WO2023192885A2 - Methods of using oligomeric compounds to treat scn2a-related disorders - Google Patents
Methods of using oligomeric compounds to treat scn2a-related disorders Download PDFInfo
- Publication number
- WO2023192885A2 WO2023192885A2 PCT/US2023/065074 US2023065074W WO2023192885A2 WO 2023192885 A2 WO2023192885 A2 WO 2023192885A2 US 2023065074 W US2023065074 W US 2023065074W WO 2023192885 A2 WO2023192885 A2 WO 2023192885A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- certain embodiments
- modified
- oligomeric compound
- nucleobase
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/712—Nucleic acids or oligonucleotides having modified sugars, i.e. other than ribose or 2'-deoxyribose
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/08—Antiepileptics; Anticonvulsants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/315—Phosphorothioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/321—2'-O-R Modification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/323—Chemical structure of the sugar modified ring structure
- C12N2310/3231—Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/33—Chemical structure of the base
- C12N2310/334—Modified C
- C12N2310/3341—5-Methylcytosine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/34—Spatial arrangement of the modifications
- C12N2310/341—Gapmers, i.e. of the type ===---===
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
- C12N2320/35—Special therapeutic applications based on a specific dosage / administration regimen
Definitions
- the human gene SCN2A encodes human SCN2A protein, the alpha-1 subunit of the voltage-gated sodium channel NaV1.2. Mutations in SCN2A are associated with a variety of neurodevelopmental and intellectual diseases and disorders, including developmental and epileptic encephalopathy (DEE), such as early-onset DEE. Early-onset DEE is caused by gain-of-function (GoF) variants in the SCN2A gene encoding the voltage-gated sodium channel NaV1.2. This is a rare, severe, and life-threatening condition characterized by drug- resistant epilepsy which is widely reported to have onset of seizures in the first three months of life (Wolff et Al 2017, Wolff et al 2019).
- DEE developmental and epileptic encephalopathy
- patients with early-onset DEE have a profound developmental impairment and extensive comorbidities including limitations in communication with most children being non-verbal; autonomic dysfunction; developmental delay; GI abnormalities; movement disorders, such as choreoathetosis, dystonia, ataxia; anxiety; sensory issues; urinary retention problems; and diminished quality of life resulting from (and characterized by) severe irritability, variable sleep problems (e.g., inability to fall and stay asleep), behavior issues, frequent ER visits and hospitalizations, and total reliance on caregivers.
- severe irritability e.g., inability to fall and stay asleep
- variable sleep problems e.g., inability to fall and stay asleep
- behavior issues e.g., frequent ER visits and hospitalizations, and total reliance on caregivers.
- DEEs include a broad range of diseases that include neonatal and early infantile DEE, for example, Ohtahara Syndrome and epilepsy with migrating focal seizures of infancy (EIMFS); infantile and childhood DEE, for example, West Syndrome and Lennon-Gastaut Syndrome; Dravet Syndrome; Idiopathic/Generic Generalized Epilepsies (IGE/GGE); Temporal Lobe Epilepsy; Myoclonic Astatic Epilepsy (MAE); Migrating Partial Epilepsy of Infancy (MMPSI); and familial hemiplegic migraines, with or without epilepsy (Wolff, M., et al., 2019; Harkin, L.A., et al., 2007, Brain 130, 843-852; Escayg, A., et al., 2010, Epilepsia 51, 1650-1658; Miller I.O, et al., 2007 Nov 29 [Updated 2019 Apr 18].
- EIMFS Oht
- Symptoms and hallmarks associated with DEEs include seizures, hypotonia, sensory issues, such as sensory integration disorders, motor development delays and dysfunctions, intellectual and cognitive dysfunctions, movement and balance dysfunctions, visual dysfunctions, delayed language and speech, gastrointestinal disorders, neurodevelopmental delays, sleep problems, and sudden unexpected death in epilepsy.
- Seizures include focal, clonic, tonic, and generalized tonic and clonic seizures, prolonged seizures (often lasting longer than 10 minutes), and frequent seizures (for example, convulsive, myoclonic, absence, focal, obtundation status, and tonic seizures) (Guzzetta, F., 2011, Epilepsia 52:S2, 35-38; Anwar et al., 2019, Cureus 11, e5006, Wolff et al., 2019).
- Symptoms and hallmarks associated with ID and ASD include motor development delays, delayed social and language milestones, repetitive actions, uncoordinated oral movements, gastrointestinal disorders, sleep problems, and seizures (Wolff et al., 2019).
- the SCN2A-related disorder is early-onset developmental or epileptic encephalopathy (DEE).
- the SCN2A-related disorder is DEE, including, for example, Ohtahara Syndrome; epilepsy with migrating focal seizures of infancy (EIMFS); infantile and childhood DEE, for example West Syndrome and Lennon- Gastaut Syndrome; Dravet Syndrome; Idiopathic/Generic Generalized Epilepsies (IGE/GGE); Temporal Lobe Epilepsy; Myoclonic Astatic Epilepsy (MAE); Migrating Partial Epilepsy of Infancy (MMPSI); and familial hemiplegic migraines, with or without epilepsy.
- EIMFS epilepsy with migrating focal seizures of infancy
- infantile and childhood DEE for example West Syndrome and Lennon- Gastaut Syndrome
- Dravet Syndrome Idiopathic/Generic Generalized Epilepsies
- IGE/GGE Idiopathic/Generic Generalized
- the SCN2A-related disorder is late seizure onset epileptic encephalopathy. In certain embodiments, the SCN2A-related disorder is Benign Familial Neonatal-Infantile Seizures. In certain embodiments, the SCN2A-related disorder is an intellectual disability (ID). In certain embodiments, the SCN2A-related disorder is an autism spectrum disorder (ASD).
- the oligomeric compounds described in this application can be used in the methods of treatment. In certain embodiments, the oligomeric compound is paired with a second oligomeric compound that is complementary to the first oligomeric compound.
- the oligomeric compounds is a singled-stranded oligomeric compound that is not paired to a second oligomeric compound, such as the antisense oligonucleotides described herein.
- the oligomeric compounds useful for treating a SCN2A- related disorder are modified oligonucleotides, such as the modified antisense oligonucleotides described herein. Also provided are methods useful for ameliorating at least one symptom or hallmark of a SCN2A-related disorder, such as early-onset DEE, in a subject in need thereof.
- the symptom or hallmark includes one or more of seizures, hypotonia, sensory issues, such as sensory integration disorders, motor dysfunctions, intellectual and cognitive dysfunctions, movement and balance dysfunctions, such as choreoathetosis, dystonia, and ataxia, anxiety, sensory issues, urinary retention problems, irritability, behavour issues, visual dysfunctions, delayed language and speech, gastrointestinal disorders (for example, gastroesophageal reflux, diarrhea, constipation, dysmotility, and the like), neurodevelopmental delays, sleep problems, sudden unexpected death in epilepsy, motor development delays, delayed social milestones, repetitive actions, uncoordinated oral movements.
- sensory issues such as sensory integration disorders, motor dysfunctions, intellectual and cognitive dysfunctions, movement and balance dysfunctions, such as choreoathetosis, dystonia, and ataxia
- anxiety, sensory issues, urinary retention problems, irritability, behavour issues visual dysfunctions, delayed language and speech
- gastrointestinal disorders for example, gastroesophageal reflux, diarrhea, constipation, dysmotility, and the
- the seizures include focal, clonic, tonic, and generalized tonic and clonic seizures, prolonged seizures (often lasting longer than 10 minutes), and frequent seizures (for example, convulsive, myoclonic, absence, focal, obtundation status, and tonic seizures).
- panel A is a graph showing SCN2A mRNA knockdown in the brains of a R1883Q mutant mouse 14 days following intracerebroventricular administration of an exemplary oligomeric compound described herein (SCN2A ASO).
- panel B is a graph showing SCN2A protein knockdown in the brains of a R1883Q mutant mouse 14 days following intracerebroventricular administration of an exemplary oligomeric compound described herein (SCN2A ASO).
- Figure 2 is a graph demonstrating that a single dose of an exemplary oligomeric compound described herein (SCN2A ASO) increases survival beyond a standard of care in SCN2A GoF mice.
- Figure 3 panel A is a graph showing that a single dose of an exemplary oligomeric compound described herein (SCN2A ASO) increases survival in SCN2A GoF mice.
- panel B is a graph showing that re-dosing with an exemplary oligomeric compound described herein (SCN2A ASO) significantly extends survival in SCN2A GoF mice.
- Figure 4 is a graph showing that an exemplary oligomeric compound described herein (SCN2A ASO) extends survival in SCN2A GoF mice when administered after the disease onset.
- panel A is an illustration of IEDs detected in an 11-year-old with early onset SCN2A DEE.
- panel B is a bar graph showing IED burden in subjects of different ages with early onset SCN2A DEE and age-matched healthy controls.
- Figure 6 is a graph demonstrating the results of PK/PD modeling of an exemplary oligomeric compound described herein.
- 2’-deoxynucleoside means a nucleoside comprising a 2’-H(H) deoxyfuranosyl sugar moiety.
- a 2’-deoxynucleoside is a 2’- ⁇ -D- deoxynucleoside and comprises a 2’- ⁇ -D-deoxyribosyl sugar moiety, which has the ⁇ -D ribosyl configuration as found in naturally occurring deoxyribonucleic acids (DNA).
- a 2’-deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil).
- 2’-MOE means a 2’-OCH 2 CH 2 OCH 3 group in place of the 2’-OH group of a furanosyl sugar moiety.
- a “2’-MOE sugar moiety” means a sugar moiety with a 2’-OCH 2 CH 2 OCH 3 group in place of the 2’-OH group of a furanosyl sugar moiety. Unless otherwise indicated, a 2’-MOE sugar moiety is in the ⁇ -D-ribosyl configuration.
- MOE means O-methoxyethyl.
- 2’-MOE nucleoside means a nucleoside comprising a 2’-MOE sugar moiety.
- 2’-OMe means a 2’-OCH 3 group in place of the 2’-OH group of a furanosyl sugar moiety.
- a “2’-O-methyl sugar moiety” or “2’-OMe sugar moiety” means a sugar moiety with a 2’-OCH 3 group in place of the 2’-OH group of a furanosyl sugar moiety.
- a 2’-OMe sugar moiety is in the ⁇ -D-ribosyl configuration.
- “2’-OMe nucleoside” means a nucleoside comprising a 2’-OMe sugar moiety.
- “2’-substituted nucleoside” means a nucleoside comprising a 2’- substituted sugar moiety.
- “2’-substituted” in reference to a sugar moiety means a sugar moiety comprising at least one 2'-substituent group other than H or OH.
- “5-methyl cytosine” means a cytosine modified with a methyl group attached to the 5 position.
- a 5-methyl cytosine is a modified nucleobase.
- “administering” means providing a pharmaceutical agent to a subject.
- antisense activity means any detectable and/or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease or reduction in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound.
- antisense compound means an oligomeric compound capable of achieving at least one antisense activity.
- An antisense compound comprises an antisense oligonucleotide and optionally one or more additional features, such as a conjugate group.
- antisense agent means an antisense compound and optionally one or more additional features, such as a sense compound.
- sense compound means a sense oligonucleotide and optionally one or more additional features, such as a conjugate group.
- antisense oligonucleotide means an oligonucleotide, including the oligonucleotide portion of an antisense compound, that is capable of hybridizing to a target nucleic acid and is capable of at least one antisense activity.
- Antisense oligonucleotides include but are not limited to antisense RNAi oligonucleotides and antisense RNase H oligonucleotides.
- “ameliorate” in reference to a treatment means improvement in at least one symptom or hallmark relative to the same symptom or hallmark in the absence of the treatment.
- amelioration is the reduction in the severity or frequency of a symptom or hallmark or the delayed onset or slowing of progression in the severity or frequency of a symptom or hallmark.
- the symptom or hallmark is seizures, hypotonia, sensory issues, such as sensory integration disorders, motor dysfunctions, intellectual and cognitive dysfunctions, movement and balance dysfunctions, visual dysfunctions, delayed language and speech, gastrointestinal disorders (for example, gastroesophageal reflux, diarrhea, constipation, dysmotility, and the like), neurodevelopmental delays, sleep problems, sudden unexpected death in epilepsy, motor development delays, delayed social milestones, repetitive actions, uncoordinated oral movements.
- the seizures include focal, clonic, tonic, and generalized tonic and clonic seizures, prolonged seizures (often lasting longer than 10 minutes), and frequent seizures (for example, convulsive, myoclonic, absence, focal, obtundation status, and tonic seizures).
- bicyclic sugar or “bicyclic sugar moiety” means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure.
- the first ring of the bicyclic sugar moiety is a furanosyl moiety.
- the furanosyl sugar moiety is a ribosyl moiety.
- the bicyclic sugar moiety does not comprise a furanosyl moiety.
- bicyclic nucleoside or “BNA” means a nucleoside comprising a bicyclic sugar moiety.
- Cerebrospinal fluid or “CSF” means the fluid filling the space around the brain and spinal cord.
- Artificial cerebrospinal fluid” or “aCSF” means a prepared or manufactured fluid that has certain properties of cerebrospinal fluid.
- cleavable moiety means a bond or group of atoms that is cleaved under physiological conditions, for example, inside a cell, an animal, or a human.
- complementary in reference to an oligonucleotide means that at least 70% of the nucleobases of the oligonucleotide or one or more portions thereof and the nucleobases of a another nucleic acid or one or more portions thereof are capable of hydrogen bonding with one another when the nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions.
- complementary nucleobases means nucleobases that are capable of forming hydrogen bonds with one another.
- Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methyl cytosine (mC) and guanine (G).
- Complementary oligonucleotides and/or target nucleic acids need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated.
- oligonucleotide As used herein, “fully complementary” or “100% complementary” in reference to an oligonucleotide, or a portion thereof, means that the oligonucleotide, or portion thereof, is complementary to another oligonucleotide or target nucleic acid at each nucleobase of the shorter of the two oligonucleotides, or at each nucleoside if the oligonucleotides are the same length.
- conjugate group means a group of atoms that is directly or indirectly attached to an oligonucleotide. Conjugate groups include a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.
- conjugate linker means a single bond or a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.
- conjugate moiety means a group of atoms that is attached to an oligonucleotide via a conjugate linker.
- contiguous in the context of an oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other.
- contiguous nucleobases means nucleobases that are immediately adjacent to each other in a sequence.
- cEt means a 4’ to 2’ bridge in place of the 2’OH-group of a ribosyl sugar moiety, wherein the bridge has the formula of 4'-CH(CH 3 )-O-2', and wherein the methyl group of the bridge is in the S configuration.
- a “cEt sugar moiety” is a bicyclic sugar moiety with a 4’ to 2’ bridge in place of the 2’OH-group of a ribosyl sugar moiety, wherein the bridge has the formula of 4'-CH(CH 3 )-O-2', and wherein the methyl group of the bridge is in the S configuration.
- cEt means constrained ethyl.
- cEt nucleoside means a nucleoside comprising a cEt modified sugar moiety.
- chirally enriched population means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers.
- the molecules are modified oligonucleotides.
- the molecules are compounds comprising modified oligonucleotides.
- “chirally controlled” in reference to an internucleoside linkage means chirality at that linkage is enriched for a particular stereochemical configuration.
- “deoxy region” means a region of 5-12 contiguous nucleotides, wherein at least 70% of the nucleosides are 2’- ⁇ -D-deoxynucleosides. In certain embodiments, each nucleoside is selected from a 2’- ⁇ -D-deoxynucleoside, a bicyclic nucleoside, and a 2’-substituted nucleoside. In certain embodiments, a deoxy region supports RNase H activity.
- a deoxy region is the gap or internal region of a gapmer.
- “gapmer” means a modified oligonucleotide comprising an internal region having a plurality of nucleosides that support RNase H cleavage positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions.
- the internal region may be referred to as the “gap” and the external regions may be referred to as the “wings” or “wing segments.”
- the internal region is a deoxy region.
- each nucleoside of the gap is a 2’- ⁇ -D-deoxynucleoside.
- the gap comprises one 2’-substituted nucleoside at position 1, 2, 3, 4, or 5 of the gap, and the remainder of the nucleosides of the gap are 2’- ⁇ -D-deoxynucleosides.
- MOE gapmer indicates a gapmer having a gap comprising 2’- ⁇ -D-deoxynucleosides and wings comprising 2’-MOE nucleosides.
- mixed wing gapmer indicates a gapmer having wings comprising modified nucleosides comprising at least two different sugar modifications. Unless otherwise indicated, a gapmer may comprise one or more modified internucleoside linkages and/or modified nucleobases and such modifications do not necessarily follow the gapmer pattern of the sugar modifications.
- hotspot region is a range of nucleobases on a target nucleic acid that is amenable to oligomeric compound-mediated reduction of the amount or activity of the target nucleic acid.
- hybridization means the pairing or annealing of complementary oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson- Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.
- the term “in some embodiments,” “in other embodiments,” or the like refers to embodiments of all aspects of the disclosure, unless the context clearly indicates otherwise.
- internucleoside linkage means the covalent linkage between contiguous nucleosides in an oligonucleotide.
- modified internucleoside linkage means any internucleoside linkage other than a phosphodiester internucleoside linkage.
- Phosphorothioate internucleoside linkage or “PS internucleoside linkage” is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with a sulfur atom.
- linker-nucleoside means a nucleoside that links, either directly or indirectly, an oligonucleotide to a conjugate moiety. Linker-nucleosides are located within the conjugate linker of an oligomeric compound. Linker-nucleosides are not considered part of the oligonucleotide portion of an oligomeric compound even if they are contiguous with the oligonucleotide.
- LNA means locked nucleic acid.
- LNA sugar moiety is a bicyclic sugar moiety with a 4’ to 2’ bridge in place of the 2’OH-group of a furanosyl sugar moiety, wherein the bridge has the formula of 4'-CH 2 -O-2'.
- LNA means locked nucleic acid.
- the furanosyl sugar moiety is a ribosyl sugar moiety.
- LNA nucleoside means a nucleoside comprising a LNA sugar moiety.
- non-bicyclic modified sugar moiety means a modified sugar moiety that comprises a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring.
- mis or “non-complementary” means a nucleobase of a first oligonucleotide that is not complementary with the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotide are aligned.
- “motif” means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or internucleoside linkages, in an oligonucleotide.
- nucleobase means an unmodified nucleobase or a modified nucleobase.
- an “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G).
- a “modified nucleobase” is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one unmodified nucleobase.
