WO2023187453A1

WO2023187453A1 - Method and microbial strains for improving the growth of plant in vitro shoot culture

Info

Publication number: WO2023187453A1
Application number: PCT/IB2022/053059
Authority: WO
Inventors: Inga TAMOSIUNE; Elena ANDRIUNAITE; Danas BANIULIS; Rytis RUGIENIUS; Martynas GAVUTIS
Original assignee: Lithuanian Research Centre For Agriculture And Forestry
Priority date: 2022-04-01
Filing date: 2022-04-01
Publication date: 2023-10-05

Abstract

The present invention relates to a method for improving growth and reducing stress injury of the antibiotic-treated in vitro plant shoot culture comprising the introduction of an endophytic microorganism to the subject plant tissue. The invention provides novel bacterial strains of Bacillus and Peribacillus spp. which confer growth enhancement and reduced stress injury for antibiotic-treated in vitro plant shoot culture. The invention settles problems associated with antibiotic-induced hypogenesis of plant tissue culture.

Description

METHOD AND MICROBIAL STRAINS FOR IMPROVING THE GROWTH OF PLANT IN VITRO SHOOT CULTURE

FIELD OF THE INVENTION

The present invention relates to the field of plant tissue culture and more particularly, to cultivation method of a plant tissue, an organ, a part thereof. The invention provides novel bacterial strains which provide beneficial features to the in vitro plant shoot culture upon colonization of the same. The method and bacterial strains disclosed herein are useful for improving the propagation of antibiotic-treated plant in vitro shoot culture.

BACKGROUND OF THE INVENTION

A large diversity of agricultural crops, such as ornamentals, vegetable and agronomic crops belonging to more than 30 families, are propagated clonally (vegetatively). It is also the preferred propagation method for genetically modified crops which allows to avoid crop-to-wild gene flow through pollen. In vitro axillary bud proliferation-based techniques are commonly used for industrial-scale production of planting stock of the clonally propagated plants, including propagation, germplasm preservation or control of systemic pathogens. In addition, in vitro techniques are often used for plant genetic transformation which over the last three decades became an essential tool for in vivo analysis of gene function as well as plant breeding. Cultivated tobacco (Nicotiana tabacum L.) has been commonly used for genetic transformation as a model species in functional genomics studies as well as for practical application in molecular farming using in vitro techniques.

During in vitro cultivation, plants are being exposed to non-natural conditions, such as synthetic cultivation media, low irradiance, low CO₂ concentration during light periods and high air humidity, which could lead to an imbalance of physiological equilibrium and stress of plant resulting in slow plant growth and early senescence (Cassells, Curry, 2001). Moreover, the use of in vitro techniques has a negative impact on microbial diversity of plant tissues, mainly due to antimicrobial treatment during introduction to in vitro culture or later use of antibiotics.

Antibiotics are mainly used to control microbial contamination of the in vitro culture or during genetic transformation procedure. To eliminate microbial contamination, the medium could be supplemented with microbial growth inhibiting concentration of antibiotic or tissue pretreatment with a high dose of antibiotic could be used. The genetic transformation procedures often include use of antibiotics as a selection system for transgenic cell line isolation and/or elimination of Agrobacterium used for the bacterium-to-plant DNA transfer. Meanwhile, the development of alternative selection systems could replace the use of antibiotics for the selection of transgenic genotypes, antibiotics remain an indispensable tool for control of Agrobacterium overgrowth. Excess proliferation of the bacterium could elicit defence response in plant cells leading to a detrimental effect on plant tissue growth and efficiency of transformation (Ozawa, 2009). Cephalosporin and penicillin type antibiotics, such as cefotaxime, carbenicillin or timentin, active against gram-negative bacteria are commonly used for the Agrobacterium elimination.

Antibiotic concentrations required for efficient control of the bacterium, in the range of 100 to 500 mg L^-1 (Wojtania et al., 2005), could be cytotoxic to plant cells. Elevated stress level associated with proline accumulation, oxidative injury and reduced antioxidative activity has been reported for a variety of plants upon application of penicillin-type antibiotics (Qin et al., 2011). Antibiotic timentin is a mixture of carboxypenicillin ticarcillin and β-lactamase inhibitor clavulanic acid. It is considered less cytotoxic to in vitro plants and is commonly used for transformation procedures or to maintain sterility in transformed plant tissues in the range of concentrations from 150 mg L^-1 (Nauerby et al., 1997) to 500 mg L^-1 (Cheng et al., 1998). However, our recent study revealed that timentin treatment at 250 mg L^-1 concentration had a negative effect on tobacco in vitro shoot biomass accumulation and resulted in elevated levels of oxidative stress injury (Tamosiune et al., 2021). Moreover, the treatment had an enduring effect on shoot growth vigour and stress level after transfer to medium without antibiotic. Tobacco shoot microbiome analysis revealed that antibiotic treatment resulted in a sharp decline of microbial diversity which suggested that impeded growth and reduced adaptive capacity of the in vitro tissue culture could be associated with antibiotic-induced perturbation of shoot microbiome composition (Tamosiune et al., 2021).

