WO2023193819A1 - Method for cultivating early-maturing rice variety by means of gene editing - Google Patents

Abstract

Provided is a method for shortening the maturation period of a rice variety by means of gene editing. Specifically, a deletion, insertion, or substitution mutation or a combination mutation is performed on a candidate gene coding region intron 28 Kb region of a QTL, named qDeh3 (in accordance with the Oryza sattiva Nipponbare reference genome, the interval being 269, 914-3, 266, 858 bp), of chromosome 3 of rice, nucleotide sequences being: target 1: AGCCGTACGTCTAAGCAGCC, and target 2: TCGGGCGGAGACGTGCGGTT. By means of editing the intron of the qDeh3 candidate gene, upon deletion in the DNA of the intron, the heading of rice is significantly shortened. By means of gene editing of the qDeh3 candidate gene 28 Kb coding region intron, Line1 and Line2 are obtained; compared to receptor MH63, the maturation periods of the edited lines are shortened by 14 days under long day lighting, and 22 days under short day lighting.

Description

A method to breed early-maturing rice varieties through gene editing Technical field

The invention relates to the fields of plant genetic engineering and biological breeding, and specifically relates to a method for advancing the maturity period of rice varieties through gene editing combined with molecular recurrent selection technology.

Background technique

With the impact of changes in the international situation such as epidemics, trade wars and even local wars, the strategic significance of food security has become increasingly prominent. Early rice is an important source of strategic grain reserves and also provides important raw materials for food processing. Since 2019, my country's early rice production has grown steadily for three consecutive years [1]. The use of early-maturing and high-yielding varieties can effectively shorten the planting cycle, reduce production costs and improve producers' ability to resist risks. Therefore, cultivating early-maturing and high-yielding rice varieties has become a focus of rice molecular breeders [2]. It is worth noting that the current early rice varieties used in large areas in production are still mainly conventional rice varieties [3], and hybrid vigor cannot be fully utilized. The reason is closely related to the fact that in the process of achieving high yield of existing hybrid combinations, the growth period of restorer lines is longer, resulting in the late maturity of hybrid combinations. Therefore, cultivating early-maturing and high-yielding lines, especially dominant early-maturing and high-yielding lines, is of great significance to rice breeding [4].

Research on the molecular basis of early ripening in rice is beneficial to understanding the mechanism of early ripening. Early maturity is directly related to early flowering (also early panicling in rice). The molecular mechanism of flowering has been studied in great detail in the long-day model plant Arabidopsis thaliana, which includes several important genes: the GI (GIGANTEA) gene is related to circadian rhythm, and the CO (CONSTANS) gene promotes flowering by activating the FT (FLOWERING LOCUS T) gene. SOC1 (SUPPRESSOR OF OVEREXPRESSION OF CO 1) is located downstream of CO. It is a key regulator that integrates multiple flowering signals such as light, gibberellins, and vernalization [5]. It also plays an important role in early maturation in leguminous crops [6 ]. Rice is a short-day model crop and has similar regulatory mechanisms, including: Hd1 and CO [7], Hd3a and FT [8], OsGI and GI [9], etc., are homologous genes respectively. There are two main regulatory pathways at the same time: pathway 1: OsGI-Hd1-Hd3a and pathway 2: Ghd7-Ehd1-RFT (Figure 1).

Under short-day conditions, rice senses the short-day circadian rhythm through OsGI in pathway 1, and then uses the Hd1 gene to regulate the expression of Hd3a (encoding florigen), transmitting the signal from the leaves to the shoot apical meristem to promote heading [10 ,11]. At the same time, Ehd1 (B-type response regulator [11]) in pathway 2 can also induce the expression of Hd3a to promote heading. In addition to these two pathways, the OsCO3 gene homologous to Hd1 will delay heading by negatively regulating the expression of Hd3a and FTL under short-day conditions [12].

Contrary to short-day conditions, OsGI in pathway 1 delays heading by regulating the Hd1 gene under long-day conditions [10, 13]. At the same time, Ghd7, DTH8, etc. in pathway 2 delay heading [14, 15] and increase plant height and grain number per panicle by inhibiting Ehd1.

It is worth noting that biological phenomena are often more complex than theoretical models, and the same is true for the regulation of rice maturity. In addition to these two pathways, there are also regulatory pathways that promote heading under long days. For example, the OsMADS50/OsSOC1/DTH3 gene leads to early heading by promoting the expression of the Ehd1 gene [16, 17]; while OsID1/Ehd2/RID1 can upregulate the expression of Ehd1 under both long and short days [18, 19]; OsDof12 gene Encoding a DOF transcription factor, it promotes heading by up-regulating the expression of Hd3a under long days [20].

Yield is the most important breeding target trait of rice, and the appropriate maturity period is an important indicator of the ecological adaptability of the variety. Judging from the maturity genes currently focused on by molecular breeding (Figure 1), the maturity genes related to yield are often related to delayed maturity while increasing yield. Therefore, there is a certain contradiction between early maturity and high yield [21].

Ghd7 affects many agronomic traits, including plant height, maturity stage and number of grains per panicle. Under long-day conditions, the expression of Ghd7 is increased, the ripening period is delayed, and the plant height and grain number per panicle increase [14]. The latest research shows that Ghd7 acts as a transcriptional repressor. Ghd7 can directly bind to the two Evening Element-like motifs located in the promoter and first intron of the ARE1 (ABC1REPRESSOR1) gene, thereby inhibiting ARE1 gene expression and improving nitrogen utilization. efficiency and grain yield [22]. Ghd7.1 encodes a pseudo-response regulatory protein. Functional Ghd7.1 delays rice heading and increases yield under long-day conditions [23]. Under long-day conditions, DTH8/Ghd8/EF8 delays rice heading and increases yield by negatively regulating the expression of Ehd1, RFT1 and Hd3a. The MOC1 gene is responsible for controlling rice tillers and lateral branches. DTH8/Ghd8 can promote the expression of MOC1 to increase the number of tillers, primary branches and secondary branches, thereby increasing yield [24].