- a “5-methyl cytosine” is a modified nucleobase.
- a universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases.
- nucleobase sequence means the order of contiguous nucleobases in a target nucleic acid or oligonucleotide independent of any sugar or internucleoside linkage modification.
- nucleoside means a compound or a fragment of a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each, independently, unmodified or modified.
- modified nucleoside means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety. Modified nucleosides include abasic nucleosides, which lack a nucleobase. “Linked nucleosides” are nucleosides that are connected in a contiguous sequence (i.e., no additional nucleosides are presented between those that are linked).
- oligomeric compound means an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group. An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound or may be unpaired.
- a “singled-stranded oligomeric compound” is an unpaired oligomeric compound.
- the term “oligomeric duplex” means a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex may be referred to as a “duplexed oligomeric compound.”
- “oligonucleotide” means a strand of linked nucleosides connected via internucleoside linkages, wherein each nucleoside and internucleoside linkage may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8-50 linked nucleosides.
- modified oligonucleotide means an oligonucleotide, wherein at least one nucleoside or internucleoside linkage is modified.
- unmodified oligonucleotide means an oligonucleotide that does not comprise any nucleoside modifications or internucleoside modifications.
- pharmaceutically acceptable carrier or diluent means any substance suitable for use in administering to a subject. Certain such carriers enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspension and lozenges for the oral ingestion by a subject.
- a pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution or sterile artificial cerebrospinal fluid.
- pharmaceutically acceptable salts means physiologically and pharmaceutically acceptable salts of compounds. Pharmaceutically acceptable salts retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.
- pharmaceutical composition means a mixture of substances suitable for administering to a subject.
- a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution.
- a pharmaceutical composition shows activity in free uptake assay in certain cell lines.
- prodrug means a therapeutic agent in a form outside the body that is converted to a different form within a subject or cells thereof. Typically, conversion of a prodrug within the subject is facilitated by the action of an enzymes (e.g., endogenous or viral enzyme) or chemicals present in cells or tissues and/or by physiologic conditions.
- an enzymes e.g., endogenous or viral enzyme
- reducing the amount,” “reducing the activity,” “decreasing the amount,” or “decreasing the activity” refers to a reduction or blockade of the transcriptional expression or activity relative to the transcriptional expression or activity in an untreated or control sample and does not necessarily indicate a total elimination of transcriptional expression or activity.
- RNA means an RNA transcript and includes pre-mRNA and mature mRNA unless otherwise specified.
- RNAi compound means an antisense compound that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and/or protein encoded by a target nucleic acid.
- RNAi compounds include, but are not limited to double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimics.
- an RNAi compound modulates the amount, activity, and/or splicing of a target nucleic acid.
- the term RNAi compound excludes antisense compounds that act through RNase H.
- SCN2A-related disorder means a disease or disorder associated with a mutation in the SCN2A gene, including neurodevelopmental and intellectual diseases and disorders, such as developmental and epileptic encephalopathy (DEE), including early-onset DEE, Ohtahara Syndrome and epilepsy with migrating focal seizures of infancy (EIMFS); infantile and childhood DEE, for example West Syndrome and Lennon-Gastaut Syndrome; Dravet Syndrome; Idiopathic/Generic Generalized Epilepsies (IGE/GGE); Temporal Lobe Epilepsy; Myoclonic Astatic Epilepsy (MAE); Migrating Partial Epilepsy of Infancy (MMPSI); and familial hemiplegic migraines, with or without epilepsy.
- DEE developmental and epileptic encephalopathy
- EIMFS epilepsy with migrating focal seizures of infancy
- IGE/GGE Idiopathic/Generic Generalized Epilepsies
- MAE Myoclonic Astatic Epi
- SCN2A disorders include Late Seizure Onset Epileptic Encephalopathy and Benign Familial Neonatal-Infantile Seizures (BFNIS), as well as intellectual disability (ID) and/or autism spectrum disorder (ASD), with or without seizures.
- BFNIS Benign Familial Neonatal-Infantile Seizures
- ID intellectual disability
- ASD autism spectrum disorder
- self-complementary in reference to an oligonucleotide means an oligonucleotide that at least partially hybridizes to itself.
- standard in vitro assay means the assay described in Example 1 and reasonable variations thereof.
- stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method that is not designed to control the stereochemical configuration.
- a stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.
- subject means a human or non-human animal. In certain embodiments, the subject is a human.
- sugar moiety means an unmodified sugar moiety or a modified sugar moiety.
- unmodified sugar moiety means a 2’-OH(H) ⁇ -D-ribosyl moiety, as found in RNA (an “unmodified RNA sugar moiety”), or a 2’-H(H) ⁇ -D- deoxyribosyl sugar moiety, as found in DNA (an “unmodified DNA sugar moiety”).
- Unmodified sugar moieties have one hydrogen at each of the 1’, 3’, and 4’ positions, an oxygen at the 3’ position, and two hydrogens at the 5’ position.
- modified sugar moiety or “modified sugar” means a modified furanosyl sugar moiety or a sugar surrogate.
- sugar surrogate means a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an internucleoside linkage, conjugate group, or terminal group in an oligonucleotide.
- Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or target nucleic acids.
- symptom or hallmark means any physical feature or test result that indicates the existence or extent of a disease or disorder.
- a symptom is apparent to a subject or to a medical professional examining or testing said subject.
- a hallmark is apparent upon invasive diagnostic testing, including, but not limited to, post-mortem tests.
- a hallmark is apparent on a brain MRI scan.
- target nucleic acid and “target RNA” mean a nucleic acid that an antisense compound is designed to affect.
- Target RNA means an RNA transcript and includes pre-mRNA and mature mRNA unless otherwise specified.
- target region means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.
- terminal group means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.
- therapeutically effective amount means an amount of a pharmaceutical agent that provides a therapeutic benefit to a subject. For example, a therapeutically effective amount improves a symptom or hallmark of a disease or disorder.
- treat refers to improving a subject’s disease or disorder by administering an oligomeric agent or oligomeric compound described herein.
- “treat”, “treating” and “treatment” refer to reducing the severity of the disease or disorder in a subject, including retarding or slowing the progression of the disease or disorder (“therapeutic treatment”) or achieving beneficial or desired clinical results.
- the beneficial or desired clinical results include, but are not limited to, alleviation of symptoms; diminishment of the extent of a disease or disorder; stabilized (i.e., not worsening) state of the disease or disorder; delay in onset or slowing of the disease or disorder progression; amelioration of the disease or disorder state or remission (whether partial or total), whether detectable or undetectable; an amelioration of at least one measurable physical parameter, not necessarily discernible by the subject; and enhancement or improvement of the disease or disorder.
- Treatment includes eliciting a clinically-significant response without excessive levels of side effects. Treatment also includes prolonging survival as compared to expected survival if not receiving treatment. In certain embodiments, treating a subject improves a symptom relative to the same symptom in the absence of the treatment.
- treatment reduces in the severity or frequency of a symptom, or delays the onset of a symptom, slows the progression of a symptom, or slows the severity or frequency of a symptom.
- the terms “prevent,” “preventing” and “prevention” contemplate an action that occurs before a subject begins to suffer from the specified disease, disorder or condition (“prophylactic treatment”).
- proliferative treatment contemplate an action that occurs before a subject begins to suffer from the specified disease, disorder or condition (“prophylactic treatment”).
- oligonucleotides In certain embodiments, provided herein are oligomeric compounds comprising oligonucleotides, which consist of linked nucleosides. Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or may be modified oligonucleotides.
- Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA. That is, modified oligonucleotides comprise at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nucleobase) and/or at least one modified internucleoside linkage.
- modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modifed sugar moiety and a modified nucleobase.
- modified sugar moieties are non-bicyclic modified sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties.
- modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.
- modified sugar moieties are non-bicyclic modified sugar moieties comprising a furanosyl ring with one or more substituent groups none of which bridges two atoms of the furanosyl ring to form a bicyclic structure. Such non-bridging substituents may be at any position of the furanosyl, including but not limited to substituents at the 2’, 4’, and/or 5’ positions. In certain embodiments one or more non-bridging substituent of non-bicyclic modified sugar moieties is branched.
- 2’-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 2’-F, 2'-OCH 3 (“OMe” or “O-methyl”), and 2'-O(CH 2 ) 2 OCH 3 (“MOE” or “O-methoxyethyl”).
- 2’-substituent groups are selected from among: halo, allyl, amino, azido, SH, CN, OCN, CF 3 , OCF 3 , O-C 1 -C 10 alkoxy, O-C 1 -C 10 substituted alkoxy, O-C 1 -C 10 alkyl, O-C 1 -C 10 substituted alkyl, S-alkyl, N(R m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O- alkaryl, O-aralkyl, O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(R m )(R n ) or
- these 2'-substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO 2 ), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl.
- Examples of 4’-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015/106128.
- Examples of 5’-substituent groups suitable for non- bicyclic modified sugar moieties include but are not limited to: 5’-methyl (R or S), 5'-vinyl, and 5’-methoxy.
- non-bicyclic modified sugar moieties comprise more than one non-bridging sugar substituent, for example, 2'-F-5'-methyl sugar moieties and the modified sugar moieties and modified nucleosides described in Migawa et al., WO 2008/101157 and Rajeev et al., US2013/0203836.
- a non-bridging 2’-substituent group selected
- a 2’-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2’-substituent group selected from: F, OCH 3 , and OCH 2 CH 2 OCH 3 .
- modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties are further defined by isomeric configuration.
- a 2’-deoxyfuranosyl sugar moiety may be in seven isomeric configurations other than the naturally occurring ⁇ -D-deoxyribosyl configuration.
- modified sugar moieties are described in, e.g., WO 2019/157531, incorporated by reference herein.
- a 2’-modified sugar moiety has an additional stereocenter at the 2’-position relative to a 2’-deoxyfuranosyl sugar moiety; therefore, such sugar moieties have a total of sixteen possible isomeric configurations.
- 2’-modified sugar moieties described herein are in the ⁇ -D- ribosyl isomeric configuration unless otherwise specified.
- Certain modified sugar moieties comprise a substituent that bridges two atoms of the furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety.
- bicyclic nucleosides comprising such bicyclic sugar moieties have been referred to as bicyclic nucleosides (BNAs), locked nucleosides, or conformationally restricted nucleotides (CRN). Certain such compounds are described in US Patent Publication No.2013/0190383; and PCT publication WO 2013/036868.
- the bicyclic sugar moiety comprises a bridge between the 4' and the 2' furanose ring atoms.
- the furanose ring is a ribose ring.
- Examples of such 4’ to 2’ bridging sugar substituents include but are not limited to: 4'-CH 2 -2', 4'-(CH 2 ) 2 -2', 4'-(CH 2 )3-2', 4'-CH 2 -O-2' (“LNA”), 4'-CH 2 -S-2', 4'-(CH 2 ) 2 - O-2' (“ENA”), 4'-CH(CH 3 )-O-2' (referred to as “constrained ethyl” or “cEt” when in the S configuration), 4’-CH 2 -O-CH 2 -2’, 4’-CH 2 -N(R)-2’, 4'-CH(CH 2 OCH 3 )-O-2' (“constrained MOE” or “cMOE”) and analogs thereof (see, e.g., Seth et al., U.S.7,399,845, Bhat et al., U.S.7,569,686, Swayze et al.
- bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration.
- an LNA nucleoside may be in the ⁇ -L configuration or in the ⁇ -D configuration.
- ⁇ -L-methyleneoxy (4’-CH 2 -O-2’) or ⁇ -L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372).
- general descriptions of bicyclic nucleosides include both isomeric configurations.
- modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5’-substituted and 4’-2’ bridged sugars).
- modified sugar moieties are sugar surrogates.
- the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom.
- such modified sugar moieties also comprise bridging and/or non-bridging substituents as described herein.
- sugar surrogates comprise a 4’-sulfur atom and a substitution at the 2'-position (see, e.g., Bhat et al., U.S.7,875,733 and Bhat et al., U.S.7,939,677) and/or the 5’ position.
- sugar surrogates comprise rings having other than 5 atoms.
- a sugar surrogate comprises a six-membered tetrahydropyran (“THP”). Such tetrahydropyrans may be further modified or substituted.
- Nucleosides comprising such modified tetrahydropyrans include but are not limited to hexitol nucleic acid (“HNA”), anitol nucleic acid (“ANA”), manitol nucleic acid (“MNA”) (see, e.g., Leumann, CJ. Bioorg. & Med. Chem.2002, 10, 841-854), fluoro HNA:
- F-HNA see e.g. Swayze et al., U.S.8,088,904; Swayze et al., U.S.8,440,803; Swayze et al., U.S.8,796,437; and Swayze et al., U.S.9,005,906;
- F-HNA can also be referred to as a F- THP or 3'-fluoro tetrahydropyran), and nucleosides comprising additional modified THP compounds having the formula: wherein, independently, for each of the modified THP nucleosides: Bx is a nucleobase moiety; T 3 and T 4 are each, independently, an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide or one of T 3 and T 4 is an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide and the other of T
- modified THP nucleosides are provided wherein q 1 , q 2 , q 3 , q 4 , q 5 , q 6 and q 7 are each H. In certain embodiments, at least one of q 1 , q 2 , q 3 , q 4 , q 5 , q 6 and q 7 is other than H. In certain embodiments, at least one of q 1 , q 2 , q 3 , q 4 , q 5 , q 6 and q 7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of R 1 and R 2 is F.
- R 1 is F and R 2 is H
- R 1 is methoxy and R 2 is H
- R 1 is methoxyethoxy and R 2 is H
- sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom.
- nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., U.S.5,698,685; Summerton et al., U.S.5,166,315; Summerton et al., U.S.5,185,444; and Summerton et al., U.S.5,034,506).
- morpholino means a sugar surrogate having the following structure:
- morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure.
- Such sugar surrogates are referred to herein as “modifed morpholinos.”
- sugar surrogates comprise acyclic moieites. Examples of nucleosides and oligonucleotides comprising such acyclic sugar surrogates include but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol.
- PNA peptide nucleic acid
- acyclic butyl nucleic acid see, e.g., Kumar et al., Org. Biomol.
- modified oligonucleotides comprise one or more nucleosides comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising a modified nucleobase.
- modified oligonucleotides comprise one or more nucleoside that does not comprise a nucleobase, referred to as an abasic nucleoside.
- modified nucleobases are selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and O-6 substituted purines.
- modified nucleobases are selected from: 2-aminopropyladenine, 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2- thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (–C ⁇ C–CH 3 ) uracil, 5- propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7- methylguanine, 7-
- modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-1,3- diazaphenoxazine-2-one (G-clamp).
- Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza- adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.
- nucleobases include those disclosed in Merigan et al., U.S.3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J.I., Ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y.S., Chapter 15, Antisense Research and Applications, Crooke, S.T. and Lebleu, B., Eds., CRC Press, 1993, 273-288; and those disclosed in Chapters 6 and 15, Antisense Drug Technology, Crooke S.T., Ed., CRC Press, 2008, 163-166 and 442-443.
- nucleosides of modified oligonucleotides may be linked together using any internucleoside linkage.
- the two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom.
- Modified internucleoside linkages compared to naturally occurring phosphodiester internucleoside linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide.
- internucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Methods of preparation of phosphorous-containing and non-phosphorous-containing internucleoside linkages are well known to those skilled in the art. Representative internucleoside linkages having a chiral center include but are not limited to alkylphosphonates and phosphorothioates.
- Modified oligonucleotides comprising internucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom internucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate internucleoside linkages in particular stereochemical configurations.
- populations of modified oligonucleotides comprise phosphorothioate internucleoside linkages wherein all of the phosphorothioate internucleoside linkages are stereorandom.
- Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate internucleoside linkage.
- each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration.
- populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate internucleoside linkage in a particular, independently selected stereochemical configuration.
- the particular configuration of the particular phosphorothioate internucleoside linkage is present in at least 65% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate internucleoside linkage is present in at least 70% of the molecules in the population.
- the particular configuration of the particular phosphorothioate internucleoside linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate internucleoside linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate internucleoside linkage is present in at least 99% of the molecules in the population.
- Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS 2003, 125, 8307, Wan et al. Nuc. Acid.
- a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (Sp) configuration.
- a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration.
- modified oligonucleotides comprising (Rp) and/or (Sp) phosphorothioates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase:
- chiral internucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.
- Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y.S. Sanghvi and P.D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH 2 component parts.
- modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar moiety.
- modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase.
- modified oligonucleotides comprise one or more modified internucleoside linkage.
- the modified, unmodified, and differently modified sugar moieties, nucleobases, and/or internucleoside linkages of a modified oligonucleotide define a pattern or motif.
- the patterns of sugar moieties, nucleobases, and internucleoside linkages are each independent of one another.
- a modified oligonucleotide may be described by its sugar motif, nucleobase motif and/or internucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases).
- nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases.
- modified oligonucleotides have a gapmer motif, which is defined by two external regions or “wings” and a central or internal region or “gap.”
- the three regions of a gapmer motif (the 5’-wing, the gap, and the 3’-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap.
- the sugar moieties of the nucleosides of each wing that are closest to the gap differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap (i.e., the wing/gap junction).
- the sugar moieties within the gap are the same as one another.
- the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap.
- the sugar motifs of the two wings are the same as one another (symmetric gapmer).
- the sugar motif of the 5'-wing differs from the sugar motif of the 3'-wing (asymmetric gapmer).
- the wings of a gapmer comprise 1-6 nucleosides.
- each nucleoside of each wing of a gapmer comprises a modified sugar moiety.
- at least one nucleoside of each wing of a gapmer comprises a modified sugar moiety.
- at least two nucleosides of each wing of a gapmer comprise a modified sugar moiety.
- at least three nucleosides of each wing of a gapmer comprise a modified sugar moiety.
- At least four nucleosides of each wing of a gapmer comprise a modified sugar moiety. In certain embodiments, at least five nucleosides of each wing of a gapmer comprise a modified sugar moiety. In certain embodiments, the gap of a gapmer comprises 7-12 nucleosides. In certain embodiments, each nucleoside of the gap of a gapmer comprises a 2’-deoxyribosyl sugar moiety. In certain embodiments, at least six nucleosides of the gap of a gapmer comprise a 2’- ⁇ -D-deoxyribosyl sugar moiety.
