ID NO:32.
  • the kit is for use in a gene-specific PCR and comprises a forward primer of SEQ ID NO:25 and a reverse primer of SEQ ID NO:24.
  • the kit is for use in an allele-specific PCR and comprises a first forward primer of SEQ ID NO:31, a second forward primer of SEQ ID NO:30, and a reverse primer of SEQ ID NO:32.
  • the present invention makes use of the principle of mutated S-genes to achieve resistance against lesion-forming pathogens instead of using classical R-genes or introgression of several (minor) effect QTL.
  • the present inventors have firstly identified a novel S-gene, Pub17, not previously known to be a susceptibility gene in Solanaceae species.
  • Solanaceae plants which carry a mutated, dysfunctional allele of this S-gene have increased pathogen resistance, especially to lesion-forming pathogens.
  • the examples demonstrate that Solanaceae plants homozygous for this mutated Pub17 allele are significantly less susceptible to necrotrophic pathogens, including Botrytis and Alternaria, and hemi-biotrophic pathogens, such as Phytophthora infestans. The inventors have shown this to be the case in several different genetic backgrounds.
  • the Pub17 allele can be used in crop breeding to obtain Solanaceae plant populations that are less prone to becoming heavily diseased by necrotrophic pathogens than existing cultivars.
  • the invention provides an alternative solution to the problem of lesion forming pathogen control in Solanaceae crops which is much simpler than using QTLs or R-genes.
  • Solanaceae family of plants are one of the largest family of crop plants, containing not only tomatoes but also potatoes and peppers, such resistant plants of the invention are economically significant.
  • the invention can be used to limit the damage caused by these pathogens and increase crop yields in the Solanaceae family.
  • BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 shows: The pedigree of the identified M2042 mutant produced by EMS mutagenesis.
  • FIG. 1 shows: The structure of the mutant M2042 candidate gene PUB17 which provides reduced susceptibility to Botrytis cinerea.
  • Tomato PUB17 (Solyc02g072080) has 3 domains: U-box N-terminal domain UND (amino acids 20-171), U-box domain (amino acids 297-364) and ARM armadillo repeats (amino acids 429-682) (deduced by comparison with potato StPUB17, Ni et al.2010).
  • a SNP at position 1477 was identified, which resulted in a premature stop codon at amino acid R493.
  • Figure 6 shows: A boxplot of lesion diameter sizes on leaves from PUB17 RNAi T3 families with the two negative controls (MM and TV24) on the left of each panel. Left panel, results from 3 days post inoculation (dpi); right panel, results from 4dpi. Different letters above the boxplots indicate significant differences, as calculated by Tukey HSD method.
  • Figure 7 shows: A boxplot of lesion diameter sizes on leaves from PUB17 RNAi T2 family TV181105 (TV05, NPTII-containing plants) with the two negative controls (MM and non-NPTII- containing plants of TV181105) on the left of each panel. Left panel, results from 3 days post inoculation (dpi); right panel, results from 4dpi.
  • FIG. 8 shows: The location of 4 sgRNAs for targeting tomato PUB17 gene using CRISPR/Cas9.
  • Figure 9 shows: Four CRISPR/Cas9 PUB17 transformants that show smaller bands than the expected wild-type Moneymaker (MM) control indicating cleavage has occurred.
  • PUB17 was amplified using primers FWD_MR_GX_CRISPR + REV_MR_GX_CRISPR (A) or AWPUB17_F1 + REV_MR_GX_CRISPR (B). PCR products were run on a 1% agarose gel with TAE. Sizes of marker bands are indicated in bp.
  • FIG 10 shows: CRISPR-induced mutations in tomato PUB17 gene. Graphical representation of the tomato PUB17 genomic sequence. The single exon is shown as a filled arrow, with position of the four sgRNA target sites as asterisks. Expected PCR products for the wild-type allele are shown below the exon. Sizes of deletions in the CRISPR transformants are indicated as lines above the exon.
  • Figure 11 shows: CRISPR-induced single-nucleotide mutations at target sites of sgRNA3 and sgRNA4 in tomato PUB17 gene in CRISPR/Cas9 transformant 7.
  • Figure 12 shows: A boxplot of lesion diameter sizes on leaves from PUB17 CRISPR mutant T3 families, compared with negative controls Moneymaker (MM) and non-mutant T2 family TV181133.
  • Figure 13 shows: Graphs showing reduced lesion diameter sizes after infection with Alternaria solani in F3, F4 and M5 EMS-induced mutant PUB17 plants compared with controls Moneymaker (MM) and Micro-Tom (MT) at (A) 10 days post inoculation and (B) 5 days post inoculation.
  • Petiole stump response Petiole stump partly or fully thinning with brown colouration.2
  • Beginning of outward main stem infection Small brown ring visible on main stem around leaf axil of inoculated petiole stump.3, Spreading of outward main stem infection. Brown ring becomes irregular and is spreading upward and downwards on main stem.4, Full main stem infection and wilting of plant. Main stem is invaded, followed by internal browning and collapsing of stem tissue. The stem is drying up and finally the plant top capsizes.
  • Figure 16 shows: Protein domains in mutant PUB17 alleles. WT, wild type tomato PUB17 protein; M2042, EMS PUB17 mutant allele; Allele 1-4, CRISPR PUB17 mutant alleles.
  • FIG. 17 shows: EMS-mutant pub17 pre-breeding results.
  • A Scheme of introgressing the pub17 mutation into breeding lines H1 and H2.
  • B Scheme of introgressing the pub17 mutation into pre-breeding lines A and B of a F1 hybrid.
  • C Observation of autonecrosis in pre-breeding line B. No necrotic spots are shown on leaves (left panel) of the F1 hybrid and the pre-breeding line A with the pub17 mutation (pub17pub17).
  • WT control carrying a normal PUB17 allele. Observation of necrotic spots on the pre-breeding line B leaves (right panel) 120 days after sowing.
  • the plant to be tested is crossed with a “tester” plant and the segregation ratio of the trait in the progeny of the cross is scored.
  • “Probe” as used herein refers to a group of atoms or molecules which is capable of recognising and binding to a specific target molecule or cellular structure and thus allowing detection of the target molecule or structure.
  • “probe” refers to a labelled DNA or RNA sequence which can be used to detect the presence of and to quantitate a complementary sequence by molecular hybridization.
  • Particularly preferred stringent hybridization conditions are for instance present if hybridization and washing occur at 65°C as indicated above.
  • Non-stringent hybridization conditions for instance with hybridization and washing carried out at 45°C, are less preferred and at 35°C even less.
  • the term "position corresponding to” position X, X being any number to be found in the respective context in the present application, does not only include the respective position in the SEQ ID NO referred to afterwards but also includes any sequence corresponding to a Pub17 allele or encoding a Pub17 protein, where, after alignment with the reference SEQ ID NO, the respective position might have a different number but corresponds to that indicated for the reference SEQ ID NO.
  • Alignment of Pub17 allelic or Pub17 protein sequences can be effected by applying various alignment tools in a sensible manner, and for example by applying the tools described below.
  • Sequence Identity refers to two or more sequences or sub-sequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same, when compared and aligned for maximum correspondence, as measured using one of the following sequence comparison algorithms or by visual inspection.
  • sequence identity preferably relates to the percentage of the nucleotide residues of the shorter sequence which are identical with the nucleotide residues of the longer sequence.
  • the comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm, as described herein below.
  • sequence identity can be determined conventionally with the use of computer programs such as the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive Madison, WI 53711). Bestfit utilizes the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2 (1981), 482-489, in order to find the segment having the highest sequence identity between two sequences.
  • Bestfit or another sequence alignment program to determine whether a particular sequence has for instance 95% identity with a reference sequence of the present invention, the parameters are preferably so adjusted that the percentage of identity is calculated over the entire length of the reference sequence and that homology gaps of up to 5% of the total number of the nucleotides in the reference sequence are permitted.
  • the so-called optional parameters are preferably left at their preset ("default") values.
  • the deviations appearing in the comparison between a given sequence and the above-described sequences of the invention may be caused for instance by addition, deletion, substitution, insertion or recombination.
  • Such a sequence comparison can preferably also be carried out with the program “fasta20u66” (version 2.0u66, September 1998 by William R. Pearson and the University of Virginia; see also W.R. Pearson (1990), Methods in Enzymology 183, 63-98, appended examples and http://workbench.sdsc.edu/).
  • the "default" parameter settings may be used.
  • hybridizing specifically to refers to the binding, duplexing, or hybridizing of a molecule only to a particular nucleotide sequence under stringent conditions when that sequence is present in a complex mixture (e.g., total cellular) DNA or RNA.
  • Bod(s) substantially refers to complementary hybridization between a probe nucleic acid and a target nucleic acid and embraces minor mismatches that can be accommodated by reducing the stringency of the hybridization media to achieve the desired detection of the target nucleic acid sequence.
  • Stringent hybridization conditions and “stringent hybridization wash conditions” in the context of nucleic acid hybridization experiments such as Southern and Northern hybridizations are sequence dependent and are different under different environmental parameters. Longer sequences hybridize specifically at higher temperatures. An extensive guide to the hybridization of nucleic acids is found in Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes part I chapter 2 “Overview of principles of hybridization and the strategy of nucleic acid probe assays” Elsevier, New York. Generally, highly stringent hybridization and wash conditions are selected to be about 5° C lower than the thermal melting point for the specific sequence at a defined ionic strength and pH.
  • a probe will hybridize to its target subsequence, but to no other sequences.
  • the “thermal melting point” is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe.
  • Very stringent conditions are selected to be equal to the melting temperature (T.sub.m) for a particular probe.
  • An example of stringent hybridization conditions for hybridization of complementary nucleic acids which have more than 100 complementary residues on a filter in a Southern or northern blot is 50% formamide with 1 mg of heparin at 42°C., with the hybridization being carried out overnight.
  • An example of highly stringent wash conditions is 0.15M NaCl at 72°C for about 15 minutes.
  • An example of stringent wash conditions is a 0.2 times SSC wash at 65°C for 15 minutes (see, Sambrook, infra, for a description of SSC buffer). Often, a high stringency wash is preceded by a low stringency wash to remove background probe signal.
  • An example medium stringency wash for a duplex of, e.g., more than 100 nucleotides, is 1 times SSC at 45°C for 15 minutes.
  • An example low stringency wash for a duplex of, e.g., more than 100 nucleotides is 4-6 times SSC at 40°C for 15 minutes.
  • stringent conditions typically involve salt concentrations of less than about 1.0M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3, and the temperature is typically at least about 30°C.
  • Stringent conditions can also be achieved with the addition of destabilizing agents such as formamide.
  • a signal to noise ratio of 2 times (or higher) than that observed for an unrelated probe in the particular hybridization assay indicates detection of a specific hybridization.
  • Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the proteins that they encode are substantially identical. This occurs, e.g.
  • homologue refers to a protein that is functionally equivalent i.e. has the same activity as a Pub17 protein having an amino acid sequence as defined herein but may have a limited number of amino acid substitutions, deletions, insertions or additions in the amino acid sequence. Homologues may have lower sequences identities, for example at least 20%, at least 25%, at least 30%, at least 35% or at least 40% or more sequence identity to a Pub17 protein identified herein, but are capable of carrying out the same function.
  • orthologue refers to a protein that is a homologue and is therefore functionally equivalent, but is found in a different species i.e., has the same activity as a Pub17 protein as defined herein but is present in a different species of plant.
  • Tomato plant A "plant” as used herein is any plant at any stage of development. Suitably in most embodiments of the invention, the plant is a tomato plant.
  • the plant is any of the following tomato species : Solanum lycopersicum, Solanum habrochaites, Solanum pimpinellifolium, Solanum pennellii, Solanum arcanum, Solanum cheesmaniae, Solanum chilense, Solanum chmielewskii, Solanum corneliomulleri, Solanum galapagense, Solanum neorickii or Solanum peruvianum.
  • the plant is a Solanum lycopersicum plant.
  • the plant may be any variety or cultivar of Solanum lycopersicum, such as for example: alicante, adoration, azoychka, beefsteak, better boy, black krim, brandywine, campari, celebrity, cherokee, early girl, fourth of July, garden peach, gardeners delight, germa johnson, guilette F1, granadero, great white, green zebra, hanover, hillbilly, japanese black trifele, jersey boy, jubilee, Juliet, lillians yellow, matt’s wild cherry, micro-tom, moneymaker, monterosa, montserrat, mortgage lifter, mr.