DTH8 can negatively regulate the expression of chlorophyll biosynthetic genes in rice to reduce chlorophyll content, and plays an important role in the photoperiodic flowering pathway, yield potential, and chlorophyll synthesis [25]. Hd1 and Ehd1 can reduce the number of primary branches and stems in the panicle, resulting in a reduction in the number of grains in the panicle, independent of the regulation of heading stage; the expression of the two florigen genes Hd3a and RFT1 in the leaves of the Hd1Ehd1 line during the flowering transition period Upregulated. Hd1 and/or Ehd1 lead to the upregulation of Terminal Flower 1-like in the apical meristem during panicle development and advance the expression of genes related to panicle formation. Therefore, Hd1 and Ehd1, two important flowering genes, have the function of regulating rice panicle development, which may affect crop yield by affecting the expression of florigen genes in leaves [26].

The non-coding sequences of eukaryotic genes mainly include the untranslated region (UTR) upstream and downstream of the promoter (promoter) and the intron (intron) of the coding region. The introns in the coding region can be transcribed and processed and sheared during the maturation of the mRNA. Recent studies have found that introns in coding regions play an important role in the regulation of gene expression. In addition to alternative splicing, the introns in the coding region play an important role in intron retention (IR) [27]. Introns are retained for It plays an important role in the regulation of Saccharomyces cerevisiae cell growth under stress conditions [28]. In starved cells, introns can also slow down cell metabolism, reduce energy consumption, and ultimately extend cell life by inhibiting ribosomal protein gene expression [29].

In addition, the intron itself may contain regulatory binding sites that affect gene expression. For example, in Arabidopsis thaliana, SNP differences in non-coding regions can lead to instability of the epigenetic memory of the FLC gene [30]. The retained intron contains important cis-elements, which may play an important role in regulating the expression of wheat powdery mildew resistance genes [31].

It is generally believed that the early maturity of rice is determined by non-photosensitive genes, photorepressor genes, early-maturing basic vegetative growth phase genes and related modifying genes [32]. It is a recessive trait controlled by a major gene or a quantitative trait controlled by multiple genes. Dominant There are few reports on precocious traits. In addition to mutants, breeders are paying more attention to dominant early-maturing genes from breeding materials. Most of the currently reported dominant precocious genes come from sterile lines/maintainer lines (Table 1), and most of the F ₂ populations conform to a segregation ratio of 3:1. Currently, there is only one cloned dominant early-maturing gene Ef-cd. Research speculates that its molecular mechanism is through the promoter variation of lncRNA encoding genes, which leads to an increase in expression levels, thereby regulating the expression of downstream genes at heading stage to promote flowering [33].

Genome editing technology refers to a genetic manipulation technology that can carry out targeted modification of DNA sequences at the genome level. It has great application value in gene function research and modification, biomedicine and plant genetic improvement. Scientists have begun to explore genome-directed editing technology since the late 1990s, but until 2002, homologous recombination-mediated genome-directed editing was only achieved in a few model organisms such as mice [34] and Drosophila [35] , and because the efficiency of homologous recombination is very low, its application prospects are limited. After entering the 21st century, with new breakthroughs in protein structure and function research and the emergence of artificial endonuclease (engineered endonuclease, EEN) technology, the protein domain that specifically recognizes and binds DNA is fused with EEN to create a protein that can specifically recognize and bind DNA. Nucleases (sequence-specific nucleases, SSNs) that cleave DNA sequences, thereby enabling efficient and precise targeted editing of specific sites in the genome [36].

At present, SSNs mainly include zinc finger nucleases (ZFNs) [37], transcription activator-like effector nucleases (TALENs) [38], and clusters of regularly spaced short loops. CRISPR/Cas9 system [39] and CRISPR/Cpf1 system [40]. The common feature of these SSNs is that they can precisely cut DNA double strands at specific parts of the genome, causing DNA double-strand breaks (DSBs); and DSBs can greatly increase the probability of chromosomal recombination events [41]. The repair mechanism of DSBs is highly conserved in eukaryotic cells, and mainly includes two repair pathways: homologous recombination (homology-directed repair, HDR) and non-homologous end joining (NHEJ) [42]. When there is no donor DNA, cells repair through the NHEJ pathway [42]. Since NHEJ repair is often not precise enough, a small number of nucleic acid bases are often inserted or inserted at the DNA strand break position. Deletion (insertion-deletion, InDel), resulting in gene mutation; when there is a homologous sequence donor DNA, HDR repair can produce precise site-directed replacement or insertion [42].

After the emergence of TALENs in 2010 and CRISPR/Cas9 technology in 2013, a research boom in genome-directed editing started in the world [43]. In particular, CRISPR/Cas9 technology has quickly been widely used in medicine, agriculture, basic research and other fields because of its relative simplicity, accuracy, and efficiency [44, 45].

The field of gene editing has experienced years of technology accumulation and development, from the early Zinc Finger nuclease technology and TALEN technology to the more programmable CRISPR technology, base editing technology (Base Editing), and guided editing technology (Prime Editing). , ushering in rapid development in multiple application directions such as biological breeding, biopharmaceuticals, and synthetic biology. Nature, the top international academic journal, also listed precision genome editing technology as seven technologies worthy of attention in 2022.

Gene sequences are usually divided into coding and non-coding regions based on whether they play a major role in coding proteins. The latter includes the promoter, upstream (5') and downstream (3') untranslated regions. UTR), their main function is to regulate the expression of coding sequences. The coding region and UTR will appear in the pre-mRNA during the transcription process. During the processing from pre-mRNA to mature mRNA, the part that is removed is called an intron; the part that is retained is called an intron. Exons are spliced and used as templates for subsequent translation of proteins, so there are introns and exons in both UTR and coding regions. The main targets of current gene editing technology are coding region exons, promoters and UTRs, while coding region introns have not been paid attention to.

In rice, quantitative regulation of rice quality traits can be achieved by editing the 5'UTR intron of the Waxy gene to change the expression level of the target gene [46]; by editing the yield-related heading date gene Ghd7 mentioned above. 1(Hd2) Upstream Open Reading Frame (uORF), that is, the 5'UTR exon can change the maturity period of rice varieties [47]. However, due to the significant correlation between these heading period genes and yield, one factor Multiple effects, using this method to advance the ripening period will lead to a reduction in yield. Therefore, how to find editing targets that can advance the maturity period and have little impact on yield is crucial for biological breeding applications.

references

[1]. National Bureau of Statistics, Statistical Data Release, 2021.