Plants are closely associated with microorganisms and plant holobiont, comprised of the host genome and its microbiome, is a co-evolved unit that is constantly adapting to the dynamic abiotic and biotic environment (Guerrero et al., 2013). Plants host diverse microbial communities that are associated with plant roots, the phyllosphere, rhizosphere and endosphere. Endophytic bacteria are a group of endosymbiotic microorganisms that live in plant tissues. The term “endophyte” means the location of an organism, with “endo” means “inside” and “phyte” means “plants”. Fungi and bacteria are the most common organisms associated with the term endophyte.

For several decades, extensive research has been carried worldwide on endophytic bacteria isolated as individual strains and their role in enhancing plant growth (Miliute et al., 2015; Santoyo et al., 2016; Le Cocq et al., 2017; Rho et al., 2018). During the last decade, high-throughput sequencing-based metagenomic analysis largely contributed to the understanding of plant-associated microbial diversity (Tamosiune et al., 2019). This provided a wealth of information about a role of microorganisms in relation to plant health and productivity. Microorganisms can provide beneficial effects on plant health directly by enhancing crop nutrition or indirectly by reducing damage caused by pathogens or environmental stress and plant growth-promoting properties of endophytic bacteria have been extensively studied. Plant growth promoting capability of endophytes is established through activity that increases the accessibility of nutrients, such as nitrogen and phosphorus, or is mediated by compounds produced by the microorganisms and the host cells, such as plant growth hormones.

Being protected inside explant or seed tissues, endophytic bacteria evade surface sterilization procedures used for cell culture initiation therefore they are common in plant in vitro tissues and their composition depends on explant origin and cultivation conditions (Kukkurainen et al., 2005; Abreu-Tarazi et al., 2010; Leone et al., 2019). The occurrence of microorganisms in aseptic culture has been often associated with contamination resulting from bacterial overgrowth on culture medium. Formation of bacterial colonies on culture medium and overgrowth plant tissues as a result of non-fastidious proliferation of pathogenic species or commensal endophytic bacteria could be triggered by changes in environmental conditions or plant host physiology. However, numerous bacterial endophytes maintain habitual concealed lifestyle or due to limited bacterial growth supporting media conditions remain latent in in vitro tissue over extended periods of time. During the last decades, the metagenomic analysis revealed a diversity of microbial communities residing in the in vitro tissue cultures and several studies showed a beneficial effect of endophytic bacteria isolated from in vitro cultures of strawberry (Dias et al., 2009), grapevine (Salomon et al., 2014), tomato (Botta et al., 2013) and sweet cherry (Quambusch et al., 2016) on plant growth, acclimatization, or rooting.

Microbiome engineering-based innovations were proposed as practical solutions required to restore natural diversity of plant-associated microbiome affected by environmental impact or agricultural practices. Application of microbial inoculum-based biostimulants could emulate the natural biological networks of plant holobiont with the recovery of functional, beneficial microbial groups positively linked to healthy plant (Wargo, Hogan, 2006; Berg et al., 2014; du Jardin, 2015; Lugtenberg, 2015). Bacterial strains of the genera Bacillus and Pseudomonas have been commonly regarded for plant growth-promoting biostimulant applications. Examples for use of endophytes as plant growth enhancers, bio-pesticides, pathogen treatment or pest tolerance agents are disclosed e.g., in WO2013190082, WO2011117351, WO2010115156, WO2007107000, WO2007021200, US20120144533, US4940834, CA2562175 and WO 2011082455, US9288995, US9260713, US9392796, US7977550, US8822190.

Application of the plant growth promoting bacteria under in vitro conditions has been rarely addressed and their use to alleviate the consequences of antibiotic-induced perturbation of the endophytic community and its effect on efficiency of the in vitro culture propagation has not been considered. However, considering the established role of endophytic bacteria as a modulator of plant growth and adaptation, it could be expected that the individual strains or synthetic microbial consortia could also have a potential used to at least partially reconstruct microbial communities affected by the application of in vitro techniques or to construct microbial communities with novel plant growth promoting effects. Recently, it has been disclosed (Andriunaite et al., 2021) that isolates of bacteria assigned to the Bacillus cereus group, derived from the phyllosphere of tobacco, administered to the tobacco shoot culture provided an effective improvement of the in vitro shoot growth.

A method for improving growth and reducing stress injury of the antibiotic-treated in vitro plant shoot culture comprising the introduction of an endophytic microorganism to the subject plant tissue and novel bacterial strains of Bacillus and Peribacillus spp. which confer growth enhancement and reduced stress injury for antibiotic-treated in vitro plant shoot culture are disclosed in the present invention.

SUMMARY OF THE INVENTION

In accordance with the objects outlined herein, the present invention provides a method to confer growth enhancement of antibiotic-treated in vitro tissue culture of target plant comprising inoculating the plant tissue with bacterial culture. The target plant of the invention includes, for example, tobacco. In vitro tissue culture of the invention includes, for example, in vitro shoot culture. Antibiotic used for the treatment of the in vitro tissue culture of the invention includes, for example, a mixture of penicillin-type antibiotics and beta-lactamase inhibitor, including carboxypenicillin ticarcillin and clavulanic acid. Bacterial culture of the invention includes, for example, endophytic bacteria, including strains of Bacillus wiedmannii and Peribacillus simplex.