- each nucleoside of the gap of a gapmer comprises a 2’- ⁇ -D-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside of the gap of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of the gap of a gapmer comprises a 2’-OMe sugar moiety. In certain embodiments, the gapmer is a deoxy gapmer. In certain embodiments, the nucleosides on the gap side of each wing/gap junction comprise 2’-deoxyribosyl sugar moieties and the nucleosides on the wing sides of each wing/gap junction comprise modified sugar moieties.
- nucleosides of the gap of a gapmer comprise a 2’- ⁇ -D-deoxyribosyl sugar moiety.
- each nucleoside of the gap of a gapmer comprises a 2’-deoxyribosyl sugar moiety.
- each nucleoside of each wing of a gapmer comprises a modified sugar moiety.
- one nucleoside of the gap comprises a modified sugar moiety and each remaining nucleoside of the gap comprises a 2’-deoxyribosyl sugar moiety.
- modified oligonucleotides comprise or consist of a portion having a fully modified sugar motif.
- each nucleoside of the fully modified portion of the modified oligonucleotide comprises a modified sugar moiety.
- each nucleoside of the entire modified oligonucleotide comprises a modified sugar moiety.
- modified oligonucleotides comprise or consist of a portion having a fully modified sugar motif, wherein each nucleoside within the fully modified portion comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif.
- a fully modified oligonucleotide is a uniformly modified oligonucleotide.
- each nucleoside of a uniformly modified oligonucleotide comprises the same 2’-modification.
- the lengths (number of nucleosides) of the three regions of a gapmer may be provided using the notation [# of nucleosides in the 5’-wing] – [# of nucleosides in the gap] – [# of nucleosides in the 3’-wing].
- a 5-10-5 gapmer consists of 5 linked nucleosides in each wing and 10 linked nucleosides in the gap.
- that modification is the modification in each sugar moiety of each wing and the gap nucleosides comprises a 2’- ⁇ -D-deoxyribosyl sugar moiety.
- a 5-10-5 MOE gapmer consists of 5 linked 2’-MOE nucleosides in the 5’-wing, 10 linked 2’- ⁇ -D- deoxynucleosides in the gap, and 5 linked 2’-MOE nucleosides in the 3’-wing.
- a 3-10-3 cEt gapmer consists of 3 linked cEt nucleosides in the 5’-wing, 10 linked 2’- ⁇ -D- deoxynucleosides in the gap, and 3 linked cEt nucleosides in the 3’-wing.
- a 5-8-5 gapmer consists of 5 linked nucleosides comprising a modified sugar moiety in the 5’-wing, 8 linked 2’- ⁇ -D-deoxynucleosides in the gap, and 5 linked nucleosides comprising a modified sugar moiety in the 3’-wing.
- a mixed wing gapmer has at least two different modified sugar moieties in the 5’- and/or the 3’-wing.
- a 5-8-5 or 5-8-4 mixed wing gapmer has at least two different modified sugar moieties in the 5’- and/or the 3’-wing.
- modified oligonucleotides are 5-10-5 MOE gapmers. In certain embodiments, modified oligonucleotides are 4-10-6 MOE gapmers.
- modified oligonucleotides are 6-10-4 MOE gapmers. In certain embodiments, modified oligonucleotides are 4-8-6 MOE gapmers. In certain embodiments, modified oligonucleotides are 6-8-4 MOE gapmers. In certain embodiments, modified oligonucleotides are 5-8-5 MOE gapmers. In certain embodiments, modified oligonucleotides are X-Y-Z MOE gapmers, wherein X and Z are independently selected from 1, 2, 3, 4, 5, 6, or 7 linked 2’- MOE nucleosides and Y is selected from 7, 8, 9, 10, or 11 linked deoxynucleosides.
- modified oligonucleotides have the following sugar motif (5’ to 3’): eeeeedyddddddddddeeeee, eeeeedddddddddddeeeee, eeeeeeddddddddddeeee, eeeedddddddddeeeee, eeeeddddddddeeeeee, eeeedddddddddeeeee, or eeeeeddddddddeeeee, wherein ‘d’ represents a 2’-deoxyribosyl sugar moiety, ‘e’ represents a 2’-MOE sugar moiety, and ’y’ represents a 2’-OMe sugar moiety.
- oligonucleotides comprise modified and/or unmodified nucleobases arranged along the oligonucleotide or portion thereof in a defined pattern or motif.
- each nucleobase is modified.
- none of the nucleobases is modified.
- each purine or each pyrimidine is modified.
- each adenine is modified.
- each guanine is modified.
- each thymine is modified.
- each uracil is modified.
- each cytosine is modified.
- cytosine nucleobases in a modified oligonucleotide are 5-methyl cytosines. In certain embodiments, all of the cytosine nucleobases are 5-methyl cytosines and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases.
- modified oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3’-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 3’-end of the oligonucleotide.
- the block is at the 5’-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 5’-end of the oligonucleotide.
- oligonucleotides having a gapmer motif comprise a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is in the central gap of an oligonucleotide having a gapmer motif.
- the sugar moiety of the nucleoside is a 2’- ⁇ -D- deoxyribosyl sugar moiety.
- the modified nucleobase is selected from: a 2-thiopyrimidine and a 5-propynepyrimidine. 3. Certain Internucleoside Linkage Motifs
- oligonucleotides comprise modified and/or unmodified internucleoside linkages arranged along the oligonucleotide or portion thereof in a defined pattern or motif.
- each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and phosphodiester internucleoside linkage.
- each phosphorothioate internucleoside linkage is independently selected from a stereorandom phosphorothioate, a (Sp) phosphorothioate, and a (Rp) phosphorothioate.
- the sugar motif of a modified oligonucleotide is a gapmer and the internucleoside linkages within the gap are all modified.
- the internucleoside linkages in the wings are unmodified phosphodiester internucleoside linkages.
- the terminal internucleoside linkages are modified.
- the sugar motif of a modified oligonucleotide is a gapmer, and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, wherein the at least one phosphodiester internucleoside linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages.
- all of the phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, all of the phosphorothioate internucleoside linkages in the wings are (Sp) phosphorothioates, and the gap comprises at least one Sp, Sp, Rp motif. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising such internucleoside linkage motifs.
- modified oligonucleotides have an internucleoside linkage motif of (5’ to 3’): sooossssssssssssss, soooosssssssssooss, sooooosssssssssoss, sooosssssssssoooss, soossssssssoooss, soooossssssssssooss, or sooosssssssssssssss, wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
- oligonucleotides can have any of a variety of ranges of lengths.
- oligonucleotides consist of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number nucleosides in the range.
- X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X ⁇ Y.
- oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16
- modified oligonucleotides are incorporated into a modified oligonucleotide.
- modified oligonucleotides are characterized by their modification motifs and overall lengths. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications.
- the internucleoside linkages within the wing regions of a sugar gapmer may be the same or different from one another and may be the same or different from the internucleoside linkages of the gap region of the sugar motif.
- sugar gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. Unless otherwise indicated, all modifications are independent of nucleobase sequence.
- E. Certain Populations of Modified Oligonucleotides Populations of modified oligonucleotides in which all of the modified oligonucleotides of the population have the same molecular formula can be stereorandom populations or chirally enriched populations.
- All of the chiral centers of all of the modified oligonucleotides are stereorandom in a stereorandom population.
- a chirally enriched population at least one particular chiral center is not stereorandom in the modified oligonucleotides of the population.
- the modified oligonucleotides of a chirally enriched population are enriched for ⁇ -D ribosyl sugar moieties, and all of the phosphorothioate internucleoside linkages are stereorandom.
- the modified oligonucleotides of a chirally enriched population are enriched for both ⁇ -D ribosyl sugar moieties and at least one, particular phosphorothioate internucleoside linkage in a particular stereochemical configuration.
- F. Nucleobase Sequence In certain embodiments, oligonucleotides (unmodified or modified oligonucleotides) are further described by their nucleobase sequence. In certain embodiments oligonucleotides have a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid.
- a portion of an oligonucleotide has a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid.
- the nucleobase sequence of a portion or entire length of an oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% complementary to the second oligonucleotide or nucleic acid, such as a target nucleic acid.
- oligomeric compounds which consist of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and/or terminal groups.
- Conjugate groups consist of one or more conjugate moiety and a conjugate linker which links the conjugate moiety to the oligonucleotide.
- Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position.
- conjugate groups are attached to the 2'-position of a nucleoside of a modified oligonucleotide.
- conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups.
- conjugate groups or terminal groups are attached at the 3’ and/or 5’-end of oligonucleotides. In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3’-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3’-end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5’-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5’-end of oligonucleotides.
- terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, abasic nucleosides, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.
- A. Certain Conjugate Groups In certain embodiments, oligonucleotides are covalently attached to one or more conjugate groups. In certain embodiments, conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance.
- conjugate groups impart a new property on the attached oligonucleotide, e.g., fluorophores or reporter groups that enable detection of the oligonucleotide.
- Certain conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y.
- Acids Res., 1990, 18, 3777-3783 a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp.
- conjugate groups may be selected from any of a C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C 6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.
- conjugate groups may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, where the alkyl chain has one or more unsaturated bonds.
- Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, lipophilic groups, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.
- a conjugate moiety comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)- (+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.
- an active drug substance for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)- (+)-pranoprofen, carprof
- Conjugate Linkers Conjugate moieties are attached to oligonucleotides through conjugate linkers.
- the conjugate linker is a single chemical bond (i.e., the conjugate moiety is attached directly to an oligonucleotide through a single bond).
- a conjugate moiety is attached to an oligonucleotide via a more complex conjugate linker comprising one or more conjugate linker moieties, which are sub- units making up a conjugate linker.
- the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units.
- a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino.
- the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups.
- the conjugate linker comprises groups selected from alkyl and amide groups.
- the conjugate linker comprises groups selected from alkyl and ether groups.
- the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group. In certain embodiments, conjugate linkers, including the conjugate linkers described above, are bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate groups to parent compounds, such as the oligonucleotides provided herein. In general, a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a particular site on a parent compound and the other is selected to bind to a conjugate group.
- bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.
- conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6- dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA).
- conjugate linkers include but are not limited to substituted or unsubstituted C 1 -C 10 alkyl, substituted or unsubstituted C 2 -C 10 alkenyl or substituted or unsubstituted C 2 -C 10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.
- conjugate linkers comprise 1-10 linker-nucleosides. In certain embodiments, conjugate linkers comprise 2-5 linker-nucleosides.
- conjugate linkers comprise exactly 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise the TCA motif. In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, linker-nucleosides are unmodified. In certain embodiments, linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine.
- a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methyl cytosine, 4-N-benzoyl-5-methyl cytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine. It is typically desirable for linker-nucleosides to be cleaved from the oligomeric compound after it reaches a target tissue. Accordingly, linker-nucleosides are typically linked to one another and to the remainder of the oligomeric compound through cleavable bonds.
- cleavable bonds are phosphodiester bonds.
- linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which an oligomeric compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and/or a specified percent complementarity to a reference nucleic acid and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising linker- nucleosides, those linker-nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for the reference nucleic acid.
- an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker-nucleosides that are contiguous with the nucleosides of the modified oligonucleotide.
- the total number of contiguous linked nucleosides in such an oligomeric compound is more than 30.
- an oligomeric compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in such an oligomeric compound is no more than 30.
- conjugate linkers comprise no more than 10 linker-nucleosides.
- conjugate linkers comprise no more than 5 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 2 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 1 linker-nucleoside. In certain embodiments, it is desirable for a conjugate group to be cleaved from the oligonucleotide.
- conjugate linkers may comprise one or more cleavable moieties.
- a cleavable moiety is a cleavable bond.
- a cleavable moiety is a group of atoms comprising at least one cleavable bond.
- a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds.
- a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome.
- a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.
- a cleavable bond is selected from among: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide.
- a cleavable bond is one or both of the esters of a phosphodiester.
- a cleavable moiety comprises a phosphate or phosphodiester.
- the cleavable moiety is a phosphate or phosphodiester linkage between an oligonucleotide and a conjugate moiety or conjugate group.
- a cleavable moiety comprises or consists of one or more linker-nucleosides. In certain such embodiments, the one or more linker-nucleosides are linked to one another and/or to the remainder of the oligomeric compound through cleavable bonds.
- cleavable bonds are unmodified phosphodiester bonds.
- a cleavable moiety is 2'-deoxynucleoside that is attached to either the 3' or 5'-terminal nucleoside of an oligonucleotide by a phosphodiester internucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate internucleoside linkage.
- the cleavable moiety is 2'-deoxyadenosine.
- a conjugate group has the general formula: wherein n is from 1 to about 3, m is 0 when n is 1, m is 1 when n is 2 or greater, j is 1 or 0, and k is 1 or 0. In certain embodiments, n is 1, j is 1 and k is 0. In certain embodiments, n is 1, j is 0 and k is 1. In certain embodiments, n is 1, j is 1 and k is 1. In certain embodiments, n is 2, j is 1 and k is 0. In certain embodiments, n is 2, j is 0 and k is 1. In certain embodiments, n is 2, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 0.
- conjugate groups comprise cell-targeting moieties that have at least one tethered ligand.
- cell-targeting moieties comprise two tethered ligands covalently attached to a branching group.
- cell- targeting moieties comprise three tethered ligands covalently attached to a branching group.
- oligomeric compounds comprise one or more terminal groups. In certain such embodiments, oligomeric compounds comprise a stabilized 5’- phosphate.
- Stabilized 5’-phosphates include, but are not limited to 5’-phosphonates, including, but not limited to 5’-vinylphosphonates.
- terminal groups comprise one or more abasic nucleosides and/or inverted nucleosides.
- terminal groups comprise one or more 2’-linked nucleosides.
- the 2’-linked nucleoside is an abasic nucleoside.
- Oligomeric Duplexes In certain embodiments, oligomeric compounds described herein comprise an oligonucleotide, having a nucleobase sequence complementary to that of a target nucleic acid.
- an oligomeric compound is paired with a second oligomeric compound to form an oligomeric duplex.
- Such oligomeric duplexes comprise a first oligomeric compound having a portion complementary to a target nucleic acid and a second oligomeric compound having a portion complementary to the first oligomeric compound.
- the first oligomeric compound of an oligomeric duplex comprises or consists of (1) a modified or unmodified oligonucleotide and optionally a conjugate group and (2) a second modified or unmodified oligonucleotide and optionally a conjugate group. Either or both oligomeric compounds of an oligomeric duplex may comprise a conjugate group.
- oligomeric compounds and oligomeric duplexes are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity; such oligomeric compounds and oligomeric duplexes are antisense compounds.
- antisense compounds have antisense activity when they reduce the amount or activity of a target nucleic acid by 25% or more in the standard cell assay. In certain embodiments, antisense compounds selectively affect one or more target nucleic acid.
- Such antisense compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in significant undesired antisense activity.
- hybridization of an antisense compound to a target nucleic acid results in recruitment of a protein that cleaves the target nucleic acid.
- certain antisense compounds result in RNase H mediated cleavage of the target nucleic acid.
- RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex.
- RNA:DNA duplex need not be unmodified DNA.
- described herein are antisense compounds that are sufficiently “DNA- like” to elicit RNase H activity.
- one or more non-DNA-like nucleoside in the gap of a gapmer is tolerated.
- an antisense compound or a portion of an antisense compound is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid.
- RISC RNA-induced silencing complex
- Antisense compounds that are loaded into RISC are RNAi compounds.
- RNAi compounds may be double-stranded (siRNA) or single- stranded (ssRNA).
- hybridization of an antisense compound to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid.
- hybridization of the antisense compound to the target nucleic acid results in alteration of splicing of the target nucleic acid.
- hybridization of an antisense compound to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid.
- hybridization of an antisense compound to a target nucleic acid results in alteration of translation of the target nucleic acid.
- Antisense activities may be observed directly or indirectly.
- observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein and/or a phenotypic change in a cell or subject.
- oligomeric compounds comprise or consist of an oligonucleotide comprising a portion that is complementary to a target nucleic acid.
- the target nucleic acid is an endogenous RNA molecule.
- the target nucleic acid encodes a protein.
- the target nucleic acid is selected from: a mature mRNA and a pre-mRNA, including intronic, exonic, and untranslated regions.
- the target nucleic acid is a mature mRNA.
- the target nucleic acid is a pre-mRNA.
- the target region is entirely within an intron.
- the target region spans an intron/exon junction.
- the target region is at least 50% within an intron.
- oligonucleotides are complementary to the target nucleic acid over the entire length of the oligonucleotide.
- oligonucleotides are 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, oligonucleotides are at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide and comprise a portion that is 100% or fully complementary to a target nucleic acid. In certain embodiments, the portion of full complementarity is 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleobases in length. In certain embodiments, oligonucleotides comprise one or more mismatched nucleobases relative to the target nucleic acid.
- antisense activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount.
- selectivity of the oligonucleotide is improved.
- the mismatch is specifically positioned within an oligonucleotide having a gapmer motif. In certain embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 from the 5’-end of the gap region. In certain embodiments, the mismatch is at position 1, 2, 3, 4, 5, or 6 from the 5’-end of the 5’ wing region or the 3’ wing region.
- oligomeric compounds comprise or consist of an oligonucleotide that is complementary to a target nucleic acid, wherein the target nucleic acid is an SCN2A nucleic acid.
- the SCN2A nucleic acid has the sequence set forth in SEQ ID NO: 1 (GENBANK Accession No. NM_001040142.2) or SEQ ID NO: 2 (GENBANK Accession No. NC_000002.12 truncated from nucleotides 165127001 to 165395000).
- contacting a cell with an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 reduces the amount of SCN2A RNA in a cell, and in certain embodiments reduces the amount of SCN1A protein in a cell.
- contacting a cell with a modified oligonucleotide complementary to SEQ ID NO: 1 or SEQ ID NO: 2 reduces the amount of SCN2A RNA in a cell, and in certain embodiments reduces the amount of SCN2A protein in a cell.
- the cell is in vitro.
- the cell is in a subject.
- the oligomeric compound consists of a modified oligonucleotide.
- contacting a cell in a subject with an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 ameliorates one or more symptoms or hallmarks of a disease or disorder associated with a voltage-gated sodium channel protein.
- the voltage- gated sodium channel protein is SCN2A.
- the subject has a disease or disorder associated with a voltage-gated sodium channel protein that is not SCN2A
- the subject has a disease or disorder associated with SCN1A.