[2]. Chinese Academy of Sciences. "Zhongkefa Zaojing No. 1" series of new early japonica rice varieties were successfully bred. 2021; Available from: https://www.cas.cn/syky/202107/t20210721_4799445.shtml .

[3]. National Rice Data Center, Rice Promotion Area, 2021.

[4].Muhiuddin Faruquee, Q.Zhang, L.Zhang, L.Xu, W.Wang, J.Chen, J.Xu, Z.Li, B.Fu, and T.Zheng, Dominant early heading without yield drag in a sister-line BC breeding progeny DEH_229 is controlled by multiple genetic factors with main-effect loci. The Crop Journal, 2021: p.400-411.

[5].Yanovsky, MJand SAKay, Molecular basis of seasonal time measurement in Arabidopsis. Nature, 2002.419(6904):p.308-12.

[6].Kou, K., H. Yang, H. Li, C. Fang, L. Chen, L. Yue, H. Nan, L. Kong, X. Li, F. Wang, J. Wang, H .Du, Z.Yang, Y.Bi, Y.Lai, L.Dong, Q.Cheng, T.Su, L.Wang, S.Li, Z.Hou, S.Lu, Y.Zhang, Z.Che , D. Yu, X. Zhao, B. Liu, and F. Kong, A functionally divergent SOC1 homolog improves soybean yield and latitudinal adaptation. Curr Biol, 2022.

[7].Yano, M., Y.Katayose, M.Ashikari, U.Yamanouchi, L.Monna, T.Fuse, T.Baba, K.Yamamoto, Y.Umehara, Y.Nagamura, and T.Sasaki, Hd1, amajor photoperiod sensitivity quantitative trait locus in rice, is closely related to the Arabidopsis flowering time gene CONSTANS.Plant Cell, 2000.12(12):p.2473-2484.

[8].Kojima, S., Y.Takahashi, Y.Kobayashi, L.Monna, T.Sasaki, T.Araki, and M.Yano, Hd3a, arice ortholog of the Arabidopsis FT gene, promotes transition to flowering downstream of Hd1 under short-day conditions.Plant Cell Physiol, 2002.43(10):p.1096-105.

[9].Hayama, R., T.Izawa, and K.Shimamoto, Isolation of rice genes possibly involved in the photoperiodic control of flowering by a fluorescent differential display method.Plant Cell Physiol, 2002.43(5):p.494- 504.

[10].Hayama, R., S.Yokoi, S.Tamaki, M.Yano, and K.Shimamoto, Adaptation of photoperiodic control pathways produces short-day flowering in rice.Nature, 2003.422(6933):p.719- twenty two.

[11].Doi, K., T.Izawa, T.Fuse, U.Yamanouchi, T.Kubo, Z.Shimatani, M.Yano, and A.Yoshimura, Ehd1, aB-type response regulator in rice, confers short -day promotion of flowering and controls FT-like gene expression independently of Hd1.Genes Dev, 2004.18(8):p.926-36.

[12].Kim, S.K., C.H.Yun, J.H.Lee, Y.H.Jang, H.Y.Park, and J.K.Kim, OsCO3, a CONSTANS-LIKE gene, controls flowering by negatively regulating the expression of FT-like genes under SD conditions in rice. Planta, 2008.228(2):p.355-65.

[13].Tamaki, S., S.Matsuo, H.L.Wong, S.Yokoi, and K.Shimamoto, Hd3a protein is a mobile flowering signal in rice.Science, 2007.316(5827):p.1033-6.

[14].Xue, W., Y.Xing, X.Weng, Y.Zhao, W.Tang, L.Wang, H.Zhou, S.Yu, C.Xu, X.Li, and Q.Zhang, Natural variation in Ghd7 is an important regulator of heading date and yield potential in rice.Nat Genet, 2008.40(6):p.761-7.

[15]. Wei, X., J. Xu, H. Guo, L. Jiang, S. Chen, C. Yu, Z. Zhou, P. Hu, H. Zhai, and J. Wan, DTH8 suppresses flowering in rice, influencing plant height and yield potential simultaneously.Plant Physiol, 2010.153(4):p.1747-58.

[16].Lee, S., J.Kim, J.J.Han, M.J.Han, and G.An, Functional analyzes of the flowering time gene OsMADS50, the putative SUPPRESSOR OF OVEREXPRESSION OF CO 1/AGAMOUS-LIKE 20 (SOC1/AGL20 )ortholog in rice.Plant J, 2004.38(5):p.754-64.

[17]. Bian, X.F., flowering in O.Glaberrima Steud.by down-regulating Ehd1.Plant Cell Rep, 2011.30(12):p.2243-54.

[18].Park, S.J., S.L.Kim, S.Lee, B.I.Je, H.L.Piao, S.H.Park, C.M.Kim, C.H.Ryu, S.H.Park, Y.H.Xuan, J.Colasanti, G.An, and C.D.Han, Rice Indeterminate 1(OsId1)is necessary for the expression of Ehd1(Early heading date 1)regardless of photoperiod.Plant J, 2008.56(6):p.1018-29.

[19].Matsubara, K., U.Yamanouchi, ZXWang, Y.Minobe, T.Izawa, and M.Yano, Ehd2, a rice ortholog of the maize INDETERMINATE1 gene, promotes flowering by up-regulating Ehd1.Plant Physiol, 2008.148(3):p.1425-35.

[20].Li, D., C.Yang, X.Li, Q.Gan, X.Zhao, and L.Zhu, Functional characterization of rice OsDof12.Planta, 2009.229(6):p.1159-69.

[21]. Wang Xiuzhi, Wang Xudong, Wu Xianjun, Han Lei, Research progress on rice early maturity. Chinese Agricultural Science Bulletin, 2004.03: p.129-132.

