WO2023172966A1 - Compositions, systems and methods for eukaryotic gene editing - Google Patents

Compositions, systems and methods for eukaryotic gene editing Download PDF

Info

Publication number
WO2023172966A1
WO2023172966A1 PCT/US2023/063954 US2023063954W WO2023172966A1 WO 2023172966 A1 WO2023172966 A1 WO 2023172966A1 US 2023063954 W US2023063954 W US 2023063954W WO 2023172966 A1 WO2023172966 A1 WO 2023172966A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
sequence
cells
coding sequence
cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2023/063954
Other languages
English (en)
French (fr)
Inventor
Baisong Lu
Anthony Atala
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to JP2024553395A priority Critical patent/JP2025510574A/ja
Priority to EP23767652.3A priority patent/EP4489772A4/en
Priority to KR1020247032958A priority patent/KR20240155953A/ko
Priority to AU2023232138A priority patent/AU2023232138A1/en
Priority to CA3245468A priority patent/CA3245468A1/en
Publication of WO2023172966A1 publication Critical patent/WO2023172966A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • C12N9/222Clustered regularly interspaced short palindromic repeats [CRISPR]-associated [CAS] enzymes
    • C12N9/226Class 2 CAS enzyme complex, e.g. single CAS protein
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90Stable introduction of foreign DNA into chromosome
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/12Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1241Nucleotidyltransferases (2.7.7)
    • C12N9/1252DNA-directed DNA polymerase (2.7.7.7), i.e. DNA replicase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y207/00Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/07Nucleotidyltransferases (2.7.7)
    • C12Y207/07007DNA-directed DNA polymerase (2.7.7.7), i.e. DNA replicase
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/20Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/16011Human Immunodeficiency Virus, HIV
    • C12N2740/16041Use of virus, viral particle or viral elements as a vector
    • C12N2740/16043Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2795/00Bacteriophages
    • C12N2795/00011Details
    • C12N2795/10011Details dsDNA Bacteriophages
    • C12N2795/10311Siphoviridae
    • C12N2795/10322New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2795/00Bacteriophages
    • C12N2795/00011Details
    • C12N2795/18011Details ssRNA Bacteriophages positive-sense
    • C12N2795/18111Leviviridae
    • C12N2795/18122New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

Definitions

  • compositions and methods of using same for eukaryotic gene editing are described.
  • CRISPR-based genome editing can unpredictably generate on-target deletions, for example, long DNA deletions (e.g., >500 bp) in the genome of a cell.
  • long DNA deletions e.g., >500 bp
  • compositions and methods for editing a cellular genome while reducing on-target deletions are necessary for safe and efficient genome editing.
  • a mammalian expression plasmid comprising a eukaryotic promoter operably linked to a non-viral nucleic acid sequence
  • the non- viral nucleic acid sequence comprises: (i) a nucleic acid sequence encoding a fusion protein, wherein the fusion protein comprises: (a) a polypeptide comprising a DNA polymerase domain; and (b) a CRISPR-associated endonuclease coding sequence; and (ii) a guide RNA (gRNA) coding sequence, wherein the gRNA coding sequence comprises at least one aptamer coding sequence.
  • the polypeptide comprising a DNA polymerase domain comprises an E. coli DNA polymerase T (DNA Pol I) or a fragment thereof Tn
  • the polypeptide comprising a DNA polymerase domain comprises the Klenow fragment of E. coli DNA polymerase I (DNA Pol I).
  • the CRISPR-associated endonuclease coding sequence encodes a Cas9 protein or a Cpfl protein.
  • the at least one aptamer coding sequence encodes an aptamer sequence bound specifically by an ABP selected from the group consisting of MS2 coat protein, PP7 coat protein, lambda N RNA-binding domain, or Com protein.
  • the aptamer is an MS2 aptamer sequence or a com aptamer sequence.
  • the sgRNA coding sequence comprises at least one aptamer inserted into the tetraloop or the ST2 loop of the sgRNA coding sequence.