  • Solanum lycopersicum such as for example: alicante, adoration, azoychka, beefsteak, better boy, black krim, brandywine, campari, celebrity, cherokee, early girl, fourth of July, garden peach, gardeners delight, germa johnson
  • a plant part or material may be any plant part, organ or tissue which is obtainable from a cultivated tomato plant, suitably from a cultivated tomato plant, suitably from a cultivated Solanum lycopersicum plant of the invention.
  • the tomato plant part or material still exhibits improved resistance to lesion-forming pathogens compared to a reference tomato plant part or material. In some embodiments, this resistance may only be present when the part or material is grown into a tomato plant.
  • the tomato plant part or material exhibits a reduction in the level, activity or expression of Pub17 protein compared to a reference tomato plant part or material.
  • the tomato plant part comprises the modified Pub17 allele and is suitably capable of expressing the modified Pub17 allele.
  • the term plant material may include propagation material obtainable from a tomato plant according to the invention. Suitable propagation material may be cuttings, roots, fruits, tubers, bulbs, rhizomes, meristem tissue and the like. Suitably the propagation material still exhibits improved resistance to lesion-forming pathogens compared to reference propagation material. Suitably therefore the propagation material exhibits a reduction in the level, activity or expression of Pub17 protein compared to reference propagation material. Suitably the propagation material comprises the modified Pub17 allele and is suitably capable of expressing the modified Pub17 allele. Suitably the propagation material may be propagated into a tomato plant, suitably into a tomato plant having improved resistance to lesion-forming pathogens compared to a reference tomato plant.
  • a tomato plant having a reduction in the level, activity or expression of Pub17 protein compared to a reference tomato plant.
  • a tomato plant comprising the modified Pub17 allele, and capable of expressing the modified Pub17 allele.
  • “Propagation” refers to the process of growing a plant from a plant part or material (for example, plant protoplast or explant). Such regeneration techniques rely on manipulation of certain phytohormones in a tissue culture growth medium. Choice of methodology for the propagation step is not critical. See, for example, Ammirato et al., Handbook of Plant Cell Culture — Crop Species. Macmillan Publ. Co. (1984). The present invention also extends to fruit.
  • a fruit produced by a tomato plant according to the invention is a tomato fruit.
  • the fruit may be obtainable from a cultivated tomato plant, more preferably a cultivated Solanum lycopersicum plant of the invention.
  • the tomato fruit still exhibits improved resistance to lesion-forming pathogens compared to a reference tomato fruit.
  • the tomato fruit exhibits a reduction in the level, activity or expression of Pub17 protein compared to a reference tomato fruit.
  • the tomato fruit comprises the modified Pub17 allele, and suitably is capable of expressing the modified Pub17 allele.
  • the present invention also extends to one or more seeds.
  • a “plant seed” as used herein is a seed which grows into a plant, suitably into a tomato plant according to the invention.
  • the term “seed” embraces seeds and plant propagules of all kinds including but not limited to true seeds, seed pieces, suckers, corms, bulbs, fruit, tubers, grains, cuttings, cut shoots and the like.
  • the seed is capable of producing a tomato plant which exhibits improved resistance to a lesion-forming pathogen compared to a reference tomato plant.
  • the seed exhibits a reduction in the level, activity or expression of Pub17 protein compared to a reference tomato seed.
  • the seed comprises the modified Pub17 allele and is suitably capable of being grown into a tomato plant expressing the modified Pub17 allele.
  • the seed is a tomato seed that produces a tomato plant according to the invention.
  • the tomato seed may be obtainable from a cultivated tomato plant, more preferably a cultivated Solanum lycopersicum plant of the invention.
  • the tomato seed comprises the modified Pub17 allele, and suitably is capable of being grown into a tomato plant expressing the modified Pub17 allele.
  • Seeds may be treated or untreated seeds.
  • the seeds can be treated to improve germination, for example, by priming the seeds, or by disinfection to protect against seed-borne pathogens.
  • seeds can be coated with any available coating to improve, for example, plantability, seed emergence, and protection against seed-borne pathogens.
  • Seed coating can be any form of seed coating including, but not limited to pelleting, film coating, and encrustments.
  • Methods of Reducing the Level, Activity or Expression of Pub17 Protein Suitably the level, activity or expression of Pub17 protein can be reduced in the tomato plant of the invention by any means. Suitably however it is not reduced by essentially biological processes.
  • the term “reducing the level, activity or expression of the Pub17 protein” may refer to under-expression, suppression or temporal or spatial mis-expression of the Pub17 polypeptide in a plant or plant material and/or reduction in the biological effects or activity of the Pub17 protein in a plant or plant material.
  • a reduction in the Pub17 protein level in the plant may be a reduction in the amount of Pub17 protein.
  • a reduction in the amount of Pub17 protein localised in cells of the plant for example in cells of the leaf tissue, as compared to the amount of Pub17 protein in the same tissue in a native plant of the same species at the same stage if grown under identical conditions, and in which no deliberate alteration of expression levels has been made (i.e., an unmodified reference plant).
  • the level, activity or expression of Pub17 protein is reduced by modification of the tomato plant.
  • genetic modification of the tomato plant Suitably genetic modification of the tomato plant may be transient or stable modification.
  • Suitable random mutagenesis techniques may be chemical, gamma-ray, UV, or X-ray mutagenesis.
  • Suitable gene editing techniques may be by CRISPR-Cas systems (in particular CRISPR-Cas9 or CRISPR-Cas13, any references to Cas9 hereinbelow may also refer to other Cas proteins such as Cas13), Zinc Finger Nucleases, or TALENs for example.
  • the level, activity or expression of Pub17 protein is reduced by suppression. Suitably by suppression of the expression of the Pub17 gene and thereby suppression of expression of the Pub17 protein.
  • a plant, or plant material of the invention may be non-transgenic, in the sense that the genetic material of the plant, part or cell has been modified by a process involving for example Crispr-Cas based gene editing, whereby modification of the identity of an individual nucleotide base or of bases is achieved in the genome.
  • Crispr-Cas based gene editing whereby modification of the identity of an individual nucleotide base or of bases is achieved in the genome.
  • the modification is carried out by chemical mutagenesis or CRISPR/Cas9 mediated gene editing.
  • the Pub17 gene sequence is modified.
  • the Pub17 gene sequence comprises one or more modifications as a result of the method of modification.
  • chemical mutagenesis may be carried out by exposing the tomato plant to a chemical mutagen such as ethyl methanesulfonate (EMS), Ethyl Nitrosourea (ENU), NMU (Nitrosyl methyl urea), Methyl Methanosulfonate (MMS), Ethidium Bromide, psoralen, acridine orange, or Sodium Azide.
  • EMS ethyl methanesulfonate
  • ENU Ethyl Nitrosourea
  • NMU Non-oxidyl methyl urea
  • Methyl Methanosulfonate MMS
  • Ethidium Bromide psoralen
  • acridine orange or Sodium Azide.
  • the seed of the tomato plant is exposed to EMS, and the tomato plant is then grown from the seed.
  • the seed may be pre-soaked in distilled water.
  • the seed may be pre-soaked for between 2 to 15 hours, suitably for around 8h.
  • the seed is treated with an EMS dilution of 0.5 to 10%, suitably 1-5%, suitably 1% EMS dilution.
  • the seed is treated for between 6 to 48 hours, suitably between 12 to 245 hours, suitably for about 12 hours.
  • CRISPR/Cas9 gene editing is carried out by introducing into the tomato plant the components of a CRISPR/Cas9 system.
  • the CRISPR-Cas system allows target- specific cleavage of genomic DNA guided by Cas9 endonuclease in complex with a guide RNA (gRNA) that complementarily binds a target DNA sequence.
  • gRNA guide RNA
  • the components of a CRISPR/Cas9 system are a Cas9 endonuclease protein and a suitable guide RNA complementary to a target sequence in the genome of the plant.
  • guide RNA generally refers to an RNA molecule (or a group of RNA molecules collectively) that can bind to a CRISPR system effector, such as a Cas or a Cpf 1 protein, and aid in targeting the Cas or Cpfl protein to a specific location within a target polynucleotide (e.g., a DNA).
  • a guide RNA can be an engineered, single RNA molecule (sgRNA), where for example the sgRNA comprises a crRNA segment and optionally a tracrRNA segment.
  • a guide RNA can also be a dual-guide system, where the crRNA and tracrRNA molecules are physically distinct molecules which then interact to form a duplex for recruitment of a CRISPR system effector, such as Cas9, and for targeting of that protein to the target polynucleotide.
  • a CRISPR system effector such as Cas9
  • the term "crRNA” or "crRNA segment” refers to an RNA molecule or to a portion of an RNA molecule that includes a polynucleotide targeting guide sequence, a stem sequence involved in protein-binding, and, optionally, a 3'-overhang sequence.
  • the polynucleotide targeting guide sequence is a nucleic acid sequence that is complementary to a sequence in a target DNA (for example the Pub17 allele).
  • This polynucleotide targeting guide sequence is also referred to as the “protospacer”.
  • the polynucleotide targeting guide sequence of a crRNA molecule interacts with a target DNA in a sequence- specific manner via hybridization (i.e., base pairing).
  • the nucleotide sequence of the polynucleotide targeting guide sequence of the crRNA molecule may vary and determines the location within the target DNA that the guide RNA and the target DNA will interact.
  • the polynucleotide targeting guide sequence of a crRNA molecule can be modified (e.g., by genetic engineering) to hybridize to any desired sequence within a target DNA.
  • the polynucleotide targeting guide sequence of a crRNA molecule of the invention can have a length from about 12 nucleotides to about 100 nucleotides.
  • the polynucleotide targeting guide sequence of a crRNA can have a length of from about 12 nucleotides (nt) to about 80 nt, from about 12 nt to about 50 nt, from about 12 nt to about 40 nt, from about 12 nt to about 30 nt, from about 12 nt to about 25 nt, from about 12 nt to about 20 nt, or from about 12 nt to about 19 nt.
  • the one or more polynucleotides may be comprised on one or more vectors.
  • the CRISPR/Cas9 complex may be introduced into the tomato plant by any known means of transformation.
  • a person skilled in the art will appreciate that techniques of CRISPR/Cas9 gene editing in plants are well known, see for example Wada, N., et al., (2020) “Precision genome editing in plants: state-of-the-art in CRISPR/Cas9-based genome engineering” BMC Plant Biology volume 20, Article number: 234.
  • Suitably means of transformation are, or example, gene transfer via a disarmed Ti-plasmid vector carried by Agrobacterium tumefaciens, using Agrobacterium sp.-mediated transformation, vacuum infiltration, floral dip, spraying, particle or microprojectile bombardment, protoplast transformation, electroporation, microinjection, electrophoresis, pollen-tube pathway, silicon carbide- or liposome-mediated transformation, uptake by the roots, direct injection into the xylem or phloem or other forms of direct DNA uptake.
  • alteration of the sequence of the guide RNA allows the Cas9 endonuclease to be programmed to cut DNA at sites complementary to the guide RNA.
  • Suitable guide RNAs for use in the present invention may be selected from those that are complementary to, or target, a sequence in the Pub17 gene.
  • the guide RNA may be complementary to, or target, a sequence in the UND domain, the U-box domain, or the ARM repeat domain of the Pub17 gene, suitably of SEQ ID NO:1 or orthologues or homologues thereof.
  • Suitable guide RNAs may be designed to target a specific sequence in a Pub17 gene using widely available bioinformatics tools.
  • the guide RNA is a single guide RNA.
  • the guide RNA is selected from one or more of the following sequences: sgRNA1 of SEQ ID NO:17, sgRNA2 of SEQ ID NO:18, sgRNA3 of SEQ ID NO:19, and sgRNA4 of SEQ ID NO:20.
  • more than one guide RNA may be used in combination to direct the CRISPR/Cas9 complex to cleave the Pub17 gene at multiple positions.
  • all four guide RNAs of SEQ ID NO: 17-20 are used.
  • the methods involving modification of the tomato plant preferably introduce one or more modifications into the Pub17 allele of the tomato plant.
  • the tomato plant comprises a modified Pub17 allele having at least 70% identity to SEQ ID NO:1 (wild type allele) with a mutation resulting in a reduced level, activity or expression of the Pub17 protein compared with a reference tomato plant.
  • the modified Pub17 allele comprises a specific mutation, suitably which is defined hereinbelow in relation to the modified Pub17 allele.
  • suppression is used to reduce the level, expression or activity of Pub17 protein in the tomato plant.
  • the suppression is carried out by RNA interference otherwise known as RNAi.
  • the Pub17 gene sequence is not modified.
  • the expression of the Pub17 gene sequence is inhibited or repressed.
  • RNAi suppression is carried out by introducing into the tomato plant one or more polynucleotide sequences encoding an RNAi agent which is complementary to a target DNA sequence.