[22].Wang, Q., Q.Su, J.Nian, J.Zhang, M.Guo, G.Dong, J.Hu, R.Wang, C.Wei, G.Li, W.Wang, H.S. Guo, S.Lin, W.Qian, X.Xie, Q.Qian, F.Chen, and J.Zuo, The Ghd7 transcription factor represses ARE1 expression to enhance nitrogen utilization and grain yield in rice.Mol Plant, 2021.14(6 ):p.1012-1023.

[23].Yan, W., H. Liu, X. Zhou, Q. Li, J. Zhang, L. Lu, T. Liu, H. Liu, C. Zhang, Z. Zhang, G. Shen, W .Yao, H.Chen, S.Yu, W.Xie, and Y.Xing, Natural variation in Ghd7.1 plays an important role in grain yield and adaptation in rice.Cell Res, 2013.23(7):p.969- 71.

[24]. Yan, W. H., P. Wang, H. X. Chen, H. J. Zhou, Q. P. Li, C. R. Wang, Z. H. Ding, Y. S. Zhang, S. B. Yu, Y. Z. regulating grain productivity, plant height, and heading date in rice. Mol Plant, 2011.4(2):p.319-30.

[25].Feng, Z., L.Zhang, C.Yang, T.Wu, J.Lv, Y.Chen, X.Liu, S.Liu, L.Jiang, and J.Wan, EF8 is involved in photoperiodic flowering pathway and chlorophyll biogenesis in rice.Plant Cell Rep, 2014.33(12):p.2003-14.

[26].Endo-Higashi, N.and T.Izawa, Flowering time genes Heading date 1 and Early heading date 1 together control panicle development in rice.Plant Cell Physiol, 2011.52(6):p.1083-94.

[27].Schmitz, U., N.Pinello, F.Jia, S.Alasmari, W.Ritchie, M.-C.Keightley, S.Shini, G.J.Lieschke, J.J.L.Wong, and J.E.J.Rasko, Intron retention enhances gene regulatory complexity in vertebrates.Genome Biology, 2017.18(1):p.216.

[28].Morgan, J.T., G.R.Fink, and D.P.Bartel, Excised linear introns regulate growth in yeast.Nature, 2019.565(7741):p.606-611.

[29]. Parenteau, J., L. Maignon, M. Berthoumieux, M. Catala, V. Gagnon, and S. Abou Elela, Introns are mediators of cell response to starvation. Nature, 2019.565(7741):p.612 -617.

[30].Questa, J.I., R.L.Antoniou-Kourounioti, S.Rosa, P.Li, S.Duncan, C.Whittaker, M.Howard, and C.Dean, Noncoding SNPs influence a distinct phase of Polycomb silencing to destabilize long -term epigenetic memory at Arabidopsis FLC.Genes Dev, 2020.34(5-6):p.446-461.

[31].Xia, T., Y. Yang, H. Zheng, X. Han, H. Jin, Z. Xiong, W. Qian, L. Xia, X. Ji, G. Li, D. Wang, and K.Zhang, Efficient expression and function of a receptor-like kinase in wheat powder mildew defense require an intron-located MYB binding site.Plant Biotechnology Journal, 2021.19(5):p.897-909.

[32]. Zhou Zhenling, Jiang Ling, Xu Dayong, Wei Xiangjin, Liu Xi, Lu Baiguan, and Wan Jianmin, Genetic analysis of heading period of late japonica varieties in Taihu Basin. Chinese Rice Science, 2011.

[33].Fang, J., F. Zhang, H. Wang, W. Wang, F. Zhao, Z. Li, C. Sun, F. Chen, F. Xu, S. Chang, L. Wu, Q .Bu, P.Wang, J.Xie, F.Chen, X.Huang, Y.Zhang, X.Zhu, B.Han, X.Deng, and C.Chu, Ef-cd locus shortens rice maturity without yield penalty.Proc Natl Acad Sci U S A, 2019.116(37):p.18717-18722.

[34].Capecchi, M., Altering the genome by homologous recombination.Science, 1989.244(4910):p.1288-1292.

[35].Bellaiche, Y., V.Mogila, and N.Perrimon, I-SceI endonuclease, a new tool for studying DNA double-strand break repair mechanisms in Drosophila.Genetics, 1999.152(3):p.1037-1044 .

[36].Baker, M., Gene-editing nucleases. Nat Methods, 2012.9(1):p.23-6.

[37].Urnov, FD, EJRebar, MCHolmes, HSZhang, and PDGregory, Genome editing with engineered zinc finger nucleases. Nat Rev Genet, 2010.11(9):p.636-46.

[38].Christian, M., T.Cermak, E.L.Doyle, C.Schmidt, F.Zhang, A.Hummel, A.J.Bogdanove, and D.F.Voytas, Targeting DNA double-strand breaks with TAL effector nucleases.Genetics, 2010.186( 2):p.757-61.

[39]. Mali, P., J. Aach, P.B. Stranges, K.M. Esvelt, M. Moosburner, S. Kosuri, L. Yang, and G.M. Church, CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Nature Biotechnology, 2013.31(9):p.833-838.

[40].Zetsche, B., J.S.Gootenberg, O.O.Abudayyeh, I.M.Slaymaker, K.S.Makarova, P.Essletzbichler, S.E.Volz, J.Joung, J.van der Oost, A.Regev, E.V.Koonin, and F.Zhang, Cpf1is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system. Cell, 2015.163(3):p.759-71.

[41].Cohen-Tannoudji, M., S. Robine, A. Choulika, D. Pinto, F. El Marjou, C. Babinet, D. Louvard, and F. Jaisser, I-SceI-Induced Gene Replacement at a Natural Locus in Embryonic Stem Cells.Molecular and Cellular Biology, 1998.18(3):p.1444-1448.

[42].Symington, L.S.and J.Gautier, Double-strand break end resection and repair pathway choice.Annu Rev Genet, 2011.45:p.247-71.

[43].Ishii, T., Germline genome-editing research and its socioethical implications.Trends Mol Med, 2015.21(8):p.473-81.

[44].Go, D.E. and R.W.Stottmann, The Impact of CRISPR/Cas9-Based Genomic Engineering on Biomedical Research and Medicine.Curr Mol Med, 2016.16(4):p.343-52.