  • the sgRNA coding comprises at least one com aptamer inserted into the ST2 loop of the gRNA coding sequence.
  • a lentiviral packaging system comprising: a) a packaging plasmid comprising a eukaryotic promoter operably linked to a Gag nucleotide sequence, wherein the Gag nucleotide sequence comprises a nucleocapsid (NC) coding sequence and a matrix protein (MA) coding sequence, wherein one or both of the NC coding sequence or the MA coding sequence comprises at least one non-viral aptamer-binding protein (ABP) nucleotide sequence, and wherein the packaging plasmid does not encode a functional integrase protein; b) at least one mammalian expression plasmid provided herein; and c) an envelope plasmid comprising an envelope glycoprotein coding sequence.
  • a packaging plasmid comprising a eukaryotic promoter operably linked to a Gag nucleotide sequence, wherein the Gag nucleotide sequence comprises a nucleocapsid (NC) coding sequence and
  • the packaging plasmid further comprises a Rev nucleotide sequence and a Tat nucleotide sequence.
  • the system further comprises a second packaging plasmid comprising a Rev nucleotide sequence.
  • the at least one non-viral ABP nucleotide sequence encodes MS2 coat protein, PP7 coat protein, lambda N peptide, or Com protein.
  • a lentiviral particle comprising: (a) a fusion protein comprising a nucleocapsid (NC) protein or a matrix (MA) protein, wherein the NC protein or MA protein comprises at least one non-viral aptamer binding protein (ABP); and (b) a ribonucleotide protein (RNP) complex comprising: (i) a nucleic acid sequence encoding a fusion protein, wherein the fusion protein comprises: (a) a polypeptide comprising a DNA polymerase domain, and (b) a CRISPR-associated endonuclease coding sequence; and (ii) a guide RNA (gRNA) coding sequence, wherein the gRNA coding sequence comprises at least one aptamer coding sequence wherein the lentivirus-like particle does not comprise a functional integrase protein.
  • the CRISPR-associated endonuclease coding sequence encodes a
  • the fusion polypeptide comprises an E. coli DNA Pol I. In some embodiments, the polypeptide comprises the Klenow fragment of DNA Pol I.
  • a method of producing a lentiviral particle comprising: a) transfecting a plurality of eukaryotic cells with the packaging plasmid, the at least one mammalian expression plasmid, and the envelope plasmid of any system described herein; and b) culturing the transfected eukaryotic cells for sufficient time for lentiviral particles to be produced.
  • the lentiviral particle comprises a ribonucleotide protein (RNP) complex comprising: (i) nucleic acid sequence encoding a fusion protein, wherein the fusion protein comprises: (a) a polypeptide comprising a DNA polymerase domain and (b) a CRISPR-associated endonuclease coding sequence; and (ii) a guide RNA.
  • RNP ribonucleotide protein
  • the plurality of eukaryotic cells are mammalian cells.
  • cells comprising any of the plasmids, lentiviral packaging systems or lentivirus-like particles described herein. Cells modified by any of the methods provided herein are also provided.
  • a method of modifying a genomic target sequence in a cell comprising transducing a plurality of eukaryotic cells with a plurality of viral particles, wherein the plurality of viral particles comprise a lentivirus-like particle as provided herein comprising (a) a fusion protein comprising a NC protein or a MA protein wherein the NC protein or MA protein comprises at least one non-viral ABP; and (b) a RNP complex comprising: (i) a nucleic acid sequence encoding a fusion protein, wherein the fusion protein comprises: (a) a polypeptide comprising a DNA polymerase domain, and (b) a CRISPR- associated endonuclease coding sequence; and (ii) a gRNA coding sequence, wherein the gRNA coding sequence comprises at least one aptamer coding sequence wherein the lentivirus- like particle does not comprise a functional integrase protein, wherein the RNP complex
  • the number of on-target deletions greater than 500 base pairs in size is decreased in the cell as compared to a cell.
