WO2023183556A2 - Treatment for retinal disorders - Google Patents

Abstract

Compositions in the treatment of retinal disorders include a phosphorothioate oligonucleotide in a therapeutically effective amount. The phosphorothioate oligonucleotide is administered in the treatment of retinal disorders.

Description

TREATMENT FOR RETINAL DISORDERS

CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of priority under 35 U.S.C. § 1 19(e) to U.S. Provisional Application No. 63/323,132 filed March 24, 2022, the entire contents of which are incorporated herein by reference in their entirety.

BACKGROUND

[0002] Visual impairment is a global health concern that has a negative impact on physical and mental health. Visually impaired individuals are at particularly high risk for chronic health conditions, accidents, social withdrawal, depression, and mortality. The number of people with visual impairment and blindness is increasing due to an overall aging population. The leading causes of blindness and low vision in the United States (nei.nih.gov/learn-about-eye- health/outreach-campaigns-and-resources/eye-health-data-and-statistics) are primarily age related eye diseases such as age-related macular degeneration, cataract, diabetic retinopathy, and glaucoma. Age-related macular degeneration and diabetic retinopathy are conditions directly related to the retina, which is a light-sensitive structure, composed mostly of nerve tissue that lines the inner surface of the eye. In the retina the images are formed and then transported to the brain by electrical impulses. The so-called Macula, is a circular, yellow spot, about 5 mm in diameter, located on the back of the retina. It is in the Macula where the image is defined in detail. Inside the macula, there is a circular depression of about 1.5 mm in diameter called Fovea. The marked alteration of the Fovea and its concentric surrounding areas (Parafovea and Perifovea) by retinal degeneration, determines the loss of central vision, fundamental for definition of images and in particular for reading.

[0003] Diabetic retinopathy (DR) and Age-related Macular Degeneration (AMD) are among the most frequent retinal diseases. Diabetic retinopathy is a frequent complication of diabetes characterized by neovascularization and edema of the tissue that progressively interrupts connections among the different types of retinal cells.

[0004] Almost all patients with Type I Diabetes and more than 50% of those who suffer from Type 2 Diabetes develop retinopathy after several years of the diagnosis of the disease. The risk of developing diabetic retinopathy can be reduced by early detection of diabetes followed by strict control of blood glucose and pressure. However, this control in many cases and for various reasons, is difficult to achieve. The most common cause of vision loss in patients with DR is diabetic macular edema (DME). DME is characterized by swelling or thickening of the macula due to sub- and mtra-retinal accumulation of fluid in the macula triggered by the breakdown of the blood-retinal barrier (BRB). The development of anti-vascular endothelial growth factor (VEGF) therapy brought about remarkable clinical benefits in DR patients; however, most patients failed to achieve clinically significant visual improvement. Recent scientific works have attempted to elucidate the mechanisms of this disease (1). Several researchers point out to oxidative stress, inflammation, dysfunction of autophagy and loss of mitochondrial homeostasis as central processes in the generation of DR (2, 3, 4, 5). Consequently, the concerted restoration of these processes is considered the most appropriate therapeutic goal for the integral resolution of this health condition.

[0005] AMD is a common, chronic, and progressive degenerative disorder of the macula that affects the elderly and can result in loss of central vision as a result of a chronic progressive degeneration of the macula (geographic atrophy) and/ or excessive angiogenesis. Advanced AMD is generally classified into two types: dry' (only with regional atrophy) and wet (with regional atrophy and excessive angiogenesis). Dry AMD represents the vast majority of cases diagnosed (~ 85%). However, wet AMD is responsible for the majority of severe vision losses. However, in its most advanced form, dry AMD can also cause a significant loss of vision. As in the case of diabetic retinopathy, the efficiency of available treatments for wet AMD is limited. Therefore, there is an urgent need to develop more effective treatments.

[0006] The most recent scientific works point to oxidative stress, inflammation, anomaly in the functioning of autophagy and loss of mitochondrial function as central processes in development of wet AMD (6, 7, 8, 9). In contrast, in dry AMD an excessive activation of the alternative complement cascade (AP cascade) leads to the formation of a membrane-attack complex and a variety of pro-inflammatory responses, which are thought to play a key role in the progression of dry AMD (10).

SUMMARY

[00071 Embodiments are directed to compositions and methods for suppressing, or preventing progression of retinal degenerations in mammals, including humans. [0008] In certain aspects, a method of treating retinal degeneration in a mammal comprises administering, through a convenient parenteral route, to the mammal in need, a pharmaceutical composition comprising a therapeutically effective amount of a phosphor othioate oligonucleotide, termed herein “IMT504”, having at least a: 50%, 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or at least a 99.9% sequence identity to SEQ ID NO: 1. In certain embodiments, the pharmaceutical composition solution comprising the phosphorothioate oligonucleotide is administered in combination with an antioxidant agent. In certain embodiments, the pharmaceutical composition solution comprises the phosphorothioate oligonucleotide and an antioxidant agent.

[0009] In certain aspects, a method of treating retinal degeneration in a mammal comprises administering, through a convenient parenteral route, to the mammal in need, a pharmaceutical composition comprising a therapeutically effective amount of a phosphorothioate oligonucleotide, termed herein “IMT504”, having the sequence TCATCATTTTGTCATTTTGTCATT (SEQ ID NO: 1). In certain embodiments, the pharmaceutical composition solution comprising the phosphorothioate oligonucleotide is administered in combination with an antioxidant agent. In certain embodiments, the pharmaceutical composition solution comprises the phosphorothioate oligonucleotide and an antioxidant agent.

[0010] In certain aspects, the phosphorothioate oligonucleotide has a sequence identity of at least 50% to SEQ ID NO: 1 . In certain aspects, the phosphorothioate oligonucleotide has a sequence identity of at least 70% to SEQ ID NO: 1 . In certain aspects, the phosphorothioate oligonucleotide has a sequence identity of at least a 50%, 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or at least a 99.9% sequence identity to SEQ ID NO: 1.

[0011] In certain aspects, a pharmaceutical composition comprises a therapeutically effective amount of a phosphorothioate oligonucleotide having at least a: 50%, 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or at least a 99.9% sequence identity to SEQ ID NO: 1.

[ 0012] In certain aspects, a composition comprises a therapeutically effective amount of a phosphorothioate oligonucleotide having at least a 50% sequence identity to SEQ ID NO: 1 (IMT504), and one or more anti-inflammatory agents, other therapeutics, immunosuppressive agents, chemotherapeutic agents or combinations thereof. In certain embodiments, a composition comprises a therapeutically effective amount of a phosphorothioate oligonucleotide having at least a 50%, 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or at least a 99.9% sequence identity to SEQ ID NO: I (IMT504), and one or more antiinflammatory agents, other therapeutics, immunosuppressive agents, chemotherapeutic agents or combinations thereof.

[0013] In certain aspects, a pharmaceutical composition comprises an aqueous solution of a phosphorothioate oligonucleotide comprising a nucleic acid sequence having at least a 70% sequence identity to SEQ ID NO: 1 in concentrations ranging from at least 10 to at least 80 mg/mL and at least one osmolyte. In certain embodiments, the osniolyte comprises: sodium chloride, calcium chloride, magnesium sulfate, mannitol, sucrose, xylitol, glucose or combinations thereof. In certain embodiments, the pH is adjusted between 4 and 8 by a buffer, an acid or an alkali without the addition of a preservative. In certain embodiments, osmolality is about 200 - 500 mOsm.

[0014] In another aspect, use of a phosphorothioate oligonucleotide comprises a nucleic acid sequence having at least a 70% sequence identity to SEQ ID NO: 1 to manufacture a composition to treat retinal disorders in a subject. In certain embodiments, the pharmaceutical composition is administered via an intramuscular (i.m) route, subcutaneous (s.c.) route, intravenous (i.v.) route, an ophthalmic route or combinations thereof. In certain embodiments, the retinal disorder is a subretinal or intraretinal fibrosis. In certain embodiments, the retinal disorder is a diabetic retinopathy. In certain embodiments, the retinal disorder is an age-related macular degeneration (AMD). In certain embodiments, the phosphorothioate oligonucleotide SEQ ID NO: 1. In certain embodiments, the pharmaceutical composition solution comprises the phosphorothioate oligonucleotide is administered in combination with an antioxidant agent.

[0015] In certain aspects, a pharmaceutical composition comprises a therapeutically effective amount of a phosphorothioate oligonucleotide having at least a 50% sequence identity to SEQ ID NO: I (IMT504), at least one buffering agent, at least one salt, or combinations thereof. In certain embodiments, the phosphorothioate oligonucleotide comprises at least a 90% sequence identity to SEQ ID NO: 1. In certain embodiments, the composition comprises SEQ ID NO: 1 in a range from about I mg/ml to about 150 mg/mL In certain embodiments, the composition comprises SEQ ID NO: I at about 5 mg/ml. In certain embodiments, the composition comprises SEQ ID NO: 1 at about 10 mg/ml. In certain embodiments, the composition comprises SEQ ID NO: I at about 15 mg/ml. In certain embodiments, the composition comprises SEQ ID NO: 1 at about 20 mg/ml. In certain embodiments, the composition comprises SEQ ID NO: 1 at about 25 mg/ml. In certain embodiments, the composition comprises SEQ) ID NO: 1 at about 30 mg/ml. In certain embodiments, the composition comprises SEQ ID NO: 1 at about 35 mg/ml. In certain embodiments, the composition comprises SEQ) ID NO: 1 at about 40 mg/ml. In certain embodiments, the composition comprises SEQ ID NO: 1 at about 45 mg/ml. In certain embodiments, the composition comprises SEQ ID NO: 1 at about 50 mg/ml. In certain embodiments, the composition comprises SEQ ID NO: 1 at about 55 mg/ml. In certain embodiments, the composition comprises SEQ ID NO: 1 at about 60 mg/ml. In certain embodiments, the composition comprises SEQ ID NO: 1 at about 65 mg/ml. In certain embodiments, the composition comprises SEQ ID NO: 1 at about 70 mg/ml. In certain embodiments, the composition comprises SEQ ID NO: 1 at about 75 mg/ml. In certain embodiments, the at least one buffer comprises monobasic sodium phosphate anhydrous or dibasic sodium phosphate anhydrous. In certain embodiments, the composition comprises at least two buffers. In certain embodiments, the at least two buffers comprise monobasic sodium phosphate anhydrous and dibasic sodium phosphate anhydrous. In certain embodiments, the monobasic sodium phosphate anhydrous is at a concentration in a range of about 0.001 mg/ml to about 1 mg/ml. In certain embodiments, the monobasic sodium phosphate anhydrous is at a concentration of about 0.06 mg/ml. In certain embodiments, the monobasic sodium phosphate anhydrous is at a concentration of about 0.09 mg/ml. In certain embodiments, the monobasic sodium phosphate anhydrous is at a concentration of about 0.2 mg/ml. In certain embodiments, the monobasic sodium phosphate anhydrous is at a concentration of about 0.25 mg/ml. In certain embodiments, the dibasic sodium phosphate anhydrous is at a concentration in a range of about. 0.5 mg/ml to about 2 mg/ml. In certain embodiments, the dibasic sodium phosphate anhydrous is at a concentration of about 0.5 mg/ml. In certain embodiments, the dibasic sodium phosphate anhydrous is at a concentration of about 1 mg/ml. In certain embodiments, the dibasic sodium phosphate anhydrous is at a concentration of about 1.1 mg/ml. In certain embodiments, the dibasic sodium phosphate anhydrous is at a concentration of about 1.2 mg/ml. In certain embodiments, the dibasic sodium phosphate anhydrous is at a concentration of about 1 .3 mg/ml. In certain embodiments, the dibasic sodium phosphate anhydrous is at a concentration of about 1.4 mg/ml. In certain embodiments, the composition further comprises a salt. In certain embodiments, the salt is at a concentration in a range of about 4 mg/ml to about 10 mg/ml. In certain embodiments, the salt is at a concentration of about 6 mg/ml. In certain embodiments, the salt is at a concentration of about 6.5 mg/ml. In certain embodiments, the salt is at a concentration of about 7 mg/ml. In certain embodiments, the salt is at a concentration of about 7.5 mg/ml. In certain embodiments, the salt is at a concentration of about 8 mg/ml.

[0016] In certain aspects, a pharmaceutical composition comprises a therapeutically effective amount of a phosphorothioate oligonucleotide having at least a 50% sequence identity to SEQ ID NO: 1 (termed herein “IMT504”), at least two buffering agents, at least one sugar alcohol, or combinations thereof. In certain embodiments, the phosphorothioate oligonucleotide comprises at least a 90% sequence identity to SEQ ID NO: 1. In certain embodiments, the composition comprises SEQ ID NO: 1 in a range from about 1 mg/ml to about 150 mg/ml. In certain embodiments, the composition comprises SEQ ID NO: 1 at about 5 mg/ml. In certain embodiments, the composition comprises SEQ ID NO: 1 at about 10 mg/ml. In certain embodiments, the composition comprises SEQ ID NO: 1 at about 1 5 mg/ml. In certain embodiments, the composition comprises SEQ ID NO: 1 at about 20 mg/ml. In certain embodiments, the composition comprises SEQ ID NO: 1 at about 30 mg/ml. In certain embodiments, the composition comprises SEQ ID NO: 1 at about 40 mg/ml. In certain embodiments, the composition comprises SEQ ID NO: 1 at about 50 mg/ml. In certain embodiments, the at least two buffering agents comprises monobasic sodium phosphate anhydrous and dibasic sodium phosphate anhydrous. In certain embodiments, the monobasic sodium phosphate anhydrous is at a concentration in a range of about 0.001 mg/ml to about 1 mg/ml. In certain embodiments, the monobasic sodium phosphate anhydrous is at a concentration of about 0.05 mg/ml. In certain embodiments, the monobasic sodium phosphate anhy drous is at a concentration of about 0.10 mg/ml. In certain embodiments, the monobasic sodium phosphate anhydrous is at a concentration of about 0.12 mg/ml. In certain embodiments, the monobasic sodium phosphate anhy drous is at a concentration of about 0.25 mg/ml. In certain embodiments, the dibasic sodium phosphate anhydrous is at a concentration in a range of about 0.5 mg/ml to about 2 mg/ml. In certain embodiments, the dibasic sodium phosphate anhydrous is at a concentration of about 0.5 mg/mL In certain embodiments, the dibasic sodium phosphate anhy drous is at a concentration of about 1 mg/ml. In certain embodiments, the dibasic sodium phosphate anhydrous is at a concentration of about 1.1 mg/ml. In certain embodiments, the dibasic sodium phosphate anhydrous is at a concentration of about 1.2 mg/ml. In certain embodiments, the dibasic sodium phosphate anhy drous is at a concentration of about 1.3 mg/ml. In certain embodiments, the dibasic sodium phosphate anhydrous is at a concentration of about 1.4 mg/mi. In certain embodiments, the sugar alcohol is at a concentration in a range of about 10 mg/mi to about 60 mg/ml. In certain embodiments, the sugar alcohol is at a concentration of about 20 mg/ml. In certain embodiments, the sugar alcohol is at a concentration of about 30 mg/ml. In certain embodiments, the sugar alcohol is at a concentration of about 35 mg/ml. In certain embodiments, the sugar alcohol is at a concentration of about 40 mg/ml. In certain embodiments, the sugar alcohol is at a concentration of about 45 mg/ml. In certain embodiments, the composition is a lyophilized composition.