In a further aspect, the present invention provides a method to confer reduced stress injury of antibiotic treated target plant tissue culture comprising inoculating the plant tissues with bacterial culture. The stress injury conferred to the plant may be, for example, oxidative injury to lipid membranes induced by cultivation under in vitro conditions.

In yet a further aspect, the present invention provides pure cultures of bacterial strains of Bacillus wiedmannii NT32 and Peribacillus simplex MD4 deposited with the Polish Collection of Microorganisms (PCM) under the Budapest Treaty, respectively as Deposit ID: B/00362 and B/00363.

The following drawings are part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to the drawings in combination with the detailed description of specific embodiments presented herein. The accompanying drawings are given by way of illustration only and thus are not limitative of the present invention.

is a photograph representing tobacco in vitro shoots cultivated on solid medium (A) and inoculation of plant in vitro shoots with composition including pure bacterial strain (B). For bacterial strain inoculation, in vitro shoots were transferred to a fresh MS based medium one day prior to the experiment. Pure strain of endophytic bacteria was cultivated in fresh medium overnight and was resuspended in the MS medium at 107 CFU/mL. Three microliters of the composition including pure bacterial strain were inoculated on nodes of leaf petioles. Subsequently, the shoots were co-cultivated with bacterial strain for 3 weeks. The detail description of experimental conditions is presented in Example 2. Scale bar represents 1 cm.

is a photograph representing 3 weeks old tobacco in vitro shoots. Antibiotic-treated shoots were maintained on medium supplemented with 250 mg·L-1 timentin for 6 months, transferred to medium without antibiotic and maintained for at least two passages (2 months) before the endophytic bacteria inoculation experiments. The shoot growth and inoculation conditions are described in Example 2. Scale bar represents 1 cm.

is a graph depicting biomass accumulation of tobacco in vitro shoots measured as fresh weight (F.W.) after 3 weeks of cultivation after transfer to fresh medium. Antibiotic-treated shoots were maintained on medium supplemented with 250 mg·L-1 timentin for 6 months, transferred to medium without antibiotic and maintained for at least two passages (2 months) before the endophytic bacteria inoculation experiments. The detail description of shoot growth and inoculation conditions is presented in Example 2. Data from 4 independent experiments presented as the mean and standard error of the mean. Statistically significant differences of the mean values were assessed using ANOVA and Tukey post-hoc test. The same letters denote insignificant differences (p>0.05).

is a graph depicting the accumulation of MDA, the membrane lipid oxidative injury marker, in tobacco in vitro shoots cultured for 3 weeks after transfer to fresh medium. Antibiotic-treated shoots were maintained on medium supplemented with 250 mg·L-1 timentin for 6 months, transferred to medium without antibiotic and maintained for at least two passages (2 months) before the endophytic bacteria co-cultivation experiments. The detail description of shoot growth and inoculation conditions is presented in Example 2. Data from 4 independent experiments presented as the mean and standard error of the mean. Statistically significant differences of the mean values were assessed using ANOVA and Tukey post-hoc test. The same letter denotes insignificant differences (p>0.05).

DETAILED DESCRIPTION OF THE INVENTION

Unless otherwise defined, all terms used in disclosing the invention, including technical and scientific terms, have the meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

As detailed in the state of the art description, antibiotics are generally used to control microbial contamination during plant in vitro tissue culture cultivation or during genetic transformation procedure. Although the application of antibiotics can be successful in avoiding microbial overgrowth in plant in vitro tissue culture, it can promote oxidative injury of the plant tissues, inhibiting growth of the culture, resulting in reduced accumulation of the biomass.

Antibiotic treatment could have a residual long-term effect on plant in vitro culture performance when the tissue is transferred to a medium without antibiotic which could last at least for several passages. The antibiotic treatment induced long-term growth suppression and elevated accumulation of oxidative stress markers in tobacco in the antibiotic treated in vitro shoot culture compared to the corresponding healthy, untreated plant tissue culture, is illustrated in Examples 2 and 3.

The long-term growth inhibition and reduced adaptive capacity of the plant in vitro culture is not a consequence of direct cytotoxic effect of the antibiotic and is associated with antibiotic impact on the diversity of endophytic bacteria of in vitro plant tissues.

The present invention is predicated on the determination that certain endophytic bacteria strains function as modulators of antibiotic-treatment induced stress and provide growth promotion advantages, such as improved growth and shoot biomass accumulation. By "endophytic bacteria" herein is meant a bacteria that generally resides in the intra- and/or inter-cellular space of a plant. An endophyte can confer a beneficial property to a plant such as an increase in yield, biomass, resistance, or fitness in its host plant. In work leading up to the present invention, the inventors identified endophytic strains of Bacillus wiedmannii and Peribacillus simplex which upon inoculation of antibiotic-treated plant in vitro shoot culture reduce oxidative stress injury and enhance growth of the shoots. The endophytic strains are Bacillus wiedmannii NT32 isolated from the phyllosphere of cultivated tobacco (Nicotiana tabacum L.) and Peribacillus simplex MD4 isolated from the phyllosphere of domestic apple (Malus x domestica Borkh.), deposited on 16 December 2021 with the Polish Collection of Microorganisms under the Budapest Treaty, under No. B/00362 and B/00363 and are identified herein by reference to an NT32 and MD4, respectively. The present invention contemplates the use of pure bacterial strains. The term "pure bacterial strain" refers to substantially no other strains than the desired strain and is therefore substantially free of other contaminants, which can include microbial contaminants.