  • RNAi agent which is complementary to a target DNA sequence.
  • Two types of small RNA molecules are central to RNA interference, microRNA (miRNA) and small interfering RNA (siRNA). These small RNAs can direct enzyme complexes to degrade messenger RNA (mRNA) molecules and thus decrease their activity by preventing translation, via post-transcriptional gene silencing.
  • transcription can be inhibited via the pre-transcriptional silencing mechanism of RNA interference, through which an enzyme complex catalyzes DNA methylation at genomic positions complementary to complexed siRNA or miRNA.
  • an inhibitory RNA e.g. a siRNA, a miRNA or another RNAi which serves to inhibit expression of the Pub17 protein is used.
  • the inhibitory RNA can be synthesized and delivered to a plant or it can be expressed in a plant from a suitable expression construct. RNAi and methods of its implementation are well known in the art.
  • RNAi agents can be synthesized chemically or enzymatically outside of cells and subsequently delivered to cells (see, e.g., Fire, et al., Nature, 391:806-11 (1998); Tuschl, et al., Genes and Dev., 13:3191-97 (1999); and Elbashir, et al., Nature, 411:494-498 (2001)); or can be expressed in vivo by an appropriate vector in cells (see, e.g., U.S. Pat. No.6,573,099).
  • the RNAi agent is an miRNA or an siRNA.
  • the RNAi agent comprises a polynucleotide sequence which is complementary to a target sequence in the Pub17 gene.
  • RNAi agent sequences may be selected from those that are complementary to, or target, a sequence in the UND domain or the U-Box domain of Pub17 gene, suitably of SEQ ID NO:1 or orthologues or homologues thereof.
  • sequence of the RNAi agent is selected from any of the following sequences: RNAi3 of SEQ ID NO:11, and RNAi7 of SEQ ID NO:12.
  • RNAi3 of SEQ ID NO:11 RNAi3 of SEQ ID NO:11
  • RNAi7 of SEQ ID NO:12 RNAi7 of SEQ ID NO:12.
  • more than one RNAi agent may be used in combination.
  • both RNAi agents of SEQ ID NO: 11 and 12 are used.
  • Modified Pub17 Allele and Pub17 protein In some embodiments the tomato plant comprises a modified Pub17 allele which reduces the level, expression or activity of the corresponding Pub17 protein. Suitably the modified Pub17 allele is not a result of an essentially biological process. Suitably the modified Pub17 allele is artificially created. In some embodiments, the tomato plant, or any plant part, seed, or product therefrom, according to the invention is not exclusively obtained by means of an essentially biological process. Suitably the modified Pub17 allele causes increased resistance to a lesion- forming pathogen.
  • the modified Pub17 nucleic acid sequence comprises a mutation in the 3’ region of the nucleic acid sequence according to SEQ ID NO:1, or in the 3’ region of an orthologous or homologous nucleic acid sequence thereof.
  • the 3’ region of a nucleic acid sequence is regarded as the half of the nucleic acid sequence which is closest to the 3’ end.
  • the 3’ region may be the latter 50%, latter 40%, latter 30%, latter 20%, latter 10% or latter 5% of a nucleic acid sequence, when read in a 5’ to 3 direction.
  • the modified Pub17 nucleic acid sequence comprises a mutation in one or more of the regions encoding the first, second, third and/or fourth ARM repeat of SEQ ID NO:1 (wild type allele), or a region corresponding thereto in an orthologue or homologue thereof.
  • the mutation is a SNP.
  • the SNP is an A to T SNP.
  • the mutation is at nucleotide position 1477 of SEQ ID NO:1 (wild type allele), or position corresponding thereto, such as in an orthologue or homologue thereof.
  • the modified Pub17 nucleic acid sequence comprises an A to T SNP at position 1477 of SEQ ID NO:1 (wild type allele), or position corresponding thereto.
  • the modified Pub17 nucleic acid sequence comprises a deletion of the region encoding the first, second and third ARM repeats of SEQ ID NO:1 (wild type allele), or a region corresponding thereto in an orthologue or homologue thereof.
  • the Pub17 protein is encoded by the Pub17 nucleic acid sequence.
  • the Pub17 protein is also modified.
  • the Pub17 protein modification is caused by the modification to the Pub17 nucleic acid sequence of the Pub17 allele as described above.
  • the Pub17 protein is truncated.
  • the truncation is caused by a premature stop codon in the Pub17 nucleic acid sequence
  • the premature stop codon is caused by the mutation in the Pub17 nucleic acid sequence, suitably by the SNP mutation in the Pub17 nucleic acid sequence.
  • the mutation, which causes the premature stop codon is present in the 3’ region of the Pub17 nucleic acid sequence as stated above.
  • the mutation, which causes the premature stop codon is present in the latter 50%, latter 40%, latter 30%, latter 20%, latter 10% or latter 5% of the 3’ end of the Pub17 nucleic acid sequence.
  • the mutation, which causes the premature stop codon is present in the ARM region, specifically in the region encoding the second ARM repeat.
  • the modified Pub17 protein is truncated at the C-terminus.
  • the Pub17 protein is not modified in the UND domain or in the U-box domain.
  • the modified Pub17 protein is truncated at the C-terminus up to within the ARM region, suitably up to the fourth, third, second or first ARM repeat.
  • the ARM region of the PUB17 protein is a region comprising one or more ARM (Armadillo) repeats.
  • the ARM region of the PUB17 protein is a region comprising four ARM (Armadillo) repeats.
  • the ARM region is between amino acids 429 and 682, or within corresponding amino acids in an orthologue or homologue thereof.
  • the modified Pub17 protein is truncated at the C-terminus up to within the second ARM repeat, or up to the first ARM repeat.
  • the modified Pub17 protein does not comprise a complete fourth, third or second ARM repeat.
  • the modified Pub17 protein comprises only a complete first ARM repeat.
  • the Pub17 protein is truncated up to position R493 of SEQ ID NO: 3 (wild type protein) or positions corresponding thereto, such as in an orthologue or homologue thereof.
  • the Pub17 protein may comprise a deletion.
  • the Pub17 protein may comprise a deletion of one or more of the first, second, third or fourth ARM repeats.
  • the Pub17 protein may comprise a deletion of the first, second and third ARM repeats. In one embodiment, therefore, the Pub17 protein may comprise only the fourth ARM repeat.
  • the Pub17 protein comprises an amino acid sequence according to a part of SEQ ID NO: 3 (wild type protein) or an orthologue or homologue thereof.
  • the Pub17 protein comprises an amino acid sequence according to at least 50%, 60%, 70%, 80%, or 90%, of the total length of SEQ ID NO:3 (wild type protein) or an orthologue or homologue thereof.
  • the modified Pub17 protein consists of an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO:4 (modified protein) or a portion thereof.
  • the modified Pub17 protein consists of an amino acid sequence according to SEQ ID NO:4 (modified protein) or a portion thereof.
  • a portion thereof of SEQ ID NO:4 may be 10%.20%.30%.40%, 50%, 60%, 70%, 80%, or 90%, of the total length of SEQ ID NO:4 (modified protein).
  • the modified Pub17 protein may comprise one, or more than one further mutation. Suitably each mutation results in reduced level, activity or expression of a Pub17 protein.
  • a lesion-forming pathogen may be any pathogen which forms one or more lesions on the tissues of a tomato plant. Suitably on the stem, leaves and/or fruit of a tomato plant. Suitably a lesion may be a localized necrotic or chlorotic area of diseased tissue.
  • lesion-forming oomycetes may be selected from: Phytophthora infestans , Hyaloperonospora arabidopsidis, Phytophthora ramorum, Phytophthora sojae, Phytophthora capsici, Plasmopara viticola, Phytophthora cinnamomi, Pythium ultimum, Albugo candida, and Phytophthora parasitica.
  • a lesion-forming pathogen is a virus.
  • Suitable lesion-forming fungi may be selected from any of the following species: Cochliobolus heterostrophus, Cochliobolus carbonum, Cochliobolus victoriae, Alternaria alternata, Alternaria solani, Alternaria brassicola, Periconia circinata, Pyrenophora tritici-repentis, Bipolaris sacchari, Phyllosticta maydis, Stagnospora nodorum, Stemphylium vesicarium, Botrytis fabae, Botrytis elliptica, Botrytis cinerea, Sclerotinia sclerotiorum, Mollinia fructicola, Fusarium graminearum, Septoria tritici, Cercospora zeae-maydis, Exserohilum turcicum, Leptosphaeria maculans, Ascochyta rabiei, Diaporthe toxica, Phoma medic
  • the lesion-forming pathogen is a pathogen which affects tomato plants.
  • the lesion-forming pathogen is a tomato pathogen, suitably a necrotrophic tomato pathogen, suitably a necrotrophic fungal tomato pathogen or a necrotrophic viral tomato pathogen.
  • Suitable necrotrophic fungi which affect tomato plants may be selected from Alternaria alternata, Alternaria solani, Botrytis cinerea, Sclerotinia sclerotiorum, Stemphyllium botryosum, Fusarium oxysporum, and Pythium spp.
  • Suitable necrotrophic viruses which affect tomato plants may be selected from Tomato yellow leaf curl virus (TYLCV), and Tomato brown rugose fruit virus (ToBRFV).
  • the lesion-forming pathogen is of the genus Botrytis or Alternaria.
  • the lesion-forming pathogen may be selected from the following species Alternaria alternata, Alternaria solani, Alternaria brassicola, Botrytis fabae, Botrytis elliptica, and Botrytis cinerea.
  • the lesion-forming pathogen may be a hemi-biotrophic tomato pathogen, suitably a hemi-biotrophic oomycete tomato pathogen.
  • Suitable diseases may be selected from: blight, botrytis blight, grey mould, white mold, early blight, late blight, leaf blight, powdery mildew, rot, leaf spot, fruit rot, brown spot, black spot, tan spot, grey spot, head blight, ear rot, blotch, stem canker, stem blight, black stem, crown rot, wilt, root rot, and seedling damping off.
  • the lesion-forming pathogen causes a disease which is a necrotic disease, suitably in which cell death occurs.
  • the lesion-forming pathogen causes a disease selected from blight such as botrytis blight, early blight, or late blight, mould such as grey mould, and rot.
  • plants of the invention have increased resistance or reduced susceptibility to necrotic diseases.
  • increased resistance or reduced susceptibility to blight such as botrytis blight, early blight, or late blight, mould such as grey mould, or rot.
  • plants of the invention have increased resistance or reduced susceptibility to blight, suitably to botrytis blight.
  • the tomato plants of the invention have increased resistance to blight caused by a lesion-forming pathogen.
  • the tomato plants of the invention have increased resistance to blight caused by Botrytis cinerea or Alternaria solani, suitably caused by Botrytis cinerea. In one embodiment, the tomato plants of the invention have increased resistance to blight caused by Phytophthora infestans. In one embodiment, the tomato plants of the invention have increased resistance to blight caused by Tomato brown rugose fruit virus (ToBRFV). Suitably the tomato plants of the invention may have increased resistance to more than one lesion-forming pathogen, and thereby may have increased resistance to more than one disease.
  • Botrytis cinerea or Alternaria solani suitably caused by Botrytis cinerea.
  • the tomato plants of the invention have increased resistance to blight caused by Phytophthora infestans.
  • the tomato plants of the invention have increased resistance to blight caused by Tomato brown rugose fruit virus (ToBRFV).
  • the tomato plants of the invention may have increased resistance to more than one lesion-forming pathogen, and thereby may have increased resistance to
  • the tomato plants of the invention may have increased resistance to a combination of lesion-forming pathogens described herein, or any combination of diseases described herein which suitably may be caused by lesion-forming pathogens.
  • the tomato plants of the invention may have increased resistance to any combination of a fungal lesion-forming pathogen, a viral lesion-forming pathogen and/or an oomycete lesion-forming pathogen.
  • the tomato plants of the invention may have increased resistance to any combination of the pathogens listed hereinabove.
  • the tomato plants of the invention may have increased resistance to any combination of: Botrytis cinerea, Alternaria solani, Tomato brown rugose fruit virus (ToBRFV) and/or Phytophthora infestans.
  • the tomato plant of the invention has increased resistance relative to a reference tomato plant, suitably increased resistance to a lesion-forming pathogen relative to a reference tomato plant.
  • a suitable reference tomato plant is a control plant.
  • such a reference tomato plant comprises the same genetic background as tomato plant of the invention but it does not contain a reduction in Pub17 protein level, expression or activity.
  • the reference tomato plant may be a wild type plant.
  • the reference tomato plant may be a tomato plant belonging to the same plant variety as a plant of the invention and does not contain a reduction in Pub17 protein level, expression or activity.
  • plant variety is herein understood according to definition of UPOV.
  • the reference tomato plant has not been modified to reduce Pub17 protein level, expression or activity.
  • the reference tomato plant does not contain the modified Pub17 allele.
  • the reference tomato plant contains a wild type Pub17 allele.
  • the reference tomato plant is grown for the same length of time and under the same conditions as a tomato plant of the invention.
  • the reference tomato plant may be a near-isogenic line, an inbred line or a hybrid provided that it has the same genetic background as the tomato plant of the present invention except the reference tomato plant has not been modified to reduce Pub17 protein level, expression or activity, and suitably does not contain the modified Pub17 allele of the present invention.
  • a reference tomato plant in the context of the present invention may comprise tomato reference genome HEINZ or tomato reference genome of Moneymaker (https://www.ebi.ac.uk/ena/browser/view/SAMEA2340764).