[0017] In certain aspects, a method of treating retinal disorders in a subject, comprising administering to the subject a pharmaceutical composition comprising a therapeutically effective amount of a peptide encoded by a nucleic acid sequence having at least a 70% sequence identity to SEQ ID NO: 1. In certain embodiments, the pharmaceutical composition comprises a therapeutically effective amount of a peptide encoded by a nucleic acid sequence having at least a 90% sequence identity to SEQ ID NO: 1. In certain embodiments, the pharmaceutical composition comprises a therapeutically effective amount of a peptide encoded by a nucleic acid sequence comprising SEQ ID NO: 1. In certain embodiments, the pharmaceutical composition is administered via an intramuscular (i.m) route, subcutaneous (s.c.) route, intravenous (i.v.) route, an ophthalmic route or combinations thereof. In certain embodiments, the retinal disorder is a subretmal or intraretinal fibrosis. In certain embodiments, the retinal disorder is a diabetic retinopathy. In certain embodiments, the retinal disorder is an age-related macular degeneration (AMD). In certain embodiments, the phosphorothioate oligonucleotide SEQ ID NO: 1. In certain embodiments, the pharmaceutical composition solution comprising the phosphorothioate oligonucleotide is administered in combination with an antioxidant agent. [0018] In certain aspects, a pharmaceutical composition comprises an aqueous solution of a peptide encoded by a phosphorothioate oligonucleotide comprising a nucleic acid sequence having at least a 70% sequence identity to SEQ ID NO: 1 in concentrations ranging from at least 10 to at least 80 mg/mL and at least one osmolyte. In certain embodiments, the pharmaceutical composition comprises a therapeutically effective amount of a peptide encoded by a nucleic acid sequence having at least a 90% sequence identity to SEQ ID NO: 1. In certain embodiments, the pharmaceutical composition comprises a therapeutically effective amount of a peptide encoded by a nucleic acid sequence comprising SEQ ID NO: 1. In certain embodiments, the osmolyte comprises: sodium chloride, calcium chloride, magnesium sulfate, mannitol, sucrose, xylitol, glucose or combinations thereof. In certain embodiments, the pH is adjusted between 4 and 8 by a buffer, an acid or an alkali without the addition of a preservative. In certain embodiments, osmolality is about 200 - 500 mOsm.

[0019] Definitions

[0020] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the singular forms “a”, “an” and “the” are intended to include the plural forms as well, unless the context clearly indicates otherwise. Furthermore, to the extent that the terms “including”, “includes”, “having”, “has”, “with”, or variants thereof are used in either the detailed descripti on and/or the claims, such terms are intended to be inclusive in a manner similar to the term “comprising.”

[0021] For the purposes of this specification and appended claims, unless otherwise indicated, all numbers expressing amounts, sizes, dimensions, proportions, shapes, formulations, parameters, percentages, parameters, quantities, characteristics, and other numerical values used in the specification and claims, are to be understood as being modified in all instances by the term “about” even though the term “about” may not expressly appear with the value, amount, or range. Accordingly, unless indicated to the contrary, the numerical parameters set forth in the following specification and attached claims are not and need not be exact but may be approximate and/or larger or smaller as desired, reflecting tolerances, conversion factors, rounding off, measurement error and the like, and other factors known to those of skill in the art depending on the desired properties sought, to be obtained by the presently disclosed subject matter. For example, the term “about,” when referring to a value can be meant to encompass variations of, in some embodiments, ± 100% in some embodiments ± 50%, in some embodiments ± 20%, in some embodiments ± 10%, in some embodiments ± 5%, in some embodiments ±1%, in some embodiments± 0.5%, and in some embodiments^ 0.1 % from the specified amount, as such variations are appropriate to perform the disclosed methods or employ the disclosed compositions.

[0022] Further, the term “about” when used in connection with one or more numbers or numerical ranges, should be understood to refer to all such numbers, including all numbers in a range and modifies that range by extending the boundaries above and below the numerical values set forth. The recitation of numerical ranges by endpoints includes all numbers, e.g., whole integers, including fractions thereof, subsumed within that range (for example, the recitation of 1 to 5 includes I, 2, 3, 4, and 5, as well as fractions thereof, e.g., 1.5, 2.25, 3.75, 4.1, and the like) and any range within that range.

[ 0023 ] The term “ammo acid” as used herein refers to naturally occurring and synthetic a, P, y, and 8 ammo acids, and includes but is not limited to, amino acids found in proteins, i.e. glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, praline, serine, threonine, cysteine, tyrosine, asparagine, glutamine, aspartate, glutamate, lysine, arginine and histidine. Alternatively, the amino acid can be a derivative of alanyl, valinyl, leucinyl, isoleucinyl, prolmyl, phenylalaninyl, tryptophanyl, methionmyl, glycinyl, serinyl, threonmyl, cysteinyl, tyrosinyl, asparaginyl, glutammyl, aspartoyl, glutaroyl, lysinyl, argininyl, histidinyl, p-alanyl, P-valinyl, P-leucmyl, p-isoleucinyl, p-prolinyl, p-phenylalanmyl, p-tryptophanyl, p- methioninyl, p-glycmyl, p-serinyl, p-threoninyl, p-cysteinyl, p-tyrosinyl, p-asparaginyl, p- glutammyl, P-aspartoyl, P-glutaroyl, P-lysinyl, P-argininyl or P-histidinyl. When the term amino acid is used, it is considered to be a specific and independent disclosure of each of the esters of a, p y, and 5 glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, praline, serine, threonine, cysteine, tyrosine, asparagine, glutamine, aspartate, glutamate, lysine, arginine and histidine in the D and L-configurations.

[0024] The term “combination therapy”, as used herein, refers to those situations in which two or more different pharmaceutical agents are administered in overlapping regimens so that the subject is simultaneously exposed to both agents. When used in combination therapy, two or more different agents may be administered simultaneously or separately. This administration in combination can include simultaneous administration of the two or more agents in the same dosage form, simultaneous administration in separate dosage forms, and separate administration. That is, two or more agents can be formulated together in the same dosage form and administered simultaneously. Alternatively, two or more agents can be simultaneously administered, wherein the agents are present in separate formulations. In another alternative, a first agent can be administered just followed by one or more additional agents. In the separate administration protocol, two or more agents may be administered a few minutes apart, or a few hours apart, or a few' days apart.

[0025] As used herein, the terms “comprising,” “comprise” or “comprised,” and variations thereof, in reference to defined or described elements of an item, composition, apparatus, method, process, system, etc. are meant to be inclusive or open ended, permitting additional elements, thereby indicating that the defined or described item, composition, apparatus, method, process, system, etc. includes those specified elements— or, as appropriate, equivalents thereof— and that other elements can be included and still fall within the scope/ definition of the defined item, composition, apparatus, method, process, system, etc.

[0026] As used herein, the term “cytokine” refers generically to proteins released by one cell population that act on another cell as intercellular mediators or have an autocrine effect on the cells producing the proteins. Examples of such cytokines include lymphokines, monokines; interleukins (“ILs”) such as IL-I, IL-la, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL- 10, ILLI, IL-12, IL-13, IL-15, IL-17A-F, IL-18 to IL-29 (such as IL-23), IL-31, including PROLEUKIN™ rIL-2; a tumor-necrosis factor such as TNF-a or TNF~p, TGF~pi, TGF-p2, TGF -[33; and other polypeptide factors including leukemia inhibitory factor (“L1F”), ciliary neurotrophic factor (“CNTF”), CNTF-like cytokine (“CLC”), cardiotrophm (“CT”), and kit ligand (“KL”).

[0027] A “derivative” polypeptide or peptide is one that is modified, for example, by glycosylation, pegylation, phosphorylation, sulfation, reduction/alkylation, acylation, chemical coupling, or mild formalin treatment. A derivative may also be modified to contain a detectable label, either directly or indirectly, including, but not limited to, a radioisotope, fluorescent, and enzyme label.

[0028] A “dosing regimen” (or “therapeutic regimen”), as that term is used herein, is a set of unit doses (typically more than one) that are administered individually to a subject, typically separated by periods of time. In some embodiments, a given therapeutic agent has a recommended dosing regimen, which may involve one or more doses. In some embodiments, a dosing regimen comprises a plurality of doses each of which are separated from one another by a time period of the same length; in some embodiments, a dosing regimen comprises a plurality of doses and at least two different time periods separating individual doses. In some embodiments, a dosing regimen is or has been correlated with a desired therapeutic outcome, when administered across a population of patients.

[0029] “Percentage of sequence identity” is determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide or polypeptide sequence in the comparison window'- may comprise additions or deletions (i. e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. In embodiments, the percentage is calculated by determining the number of positions at W'hich the identical nucleic acid base or ammo acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity.

[0030] The term “identical” or percent “identity’,” in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identity' over a specified region, e.g., of an entire polypeptide sequence or an individual domain thereof), when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using a sequence comparison algorithm or by manual alignment and visual inspection. In embodiments, two sequences are 100% identical. In embodiments, two sequences are 100% identical over the entire length of one of the sequences (e.g., the shorter of the two sequences where the sequences have different lengths). In embodiments, identity may refer to the complement of a test sequence. In embodiments, the identity exists over a region that is at least about 10 to about 100, about 20 to about 75, about 30 to about 50 amino acids or nucleotides in length. In embodiments, the identity exists over a region that is at least about 50 ammo acids or nucleotides in length, or over a region that is 100 to 500, 100 to 200, 150 to 200, 175 to 200, 175 to 225, 175 to 250, 200 to 225, 200 to 250 or more amino acids or nucleotides in length. [0031] As used herein, the term “immune cells” generally includes white blood cells (leukocytes) which are derived from hematopoietic stem cells (HSC) produced in the bone marrow “Immune cells” includes, e.g., lymphocytes (T cells, B cells, natural killer (NK) cells) and myeloid-derived cells (neutrophil, eosinophil, basophil, monocyte, macrophage, dendritic cells).

[0032] As used herein, the term “immune cells” generally includes white blood cells (leukocytes) which are derived from hematopoietic stem cells (HSC) produced in the bone marrow “Immune cells” includes, e.g., lymphocytes (T cells, B cells, natural killer (NK) cells) and myeloid-derived cells (neutrophil, eosinophil, basophil, monocyte, macrophage, dendritic cells).

[0033] As used herein, the term “in combination” in the context of the administration of a therapy to a subject refers to the use of more than one therapy for therapeutic benefit. The term “in combination” in the context of the administration can also refer to the prophylactic use of a therapy to a subject when used with at least one additional therapy. The use of the term “in combination” does not restrict the order in which the therapies (e.g., a first and second therapy) are administered to a subject. A therapy can be administered prior to (e.g., 1 minute, 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks before), concomitantly with, or subsequent to (e.g., 1 minute, 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks after) the administration of a second therapy to a subject which had, has, or is susceptible to cancer. The therapies are administered to a subject in a sequence and within a time interval such that the therapies can act together. In a particular embodiment, the therapies are administered to a subject in a sequence and within a time interval such that they provide an increased benefit than if they were administered otherwise. Any additional therapy can be administered in any order with the other additional therapy.

[0034] As used herein, the terms “nucleic acid sequence”, “polynucleotide,” and “gene” are used interchangeably throughout the specification and include complementary DNA (cDNA), linear or circular oligomers or polymers of natural and/or modified monomers or linkages, including deoxyribonucleosides, ribonucleosides, substituted and alpha-anomeric forms thereof, peptide nucleic acids (PNA), locked nucleic acids (LNA), phosphorothioate, methylphosphonate, and the like. Polynucleotides include, but are not limited to, all nucleic acid sequences which are obtained by any means available in the art, including, without limitation, recombinant means, i.e., the cloning of nucleic acid sequences from a recombinant library or a cell genome, using ordinary cloning technology and PCR™, and the like, and by synthetic means.

[0035] As used in this specification and the appended claims, the term “or” is generally employed in its sense including “and/or” unless the content clearly dictates otherwise.

[0036] As used herein, unless otherwise indicated, the terms “peptide”, “polypeptide” or “protein” are used interchangeably herein, and refer to a polymer of amino acids of varying sizes. These terms do not connote a specific length of a polymer of amino acids. Thus, for example, the terms oligopeptide, protein, and enzyme are included within the definition of polypeptide or peptide, whether produced using recombinant techniques, chemical or enzymatic synthesis, or be naturally occurring. This term also includes polypeptides that have been modified or derivatized, such as by glycosylation, acetylation, phosphorylation, and the like.

[0037] The phrase “pharmaceutically acceptable carrier” refers to a carrier for the administration of a therapeutic agent. Exemplary carriers include saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. For drugs administered orally, pharmaceutically acceptable carriers include, but are not limited to pharmaceutically acceptable excipients such as inert diluents, disintegrating agents, binding agents, lubricating agents, sweetening agents, flavoring agents, coloring agents and preservatives. Suitable inert diluents include sodium and calcium carbonate, sodium and calcium phosphate, and lactose, while corn starch and alginic acid are suitable disintegrating agents. Binding agents may include starch and gelatin, while the lubricating agent, if present, will generally be magnesium stearate, stearic acid or talc. If desired, the tablets may be coated with a material such as glyceryl monostearate or glyceryl distearate, to delay absorption in the gastrointestinal tract.

[0038] As used herein, the terms “prognostic” and “predictive information” are used interchangeably to refer to any information that may be used to indicate any aspect of the course of a disease or condition either in the absence or presence of treatment. Such information may include, but is not limited to, the average life expectancy of a patient, the likelihood that a patient will survive for a given amount of time (e.g., 6 months, 1 year, 5 years, etc.), the likelihood that a patient will be cured of a disease, the likelihood that a patient's disease wall respond to a particular therapy (wherein response may be defined in any of a variety of ways). Prognostic and predictive information are included within the broad category of diagnostic information.

[0039] The terms “subject”, “patient” or “individual” are used interchangeably herein, and refers to a mammalian subject to be treated, with human patients being preferred. In some cases, the methods of the disclosure find use in experimental animals, in veterinary application, and in the development of animal models for disease, including, but not limited to, rodents including mice, rats, and hamsters; and primates. Patients in need of therapy comprise those at risk of developing a certain condition, disease or disorder (e.g. due to genetic, environmental or physical attributes, such as for example, obesity). Patients in need of therapy also include those afflicted with a condition, disease or disorder. The diseases or disorders comprise, for example: autoimmune diseases, cancer, inflammatory diseases, neurological diseases or disorders, neuroinflammatory diseases or disorders, cardiovascular disease, obesity, diseases or disorders caused by infectious agents such as, for example, viruses, bacteria, fungi, prions, or parasites.

[0040] As defined herein, a “therapeutically effective” amount of a compound or agent (i.e., an effective dosage) means an amount sufficient to produce a therapeutically (e.g., clinically) desirable result. The compositions can be administered from one or more times per day to one or more times per week; including once every other day. The skilled artisan will appreciate that certain factors can influence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present. Moreover, treatment of a subject with a therapeutically effective amount of the compounds of the disclosure can include a single treatment or a series of treatments.

[0041] “Treating” or “treatment” covers the treatment of a disease-state in a mammal, and includes: (a) preventing the disease-state from occurring in a mammal, in particular, when such mammal is predisposed to the disease-state but has not yet been diagnosed as having it; (b) inhibiting the disease-state, e.g., arresting it development; and/or (c) relieving the disease-state, e.g., causing regression of the disease state until a desired endpoint is reached. Treating also includes the amelioration of a symptom of a disease (e.g., lessen the pain or discomfort), wherein such amelioration may or may not be directly affecting the disease (e.g., cause, transmission, expression, etc.). [0042] The term “variant,” when used in the context of a polynucleotide sequence, may encompass a polynucleotide sequence related to a wild type gene. This definition may also include, for example, “allelic,” “splice,” “species,” or “polymorphic” variants. A splice variant may have significant identity to a reference molecule, but will generally have a greater or lesser number of polynucleotides due to alternate splicing of exons during mRNA processing. The corresponding poly peptide may possess additional functional domains or an absence of domains. Species variants are polynucleotide sequences that vary from one species to another. Of particular utility in the disclosure are variants of wild type gene products. Variants may result from at least one mutation in the nucleic acid sequence and may result in altered mRNAs or in polypeptides whose structure or function may or may not be altered. Any given natural or recombinant gene may have none, one, or many allelic forms. Common mutational changes that give rise to variants are generally ascribed to natural deletions, additions, or substitutions of nucleotides. Each of these types of changes may occur alone, or in combination with the others, one or more times in a given sequence. The resulting polypeptides generally will have significant amino acid identity relative to each other. A polymorphic variant is a variation in the polynucleotide sequence of a particular gene between individuals of a given species. Polymorphic variants also may encompass “single nucleotide polymorphisms” (SNPs,) or single base mutations in which the polynucleotide sequence varies by one base. The presence of SNPs may be indicative of, for example, a certain population with a propensity for a disease state, that is susceptibility versus resistance.