The tobacco plant tissue culture is applied in the preferred embodiment of the present invention but the described method is not limited to tobacco plant tissue and it could be applicable to tissue culture of any plant, particularly a plant of agronomic importance. In useful embodiments of the present invention, inoculation and co-cultivation of the antibiotic-treated tobacco in vitro shoot culture with a composition including pure strain NT32 or MD4 had a clear growth and adaptation enhancing effect, while other related bacterial strains Bacillus mycoides NT42 and Bacillus sp. MD5 did not have any effect or had shoot growth inhibiting effect. Examples of such inoculum effect are described in the experimental section of the specification (Example 2 and 3). In the examples, the in vitro tobacco shoot culture previously treated with antibiotic timentin is used. The antibiotics used for the plant shoot culture treatment could include but are not limited to other related beta-lactam type antibiotics commonly used for plant in vitro culture, such as carbenicillin and cefotaxime, used to treat plant in vitro culture from microbial decontamination or for prevention of overgrowth of Agrobacterium transformation agent during plant genetic transformation procedure.

The invention overcomes substantial limitations in the art resulting from antibiotic-induced suppression of in vitro propagation efficiency of important crop plants. Accordingly, this has led to the development of a new methodology for the introduction of effective concentration of the pure strain of bacteria to the plant in vitro tissue culture which could facilitate propagation of the antibiotic-treated in vitro tissue culture, in particular tobacco in vitro shoot culture, due to improved plant adaptation and growth characteristics. The following is a detailed description of the invention provided to aid those skilled in the art in practicing the present invention. Many of the techniques and procedures described or referenced herein are well understood and commonly employed using conventional methodology by those skilled in the art. Those of ordinary skill in the art may make modifications and variations in the embodiments described herein without departing from the spirit or scope of the present invention.

In such a method, antibiotic-treated plant in vitro tissue culture is inoculated and co-cultivated with a composition including pure bacterial strain in accordance with the present invention. In a preferred embodiment, the first step (a) of the method according to the invention is preparation of the in vitro shoot culture which is followed by the second step (b) involving preparation of the composition for the inoculum including pure bacterial strain, the third step (c) is the in vitro shoot inoculation with the composition including pure bacterial strain and the fourth step (d) is co-cultivation of the in vitro shoot culture with the bacterial strain.

At the first step (a) of the method plant in vitro tissue culture is prepared for inoculation with a composition including pure bacterial strain. Those of skill in the art are aware of the typical steps in the plant tissue culture cultivation and are familiar with the variety of tissue culture media, which when supplemented appropriately, support plant tissue growth and development and are suitable for the shoot propagation. The basic medium in plant tissue culture can either be purchased as a commercial preparation, or custom prepared and modified. Example of such media would include but are not limited to Murashige and Skoog (1962) [hereinafter abbreviated as “MS medium”] or derivations of this media supplemented accordingly. To maintain a plant in vitro shoot culture, the ingredients of the solid medium may be inorganic salts (e.g., MS basal salts disclosed by Murashige and Skoog (1962), saccharides (e.g., sucrose), organic supplements (e.g., tryptone or peptone), gelling agent (e.g., agar) and plant growth regulators. Any suitable plant culture medium can be used supplemented with additional plant growth regulators as appropriate for in vitro shoot culture, including but not limited to cytokinins such as BAP (6-benzylaminopurine). Those of skill in the art are aware of other culture conditions used for in vitro shoot culture, such as light intensity during incubation, pH, and incubation temperatures that can be optimized for the particular variety of interest.

In the preferred embodiment, the antibiotic-treated tobacco in vitro shoots are maintained using the described medium and growth conditions for three-to-four weeks and later on are transferred to fresh medium and cultivated for a duration of one to several days before inoculation with the bacterial composition. The duration of shoot cultivation could require optimization for the particular variety of interests.

In the second step (b) of the preferred embodiment, a composition including pure bacterial strain is prepared. The Bacillus wiedmannii NT32 or Peribacillus simplex MD4 strains to be used can be prepared either by inoculating a liquid medium such as LB media (Bertani, 1951) directly from a glycerol stock or streaking the bacteria onto a solidified media from a glycerol stock, allowing the bacteria to grow under the appropriate selective conditions. Those of skill in the art are familiar with procedures for growth and suitable culture conditions for bacteria as well as subsequent inoculation procedures.