- the disease or disorder is a Developmental or Epileptic Encephalopathy, such as Early Seizure Onset Epileptic Encephalopathy, Late Seizure Onset Epileptic or Encephalopathy, Benign Familial Neonatal-Infantile Seizures; in certain embodiments, the disease or disorder is an intellectual disability or an autism spectrum disorder; in certain embodiments, the disease or disorder is Dravet Syndrome.
- Developmental or Epileptic Encephalopathy such as Early Seizure Onset Epileptic Encephalopathy, Late Seizure Onset Epileptic or Encephalopathy, Benign Familial Neonatal-Infantile Seizures
- the disease or disorder is an intellectual disability or an autism spectrum disorder
- the disease or disorder is Dravet Syndrome.
- the symptom or hallmark is any of seizures, hypotonia, sensory issues, such as sensory integration disorders, motor dysfunctions, intellectual and cognitive dysfunctions, movement and balance dysfunctions, visual dysfunctions, delayed language and speech, gastrointestinal disorders (for example, gastroesophageal reflux, diarrhea, constipation, dysmotility, and the like), neurodevelopmental delays, sleep problems, sudden unexpected death in epilepsy, motor development delays, delayed social milestones, repetitive actions, uncoordinated oral movements.
- the seizures include focal, clonic, tonic, and generalized tonic and clonic seizures, prolonged seizures (often lasting longer than 10 minutes), and frequent seizures (for example, convulsive, myoclonic, absence, focal, obtundation status, and tonic seizures).
- an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing the detectable amount of SCN2A RNA in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% in the standard in vitro assay.
- an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing the detectable amount of SCN2A protein in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% in the standard in vitro assay.
- an oligomeric compound complementary to SCN2A RNA in vivo is capable of reducing the detectable amount of SCN2A RNA in vivo by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to the standard in vivo assay.
- an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing the detectable amount of SCN2A protein in vivo by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to the standard in vivo assay.
- an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing the detectable amount of SCN2A RNA in the CSF of a subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.
- an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing the detectable amount of SCN2A protein in the CSF of a subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.
- oligomeric compounds do not comprise a bicyclic sugar moiety.
- oligomeric compounds do not comprise more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties.
- oligomeric compounds comprise one or two wing segments that comprise a nucleoside that is not a bicyclic nucleoside.
- oligomeric compounds do not comprise a LNA sugar moiety. In certain embodiments, oligomeric compounds do not comprise more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In certain embodiments, oligomeric compounds comprise one or two wing segments that comprise a nucleoside that is not a LNA nucleoside.
- oligomeric compounds comprise or consist of an oligonucleotide comprising a portion that is complementary to a target nucleic acid, wherein the target nucleic acid is expressed in a pharmacologically relevant tissue.
- the pharmacologically relevant tissues are the cells and tissues that comprise the central nervous system. Such tissues include brain, including but not limited to the cortex and the hippocampus, and the spinal cord.
- compositions comprising one or more oligomeric compounds.
- the one or more oligomeric compounds each consists of a modified oligonucleotide.
- the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier.
- a pharmaceutical composition comprises or consists of a sterile saline solution and one or more oligomeric compound.
- the sterile saline is pharmaceutical grade saline.
- a pharmaceutical composition comprises or consists of one or more oligomeric compound and sterile water.
- the sterile water is pharmaceutical grade water.
- a pharmaceutical composition comprises or consists of one or more oligomeric compound and phosphate-buffered saline (PBS).
- PBS phosphate-buffered saline
- the sterile PBS is pharmaceutical grade PBS.
- a pharmaceutical composition comprises or consists of one or more oligomeric compound and artificial cerebrospinal fluid (“artificial CSF” or “aCSF”).
- the artificial cerebrospinal fluid is pharmaceutical grade.
- a pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid.
- a pharmaceutical composition consists of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, a pharmaceutical composition consists essentially of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade. In certain embodiments, pharmaceutical compositions comprise one or more oligomeric compound and one or more excipients. In certain embodiments, excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone.
- oligomeric compounds may be admixed with pharmaceutically acceptable active and/or inert substances for the preparation of pharmaceutical compositions or formulations.
- Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
- pharmaceutical compositions comprising an oligomeric compound encompass any pharmaceutically acceptable salts of the oligomeric compound, esters of the oligomeric compound, or salts of such esters.
- compositions comprising oligomeric compounds comprising one or more oligonucleotide, upon administration to a subject, including a human, are capable of providing (directly or indirectly) the biologically active metabolite or residue thereof.
- the disclosure is also drawn to pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.
- Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
- prodrugs comprise one or more conjugate group attached to an oligonucleotide, wherein the conjugate group is cleaved by endogenous nucleases within the body.
- Lipid moieties have been used in nucleic acid therapies in a variety of methods.
- the nucleic acid such as an oligomeric compound, is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids.
- DNA complexes with mono- or poly-cationic lipids are formed without the presence of a neutral lipid.
- a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue.
- a lipid moiety is selected to increase distribution of a pharmaceutical agent to fat tissue.
- a lipid moiety is selected to increase distribution of a pharmaceutical agent to muscle tissue.
- compositions comprise a delivery system.
- delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds.
- certain organic solvents such as dimethylsulfoxide are used.
- pharmaceutical compositions comprise one or more tissue- specific delivery molecules designed to deliver the one or more pharmaceutical agents comprising an oligomeric compound provided herein to specific tissues or cell types.
- pharmaceutical compositions include liposomes coated with a tissue-specific antibody.
- pharmaceutical compositions comprise a co-solvent system.
- co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase.
- co-solvent systems are used for hydrophobic compounds.
- a non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant Polysorbate 80TM and 65% w/v polyethylene glycol 300.
- the proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics.
- co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80TM; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.
- pharmaceutical compositions are prepared for oral administration.
- pharmaceutical compositions are prepared for buccal administration.
- a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), intraneural, perineural, etc.).
- a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer.
- aqueous solution such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer.
- other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives).
- injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like.
- Certain pharmaceutical compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers.
- Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
- Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.
- certain compounds disclosed herein act as acids. Although such compounds may be drawn or described in protonated (free acid) form, or ionized and in association with a cation (salt) form, aqueous solutions of such compounds exist in equilibrium among such forms. For example, a phosphate linkage of an oligonucleotide in aqueous solution exists in equilibrium among free acid, anion and salt forms. Unless otherwise indicated, compounds described herein are intended to include all such forms.
- oligonucleotides have several such linkages, each of which is in equilibrium. Thus, oligonucleotides in solution exist in an ensemble of forms at multiple positions all at equilibrium.
- the term “oligonucleotide” is intended to include all such forms.
- Drawn structures necessarily depict a single form. Nevertheless, unless otherwise indicated, such drawings are likewise intended to include corresponding forms.
- a structure depicting the free acid of a compound followed by the term “or salt thereof” expressly includes all such forms that may be fully or partially protonated/de-protonated/in association with a cation. In certain instances, one or more specific cation is identified.
- modified oligonucleotides or oligomeric compounds are in aqueous solution with sodium. In certain embodiments, modified oligonucleotides or oligomeric compounds are in aqueous solution with potassium. In certain embodiments, modified oligonucleotides or oligomeric compounds are in PBS. In certain embodiments, modified oligonucleotides or oligomeric compounds are in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and/or HCl to achieve a desired pH.
- a dose may be in the form of a dosage unit.
- a dose (or dosage unit) of a modified oligonucleotide or an oligomeric compound in milligrams indicates the mass of the free acid form of the modified oligonucleotide or oligomeric compound.
- the free acid is in equilibrium with anionic and salt forms.
- the modified oligonucleotide or oligomeric compound exists as a solvent-free, sodium-acetate free, anhydrous, free acid.
- a modified oligonucleotide or an oligomeric compound may be partially or fully de-protonated and in association with Na+ ions.
- the mass of the protons are nevertheless counted toward the weight of the dose, and the mass of the Na+ ions are not counted toward the weight of the dose.
- a dose, or dosage unit, of 10 mg of Compound No. 1348259 equals the number of fully protonated molecules that weighs 10 mg.
- an oligomeric compound comprises a conjugate group
- the mass of the conjugate group is included in calculating the dose of such oligomeric compound. If the conjugate group also has an acid, the conjugate group is likewise assumed to be fully protonated for the purpose of calculating dose. VII. Certain Compositions 1.
- Compound No.1348259 is characterized as a 5-10-5 MOE gapmer having a sequence (from 5’ to 3’) of GCATAATCCCATTATACAAA (SEQ ID NO: 2493), wherein each of nucleosides 1-5 and 16-20 (from 5’ to 3’) are 2’-MOE nucleosides and each of nucleosides 6-15 are 2’- ⁇ -D-deoxynucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 16 to 17, and 17 to 18 are phosphodiester internucleoside linkages, the internucleoside linkages between nucleosides 1 to 2, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-methyl
- G an adenine nucleobase
- mC a 5-methyl cyto
- the sodium salt of Compound No.1348259 is represented by the following chemical structure: Structure 2.
- the sodium salt of Compound No.1348259 is represented by the following chemical structure: Structure 2.
- Compound No.1348289 is characterized as a 6-10-4 MOE gapmer having a sequence (from 5’ to 3’) of CACGACATATTTTTCTACAC (SEQ ID NO: 2514), wherein each of nucleosides 1-6 and 17-20 (from 5’ to 3’) are 2’-MOE nucleosides and each of nucleosides 7-16 are 2’- ⁇ -D-deoxynucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, and 17 to 18 are phosphodiester internucleoside linkages, the internucleoside linkages between nucleosides 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-
- Compound No.1348289 is represented by the following chemical structure: Structure 3.
- the sodium salt of Compound No.1348289 is represented by the following chemical structure: Structure 4.
- the sodium salt of Compound No.1348289 is represented by the following chemical structure: Structure 4.
- Compound No.1348290 is characterized as a 6-10-4 MOE gapmer having a sequence (from 5’ to 3’) of CCACGACATATTTTTCTACA (SEQ ID NO: 2510), wherein each of nucleosides 1-6 and 17-20 (from 5’ to 3’) are 2’-MOE nucleosides and each of nucleosides 7-16 are 2’- ⁇ -D-deoxynucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, and 17 to 18 are phosphodiester internucleoside linkages, the internucleoside linkages between nucleosides 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-
- Compound No.1348290 is represented by the following chemical structure: Structure 5: Compound No.1348290
- the sodium salt of Compound No.1348290 is represented by the following chemical structure: Structure 6: The sodium salt of Compound No.1348290
- Compound No.1348331 is characterized as a 6-10-4 MOE gapmer having a sequence (from 5’ to 3’) of TCTGCATGTAACCTTTATAC (SEQ ID NO: 2487), wherein each of nucleosides 1-6 and 17-20 (from 5’ to 3’) are 2’-MOE nucleosides and each of nucleosides 7-16 are 2’- ⁇ -D-deoxynucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, and 17 to 18 are phosphodiester internucleoside linkages, the internucleoside linkages between nucleosides 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is a sequence (from 5’ to 3’) of TC
- Compound No.1348331 is represented by the following chemical structure: Structure 7: Compound No.1348331
- the sodium salt of Compound No.1348331 is represented by the following chemical structure: Structure 8: The sodium salt of Compound No.1348331
- Compound No.1348347 is characterized as a 6-10-4 MOE gapmer having a sequence (from 5’ to 3’) of GCATAATCCCATTATACAAA (SEQ ID NO: 2493), wherein each of nucleosides 1-6 and 17-20 (from 5’ to 3’) are 2’-MOE nucleosides and each of nucleosides 7-16 are 2’- ⁇ -D-deoxynucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, and 17 to 18 are phosphodiester internucleoside linkages, the internucleoside linkages between nucleosides 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-methyl
- Compound No.1348347 is represented by the following chemical structure: Structure 9: Compound No. 1348347
- the sodium salt of Compound No.1348347 is represented by the following chemical structure: Structure 10: The sodium salt of Compound No.1348347
- Compound No.1348937 is characterized as a 5-8-5 MOE gapmer having a sequence (from 5’ to 3’) of CTGCATGTAACCTTTATA (SEQ ID NO: 2534), wherein each of nucleosides 1-5 and 14-18 (from 5’ to 3’) are 2’-MOE nucleosides and each of nucleosides 6-13 are 2’- ⁇ -D-deoxynucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 14 to 15 and 15 to 16 are phosphodiester internucleoside linkages, the internucleoside linkages between nucleosides 1 to 2, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 16 to 17, and 17 to 18 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-methyl cytosine.
- Compound No.1348937 is represented by the following chemical structure: Structure 11: Compound No.1348937
- the sodium salt of Compound No.1348937 is represented by the following chemical structure: Structure 12: The sodium salt of Compound No.1348937 VIII.
- Certain Hotspot Regions nucleobases in the ranges specified below comprise a hotspot region of SCN2A nucleic acid.
- modified oligonucleotides that are complementary to an equal length portion within a hotspot region of SCN2A nucleic acid achieve an average of 69.9% or greater reduction of SCN2A RNA in vitro in the standard in vitro assay.
- modified oligonucleotides that are complementary to an equal length portion within a hotspot region of SCN2A nucleic acid achieve an average of 59% or greater reduction of SCN2A RNA in vivo in the standard in vivo assay.
- Nucleobases 2306-2367 of SEQ ID NO: 1 or 199863-199905 of SEQ ID NO: 2 In certain embodiments, nucleobases 2306-2367 of SEQ ID NO: 1 or 199863-199905 of SEQ ID NO: 2 comprise a hotspot region.
- modified oligonucleotides are complementary to an equal length portion within nucleobases 2306-2367 of SEQ ID NO: 1 or 199863-199905 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are 18 nucleobases in length. In certain embodiments, modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides. In certain embodiments, modified oligonucleotides are gapmers.
- the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers.
- the gapmers have the sugar motif in order from 5’ to 3’: eeeeeddddddddddddeeeee, eeeeeeddddddddddeeee, eeeedddddddddeeeee, eeeeddddddddeeeee, eeeeeddddddddeeeee, or eeeeeddddddddeeeee; wherein ‘d’ represents a 2’- ⁇ -D-deoxyribosyl sugar moiety, and ‘e’ represents a 2’-MOE sugar moiety.
- the gapmers comprise a 2’- substituted nucleoside in the gap.
- the 2’-substituted nucleoside comprises a 2’-OMe sugar moiety.
- the 2’-substituted nucleoside is at position 2 of the gap (5’ to 3’).
- modified oligonucleotides do not comprise a bicyclic sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties.
- modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a bicyclic nucleoside. In certain embodiments, modified oligonucleotides do not comprise a LNA sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a LNA nucleoside.
- the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.
- the phosphodiester (“o”) and phosphorothioate (“s”) internucleoside linkages are arranged in order from 5’ to 3’.
- the modified nucleotides have an internucleoside linkage motif of (from 5’ to 3’) of soooosssssssssooss, sooooossssssssoss, sooosssssssssoooss, soossssssssoooss, soooossssssssoss, or sooosssssssssooss wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
- nucleobase sequences of SEQ ID NOs: 336, 488, 2021, 2097, 2174, 2250, 2326, 2403, 2499, 2500, 2501, 2502, and 2526 are complementary to an equal length portion within nucleobases 2306-2367 of SEQ ID NO: 1 or 199863-199905 of SEQ ID NO: 2.
- nucleobase sequence of Compound IDs: 909979, 1248427, 1248428, 1248429, 1248430, 1248431, 1248432, 1248433, 1348279, 1348282, 1348286, 1348297, 1348328, 1348343, 1348358, 1348360, 1348361, 1348362, 1348364, 1348365, 1348366, 1348367, 1348378, and 1348380 are complementary to an equal length portion within nucleobases 2306-2367 of SEQ ID NO: 1 or 199863-199905 of SEQ ID NO: 2.
- modified oligonucleotides complementary to an equal length portion within nucleobases 2306-2367 of SEQ ID NO: 1 or 199863-199905 of SEQ ID NO: 2 achieve at least 53% reduction of SCN2A RNA in vitro in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 2306-2367 of SEQ ID NO: 1 or 199863-199905 of SEQ ID NO: 2 achieve an average of 69.9% reduction of SCN2A RNA in vitro in the standard in vitro assay.
- modified oligonucleotides complementary to an equal length portion within nucleobases 2306-2367 of SEQ ID NO: 1 or 199863-199905 of SEQ ID NO: 2 achieve an average of 77.1% reduction of SCN2A RNA in vivo in the standard in vivo assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 2306-2367 of SEQ ID NO: 1 or 199863-199905 of SEQ ID NO: 2 achieve an average of 63.2% reduction of SCN2A RNA in vivo in the standard in vivo assay. 2.
- nucleobases 3499-3557 of SEQ ID NO: 1 or 227493-227551 of SEQ ID NO: 2 comprise a hotspot region.
- modified oligonucleotides are complementary to an equal length portion within nucleobases 3499-3557 of SEQ ID NO: 1 or 227493-227551 of SEQ ID NO: 2.
- modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are 18 nucleobases in length.
- modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers.
- the gapmers have the sugar motif in order from 5’ to 3’: eeeeeddddddddddddeeeee, eeeeeeddddddddddeeee, eeeedddddddddeeeee, eeeeddddddddeeeee, eeeeeddddddddeeeee, or eeeeeddddddddeeeee; wherein ‘d’ represents a 2’- ⁇ -D-deoxyribosyl sugar moiety, and ‘e’ represents a 2’-MOE sugar moiety.
- the gapmers comprise a 2’- substituted nucleoside in the gap.
- the 2’-substituted nucleoside comprises a 2’-OMe sugar moiety.
- the 2’-substituted nucleoside is at position 2 of the gap (5’ to 3’).
- modified oligonucleotides do not comprise a bicyclic sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties.
- modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a bicyclic nucleoside. In certain embodiments, modified oligonucleotides do not comprise a LNA sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a LNA nucleoside.
- the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.
- the phosphodiester (“o”) and phosphorothioate (“s”) internucleoside linkages are arranged in order from 5’ to 3’.
- the modified nucleotides have an internucleoside linkage motif of (from 5’ to 3’) of soooosssssssssooss, sooooossssssssoss, sooosssssssssoooss, soossssssssoooss, soooossssssssoss, or sooosssssssssooss wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
- nucleobase sequences of SEQ ID NOs: 181, 259, 643, 720, 796, 2504, 2505, 2506, 2507, 2508, 2509, 2510, 2511, 2512, 2513, 2514, and 2521 are complementary to an equal length portion within nucleobases 3499-3557 of SEQ ID NO: 1 or 227493-227551 of SEQ ID NO: 2.