[45].Weeks, D.P., M.H.Spalding, and B.Yang, Use of designer nucleases for targeted gene and genome editing in plants.Plant Biotechnol J, 2016.14(2):p.483-95.

[46].Zeng, D., T. Liu, X. Ma, B. Wang, Z. Zheng, Y. Zhang, X. Xie, B. Yang, Z. Zhao, Q. Zhu, and Y. G. Liu, Quantitative regulation of Waxy expression by CRISPR/Cas9-based promoter and 5'UTR-intron editing improves grain quality in rice.Plant Biotechnol J, 2020.18(12):p.2385-2387.

[47].Liu, X., H. Liu, Y. Zhang, M. He, R. Li, W. Meng, Z. Wang, X. Li, and Q. Bu, Fine-tuning Flowering Time via Genome Editing of Upstream Open Reading Frames of Heading Date 2 in Rice.Rice, 2021.14(1):p.59.

[48]. Yang Yaojun, Wang Xudong, Wu Xianjun, Zhang Hongyu, Zhang Peng, and Zhao Huixia, Discovery, genetic analysis and molecular marker positioning of dominant early-maturing rice material D64B. Acta Genetics, 2005.

[49]. Li Xiulan, Jiang Yueshui, Wang Pingrong, and Deng Xiaojian, Genetic analysis and gene mapping of early maturity in rice H14. Journal of Applied and Environmental Biology, 2008.03: p.332-336.

[50].Zhang, H., X. Wang, Q. Pan, P. Li, Y. Liu, X. Lu, W. Zhong, M. Li, L. Han, J. Li, P. Wang, D .Li, Y.Liu, Q.Li, F.Yang, Y.M.Zhang, G.Wang, and L.Li, QTG-Seq Accelerates QTL Fine Mapping through QTL Partitioning and Whole-Genome Sequencing of Bulked Segregant Samples.Mol Plant, 2019.12(3):p.426-437.

[51]. Zhang, L., H. Li, and J. Wang, The statistical power of inclusive composite interval mapping in detecting digenic epistasis showing common F2 segregation ratios.J Integr Plant Biol, 2012.54(4):p.270- 9.

Contents of the invention

The present invention found that the variation in the intron of the 28Kb coding region of the qDeh3 candidate gene controls the ripening period of the dominant early-maturing material DEH229 under long and short days, and then introduced the intron region of the 28Kb coding region of the qDeh3 candidate gene through gene editing means. Genomic variation can advance rice maturity and has no significant impact on other agronomic traits. The early-maturing materials created by this method can be used as donors and used in crop breeding such as rice in combination with techniques such as molecular recurrent selection. This completes the present invention.

The present invention provides a method for cultivating early-maturing varieties through gene editing, which is characterized by performing gene editing mutations on genes homologous to the candidate gene whose QTL number is qDeh3 on chromosome 3 of rice in gramineous crops as a target. In order to obtain early maturing characteristics of crops, it is preferred that the crops are grass or leguminous crops, and more specific examples are rice, corn, and soybeans. After investigation, it was found that the above-mentioned homologous genes exist in both gramineous plants and leguminous plants and are related to the maturity period. Therefore, the method of the present invention can be applied to gramineous or leguminous crops.

Preferably, the gene editing target is located in the intron region of the candidate gene numbered qDeh3 or its homologous gene.

Further preferably, for rice crops, the target is a deletion, insertion or replacement mutation or a combination thereof in the 28Kb region of the intron of the coding region of the candidate gene whose QTL number is qDeh3 on chromosome 3, such as a large fragment Deletion insertion and deletion insertion of small fragments, or single base substitutions, to obtain premature properties.

More specifically, the nucleotide sequence of the gene editing target is: target 1-AGCCGTACGTCTAAGCAGCC, target 2-TCGGGCGGAGACGTGCGGTT.

In the specific operation, primers are designed at both ends of the target; then the target primer linker is connected to the promoter, and then an sgRNA expression cassette containing the target is constructed through the Overlapping PCR method; the vector and sgRNA expression cassette are connected together to complete Vector construction.

Further, the constructed vector was genetically transformed into rice.

More preferably, the T ₀ generation transgenic seedlings are obtained through gene editing, the inbred seeds are harvested, the T ₁ generation is further planted and the target-edited homozygotes are identified to further obtain a stable strain with early maturing characteristics.

In specific embodiments, the starting rice varieties are medium-maturing varieties or late-maturing varieties in each ecological zone, such as Minghui 63 (MH63) in the indica rice zone and Zhongnongjing 11 in the japonica rice zone.

The present invention also provides the application of early-maturing crop varieties obtained by the method, which is characterized by using them as donors and combining them with molecular reincarnation selection technology, that is, selecting late-maturing materials as reincarnation parents, and editing early-maturing materials as donors. Parents, design primers and develop molecular markers based on the target information of editing early-maturing materials. In each round of backcrossing, this pair of markers is used to assist. In the separation generation of hybrid offspring, early-maturing single plants are selected as hybrid objects and continue to hybridize with the recurrent parents. Then, through rapid stabilization methods such as hybridization or flower culture, the target early-maturing rice varieties are finally cultivated;

The crops are grass and leguminous crops, preferably the crops are rice, corn or soybeans.

The present invention is based on the research discovery that the variation in the intron of the 28Kb coding region of the qDeh3 candidate gene controls the maturity period of dominant early-maturing materials, and then introduces genomic variation here through gene editing means, which can advance the maturity of crops, especially grass crops. period, but had no significant impact on other agronomic traits. Therefore, the method of the present invention can be used to create early-maturing crop materials, which can then be used as donors in crop breeding.

Description of the drawings

Figure 1. Rice maturity control network under long/short daylight conditions.

Figure 2A shows the BSA-seq heading stage positioning results of the F ₂ population based on the MH63/DEH229 combination.

Figure 2B shows the short-day heading period positioning results of the F ₂ population ES-RIL population in Hainan based on the MH63/DEH229 combination.

Figure 2C shows the positioning results of the Beijing long-day heading period of the F ₂ population ES-RIL population based on the MH63/DEH229 combination.