The next step (c) of the process is the in vitro shoot tissue culture inoculation. In this stage, the suitably prepared bacterial cell suspension is inoculated on the plant shoot tissues. To get benefits from bacterial inoculum, it is crucial to apply (technique and timing) bacterial inoculum in a viable way. Thus, in the preferred embodiment, the pure bacterial culture used for inoculation of tobacco in vitro shoots is applied at the density of 10⁷ CFU/mL, and at least 3 microliters of the bacterial suspension is required for inoculation on several nodes of the shoot petiole. A detail explanation of subsequent inoculation procedures is presented in Example 2 and

It is important that inoculated microorganisms colonize the plant environment and would remain viable during the subsequent cultivation of extended duration required for the shoot culture propagation. The method described herein uses co-cultivation of plant tissue with inoculated pure bacterial strain to allow the colonization of plant tissues by the bacterium (d). A strain is said to colonize a plant or plant tissue when it can exist in a non-detrimental relationship with the plant tissue, for example on and/or inside the plant tissue, and it can be stably detected within the plant or plant elements over a period time, such as one or more days, weeks, months or years. The co-culture refers to the time post-inoculation which continues for any number of passages of plant tissue on a fresh culture medium. In a preferred embodiment, to ensure efficient colonization, tobacco in vitro shoots inoculated with pure bacterial strain are co-cultured for at least 3 passages. Conditions used for the co-cultivation are the same as described for in vitro shoot culture preparation in the first step of the method. The density of the inoculated bacteria stain in shoot tissue could be estimated using serial dilution and plating on a solidified medium such as LB medium. A colony-forming unit or CFU is used as a measure of viable bacteria in a sample. A CFU is an individual viable cell capable of forming on a solid medium a visible colony whose individual cells are derived by cell division from one parental cell. A procedure used to assess density of the inoculated bacteria stain in tobacco in vitro shoot tissue is presented in Example 4.

The above-described techniques of the preferred embodiment are useful for plants such as tobacco and may be suitable for any plant. In the present invention, the type of plant to be cultured is not particularly limited as long as it has differentiation totipotency and can be tissue-cultured, and any plant can be applied. The same applies for the plant organ or tissue type which is not particularly limited to in vitro shoot culture described in the preferred embodiment of the method and may be suitable for any plant tissues, organs or parts thereof that could be inoculated and co-cultured with the pure bacterium composition.

The following experimental examples are provided to illustrate the present invention. The invention is further described by way of the following examples and the drawing figures, yet without being restricted thereto. Experiments were conducted to demonstrate the feasibility of the presented embodiment of the present invention. The bacterial strains and the inoculation of the tobacco in vitro shoot culture used in the following Examples were performed as follows.

EXAMPLE 1. Bacillus wiedmannii and Peribacillus simplex strains

Bacillus wiedmannii NT32 (SEQ ID No. 1) was isolated from leaves of tobacco cultivated in the greenhouse in Babtai, Lithuania. Peribacillus simplex MD4 (SEQ ID No. 2) was isolated from leaves of domestic apple cultivated in field collection in Babtai, Lithuania. The taxonomy identity of strains was confirmed by sequencing the PCR product of a 16S rRNA amplified with the following primers:

E8F - 5′AGAGTTTGATCCTGGCTCAG3′ (SEQ ID No.3) and

E1541R - 5′AAGGAGGTGATCCAGCC3′ (SEQ ID No. 4).

EXAMPLE 2. Effect of bacterial strain inoculation on tobacco shoot culture growth

This experiment was conducted to demonstrate the effect of inoculation with pure culture of Bacillus wiedmannii strain NT32 and Peribacillus simplex strain MD4 on biomass accumulation of the antibiotic-treated tobacco shoot culture.

Cultivated tobacco (Nicotiana tabacum) shoot culture was maintained on solid Murashige-Skoog (MS) medium (Murashige, Skoog, 1962), supplemented with 0.75 mg L−1 BAP, 30 g L−1 sucrose and 0.8% agar in a climatic chamber (Sanyo Electric Co.) at 25 ºC ± 3 ºC, under fluorescent lamp illumination at 150 μmol m⁻² s⁻¹ intensity and with a 16/8 h light/dark photoperiod. The shoots were used as a reference experimental group of untreated shoots (indicated as a control in and ) for comparison of effects of antibiotic treatment and inoculation with the pure bacterial strain.

The reference antibiotic-treated tobacco shoot line (indicated as antibiotic-treated shoots in and ) was initiated from the control shoot culture and was propagation on a medium supplemented with timentin at 250 mg·L^-1 for six culture passages. Medium composition and growth conditions were the same as described above for the control experimental group. After the treatment, shoots were transferred to the medium without antibiotic, and further were maintained for at least 2-3 culture passages and was used to assess the effect of inoculation with pure bacterial strains on parameters of growth and adaptation to in vitro conditions.

For the bacterium inoculation experiments, antibiotic-treated shoots were transferred to a fresh medium and were used for bacterial inoculation the next day (representative sample is shown in FIG. 1A).

Bacterial inoculum was initiated from a glycerol stock and was grown in LB broth at 25 ºC to an exponential growth phase. Bacteria were sedimented via centrifugation and resuspended in MS medium at a concentration of ~10⁷ CFU/mL. Three microliters of the bacterial suspension were inoculated on several nodes of the shoot petiole of the tobacco shoots as illustrated in FIG. 1B. The inoculated shoots were maintained as described above and were transferred to a fresh medium every 4 weeks. Shoot fresh weight (FW) was assessed using shoot samples collected three weeks after transfer to fresh medium.