[0043] Ranges provided herein are understood to be shorthand for all of the values within the range. For example, a range of 1 to 50 is understood to include any number, combination of numbers, or sub-range from the group consisting 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50.

[0044] The practice of the present invention employs, unless otherwise indicated, conventional techniques of chemistry, molecular biology, microbiology, recombinant DNA, genetics, immunology, cell biology, cell culture and transgenic biology, which are within the skill of the art. See, e.g., Maniatis et al,, 1982, Molecular Cloning (Cold Spring Harbor Laboratory- Press, Cold Spring Harbor, N.Y.), Samhrooketal., 1989, Molecular Cloning, 2nd Ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.); Sambrook and Russell, 2001 , Molecular Cloning, 3rd Ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.); Ausubel et al., 1992), Current Protocols in Molecular Biology (John Wiley & Sons, including periodic updates); Glover, 1985, DNA Cloning (IRL Press, Oxford); Anand, 1992; Guthrie and Fink, 1991; Harlow and Lane, 1988, Antibodies, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.); Jakoby and Pastan, 1979; Nucleic Acid Hybridization (B. D. Haines & S. J. Higgins eds. 1984); Transcription And Translation (B. D. Hanies & S. J. Higgins eds. 1984); Culture Of Animal Cells (R. I. Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells And Enzymes (JRL Press, 1986); B. Perbal, A Practical Guide To Molecular Cloning (1984); Methods In Enzymology (Academic Press, Inc., N.Y.); Gene Transfer Vectors For Mammalian Cells (J. H. Miller and M. P. Cales eds., 1987, Cold Spring Harbor Laboratory); Methods In Enzymology, V ols. 154 and 155 (Wu et al. eds.), Immunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook Of Experimental Immunology, Volumes I-IV (D. M. Weir and C. C. Blackwell, eds., 1986); Riott, Essential Immunology, 6th Edition, Blackwell Scientific Publications, Oxford, 1988; Hogan et al., Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986); Westerfield, M., The zebrafish book. A guide for the laboratory use of zebrafish (Danie rerio), (4th Ed., Univ, of Oregon Press, Eugene, 2000).

[0045] Any compositions or methods provided herein can be combined with one or more of any of the other compositions and methods provided herein,

BRIEF DESCRIPTION OF THE DRAWINGS

[0046] FIG. 1: Evolution of sub-retinal fibrosis upon three intramuscular treatments with IMT504.

[0047] HG. 2: Evolution of Diabetic Retinopathy upon two intramuscular treatments with IMT504 (left eye).

[0048] HG. 3: Evolution of Diabetic Retinopathy upon two intramuscular treatments with IMT504 (right eye).

DETAILED DESCRIPTION

[0049] We have now, surprisingly found, that systemic (i.m, s.c. or i.v.) inoculation with an appropriate aqueous preparation of the immunoprotective/immunoregenerative oligonucleotide IMT504 (18) results in significant improvement of ocular medical conditions including fibrosis. This treatment, while effective and well tolerated, is free from complications, specifically associated with intravitreal injections.

[0050] Anti-VEGF therapies are currently the most common therapies used for the treatment of maculopathies (12). These treatments are administered by invasive intravitreal injections, generally, after several medical consults and in a well-equipped optometric clinic. The expectation of receiving intraocular anti-VEGF injections is, often, a stressful experience for patients who suffer great anxiety anticipating the upcoming pain and discomfort (13, 14, 15).

[0051 ] On the other hand, the repeated and long-term applied intravitreal injections that are commonly needed in anti-VEGF treatments increases the chance of ocular complications (16) such as infectious endophthalmitis, intraocular inflammation, retinal detachment, intraocular pressure elevation and ocular hemorrhage (15). Besides, approximately one-third of patients receiving anti-VEGF treatment) develop macular fibrosis or atrophy (17). Once established, fibrosis results in permanent loss of vision without available treatment so far.

Compositions

[0052] IMT504 is a 24 base oligodeoxynucleotide (ODN) with phosphorothioate bonds comprising a nucleotide sequence as follows:

[0053] (5 ') TCA TCATTTTGTCAT1 TTGTC A TT (3').

[0054| This ODN is the prototype of a class of immunomodulatory oligonucleotides that have a common sequence with the PyNTTTTGT composition (19,20). Components of this class directly activate B lymphocytes and plasmacytoid dendritic cells and indirectly activate NK and NKT cells in collaboration with interleukin 2 (IL2) (21). Some of the consequences of this multiple cell activation are the secretion of interleukins IL6, IL10, GM-CSF, IFNy and TNFa and the increase of a series of surface molecules such as CD40, CD86, MHC I and MHC II. On the other hand, IMT504 increases the number of precursors of mesenchymal stem cells (MSC) in vitro and in vivo (22). In a recent study our research team has found that B cells incubated with IMT504 differentiate into cells with a strong homeostatic phenotype (Bhom cells) that may collaborate with MSC in restoring homeostasis of damaged tissues. This effect may be attained using systemically inoculated IMT504, without significant generation of unwanted side effects based on its safety according to precl inical studies and human compassionate treatments (23, 24). Thus, injecting IMT504 systemically offers a better solution than injecting anti- VEGF antibodies intravitreally, due to the already described complications brought about by the latter. Moreover, IMT504 injections can make people regain sight after suffering from macular fibrosis, an effect never observed so far in human medicine.

[0055] IMT504 is an immunomodulatory phosphorothioate oligonucleotide, therapeutically effective when injected in mammals suffering several medical disorders (18). On the other hand, it has been demonstrated that IMT504 is able to induce the expansion of mesenchymal stem cells (MSCs) both, in vitro and in vivo (22). Without wishing to be bound by theory, it was postulated that the therapeutic activity of IMT504 may be mainly owing to the antiinflammatory and pro-repairing activity’ of IMT504 induced MSCs (18). However, it was now found that purified human CD19~ B cells incubated with IMT504 for more than 20 hours, generate a previously unknown B cell differentiated phase that is termed herein as “Bhoni” and is characterized by high expression of genes codifying proteins involved in keeping cell homeostasis and/or restoring homeostasis in damaged cells. Therefore, according to its properties, Bhom cells may’ be also key players in the therapeutic effect of IMT504. Thus, induction of Bhoni cells and activation of MSC in vivo may partially explain why’ systemically injected IMT504 therapeutic effect on several diseases in which multiple factors has contribute to the pathological process. This is the case of retinal degenerative diseases, in which excessive VEGF production has been pointed out as an important pathogenic factor but in which several other factors contribute to the deteriorating process (1 -11). For additional clarification, some of these processes are now briefly described:

[0056] Fibrosis: Sub-retinal fibrosis is a result of a wound healing response that follows choroidal neovascularization in wet age-related macular degeneration (wet AMD). Sub-retinal fibrosis is also a frequent outcome in proliferative diabetic retinopathy (PDR). Sub-retinal fibrosis can cause local destruction of photoreceptors, retinal pigment epithelium (RPE), and choroidal vessels leading to permanent dysfunction of the macular visual system (25). In this regard, a notable decrease in fibrous mass has been observed after treatment with IMT504 in a patient who presented massive fibrosis in the left eye with loss of vision (see EXAMPLE 1).

[0057] This positive outcome was highly surprising, since no available treatment is able to produce this effect (26). [0058] Excessive Angiogenesis and Endothelium dysfunction: .AMD and DR share a hypoxic retinal environment, which is a major inducer of vascular endothelial growth factor (VEGF) synthesis. Overexpression of VEGF promotes neovascularization, leakage, edema, and hemorrhage bringing about retinal damage (27). Surprisingly treatment with injections of IMT504 produced marked recession of edema in both eyes of a patient (EXAMPLES 2 and 3). Notably , this effect remained unchanged after twenty months without any further intervention.

[0059] ZffAS’ damage The retina is exposed to chronic oxidative stress by constant exposure to light and reactive oxygen species (ROS) generated by the high oxygen consumption. Excessive oxidative stress induces harmful changes in retina that result in optical deficiency and ultimately in visual loss. In A.MD, DR, glaucoma and retinal vein occlusion (RVO), oxidative stress plays a central role in the development and acceleration of disease. (28). Several antioxidant protein genes are induced during differentiation of CD19⁺ B human B cells to Bhom that can contribute to lower oxidative stress.

[0060] Inflammation: Abundant evidence supports a role for inflammation in the pathogenesis of retinal diseases, including AMD, DR, retinal vein occlusion (RVO) and retinitis pigmentosa (RP) (29). IMT504 treatment have been demonstrated to be effective to resolve both, acute and chronic inflammatory conditions (30, 31). Therefore, one of the IMT504 positive effects on eye degeneration may be related to its antiinflammatory action.

[0061] Accordingly, in certain embodiments, a pharmaceutical composition comprises a therapeutically effective amount of a phosphorothioate oligonucleotide IMT504, having the sequence TCATCATTTTGTCATTTTGTCATT (SEQ ID NO: 1). In certain embodiments, a pharmaceutical composition comprises a therapeutically effective amount of a phosphorothioate oligonucleotide having at least a 50% sequence identity to SEQ ID NO: 1 . In certain embodiments, a pharmaceutical composition comprises a therapeutically effective amount of a phosphorothioate oligonucleotide having at least a: 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or at least a 99.9% sequence identity to SEQ ID NO: 1. The term “percent sequence identity” refers to the degree of identity between any given query sequence and a subject sequence.

Combination Therapy [0062] Compositions of the disclosure may be combined in a pharmaceutical combination formulation, or dosing regimen as combination therapy, with a second compound. The second compound of the pharmaceutical combination formulation or dosing regimen preferably has complementary activities to the compounds of the disclosure such that they do not adversely affect the other(s). Such molecules are suitably present in combination in amounts that are effective for the purpose intended.

[0063] In certain embodiments, a pharmaceutical composition comprises a therapeutically effective amount of the phosphorothioate oligonucleotide IMT504, having the sequence TCATCATTTTGTCATTTTGTCATT (SEQ ID NO: I) and a second agent. The second agent can be, for example, a cytokine, a chemokine, an anti-inflammatory agent, a non-steroidal antiinflammatory’ drug with analgesic, antipyretic and anti-inflammatory effects, an immune modulator, an immunotherapeutic, a targeted therapeutic agent, a T cell expressing a chimeric antigen receptor, an angiogenesis inhibitor, an antineoplastic agent, a B-cell modulator, a T-cell modulator, a NK cell modulator, an enzyme, a siRNA, a protease inhibitor, an anti-oxidant or combinations thereof.

[0064] The combination therapy may be administered as a simultaneous or sequential regimen. When administered sequentially, the combination may be administered in two or more administrations. The combined administration includes coadministration, using separate formulations or a single pharmaceutical formulation, and consecutive administration in either order, wherein preferably there is a time period while both (or all) active agents simultaneously exert their biological activities. Suitable dosages for any of the above co-administered agents are those presently used and may be lowered due to the combined action (synergy) of the newly identified agent and other chemotherapeutic agents or treatments,

[0065] The combination therapy may provide “synergy” and prove “synergistic”, e.g. the effect achieved when the active ingredients used together is greater than the sum of the effects that results from using the compounds separately, A synergistic effect may be attained when the active ingredients are: (1) co-formulated and administered or delivered simultaneously in a combined, unit dosage formulation; (2) delivered by alternation or in parallel as separate formulations, or (3) by some other regimen. When delivered in alternation therapy, a synergistic effect may be attained when the compounds are administered or delivered sequentially, e.g. by different injections in separate syringes. In general, during alternation therapy, an effective dosage of each active ingredient is administered sequentially, e.g. serially, whereas in combination therapy, effective dosages of two or more active ingredients are administered together.

Modified or Mutated Nucleic Acid Sequences

[0066] In certain embodiments, the phosphorothioate oligonucleotide has at least a 50% sequence identity to SEQ ID NO: 1. In certain embodiments, the phosphorothioate oligonucleotide has at least a: 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or at least a 99.9% sequence identity to SEQ ID NO: 1. The term “percent sequence identity” refers to the degree of identity between any given query sequence and a subject sequence.

[00671 In certain embodiments, the nucleic acid sequence of SEQ ID NO: 1 may be modified or derived from a native nucleic acid sequence, for example, by introduction of mutations, deletions, substitutions, modification of nucleobases, backbones and the like. Examples of some modified nucleic acid sequences envisioned for this disclosure include those comprising modified backbones, for example, phosphorothioates, phosphotriesters, methyl phosphonates, short chain alkyl or cycloalkyl intersugar linkages or short chain heteroatomic or heterocyclic intersugar linkages.

[0068] In some embodiments, modified oligonucleotides comprise those with phosphorothioate backbones and those with heteroatom backbones, CEb --NH--O--CH2, CH,— N(CH?)— O— CH₂ [known as a methylene(methylimino) or MMI backbone], CH2. --O— N (CH3)— CH2, CH2 — N (CEb)--N (CH?)— CEb and O— N (CH?)-- CEb— CEb backbones, wherein the native phosphodiester backbone is represented as O— P— O— CH). The amide backbones disclosed by De Mesmaeker el al. Ace. Chem. Res. 1995, 28:366-374) are also embodied herein. In some embodiments, the nucleic acid sequences having morpholino backbone structures (Summerton and Weller, U.S, Pat. No. 5,034,506), peptide nucleic acid (PNA) backbone wherein the phosphodi ester backbone of the oligonucleotide is replaced with a polyamide backbone, the nucleobases being bound directly or indirectly to the aza nitrogen atoms of the polyamide backbone (Nielsen etal. Science 1991, 254, 1497). The nucleic acid sequences may also comprise one or more substituted sugar moieties. The nucleic acid sequences may also have sugar mimetics such as cyclobutyls in place of the pentofuranosyl group. [0069] The nucleic acid sequence of SEQ ID NO: I may also include, additionally or alternatively, nucleobase (often referred to in the art simply as “base”) modifications or substitutions. As used herein, “unmodified” or “natural” nucleobases include adenine (A), guanine (G), thymine (T), cytosine (C) and uracil (U). Modified nucleobases include nucleobases found only infrequently or transiently in natural nucleic acids, e.g., hypoxanthine, 6- methyladenine, 5- Me pyrimidines, particularly 5-methylcytosme (also referred to as 5-methyl-2' deoxycytosine and often referred to in the art as 5-Me-C), 5 -hydroxymethylcytosine (HMC), glycosyl HMC and gentobiosyl HMC, as well as synthetic nucleobases, e.g., 2-aminoadenine, 2- (methylammo)adenine, 2-(imidazolylalkyl) adenine, 2-(aminoalklyamino) adenine or other heterosubstituted alkyladenines, 2-thiouracil, 2-thiothymine, 5-bromouracil, 5- hydroxymethyluracil, 8-azaguanme, 7-deaza guanine, N⁶ (6-aminohexyl)adenine and 2,6- diaminopurine. Kornberg, A., DNA Replication, W. H. Freeman & Co., San Francisco, 1980, pp75-77; Gebeyehu, G., et cd. Nucl. Acids Res. 1987, 15:4513). A “universal” base known in the art, e.g., inosine may be included. 5-Me-C substitutions have been shown to increase nucleic acid duplex stability' by 0.6-1.2°C. (Sanghvi, Y. S., in Crooke, S. T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278).