Figure 3 Variation analysis of qDeh3 candidate genes of DEH229 and MH63 based on third-generation genome sequencing.

Figure 4. Connection of adapter primer and promoter (A) and expression cassette construction (B) effect detection. Among them, Ladder: 2000+ markers, U6aT1: includes the sequence of target 1, gRT1: includes the reverse sequence of target 1, U6bT2: includes the sequence of target 2, gRT2: includes the reverse sequence of target 2, sgRT1 : Add the sgRNA after target 1, sgRT2: Add the sgRNA after target 2.

Figure 5 Maturation phenotypes of two lines (Line1 and Line2) and their recipient parent (MH63) edited by the intron of the 28Kb coding region of the qDeh3 candidate gene under Hainan (short day) and Beijing (long day) conditions .

Figure 6 Target variation of the early-maturing strain (C) obtained by editing the vector (A and B are target 1 and target 2 respectively) and the 28Kb intron of the qDeh3 coding region.

Detailed ways

In order to make the purpose, technical solutions and advantages of the present invention more clear, the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described here are only used to explain the present invention and are not intended to limit the present invention. Specific experimental operations not specifically described are routine operations.

Experimental materials used in the examples: one F ₂ population of the parents Minghui 63 (MH63), DEH229 and their hybrid combination MH63/DEH229, and the Extreme-Select Recombinant Inbred Lines derived from this combination. ES-RIL)1 set.

The material DEH229 used in the present invention is derived from the high-generation backcross progeny of MH63. The F ₁ generation hybridized with MH63 and other medium-late maturing materials shows dominant early maturation. Different from other reported dominant early-maturing breeding materials, the F ₂ population of MH63/DEH229 showed a bimodal distribution of panicle stage but seriously deviated from 3:1. Candidate gene analysis of the mapped main effect locus found that both parents were in the coding region. There is no variation[4].

Table 1. Dominant early maturation genes that have been mapped/cloned in current breeding materials

According to the Nipponbare reference genome, the qDeh3 candidate gene (a MADS-box family gene) has a 28Kb coding region intron, and the mutations in DEH229 and MH63 are concentrated in the intron region. This is likely to cause qDeh3 to be different from the existing genes. Known coding region variations have different dominant precocious puberty regulatory mechanisms.

Example 1 Gene Mapping

In 2021, the F ₂ population of MH63/DEH229 will be planted in Hainan (short daylight), and the ES-RIL population will be planted under two environmental conditions in Hainan and Beijing (long daylight), and two biological replicates will be set up. Genome-wide molecular marker genotype identification was performed on the population. The F ₂ population used BSA split-pool sequencing combined with biparental re-sequencing, with a sequencing depth of more than 100X; ES-RIL used chips to identify SNP marker genotypes. General conventional methods are also used for positioning. The former uses QTG-Seq [50], and the latter uses QTL positioning software for single marker analysis (SMA) and interval mapping [51]. In order to reduce false positives, the LOD threshold is 5.0. The sites detected by both methods were selected as reliable sites.

The BSA-seq method was used to sequence the early-maturing pool and the late-maturing pool of the F ₂ population of MH63/DEH229, and then QTG-Seq was used for positioning. When window size = 50, a QTL was located on the short arm of chromosome 3. According to the Nipponbare reference genome, the interval is 269,914-3,266,858bp and the size is 2.99Mb. We named this QTL site qDeh3 (Figure 2A). Combined with the verification of linkage positioning of the ES-RIL population under long/short daylight conditions, qDeh3 can be detected under both long and short daylight conditions. The contribution rate of qDeh3 on chromosome 3 was 63.2% under short-day conditions (Fig. 2B), and the contribution rate of qDeh3 under long-day conditions was 55.0% (Fig. 2C). The favorable allele that promotes heading period is derived from DEH229.

Example 2 Analysis of intron variation in the 28Kb coding region

The parents MH63 and DEH229 were separately sampled for long fragment third-generation sequencing.

The specific process is as follows:

1. Genomic DNA sample detection

(1) Use the Agilent 4200 system to detect the size of the extracted DNA fragments and check whether there is degradation in the sample;

(2) Use Nanodrop system to detect DNA purity, OD260/280 is between 1.8-2.0, OD260/230 is between 2.0-2.2;

(3) Use the Qubit system to accurately quantify DNA.

2. Library construction

After passing the DNA quality inspection, use g-TUBE performs fragment fragmentation, and then performs fragment sorting to obtain ~20kb insert fragments. Magnetic beads are further used to enrich and purify large fragments of DNA, the ends of the fragments are repaired, and stem-loop sequencing adapters are connected to both ends of the DNA fragments. After sorting the fragments again, annealing is performed to bind DNA polymerase, and the library is detected by Agilent 2100. After the quality is qualified, sequencing will be performed on the computer.

3. Sequencing on computer:

After the DNA library is quantified, a certain concentration and volume of the library template and enzyme complex are transferred to the nanopore of the PacBio Sequel sequencer and sequenced on the machine.

4. Off-machine data processing and quality control

Perform sequencing adapter removal and split processing on the raw data Polymerase reads that are off the machine to obtain Subreads. Then, based on the sequencer itself, automatic quality control is performed on the Subreads, including removing Subreads that still contain sequencing adapter sequences and filtering out Subreads with an average base quality less than 0.8. Use the CCS tool in Smrtlink to convert Subreads into HiFi reads. Finally, descriptive statistical analysis was performed on Polymerase reads, Subreads, and HiFireads.

The quality of the data obtained is as follows: under the premise of single base accuracy of 99%, Reads N50 and average length are both >14kb (Table 2). The Reads were spliced into fasta format files, and the Contig N50 obtained were all greater than 30Mb (Table 3). On this basis, BLAST is used to establish a local sequence retrieval library for subsequent analysis.

Table 2. Third-generation sequencing raw data statistics

Table 3. Third-generation sequencing data assembly results

The candidate gene sequences were used to perform BLAST on the local sequence retrieval libraries of MH63 and DEH229, and the retrieved FASTA format sequence files were used for sequence comparison. The analysis results found that the genomic differences between MH63 and DEH229 were concentrated in the intron region of the 28Kb coding region of the qDeh3 candidate gene. Compared with MH63, the intron of the 28Kb coding region of the qDeh3 candidate gene of DEH229 has two large fragments of 3-4Kb inserted and 15 small InDels (Figure 5).