- nucleobase sequence of Compound IDs: 909989, 909990, 1248487, 1248488, 1248489, 1348289, 1348290, 1348291, 1348292, 1348295, 1348298, 1348302, 1348303, 1348304, 1348306, 1348307, 1348369, 1348370, 1348371, 1348373, 1348374, 1348375, 1348376, 1348377, 1348381, 1348382, 1348383, 1348384, 1348385, 1348386, 1348387, 1348405, 1348411, 1348423, 1348439, 1348440, 1348441, 1348442, 1348443, 1348444, 1348446, 1348447, and 1348456 are complementary to an equal length portion within nucleobases 3499-3557 of SEQ ID NO: 1 or 227493-227551 of SEQ ID NO
- modified oligonucleotides complementary to an equal length portion within nucleobases 3499-3557 of SEQ ID NO: 1 or 227493-227551 of SEQ ID NO: 2 achieve at least 75% reduction of SCN2A RNA in vitro in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 3499-3557 of SEQ ID NO: 1 or 227493-227551 of SEQ ID NO: 2 achieve an average of 81.6% reduction of SCN2A RNA in vitro in the standard in vitro assay.
- modified oligonucleotides complementary to an equal length portion within nucleobases 3499-3557 of SEQ ID NO: 1 or 227493-227551 of SEQ ID NO: 2 achieve an average of 76.6% reduction of SCN2A RNA in vivo in the standard in vivo assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 3499-3557 of SEQ ID NO: 1 or 227493-227551 of SEQ ID NO: 2 achieve an average of 67.2% reduction of SCN2A RNA in vivo in the standard in vivo assay. 3.
- nucleobases 243124-243204 of SEQ ID NO: 2 comprise a hotspot region.
- modified oligonucleotides are complementary to an equal length portion within nucleobases 243124-243204 of SEQ ID NO: 2.
- modified oligonucleotides are 20 nucleobases in length.
- modified oligonucleotides are 18 nucleobases in length.
- modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length.
- modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides.
- modified oligonucleotides are gapmers.
- the gapmers are 5-10-5 MOE gapmers.
- the gapmers are 6-10-4 MOE gapmers.
- the gapmers are 4-10-6 MOE gapmers.
- the gapmers are 4-8-6 MOE gapmers.
- the gapmers are 6-8-4 MOE gapmers.
- the gapmers are 5-8-5 MOE gapmers.
- the gapmers have the sugar motif in order from 5’ to 3’: eeeeeddddddddddddeeeee, eeeeeeddddddddddeeee, eeeedddddddddeeeee, eeeeddddddddeeeee, eeeeeddddddddeeeee, or eeeeeddddddddeeeee; wherein ‘d’ represents a 2’- ⁇ -D-deoxyribosyl sugar moiety, and ‘e’ represents a 2’-MOE sugar moiety.
- the gapmers comprise a 2’- substituted nucleoside in the gap.
- the 2’-substituted nucleoside comprises a 2’-OMe sugar moiety.
- the 2’-substituted nucleoside is at position 2 of the gap (5’ to 3’).
- modified oligonucleotides do not comprise a bicyclic sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties.
- modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a bicyclic nucleoside. In certain embodiments, modified oligonucleotides do not comprise a LNA sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a LNA nucleoside.
- the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.
- the phosphodiester (“o”) and phosphorothioate (“s”) internucleoside linkages are arranged in order from 5’ to 3’.
- the modified nucleotides have an internucleoside linkage motif of (from 5’ to 3’) of soooosssssssssooss, sooooossssssssoss, sooosssssssssoooss, soossssssssoooss, soooossssssssoss, or sooosssssssssooss wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
- nucleobase sequences of SEQ ID NOs: 491, 567, 644, 721, 797, 2177, 2253, 2315, 2329, 2406, and 2527 are complementary to an equal length portion within nucleobases 243124-243204 of SEQ ID NO: 2.
- the nucleobase sequence of Compound IDs: 1248507, 1248508, 1248509, 1248510, 1248511, 1248512, 1248513, 1248514, 1248515, 1250138, 1348299, 1348379, 1348388, and 1348397 are complementary to an equal length portion within nucleobases 243124-243204 of SEQ ID NO: 2.
- modified oligonucleotides complementary to an equal length portion within nucleobases 243124-243204 of SEQ ID NO: 2 achieve at least 51% reduction of SCN2A RNA in vitro in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 243124- 243204 of SEQ ID NO: 2 achieve an average of 71.4% reduction of SCN2A RNA in vitro in the standard in vitro assay.
- modified oligonucleotides complementary to an equal length portion within nucleobases 243124-243204 of SEQ ID NO: 2 achieve an average of 61.3% reduction of SCN2A RNA in vivo in the standard in vivo assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 243124-243204 of SEQ ID NO: 2 achieve an average of 61.5% reduction of SCN2A RNA in vivo in the standard in vivo assay. 4. Nucleobases 243917-244073 of SEQ ID NO: 2 In certain embodiments, nucleobases 243917-244073 of SEQ ID NO: 2 comprise a hotspot region.
- modified oligonucleotides are complementary to an equal length portion within nucleobases 243917-244073 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are 18 nucleobases in length. In certain embodiments, modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers.
- the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers.
- the gapmers have the sugar motif in order from 5’ to 3’: eeeeeddddddddddddeeeee, eeeeeeddddddddddeeee, eeeedddddddddeeeee, eeeeddddddddeeeee, eeeeeddddddddeeeee, or eeeeeddddddddeeeee; wherein ‘d’ represents a 2’- ⁇ -D-deoxyribosyl sugar moiety, and ‘e’ represents a 2’-MOE sugar moiety.
- the gapmers comprise a 2’- substituted nucleoside in the gap.
- the 2’-substituted nucleoside comprises a 2’-OMe sugar moiety.
- the 2’-substituted nucleoside is at position 2 of the gap (5’ to 3’).
- modified oligonucleotides do not comprise a bicyclic sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties.
- modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a bicyclic nucleoside. In certain embodiments, modified oligonucleotides do not comprise a LNA sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a LNA nucleoside.
- the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.
- the phosphodiester (“o”) and phosphorothioate (“s”) internucleoside linkages are arranged in order from 5’ to 3’.
- the modified nucleotides have an internucleoside linkage motif of (from 5’ to 3’) of soooosssssssssooss, sooooossssssssoss, sooosssssssssoooss, soossssssssoooss, soooossssssssoss, or sooosssssssssooss wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
- nucleobase sequences of SEQ ID Nos: 1090, 1166, 2484, 2485, 2487, 2493, 2496, 2497, 2498, 2533, 2534, 2535, and 2537 are complementary to an equal length portion within nucleobases 243917-244073 of SEQ ID NO: 2.
- nucleobase sequence of Compound IDs: 1250148, 1250149, 1348250, 1348251, 1348253, 1348259, 1348265, 1348266, 1348267, 1348331, 1348332, 1348333, 1348338, 1348342, 1348344, 1348345, 1348347, 1348419, 1348420, 1348421, 1348427, 1348428, 1348435, 1348436, 1348437, 1348920, 1348922, 1348923, 1348925, 1348927, 1348928, 1348929, 1348931, 1348934, 1348935, 1348937, and 1348938 are complementary to an equal length portion within nucleobases 243917-244073 of SEQ ID NO: 2.
- modified oligonucleotides complementary to an equal length portion within nucleobases 243917-244073 of SEQ ID NO: 2 achieve at least 80% reduction of SCN2A RNA in vitro in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 243917- 244073 of SEQ ID NO: 2 achieve an average of 80.5% reduction of SCN2A RNA in vitro in the standard in vitro assay.
- modified oligonucleotides complementary to an equal length portion within nucleobases 243917-244073 of SEQ ID NO: 2 achieve an average of 67.7% reduction of SCN2A RNA in vivo in the standard in vivo assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 243917-244073 of SEQ ID NO: 2 achieve an average of 62.1% reduction of SCN2A RNA in vivo in the standard in vivo assay. 5.
- nucleobases 4389-4487 of SEQ ID NO: 1 or 247823-247921 of SEQ ID NO: 2 comprise a hotspot region.
- modified oligonucleotides are complementary to an equal length portion within nucleobases 4389-4487 of SEQ ID NO: 1 or 247823-247921 of SEQ ID NO: 2.
- modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are 18 nucleobases in length.
- modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers.
- the gapmers have the sugar motif in order from 5’ to 3’: eeeeeddddddddddddeeeee, eeeeeeddddddddddeeee, eeeedddddddddeeeee, eeeeddddddddeeeee, eeeeeddddddddeeeee, or eeeeeddddddddeeeee; wherein ‘d’ represents a 2’- ⁇ -D-deoxyribosyl sugar moiety, and ‘e’ represents a 2’-MOE sugar moiety.
- the gapmers comprise a 2’- substituted nucleoside in the gap.
- the 2’-substituted nucleoside comprises a 2’-OMe sugar moiety.
- the 2’-substituted nucleoside is at position 2 of the gap (5’ to 3’).
- modified oligonucleotides do not comprise a bicyclic sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties.
- modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a bicyclic nucleoside. In certain embodiments, modified oligonucleotides do not comprise a LNA sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a LNA nucleoside.
- the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.
- the phosphodiester (“o”) and phosphorothioate (“s”) internucleoside linkages are arranged in order from 5’ to 3’.
- the modified nucleotides have an internucleoside linkage motif of (from 5’ to 3’) of soooosssssssssooss, sooooossssssssoss, sooosssssssssoooss, soossssssssoooss, soooossssssssoss, or sooosssssssssooss wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
- nucleobase sequences of SEQ ID NOs: 29, 30, 107, 108, 185, 186, 263, 264, 341, 342, 419, 420, 1796, 1871, 1948, 2025, 2101, 2178, 2254, 2330, 2503, 2517, and 2522 are complementary to an equal length portion within nucleobases 4389-4487 of SEQ ID NO: 1 or 247823-247921 of SEQ ID NO: 2.
- nucleobase sequence of Compound IDs: 910009, 910010, 910011, 910012, 910013, 910014, 910015, 910016, 910017, 910018, 910019, 910020, 1248528, 1248529, 1248530, 1248531, 1248532, 1248533, 1248534, 1248535, 1348269, 1348270, 1348271, 1348275, 1348277, 1348348, 1348353, 1348355, 1348356, 1348396, and 1348450 are complementary to an equal length portion within nucleobases 4389-4487 of SEQ ID NO: 1 or 247823-247921 of SEQ ID NO: 2.
- modified oligonucleotides complementary to an equal length portion within nucleobases 4389-4487 of SEQ ID NO: 1 or 247823-247921 of SEQ ID NO: 2 achieve at least 27% reduction of SCN2A RNA in vitro in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 4389-4487 of SEQ ID NO: 1 or 247823-247921 of SEQ ID NO: 2 achieve an average of 71.1% reduction of SCN2A RNA in vitro in the standard in vitro assay.
- modified oligonucleotides complementary to an equal length portion within nucleobases 4389-4487 of SEQ ID NO: 1 or 247823-247921 of SEQ ID NO: 2 achieve an average of 63.4% reduction of SCN2A RNA in vivo in the standard in vivo assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 4389-4487 of SEQ ID NO: 1 or 247823-247921 of SEQ ID NO: 2 achieve an average of 59.1% reduction of SCN2A RNA in vivo in the standard in vivo assay. 6.
- nucleobases 4774-4809 of SEQ ID NO: 1 or 254142-254177 of SEQ ID NO: 2 In certain embodiments, nucleobases 4774-4809 of SEQ ID NO: 1 or 254142-254177 of SEQ ID NO: 2 comprise a hotspot region.
- modified oligonucleotides are complementary to an equal length portion within nucleobases 4774-4809 of SEQ ID NO: 1 or 254142-254177 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are 18 nucleobases in length.
- modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers.
- the gapmers have the sugar motif in order from 5’ to 3’: eeeeeddddddddddddeeeee, eeeeeeddddddddddeeee, eeeedddddddddeeeee, eeeeddddddddeeeee, eeeeeddddddddeeeee, or eeeeeddddddddeeeee; wherein ‘d’ represents a 2’- ⁇ -D-deoxyribosyl sugar moiety, and ‘e’ represents a 2’-MOE sugar moiety.
- the gapmers comprise a 2’- substituted nucleoside in the gap.
- the 2’-substituted nucleoside comprises a 2’-OMe sugar moiety.
- the 2’-substituted nucleoside is at position 2 of the gap (5’ to 3’).
- modified oligonucleotides do not comprise a bicyclic sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties.
- modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a bicyclic nucleoside. In certain embodiments, modified oligonucleotides do not comprise a LNA sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a LNA nucleoside.
- the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.
- the phosphodiester (“o”) and phosphorothioate (“s”) internucleoside linkages are arranged in order from 5’ to 3’.
- the modified nucleotides have an internucleoside linkage motif of (from 5’ to 3’) of soooosssssssssooss, sooooossssssssoss, sooosssssssssoooss, soossssssssoooss, soooossssssssoss, or sooosssssssssooss wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
- nucleobase sequences of SEQ ID NOs: 1016, 1093, 1104, 1169, 1246, 1323, 1400, 1477, 1554, 1708, 1785, 1860, 1937, 2014, 1631, 2090, and 2539 are complementary to an equal length portion within nucleobases 4774-4809 of SEQ ID NO: 1 or 254142- 254177 of SEQ ID NO: 2.
- nucleobase sequence of Compound IDs: 1248544, 1250225, 1250226, 1250227, 1250228, 1250229, 1250230, 1250231, 1250232, 1250233, 1250234, 1250235, 1250236, 1250237, 1250238, 1250239, 1348936, and 1348939 are complementary to an equal length portion within nucleobases 4774-4809 of SEQ ID NO: 1 or 254142-254177 of SEQ ID NO: 2.
- modified oligonucleotides complementary to an equal length portion within nucleobases 4774-4809 of SEQ ID NO: 1 or 254142-254177 of SEQ ID NO: 2 achieve at least 51% reduction of SCN2A RNA in vitro in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 4774-4809 of SEQ ID NO: 1 or 254142-254177 of SEQ ID NO: 2 achieve an average of 89% reduction of SCN2A RNA in vitro in the standard in vitro assay.
- modified oligonucleotides complementary to an equal length portion within nucleobases 4774-4809 of SEQ ID NO: 1 or 254142-254177 of SEQ ID NO: 2 achieve an average of 74.8% reduction of SCN2A RNA in vivo in the standard in vivo assay.
- modified oligonucleotides complementary to an equal length portion within nucleobases 4774-4809 of SEQ ID NO: 1 or 254142-254177 of SEQ ID NO: 2 achieve an average of 67.8% reduction of SCN2A RNA in vivo in the standard in vivo assay. 7. Additional Hotspot Regions
- the ranges described in the table below comprise hotspot regions.
- modified oligonucleotides are complementary to an equal length portion within any of the hotspot regions 1-17, as defined in the table below.
- modified oligonucleotides are 20 nucleobases in length.
- modified oligonucleotides are 18 nucleobases in length.
- modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length.
- modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides.
- modified oligonucleotides are gapmers.
- the gapmers are 5-10-5 MOE gapmers.
- the gapmers are 6-10-4 MOE gapmers.
- the gapmers are 4-10-6 MOE gapmers.
- the gapmers are 4-8-6 MOE gapmers.
- the gapmers are 6-8-4 MOE gapmers.
- the gapmers are 5-8-5 MOE gapmers.
- the gapmers have the sugar motif in order from 5’ to 3’: eeeeeddddddddddddeeeee, eeeeeeddddddddddeeee, eeeedddddddddeeeee, eeeeddddddddeeeee, eeeeeddddddddeeeee, or eeeeeddddddddeeeee; wherein ‘d’ represents a 2’- ⁇ -D-deoxyribosyl sugar moiety, and ‘e’ represents a 2’-MOE sugar moiety.
- the gapmers comprise a 2’- substituted nucleoside in the gap.
- the 2’-substituted nucleoside comprises a 2’-OMe sugar moiety.
- the 2’-substituted nucleoside is at position 2 of the gap (5’ to 3’).
- modified oligonucleotides do not comprise a bicyclic sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine bicyclic sugar moieties.
- modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a bicyclic nucleoside. In certain embodiments, modified oligonucleotides do not comprise a LNA sugar moiety. In certain embodiments, modified oligonucleotides do not comprise more than one, two, three, four, five, six, seven, eight, or nine LNA sugar moieties. In certain embodiments, modified oligonucleotides comprise one or two wing segments that comprise a nucleoside that is not a LNA nucleoside.
- the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.
- the phosphodiester (“o”) and phosphorothioate (“s”) internucleoside linkages are arranged in order from 5’ to 3’.
- the modified nucleotides have an internucleoside linkage motif of (from 5’ to 3’) of soooosssssssssooss, sooooossssssssoss, sooosssssssssoooss, soossssssssoooss, soooossssssssoss, or sooosssssssssooss wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
- nucleobase sequences of compounds listed in the “Compound IDs in range” column in the table below are complementary to SEQ ID NO: 2 within the specified hotspot region.
- the nucleobase sequences of the oligonucleotides listed in the “SEQ ID NOs in range” column in the table below are complementary to the target sequence, SEQ ID NO: 2, within the specified hotspot region.
- modified oligonucleotides complementary to nucleobases within the hotspot region achieve at least “Min.% Red. in vitro” (minimum % reduction, relative to untreated control cells) of SCN2A RNA in vitro in the standard in vitro assay, as indicated in the table below.
- modified oligonucleotides complementary to nucleobases within the hotspot region achieve an average of “Avg.% Red. in vitro” (average % reduction, relative to untreated control cells) of SCN2A RNA in vitro in the standard in vitro assay, as indicated in the table below. In certain embodiments, modified oligonucleotides complementary to nucleobases within the hotspot region achieve a maximum of “Max. % Red. in vitro” (maximum % reduction, relative to untreated control cells) of SCN2A RNA in vitro in the standard in vitro assay, as indicated in the table below.
- modified oligonucleotides complementary to nucleobases within the hotspot region achieve an average of “Avg. % Red. in vivo Cortex” (average % reduction, relative to PBS-treated animals) of SCN2A RNA in vivo in the standard in vivo assay in cortical tissue, as indicated in the table below.
- modified oligonucleotides complementary to nucleobases within the hotspot region achieve an average of “Avg. % Red. in vivo Spinal” (average % reduction, relative to PBS-treated animals) of SCN2A RNA in vivo in the standard in vivo assay in spinal cord tissue, as indicated in the table below.