[0070] Another modification of the nucleic acid sequences of the disclosure involves chemically linking to the nucleic acid sequences one or more moieties or conjugates which enhance the activity or cellular uptake of the oligonucleotide. Such moieties include but are not limited to lipid moieties such as a cholesterol moiety', a cholesteryl moiety (Letsinger el al., Proc. Natl. Acad. Set. USA 1989, 86, 6553), cholic acid (Manoharan et al Bioorg. Med Chem. Let. 1994, 4, 1053), a thioether, e.g., hexyl-S-tntylthiol (Manoharan et al. Ann. NY. Acad. Sei. 1992, 660, 306; Manoharan et al. Bioorg. Med. Chem. Let. 1993, 3, 2765), a thiocholesterol (Oberhauser et al., Nucl. Acids Res. 1992, 20, 533), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison- Behmoaras et al. EMBO J. 1991, 10, 111, Kabanov et al. FEBS Lett. 1990, 259, 327; Svinarchuk et al. Biochimie 1993, 75, 49), a phospholipid, e.g., di-hexadecyl-rac-glycerol or tri ethylammonium l,2-di-O-hexadecyl-rac-g1ycero-3-H-phosphonate (Manoharan et al. Tetrahedron Lett. 1995, 36, 3651 ; Shea et al. Nucl. Acids Res. 1990, 18, 3777), a polyamine or a polyethylene glycol chain (Manoharan et al. Nucleosides & Nucleotides 1995, 14, 969), or adamantane acetic acid (Manoharan et cd. Tetrahedron Lett. 1995, 36, 3651). It is not necessary for ah positions in a given nucleic acid sequence to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single nucleic acid sequence or even at within a single nucleoside within a nucleic acid sequence.

[0071] The isolated nucleic acid molecules of the present disclosure can be produced by standard techniques. For example, polymerase chain reaction (PCR) techniques can be used to obtain an isolated nucleic acid containing a nucleotide sequence described herein. Various PCR methods are described in, for example, PCR Primer: A Laboratory Manual, Dieffenbach and Dveksler, eds., Cold Spring Harbor Laboratory Press, 1995. Generally, sequence information from the ends of the region of interest or beyond is employed to design oligonucleotide primers that are identical or similar in sequence to opposite strands of the template to be amplified. Various PCR strategies also are available by which site-specific nucleotide sequence modifications can be introduced into a template nucleic acid. Isolated nucleic acids also can be chemically synthesized, either as a single nucleic acid molecule (e.g., using automated DNA synthesis in the 3' to 5' direction using phosphoramidite technology) or as a series of oligonucleotides. For example, one or more pairs of long oligonucleotides (e.g, >50-100 nucleotides) can be synthesized that contain the desired sequence, with each pair containing a short segment of complementarity (e.g., about 15 nucleotides) such that a duplex is formed when the oligonucleotide pair is annealed. DNA polymerase is used to extend the oligonucleotides, resulting in a single, double- stranded nucleic acid molecule per oligonucleotide pair, which then can be ligated into a vector.

[0072] The nucleic acid sequences may be “chimeric,” that is, composed of different regions. In the context of this disclosure “chimeric” compounds are oligonucleotides, which contain two or more chemical regions, for example, DNA region(s), RNA region(s), PNA region(s) etc. Each chemical region is made up of at least one monomer unit, i.e., a nucleotide. These sequences typically comprise at least one region wherein the sequence is modified in order to exhibit one or more desired properties.

Modified Amino Acids Sequences

[0073] In certain embodiments, the ammo acid sequence, SEQ ID NO: 1 , comprises one or more modified amino acids, one or more derivatives and combinations thereof. As used herein, “variant” of polypeptides refers to an amino acid sequence that is altered by one or more amino acid residues. The variant may have “conservative” changes, wherein a substituted amino acid has similar structural or chemical properties (e.g., replacement of leucine with isoleucine). More rarely, a variant may have “nonconservative” changes (e.g., replacement of glycine with tryptophan). Analogous minor variations may also include ammo acid deletions or insertions, or both. Guidance in determining which ammo acid residues may be substituted, inserted, or deleted without abolishing biological activity may be found using computer programs well known in the art, for example, LASERGENE software (DNASTAR).

[0074] The amino acid sequence of SEQ ID NO: I can be modified. For example, the nucleotide sequence encoding SEQ ID NO: 1 can be modified to encode biologically active variants of SEQ ID NO: 1, and these variants can have or can include, for example, an amino acid sequence that differs from the SEQ ID NO: 1 encoded ammo acid sequence by virtue of containing one or more mutations (e.g., an addition, deletion, or substitution mutation or a combination of such mutations). One or more of the substitution mutations can be a substitution (e.g., a conservative amino acid substitution). For example, a biologically active variant of the polypeptide encoded by SEQ ID NO: 1 can have an amino acid sequence with at least or about 50% sequence identity (e.g., at least, or about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% sequence identity) to SEQ ID NO: 1 encoded peptide. Conservative amino acid substitutions typically include substitutions within the following groups: glycine and alanine; valine, isoleucine, and leucine; aspartic acid and glutamic acid; asparagine, glutamine, serine and threonine; lysine, histidine and arginine; and phenylalanine and tyrosine. The amino acid residues in the amino acid sequence can be non-naturally occurring amino acid residues. Naturally occurring amino acid residues include those naturally encoded by the genetic code as well as nonstandard ammo acids (e.g. , amino acids having the D-configuration instead of the L-configuration). The present peptides can also include amino acid residues that are modified versions of standard residues (e.g. pyrrolysine can be used in place of lysine and selenocysteine can be used in place of cysteine). Non-naturally occurring ammo acid residues are those that have not been found in nature, but that conform to the basic formula of an ammo acid and can be incorporated into a peptide. These include D- alloisoleucine(2R,3S)-2-amino-3-inethylpentanoic acid and L- cyclopentyl glycine (S)-2-amino-2- cyclopentyl acetic acid. For other examples, one can consult textbooks or the worldwide web (a site currently maintained by the California Institute of Technology displays structures of non-natural ammo acids that have been successfully incorporated into functional proteins).

Methods and Uses Thereof [0075] The disclosure provides a method for preventing or treating ocular disorders consisting of intramuscular (i.m), subcutaneous (s.c.) or intravenous (i.v.) injection of an appropriate solution containing a suitable concentration of the phospliorothioate oligonucleotide IMT504 with the following sequence:

[0076] 5'-TCATCATTTTGTCATTTTGTCATT-3' (SEQ ID NO: I), m an appropriate unitary dose, once a day, for at least five s uccessive days. A total of five or more successive unitary doses can be given to the patient in order to achieve a therapeutically acceptable effect on the ocular medical condition.

[0077] In an embodiment, the chosen treatment can be repeated once per month, once every two months, once every three months, once every five months or once every six months. However, many other schedules may be also effective depending on the patient and the specific ocular condition.

[0078] In certain embodiments the effective unitary dose of IMT504 is of 10 mg or 20 mg or 30 mg or 40 mg or 50 mg or 60 mg or 70 mg or 80 mg and a total of 5 or 7 or 9 or 12 unitary daily unitary doses.

[0079] In other embodiments, a composition comprises a therapeutically effective amount of a phospliorothioate oligonucleotide having at least a 50% sequence identity’ to SEQ ID NO: 1 (IMT504) and one or more anti-inflammatory' agents, other therapeutics, immunosuppressive agents or combinations thereof.

[0080] In one embodiment, the inventive method comprises submitting to a mammal, including humans, a dose of the phospliorothioate oligonucleotide IMT504, having the sequence TCATCATTTTGTCATTTTGTCATT (SEQ ID NO: 1), within an adequate schedule, to provide a therapeutically effective effect for a given ocular medical condition. Within the scope of the disclosure, an effect is therapeutically effective if partially or completely cures a disease.

[0081] Exemplary’ ocular diseases which may be treated by the present method include, but are not limited to, diabetic retinopathy and age-related macular degeneration.

[0082] In certain embodiments, the inventive method comprises administering a “prophylactically effective amount” of phosphorothioate oligonucleotide to a person that suffers a medical condition that may result in development of an eye disease. For example, the condition is diabetes that frequently results in development of retinopathy. “Prophy tactically effective amount” refers to an amount effective, at dosages and for periods of time necessary, to attain a desired prophylactic result (e.g., prevention of diabetic retinopathy).

[00831 In certain embodiments, the method comprises administration of the phosphorothioate oligonucleotide in combination with one or more therapeutic agents.

10084 i As used herein, the term “combination” embraces groups of compounds or nondrug therapies useful as part of a combination therapy. Such combination treatment is achieved by way of the simultaneous, sequential, or separate dosing of the individual components of the treatment. In certain examples, a composition of the disclosure is conjointly administered with one or more anti-inflammatory agents, chemotherapeutics, other therapeutics, or combinations thereof.

[0085] In certain embodiments, a composition of the disclosure is administered in combination with a non-steroidal anti-inflammatory. Suitable non-steroidal anti-inflammatory compounds include, but are not limited to, piroxicam, diclofenac, etodolac, indomethacin, ketoralac, oxaprozin, tolmetin, naproxen, flubiprofen, fenoprofen, ketoprofen, ibuprofen, mefenamic acid, sulindac, apazone, phenylbutazone, aspirin, celecoxib and rofecoxib.

[00861 According to the methods of the disclosure, the agents of may be administered prior to, concurrent with, or following the other therapeutic compounds or therapies. The administration schedule may involve administering the different agents in an alternating fashion. In other embodiments, the agent may be delivered before and during, or during and after, or before and after treatment with other therapies. In some cases, the agent is administered more than 24 hours before the administration of the second agent treatment.

Pharmaceutical Compositions

[0087] In certain embodiments, a pharmaceutical composition comprises a therapeutically effective amount of SEQ ID NO: 1, variants, derivatives or peptides thereof. The composition can be suitably formulated and introduced into a subject or the environment of a cell by any means recognized for such delivery. Such compositions typically include the agent and a pharmaceutically acceptable carrier. As used herein the language “pharmaceutically acceptable carrier” includes saline, solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration.

[0088] Supplementary active compounds can also be incorporated into the compositions.

[0089] A pharmaceutical composition is formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical), transmucosal, and rectal administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.

[0090] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, NJ.) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, using a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin. Compositions of the present disclosure are administered to subjects in a variety of routes including but not limited to: intravenous administration, parenteral administration, intraperitoneal administration, intramuscular administration, intraarterial administration, ocular administration, intraocular administration, transderrnal administration, transmucosal administration, inhaled administration, or subcutaneous administration.

[0091 ] Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in a selected solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle, which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

[0092 ] In certain embodiments, the SEQ ID NO: 1, derivatives or variants thereof: can be formulated for administration via an ocular route. The ophthalmic formulations further comprise at least one ophthalniically acceptable excipient such as, but not limited to, demulcent, tonicity adjusting agent, preservative, buffering agent, pH adjusting agent, solubilizing agent, surfactant, chelating agent, penetration enhancer, emulsifying agent, suspending agent, stabilizing agent, antioxidant, carrier, plasticizer, release modifying or controlling excipients, ion exchange resins and the like. Suitable demulcents include, but are not limited to, glycerin, polyvinyl pyrrolidone, polyethylene oxide, polyethylene glycol (PEG) such as but not limited to PEG 400, PEG 300 and the like or combinations thereof; propylene glycol, sorbitol and polyacrylic acid and the like or combinations thereof. Tomcity adjusting agents useful in the compositions of the present disclosure may include, but. are not limited to, salts such as, but not limited to, sodium chloride, potassium chloride and calcium chloride, non- ionic tonicity agents may include, but are not limited to, propylene glycol, glycerol, mannitol, dextran and the like or combinations thereof.

[0093] The compositions of the present disclosure can be prepared in a variety of ways known to one of ordinary skill in the art. Regardless of their original source or the manner in which they are obtained, the compositions of the disclosure can be formulated in accordance with their use. For example, the nucleic acids and vectors described above can be formulated within compositions for application to cells in tissue culture or for administration to a patient or subject. Any of the pharmaceutical compositions of the disclosure can be formulated for use in the preparation of a medicament, and particular uses are indicated below in the context of treatment. These compositions can be prepared in a manner well known in the pharmaceutical art, and can be administered by a variety of routes, depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic and to mucous membranes including intranasal, vaginal and rectal delivery), pulmonary (e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdernial), ocular, oral or parenteral. Methods for ocular deliver}' can include topical administration (eye drops), subconjunctival, periocular or intravitreal injection or introduction by balloon catheter or ophthalmic inserts surgically placed in the conjunctiva! sac. Parenteral administration includes intravenous, intra-arterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g,, intrathecal or intraventricular administration. Parenteral administration can be in the form of a single bolus dose, or may be, for example, by a continuous perfusion pump. Pharmaceutical compositions and formulations for topical administration may include transdernial patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids, powders, and the like. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable.

[0094] This disclosure also includes pharmaceutical compositions which contain, as the active ingredient, polypeptides, nucleic acids and vectors described herein in combination with one or more pharmaceutically acceptable carriers. The term “pharmaceutically acceptable carrier”, includes any and all solvents, dispersion media, coatings, antibacterial, isotonic and absorption delaying agents, buffers, excipients, binders, lubricants, gels, surfactants and the like, that may be used as media for a pharmaceutically acceptable substance. In making the compositions of the disclosure, the active ingredient is typically mixed with an excipient, diluted by an excipient or enclosed within such a carrier in the form of, for example, a capsule, tablet, sachet, paper, or other container. When the excipient serves as a diluent, it can be a solid, semisolid, or liquid material (e.g., normal saline), which acts as a vehicle, carrier or medium for the active ingredient. Thus, the compositions can be in the form of tablets, pills, powders, lozenges, sachets, cachets, elixirs, suspensions, emulsions, solutions, syrups, aerosols (as a solid or in a liquid medium), lotions, creams, ointments, gels, soft and hard gelatin capsules, suppositories, sterile injectable solutions, and sterile packaged powders. As is known in the art, the type of diluent can vary depending upon the intended route of administration. The resulting compositions can include additional agents, such as preservatives. In some embodiments, the carrier can be, or can include a lipid-based or polymer-based colloid. In some embodiments, the carrier material can be a colloid formulated as a liposome, a hydrogel, a microparticle, a nanoparticle, or a block copolymer micelle. As noted, the carrier material can form a capsule, and that material may be a polymer-based colloid.

[0095] In some instances, the topical ocular formulation is a solution, a suspension, creams, ointments, gels, gel-forming liquid, suspension containing liposomes or micelles, spray formulation, or an emulsion, fu some cases, the topical ocular formulation also includes one or more pharmaceutically acceptable excipients selected from stabilizers, surfactants, polymer base carriers, gelling agents, organic co-solvents, pH active components, osmotic active components and with or without preservatives. In some cases, the sustained release semi-solid formulation, sustained release solid formulation or ocular implant is injected into the affected eye. In some embodiments, the sustained release semi-solid formulation, sustained release solid formulation or ocular implant further comprises a pharmaceutically acceptable excipient. In some cases, the sustained release semi-solid formulation, sustained release solid formulation or ocular implant includes one or more secondary agents; and a biodegradable polymer selected from polylactic acid (PL. A), polyglycolic acid (PLGA) and polylactic acid and polyglycolic acid copolymers.