MS medium without bacteria was used for the control treatment. To demonstrate the specific effect of the endophytic strains of this invention, Bacillus wiedmannii strain NT32 and Peribacillus simplex strain MD4, two additional strains of bacterial species isolated from the same plant source, Bacillus mycoides NT42 and Bacillus sp. MD5, respectively, were used in the experiment.

Results

Antibiotic-treatment induced suppression of tobacco shoot growth and growth promoting effect of the strains NT32 and MD4 are illustrated by the representative shoot samples shown in .

The results of the quantitative shoot biomass accumulation assessment are presented in . As compared to antibiotic-treated experimental group, the shoots inoculated with strains NT32 and MD4 showed significant (19.8 ± 5.1 % and 21.4 ± 3.7 %, respectively) increase in FW to the levels that are comparable to the control experimental group which did not receive the antibiotic treatment. Inoculation with the other two strains, NT42 and MD5, used in the experiment did not show significant growth stimulating effect.

EXAMPLE 3. Effect of bacterial strain inoculation on tobacco shoot culture adaptation

This experiment was conducted to demonstrate the effect of inoculation with a pure culture of Bacillus wiedmannii strain NT32 and Peribacillus simplex strain MD4 on adaptation to in vitro conditions of the antibiotic-treated tobacco shoot culture.

The tobacco in vitro shoot test sample of Example 3 was obtained by the same method as Example 2.

Oxidative injury of tobacco shoot cellular membranes was estimated based on quantitative analysis of the lipid peroxidation product malondialdehyde (MDA) using previously described method (Hodges et al., 1999; Jagendorf, Takabe, 2001). Homogenized frozen tobacco shoot powder was extracted with 50mM Tris-HCl pH 7.4, containing 1.5% of polyvinylpolypyrrolidone for 30 min at 4 ºC and centrifuged at 10000 xg for 15 min at 4 ºC. Equal amounts of tissue extract and 0.5% thiobarbituric acid in 20% trichloroacetic acid were mixed, heated at 95 ºC for 30 min, cooled on ice and centrifuged at 10000 xg for 5 min. The absorbance measured at 532 nm was corrected by subtracting the absorbance value at 600 nm and MDA concentration was estimated using ε=155 mM^-1cm^-1. The absence of interference from the absorbance of anthocyanins at 532 nm was verified using control samples without thiobarbituric acid.

Results

The results of a quantitative assessment of the MDA accumulation in tobacco shoot tissue are presented in . As compared to antibiotic-treated experimental group, the shoots inoculated with strains NT32 and MD4 had significantly reduced (21.8 ± 7.7 % and 17.1 ± 2.8 %, respectively) accumulation of the oxidative membrane lipid injury marker and it was comparable to the level characteristic to control experimental group which did not receive antibiotic treatment. The inoculation with the other two strains, NT42 and MD5, used in the experiment did not have a significant effect on the accumulation of MDA. The data imply that the inoculation with strains NT32 and MD4 promotes adaptation of tobacco shoots to the stress induced by the in vitro conditions and is associated with reduced stress-induced oxidative membrane lipid injury.

EXAMPLE 4. Survival of Bacillus wiedmannii and Peribacillus simplex strains in the inoculated tobacco in vitro shoot culture tissues.

Colonization and survival in plant tissues of the inoculated pure bacterial strain are essential to ensure an effect of bacteria for an extended period of time required for shoot propagation. This experiment was conducted to confirm that Bacillus wiedmannii strain NT32 and Peribacillus simplex strain MD4 inoculated to tobacco in vitro shoot tissues maintained a viable bacterial population for at least several months.

The tobacco in vitro shoot test sample of Example 4 was obtained by the same method as Example 2.

Survival of the inoculated bacteria strains in the tobacco shoot tissues was confirmed after three cultivation passages (of approximately 1 month duration each).

Since no bacterial growth was detectable on the LB medium for the control shoot samples, the density of endophytic bacteria in shoot tissues was estimated using serial dilution and plating. A hundred milligrams of the pooled shoot sample was homogenized in 1 mL LB medium, diluted via serial dilution and plated on solidified LB medium. Two replicates were used for each dilution and the experiment was repeated at least twice. The cultivated bacterial strain identity was confirmed by 16S rRNA gene sequencing as described in Example 1.

Results

The analysis confirmed the viable bacterial cell population of the strains NT32 and MD4 is maintained in the shoot culture inoculated with the pure bacteria composition. Bacterial cell density in the shoot tissues was estimated at 1.0 ± 0.06 x 10⁶ and 0.7 ± 0.05 x 10⁶ CFU g^-1 FW for the strains NT32 and MD4, respectively.