  • the ratio of on- target one base pair (1 -bp) deletions to on-target deletions greater than 1-bp is increased in the cell.
  • the ratio of on-target one base pair (1-bp) deletions to deletions greater than 500 base pairs is increased in the cell.
  • the number of templated insertions (TIS) increases in the cell.
  • the ratio of TIS to non- TIS increases in the cell.
  • the plurality of eukaryotic cells are mammalian cells. In some embodiments, the plurality of eukaryotic cells are cells present in subject. In some embodiments, the subject is a human subject. In some embodiments, the subject is injected with the plurality of viral particles.
  • a method for treating a disease in a subject comprising: a) obtaining cells from the subj ect; b) modifying the cells of the subj ect using the method provided herein using the lentivirus-like particles as provided herein; and c) administering the modified cells to the subject.
  • the disease is cancer.
  • the disease is Duchenne muscular dystrophy.
  • the cells are T cells.
  • the present application includes the following figures.
  • the figures are intended to illustrate certain embodiments and/or features of the compositions and methods, and to supplement any descnption(s) of the compositions and methods.
  • the figures do not limit the scope of the compositions and methods, unless the written description expressly indicates that such is the case.
  • FIG. 1 A is a diagram showing a counteracting DNA resection (e.g., by MRE11) by DNA polymerase I (DNA Pol I or pol I) fused to Cas9.
  • MMEJ microhomology -mediated end joining
  • SSA single stranded annealing
  • FIG. IB shows that DNA polymerase 1 generates one base pair (1-bp) insertions (TIS) via filling in 5’ overhangs.
  • the red nucleotides are filled in by DNA polymerase.
  • the target site of CLCN5 sgRNA ((GAGGACAAGTCGTACAATGGTGG) (SEQ ID NO: 111) and its complement (CTCCTGTTCAGCATGTTACCACC) (SEQ ID NO: 112)) was used as an example.
  • the cleavage sites on both strands generate one nucleotide (1 -nt) 5’ overhangs, as indicated by small arrows.
  • FIG. 1C is a graph showing that fusion of DNA pol I to Cas9 increased the percentage of 1-bp deletions and decreased >l-bp deletions targeting CLCN5 gene in HEK293T cells. Two-way ANOVA was followed by Bonferroni posttests. Replicate numbers are listed in parenthesis.
  • FIG. ID is a graph showing that fusion of DNA pol I to Cas9 (Cas9-pol I) increased the ratio of 1-bp TIS versus 1-bp non-TIS (two tailed t-test).
  • FIG. 2A is an illustration showing Cas9-pol I and various mutant fusion proteins tested in the studies described in the Examples. Dashed lines indicate the deleted regions.
  • FIG. 2B is a graph showing the effects of different DNA pol I mutants on deletion profiles targeting CLCN5 gene in HEK293T cells. Numbers in parentheses indicate biological replicate numbers. Groups above the red dashed lines showed statistical significance compared to those below the lines
  • FIG. 2C is a graph showing the effects of different DNA pol I mutants on insertions targeting CLCN5 gene in HEK293T cells. Numbers in parentheses indicate biological replicate numbers. Groups above the red dashed lines showed statistical significance compared to those below the lines
  • FIG. 2D is a graph showing the effects of different DNA pol I mutants on deletion profiles targeting CLCN5 gene in IMR90 cells. Replicate numbers were 3 for all groups. * and ** indicate p ⁇ 0.05 and p ⁇ 0.01, respectively, between the indicated group and all other groups (Bonferroni posttests following two-way ANOVA).
  • FIG. 2E is a graph showing the effects of different DNA pol I mutants on insertions targeting CLCN5 gene in IMR90 cells. Replicate numbers were 3 for all groups. * and ** indicate p ⁇ 0.05 and p ⁇ 0.01, respectively, between the indicated group and all other groups (Bonferroni posttests following two-way ANOVA).