[0096] The ophthalmic formulations further comprise at least one ophtbalmically acceptable excipient such as, but not limited to, demulcent, tonicity adjusting agent, preservative, buffering agent, pH adjusting agent, solubilizing agent, surfactant, chelating agent, penetration enhancer, emulsifying agent, suspending agent, stabilizing agent, antioxidant, carrier, plasticizer, release modifying or controlling excipients, ion exchange resins and the like. Suitable demulcents include, but are not limited to, glycerin, polyvinyl pyrrolidone, polyethylene oxide, polyethylene glycol (PEG) such as but not limited to PEG 400, PEG 300 and the like or combinations thereof; propylene glycol, sorbitol and polyacrylic acid and the like or combinations thereof. Tonicity adjusting agents useful in the compositions of the present disclosure may include, but are not limited to, salts such as, but not limited to, sodium chloride, potassium chloride and calcium chloride, non- ionic tonicity agents may include, but are not limited to, propylene glycol, glycerol, mannitol, dextran and the like or combinations thereof.

[ 00971 Suitable chelating agents may include, but are not limited to, EDTA and its salts.

Solubilizing agents, that may be employed include, but are not limited to, CREMOPHOR EL®, tween 80, cyclodextrin and the like or combinations thereof. Suitable cyclodextrins may be employed, such as, but not limited to, a-cyclodextrin, P-cyclodextrin y-cyclodextrin, hydroxypropyl-p-cyclodextrin, hydroxypropyl- y-cyclodextnn, dimethyl-p-cyclodextrin and dimethyi-y -cyclodextrin, and the like or combinations thereof. pH adjusting agents may include sodium hydroxide, hydrochloric acid, boric acid, Tris, triethanolamine and sodium hydroxide.

[0098] Suitable buffering agents include, but are not limited to, phosphates, acetates and the like, and amino alcohols such as 2-amino-2-methyl-l -propanol (AMP), ascorbates, borates, hydrogen carbonate/carbonates, citrates, gluconates, lactates, propionates and TRIS (tromethamine) buffers, and the like or combinations thereof. Suitable preservatives include, but are not limited to, benzalkonium chloride, polyquatemium- 1 , p- hydroxybenzoic acid ester, sodium perborate, sodium chlorite, alcohols such as chlorobutanol, benzyl alcohol or phenyl ethanol, guanidine derivatives such as polyhexamethylene biguanide, sodium perborate, sorbic acid, and the like or combinations thereof. Suitable penetration enhancers that may optionally be employed include, but are not limited to, polyoxyethylene glycol lauryl ether, polyoxyethylene glycol stearyl ether, polyoxyethylene glycol oleyl ether, sodium taurocholate, saponins, CREMOPHOR EL, and the like or combinations thereof.

[0099] Suitable surfactants that may be employed include, but are not limited to, ionic and nonionic surfactants, and the like or combinations thereof. Suitable nonionic surfactants include, but are not limited to, poloxamers, tyloxapol, polysorbates, polyoxyethylene castor oil derivatives, sorbitan esters, polyoxyl stearates and a mixture of two or more thereof. Suitable pharmaceutical carriers include sterile water; electrolytes such as sodium chloride, dextrose, dextrose in water or saline; lower alkanols, ointment bases such as but not limited to, natural wax e.g. white bees wax, carnauba wax, wool wax (wool fat), purified lanolin, anhydrous lanolin; petroleum wax e.g. solid paraffin, microcrystalline wax; hydrocarbons e.g. liquid paraffin, white petrolatum (e.g. white PROTOPET®), yellow petrolatum, and the like or combinations thereof. Suitable emulsifying agent may be included such as, but not limited to, mono- or di-glyceride of a fatty acid, phosphatide, e.g., lecithin, polysorbates, macrogols, poloxamers, tyloxapol, polyethylene glycol derivatives, polyvinyl alcohol and the like, and mixtures thereof. Suitable stabilizing agent such as, but not limited to, polyethylene glycol hydroxystearate, thiourea, thiosorbitol, sodium dioctyl sulfosuccinate, monothioglycerol and the like, or combinations thereof may be employed. Antioxidants such as, but not limited to, ascorbic acid, acetylcysteine, cysteine, sodium hydrogen sulfite, butylated hydroxyanisole, butylated hydroxytoluene or alpha- tocopherol acetate may be employed. Plasticizers, such as, but not limited to, glycerol, and the like may be employed.

[00100] Release modifying or controlling excipients, such as but not limited to, polymeric release modifying or controlling excipients, non-polymeric release modifying or controlling excipients or combinations thereof may be included in the compositions of the present disclosure. Exemplary release modifying or controlling excipients include glyceryl behenate, chitosan, carrageenan, cellulose derivatives such as ethylcellulose, acrylic acid and methacrylic acid polymers or copolymers and the like, or derivatives or combinations thereof. The ophthalmic formulations of the present disclosure may optionally include additional viscosity enhancing agents such as, but not limited to, cellulose and cellulose derivatives, such as, but not limited to, methylcellulose, hydroxypropylcellulose, hydroxyethyl cellulose, ethylhydroxyethyl cellulose, hydroxypropylmethylcellulose, sodium carboxy methylcellulose, cellulose acetophthalate, and the like or combinations thereof; alginic acid, sodium alginate, propylene glycol alginate, polyvinylpyrrolidone, carboxyvinyl polymers or carbomers (CARBOPOL®), polyvinyl alcohol, glycerin, polyethylene glycol, triblock copolymers of polyoxypropylene and polyoxyethylene, poly ethoxylated sorbitan, polysorbate 80, chondroitin sulfate, dimethicone, perfluorononyl dimethicone, cyclomethicone, dextrans, proteoglycans, natural polysaccharides, such as, but not limited to, hyaluronic acid and salts thereof, guar gum, karaya, xyloglucan gum, chitosan, gellan gum, pectin, collagen, modified collagen and like or combinations thereof.

[00101] The ophthalmic formulations of the present disclosure may optionally include additional gelling agents such as, but not limited to, polysaccharide gums such as, but not limited to, gellan gum, tamarind gum, tragacanth, locust bean gum, agarose, carageenans, guar gum, hydroxypropyl guar gum, hyaluronic acid, chitosan, konjac, acacia, pectin, arable, curdlan, glucan gum, scleroglucan and sulfated glucan sulfate and the like or combinations thereof, cellulose and its derivatives such as, but not limited to, methyl cellulose, carboxymethyl cellulose, methyl cellulose, hydroxypropyl cellulose, methyl hydroxypropyl cellulose, hydroxypropyl methyl cellulose, cellulose acetate, ethyl cellulose, methyl hydroxyethyl cellulose, hydroxyethyl cellulose, cellulose gum, and the like or combinations thereof; cross- linked acrylic polymers or carbomer (CARBOPOL™), aloe vera gel, polyvinyl alcohol, polyacrylamide, poloxamer, polymethylvinylether-maleic anhydride, swellable water-insoluble polymers such as, but not limited to, hydrogel and the like or combinations thereof. Ion exchange resins such as, but not limited to, inorganic zeolites or synthetically produced organic resins may be employed in the compositions of the present disclosure. The ophthalmic formulations of the present disclosure may optionally include additional mucodhesive agents such as, but not limited to, polyacrylic acid, hyaluronans, chitosan, pullulan, cellulose derivatives such as, but not limited to, methyl cellulose, hydroxypropyl methyl cellulose, sodium carboxymethylcellulose, poly (galacturonic) acid, sodium alginate, pectin, xyloglucan, xanthan gum, carbomers (CARBOPOL™), polyvinyl alcohol, polyvinylpyrrolidone, polyethylene glycol, poloxamer, and the like or combinations thereof.

[00102] The above listing of examples is given for illustrative purposes and is not intended to be exhaustive. Examples of other agents useful for the foregoing purposes are well known in ophthalmic formulation and are contemplated by the present disclosure. It is also contemplated that the concentrations of the excipients in the formulations of the present disclosure can vary. The ophthalmic formulations of the present disclosure can be in the form of eye drops, eye lotions, suspensions, dispersions, gels, ointments, emulsions, colloidal solutions, ocular inserts, ocular hydrogels, films, minitablets, nanoemulsions, and particulate systems such as but not limited to, liposomes, microparticles, nanoparticles, and the like. In one embodiment, the ophthalmic formulation of the present disclosure is in the form of an in-situ gelling system. In another embodiment, the in-situ type gelling composition of the present disclosure may comprise one or more cross-linking agent, such as but not limited to borate, and the like. In another embodiment, the in-situ type gelling composition of the present disclosure does not comprise one or more crosslinking agent.

[00103] In a further embodiment, the ophthalmic formulation of the present disclosure in the form of ocular insert is a bioerodible ocular insert. In another embodiment, the ophthalmic formulation of the present disclosure in the form of ocular insert is a non-bioerodible ocular insert. [00104] The ophthalmic formulations of the present disclosure may be in the form of liquid, solid or semisolid dosage form. Further, in one embodiment, the ophthalmic formulations of the present disclosure are formulated so as to have a pH and osmolality that are compatible with the eye. The ophthalmic formulations of the present disclosure may comprise depending on the final dosage form suitable ophthalmically acceptable excipients. In one embodiment, the ophthalmic formulations are formulated to maintain a physiologically tolerable pH range. In one embodiment, the pH range of the ophthalmic formulation is in the range of from 5 to 9. In another embodiment, pH range of the ophthalmic formulation is in the range of from 6 to 8.

[00105] In a further embodiment, the ophthalmic formulations of the present disclosure are for topical administration to the eye. In another embodiment, the ophthalmic formulations of the present disclosure are for intraocular or periocular administration. In a further embodiment, the ophthalmic formulations of the present disclosure are for immediate release of active agent in the ocular cavity.

[00106] In another embodiment, the ophthalmic formulations of the present disclosure are for sustained or controlled release in the ocular cavity. In a further embodiment, the ophthalmic formulations of the present disclosure are for at once-a-day administration. In one embodiment, the sustained or controlled release delivery of the active agent from the ophthalmic formulation is for a sustained period of time of about 24 hours. In another embodiment, the sustained or controlled release delivery of the active agent from the ophthalmic formulation is for a sustained period of time of about 12 hours. In a further embodiment, the sustained or controlled release delivery of the active agent from the ophthalmic formulation is for a sustained period of time of about 10 hours. In yet another embodiment, the sustained or controlled release delivery of the active agent from the ophthalmic formulation is for a sustained period of time of about 8 hours. In one embodiment, the sustained or controlled release delivery of the active agent from the ophthalmic formulation is for a sustained period of time of about 6 hours. In a further embodiment, the sustained or controlled release delivery of the active agent from the ophthalmic formulation is for a sustained period of time of about 4 hours to about 24 hours.

[00107] Depending on the dosage form of the ophthalmic formulations of the present disclosure, appropriate method of preparation is employed. Various methods for preparation of ophthalmic formulations known in the art may be employed. Further depending on the dosage form, the ophthalmic formulations or excipients and/or active agents employed therein are suitably sterilized by one or more methods known to a person skilled in the art. In one embodiment, the ophthalmic formulations of the present disclosure in the form of ocular insert, is prepared by molding or extrusion procedures well known in the art. In another embodiment, the ophthalmic formulation of the present disclosure in the form of ophthalmic solution is prepared by either by dissolving or suspending prescribed amount of a drug in a prescribed volume of a carrier solvent along ophthalmically accep table excipients. Particle size of certain ophthalmic formulations of the present disclosure is within ophthalmically acceptable limits known to a person skilled in the art.

Recombinant Constructs, Nucleic Acids and Delivery Vehicles

[00108] Recombinant constructs are also provided herein and can be used to transform cells in order to express the isolated nucleic acid sequences embodied herein. A recombinant nucleic acid construct comprises promoter operably linked to a regulatory region suitable for expressing SEQ ID NO: 1.

[00109] It wall be appreciated that a number of nucleic acids can encode a polypeptide having a particular amino acid sequence. The degeneracy of the genetic code is well known in the art. For many amino acids, there is more than one nucleotide triplet that serves as the codon for the ammo acid. For example, codons in the coding sequence for SEQ ID NO: 1 can be modified such that optimal expression in a particular organism is obtained, using appropriate codon bias tables for that organism.

[00110] Nucleic acids as described herein may be administered as alone or contained in vectors. Vectors can include, for example, origins of replication, scaffold attachment regions (SARs), and/or markers, A marker gene can confer a selectable phenotype on a host cell. For example, a marker can confer biocide resistance, such as resistance to an antibiotic (e.g., kanamycin, G418, bleomycin, or hygromycin). An expression vector can include a tag sequence designed to facilitate manipulation or detection (e.g., purification or localization) of the expressed polypeptide. Tag sequences, such as green fluorescent protein (GFP), glutathione S~transferase (GST), polyhistidine, c-myc, hemagglutinin, or FLAG™ tag (Kodak, New' Haven, CT) sequences typically are expressed as a fusion with the encoded polypeptide. Such tags can be inserted anywhere within the polypeptide, including at either the carboxyl or amino terminus. [00111] Additional expression vectors also can include, for example, segments of chromosomal, non-chromosomal and synthetic DNA sequences. Suitable vectors include derivatives of SV40 and known bacterial plasmids, e.g., E. coll plasmids col El, pCRl, pBR322, pMal-C2, pET, pGEX, pMB9 and their derivatives, plasmids such as RP4; phage DNAs, e.g., the numerous derivatives of phage 1, e.g., NM989, and other phage DNA, e.g., M13 and filamentous single stranded phage DNA; yeast plasmids such as the 2g plasmid or derivatives thereof, vectors useful in eukaryotic cells, such as vectors useful in insect or mammalian cells; vectors derived from combinations of plasmids and phage DNAs, such as plasmids that have been modified to employ phage DNA or other expression control sequences.

[00112] Several deliver}' methods may be utilized for in vitro (cell cultures) and in vivo (animals and patients) systems. In one embodiment, a lentiviral gene delivery system may be utilized. Such a system offers stable, long term presence of the gene in dividing and nondividing cells with broad tropism and the capacity for large DNA inserts. (Dull et al, J Virol, 72:8463-8471 1998). In an embodiment, adeno-associated virus (AAV) may be utilized as a delivery method. AAV is a non-pathogenic, single-stranded DNA virus that has been actively employed in recent years for delivering therapeutic gene in in vitro and in vivo systems (Choi et al, Curr Gene Then, 5:299-310, 2005). An example non-viral delivery method may utilize nanoparticle technology. This platform has demonstrated utility as a pharmaceutical in vivo. Nanotechnology has improved transcytosis of drugs across tight epithelial and endothelial barriers. It offers targeted delivery of its payload to cells and tissues in a specific manner (Allen and Cullis, Science, 303: 1818-1822, 1998).

[00113] The vector can also include a regulatory region. The term “regulatory region” refers to nucleotide sequences that influence transcription or translation initiation and rate, and stability and/or mobility of a transcription or translation product. Regulator}? regions include, without limitation, promoter sequences, enhancer sequences, response elements, protein recognition sites, inducible elements, protein binding sequences, 5' and 3‘ untranslated regions (UTRs), transcriptional start sites, termination sequences, polyadenylation sequences, nuclear localization signals, and introns.

[00114] The term “operably linked” refers to positioning of a regulatory region and a sequence to be transcribed in a nucleic acid so as to influence transcription or translation of such a sequence. For example, to bring a coding sequence under the control of a promoter, the translation initiation site of the translational reading frame of the polypeptide is typically positioned between one and about fifty nucleotides downstream of the promoter. A promoter can, however, be positioned as much as about 5,000 nucleotides upstream of the translation initiation site or about 2,000 nucleotides upstream of the transcription start site. A promoter typically comprises at least a core (basal) promoter. A promoter also may include at least one control element, such as an enhancer sequence, an upstream element or an upstream activation region (UAR). The choice of promoters to be included depends upon several factors, including, but not limited to, efficiency, selectability, inducibility, desired expression level, and cell- or tissue-preferential expression. It is a routine matter for one of skill in the art to modulate the expression of a coding sequence by appropriately selecting and positioning promoters and other regulator}' regions relative to the coding sequence.