  • the tomato plant of the invention has a statistically significant increase in resistance to one or more lesion-forming pathogens compared to a reference tomato plant.
  • a plant of the invention has at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80% fewer lesions than a reference tomato plant.
  • a tomato plant of the invention has between 25-50% fewer lesions than a reference tomato plant.
  • a tomato plant of the invention has lesions which are at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80% smaller than the lesions on a reference tomato plant, suitably as measured by the average diameter of lesions on the tomato plant.
  • a plant of the invention has lesions which are between 20-30% smaller than the lesions on a reference tomato plant, suitably as measured by the average diameter of lesions on the tomato plant.
  • measurements of resistance are calculated after a step of exposing the tomato plant or a part thereof to a lesion-forming pathogen for a suitable period of time.
  • a suitable period of time is an amount of time sufficient to allow the lesion-forming pathogen to infect the tomato plant or part thereof and cause lesions to appear.
  • a suitable period of time may be between 1-28 days, suitably between 1-14 days, suitably between 1 to 7 days after exposing the tomato plant or part thereof to a lesion-forming pathogen.
  • Methods of screening further relate to methods of identifying or screening for tomato plants having increased resistance to one or more lesion-forming pathogens.
  • the methods relate to identifying tomato plants in a population which have the desirable trait of increased resistance to one or more lesion-forming pathogens.
  • the population of plants may be a mutant population or a wild population of tomato plants.
  • a mutant population of tomato plants may be generated by mutagenesis, as described elsewhere herein.
  • chemical mutagenesis suitably by the use of a chemical mutagen such as EMS.
  • the methods may comprise an initial step of obtaining or generating a mutant population of tomato plants, suitably by EMS mutagenesis.
  • a tomato plant may be identified directly as having resistance to a lesion-forming pathogen, alternatively or additionally a tomato plant may be identified indirectly by having a reduced level, expression or activity of Pub17 protein.
  • identifying resistance to a lesion-forming pathogen in a tomato plant may be determined by inoculation or exposure assays.
  • the tomato plant is exposed to a lesion-forming pathogen and its response is assessed in comparison to a reference tomato plant.
  • Increased resistance to lesion forming pathogens may be determined by such an assay, such as a detached leaf assay, such as carried out in the examples herein.
  • the methods may comprise a step of carrying out an inoculation or exposure assay on the or each tomato plant, optionally on the population of tomato plants.
  • the such assays may comprise identifying plants which exhibit a reduction in the number and/or average size of lesions when exposed to a lesion-forming pathogen as compared to a reference plant. Suitable levels of reduction are defined elsewhere herein.
  • resistance to a lesion-forming pathogen in a tomato plant may be determined by identifying a tomato plant having a modified Pub17 allele.
  • identifying a tomato plant which has a modified Pub17 allele having the mutation described hereinabove may be determined by molecular methods such as PCR or genome sequencing of the tomato plant.
  • this may be determined by genotypic analysis of the tomato plant.
  • Genotypic evaluation of plants includes using techniques such as Isozyme Electrophoresis, Restriction Fragment Length Polymorphisms (RFLPs), Randomly Amplified Polymorphic DNAs (RAPDs), Arbitrarily Primed Polymerase Chain Reaction (AP-PCR), Allele-specific PCR (AS-PCR), DNA Amplification Fingerprinting (DAF), Sequence Characterized Amplified Regions (SCARs), Amplified Fragment Length Polymorphisms (AFLPs), Simple Sequence Repeats (SSRs) which are also referred to as "Microsatellites”.
  • RFLPs Restriction Fragment Length Polymorphisms
  • RAPDs Randomly Amplified Polymorphic DNAs
  • AP-PCR Arbitrarily Primed Polymerase Chain Reaction
  • AS-PCR Allele-specific PCR
  • DAF Sequence Characterized Amplified Regions
  • AFLPs Amplified Fragment Length Polymorphisms
  • Standard methods and commercial services are known in the art.
  • Basic methods for DNA sequencing include the Maxam-Gilbert method and the chain termination method.
  • High- throughput techniques have also been developed and are preferably used in the method of the present invention. These high-throughput techniques include, but are not limited to, Massively parallel signature sequencing (MPSS), Polony sequencing, 454 pyrosequencing, Illumina (Solexa) sequencing, Combinatorial probe anchor synthesis (cPAS), SOLiD sequencing, Ion Torrent semiconductor sequencing, DNA nanoball sequencing, Heliscope single molecule sequencing, Single molecule real time (SMRT) sequencing and Nanopore DNA sequencing.
  • MPSS Massively parallel signature sequencing
  • Polony sequencing Polony sequencing
  • 454 pyrosequencing Illumina (Solexa) sequencing
  • cPAS Combinatorial probe anchor synthesis
  • SOLiD sequencing Ion Torrent semiconductor sequencing
  • DNA nanoball sequencing Heliscope single molecule sequencing
  • SMRT Single molecule real time sequencing
  • Nanopore DNA sequencing Nanopore DNA sequencing
  • primer refers to an oligonucleotide which is capable of annealing to a nucleic acid target and serving as a point of initiation of DNA synthesis when placed under conditions in which synthesis of a primer extension product is induced (e.g., in the presence of nucleotides and an agent for polymerization such as DNA polymerase and at a suitable temperature and pH).
  • a primer in some examples an extension primer and in some examples an amplification primer
  • the primer may be an oligodeoxyribonucleotide.
  • a primer is typically sufficiently long to prime the synthesis of extension and/or amplification products in the presence of the agent for polymerization.
  • the minimum length of the primer can depend on many factors, including, but not limited to temperature and composition (A/T vs. G/C content) of the primer.
  • amplification primers these are typically provided as a pair of bi-directional primers consisting of one forward and one reverse primer or provided as a pair of forward primers as commonly used in the art of DNA amplification such as in PCR amplification.
  • the methods of identifying or screening tomato plants may comprise using the SNP at position 1477 of the Pub17 allele according to SEQ ID NO:1, or corresponding positions thereof, as a marker to identify in a tomato plant the presence of resistance to a lesion-forming pathogen.
  • a marker to identify in a tomato plant the presence of resistance to a lesion-forming pathogen Suitably to identify in a tomato plant the presence of the modified Pub17 allele of the invention.
  • a further aspect of the invention is, therefore, the use of a SNP at position 1477 of the Pub17 allele of SEQ ID NO:1, or corresponding positions thereof, for identification and/or diagnostic selection and/or genotyping of a lesion-forming pathogen resistance allele in a tomato plant or part thereof. Suitably in a cultivated tomato plant.
  • the identification or screening methods further comprise a step of selecting the or each tomato plant identified as having a reduced level, expression or activity of Pub17 protein, and/or therefore selecting the or each tomato plant identified as having increased resistance to one or more lesion-forming pathogens.
  • the identification or screening methods may further comprise a step of breeding the or each selected tomato plant, suitably to form progeny.
  • the screening methods may further comprise additional rounds of screening the progeny and breeding selected progeny having the desired trait. Suitably this may comprise additional steps of screening the progeny for the presence of the desired trait as explained above, and one or more further steps of breeding the selected progeny.
  • Hybrids and Methods of Breeding Hybrids or cultivated plants may be produced by crossing a first plant of the invention with a second reference plant and obtaining progeny.
  • said hybrid or cultivated plants are tomato plants.
  • Suitably producing a hybrid tomato plant comprises crossing a first tomato plant according to the invention with a second reference tomato plant as defined hereinabove.
  • the reference tomato plant lacks a reduction in level, expression or activity of Pub17 protein, suitably the reference tomato plant lacks the modified Pub17 allele described herein.
  • the reference plant is of the same species as the tomato plant of the invention, suitably of the same variety as the tomato plant of the invention.
  • the reference plant and the plant of the invention are tomato plants.
  • the method of producing a hybrid tomato plant may optionally further comprise selecting a hybrid tomato plant from the progeny which exhibits increased resistance to a lesion-forming pathogen, and/or which comprises a reduced level, expression or activity of Pub17 protein.
  • selection of a hybrid tomato plant having the desired trait may be achieved using screening techniques described hereinabove.
  • the selecting step may be carried out by detecting the presence of the modified Pub17 allele of the invention by carrying out PCR with the primer pair of SEQ ID NO:24 and 25, suitably followed by sequencing the resulting amplicon.
  • the selection step may comprise selecting a plant from the progeny which exhibits a reduction in the number and/or average size of lesions when exposed to a lesion-forming pathogen as compared to a reference plant. Suitable levels of reduction are defined elsewhere herein.
  • a plant line as described herein could be crossed to any second plant, and the resulting hybrid progeny each selfed and/or sibbed for about 5 to 7 or more generations, thereby providing a large number of distinct, parent lines. These parent lines could then be crossed with other lines and the resulting hybrid progeny analyzed for beneficial characteristics. In this way, novel lines conferring desirable characteristics could be identified.
  • Various breeding methods may be used in the methods, including haploidy, pedigree breeding, single-seed descent, modified single seed descent, recurrent selection, and backcrossing.
  • a further aspect of the present invention relates to use of a tomato plant or part thereof, or seed, of the invention for growing a tomato plant and producing and harvesting crop yield, seed, and/or fruit therefrom.
  • kits for detection of the modified Pub17 allele of the invention in a plant are provided.
  • the plant is a tomato plant.
  • a kit may be used in the methods of screening above.
  • the kit comprises at least one PCR primer pair having a forward primer and a reverse primer which bind specifically to the Pub17 coding sequence.
  • the primers used may either bind specifically to the Pub17 gene, or specifically to the modified Pub17 allele.
  • primers which bind to the Pub17 gene may bind to regions of the gene which flank the modification, suitably which flank the SNP at position 1477 of SEQ ID NO:1.
  • subsequent sequencing is used to identity the modified allele, if present.
  • kits which specifically bind to the modified Pub17 allele may directly detect the presence of the modification.
  • the kit may comprise a PCR primer pair comprising a forward and reverse primers that are complementary to the Pub17 coding sequence.
  • the forward primer consists of SEQ ID NO:25.
  • the reverse primer consists of SEQ ID NO:24.
  • the kit may be used to detect the modified Pub17 allele, suitably by subsequent sequencing of the resulting amplicon.
  • the kit is for use in a gene-specific PCR.
  • a resulting amplicon is produced from the PCR.
  • the kit is for use in allele specific PCR, suitably competitive allele specific PCR, otherwise known as KASP PCR, which is described in (Semagn et al. 2014) for example.
  • each forward primer comprises an indicator molecule, such as a flourescent molecule.
  • the indicator molecule is tethered to the forward primer, suitably to the first and second forward primers.
  • Suitable flourescent molecules may be FAM, or HEX.
  • the first forward primer comprises FAM and the second forward primer comprises HEX.
  • a resulting amplicon is produced from the PCR.
  • the amplicon is sequenced and comprises an SNP of A to T at position 1477 of SEQ ID NO:1 (wild type Pub17 allele) or at a corresponding position thereof, such as in an orthologue or homologue sequence.
  • the SNP is used as a marker, suitably the A1477T mutation is used as a marker, suitably as a marker of lesion-forming pathogen resistance.
  • the invention further discloses the use of the SNP marker according to the invention for diagnostic selection and/or genotyping of the lesion-forming pathogen resistance trait allele in a cultivated plant, particularly a cultivated tomato plant, more particularly a cultivated Solanum lycopersicum plant.
  • the present invention further discloses the use of the SNP marker according to the invention for identifying in a plant, particularly a cultivated tomato plant, more particularly a Solanum lycopersicum plant according to the invention, the presence of the lesion-forming pathogen resistance trait allele and/or for monitoring the introgression of the lesion-forming pathogen resistance trait allele in a cultivated plant, particularly a cultivated tomato plant, more particularly a Solanum lycopersicum plant according to the invention and as described herein.
  • the SNP marker is identified by one of the above PCR methods, suitably using the above described primers.
  • the kit may further comprise other components suitable for carrying out PCR, such as polymerases, salts, buffers, instructions etc.
  • derived markers or probes which are genetically linked to the lesion forming pathogen resistance trait.