- “n.d.” indicates that no in vivo data is available for compounds within that range. In other cases, average reduction in vivo includes a subset of the compounds in any given hotspot, as not all compounds were tested in vivo.
- Comparator Compound No.1506060 was selected as a comparator compound.
- Comparator Compound No.1506060 previously described in WO2020/041348, incorporated herein by reference, is a 4-8-4 LNA gapmer with the sequence (from 5’ to 3’) TGGGTCTCTTAGCTTT (SEQ ID NO: 2540), wherein the central gap segment consists of eight 2’- ⁇ -D-deoxynucleosides, the 5’ and 3’ wing segments each consist of four LNA modified nucleosides, and each internucleoside linkage is a phosphorothioate internucleoside linkage.
- compounds described herein are more tolerable relative to Comparator Compound No.1506060.
- Comparator Compound No.1506060 had a 3-hour FOB of 6.00 in mice, whereas Compound Nos.1348290, 1348331, and 1348347 each had a 3-hour FOB of 0.00 in mice, and Compound Nos.1348259, 1348289, and 1348937 each had a 3-hour FOB of 0 or 1.00 in mice. Therefore, certain compounds described herein are more tolerable than Comparator Compound No.1506060 in this assay.
- an oligonucleotide comprising a nucleoside comprising a 2’-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (2’-OH in place of one 2’-H of DNA) or as an RNA having a modified base (thymine (methylated uracil) in place of a uracil of RNA).
- nucleic acid sequences provided herein, including, but not limited to those in the sequence listing are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases.
- an oligomeric compound having the nucleobase sequence “ATCGATCG” encompasses any oligomeric compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence “AUCGAUCG” and those having some DNA bases and some RNA bases such as “AUCGATCG” and oligomeric compounds having other modified nucleobases, such as “AT m CGAUCG,” wherein m C indicates a cytosine base comprising a methyl group at the 5-position.
- Certain compounds described herein e.g., modified oligonucleotides have one or more asymmetric center and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), as ⁇ or ⁇ such as for sugar anomers, or as (D) or (L), such as for amino acids, etc.
- Compounds provided herein that are drawn or described as having certain stereoisomeric configurations include only the indicated compounds.
- Compounds provided herein that are drawn or described with undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms, unless specified otherwise.
- Oligomeric compounds described herein include chirally pure or enriched mixtures as well as racemic mixtures.
- Oligomeric compounds having a plurality of phosphorothioate internucleoside linkages include such compounds in which chirality of the phosphorothioate internucleoside linkages is controlled or is random.
- compounds described herein are intended to include corresponding salt forms.
- the compounds described herein include variations in which one or more atoms are replaced with a non-radioactive isotope or radioactive isotope of the indicated element.
- compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the 1 H hydrogen atoms.
- Isotopic substitutions encompassed by the compounds herein include but are not limited to: 2 H or 3 H in place of 1 H, 13 C or 14 C in place of 12 C, 15 N in place of 14 N, 17 O or 18 O in place of 16 O, and 33 S, 34 S, 35 S, or 36 S in place of 32 S.
- non-radioactive isotopic substitutions may impart new properties on the oligomeric compound that are beneficial for use as a therapeutic or research tool.
- radioactive isotopic substitutions may make the compound suitable for research or diagnostic purposes such as imaging.
- the SCN2A-related disorder is early-onset developmental or epileptic encephalopathy (DEE) and the method comprises administering a therapeutically effective amount of a oligomeric compound, as described herein, to a subject in need thereof, wherein the oligomeric compound is administered intrathecally to the subject at a dosage of about 1 mg to about 100 mg.
- DEE early-onset developmental or epileptic encephalopathy
- the methods disclosed herein may be used to ameliorate one or more symptoms of early-onset DEE, including, for example, seizures, limitations in communication, such as delayed language and speech; autonomic dysfunction; developmental delay; gastrointestinal abnormalities; movement disorders, such as choreoathetosis, dystonia, ataxia; anxiety; sensory issues; urinary retention problems; irritability; sleep problems (e.g., inability to fall asleep and inability to stay asleep); and behavior issues. Seizures include focal, clonic, tonic, and generalized tonic and clonic seizures, prolonged seizures (often lasting longer than 10 minutes), and frequent seizures.
- the method comprises a dose escalation phase (or a titration phase) and a maintenance phase.
- the dose escalation phase is used to to determine a maximum dose for the subejct and the maintenace phase is used to administer the maximum dose to the subject on an ongoing basis.
- the method does not include a dose escalation phase and a selected dose (also referred to herein as a maintenance dose) is administered to the subject on an ongoing basis.
- the dosage of the oligomeric compound is about 1 mg to about 50 mg. In certain embodiments, the dosage of the oligomeric compound is about 1 mg to about 25 mg. In certain embodiments, the dosage of the oligomeric compound is about 1 mg to about 15 mg. In certain embodiments, the dosage of the oligomeric compound is about 1 mg to about 10 mg.
- the dosage of the oligomeric compound is about 5 mg to about 50 mg. In certain embodiments, the dosage of the oligomeric compound is about 5 mg to about 40 mg. In certain embodiments, the dosage of the oligomeric compound is about 5 mg to about 30 mg. In certain embodiments, the dosage of the oligomeric compound is about 5 mg to about 25 mg. In certain embodiments, the dosage of the oligomeric compound is about 5 mg to about 20 mg. In certain embodiments, the dosage of the oligomeric compound is about 5 mg to about 15 mg. In certain embodiments, the dosage of the oligomeric compound is about 5 mg to about 10 mg. In certain embodiments, the dosage of the oligomeric compound is about 10 mg to about 50 mg.
- the dosage of the oligomeric compound is about 10 mg to about 25 mg. In certain embodiments, the dosage of the oligomeric compound is about 15 mg to about 50 mg. In certain embodiments, the dosage of the oligomeric compound is about 15 mg to about 35 mg. In certain embodiments, the dosage of the oligomeric compound is about 15 mg to about 25 mg. In certain embodiments, the dosage of the oligomeric compound is at least 0.25 mg. In certain embodiments, the dosage of the oligomeric compound is at least 0.5 mg. In certain embodiments, the dosage of the oligomeric compound is at least 0.75 mg. In certain embodiments, the dosage of the oligomeric compound is at least 1 mg.
- the dosage of the oligomeric compound administered to a subject is at least 0.25 mg, at least 0.5 mg, at least 0.75 mg, at least 1 mg, at least 1.5 mg, at least 2 mg, at least 2.5 mg, at least 3 mg, at least 4 mg, at least 5 mg, at least 6 mg, at least 7 mg, at least 8 mg, at least 9 mg, at least 10 mg, at least 11 mg, at least 12 mg, at least 13 mg, at least 14 mg, at least 15 mg, at least 16 mg, at least 17 mg, at least 18 mg, at least 19 mg, or at least 20 mg.
- the dosage of the oligomeric compound is at least 0.251 mg and no more than 50, 45, 40, 35, 30, 25, or 20, 15, 10, 5, 2.5, or 1 mg. In various embodiments, the dosage of the oligomeric compound is at least 0.25 mg, at least 0.5 mg, at least 0.75 mg, at least 1 mg, at least 1.5 mg, at least 2 mg, at least 2.5 mg, at least 3 mg, at least 4 mg, at least 5 mg, at least 6 mg, at least 7 mg, at least 8 mg, at least 9 mg, at least 10 mg, at least 11 mg, at least 12 mg, at least 13 mg, at least 14 mg, at least 15 mg, at least 16 mg, at least 17 mg, at least 18 mg, or at least 19 mg, and no more than 50, 45, 40, 35, 30, 25, or 20 mg.
- the dosage of the oligomeric compound is at least 20 mg and no more than 50, 45, 40, 35, 30, or 25 mg. In certain embodiments, the dosage of the oligomeric compound is at least 0.25 mg and no more than 2.0 mg or no more than 1 mg. In certain embodiments, the dosage of the oligomeric compound is at least 5 mg, at least 10 mg, at least 15 mg, at least 20 mg, at least 25 mg, at least 30 mg, at least 35 mg, at least 40 mg, at least 45 mg, at least 50 mg, at least 55 mg, at least 60 mg, at least 65 mg, at least 70 mg, at least 75 mg, at least 80 mg, at least 85 mg, at least 90 mg, at least 95 mg, or at least 100 mg.
- the dosage of the oligomeric compound is at least 5 mg, at least 10 mg, at least 15 mg, or at least 20 mg and no more than 50, 45, 40, 35, 30 mg, or 25 mg. In various embodiments, the dosage of the oligomeric compound is at least 25 mg or 30 mg and no more than 60, 55, 50, 45, 40, or 35 mg. In various embodiments, the dosage of the oligomeric compound is at least 35 mg or at least 40 mg and no more than 70, 65, 60, 55, 50, or 45 mg. In various embodiments, the dosage of the oligomeric compound is at least 45 mg or at least 50 mg and no more than 80, 75, 70, 65, 60, or 55 mg.
- the dosage of the oligomeric compound is at least 55 mg or at least 60 mg and no more than 90, 85, 80, 75, 70, or 65 mg. In various embodiments, the dosage of the oligomeric compound is at least 65 mg or at least 70 mg and no more than 100, 95, 90, 85, 80, or 75 mg. In various embodiments, the dosage of the oligomeric compound is at least 75 mg or at least 80 mg and no more than 110, 105, 100, 95, 90, or 85 mg. In various embodiments, the dosage of the oligomeric compound is at least 85 mg or at least 90 mg and no more than 120, 115, 110, 105, 100, or 95 mg.
- the dosage of the oligomeric compound is at least 95 mg or at least 100 mg and no more than 130, 125, 120, 115, 110, or 100 mg. In certain embodiments, the dosage of the oligomeric compound is at least 0.1 mg/kg.
- the dosage of the oligomeric compound administered to a subject is at least 0.2 mg/kg, at least 0.3 mg/kg, at least 0.4 mg/kg, at least 0.5 mg/kg, at least 0.6 mg/kg, at least 0.7 mg/kg, at least 0.8 mg/kg, at least 0.9 mg/kg, at least 1.0 mg/kg, at least 1.1 mg/kg, at least 1.2 mg/kg, at least 1.3 mg/kg, at least 1.4 mg/kg, at least 1.5 mg/kg, at least 1.6 mg/kg, at least 1.7 mg/kg, at least 1.8 mg/kg, at least 1.9 mg/kg, or at least 2.0 mg/kg.
- the dosage of the oligomeric compound is at least 0.1 mg/kg and no more than 10 mg/kg, no more than 5 mg/kg, no more than 2.0 mg/kg, or no more than 1.0 mg/kg.
- the dosage of the oligomeric compound administered to a subject is at least 5 mg/kg, at least 10 mg/kg, at least 15 mg/kg, at least 20 mg/kg, at least 25 mg/kg, at least 30 mg/kg, at least 35 mg/kg, at least 40 mg/kg, at least 45 mg/kg, at least 50 mg/kg, at least 55 mg/kg, at least 60 mg/kg, at least 65 mg/kg, at least 70 mg/kg, at least 75 mg/kg, at least 80 mg/kg, at least 85 mg/kg, at least 90 mg/kg, at least 95 mg/kg, or at least 100 mg/kg.
- the dosage of the oligomeric compound is at least 5 mg/kg or at least 10 mg/kg and no more than 20 mg/kg or 15 mg/kg. In certain embodiments, the dosage of the oligomeric compound is at least 15 mg/kg or at least 20 mg/kg and no more than 30 mg/kg or 25 mg/kg. In certain embodiments, the dosage of the oligomeric compound is at least 25 mg/kg or at least 30 mg/kg and no more than 40 mg/kg or 35 mg/kg. In certain embodiments, the dosage of the oligomeric compound is at least 35 mg/kg or at least 40 mg/kg and no more than 50 mg/kg or 45 mg/kg.
- the dosage of the oligomeric compound is at least 45 mg/kg or at least 50 mg/kg and no more than 60 mg/kg or 55 mg/kg. In certain embodiments, the dosage of the oligomeric compound is at least 55 mg/kg or at least 60 mg/kg and no more than 70 mg/kg or 65 mg/kg. In certain embodiments, the dosage of the oligomeric compound is at least 65 mg/kg or at least 70 mg/kg and no more than 80 mg/kg or 75 mg/kg. In certain embodiments, the dosage of the oligomeric compound is at least 75 mg/kg or at least 80 mg/kg and and no more than 90 mg/kg or 85 mg/kg.
- the dosage of the oligomeric compound is at least 85 mg/kg or at least 90 mg/kg and no more than 100 mg/kg or 95 mg/kg. In certain embodiments, the dosage of the oligomeric compound is at least 95 mg/kg or at least 100 mg/kg and no more than 150 mg/kg or 125 mg/kg. In one aspect, the dosage of the oligomeric compound is titrated one or more times. In certain embodiments, the dosage is increased 1.25-fold to 5-fold between each titrated dose. In certain embodiments, the dosage is increased 1.25-fold to 2-fold, 1.5-fold to 3-fold, 1.5-fold to 2.5-fold, or 1.5-fold to 2-fold between each titrated dose.
- the dosage is increased 1.25-fold to 1.75-fold between each titrated dose. In certain embodiments, the dosage is increased 2-fold, up to 8 mg, followed by no more than a 1.5-fold increase for all subsequent doses. In certain embodiments, during the dose escalation phase, the dosage of the oligomeric compound is titrated from an initial dose of about 1 mg to a maximum dose of at least about 2 mg, about 4 mg, about 8 mg, about 10 mg, about 12 mg, about 15 mg, about 18 mg, about 20 mg, about 15 mg, about 25 mg, about 30 mg, about 32 mg, about 35 mg, about 40 mg, about 50 about mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 100 mg, or more.
- the dosage of the oligomeric compound is titrated from an initial dose of about 1 mg, about 2 mg, about 3 mg, about 4 mg, about 5 mg, about 6 mg, about 7 mg, about 8 mg, about 9 mg, about, 10 mg, about 11 mg, about 12 mg, about 13 mg, about 14 mg, or about 15 mg to a maximum dose of at least about 20 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 50 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 95 mg, about 100 mg, or more.
- the maximum dose is about 4-100 mg, about 4-50 mg, about 4-25 mg, about 4-15 mg, about 8-100 mg, about 8-75 mg, about 8-50 mg, about 8-25 mg, or about 8-15 mg. In certain embodiments, the maximum dose is about 15-100 mg, about 15-75 mg, about 15-50 mg, about 15-40 mg, about 15-30 mg, about 15-25 mg. In certain embodiments, during the dose escalation phase, the dosage of the oligomeric compound is titrated from an initial dose of about 1 mg to a maximum dose of at least about 15 mg. In certain embodiments, during the dose escalation phase, the dosage of the oligomeric compound is titrated from an initial dose of about 1 mg to a maximum dose of about 32 mg.
- the dosage of the oligomeric compound is titrated from an initial dose of about 1 mg to a maximum dose of about 32-64 mg. In certain embodiments, the dosage of the oligomeric compound is titrated from an initial dose of about 1 mg to a maximum dose of at least 64 mg.
- the dosage of the oligomeric compound is titrated from an initial dose of about 1 mg to a cumulative dose of at least about 20 mg, about 30 mg, about 40 mg, about 50 mg, about 60 mg, about 70 mg, about 80 mg, about 90 mg, about 100 mg, about 110 mg, about 120 mg, about 130 mg, about 140 mg, about 150 mg, about 160 mg, about 170 mg, about 180 mg, about 190 mg, about 200 mg, or more.
- the dosage of the oligomeric compound is titrated from an initial dose of about 1 mg, about 2 mg, about 3 mg, about 4 mg, about 5 mg, about 6 mg, about 7 mg, about 8 mg, about 9 mg, about 10 mg, about 11 mg, about 12 mg, about 13 mg, about 14 mg, about 15 mg, about 16 mg, about 17 mg, about 18 mg, about 19 mg, about 20 mg, about 25 mg, or about 30 mg to a cumulative dose of at least about 50 mg, about 60 mg, about 70 mg, about 80 mg, about 90 mg, about 100 mg, about 110 mg, about 120 mg, about 130 mg, about 140 mg, about 150 mg, about 160 mg, about 170 mg, about 180 mg, about 190 mg, about 200 mg, or more.
- the cumulative dose is about 40-200 mg, about 50-200 mg, about 50-175 mg, about 50-150 mg, about 50-125 mg, about 50-100 mg, about 50-75 mg, about 40-50 mg, about 75-200 mg, about 75-175 mg, about 75-150 mg, about 75-125 mg, about 75-100 mg, about 100-200 mg, about 100-175 mg, about 100-150 mg, about 100-125 mg, about 125-200 mg, about 125-175 mg, about 125-150 mg, about 150- 200 mg, or about 150-175 mg.
- the dosage of the oligomeric compound is titrated from an initial dose of about 1 mg to a cumulative dose of at least about 40 mg or 50 mg. In certain embodiments, during the dose escalation phase, the dosage of the oligomeric compound is titrated from an initial dose of about 1 mg to a cumulative dose of at least about 100 mg. In certain embodiments, during the dose escalation phase, the dosage of the oligomeric compound is titrated from an initial dose of about 1 mg to a cumulative dose of at least about 40-100 mg or 50-100 mg.
- either the maximum dose or cumulative dose of the dose escalation phase is reached after administration of multiple titrated doses of the oligomeric compound.
- the cumulative dose of the dose escalation phase is reached after administration of 2-20 titrated doses of the oligomeric compound, including after 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 titrated doses of the oligomeric compound.
- either the maximum dose or cumulative dose of the dose escalation phase is reached after administration of 4-16, 4-12, 4-10, 4-8, 5-15, 5-12, 5-10, 5-8, 6-12, 6- 10, 8-12, or 8-10 titrated doses of the oligomeric compound.
- either the maximum dose or cumulative dose of the dose escalation phase is reached after administration of up to about 4 to about 12 titrated doses of the oligomeric compound.
- each administration of the titrated dose of the oligomeric compound is separated by about 3-20 weeks.
- each administration of the titrated dose of the oligomeric compound is separated by about 1 week, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 weeks.
- the titrated dose of the oligomeric compound is administered about every 4-6 weeks.
- each administration of the titrated dose of the oligomeric compound is separated by at least about 6 weeks.