[00115] Vectors include, for example, viral vectors (such as adenoviruses Ad, AAV, lentivirus, and vesicular stomatitis virus (VSV) and retroviruses), liposomes and other lipid- containing complexes, and other macromolecular complexes capable of mediating delivery of a polynucleotide to a host cell. Vectors can also comprise other components or functionalities that further modulate gene delivery and/or gene expression, or that otherwise provide beneficial properties to the targeted cells. As described and illustrated in more detail below, such other components include, for example, components that influence binding or targeting to cells (including components that mediate cell-type or tissue-specific binding); components that influence uptake of the vector nucleic acid by the cell; components that influence localization of the polynucleotide within the cell after uptake (such as agents mediating nuclear localization); and components that influence expression of the polynucleotide. Such components also might include markers, such as detectable and/or selectable markers that can be used to detect or select for cells that have taken up and are expressing the nucleic acid delivered by the vector. Such components can be provided as a natural feature of the vector (such as the use of certain viral vectors which have components or functionalities mediating binding and uptake), or vectors can be modified to provide such functionalities. Other vectors include those described by Chen et al; BioTechniques, 34: 167-171 (2003). A large variety of such vectors is known in the art and are generally available. A “recombinant viral vector” refers to a viral vector comprising one or more heterologous gene products or sequences. Since many viral vectors exhibit size-constraints associated with packaging, the hetero logons gene products or sequences are typically introduced by replacing one or more portions of the viral genome. Such viruses may become replicationdefective, requiring the deleted function(s) to be provided in trans during viral replication and encapsidation (by using, e.g., a helper virus or a packaging cell line carrying gene products necessary for replication and/or encapsidation). Modified viral vectors in which a polynucleotide to be delivered is carried on the outside of the viral particle have also been described (see, e.g., Curiel, D T, etal. PNAS 88: 8850-8854, 1991).

[00116] Additional vectors include viral vectors, fusion proteins and chemical conjugates. Retroviral vectors include Moloney murine leukemia viruses and HIV-based viruses. One HIV based viral vector comprises at least two vectors wherein the gag and pol genes are from an HI V genome and the env gene is from another virus. DNA viral vectors include pox vectors such as orthopox or avipox vectors, herpesvirus vectors such as a herpes simplex I virus (HSV) vector [Geller, A.I. et al., J. Neurochem, 64: 487 (1995); Lim, F., et al., in DNA Cloning: Mammalian Systems, D. Glover, Ed. (Oxford Univ. Press, Oxford England) (1995); Geller, A.I. etal., Proc Natl. Acad. Set.: U.S.A.:90 7603 (1993); Geller, A.I., etal., Proc Natl. Acad. Sci lJSN. 87:1149 (1990)], Adenovirus Vectors [LeGal LaSalle et al., Science, 259:988 (1993); Davidson, etal., Nat. Genet. 3: 219 (1993); Yang, et al., J. Virol. 69: 2004 (1995)] and Adeno-associated Virus Vectors [Kaplitt, M.G., etal., Nat. Genet. 8: 148 (1994)].

[00117] The oligonucleotides disclosed herein may be used with a microdelivery vehicle such as cationic liposomes and adenoviral vectors. For a review of the procedures for liposome preparation, targeting and delivery of contents, see Mannino and Gould-Fogente, BioTechniques, 6:682 (1988). See also, Feigner and Holm, Bethesda Res. Lab. Focus, 1 1(2):21 (1989) and Maurer, R. A., Bethesda Res. Lab. Focus, 11(2):25 (1989).

[00118] Replication-defective recombinant adenoviral vectors, can be produced in accordance with known techniques. See, Quantin, etal., Proc. Natl. Acad. Sei. USA, 89:2581- 2584 (1992); Stratford-Perricadet, etal., J. Clin. Invest., 90:626-630 (1992); and Rosenfeld, et al., Cell, 68: 143-155 (1992).

[00119] Another delivery method is to use single stranded DNA producing vectors which can produce the expressed products intracellularly. See for example, Chen et al, BioTechniques, 34: 167-171 (2003), which is incorporated herein, by reference, in its entirety. [00120] The oligonucleotides disclosed herein may be used with a microdelivery vehicle such as cationic liposomes and adenoviral vectors. For a review of the procedures for liposome preparation, targeting and delivery of contents, see Mannino and Gould-Fogerite, BioTechniques, 6:682 (1988). See also, Feigner and Hohn, Bethesda Res. Lab. Focus, 11 (2): 21 (1989) and Maurer, R.A., Bethesda Res. Lab. Focus, 11(2):25 (1989).

[00121 ] In certain embodiments, non-viral vectors may be used to effectuate transfection.

Methods of non-viral delivery of nucleic acids include lipofection, nucleofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycation or lipid: nucleic acid conjugates, naked DNA, artificial virions, and agent- enhanced uptake of DNA. Lipofection is described in e.g., U.S. Pat. Nos. 5,049,386, 4,946,787; and 4,897,355) and lipofection reagents are sold commercially (e.g., Transfectam and Lipofectin). Cationic and neutral lipids that are suitable for efficient receptor-recognition lipofection of polynucleotides include those described in U.S. Pat. No. 7,166,298 to Jessee or U.S. Pat. No. 6,890,554 to Jesse, the contents of each of which are incorporated by reference. Delivery’ can be to cells (e.g. in vitro or ex vivo administration) or target tissues (e.g. in vivo administration).

[00122] Synthetic vectors are typically based on cationic lipids or polymers which can complex with negatively charged nucleic acids to form particles with a diameter in the order of 100 nm. The complex protects nucleic acid from degradation by nuclease. Moreover, cellular and local delivery strategies have to deal with the need for internalization, release, and distribution in the proper subcellular compartment. Systemic delivery? strategies encounter additional hurdles, for example, strong interaction of cationic delivery? vehicles with blood components, uptake by? the reticuloendothelial system, kidney filtration, toxicity and targeting ability of the carriers to the cells of interest. Modifying the surfaces of the cationic lipids or polymers can minimize their interaction with blood components, reduce reticuloendothelial system uptake, decrease their toxicity and increase their binding affinity with the target cells. Binding of plasma proteins (also termed opsonization) is the primary mechanism for RES to recognize the circulating nanoparticles. For example, macrophages, such as the Kupffer cells in the liver, recognize the opsonized nanoparticles via the scavenger receptor.

[00123] The isolated nucleic acid sequences of the disclosure can be delivered to an appropriate cell of a subject. This can be achieved by, for example, the use of a polymeric, biodegradable microparticle or microcapsule delivery vehicle, sized to optimize phagocytosis by phagocytic cells such as macrophages. For example, PLGA (poly-lacto-co-glycolide) microparticles approximately 1-10 gm in diameter can be used. The oligonucleotide is encapsulated in these microparticles, which are taken up by macrophages and gradually biodegraded within the cell, thereby releasing the polynucleotide. Once released, the DNA is expressed within the cell. A second type of microparticle is intended not to be taken up directly by cells, but rather to serve primarily as a slow-release reservoir of nucleic acid that is taken up by cells only upon release from the micro-particle through biodegradation. These polymeric particles should therefore be large enough to preclude phagocytosis (i.e., larger than 5 gm and preferably larger than 20 pm). Another way to achieve uptake of the nucleic acid is using liposomes, prepared by standard methods. The nucleic acids can be incorporated alone into these deliver}' vehicles or co-incorporated with tissue-specific antibodies, for example antibodies that target cell types. Alternatively, one can prepare a molecular complex composed of a plasmid or other vector attached to poly-L-lysine by electrostatic or covalent forces. Poly-L-lysme binds to a ligand that can bind to a receptor on target cells. Delivery of “naked DNA” (i.e., without a delivery vehicle) to an intramuscular, intradermal, or subcutaneous site, is another means to achieve in vivo expression. In the relevant polynucleotides (e.g,, expression vectors) the nucleic acid sequence encoding an isolated nucleic acid sequence comprises SEQ ID NO: 1 , for example.

[00124] In some embodiments, the compositions of the disclosure can be formulated as a nanoparticle, for example, nanoparticles comprised of a core of high molecular weight linear polyethylen imine (LPEI) complexed with DNA and surrounded by a shell of polyethyleneglycol modified (PEGylated) low molecular weight LPEI. In some embodiments, the compositions can be formulated as a nanoparticle encapsulating the compositions embodied herein. L-PEI has been used to efficiently deliver genes in vivo into a wide range of organs such as lung, brain, pancreas, retina, bladder as well as tumor. L-PEI is able to efficiently condense, stabilize and deliver nucleic acids in vitro and in vivo.

[00125] In some embodiments, delivery of vectors can also be mediated by exosomes. Exosomes are lipid nanovesicles released by many cell types. They mediate intercellular communication by transporting nucleic acids and proteins between cells. Exosomes contain RNAs, miRNAs, and proteins derived from the endocytic pathway. They may be taken up by target cells by endocytosis, fusion, or both. Exosomes can be harnessed to deliver nucleic acids to specific target cells.

[00126 ] The expression constructs of the present disclosure can also be delivered by means of nanoclews. Nanoclews are a cocoon-like DNA nanocomposites (Sun, et al., J. Am. Chem. Soc. 2014, 136: 14722-14725). They can be loaded with nucleic acids for uptake by target cells and release in target cell cytoplasm. Methods for constructing nanoclews, loading them, and designing release molecules can be found in Sun, et al. (Sun W, et al., J. Am. Chem. Soc. 2014, 136:14722-14725; Sun W, etal.,Angew. Chem. Ini. Ed. 2015: 12029-12033.)

[00127] The nucleic acids and vectors may also be applied to a surface of a device (e.g., a catheter) or contained within a pump, patch, or any other drug delivery device. The nucleic acids and vectors disclosed herein can be administered alone, or in a mixture, in the presence of a pharmaceutically acceptable excipient or carrier (e.g., physiological saline). The excipient or carrier is selected on the basis of the mode and route of administration. Suitable pharmaceutical carriers, as well as pharmaceutical necessities for use in pharmaceutical formulations, are described in Remington’s Pharmaceutical Sciences (E. W. Martin), a well-known reference text in this field, and in the USP/NF (United States Pharmacopeia and the National Formulary).

[00128] In some embodiments, liposomes are used to effectuate transfection into a cell or tissue. The pharmacology of a liposomal formulation of nucleic acid is largely determined by the extent to which the nucleic acid is encapsulated inside the liposome bilayer. Encapsulated nucleic acid is protected from nuclease degradation, while those merely associated with the surface of the liposome is not protected. Encapsulated nucleic acid shares the extended circulation lifetime and biodistribution of the intact liposome, while those that are surface associated adopt the pharmacology of naked nucleic acid once they disassociate from the liposome. Nucleic acids may be entrapped within liposomes with conventional passive loading technologies, such as ethanol drop method (as in SALP), reverse-phase evaporation method, and ethanol dilution method (as in SNALP).

[00129] Liposomal delivery systems provide stable formulation, provide improved pharmacokinetics, and a degree of 'passive' or 'physiological' targeting to tissues. Encapsulation of hydrophilic and hydrophobic materials, such as potential chemotherapy agents, are known. See for example U.S. Pat. No. 5,466,468 to Schneider, which discloses parenterally administrable liposome formulation comprising synthetic lipids; U.S. Pat. No. 5,580,571, to Hostetler et al. which discloses nucleoside analogues conjugated to phospholipids; U.S. Pat. No. 5,626,869 to Nyqvist, which discloses pharmaceutical compositions wherein the pharmaceutically active compound is heparin or a fragment thereof contained in a defined lipid system comprising at least one amplnphatic and polar lipid component and at least one nonpolar lipid component.

[00130] Liposomes and polymerosomes can contain a plurality of solutions and compounds. In certain embodiments, the complexes of the disclosure are coupled to or encapsulated in polymersomes. As a class of artificial vesicles, polymersomes are tiny hollow spheres that enclose a solution, made using amphiphilic synthetic block copolymers to form the vesicle membrane. Common polymersomes contain an aqueous solution in their core and are useful for encapsulating and protecting sensitive molecules, such as drugs, enzymes, other proteins and peptides, and DNA and RNA fragments. The polymersome membrane provides a physical barrier that isolates the encapsulated material from external materials, such as those found in biological systems. Polymerosomes can be generated from double emulsions by known techniques, see Lorenceau et al., 2005, Generation of Polymerosomes from Double-Emulsions, Langmuir 21(20): 9183-6.

[00131] In some embodiments, non-viral vectors are modified to effectuate targeted delivery and transfection, PEGylation (i.e. modifying the surface with polyethyleneglycol) is the predominant method used to reduce the opsonization and aggregation of non-viral vectors and minimize the clearance by reticuloendothelial system, leading to a prolonged circulation lifetime after intravenous (i.v.) administration, PEGylated nanoparticles are therefore often referred as “stealth” nanoparticles. The nanoparticles that are not rapidly cleared from the circulation will have a chance to encounter infected cells.

[00132] In some embodiments, targeted controlled-release systems responding to the unique environments of tissues and external stimuli are utilized. Gold nanorods have strong absorption bands in the near-infrared region, and the absorbed light energy is then converted into heat by gold nanorods, the so-called “photothermal effect”. Because the near-infrared light can penetrate deeply into tissues, the surface of gold nanorod could be modified with nucleic acids for controlled release. When the modified gold nanorods are irradiated by near-infrared light. nucleic acids are released due to thermo-denaturation induced by the photothermal effect. The amount of nucleic acids released is dependent upon the power and exposure time of light irradiation.

[00133] Regardless of whether compositions are administered as nucleic acids or polypeptides, they are formulated in such a way as to promote uptake by the mammalian cell. Useful vector systems and formulations are described above. In some embodiments the vector can deliver the compositions to a specific cell type. The disclosure is not so limited however, and other methods of DNA delivery such as chemical transfection, using, for example calcium phosphate, DEAE dextran, liposomes, lipoplexes, surfactants, and perfluoro chemical liquids are also contemplated, as are physical delivery methods, such as electroporation, micro injection, ballistic particles, and “gene gun” systems.

[00134] In other embodiments, the compositions comprise a cell which has been transformed or transfected with one or more vectors encoding the isolated nucleic acids embodied herein. In some embodiments, the methods of the disclosure can be applied ex vivo. That is, a subject’s cells can be removed from the body and treated with the compositions in culture to excise, and the treated cells returned to the subject’s body. The cell can be the subject’s cells or they can be haplotype matched or a cell line. The cells can be irradiated to prevent replication. In some embodiments, the cells are human leukocyte antigen (HLA)- matched, autologous, cell lines, or combinations thereof. In other embodiments the cells can be a stem cell. For example, an embryonic stem cell or an artificial pluripotent stem cell (induced pluripotent stem cell (iPS cell)). Embryonic stem cells (ES cells) and artificial pluripotent stem cells (induced pluripotent stem cell, iPS cells) have been established from many animal species, including humans. These types of pluripotent stem cells would be the most useful source of cells for regenerative medicine because these cells are capable of differentiation into almost all of the organs by appropriate induction of their differentiation, with retaining their ability of actively dividing while maintaining their pluripotency. iPS cells, in particular, can be established from self-derived somatic cells, and therefore are not likely to cause ethical and social issues, in comparison with ES cells which are produced by destruction of embryos. Further, iPS cells, which are self-derived cell, make it possible to avoid rejection reactions, which are the biggest obstacle to regenerative medicine or transplantation therapy. [00135] Transduced cells are prepared for reinfusion according to established methods. After a period of about 2-4 weeks in culture, the cells may number between 1 ^x 10^b and 1 ^x 10¹⁰. In this regard, the growth characteristics of cells vary from patient to patient and from cell type to cell type. About 72 hours prior to reinfusion of the transduced cells, an aliquot is taken for analysis of phenotype, and percentage of cells expressing the therapeutic agent. For administration, cells of the present disclosure can be administered at a rate determined by the LD50 of the cell type, and the side effects of the cell type at various concentrations, as applied to the mass and overall health of the patient. Administration can be accomplished via single or divided doses. Adult stem cells may also be mobilized using exogenously administered factors that stimulate their production and egress from tissues or spaces that may include, but are not restricted to, bone marrow or adipose tissues.