  • derived markers or probes may equally be used to identify plants having increased resistance to lesion-forming pathogens.
  • the lesion diameters on the leaves were measured using a calliper with digital display (Mitutoyo nr 500-161-30, Mitutoyo Nederland B.V., Veenendaal, The Netherlands) at 3- and 4-days post inoculation (dpi).
  • the stem assay was performed by cutting the 3 rd , 4 th , and 5 th leaves from 6-week-old plants and leaving a petiole stump of approximately 2.5 cm.
  • the petiole surfaces were inoculated with 10 ⁇ l of the B. cinerea strain B05.10 at a density of 1x10 6 spores/ml.
  • the plants were kept in a plastic tent for high humidity for 24 hours.
  • Symptoms were scored at 3, 6, 10, 14, 17 and 21 days after inoculation. The score was based on a scale of 0-4, with 0: unchanged petiole stump being comparable to mock treatment, 1: petiole stump partly or fully thinning along with brown colouration, 2: beginning of outward stem infection with a small brown ring visible on the main stem around the leaf axil of the inoculated petiole stump, 3: spreading of the infection throughout the stem with a brown ring becoming irregular and spreading upward and downwards along the stem, and 4: full main stem infection and wilting of the plant along with internal browning, collapsing of the stem tissue and eventual folding and falling over capsizing of the plant’s top (Figure 15).
  • DLA Alternaria solani disease assays
  • the DLA for MT followed the same process as with B. cinerea.
  • the DLA for MM consisted of taking the terminal leaflet of the 3 rd , 4 th and 5 th true leaves leaf from 6 week-old plants and placing all three leaflets in square petri dishes prepared as above. The leaves were inoculated on the adaxial side with 5-610 ⁇ l-droplets of the A. solani isolate ‘altNL03003’ (accession number CBS 143772).
  • the lesion diameters on the leaves were measured using a calliper with digital display (Mitutoyo nr 500-161-30, Mitutoyo Nederland B.V., Veenendaal, The Netherlands) at 5- and 7-days post inoculation (dpi). Additional disease assays Screening for altered susceptibility to tomato powdery mildew (Pseudoidium neolycopersici) Wageningen isolate On-Ne was performed as described by Bai et al. (2003). Disease assays with Phytophthora infestans isolates PIC99177 or C65 were performed using a DLA as described by Sun et al. (2016).
  • Tomato yellow leaf curl virus (TYLCV) resistance was performed using agroinoculation as described by Verlaan et al. (2011).
  • Tomato brown rugose fruit virus (ToBRFV) resistance was assayed by manual infection of 10-days old seedlings using the ToBRFV-IL isolate (Luria et al.2017; Genbank accession no. KX619418). Leaves were rubbed with carborundum and subsequently sap-inoculated. Disease symptoms were monitored weekly and scored four weeks post inoculation. Development of segregating populations Mutant M2042 showing reduced susceptibility to Botrytis cinerea was selfed until M4 lines were obtained. M4 lines were fixed for the mutation causing lower susceptibility.
  • Micro-Tom Tomato cultivar Micro-Tom contains at least two mutations responsible for the small size of the plants, in genes Self-Pruning (Sp; Solyc06g074350) and Dwarf (D; Solyc02g089160) (Mart ⁇ et al. 2006).
  • a High Resolution Melting (HRM) assay was developed for the identification of the causal Micro-Tom SNP for the determinate (sp, self-pruning) phenotype.
  • SP_F TGAGACGGACAAGATGACATGA
  • SP_R TGTCATTTCCCCTTCCAAAGT
  • a CAPS marker was used with primer C (GGAACTTGGTGTAGCAGAAATTTCCACATTTC) SEQ ID NO:5 in exon 8 and primer D (TTAGTGAGCTGAAACTCTAATCCGTAGAC) SEQ ID NO:6 in exon 9 (Mart ⁇ et al. 2006).
  • PCR was performed using DreamTaq polymerase with a melting temperature of 60°C.
  • the 243-bp PCR product was then incubated with the restriction enzyme HpyCH4V at 47°C for 4 hours. Subsequently, the product was run on a 1.5% TBE gel for 1 hour at 110V.
  • DNA was isolated from leaf samples of these plants, and from 10 individual wild-type MT plants using the DNeasy Plant Mini Kit (Qiagen). DNA concentrations were determined using NanoDrop ® and Qubit ® (ThermoFisher Scientific). DNA of the resistant and susceptible F2 plants, and of the wild-type MT plants, was pooled equimolarly, resulting in three DNA pools M2042R, M2042S and MTWT. These DNA pools were sequenced (whole genome resequencing, WGS) by Novogene Ltd (Hong Kong). For this, 350-bp insert DNA libraries were prepared.
  • Pair-end sequencing was performed on Illumina ® HiSeq platform, with a read length of 150 bp at each end (PE150), with approximately 35x genome coverage for each sample. Reads were mapped to the tomato Heinz reference genome (version SL2.50) and SNP detection was performed using SAMtools. In total, 2,659,728 SNPs were identified. For each pool, the number of reads containing the reference (Heinz) allele and the number of reads containing the alternative allele was recorded per SNP position.
  • Progeny was tested for Botrytis resistance to check whether segregation of disease resistance occurred, in order to link resistance with the mutation. Determination of gene expression level by RT-qPCR Gene expression level was determined by performing a RT-qPCR on plant cDNA synthesized using an iScript cDNA Synthesis kit (BioRad) on RNA extracted through an RNeasy Plant Mini Kit (Qiagen). Specific primers were developed for PUB17, PUB17_qPCR_Fw1 (5’- GGAAGTGAAGGTGTTGCGA-3’) SEQ ID NO:7 and PUB17_qPCR_Rv1 (5’- CTACTGCCATTTCCTCATTGC -3’) SEQ ID NO:8, yielding a 100-bp PCR product.
  • Elongation factor 1 alpha (Ef1 ⁇ ) was used as reference gene, with primers Ef1a-Fw (5’- ATTGGAAACGGATATGCCCCT-3’) SEQ ID NO:9 and Ef1a-Rv (5’- TCCTTACCTGAACGCCTGTCA-3’) SEQ ID NO:10, yielding a 101-bp PCR product.
  • RT- qPCR was performed using a CFX96 Real-Time PCR machine (BioRad) with two technical replicates used per sample. The relative expression of PUB17 was calculated with the ⁇ CT method (Livak & Schmittgen 2001).
  • RNAi and CRISPR transformation were generated using the binary vector pHellsgate12 (Helliwell and Waterhouse 2003). This vector contains a CaMV 35S promoter driving the expression of the inverted repeat and a kanamycin resistance gene as a selectable marker. Primers were designed for PUB17 to amplify fragments from tomato gDNA sequence of the cv. Moneymaker. Primer sequences are shown in Table 6. RNAi fragment 7 was amplified using forward primer caccGGTGTGGGAAATTGATGGCA (SEQ ID NO:15) and reverse primer AAACGGCAGCCTTTTACCTG (SEQ ID NO:16), yielding a 176-bp product which targets the UND domain of the PUB17 protein.
  • the resulting DNA was cloned into pENTR/D- TOPO and transformed into E. coli DH5 ⁇ .
  • the culture was plated onto LB medium containing spectinomycin (100 ⁇ g/ul) and grown overnight at 37°C.
  • the plasmid DNA of the clones was sequenced to verify presence of the correct insert.
  • the CRISPR/Cas9 construct was designed to create deletions within the PUB17 coding sequence, using four sgRNAs alongside the Cas9 endonuclease gene and the NPTII plant selectable marker.
  • the sgRNAs were designed using the CCTop-CRISPR/Cas9 target online predictor tool (https://crispr.cos.uni-heidelberg.de/; Stemmer et al. 2015), with the tomato genome (Solanum lycopersicum cv. Heinz SL2.50) as reference for target site evaluation. From the sgRNA table provided by the online predictor, only the sgRNAs without exonic off- target sites were selected. The selected sgRNAs were further curated by verifying that their GC-content was between 30 and 80% (http://www.endmemo.com/bio/gc.php) and their secondary structures were evaluated according to Liang et al.
  • the Level 1 constructs together with NPTII (pICH47732), Cas9 (pICH47742), and the linker (pICH41822) were assembled into the Level 2 binary vector pAGM4723 by digestion using BpiI/BpsI and ligating back with T4 DNA, and cloned into E.coli DH5 ⁇ .
  • the Level 2 constructs were purified and sequenced for verification.
  • the two RNAi constructs and one CRISPR/Cas9 construct for PUB17 were transformed into electrocompetent Agrobacterium tumefaciens AGL1 + virG cells. Transformation of tomato cv. MM was carried out as previously described by Huibers et al. (2013).
  • CRISPR and RNAi transformants DNA was isolated from young leaves using CTAB buffer (1 M Tris-HCl pH 7.5, 0.5 M EDTA pH 8.0, 5 M NaCl, 2% CTAB). The genomic DNA was then subjected to a gene-specific PCR using DreamTaq DNA polymerase (Thermo Scientific, Bleiswijk, The Netherlands).
  • FWD_MR_GX_CRISPR (5’-ACGGCGTTATCTTCTGAGCT-3’) SEQ ID NO:23 and AWPUB17_F1 (5’- AGAGAGTGGGACGCAGATT-3’) SEQ ID NO:25, paired individually with reverse primer REV_MR_GX_CRISPR (5’- CATGCTCACACCGTTGGAAT -3’) SEQ ID NO:24, yielding respectively 1942-bp and 827-bp PCR products for the wild type (WT) allele.
  • the PCR products were sent for sequencing to Macrogen Europe (Amsterdam, The Netherlands).
  • RNAi transformants To confirm the integration of the T-DNAs of the silencing constructs in the genome of the RNAi transformants, a PCR was performed to detect the presence of the NPTII gene and 35S promoter.
  • the forward primer for the WT sequence was labelled with HEX dye while the forward primer for the mutant sequence was labelled with the FAM dye.
  • KASP V4.02X Master mix 96/384, Low Rox (LGC group) was used for the PCR KASP V4.02X Master mix 96/384, Low Rox (LGC group) was used. PCR was performed according to the KASP thermal protocol provided by the manufacturer (LCG group). Plates were read in a plate reader (Bio-Rad C1000 thermal cycler), and data analyzed using Bio-Rad CFX Maestro 1.1. Results Reduced susceptibility to Botrytis cinerea in tomato mutant M2042 To identify S-genes against necrotrophic fungi a Micro-Tom EMS population developed at Wageningen University – Plant Breeding (Yan et al.2021) was screened.
  • the plants with extreme phenotypes were selected for the two pools, “resistant” and susceptible, with 18 plants chosen per pool.
  • a third pool was developed consisting of wild type Micro- Tom plants.
  • An interesting non-synonymous mutation was initially identified through whole genome sequencing and further filtering of SNPs, as described in Materials and Methods. The mutation was an A ⁇ T SNP at position 1477 of the coding region of gene Solyc02g072080 resulting in a premature stop codon R493* ( Figure 2). This gene is the tomato ortholog of PUB17.
  • a RT-qPCR was performed using wild-type MT plants and M4 progeny showing intermediate resistance (M2042-1-1-17 and M2042-1-2-12).
  • the leaves were mock-inoculated or inoculated with B. cinerea and samples were taken at 3 time points, 0, 24 and 48 hours post infection (hpi).
  • the expression of PUB17 was significantly induced upon infection with B. cinerea in wild-type MT ( Figure 3). However, PUB17 expression was not induced in the mutants M2042-1-1-17 and M2042-1-2- 12.
  • a disease assay was performed using progeny of selected M4 and F2 plants derived from crosses between MM and M4 plant M2042-1-2-12 ( Figure 1B, Table 1). F3 and M5 progeny plants were tested for B. cinerea resistance to evaluate whether they were segregating for the phenotype. Table 1.
  • PUB17 genotype of M2042 M4 controls and F2 plants, and Botrytis disease assay results of progeny.
  • WT homozygous for wild type allele of PUB17
  • H heterozygous for the PUB17 SNP
  • M homozygous mutant for the PUB17 SNP
  • R resistant
  • S susceptible.
  • progeny of F2 plant 3-39, heterozygous (one mutant allele, one wild type allele) for the PUB17 gene showed segregation in the response to Botrytis infection (Table 1).
  • the F3 progeny of 3-39 was genotyped for the PUB17 gene.
  • 4 homozygous mutant plants were observed among 24 progeny plants (Table 2).
  • All four homozygous mutant plants developed smaller lesions than the heterozygous and homozygous wild-type progeny.
  • RNAi fragment 3 appeared slightly more efficient in silencing when compared with RNAi fragment 7 ( Figure 5).
  • T1 RNAi3- 5 T2 progeny TV181088, Table 3
  • T1 RNAi3- 5 T2 progeny TV181088, Table 3
  • RNAi families TV181105 and TV181136 were also selected for further testing.
  • T2 families TV181088 and TV181136 individual plants were selected based on the presence of a clear and intense fragment after PCR with NPTII primers, indicating the presence of the T-DNA.
  • T3 progeny was obtained from these selected plants (Table 3).
  • T3 RNAi silenced transformants of PUB17 were inoculated with strain B05.10 of B. cinerea in a stem assay and a detached leaf assay (DLA).
  • MM plants and an RNAi family (TV192024) which showed no presence of NPTII were used as the susceptible controls.
  • DSI Disease Severity Index
  • T2 TV181105, T3 progeny was only obtained later. Therefore, the segregating T2 family was subjected to the Botrytis tests, both stem and leaf assays.
  • T2 plants were genotyped for the presence of NPTII, to distinguish between transgenic and non-transgenic plants.
  • the stem test results indicated a lower level of susceptibility to B. cinerea of transgenic TV181105 plants compared with non-transgenic T2 plants and negative control MM, based on the low percentage of stems displaying a DSI 3 and none of the stems displaying DSI 4.
  • the PUB17 mutant M2042 was found to show reduced susceptibility to the hemibiotrophic oomycete Phytophthora infestans, in addition to the necrotrophic fungus Botrytis cinerea.
  • disease assays were performed on the PUB17 mutant with necrotrophic fungus Alternaria solani. We observed that the original mutant, as well as F3 mutant plants obtained after crossing with MM, showed significantly reduced susceptibility to this fungus, as indicated by reduced lesion diameter sizes ( Figure 13).
  • a DLA with A was performed on the PUB17 mutant with necrotrophic fungus Alternaria solani.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Environmental Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Botany (AREA)
  • Developmental Biology & Embryology (AREA)
  • Cell Biology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Physiology (AREA)
  • Virology (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