Example 3 Target Design and Genetic Transformation

First, use Nipponbare as the reference genome and use the target Design website to design the target for locating the introns of the coding region of the candidate gene. Then, based on the off-target rate, specificity, and secondary structure of the target + sgRNA, two candidates are screened. Suitable target. Then, primers were designed at both ends of the target site to detect whether the target site also exists in the MH63 and DEH229 genomes and has consistent sequences. The target primer linker is then connected to the U6a/U6b promoter, and an sgRNA expression cassette containing the target is constructed using the Overlapping PCR method. Use the Golden Gate cloning method to connect the pYLCRISPR/Cas9 vector and sgRNA expression cassette together to complete the vector construction.

According to the target design process of the intron of the 28Kb coding region of the qDeh3 candidate gene mentioned above, the selected targets and detection primers are shown in Table 5, and the PCR reaction system is shown in Table 6. The adapter primer was connected to the U6a promoter for a total of four PCR reactions, named U6aT1, gRT1, U4bT2 and gRT2 (Table 4). The PCR products of promoter ligation and expression cassette construction were detected by agarose electrophoresis. The product sizes of U6aT1 and U4bT2 range from 140 to 600 bp; the target fragment lengths obtained by constructing gRT1 and gRT2 with expression cassettes are 629 bp and 515 bp respectively (Figure 4). The primers involved in constructing the vector are also listed in Table 5.

Table 4. 4 PCR reactions used to connect sgRNA to promoter and construct expression cassette

Table 5. Target/primer sequences used in experiments

Table 6. PCR reaction system used in the experiment

PCR reaction parameters: denaturation at 98°C for 5 minutes, then enter the PCR cycle, that is, 98°C for 10 seconds, 55°C for 15 seconds, 68°C for 1 minute, a total of 35 cycles, and finally extension at 68°C for 10 minutes.

Follow the conventional transformation method, transform the vector into Agrobacterium, sequence and identify it, confirm that the target has been connected to the vector, and then send for genetic transformation. The receptor material is Minghui 63, and the plant resistance is hygromycin. The specific steps are as follows .

Specific steps

1. Callus induction and subculture

Select mature rice seeds (preferably newly harvested that year), peel off the chaff, pour into a 50ml centrifuge tube, add 75% ethanol to sterilize for 1 minute, pour out the ethanol, rinse with sterile water, pour it out, and then add 30% sodium hypochlorite Disinfect for 20 minutes, discard the sodium hypochlorite and rinse 5-6 times with sterile water. Use a pipette to absorb excess water (you can use sterilized filter paper to absorb it), and transfer the seeds to the induction medium, 20-25 seeds per dish.

After the callus grows, the original embryo can be directly transformed. The small particles growing next to the original embryo can be picked out and subcultured on a new induction medium. When they grow to a suitable size, they can also be transformed.

2. Agrobacterium culture

The Agrobacterium EHA105 containing the target gene vector was streaked on a plate containing the corresponding antibiotics, and cultured in the dark at 28°C for 2 days until a single colony appeared.

3. Agrobacterium infection

Prepare the AAM infection solution, add AS (1000 times dilution), use a pipette to absorb the AAM and wash off the Agrobacterium on the plate, adjust the bacterial concentration to an OD600 of 0.3-0.5, which is the Agrobacterium used for co-cultivation and transformation of rice. suspension.

Select a sufficient amount of callus (the callus is in good condition, bright yellow in color, round and hard in texture, and the particle diameter is 3mm) (left or right is appropriate,) into a 100ml sterile Erlenmeyer flask, add an appropriate amount of Agrobacterium suspension (just ensure that there is enough bacterial liquid in contact with the material), and place it at room temperature for infection for 20 minutes, shaking from time to time. Pour off the bacterial liquid, place the callus on sterile filter paper to absorb excess bacterial liquid, then transfer it to a solid co-culture medium covered with a layer of sterile filter paper, and cultivate it in the dark at 26°C for 3 days.

4. Screening and cultivation

The callus after 3 days of co-cultivation needs to be cleaned. Use a 1ml blue pipette tip to sow the callus on the co-culture medium into a sterilized Erlenmeyer flask, add sterile water to rinse both sides, and use a 1ml blue pipette tip to rinse both sides. Rinse once with /L carbenicillin sterile water, absorb the excess water with a pipette, transfer the callus to sterile filter paper, and use the wind from a clean bench to blow dry the water on the callus. The blowing time is controlled to about 30 minutes. After the calli are dried, they are transferred to the screening medium for screening and culture. The culture conditions are 28-30 degrees and cultured in the dark. Screening time is 3-4 weeks.

5. Differentiation and regeneration

One month after screening, positive calli with a bright yellow color and a diameter of 1-2 mm can be seen growing. At this time, the positive calli can be picked out on the differentiation medium for differentiation and regeneration. Place 16 positive calli on each differentiation dish and place them in a greenhouse at 28-30 degrees for light culture. Generally, green spots will emerge from the callus in about 10 days, and seedlings will differentiate after about 10 days.

6. Seedlings taking root

When the differentiated seedlings grow to about 2-3cm and have obvious root systems, they can be transferred to the rooting medium to let the seedlings grow. The rooting medium should be poured into a relatively tall bottle or tube. Only when there is enough space to grow taller, the rooting culture conditions are 28-30 degrees and sterile light culture.

Example 4 Gene Editing Effect

For the obtained transgenic plants, target-specific primers were used to amplify the genomic DNA of the edited progeny and the recipient parent (MH63), and the PCR products were sequenced to obtain the sequences for comparison and analysis.

Extraction of total rice DNA:

TPS formula: 10mL of 1M Tris-HCL (PH8.0), 2mL of 0.5M EDTA (PH8.0), 7.45g of KCl, and dilute to 100mL of ddH2O.