EXAMPLES

[00136] EXAMPLE 1: Eye fibrosis Treatment with IMT504

[00137] AMD is currently treated by intravitreal injection of vascular endothelial growth factor inhibitors. Although this treatment can prevent or even improve vision, approximately one-third of patients develop macular fibrosis or atrophy (17). Once stablished, fibrosis results in permanent loss of vision. Currently, there is no available therapy for fibrosis (26).

[00138] Case report

[00139] A 70 years-old woman, in the year 2014, was diagnosed as having a massive fibrosis in the left eye impeding central vision. In the right eye, AMD was diagnosed and treated with anti- VEGF therapy. In August 2017, the prognostic was pessimistic because of worsening of the right eye. Therefore, a compassionate treatment with intramuscular injections (i.m.) of 1MT504 was initiated. The treatment consisted of five daily injections containing 20 mg of IMT504 dissolved in buffered saline. The right eye remained treated with anti- VEGF therapy. In May of the year 2018, a slight improvement in the optical coherence tomography (OCT) image of the left eye, was observed. On the other hand, the patient alleged that, with her left eye, now she could see some blurred figures that previously could not see at all. Thus, it was decided to submit a second treatment with IMT504. In October of the year 2018 a new OCT was carried out that showed a marked improvement in the left eye. The patient states that “she now perceives light better with her left eye and begins to better define the contour of large objects”. It was decided to submit a third treatment with IMT504. During the control of tins treatment, the patient reported that her left eye continues improving and that she thinks that soon will be able to read. The OCT image of the left eye corresponding to this control, compared to that performed in 2017 before starting the first treatment with IMT504, is shown in FIG. 1. After the three treatments, an improvement in the organization of the retina, a significant decrease in the thickness of the fibrous body in the nasal region (bars) and disappearance of a localized extension of the fibrous body in the temporal region (arrowhead) were observed. A new' control OCT performed twenty months after the last IMT504 treatment showed a dramatic reduction of the fibrous mass. During this control, the patient described that “peripheric vision was now' wider and large letters discriminated”. No adverse events occurred during the entire period of successive treatments.

[00140] EXAMPLE 2: Diabetic retinopathy treatment with IMT504

[00141] Diabetic retinopathy is one of the most common diabetes-specific complications and the leading cause of blindness in the adult working population (59). Although anti-VEGF therapies are initiated for treating all manner of retinopathy with central retinal thickening, they only result in modest, and very’ often transient, improvement of visual acuity’ (60). Therefore, there is the need to evolve treatments aligned to what is now' known regarding diabetes and its complications as influenced by the multiple interrelated pathophysiologic mechanisms that impact cell and tissue damage within the retinal neurovascular unit leading to glial, neural, and microvascular dysfunction.

[00142] Case Report

[00143] A diabetic (type2) 52 years-old man, was diagnosed as having retinopathy in both eyes in 2013. Intravitreal, anti -VE GF therapy was applied to both eyes during 2014 and 2015. Despite treatment, the condition in both eyes worsened and the intraocular therapy was interrupted. In 2019, a compassionate treatment with IMT504 was applied. The treatment consisted of five daily intramuscular (i.m.) injections containing 20 mg of IMT504 dissolved in buffered saline. Two months later, a second treatment was applied and after two more months a control performed. Results of this control are shown in FIG. 2 and FIG. 3. The OCT image of the left eye (FIG. 2A) showed, a significant improvement, over the baseline in the foveal region. Prior to treatment, strong macular edema was present in the form of cysts and retinal serous detachment. After these two treatments: - Both of degenerative modifications markedly receded

- The structure of the retina became better defined

- Edema clearly diminished.

- The OCT central retina thickness receded about 120 jim (FIG. 2B).

- The right eye improvement was also evident in the OCT image (FIG. 3 A) and in the central retina thickness map (FIG. 3B)

- Visual acuity significantly improved in both eyes.

- A new control, performed twenty months after the last IMT504 treatment, showed further improvement in both eyes, except for increased thickness of the fovea of the left eye.

- Adverse effects were not observed during the entire period of successive treatments and controls.

[00144] EXAMPLE 3 SINGLE-USE INJECTABLE FORMULATIONS OF IMT 504

[ 00145] IMT 504 is a polyanion with Sodium as counterion and this makes it difficult to predict the final pH of a solution as well as the Van't Hoffs coefficient to determine the right amount of buffer and sodium chloride to get an approximately isotonic (250 - 350) solution at a suitable pH range (6,3 - 7.8) for different concentrations of IMT 504. Several experiments were run to determine suitable concentrations of phosphates in ca. IO mM buffer and sodium chloride as osmolyte.

[00146] Single-use injectable formulations of IMT 504 are presented in the following table for different concentrations of IMT 504:

[00147] An adjustment of pH with phosphoric acid or sodium hydroxide without a significant variation of osmotic pressure is possibl e due to the low molarity of the ph osphate buffer used (around 10 mM).

[00148] These formulations can be packaged into ampoules, prefilled syringes, and Type I glass vials with rubber stoppers and aluminum seals.

[00149] EXAMPLE 4 MULTIDOSE INJECTABLE FORMULATIONS OF IMT 504

[O015O] Multidose formulations should include a preservative. Preferred preservative is benzyl alcohol at 1 % m/V concentration. Formulations are disclosed herein:

[00151] An adjustment of pH with phosphoric acid or sodium hydroxide without a significant variation of osmotic pressure is possible due to the low molarity of the phosphate buffer used (around 10 mM).

[00152] These formulations can be packaged into ampoules and Type I glass vials with rubber stoppers and aluminum seals.

[00153] EXAMPLE 5: Lyophilized Composition

[ 00154] A lyophilizate containing IMT 504 is presented:

[00155] An adjustment of pH with phosphoric acid or sodium hydroxide without a significant variation of osmotic pressure is possible due to the low molarity of the phosphate buffer used (around 10 mM).

[00156] These formulations can be packaged into Type I glass vials with rubber stoppers and aluminum seals.

[00157] REFERENCES CITED

1) Wang W, Lo ACY. Diabetic Retinopathy: Pathophysiology and Treatments. Int J Mol Sci. 2018 Jun 20,19(6): 1816. doi: 10.3390/ijmsl 9061816 PMED: 29925789; PMCID: PMC6032159

2) Hammes HP Diabetic retinopathy: hyperglycaemia, oxidative stress and beyond. Diabetologia. 2018,61(1 ):29-38. doi: 10.1007/s00125-017-4435-8

3) Rubsam A, Parikh S, Fort PE. Role of Inflammation in Diabetic Retinopathy. Int J Mol Sci. 2018;19(4):942. Published 2018 Mar 22. doi: 10.3390/ijmsl 9040942 4) Lopes de Faria JM, Duarte DA, Montemurro C, Papadimitriou A, Consonni SR, Lopes de

Faria JB. Defective Autophagy in Diabetic Retinopathy. Invest Ophthalmol Vis Sci. 2016;57(10):4356-4366. doi: 10.1167/iovs.I6-19197

5) Bek T. Mitochondrial dysfunction and diabetic retinopathy. Mitochondrion. 2017;36:4-6. doi:10.1016/j.mito.2016.07.011

6) Lambros ML, Platker SM. Oxidative Stress and the Nrf2 Anti-Oxidant Transcription Factor in Age-Related Macular Degeneration. Adv Exp Med Biol. 2016;854:67-72. doi: 10.1007/978-3-319- 17121-0 10

7) Kauppinen A, Patemo JJ, Blasiak J, Salminen A, Kaarniranta K. Inflammation and its role in age-related macular degeneration. Cell Mot Life Sci. 2016;73(9): 1765-1786. doi : 10.1007/s00018-016-2147-8

8) Kivmen N. The role of autophagy in age-related macular degeneration. Acta Ophthalmol.

2018,96 Suppl Al 10: 1-50. doi.10.1 1 1 l/aos.13753

9) Brown EE, Lewin AS, Ash .ID. Mitochondria: Potential Targets for Protection in Age- Related Macular Degeneration. Adv Exp Med Biol. 2018;1074:11-17. doi:10.1007/978-3-319- 75402-4 2

10) van Lookeren Campagne M, LeCouter J, Yaspan BL, Ye W. Mechanisms of age- related macular degeneration and therapeutic opportunities. J Pathol. 2014 Jan;232(2):151-64. doi: 10.1002/path 4266

11) Stone WL, Shah D, Hollinger SM. Retinopathy of prematurity: an oxidative stress neonatal disease. Front Biosci (Landmark Ed). 2016 Jan 1;21 : 165-77. doi: 10.2741/4382. PMID: 26709767

12) Khanna S, Komati R, Eichenbaum DA, Hariprasad I, Ciulla TA, Hariprasad SM. Current and upcoming anti-VEGF therapies and dosing strategies for the treatment of neovascular AMD: a comparative review. BMJ Open Ophthalmol. 2019;4(l):e000398. Published 2019 Dec 15. doi: 10. 1136/bmjophth-2019-000398

13) Senra H. All Z, Balaskas K, Aslam T. Psychological impact of anti-VEGF treatments for wet macular degeneration-a review. Graefes Arch Clio Exp Ophthalmol. 2016;254(10):1873- 1880. doi: 10.1007/s00417-016-3384-0

14) Senra H, Balaskas K, Mahmoodi N., Aslam T. Experience of Anti-VEGF Treatment and Clinical Levels of Depression and Anxiety in Patients With Wet Age- Related Macular Degeneration. (2017) American Journal of Ophthalmology, 1 77 , pp. 213-224

15) Spooner KL, Guinan G, Koller S, Hong T, Chang AA. Burden Of Treatment Among Patients Undergoing Intravitreal Injections For Diabetic Macular Oedema In Australia. Diabetes Metab Syndr Obes. 2019;12: 1913-1921. doi:10.2147/DMSO.S214098

16) Falavarjani KG, Nguyen QD. Adverse events and complications associated with intravitreal injection of anti-VEGF agents: a review of literature. Eye (Lond). 2013;27(7):787-794. doi:10.1038/eye.2013.107

17) Little K, Ma JH, Yang N, Chen M, Xu H. Myofibroblasts in macular fibrosis secondary to neovascular age-related macular degeneration - the potential sources and molecular cues for their recruitment and activation. EBioMedicine. 2018;38:283-291. doi: 10.1016/j.ebiom.2018.11.029 18) Zorzopulos J, Opal SM, Hernando-Insua A, et al. Immunomodulatory oligonucleotide

IMT504: Effects on mesenchymal stem cells as a first-in-class immunoprotective/immunoregenerative therapy. World J Stem Cells. 2017;9(3):45-67. doi:10.4252/wjsc.v9.13.45

19) Elias F, Flo J, Lopez RA, Zorzopulos J, Montaner A, Rodriguez JM. Strong cytosine- guanosine-independent immunostimulation in humans and other primates by synthetic oligodeoxynucleotides with PyNTTTTGT motifs. J Immunol. 2003;171(7):3697-3704. doi: 10.4049/j immuno 1.171.7.3697

20) Rodriguez JM, Elias F, F16 J, Lopez RA, Zorzopulos J, Montaner AD. Immunostimulatory PyNTTTTGT oligodeoxynucleotides: structural properties and refinement of the active motif. Oligonucleotides. 2006; 16(3):275-285. doi: 10.1089/oli.2006.16.275

21) Rodriguez JM, Marchicio J, Lopez M, et al. PyNTTTTGT and CpG immunostimulatory oligonucleotides: effect on granulocyte/monocyte colony-stimulating factor (GM-CSF) secretion by human CD56+ (NK and NKT) cells. PLoS One. 2015;10(2):e0117484. Published 2015 Feb 23. doi : 10.1371 /j ournal. pone.0117484

22) Hernando Insua A, Montaner AD, Rodriguez JM, et al. IMT504, the prototype of the immunostimulatory oligonucleotides of the PyNTTTTGT class, increases the number of progenitors of mesenchymal stem cells both in vitro and in vivo: potential use in tissue repair therapy. Stem Cells. 2007;25(4): 1047-1054. doi: 10.1634/stemcells.2006-0479

23) Franco R, Rodriguez JM, Elias F, et al. Non-clinical safety studies of IMT504, a umque non-CpG oligonucleotide. Nucleic Acid Ther. 2014;24(4):267-282. doi:10.1089/nat.2013.0479

24) Hernando-Insua A, Rodriguez JM, Elias F, et al. A high dose of IMT504, the PyNTTTTGT prototype immunostimulatory oligonucleotide, does not alter embryonic development in rats. Oligonucleotides. 2010;20(l):33-36. doi: 10.1089/oli.2009.0206

25) Litle K, Ma JH, Yang N, Chen M, Xu H. Myofibroblasts in macular fibrosis secondary to neovascular age-related macular degeneration - the potential sources and molecular cues for their recruitment and activation. EBioMedicine. 2018 Dec;38:283-291. doi:

10.1016/j . ebiom.2018.11.029

26) Tenbrock L, Wolf J, Boneva S, Schlecht A, Agostini H, Wieghofer P, Schlunck G, Lange C. Subretmal fibrosis in neovascular age-related macular degeneration: current concepts, therapeutic avenues, and future perspectives. Cell Tissue Res. 2021 Sep 3. doi: 10.1007/s00441- 021-03514-8. Epub ahead of print. PMID: 34477966

27) Penn IS, Madan A, Caldwell RB, Bartoli M. Caldwell RW, Hartnett ME. Vascular endothelial growth factor in eye disease. Prog Retin Eye Res. 2008;27(4):331-371. doi : 10.1016/j . preteyeres.2008.05.001

28) Masuda T, Shimazawa M, Hara H. Retinal Diseases Associated with Oxidative Stress and the Effects of a Free Radical Scavenger (Edaravone). Oxid Med Cell Longev. 2017:2017:9208489. doi: 10.1 155/2017/9208489

29) Whitcup SM, Nussenblatt RB, Lightman SL, Hollander DA. Inflammation in retinal disease. Ini J inflam. 2013;2013:724648. doi: 10.1155/2013/724648 30) Chahin A, Opal SM, Zorzopulos J, Jobes DV, Migdady Y, Yamamoto M, Parejo N, Palardy JE, Horn DL. The novel immunotherapeutic oligodeoxynucleotide IMT504 protects neutropenic animals from fatal Pseudomonas aeruginosa bacteremia and sepsis. Antimicrob Agents Chemother. 2015 Feb;59(2): 1225-9. doi: \ 0.1128/ A AC.03923 -14. Epub 2014 Dec 15. PMD: 25512413; PMCID: PMC4335857

31) Leiguarda C, Potilinski C, Rubione J, Tate P, Villar MJ, Montaner A, Bisagno V, Constandil L, Brumovsky PR. WT504 Provides Analgesia by Modulating Cell Infiltrate and Inflammatory Milieu in a Chronic Pam Model. J Neuroimmune Pharmacol. 2021 Sep;16(3):651- 666. doi: 10.’l 007/s 11481-020-09971-2. Epub 2020 Nov 21. PMID: 33221983

32) Yau JW, Rogers SL, Kawasaki R, Lamoureux EL, Kowalski JW, Bek T, et al. Global prevalence and major risk factors of diabetic retinopathy. Diabetes Care. (2012) 35:556-64. 10.2337. del 1-1909

33) Cai S, Bressler NM. Aflibercept, bevacizumab or ranibizumab for diabetic macular oedema: recent clinically relevant findings from DRCRnet Protocol I'. Curr Opin Ophthalmol. (2017) 28:636-43. 10.1097/100.0000000000000424

[00158] SEQUENCE LISTING

SEQ ID NO: 1

LENGTH: 24

TYPE: DNA

ORGANISM: .Artificial Sequence

SEQUENCE: tcatcattttgtcatttgtcatt

OTHER EMBODIMENTS

[00159] From the foregoing description, it will be apparent that variations and modifications may be made to the disclosure described herein to adopt it to various usages and conditions. Such embodiments are also within the scope of the following claims.