La présente invention concerne de nouveaux plants de tomate présentant une résistance améliorée aux agents pathogènes formant des lésions provoqués par un niveau, une activité ou une expression réduits de la protéine Pub17. Le niveau, l'activité ou l'expression d'une protéine Pub17 peuvent être réduits par modification de l'allèle Pub17 pour qu'il contienne un SNP identifié comme lié à une résistance accrue aux agents pathogènes formant des lésions. La présente invention concerne en outre des parties de plante et des graines dérivées desdits plants de tomate, et des procédés de production desdits plants de tomate ou d'augmentation de la résistance aux agents pathogènes formant des lésions dans un plant de tomate, ainsi que l'utilisation du SNP en tant que marqueur et des kits associés.
PCT/EP2023/058645 2022-04-06 2023-04-03 Plantes présentant une résistance améliorée aux agents pathogènes WO2023194291A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
EP22167005.2 2022-04-06
EP22167005 2022-04-06
EP23156377.6 2023-02-13
EP23156377 2023-02-13

Publications (1)

Publication Number Publication Date
WO2023194291A1 true WO2023194291A1 (fr) 2023-10-12

Family

ID=86007299

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2023/058645 WO2023194291A1 (fr) 2022-04-06 2023-04-03 Plantes présentant une résistance améliorée aux agents pathogènes