REFERENCES

Abreu-Tarazi M.F., Navarrete A.A., Andreote F.D., Almeida C.V., Tsai S.M., Almeida M. 2010. Endophytic bacteria in long-term in vitro cultivated “axenic” pineapple microplants revealed by PCR–DGGE. World Journal of Microbiology & Biotechnology, 26(3): 555-560. https://doi.org/10.1007/s11274-009-0191-3.
Andriunaite E., Tamosiune I., Aleksandraviciute M., Gelvonauskiene D., Vinskiene J., Rugienius R., Baniulis D. 2021. Stimulation of Nicotiana tabacum L. in vitro shoot growth by endophytic Bacillus cereus group bacteria. Microorganisms, 9(9): 1893. https://doi.org/10.3390/microorganisms9091893.
Berg G., Grube M., Schloter M., Smalla K. 2014. Unraveling the plant microbiome: looking back and future perspectives. Frontiers in Microbiology, 5: 148. https://doi.org/10.3389/fmicb.2014.00148.
Bertani G. 1951. Studies on lysogenesis. I. The mode of phage liberation by lysogenic Escherichia coli. Journal of Bacteriology, 62(3): 293-300. https://doi.org/10.1128/JB.62.3.293-300.1951.
Botta A.L., Santacecilia A., Ercole C., Cacchio P., Del Gallo M. 2013. In vitro and in vivo inoculation of four endophytic bacteria on Lycopersicon esculentum. New Biotechnology, 30(6): 666-674. https://doi.org/10.1016/j.nbt.2013.01.001.
Cassells A.C., Curry R.F. 2001. Oxidative stress and physiological, epigenetic and genetic variability in plant tissue culture: implications for micropropagators and genetic engineers. Plant Cell, Tissue and Organ Culture, 64(2): 145-157. https://doi.org/10.1023/A:1010692104861.
Cheng Z.M., Schnurr J.A., Kapaun J.A. 1998. Timentin as an alternative antibiotic for suppression of Agrobacterium tumefaciens in genetic transformation. Plant Cell Reports, 17(8): 646-649. https://doi.org/10.1007/s002990050458.
Dias A.C.F., Costa F.E.C., Andreote F.D., Lacava P.T., Teixeira M.A., Assumpcao L.C., Araujo W.L., Azevedo J.L., Melo I.S. 2009. Isolation of micropropagated strawberry endophytic bacteria and assessment of their potential for plant growth promotion. World Journal of Microbiology and Biotechnology, 25(2): 189-195. https://doi.org/10.1007/s11274-008-9878-0.
du Jardin P. 2015. Plant biostimulants: Definition, concept, main categories and regulation. Scientia Horticulturae, 196: 3-14. https://doi.org/https://doi.org/10.1016/j.scienta.2015.09.021.
Guerrero R., Margulis L.S., Berlanga M. 2013. Symbiogenesis: the holobiont as a unit of evolution. International microbiology : the official journal of the Spanish Society for Microbiology, 16(3): 133-143. https://doi.org/10.2436/20.1501.01.188.
Hodges D.M., DeLong J.M., Forney C.F., Prange R.K. 1999. Improving the thiobarbituric acid-reactive-substances assay for estimating lipid peroxidation in plant tissues containing anthocyanin and other interfering compounds. Planta, 207(4): 604-611. https://doi.org/10.1007/s004250050524.
Jagendorf A.T., Takabe T. 2001. Inducers of glycinebetaine synthesis in barley. Plant Physiology, 127(4): 1827-1835. https://doi.org/10.1104/pp.010392.
Kukkurainen S., Leino A., Vahamiko S., Karkkainen H.R., Ahanen K., Sorvari S., Rugienius R., Toldi O. 2005. Occurrence and location of endophytic bacteria in garden and wild strawberry. HortScience, 40(2): 348-352. https://doi.org/10.21273/hortsci.40.2.348.
Le Cocq K., Gurr S.J., Hirsch P.R., Mauchline T.H. 2017. Exploitation of endophytes for sustainable agricultural intensification. Molecular Plant Pathology, 18(3): 469-473. https://doi.org/10.1111/mpp.12483.
Leone G.F., Andrade P.A.M., de Almeida C.V., de Almeida C.V., Dini Andreote F., de Almeida M. 2019. Use of antibiotics to control endophytic bacterial growth migration onto culture medium in Eucalyptus cloeziana F. Muell.: a micropropagation approach. In Vitro Cellular & Developmental Biology - Plant, 55(4): 421-432. https://doi.org/10.1007/s11627-019-09986-2.
Lugtenberg B., 2015. Principles of Plant-Microbe Interactions: Microbes for Sustainable Agriculture, 1st ed. Springer International Publishing: Imprint: Springer, Cham, pp. 1 online resource (XXIV, 448 pages 200 illustrations, 100 illustrations in color.
Miliute I., Buzaite O., Baniulis D., Stanys V. 2015. Bacterial endophytes in agricultural crops and their role in stress tolerance: a review. Zemdirbyste-Agriculture, 102(4): 465-478. https://doi.org/10.13080/z-a.2015.102.060.
Murashige T., Skoog F. 1962. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiologia Plantarum, 15(3): 473-497. https://doi.org/10.1111/j.1399-3054.1962.tb08052.x.
Nauerby B., Billing K., Wyndaele R. 1997. Influence of the antibiotic timentin on plant regeneration compared to carbenicillin and cefotaxime in concentrations suitable for elimination of Agrobacterium tumefaciens. Plant Science, 123(1): 169-177. https://doi.org/10.1016/S0168-9452(96)04569-4.
Ozawa K. 2009. Establishment of a high efficiency Agrobacterium-mediated transformation system of rice (Oryza sativa L.). Plant Science, 176(4): 522-527. https://doi.org/10.1016/j.plantsci.2009.01.013.
Qin Y.H., Teixeira da Silva J.A., Bi J.H., Zhang S.L., Hu G.B. 2011. Response of in vitro strawberry to antibiotics. Plant growth regulation, 65(1): 183-193. https://doi.org/10.1007/s10725-011-9587-9.
Quambusch M., Brummer J., Haller K., Winkelmann T., Bartsch M. 2016. Dynamics of endophytic bacteria in plant in vitro culture: quantification of three bacterial strains in Prunus avium in different plant organs and in vitro culture phases. Plant Cell, Tissue and Organ Culture, 126(2): 305-317. https://doi.org/10.1007/s11240-016-0999-0.
Rho H., Hsieh M., Kandel S.L., Cantillo J., Doty S.L., Kim S.-H. 2018. Do endophytes promote growth of host plants under stress? A meta-analysis on plant stress mitigation by endophytes. Microbial Ecology, 75(2): 407-418. https://doi.org/10.1007/s00248-017-1054-3.
Salomon M.V., Bottini R., de Souza Filho G.A., Cohen A.C., Moreno D., Gil M., Piccoli P. 2014. Bacteria isolated from roots and rhizosphere of Vitis vinifera retard water losses, induce abscisic acid accumulation and synthesis of defense-related terpenes in in vitro cultured grapevine. Physiologia Plantarum, 151(4): 359-374. https://doi.org/10.1111/ppl.12117.
Santoyo G., Moreno-Hagelsieb G., Orozco-Mosqueda Mdel C., Glick B.R. 2016. Plant growth-promoting bacterial endophytes. Microbiological Research, 183: 92-99. https://doi.org/10.1016/j.micres.2015.11.008.
Tamosiune I., Andriunaite E., Stanys V., Baniulis D. 2019. Exploring Diversity of Bacterial Endophyte Communities Using Advanced Sequencing Technology. Kumar V. Prasad R. Kumar M., Choudhary D.K. (eds.), Microbiome in Plant Health and Disease: Challenges and Opportunities. Springer Singapore, Singapore, p. 447-481.
Tamosiune I., Andriunaite E., Vinskiene J., Stanys V., Rugienius R., Baniulis D., 2021. Antibiotic treatment impaired growth of tobacco in vitro shoots is associated with oxidative injury and reduced microbiome diversity. Preprint (Version 1) available at Research Square.
Wargo M.J., Hogan D.A. 2006. Fungal--bacterial interactions: a mixed bag of mingling microbes. Current Opinion in Microbiology, 9(4): 359-364. https://doi.org/10.1016/j.mib.2006.06.001.
Wojtania A., Pulawska J., Gabryszewska E. 2005. Identification and elimination of bacterial contaminants from Pelargonium tissue cultures. Journal of Fruit and Ornamental Plant Research, 13: 101-108.
WO2013190082
WO2011117351
WO2010115156
WO2007107000
WO2007021200
US20120144533
US4940834
CA2562175
WO2011082455
US9288995
US9260713
US9392796
US7977550
US8822190