[00160] All citations to sequences, patents and publications in this specification are herein incorporated by reference to the same extent as if each independent patent and publication was specifically and individually indicated to be incorporated by reference.

Claims

What is claimed:

1. A method of treating retinal disorders in a subject, comprising administering to the subject a pharmaceutica l composition comprising a therapeutically effective amount of a phosphorothioate oligonucleotide comprising a nucleic acid sequence having at least a 70% sequence identity to SEQ ID NO: 1.

2. The method of claim 1, wherein the pharmaceutical composition is administered via an intramuscular (i.m) route, subcutaneous (s.c.) route, intravenous (i.v.) route, an ophthalmic route or combinations thereof.

3. The method of the claim 1, wherein the retinal disorder is a subr etinal or intraretmal fibrosis.

4. The method of the claim 1 , wherein the retinal disorder is a diabetic retinopathy.

5. The method of the claim 1, wherein the retinal disorder is an age-related macular degeneration (AMD).

6. The method of claim 1 , wherein the phosphorothioate oligonucleotide SEQ ID NO: 1.

7. The method of claim 1, wherein the pharmaceutical composition solution comprising the phosphorothioate oligonucleotide is administered in combination with an antioxidant agent.

8. A pharmaceutical composition comprising an aqueous solution of a phosphorothioate oligonucleotide comprising a nucleic acid sequence having at least a 70% sequence identity to SEQ ID NO: 1 in concentrations ranging from at least 10 to at least 80 mg/mL and at least one osmolyte.

9. The pharmaceutical composition of claim 8, wherein the osmolyte comprises: sodium chloride, calcium chloride, magnesium sulfate, mannitol, sucrose, xylitol, glucose or combinations thereof.

10. The pharmaceutical composition of claim 8, wherein the pH is adjusted between 4 and 8 by a buffer, an acid or an alkali without the addition of a preservative.

11. The pharmaceutical composition of claim 8, wherein the osmolality is about 200 - 500 mOsm.

12. Use of a phosphorothioate oligonucleotide comprising a nucleic acid sequence having at least a 70% sequence identity to SEQ ID NO: 1 to manufacture a composition to treat retinal disorders in a subject.

13. The use of claim 12, wherein the pharmaceutical composition is administered via an intramuscular (i.m) route, subcutaneous (s.c.) route, intravenous (i.v.) route, an ophthalmic route or combinations thereof.

14. The use of the claim 12, wherein the retinal disorder is a subretinal or intraretinal fibrosis.

15. The use of the claim 12, wherein the retinal disorder is a diabetic retinopathy.

16. The use of the claim 12, wherein the retinal disorder is an age-related macular degeneration (AMD).

17. The use of claim 12, wherein the phosphorothioate oligonucleotide SEQ ID NO: 1.

18. The use of claim 12, wherein the pharmaceutical composition solution comprising the phosphorothioate oligonucleotide is administered in combination with an antioxidant agent.

19. A pharmaceutical composition comprising a therapeutically effective amount of a phosphorothioate oligonucleotide having at least a 50% sequence identity to SEQ ID NO: 1 (IMT504), at least one buffering agent, at least one salt, or combinations thereof.

20. The pharmaceutical composition of claim 19, wherein the phosphorothioate oligonucleotide comprises at least a 90% sequence identity to SEQ ID NO: 1.

21. The pharmaceutical composition of claims 19 or 20, wherein the composition comprises SEQ ID NO: 1 in a range from about 1 mg/ml to about 150 mg/ml.

22. The pharmaceutical composition of claim 19, wherein the composition comprises SEQ ID NO: 1 at about 5 mg/ml.

23. The pharmaceutical composition of claim 19, wherein the composition comprises SEQ ID NO: 1 at about 10 mg/ml.

24. The pharmaceutical composition of claim 19, wherein the composition comprises SEQ ID NO: 1 at about 15 mg/ml.

53

25. The pharmaceutical composition of claim 19, wherein the composition comprises SEQ ID NO: 1 at about 20 mg/ml.

26. The pharmaceutical composition of claim 19, wherein the composition comprises SEQ ID NO: 1 at about 25 mg/ml.

27. The pharmaceutical composition of claim 19, wherein the composition comprises SEQ ID NO: 1 at about 30 mg/ml.

28. The pharmaceutical composition of claim 19, wherein the composition comprises SEQ ID NO: I at about 35 mg/ml.

29. The pharmaceutical composition of claim 19, wherein the composition comprises SEQ ID NO: 1 at about 40 mg/ml.

30. The pharmaceutical composition of claim 19, wherein the composition comprises SEQ ID NO: 1 at about 45 mg/ml.

31. The pharmaceutical composition of claim 19, wherein the composition comprises SEQ ID NO: 1 at about 50 mg/ml.

32. The pharmaceutical composition of claim 19, wherein the composition comprises SEQ ID NO: 1 at about 55 mg/ml.

33. The pharmaceutical composition of claim 19, wherein the composition comprises SEQ ID NO: 1 at about 60 mg/ml.

34. The pharmaceutical composition of claim 19, wherein the composition comprises SEQ ID NO: 1 at about 65 mg/ml.

35. The pharmaceutical composition of claim 19, wherein the composition comprises SEQ ID NO: 1 at about 70 mg/ml.

36. The pharmaceutical composition of claim 19, wherein the composition comprises SEQ ID NO: 1 at about 75 mg/ml.

37. The pharmaceutical composition of any one of claims 19-36, wherein the at least one buffer comprises monobasic sodium phosphate anhydrous or dibasic sodium phosphate anhydrous.

38. The pharmaceutical composition of any one of claims 19-36, wherein the composition comprises at least two buffers.

39. The pharmaceutical composition of claim 38, wherein the at least two buffers comprise monobasic sodium phosphate anhydrous and dibasic sodium phosphate anhydrous.

40. The pharmaceutical composition of any one of claims 37 or 38, wherein the monobasic sodium phosphate anhydrous is at a concentration in a range of about 0.001 mg/ml to about 1 mg/ml.

41. The pharmaceutical composition of any one of claims 37 or 38, wherein the monobasic sodium phosphate anhydrous is at a concentration of about 0.06 mg/ml.

42. The pharmaceutical composition of any one of claims 37 or 38, wherein the monobasic sodium phosphate anhy drous is at a concentration of about 0.09 mg/ml.

43. The pharmaceutical composition of any one of claims 37 or 38, wherein the monobasic sodium phosphate anhy drous is at a concentration of about 0.2 mg/ml.

44. The pharmaceutical composition of any one of claims 37 or 38, wherein the monobasic sodium phosphate anhy drous is at a concentration of about 0.25 mg/ml.

45. The pharmaceutical composition of any one of claims 37 or 38, wherein the dibasic sodium phosphate anhy drous is at a concentration in a range of about 0.5 mg/ml to about 2 mg/ml.

46. The pharmaceutical composition of any one of claims 37 or 38, wherein the dibasic sodium phosphate anhydrous is at a concentration of about 0.5 mg/ml.

47. The pharmaceutical composition of any one of claims 37 or 38, wherein the dibasic sodium phosphate anhydrous is at a concentration of about 1 mg/ml.

48. The pharmaceutical composition of any one of claims 37 or 38, wherein the dibasic sodium phosphate anhydrous is at a concentration of about 1.1 mg/ml.

49. The pharmaceutical composition of any one of claims 37 or 38, wherein the dibasic sodium phosphate anhydrous is at a concentration of about 1.2 mg/ml.

50. The pharmaceutical composition of any one of claims 37 or 38, wherein the dibasic sodium phosphate anhydrous is at a concentration of about 1.3 mg/ml.

51. The pharmaceutical composition of any one of claims 37 or 38, wherein the dibasic sodium phosphate anhydrous is at a concentration of about 1.4 mg/ml.

52. The pharmaceutical composition of claim 19, further comprising a salt.

53. The pharmaceutical composition of claim 52, wherein the salt is at a concentration in a range of about 4 mg/ml to about 10 mg/ml.

54. The pharmaceutical composition of claim 52, wherein the salt is at a concentration of about 6 mg/ml.

55. The pharmaceutical composition of claim 52, wherein the salt is at a concentration of about 6.5 mg/ml.

56. The pharmaceutical composition of claim 52, wherein the salt is at a concentration of about 7 mg/ml.

57. The pharmaceutical composition of claim 52, wherein the salt is at a concentration of about 7.5 mg/ml.

58. The pharmaceutical composition of claim 52, wherein the salt is at a concentration of about 8 mg/ml.

59. A pharmaceutical composition comprising a therapeutically effective amount of a phosphorothioate oligonucleotide having at least a 50% sequence identity to SEQ ID NO: 1 (IMT504), at least two buffering agents, at least one sugar alcohol, or combinations thereof.

60. The pharmaceutical composition of claim 59, wherein the phosphorothioate oligonucleotide comprises at least a 90% sequence identity to SEQ ID NO: 1.

61. The pharmaceutical composition of claims 59 or 60, wherein the composition comprises SEQ ID NO: 1 in a range from about 1 mg/ml to about 150 mg/ml.

62. The pharmaceutical composition of claims 59 or 60, wherein the composition comprises SEQ ID NO: 1 at about 5 mg/ml.

63. The pharmaceutical composition of claims 59 or 60, wherein the composition comprises SEQ ID NO: 1 at about 10 mg/ml.

64. The pharmaceutical composition of claims 59 or 60, wherein the composition comprises SEQ ID NO: 1 at about 15 mg/ml.

65. The pharmaceutical composition of claims 59 or 60, wherein the composition comprises SEQ ID NO: 1 at about 20 mg/ml.

66. The pharmaceutical composition of claims 59 or 60, wherein the composition comprises SEQ ID NO: 1 at about 30 mg/ml.

67. The pharmaceutical composition of claims 59 or 60, wherein the composition comprises SEQ ID NO: 1 at about 40 mg/ml.

68. The pharmaceutical composition of claims 59 or 60, wherein the composition comprises SEQ ID NO: 1 at about 50 mg/ml.

69. The pharmaceutical composition of claim 59, wherein the at least tw'O buffering agents comprises monobasic sodium phosphate anhydrous and dibasic sodium phosphate anhydrous.

70. The pharmaceutical composition of claim 69, wherein the monobasic sodium phosphate anhydrous is at a concentration in a range of about 0.001 mg/ml to about 1 mg/ml.

71. The pharmaceutical composition of claim 69, wherein the monobasic sodium phosphate anhydrous is at a concentration of about 0.05 mg/ml.

72. The pharmaceutical composition of claim 69, wherein the monobasic sodium phosphate anhydrous is at a concentration of about 0.10 mg/ml.

73. The pharmaceutical composition of claim 69, wherein the monobasic sodium phosphate anhydrous is at a concentration of about 0.12 mg/ml.

74. The pharmaceutical composition of claim 69, wherein the monobasic sodium phosphate anhydrous is at a concentration of about 0.25 mg/ml.

75. The pharmaceutical composition of claim 69, wherein the dibasic sodium phosphate anhydrous is at a concentration in a range of about 0.5 mg/ml to about 2 mg/ml.

76. The pharmaceutical composition of claim 69, wherein the dibasic sodium phosphate anhydrous is at a concentration of about 0.5 mg/ml.

77. The pharmaceutical composition of claim 69, wherein the dibasic sodium phosphate anhydrous is at a concentration of about I mg/ml.

78. The pharmaceutical composition of claim 69, wherein the dibasic sodium phosphate anhydrous is at a concentration of about 1.1 mg/ml.

79. The pharmaceutical composition of claim 69, wherein the dibasic sodium phosphate anhy drous is at a concentration of about 1.2 mg/ml.

80. The pharmaceutical composition of claim 69, wherein the dibasic sodium phosphate anhydrous is at a concentration of about 1.3 mg/ml.

81. The pharmaceutical composition of claim 69, wherein the dibasic sodium phosphate anhydrous is at a concentration of about 1.4 mg/ml.

82. The pharmaceutical composition of claim 59, wherein the sugar alcohol is at a concentration in a range of about 10 mg/ml to about 60 mg/ml.

83. The pharmaceutical composition of claim 82, wherein the sugar alcohol is at a concentration of about 20 mg/ml.

84. The pharmaceutical composition of claim 82, wherein the sugar alcohol is at a concentration of about 30 mg/ml.

85. The pharmaceutical composition of claim 82, wherein the sugar alcohol is at a concentration of about 35 mg/ml.

86. The pharmaceutical composition of claim 82, wherein the sugar alcohol is at a concentration of about 40 mg/ml.

87. The pharmaceutical composition of claim 82, wherein the sugar alcohol is at a concentration of about 45 mg/ml.

88. The pharmaceutical composition of claim 59, wherein the composition is a lyophilized composition.

89. A method of treating retinal disorders in a subject, comprising administering to the subject a pharmaceutical composition comprising a therapeutically effective amount of a peptide encoded by a nucleic acid sequence having at least a 70% sequence identity to SEQ ID NO: 1.

58

90. The method of claim 89, wherein the pharmaceutical composition comprises a therapeutically effective amount of a peptide encoded by a nucleic acid sequence having at least a 90% sequence identity to SEQ ID NO: 1.

91. The method of claim 89, wherein the pharmaceutical composition comprises a therapeutically effective amount of a peptide encoded by a nucleic acid sequence comprising SEQ ID NO: 1.

92. The method of claim 89, wherein the pharmaceutical composition is administered via an intramuscular (i.m) route, subcutaneous (s.c.) route, intravenous (i.v.) route, an ophthalmic route or combinations thereof.

93. The method of the claim 89, wherein the retinal disorder is a subretinal or intraretinal fibrosis.

94. The method of the claim 89, wherein the retinal disorder is a diabetic retinopathy.

95. The method of the claim 89, wherein the retinal disorder is an age-related macular degeneration (AMD).

96. The method of claim 89, wherein the phosphor othioate oligonucleotide SEQ ID NO: 1.

97. The method of claim 89, wherein the pharmaceutical composition solution comprising the phosphor othioate oligonucleotide is administered in combination with an antioxidant agent.

98. A pharmaceutical composition comprising an aqueous solution of a peptide encoded by a phosphorothioate oligonucleotide comprising a nucleic acid sequence having at least a 70% sequence identity⁷ to SEQ ID NO: 1 in concentrations ranging from at least 10 to at least 80 mg/mL and at least one osmolyte.

99. The pharmaceutical composition of claim 98, wherein the pharmaceutical composition comprises a therapeutically effective amount of a peptide encoded by a nucleic acid sequence having at least a 90% sequence identity⁷ to SEQ ID NO: 1.

100. The pharmaceutical composition of claim 98, wherein the pharmaceutical composition comprises a therapeutically effective amount of a peptide encoded by a nucleic acid sequence comprising SEQ ID NO: 1.

59

101. The pharmaceutical composition of claim 98, wherein the osmolyte comprises: sodium chloride, calcium chloride, magnesium sulfate, mannitol, sucrose, xylitol, glucose or combinations thereof.

102. The pharmaceutical composition of claim 98, wherein the pH is adjusted between 4 and 8 by a buffer, an acid or an alkali without the addition of a preservative.

103. The pharmaceutical composition of claim 98, wherein the osmolality is about 200 - 500 mOsm.