1) Take about 4cm of rice leaves and place them in a 2mL centrifuge tube, and add two steel balls. Label the centrifuge tube according to the number on the ziplock bag.

2) Place it in a 100-well plate in a 6*8 pattern and close the lid.

3) Transfer the centrifuge tube to a fixed plate, cover it from top to bottom, freeze it in liquid nitrogen for about 1 minute, take it out, and put it into a proofing machine to crush the sample.

4) Open the lid, add 1 mL of TPS buffer, close the lid, place in a 65°C oven for more than 40 minutes (shake every 5 minutes), and centrifuge at 12,000 rpm for 10 minutes.

5) Take the supernatant and put it into a 1.5 mL centrifuge tube with 500 μL of isopropyl alcohol (equal volume). The isopropyl alcohol needs to be placed in a 4°C refrigerator. (Excess well plates with isopropyl alcohol can be placed in a 4°C refrigerator first)

6) Place the centrifuge tube mixed with supernatant and isopropyl alcohol in a -20°C refrigerator for more than 1 hour.

7) Centrifuge at 12,000 rpm for 6 minutes and remove the supernatant.

8) Add 200 μL of 75% alcohol to wash, remove the supernatant, and dry in a 30°C oven for 20-30 minutes.

9) Add 200 μL dd H ₂ O to dissolve and store in a refrigerator at 4°C.

Phenotypic observations:

After obtaining the T ₀ generation transgenic seedlings, slow down the seedlings, transplant them, and harvest sufficient selfing seeds. In 2021, the T ₁ generation will continue to be planted in Beijing, and the parents will be planted at the same time as a control. At the seedling stage, samples from each line were mixed to identify whether the target was homozygous. Investigate heading stage phenotypes. In 2022, the T2 generation will be planted in Hainan, and samples will also be taken to identify targets and investigate phenotypes. By editing the intron of the 28Kb coding region of the qDeh3 candidate gene, stable lines such as Line1 and Line2 were obtained. Compared with the recipient MH63, the maturity period was earlier and other agronomic traits changed little. As shown in Figure 5, the intronic gene editing of the 28Kb coding region of the qDeh3 candidate gene in two lines (Line1 and Line2) and its recipient parent (MH63) under Hainan (short day) and Beijing (long day) conditions From the ripening stage phenotype, it can be seen that by editing the intron of the qDeh3 candidate gene and deleting the intron DNA, the heading of rice is significantly advanced. Compared with the wild-type receptor MH63, the edited strain can advance about 14 days under long-day conditions and about 22 days under short-day conditions (Table 7).

Table 7. Heading period performance of edited lines

Edit target verification:

Design forward primer C2-F and reverse primer C2-R (Table 3) respectively on the genome sequences on the left side of the homologous left arm and the right side of the homologous right arm, and amplify the target segment after recombination through PCR reaction. (Table 4), and then through Sanger sequencing, the edited strain sequence and wild-type sequence information will be obtained, and compared to check the editing status of the target. Based on the comparison of target site variations between vectors and edited strains, it was found that the InDel variation was introduced into the intron of the 28Kb coding region of the qDeh3 candidate gene near target site 1 in Line1 and Line2. As shown in Figure 6, A and B are the vector parts containing target 1 and target 2 respectively. Sequence, C is the sequence comparison of the target variation of early-maturing lines obtained by editing the 28Kb intron of the qDeh3 coding region. It can be seen that deletion of a sequence near the first target site, including Line1 and Line2 type deletions, will promote rice heading. .

Claims (10)

1. A method of cultivating early-maturing varieties through gene editing, which is characterized by performing gene editing on the homologous gene of the candidate gene with the QTL number qDeh3 on chromosome 3 of rice in gramineous crops as a target to achieve genome variation so that The crop acquires early maturing characteristics. Preferably, the crop is a gramineous or leguminous crop, and more specifically, it is rice, corn, and soybean.
2. The method of claim 1, wherein the gene editing target is located in the intron region of the coding region of the homologous gene of the candidate gene numbered qDeh3.
3. The method according to claim 2, characterized in that, for rice crops, the target is a deletion, insertion or replacement mutation in the 28Kb region of the intron of the coding region of the candidate gene whose QTL number is qDeh3 on chromosome 3 Or their combination of mutations, such as deletion and insertion of large fragments and deletion and insertion of small fragments, or single base substitutions, to cause premature characteristics.
4. The method of claim 3, wherein the nucleotide sequence of the gene editing target is: target 1-AGCCGTACGTCTAAGCAGCC, target 2-TCGGGCGGAGACGTGCGGTT.
5. The method as claimed in claim 3, characterized in that primers are designed at both ends of the target site; the target primer joint is connected to a promoter, and an sgRNA expression cassette containing the target site is constructed by an Overlapping PCR method; the vector is Connect it with the sgRNA expression cassette to complete the vector construction.
6. The method according to claim 5, characterized in that the constructed vector is genetically transformed into rice.
7. The method according to claim 6, characterized in that, T ₀ generation transgenic seedlings are obtained through gene editing, inbred seeds are harvested, T ₁ generation is further planted and homozygotes of target editing are identified, and a stable strain with early maturing characteristics is further obtained. .
8. The method according to any one of claims 1 to 7, characterized in that the starting rice variety is a mid-ripening variety or a late-maturing variety in each ecological zone, such as Minghui 63 (MH63) in the indica rice zone or MH63 in the japonica rice zone. Zhongnongjing11.
9. The application of early maturing crop varieties obtained by the method according to any one of claims 1 to 8 is characterized in that it is used as a donor and combined with molecular reincarnation selection technology, that is, materials with a late maturity period are selected as reincarnation parents, edited Early-maturing materials are used as donor parents. Primers are designed based on the target information of editing early-maturing materials, and molecular markers are developed. In each round of backcrossing, this pair of markers is used to assist. In the isolation generation of hybrid offspring, early-maturing single plants are selected as hybrid objects, and The recurrent parents continue to cross, and then through hybridization or flower culture rapid stabilization methods, the target early-maturing rice variety is finally cultivated;

   The crop is a gramineous or leguminous crop.
10. The application according to claim 9, characterized in that the crop is rice, corn or soybean.