- each administration of the titrated dose of the oligomeric compound is separated by at least about 4 weeks. In other embodiments, each administration of the titrated dose of the oligomeric compound is separated by at least about 2 weeks. In certain embodiments, a titrated dose of the oligomeric compound is administered no more frequently than every 6 weeks. In other embodiments, a titrated dose of the oligomeric compound is administered no more frequently than every 4 weeks. In other embodiments, a titrated dose of the oligomeric compound is administered no more frequently than every 2 weeks. In some embodiments, the oligomeric compound is administered to a subject every week. In some embodiments, the oligomeric compound is administered to a subject every 2 weeks.
- the oligomeric compound is administered to a subject every 3 weeks. In some embodiments, the oligomeric compound is administered to a subject every 4 weeks. In some embodiments, the oligomeric compound is administered to a subject every 6 weeks. In some embodiments, the oligomeric compound is administered to a subject every 8 weeks. In some embodiments, the oligomeric compound is administered to a subject every 10 weeks. In some embodiments, the oligomeric compound is administered to a subject every 12 weeks. In certain embodiments, during the dose escalation phase, the dosage of the oligomeric compound is titrated from an initial dose of about 1 mg to a maximum dose of about 15 mg.
- the dosage of the oligomeric compound is titrated from a first dose of about 1 mg to a second dose of about 2 mg, and optionally to a third dose of about 4 mg, and optionally to a fourth dose of up to about 8 mg, and optionally to a fifth dose of up to about 12 mg, and optionally to a sixth dose of up to about 15 mg.
- the fourth dose of about 8 mg is titrated to a fifth dose of about 15 mg.
- 2-6 weeks separate the administration of each titrated dose. In other embodiments, the titration can continue up to a maximum dose of 100 mg.
- the method of treatment further comprises administering a maintenance dose during a maintenance phase.
- the maintenance phase follows the dose escalation phase.
- the maintenance dose is the maximum dose following the dose escalation phase.
- the maintenance dose is selected and administered to a subject without the subject undergoing a dose escalation phase.
- the maintenance dose is administered up to about every 16- 20 weeks or every 2-20 weeks.
- the maintenance dose is administered up to about every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 weeks.
- the maintenance dose is administered up to about every 1- 16 weeks, 2-16 weeks, 2-8 weeks, 6-18 weeks, 6-16 weeks, 6-14 weeks, 6-12 weeks, 6-10 weeks, 8-18 weeks, 8-16 weeks, 8-14 weeks, 8-12 weeks, 8-10 weeks, 10-18 weeks, 10-16 weeks, 10-14 weeks, or 10-12 weeks. In certain embodiments, the maintenance dose is administered up to about every 12 weeks. In one aspect of the methods of treatment, the maintenance dose is administered after the maximum dose, as described herein, has been reached during the dose escalation phase. In certain embodiments, the maintenance dose is administered after the maximum dose of about 8-15 mg has been reached. In certain embodiments, the maintenance dose is administered after the maximum dose of about 15 mg has been reached.
- the maintenance dose is administered after a maximum dose of greater than 15 mg has been reached. In certain embodiments, the maintenance dose is administered after a maximum dose of about 15-32 mg has been reached. In certain embodiments, the maintenance does is administered after a maximum dose of about 30-50 mg has been reached. In certain embodiments, the maintenance dose is administered after a maximum dose of greater than 50 mg has been reached. In one aspect, multiple maintenance doses are administered. In certain embodiments each administration of the maintenance dose is separated by about 8-20 weeks. In certain embodiments, each administration of the maintenance dose is separated by about 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 weeks.
- each administration of the maintenance dose is separated by about 8-16, 8-14, 8-12, 8-10, 10-16, 10-14, or 10-12 weeks.
- the maintenance dose is administered at least about every 12 weeks.
- maintenance doses are administered over a period of 6 months or greater.
- maintenance doses are administered for the remainder of a subject’s life.
- maintenance doses are administered for at least 1-50 years.
- maintenance doses are administered for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 years.
- maintenance doses are administered for at least 2-50 years, 2-40 years, 2-35 years, 2-30 years, 2-25 years, 2-20 years, 2-15 years, 2-10 years, or 2-5 years.
- the method of treatment comprises inhibiting the expression of SCN2A in neuronal cells in the subject.
- the method of treatment comprises inhibiting the expression of SCN2A mRNA in the subject by about 10% to about 90%, about 35% to about 80%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or more than about 95% but less than 100%.
- about 25% to about 50% or about 35% to about 40% knockdown of SCN2A mRNA is achieved.
- the subject has been diagnosed with early-onset DEE prior to three months of age. In certain embodiments, the subject has been diagnosed with early-onset DEE prior to two months or prior to one month of age. In certain embodiments, the subject has been diagnosed with early-onset DEE in utero. Typically, the diagnosis comprises determining that the subject carries a SCN2A mutation prior to administering the oligomeric compound. Any SCN2A mutation can be used to diagnose early-onset DEE, including any known SCN2A mutation and any SCN2A mutation identified in the future.
- the SCN2A mutation comprises one or more of A263V, E430A, E430G, R1882Q, G879R, G1593R, K1502N, V1601L, G211D, S1780I, D343H, R1626Q, G882E, M1545V, L210Q, Q1479H, N1662D, F1597L, V423L, A215T, I891T, or a combination thereof.
- the SCN2A mutation comprises one or more of Q1531K, L1563V, E1321K, Y1589C, M252V, R 2 23E, L1330F, V208E, R36G, R1882G, D343G, V261L, F1651C, R1319Q, A263V, Q383E, V1325I, K908E, V261M, S987I, R1629H, R1882Q, M1338T, E999K, R856Q, V423L, S1336Y, R1626Q, G882E, N212D, E1211K, D195G, L1342P, R 2 20Q, R853Q, R1435*, K503fs*, R937C, or a combination thereof.
- the subject is a human or non-human animal. In certain embodiments, the subject is a human. In certain embodiments, the subject is a human from 2 years old to 18 years old. In other embodiments, the subject is a human older than 2 years old or younger than 18 years old. In other embodiments, the subject is a human older than 18 years old. In certain embodiments, the subject is a human younger than 2 years old. In certain embodiments, the subject is a human infant. In further embodiments, the infant is 6 months or younger, 5 months or younger, 4 months or younger, 3 months or younger, 2 months or younger or 1 month or younger. In certain embodiments, the subject is a human newborn.
- the newborn is a full term newborn, i.e., born after 39 or more weeks of gestation. In other embodiments, the newborn is a premature newborn, i.e., born after less than 39 weeks of gestation. In some embodiments, the subject is a human premature newborn born after less than 38 weeks, less than 37 weeks, less than 36 weeks, less than 35 weeks, less than 34 weeks, less than 33 weeks, less than 32 weeks, or less than 31 weeks, less than 30 weeks, or less than 28 weeks of gestation.
- An oligomeric compound described herein may be administered to a subject in the context of the present invention in combination with another agent or therapy, e.g., an antiepilepsy agent.
- Non-limiting examples of the anti-epilepsy agents include brivaracetam, carbamazepine, clobazam, clonazepam, diazepam, divalproex, eslicarbazepine, ethosuximide, ezogabine, felbamate, gabapentin, lacosamide, lamotrigine, levetiracetam, lorazepam, oxcarbezepine, permpanel, phenobarbital, phenytoin, pregabalin, primidone, rufinamide, tigabine, topiramate, valproic acid, vigabatrin, zonisamide, and cannabidiol.
- an oligomeric compound is administered in combination with carbamazepine.
- the oligomeric compounds described herein may also be administered, for example, by oral, parenteral, intracerebroventricular, intraparenchymal, buccal, sublingual, nasal, rectal, patch, pump, or transdermal administration.
- Parenteral administration includes intravenous, intraperitoneal, subcutaneous, intramuscular, transepithelial, nasal, intrapulmonary, intrathecal, intracisternal, intracerebroventricular, intraparenchymal, rectal, and topical modes.
- SCN2A disorders can be treated according to the methods disclosed in this application include developmental or epileptic encephalopathy (DEE), such as, Ohtahara Syndrome; epilepsy with migrating focal seizures of infancy (EIMFS); infantile and childhood DEE, for example West Syndrome and Lennon-Gastaut Syndrome; Dravet Syndrome; Idiopathic/Generic Generalized Epilepsies (IGE/GGE); Temporal Lobe Epilepsy; Myoclonic Astatic Epilepsy (MAE); Migrating Partial Epilepsy of Infancy (MMPSI); and familial hemiplegic migraines, with or without epilepsy.
- DEE developmental or epileptic encephalopathy
- EIMFS epilepsy with migrating focal seizures of infancy
- infantile and childhood DEE for example West Syndrome and Lennon-Gastaut Syndrome
- Dravet Syndrome Idiopathic/Generic Generalized Epilepsies
- IGE/GGE Idiopathic/Gen
- the SCN2A-related disorder is late seizure onset epileptic encephalopathy. In certain embodiments, the SCN2A-related disorder is Benign Familial Neonatal-Infantile Seizures. In certain embodiments, the SCN2A-related disorder is an intellectual disability (ID). In certain embodiments, the SCN2A-related disorder is an autism spectrum disorder (ASD).
- the methods of treatment disclosed herein may be used to ameliorate one or more symptoms of SCN2A disorders, including seizures, hypotonia, sensory issues, such as sensory integration disorders, motor development delays and dysfunctions, intellectual and cognitive dysfunctions, movement and balance dysfunctions, visual dysfunctions, delayed language and speech, gastrointestinal disorders, neurodevelopmental delays, and sleep problems.
- Seizures include focal, clonic, tonic, and generalized tonic and clonic seizures, prolonged seizures (often lasting longer than 10 minutes), and frequent seizures.
- administering an oligomeric compound to a subject in need thereof in the context of the present disclosure results in a decrease in the frequency of seizures in the subject, as compared to the frequency of seizures in the subject prior to administering an oligomeric compound.
- administering an oligomeric compound to a subject in need thereof in the context of the present disclosure results in a decrease of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75% or at least about 80% in the frequency of seizures in the subject, as compared to the frequency of seizures in the subject prior to administering an oligomeric compound.
- the decrease in the frequency of seizures in the subject is observed at least 1 week, at least 2 weeks, at least 4 weeks, at least 6 weeks, at least 8 weeks, at least 10 weeks, at least 12 weeks, at least 14 weeks or at least 16 or more weeks after the start of the administration of an oligomeric compound. In other embodiments, the decrease in frequency of seizures is observed within 24 hours after the start of administration of an oligomeric compound.
- Interictal epileptiform discharges are abnormal electrical brain activity patterns that occur between seizures in patients with epilepsy (Smith et al., Elife.2022 Jan 20;11:e73541. doi: 10.7554/eLife.73541. PMID: 35050851; PMCID: PMC8813051).
- IEDs in children with idiopathic epilepsy can affect both cognitive function and academic performance.
- IEDs can be measured non-invasively using electroencephalography (EEG), a technique that records electrical activity in the brain through electrodes placed on the scalp. This makes it possible to monitor changes in IED frequency in real-time without causing discomfort to the subject.
- EEG electroencephalography
- IEDs can serve as an objective biomarker for the presence and severity of epileptic activity.
- the drug's effectiveness in reducing epileptic activity can be monitored.
- changes in IED frequency and distribution may be detectable before any significant changes in seizure frequency or other clinical signs.
- IEDs can provide an early indication of the drug’s effectiveness in treating DEE in a clinical trial, and may be used to inform target engagement and dosing strategies.
- a decrease in IED frequency after drug treatment may be associated with improved seizure control and cogntive outcomes.
- monitoring IEDs during a clinical trial can provide valuable information on the potential long-term benefits of the treatment.
- administering an oligomeric compound to a subject in need thereof in the context of the present disclosure results in a decrease in the frequency of IEDs in the subject, as compared to the frequency of IEDs in the subject prior to administering an oligomeric compound.
- administering an oligomeric compound to a subject in need thereof in the context of the present disclosure results in a decrease of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75% or at least about 80% in frequency of IEDs in the subject, as compared to the frequency of IEDs in the subject prior to administering an oligomeric compound.
- the decrease in the frequency of IEDs in the subject is observed at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 6 weeks, at least 8 weeks, at least 10 weeks, at least 12 weeks, at least 14 weeks or at least 16 or more weeks after the start of the administration of an oligomeric compound.
- administering an oligomeric compound to a subject in need thereof in the context of the present disclosure results in a decrease in the frequency of amplitude-integrated electroencephalography (aEEG) signals, as compared to the frequency of aEEG signals in the subject prior to administering an oligomeric compound.
- aEEG amplitude-integrated electroencephalography
- administering an oligomeric compound to a subject in need thereof in the context of the present disclosure results in a decrease of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75% or at least about 80% in frequency of aEEG signals in the subject, as compared to the frequency of aEEG signals in the subject prior to administering an oligomeric compound.
- the decrease in the frequency of aEEG signals in the subject is observed at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 6 weeks, at least 8 weeks, at least 10 weeks, at least 12 weeks, at least 14 weeks or at least 16 or more weeks after the start of the administration of an oligomeric compound. In other embodiments, the decrease in frequency of aEEG signals in a subject is observed within 24 hours after the start of administration of an oligomeric compound.
- the present disclosure also provides a method for evaluating efficacy of therapy for early onset developmental and epileptic encephalopathy (early onset DEE therapy), the method comprising measuring frequency of interictal epileptiform discharges (IEDs) in a subject being administered the early onset DEE therapy.
- IEDs interictal epileptiform discharges
- the method further comprises comparing frequency of IEDs in the subject measured prior to administration of the early onset DEE therapy to the frequency of IEDs in the subject measured after the start of administration of the early onset DEE therapy, wherein a decrease in the frequency of IEDs measured after the start of administration of the early onset DEE therapy is indicative that the early onset DEE therapy is effective and wherein lack of a decrease of an increase in the frequency of IEDs measured after the start of administration of the early onset DEE therapy is indicative that the early onset DEE therapy is not effective.
- the early onset DEE therapy comprises an oligomeric compound.
- the oligomeric compound useful in the methods of the present disclosure comprises a modified oligonucleotide consisting of 12 to 30 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to an equal length portion of an SCN2A nucleic acid, and wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.
- the oligomeric compound is at least 90% complementary to an equal length portion of SEQ ID NO: 2 and is not more than 50% complementary to an equal length portion of SEQ ID NO: 1.
- the oligomeric compound has a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 16-2531. In certain embodiments, the oligomeric compound has a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or 18 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2532-2539.
- the oligomeric compound has a nucleobase sequence comprising: a) at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases complementary to an equal length portion of nucleobases 199863- 199905, 227493-22755, 243124-243204, 247823-247921, 254142-254177, 168911-168945, 170026-170061, 183519-183562, 188630-188668, 199912- 199962, 227419-227450, or 238173-238192 of SEQ ID NO: 2, provided that the modified oligonucleotide does not comprise more than six LNA nucleosides; or b) at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases complementary to an equal length
- the oligomeric compound has a nucleobase sequence comprising: a) at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases of a sequence selected from SEQ ID NOs: 336, 488, 2021, 2097, 2174, 2250, 2326, 2403, 2499, 2500, 2501, 2502, 2526; 181, 259, 643, 720, 796, 2504, 2505, 2506, 2507, 2508, 2509, 2510, 2511, 2512, 2513, 2514, 2521; 491, 567, 644, 721, 797, 2177, 2253, 2315, 2329, 2406, 2527; 29, 30, 107, 108, 185, 186, 263, 264, 341, 342, 419, 420, 1796, 1871, 1948, 2025, 2101, 2178, 2254, 2330, 2503, 2517, 25
- the oligomeric compound has a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 2487, 2493, 2510, or 2514. In certain embodiments, the oligomeric compound has a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of SEQ ID NO: 2510. In certain embodiments, the oligomeric compound comprises or consists of the nucleobase sequence of SEQ ID NO: 2510.
- the oligomeric compound has a nucleobase sequence consisting of 17-19 or 21-30 linked nucleosides. In certain embodiments, the oligomeric compound has a nucleobase sequence consisting of 16, 17, 18, 19, or 20 linked nucleosides. In certain embodiments, the oligomeric compound is an antisense oligonucleotide and comprises one or more modified sugar moieties, one or more modified internucleoside linkages, and one or more modified nucleobases, as described herein.
- each of the one or more modified sugars is independently chosen from a bicyclic sugar, a 2'-O-methoxyethyl (2MOE) modified sugar, a 2'-O-methyl (2-OMe) modified sugar, a 2'-methoxy modified sugar, a 2'-Fluoro modified sugar, a 2'-O- alkyl modified sugar, a constrained ethyl (cEt) modified sugar, a locked sugar, or an unlocked sugar.
- the antisense oligonucleotide comprises one or more 2MOE modified sugars. In certain embodiments, the antisense oligonucleotide does not comprise a bicyclic sugar moiety.
- each of one or more modified internucleoside linkages is independently chosen from a phosphorothioate, a phosphorodithioate, a phosphoramidate, a phosphorodiamidate, a thiophosphoramidate, a thiophosphorodiamidate, a methyl phosphonate, a phosphoromorpholidate, or a phosphoropiperazidate.
- each modified internucleoside linkage is a phosphorothioate internucleoside linkage.
- At least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 internucleoside linkages of the antisense oligonucleotide are phosphorothioate internucleoside linkages.
- each internucleoside linkage of the antisense oligonucleotide is independently selected from a phosphodiester or a phosphorothioate internucleoside linkage.
- the one or more modified nucleobases is chosen from 5- methylcytosine, 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6- methyladenine, 6-methylguanine, 2-propyladenine, 2-propylguanine, 2-thiouracil, 2- thiothymine, 2-thiocytosine, 5-halouracil, 5-halocytosine, 5-propynyluracil, 5- propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-uracil (pseudouracil), 4- thiouracil, 8-haloadenine, 8-aminoadenine, 8-thioladenine, 8-thioalkyladenine, 8- hydroxyladenine, 8-haloguanine, 8-aminoguanine, 8-thiolguanine, 8-thioalkylguanine, 8- hydroxylguanine, 8
- the modified nucleobase is a 5-methylcytosine.
- each cytosine in the antisense oligonucleotide is a 5-methylcytosine.
- the antisense oligonucleotide comprises: a gap segment consisting of linked deoxynucleosides; a 5' wing segment consisting of linked nucleosides; and a 3' wing segment consisting of linked nucleosides; wherein the gap segment is positioned immediately adjacent to and between the 5' wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
- the antisense oligonucleotide does not comprise a bicyclic sugar moiety.
- the antisense oligonucleotide has the following chemical structure: (SEQ ID NO: 2493) or a salt thereof, such as a potassium salt.
- the antisense oligonucleotide has the following chemical structure: (SEQ ID NO: 2514) or a salt thereof, such as a potassium salt.