Country Status (1)

Country Link
WO (1) WO2023194291A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117904142A (zh) * 2024-03-18 2024-04-19 浙江大学海南研究院 SlMYB52基因在提高番茄盐胁迫抗性中的应用

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6573099B2 (en) 1998-03-20 2003-06-03 Benitec Australia, Ltd. Genetic constructs for delaying or repressing the expression of a target gene

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6573099B2 (en) 1998-03-20 2003-06-03 Benitec Australia, Ltd. Genetic constructs for delaying or repressing the expression of a target gene

Non-Patent Citations (63)

* Cited by examiner, † Cited by third party
Title
"Genbank", Database accession no. KX619418
AMMIRATO ET AL.: "Handbook of Plant Cell Culture", 1984, MACMILLAN PUBL. CO., article "Crop Species"
AMSELEM JCUOMO CAVAN KAN JAL ET AL.: "Genomic analysis of the necrotrophic fungal pathogens Sclerotinia sclerotiorum and Botrytis cinerea", PLOS GENET, vol. 7, 2011, pages e1002230
BAI YHUANG C-CVAN DER HULST RMEIJER-DEKENS FBONNEMA GLINDHOUT P: "QTLs for tomato powdery mildew resistance (Oidium lycopersici) in Lycopersicum parviflorum G1.1601 co-localize with two qualitative powdery mildew resistance genes", MOL PLANT-MICROBE INTERACT, vol. 16, 2003, pages 169 - 176, XP002451564
BENITO EPTEN HAVE AVAN 'T KLOOSTER JWVAN KAN JAL: "Fungal and plant gene expression during synchronized infection of tomato leaves by Botrytis cinerea", EUR J PLANT, vol. 104, 1998, pages 207 - 220
CHETELAT RTSTAMOVA L: "Tolerance to Botrytis cinerea", ACTA HORTIC, vol. 487, 1999, pages 313 - 316
CHEUNG N, TIAN L, LIU X, LI X: "The destructive fungal pathogen Botrytis cinerea - Insights from genes studied with mutant analysis", PATHOGENS, vol. 9, 2020, pages 923
DAVIS J, YU D, EVANS W, GOKIRMAK T, CHETELAT RT, STOTZ HU: "Mapping of loci from Solanum lycopersicoides conferring resistance or susceptibility to Botrytis cinerea in tomato", THEOR APPL GENET, vol. 119, 2009, pages 305 - 314, XP019698406
DE CASTRO E, SIGRIST CJA, GATTIKER A, BULLIARD V, LANGENDIJK-GENEVAUX PS, GASTEIGER E, BAIROCH A, HULO N: "ScanProsite: detection of PROSITE signature matches and ProRule-associated functional and structural residues in proteins", NUCLEIC ACIDS RESEARCH, vol. 34, 2006, pages W362 - W365
DEAN R, VAN KAN JAL, PRETORIUS ZA, HAMMOND-KOSACK KE, DI PIETRO A, SPANU PD, RUDD JJ, DICKMAN M, KAHMANN R, ELLIS J, FOSTER GD: "The Top 10 fungal pathogens in molecular plant pathology", MOL PLANT PATHOL, vol. 13, 2012, pages 414 - 430, XP055218173, DOI: 10.1111/j.1364-3703.2011.00783.x
DIEZ MJNUEZ F: "Vegetables", vol. II, 2008, SPRINGER, article "Tomato", pages: 249 - 323
EGASHIRA HKUWASHIMA AISHIGURO HFUKUSHIMA KKAYA TIMANISHI S: "Screening of wild accessions resistant to gray mold (Botrytis cinerea Pers.) in Lycopersicon", ACTA, vol. 22, 2000, pages 324 - 326, XP037875888, DOI: 10.1007/s11738-000-0046-x
ELBASHIR ET AL., NATURE, vol. 411, 2001, pages 494 - 498
ENGLER C, KANDZIA R, MARILLONNET S: "A one pot, one step, precision cloning method with high throughput capability", PLOS ONE, vol. 3, 2008, pages e3647
FINKERS R, BAI Y, VAN DEN BERG P, VAN BERLOO R, MEIJER-DEKENS F, TEN HAVE A, VAN KAN J, LINDHOUT P, VAN HEUSDEN AW: "Quantitative resistance to Botrytis cinerea from Solanum neorickii", EUPHYTICA, vol. 159, 2008, pages 83 - 92, XP019551125, DOI: 10.1007/s10681-007-9460-0
FINKERS R, VAN DEN BERG P, VAN BERLOO R, TEN HAVE A, VAN HEUSDEN AW, VAN KAN JAL, LINDHOUT P: "Three QTLs for Botrytis cinerea resistance in tomato", THEOR APPL GENET, vol. 114, 2007, pages 585 - 593, XP019487564
FINKERS R, VAN HEUSDEN AW, MEIJER-DEKENS F, VAN KAN JAL, MARIS P, LINDHOUT P: "The construction of a Solanum habrochaites LYC4 introgression line population and the identification of QTLs for resistance to Botrytis cinerea", THEOR APPL GENET, vol. 114, 2007, pages 1071 - 1080, XP019510484, DOI: 10.1007/s00122-006-0500-2
FIRE ET AL., NATURE, vol. 391, 1998, pages 806 - 11
GUIMARAES RLCHETELAT RTSTOTZ HU: "Resistance to Botrytis cinerea in Solanum lycopersicoides is dominant in hybrids with tomato, and involves induced hyphal death", EUR J PLANT PATHOL, vol. 110, 2004, pages 13 - 23, XP002320546, DOI: 10.1023/B:EJPP.0000010133.62052.e4
HANIKA K, SCHIPPER D, CHINNAPPA S, OORTWIJN M, SCHOUTEN HJ, THOMMA BPHJ, BAI Y: "Impairment of tomato WAT1 enhances resistance to vascular wilt fungi despite severe growth defects", FRONT PLANT SCI, vol. 12, 2021, pages 721674
HE Q, MCLELLAN H, BOEVINK PC, SADANANDOM A, XIE C, BIRCH PRJ, TIAN Z: "U-box E3 ubiquitin ligase PUB17 acts in the nucleus to promote specific immune pathways triggered by Phytophthora infestans", J EXP BOT, vol. 66, 2015, pages 3189 - 3199, XP055962281, DOI: 10.1093/jxb/erv128
HE QIN ET AL: "U-box E3 ubiquitin ligase PUB17 acts in the nucleus to promote specific immune pathways triggered by Phytophthora infestans", vol. 66, no. 11, 1 June 2015 (2015-06-01), GB, pages 3189 - 3199, XP055962281, ISSN: 0022-0957, Retrieved from the Internet <URL:https://academic.oup.com/jxb/article-pdf/66/11/3189/17137013/erv128.pdf> DOI: 10.1093/jxb/erv128 *
HUIBERS RP, LOONEN AEHM, GAO D, VAN DEN ACKERVEKEN G, VISSER RGF, BAI Y: "Powdery mildew resistance in tomato by impairment of SIPMR4 and SIDMR1", PLOS ONE, vol. 8, 2013, pages e67467
JIANG YYU D: "The WRKY57 transcription factor affects the expression of jasmonate ZIM-domain genes transcriptionally to compromise Botrytis cinerea resistance", PLANT, vol. 171, 2016, pages 2771 - 2782
JORGENSEN IH: "Discovery, characterization and exploitation of Mlo powdery mildew resistance in barley", EUPHYTICA, vol. 63, 1992, pages 141 - 152, XP002035755, DOI: 10.1007/BF00023919
KUSCH S, PANSTRUGA R: "mlo-based resistance: an apparently universal "weapon" to defeat powdery mildew disease", MOL PLANT-MICROBE INTERACT, vol. 30, 2017, pages 179 - 189, XP055734572, DOI: 10.1094/MPMI-12-16-0255-CR
LIN T, ZHU G, ZHANG J, XU X, YU Q, ZHENG Z, ZHANG Z, LUN Y, LI S, WANG X, HUANG Z, LI J, ZHANG C, WANG T, ZHANG Y, WANG A, ZHANG Y: "Genomic analyses provide insights into the history of tomato breeding", NATURE, vol. 46, 2014, pages 1220 - 1226, XP055460002, DOI: 10.1038/ng.3117
LIVAK KJSCHMITTGEN TD: "Analysis of relative gene expression data using real-time quantitative PCR and the 2 method", METHODS, vol. 25, 2001, pages 402 - 408, XP055567699, DOI: 10.1006/meth.2001.1262
LURIA NSMITH EREINGOLD VBEKELMAN ILAPIDOT MLEVIN IELAD NTAM YSELA NABU-RAS A: "A new Israeli Tobamovirus isolate infects tomato plants harboring Tm-22 resistance genes", PLOS ONE, vol. 12, 2017, pages e0170429, XP055469071, DOI: 10.1371/journal.pone.0170429
MADEIRA FPEARCE MTIVEY ARNBASUTKAR PLEE JEDBALI OMADHUSOODANAN NKOLESNIKOV ALOPEZ R: "Search and sequence analysis tools services from EMBL-EBI", NUCLEIC ACIDS RESEARCH, vol. 50, 2022, pages W276 - W279
MARTI E, GISBERT C, BISHOP GJ, DION MS, GARCIA-MARTINEZ JL: "Genetic and physiological characterization of tomato cv. Micro-Tom", J EXP BOT, vol. 57, 2006, pages 2037 - 2047, XP055831076, DOI: 10.1093/jxb/erj154
MCLELLAN H, CHEN K, HE Q, WU X, BOEVINK PC, TIAN Z, BIRCH PRJ: "The ubiquitin E3 ligase PUB17 positively regulates immunity by targeting a negative regulator, KH17, for degradation", PLANT COMM, vol. 1, 2020, pages 100020, XP055960962, DOI: 10.1016/j.xplc.2020.100020
MCLELLAN HAZEL ET AL: "The Ubiquitin E3 Ligase PUB17 Positively Regulates Immunity by Targeting a Negative Regulator, KH17, for Degradation", PLANT COMMUNICATIONS, vol. 1, no. 4, 1 July 2020 (2020-07-01), pages 100020, XP055960962, ISSN: 2590-3462, DOI: 10.1016/j.xplc.2020.100020 *
MEISSNER R, JACOBSON Y, MELAMED S, LEVYATUV S, SHALEV G, ASHRI A, ELKIND Y, LEVY A: "A new model system for tomato genetics", PLANT J, vol. 12, 1997, pages 1465 - 1472, XP002096585, DOI: 10.1046/j.1365-313x.1997.12061465.x
NI X ET AL: "StPUB17, a novel potato UND/PUB/ARM repeat type gene, is associated with late blight resistance and NaCl stress", PLANT SCIENCE, ELSEVIER IRELAND LTD, IE, vol. 178, no. 2, 1 February 2010 (2010-02-01), pages 158 - 169, XP026876954, ISSN: 0168-9452, [retrieved on 20091216] *
NI X, TIAN Z, LIU J, SONG B, LI J, SHI X, XIE C: "StPUB17, a novel potato UND/PUB/ARM repeat type gene, is associated with late blight resistance and NaCl stress", PLANT SCI, vol. 178, 2010, pages 158 - 169, XP026876954
NICOT PC, MORETTI A, ROMITI C, BARDIN M, CARANTA C, FERRIERE H: "Differences in susceptibility of pruning wounds and leaves to infection by Botrytis cinerea among wild tomato accessions", TGS REPORT, vol. 52, 2002, pages 24 - 26
OROSA BEATRIZ ET AL: "BTB-BACK Domain Protein POB1 Suppresses Immune Cell Death by Targeting Ubiquitin E3 ligase PUB17 for Degradation", vol. 13, no. 1, 5 January 2017 (2017-01-05), USA, pages e1006540, XP055962107, ISSN: 1553-7390, Retrieved from the Internet <URL:https://journals.plos.org/plosgenetics/> DOI: 10.1371/journal.pgen.1006540 *
PRINS TW, TUDZYNSKI P, VON TIEDEMANN A, TUDZYNSKI B, TEN HAVE A, HANSEN ME, TENBERGE K, VAN KAN JAL: "Fungal Pathology", 2000, SPRINGER, article "Infection strategies of Botrytis cinerea and related necrotrophic pathogens", pages: 33 - 64
QIN T, LIU S, ZHANG Z, SUN L, HE X, LINDSEY K, ZHU L, ZHANG X: "GhCyP3 improves the resistance of cotton to Verticillium dahliae by inhibiting the E3 ubiquitin ligase activity of GhPUB17", PLANT MOL BIOL, vol. 99, 2019, pages 379 - 393
QIN TAO ET AL: "GhCyP3 improves the resistance of cotton toVerticillium dahliaeby inhibiting the E3 ubiquitin ligase activity of GhPUB17", PLANT MOLECULAR BIOLOGY, SPRINGER, DORDRECHT, NL, vol. 99, no. 4, 22 January 2019 (2019-01-22), pages 379 - 393, XP036724426, ISSN: 0167-4412, [retrieved on 20190122], DOI: 10.1007/S11103-019-00824-Y *
RICHARDS JK, XIAO C-L, JURICK II WM: "Botrytis spp.: A contemporary perspective and synthesis of recent scientific developments of a widespread genus that threatens global food security", PHYTOPATHOL, vol. 111, 2021, pages 432 - 436
SCHOUTEN HJTIKUNOV YVERKERKE WFINKERS RBOVY ABAI YVISSER RGF: "Breeding has increased the diversity of cultivated tomato in The Netherlands", FRONT PLANT SCI, vol. 10, 2019, pages 1606
SEMAGN K, BABU R, HEARNE S, OLSEN M: "Single nucleotide polymorphism genotyping using Kompetitive Allele Specific PCR (KASP): overview of the technology and its application in crop improvement", MOL BREED, vol. 33, 2014, pages 1 - 14, XP055255322, DOI: 10.1007/s11032-013-9917-x
SMITH JEMENGESHA BTANG HMENGISTE TBLUHM BH: "Resistance to Botrytis cinerea in Solanum lycopersicoides involves widespread transcriptional reprogramming", BMC, vol. 15, 2014, pages 334, XP021184310, DOI: 10.1186/1471-2164-15-334
SMITHWATERMAN, ADVANCES IN APPLIED MATHEMATICS, vol. 2, 1981, pages 482 - 489
SUN K, VAN TUINEN A, VAN KAN JAL, WOLTERS AMA, JACOBSEN E, VISSER RGF, BAI Y: "Silencing of DND1 in potato and tomato impedes conidial germination, attachment and hyphal growth of Botrytis cinerea", BMC PLANT BIOLOGY, vol. 17, 2017, pages 235
SUN K, WOLTERS AMA, LOONEN AEHM, HUIBERS RP, VAN DER VLUGT R, GOVERSE A, JACOBSEN E, VISSER RGF, BAI Y: "Down-regulation of Arabidopsis DND1 orthologs in potato and tomato leads to broad-spectrum resistance to late blight and powdery mildew", TRANSGENIC, vol. 25, 2016, pages 123 - 138
TEN HAVE AVAN BERLOO RLINDHOUT PVAN KAN JAL: "Partial stem and leaf resistance against the fungal pathogen Botrytis cinerea in wild relatives of tomato", EUR J PLANT PATHOL, vol. 117, 2007, pages 153 - 166, XP019465032
TIJSSEN: "Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes", 1993, ELSEVIER, article "Overview of principles of hybridization and the strategy of nucleic acid probe assays"
TRUJILLO M ET AL: "Ubiquitination in plant immunity", CURRENT OPINION IN PLANT BIOLOGY, ELSEVIER, AMSTERDAM, NL, vol. 13, no. 4, 1 August 2010 (2010-08-01), pages 402 - 408, XP027173295, ISSN: 1369-5266, [retrieved on 20100512] *
TUSCHL ET AL., GENES AND DEV., vol. 13, 1999, pages 3191 - 97
VAN BAARLEN P, WOLTERING EJ, STAATS M, VAN KAN JAL: "Histochemical and genetic analysis of host and non-host interactions of Arabidopsis with three Botrytis species: an important role for cell death control", MOLECULAR PLANT PATHOLOGY, vol. 8, 2007, pages 41 - 54
VAN KAN JAL, SHAW MW, GRANT-DOWNTON RT: "Botrytis species: relentless necrotrophic thugs or endophytes gone rogue? ", MOL PLANT PATHOL, vol. 15, 2014, pages 957 - 961
VAN KAN JAL: "Licensed to kill: the lifestyle of a necrotrophic plant pathogen", TRENDS, vol. 11, 2006, pages 247 - 253, XP028013196, DOI: 10.1016/j.tplants.2006.03.005
VERLAAN MG, SZINAY D, HUTTON SF, DE JONG H, KORMELINK R, VISSER RGF, SCOTT JW, BAI Y: "Chromosomal rearrangements between tomato and Solanum chilense hamper mapping and breeding of the TYLCV resistance gene Ty-1", PLANT J, vol. 68, 2011, pages 1093 - 1103, XP055031910, DOI: 10.1111/j.1365-313X.2011.04762.x
W.R. PEARSON, METHODS IN ENZYMOLOGY, vol. 183, 1990, pages 63 - 98
WADA, N. ET AL.: "Precision genome editing in plants: state-of-the-art in CRISPR/Cas9-based genome engineering", BMC PLANT BIOLOGY, vol. 20, 2020, XP055706050, DOI: 10.1186/s12870-020-02385-5
WILLIAMSON B, TUDZYNSKI B, TUDZYNSKI P, VAN KAN JAL: "Botrytis cinerea: the cause of grey mould disease", MOL PLANT PATHOL, vol. 8, 2007, pages 561 - 580, XP055441015, DOI: 10.1111/j.1364-3703.2007.00417.x
YAN Z, APPIANO M, VAN TUINEN A, MEIJER-DEKENS F, SCHIPPER D, GAO D, HUIBERS R, VISSER RGF, BAI Y, WOLTERS AMA: "Discovery and characterization of a novel tomato mlo mutant from an EMS mutagenized Micro-Tom population", GENES, vol. 12, 2021, pages 719
YANG CHENG-WEI ET AL: "The E3 ubiquitin ligase activity of Arabidopsis PLANT U-BOX17 and its functional tobacco homolog ACRE276 are required for cell death and defense", THE PLANT CELL, AMERICAN SOCIETY OF PLANT BIOLOGISTS, US, vol. 18, no. 4, 1 April 2006 (2006-04-01), pages 1084 - 1098, XP002463573, ISSN: 1040-4651, DOI: 10.1105/TPC.105.039198 *
YANG C-W, GONZALEZ-LAMOTHE R, EWAN RA, ROWLAND O, YOSHIOKA H, SHENTON M, YE H, O'DONNELL E, JONES JDG, SADANANDOM A: "The E3 ubiquitin ligase activity of Arabidopsis PLANT U-BOX17 and its functional tobacco homolog ACRE276 are required for cell death and defense", PLANT CELL, vol. 18, 2006, pages 1084 - 1098, XP002463573, DOI: 10.1105/tpc.105.039198
ZHANG HZHANG WJIAN GQI FSI N: "The genes involved in the protective effects of phytohormones in response to Verticillium dahliae infection in Gossypium hirsutum", J PLANT BIOL, vol. 59, 2016, pages 194 - 202