Claims

A method for enhancing the growth of in vitro plant tissue culture, wherein said plant tissue is inoculated with an endophytic bacteria culture.
A method for enhancing the growth of in vitro plant tissue culture according to claim 1, wherein said in vitro plant tissue culture is a tobacco in vitro shoot culture.
A method for enhancing the growth of in vitro plant tissue culture according to claims 1-2, wherein said in vitro plant tissue culture has been previously treated with antibiotics.
A method for enhancing the growth of in vitro plant tissue culture according to claim 3, wherein the in vitro plant tissue culture has been previously treated with a mixture of carboxypenicillin ticarcillin and clavulanic acid.
A method for enhancing the growth of in vitro plant tissue culture according to claims 1-5, wherein said endophytic bacteria culture is a purified bacterial strain of Bacillus spp. or Peribacillus spp.
A purified bacterial strain of Bacillus spp. according to claim 5, characterized in that, said strain comprises at least one 16S nucleotide sequence that is at least 95% identical to SEQ ID No. 1 or SEQ ID No. 2.
A purified bacterial strain of Peribacillus spp. according to claim 5, characterized in that, said strain comprises at least one 16S nucleotide sequence that is at least 95% identical to SEQ ID No. 2.
Purified bacterial strains of Bacillus spp. and Peribacillus spp. according to claims 5-7, characterized in that, said strains are deposited with the PCM as B/00362 and B/00363, respectively.
A method to reduce antibiotic stress injury of in vitro plant tissue culture, wherein said plant tissue is inoculated with an endophytic bacteria culture.
A method to reduce antibiotic stress injury of in vitro plant tissue culture according to claim 9, wherein the plant tissue culture is inoculated with Bacillus spp. or Peribacillus spp. strains.
Purified bacterial strains of Bacillus spp. and Peribacillus spp. according to claim 10, characterized in that, said strains are deposited with the PCM as B/00362 and B/00363, respectively.