- the antisense oligonucleotide has the following chemical structure: (SEQ ID NO: 2510) or a salt thereof, such as a potassium salt.
- the antisense oligonucleotide has the following chemical structure: (SEQ ID NO: 2487) or a salt thereof, such as a potassium salt.
- the antisense oligonucleotide has the following chemical structure: (SEQ ID NO: 2493) or a salt thereof, such as a potassium salt.
- the antisense oligonucleotide has the following chemical structure: (SEQ ID NO: 2534) or a salt thereof, such as a potassium salt.
- Preliminary Safety Part 1 will be conducted exclusively in the United States (US) with the objective of obtaining clinical safety data which will further inform the dose escalation in Part A.
- US United States
- 4 participants will be enrolled and receive COMPOUND 11 mg doses at ⁇ 4-week intervals for up to 13 weeks.
- Safety, along with available PK data, will be assessed by the sponsor on an ongoing basis along with scheduled quarterly Data Monitoring Committee (DMC) reviews after each interim analysis, and ad hoc reviews as needed based on emerging safety data.
- DMC Data Monitoring Committee
- Part A The goal of Part A is to identify a cumulative dose of COMPOUND 1 with a favorable benefit-risk profile for seizure reduction that can be further assessed in Part B.
- Part A will consist of up to 16 participants. Initially, 8 treatment-na ⁇ ve participants will be randomized 3:1 to receive ascending doses of COMPOUND 1 or a placebo procedure. The first 4 participants must reach at least 4 weeks after their first dose before additional participants can be administered study drug. Administrations will occur at ⁇ 4-week intervals for the first 4 doses, and at ⁇ 6-week intervals for the subsequent doses. Dose escalations will be within-participant. The starting dose will be 1 mg with ⁇ 2-fold increase- for subsequent doses with specific dose escalation criteria in Section 6.5.
- the target is to reach a cumulative dose of up to 42 mg, which is predicted to correspond to approximately 35% knock down (KD), divided into 6 administrations.
- KD knock down
- Safety along with available PK data, will be assessed by the sponsor on an ongoing basis along with scheduled quarterly DMC reviews and ad hoc reviews as needed based on emerging safety data.
- Preliminary efficacy in seizure reduction and safety will be assessed during the time period after the 6 th dose administration after up to 8 participants have reached a cumulative dose of up to 42 mg or a corresponding placebo procedure.
- the dosing regimen may be revised based on the analysis of safety and efficacy.
- Maximum tolerated dose (MTD) in this trial is defined as 1 dose level below a single or cumulative dose associated with 2 or more Dose Limiting Toxicities (DLTs) in Part A or a 25% rate trial-wide.
- DLTs Dose Limiting Toxicities
- Up to 8 additional participants may be added (Group 2, randomized to active or placebo in a 3:1 ratio) to further assess the safety and efficacy of escalating doses of COMPOUND 1.
- the starting dose for these additional participants will be up to the highest tolerated single dose previously administered.
- a second planned analysis assessing safety and efficacy during the time period after the 6 th dose will occur after up to 8 participants have reached up to 100 mg cumulatively.
- participants will subsequently have the opportunity to enter Part C/ open-label extension.
- Part B Confirmatory Phase Part B will further assess and confirm the safety and efficacy of the cumulative dose identified in Part A in a randomized, placebo procedure-controlled design. This trial part will only be initiated after authorization is obtained from regulatory authorities. Up to 40 treatment-na ⁇ ve participants will be randomized, with no more than 75% to receive COMPOUND 1 over placebo treatment (3:1 randomization maximum). The final sample size and randomization scheme will be further confirmed based on the preliminary data and power calculations from Part A. The cumulative dose and highest single dose will not exceed the respective MTD in Part A. The cumulative dose from Part A will be divided into ⁇ 6 administrations of COMPOUND 1 or placebo procedure and will be given no more frequently than every 6 weeks.
- the primary endpoint will be seizure frequency over the time period after the 6 th dose as assessed by the seizure diary.
- the duration of participation in Part B is up to 30 weeks.
- participants will subsequently have the opportunity to enter the open-label extension of the trial, Part C.
- Parts 1, A, and B will each consist of 3 periods: Screening Period, Intervention Period (open-label in Part 1, double-blind in Parts A and B), and Follow-up Period. Screening Period Prior to any clinical trial procedures, the participant/caregiver will provide written informed consent and satisfy inclusion/exclusion criteria.
- Intervention Period Part 1 Open-label Intervention: Participants will be admitted to the trial site on Day - 1 for Baseline dosing visit. On Day 1, after confirmation of eligibility, they will receive COMPOUND 1 via IT administration. Each participant will remain inpatient for at least 24- 48 hours after dosing for physical examination (including detailed neurological examination), clinical laboratory evaluations, vital signs measurements, 12-lead ECGs, and any other trial assessments in this visit as outlined in the SoA (Table 1).
- the corresponding procedures and assessments including COMPOUND 1 administration will take place again in intervals of approximately (but not more frequent than) every 4 weeks, for up to 4 doses in total. Dosing in Part 1 may be less frequent based on the tolerability of the study drug.
- home-health visits as well as home vEEG, will be conducted as per the SoA (Table 1). Home-health visits may be conducted at home (i.e., remote to the investigational site) or in the clinic (at the investigational site), at the discretion of the participant together with the investigator. If there are any concerning AEs, or changes in the participant’s examination, the participant may return at the discretion of the investigator for an unscheduled visit in the clinic for further evaluation.
- Parts A and B Double-blind Interventions: Participants will be admitted to the trial site on Day -1 for Baseline dosing visit. On Day 1, after confirmation of eligibility, they will receive Compound 1 via IT administration, or placebo procedure per the randomization schedule. Each participant will remain inpatient for at least 24-48 hours after dosing for physical examination (including detailed neurological examination), clinical laboratory evaluations, vital signs measurements, 12-lead ECGs, and any other trial assessments in this visit as outlined in the SoA (Table 2, Table 3).
- the corresponding procedures and assessments including COMPOUND 1 administration, or placebo procedure will take place again in intervals of approximately (but not more frequent than) every 4 weeks for the first 4 doses, and every 6 weeks for the subsequent doses in Part A, and every 6 weeks in Part B as outlined in the SoA (Table 2, Table 3).
- home-health visits, as well as home vEEG will be conducted as per the SoA (Table 2, Table 3).
- Home-health visits may be conducted at home (i.e., remote to the investigational site) or in the clinic (at the investigational site), at the discretion of the participant together with the investigator.
- Safety follow-up Period During the 6-month follow-up period, home-health visits, as well as home vEEG as outlined in the SoA (Table 1, Table 2, Table 3), will be conducted. Home-health visits may be conducted at home (i.e., remote to the investigational site) or in the clinic (at the investigational site), at the discretion of the participant together with the investigator. If there are any concerning Aes or changes in the participant’s examination (per caregiver report or noted at the home-health visit), the participant may return at the discretion of the investigator for an unscheduled visit in the clinic for further evaluation.
- Part C Open-Label Extension Open label extension will be available for any patient with prior exposure to COMPOUND 1 or if they are rolling over from an active COMPOUND 1 trial. Following Part 1 Following their final dose, participants from Part 1, will have the potential to transition to long term extension. The dose and dosing frequency in the open-label extension for participants from Part 1 will be determined after approval from the regulatory authorities.
- Part C is an open-label extension of the trial that will assess the safety and durability of effect on seizures and other outcomes measures of a maintenance dosing regimen over up to 2 years (see Table 4 for the schedule of activities in this part).
- the highest dose administered in Part C will be up to the maximum tolerated single dose from Part A and Part B. This dose level may change as Part A and Part B progress. It is expected that dosing every 12 weeks will be sufficient to maintain KD levels. Therefore, dosing will be at least 12 weeks apart for up to 2 years.
- a titration dose regimen may be added for participants who received only placebo procedures in Part A or Part B.
- the starting dose for this titration regimen will be no more than the maximum tolerated single dose from Part A or Part B.
- the follow-up period may be extended based on the results of the assessments at the end of study (EOS) visit and the investigator’s best clinical judgement. Should it be considered necessary, the extended follow-up will include assessments for the presence of potential long-term and developmental effects.
- Prompts will be used to ensure adequate data capture in addition to spontaneous reporting.
- the diary will be completed by the same caregiver as often as possible.
- Daily seizure diary data collected as part of an ongoing observation trial that falls within the Screening window per this protocol may be used without having to be repeated.
- Video EEG To the extent allowed by local regulations, a vEEG will be performed by a trained technician throughout the trial in order to record brainwave activity and to evaluate for changes over time. Prolonged vEEG can be completed at home or in a facility, ideally with a minimum of 12 hours of continuous recording and capturing periods of both wakefulness and sleep. vEEGs collected within the Screening window per this protocol, as part of an ongoing observational trial, would not have to be repeated during the Screening period.
- Bayley Scales of Infant Development-Fourth Edition (Bayley-4)
- the Bayley-4 is a standardized neurodevelopmental assessment measure used by clinicians to evaluate key domains in early childhood development for individuals between 16 days and 42 months after birth (Bayley and Aylward 2019). These domains include adaptive behavior, cognition, language, motor function (gross and fine), and social-emotional development.
- the Bayley-4 assessments will be videorecorded to the extent allowed by local regulations.
- Vineland Adaptive Behavior Scale-3 (Vineland-3)
- the Vineland-3 is a clinician-assessed measure of adaptive behavior in individuals with intellectual disabilities (Sparrow et al 2016).
- the Vineland-3 includes assessment of communication, socialization, maladaptive behaviors, motor skills, and daily living skills in children as young as 3 years of age.
- the WPPSI-IV is a comprehensive test used to assess cognitive function in children from the age of 2 years 6 months to 7 years 7 months.
- the WPPSI-IV assesses 5 areas: full scale intelligence quotient (IQ), verbal IQ, performance IQ, processing speed, and global language.
- IQ full scale intelligence quotient
- Investigators will be trained in the administration of the WPPSI-IV.
- Cognitive Test Selection Guide During the evaluation period, participants will undergo cognitive tests.
- the cognitive test used (Bayley ⁇ 4 or WPPSI ⁇ IV) will be dependent not only on the participant’s age but also, for participants ⁇ 3 years of age, on the participant’s initial Vineland-3 score obtained prior to Baseline, as shown in Figure 2.
- Vineland-3 is an individually administered measure of behavior that is used to assess individuals with intellectual, developmental, and other neurologic disabilities.
- the Vineland-3 will be used to assess the participant’s cognitive age based on measures of receptive and expressive communication, rather than chronological age, in participants ⁇ 3 years of age as follows: • Participants ⁇ 3 years (36 months) of age at Baseline (Visit 1): All participants will be assigned to the Bayley ⁇ 4 cognitive test; and • Participants ⁇ 3 years (36 months) of age at Baseline (Visit 1): All participants will be assigned to either the Bayley ⁇ 4 or the WPPSI ⁇ IV, based upon their initial Vineland-3, Parent/Caregiver version score, as described in Figure 2. The scores achieved on the receptive communication and expressive communication subscales will determine their cognitive test assignment.
- the instrument provides 5 sub-scores for the following: disorders of initiating and maintaining sleep, sleep breathing disorders, disorders of arousal or sleep ⁇ wake transition disorders, disorders of excessive somnolence, and sleep hyperhidrosis.
- Quality of Life Inventory-Disability QI-Disability
- the QI-Disability is a parent-report measure for children with intellectual disabilities. It is a reliable and valid measure of the quality of life across the spectrum of intellectual disability. (Downs et al 2018). It has the potential to allow for clearer identification of support needs and measures responsiveness to interventions.
- ABC-2 Aberrant Behaviors Checklist-2 nd Edition
- the ABC-2 is a clinician-assessed rating scale that measures the severity of a range of problem behaviors commonly observed in individuals with intellectual disabilities (Aman and Singh 2017).
- CGI-S Clinical Global Impression-Severity
- CGI-I Clinical Global Impression-Improvement
- the CGI was developed for use in NIH-sponsored clinical trials in individuals with mental health disorders.
- the CGI provides an overall assessment of improvement over a specified period.
- the CGI includes two, 7-point Likert rating scales: the CGI-S and the CGI-I scale (Guy 1976).
- the CGI will be anchored with reference to domains/symptoms experienced by participants with SCN2A-DEE.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Neurosurgery (AREA)
- Neurology (AREA)
- Medicinal Chemistry (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Biochemistry (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Hospice & Palliative Care (AREA)
- Psychiatry (AREA)
- Pain & Pain Management (AREA)
- Epidemiology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Hydrogenated Pyridines (AREA)
Priority Applications (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2023244348A AU2023244348A1 (en) | 2022-03-28 | 2023-03-28 | Methods of using oligomeric compounds to treat scn2a-related disorders |
| EP23782026.1A EP4499835A2 (en) | 2022-03-28 | 2023-03-28 | Methods of using oligomeric compounds to treat scn2a-related disorders |
| CA3246834A CA3246834A1 (en) | 2022-03-28 | 2023-03-28 | METHODS OF USING OLIGOMER COMPOUNDS TO TREAT DISORDERS RELATED TO SCN2A |
| US18/851,471 US20250179503A1 (en) | 2022-03-28 | 2023-03-28 | Methods of using oligomeric compounds to treat scn2a-related disorders |
| JP2024557582A JP2025510339A (ja) | 2022-03-28 | 2023-03-28 | オリゴマー化合物を使用してscn2a関連障害を治療する方法 |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202263324531P | 2022-03-28 | 2022-03-28 | |
| US63/324,531 | 2022-03-28 | ||
| US202263335152P | 2022-04-26 | 2022-04-26 | |
| US63/335,152 | 2022-04-26 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2023192885A2 true WO2023192885A2 (en) | 2023-10-05 |
| WO2023192885A3 WO2023192885A3 (en) | 2024-01-11 |
Family
ID=88203426
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2023/065074 Ceased WO2023192885A2 (en) | 2022-03-28 | 2023-03-28 | Methods of using oligomeric compounds to treat scn2a-related disorders |
Country Status (6)
| Country | Link |
|---|---|
| US (1) | US20250179503A1 (cg-RX-API-DMAC7.html) |
| EP (1) | EP4499835A2 (cg-RX-API-DMAC7.html) |
| JP (1) | JP2025510339A (cg-RX-API-DMAC7.html) |
| AU (1) | AU2023244348A1 (cg-RX-API-DMAC7.html) |
| CA (1) | CA3246834A1 (cg-RX-API-DMAC7.html) |
| WO (1) | WO2023192885A2 (cg-RX-API-DMAC7.html) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2025059511A1 (en) * | 2023-09-15 | 2025-03-20 | Praxis Precision Medicines, Inc. | Elsunersen / prax-222 for use in the treatment of scn2a-related disorders |
| US12618072B2 (en) | 2024-09-13 | 2026-05-05 | Praxis Precision Medicines, Inc. | Methods of treatment of SCN2A-related disorders |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8138201B2 (en) * | 2007-07-11 | 2012-03-20 | Medicinova, Inc. | Treatment of progressive neurodegenerative disease with ibudilast |
| IL297642A (en) * | 2020-04-29 | 2022-12-01 | Praxis Prec Medicines Inc | Methods for using t-type calcium channel modulators |
| IL300258A (en) * | 2020-08-07 | 2023-03-01 | Ionis Pharmaceuticals Inc | Compounds and methods for modulating SCN2A |
-
2023
- 2023-03-28 WO PCT/US2023/065074 patent/WO2023192885A2/en not_active Ceased
- 2023-03-28 CA CA3246834A patent/CA3246834A1/en active Pending
- 2023-03-28 JP JP2024557582A patent/JP2025510339A/ja active Pending
- 2023-03-28 AU AU2023244348A patent/AU2023244348A1/en active Pending
- 2023-03-28 EP EP23782026.1A patent/EP4499835A2/en active Pending
- 2023-03-28 US US18/851,471 patent/US20250179503A1/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2025059511A1 (en) * | 2023-09-15 | 2025-03-20 | Praxis Precision Medicines, Inc. | Elsunersen / prax-222 for use in the treatment of scn2a-related disorders |
| US12618072B2 (en) | 2024-09-13 | 2026-05-05 | Praxis Precision Medicines, Inc. | Methods of treatment of SCN2A-related disorders |
Also Published As
| Publication number | Publication date |
|---|---|
| EP4499835A2 (en) | 2025-02-05 |
| US20250179503A1 (en) | 2025-06-05 |
| AU2023244348A1 (en) | 2024-10-10 |
| CA3246834A1 (en) | 2023-10-05 |
| JP2025510339A (ja) | 2025-04-14 |
| WO2023192885A3 (en) | 2024-01-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12129466B2 (en) | Compounds and methods for modulating UBE3A-ATS | |
| US12227746B2 (en) | Compounds and methods for modulating SCN2A | |
| US20260002154A1 (en) | Compounds and methods for reducing prion expression | |
| AU2017336093A1 (en) | Compounds and methods for reducing Tau expression | |
| US20250320505A1 (en) | Compounds and Methods for Reducing KCNT1 Expression | |
| US12502402B2 (en) | Compounds and methods for modulating GFAP | |
| EP3976791B1 (en) | Compounds and methods for reducing fus expression | |
| US20250179503A1 (en) | Methods of using oligomeric compounds to treat scn2a-related disorders | |
| US20240229042A1 (en) | Compounds and methods for reducing kcnt1 expression | |
| US20230124616A1 (en) | Compounds and methods for modulating kcnq2 | |
| HK40129490A (en) | Compounds and methods for modulating ube3a-ats | |
| EP4453214A2 (en) | Compounds and methods for modulating glycogen synthase 1 | |
| EP4453215A2 (en) | Compounds and methods for reducing glycogen synthase 1 | |
| WO2024226802A2 (en) | Compositions and methods for allele specific modulation of tnpo2 expression | |
| HK40067280A (en) | Compounds and methods for modulating ube3a-ats | |
| HK40067280B (en) | Compounds and methods for modulating ube3a-ats |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 23782026 Country of ref document: EP Kind code of ref document: A2 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: AU2023244348 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2024557582 Country of ref document: JP |
|
| ENP | Entry into the national phase |
Ref document number: 2023244348 Country of ref document: AU Date of ref document: 20230328 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2023782026 Country of ref document: EP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2023782026 Country of ref document: EP Effective date: 20241028 |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 23782026 Country of ref document: EP Kind code of ref document: A2 |
|
| WWP | Wipo information: published in national office |
Ref document number: 18851471 Country of ref document: US |