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117904142A (zh) * 2024-03-18 2024-04-19 浙江大学海南研究院 SlMYB52基因在提高番茄盐胁迫抗性中的应用

Similar Documents

Publication Publication Date Title
WO2021000878A1 (fr) Nouveaux loci génétiques associés à la résistance à la rouille dans des graines de soja
CA3093000A1 (fr) Procedes d&#39;identification, de selection et de production de cultures resistantes aux maladies
WO2020185735A1 (fr) Procédés d&#39;identification, de sélection et de production de cultures résistant à la rouille du maïs du sud
US20200190530A1 (en) Identification and use of grape genes controlling salt/drought tolerance and fruit sweetness
US9732354B2 (en) Plant resistance gene
WO2022218158A1 (fr) Identification de gène de résistance aux maladies et de gène effecteur d&#39;agent pathogène végétal, compositions et procédés d&#39;utilisation
WO2023194291A1 (fr) Plantes présentant une résistance améliorée aux agents pathogènes
WO2021092173A1 (fr) Procédés d&#39;identification, de sélection et de production de cultures résistant à la rouille du maïs du sud
US20230151382A1 (en) Plant pathogen effector and disease resistance gene identification, compositions, and methods of use
WO2023242393A1 (fr) Plantes présentant une résistance améliorée aux agents pathogènes
CA3150025A1 (fr) Procedes d&#39;identification, de selection et de production de cultures resistant a la pourriture de la tige causee par l&#39;anthracnose
WO2014112875A1 (fr) Nouveau procédé pour conférer aux plantes une résistance à la pourriture molle bactérienne
CA2797875C (fr) Clonage et exploitation d&#39;un gene fonctionnel de resistance provenant de solanum x edinense
US20230189732A1 (en) Didymella bryoniae internal fruit rot resistance in cucumis sativus plants
EP4380352A1 (fr) Résistance durable au mildiou chez l&#39;épinard
CA3228155A1 (fr) Compositions et procedes de resistance aux taches grises des feuilles
WO2021198186A1 (fr) Plantes présentant une résistance améliorée aux nématodes
WO2020185663A2 (fr) Maîtriser l&#39;auto-incompatibilité chez les plantes diploïdes pour la sélection et la production d&#39;hybrides par la modulation du ht

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23717116

Country of ref document: EP

Kind code of ref document: A1