  • FIG. 3A is a graph showing the effects of RBBP8 knockdown on Cas9-induced DNA mutation profiles targeting CLCN5 in HEK293T cells. Replicate numbers were 6 for Cas9 and 3 for the remaining groups. *, ** and *** indicate p ⁇ 0.05, p ⁇ 0.01 and p ⁇ 0.001 between the indicated groups (Bonferroni post-tests following two-way ANOVA).
  • FIG. 3B is a graph showing the effects of RBBP8 knockdown on Cas9-induced insertions targeting CLCN5 in HEK293T cells. Replicate numbers were 6 for Cas9 and 3 for the remaining groups. *, ** and *** indicate p ⁇ 0.05, p ⁇ 0.01 and p ⁇ 0.001 between the indicated groups (Bonferroni post-tests following two-way ANOVA)
  • FIG. 3C is a graph showing the effects of Effects of RBBP8 knockdown on deletions with various sizes targeting CLCN5 in HEK293T cells.
  • the single and double arrows indicate the resection-dependent and independent deletions, respectively.
  • FIG. 3D shows the most frequently observed deletions generated by Cas9 targeting CLCN5 in HEK293T cells.
  • a partial wildtype CLCN5 sequence (SEQ ID NO: 113) is shown, as well as SEQ ID NO: 113 comprising an 11 base pair deletion (SEQ ID NO: 114), SEQ ID NO: 113 comprising a different 11 base pair deletion (SEQ ID NO: 115), SEQ ID NO: 113 comprising an 8 base pair deletion (SEQ ID NO: 116), SEQ ID NO: 113 comprising a different 8 base pair deletion (SEQ ID NO: 117), and SEQ ID NO: 113 comprising a 16 base pair deletion (SEQ ID NO: 118). Dashed lines indicate deletions. Microhomology is underlined. Microhomology away from cleavage sites is indicated with a caret symbol ( A ). Asterisks indicate microhomology at the predicted cleavage size, which is indicated by a vertical dashed line.
  • FIG. 4A shows examination of suppressed deletions targeting HBB gene in hematopoietic cells.
  • * and *** indicate p ⁇ 0.05 and p ⁇ 0.001, respectively, between Cas9 and Cas9-Klenow (Bonferroni posttests following two-way ANOVA).
  • a partial wildtype HBB sequence SEQ ID NO: 119
  • SEQ ID NO: 120 SEQ ID NO: 120
  • SEQ ID NO: 119 comprising a 12 base pair deletion
  • the top image shows the peaks of deletions and the bottom image show the most frequently observed deletions.
  • Microhomology was underlined.
  • Asterisks (*) indicate microhomology at the predicted cleavage size, which is indicated by a vertical dashed line. Carets ( A ) indicate microhomology away from the predicted cleavage site. Each group has three biological replicates.
  • FIG. 4B shows examination of suppressed deletions targeting DMD exon 53 in HEK293T cells.
  • * and *** indicate p ⁇ 0.05 and pO.OOl, respectively, between Cas9 and Cas9- Klenow (Bonferroni posttests following two-way ANOVA).
  • a partial wildtype DMD exon 53 sequence (SEQ ID NO: 122) as well as SEQ ID NO: 122 comprising an 11 base pair deletion (SEQ ID NO: 123), SEQ ID NO: 122 comprising a 9 base pair deletion (SEQ ID NO: 124), and SEQ ID NO: 122 with a 6 base pair deletion are shown (SEQ ID NO: 125).
  • the top image shows the peaks of deletions and the bottom image shows the most frequently observed deletions Microhomology is underlined.
  • Asterisks (*) indicate microhomology at the predicted cleavage size, which is indicated by a vertical dashed line.
  • Carets ( A ) indicate microhomology away from the predicted cleavage site. Each group has three biological replicates.
  • FIG. 4C shows examination of suppressed deletions targeting HBB gene in IMR90 cells. * and *** indicate p ⁇ 0.05 and p ⁇ 0.001, respectively, between Cas9 and Cas9-Klenow (Bonferroni posttests following two-way ANOVA).
  • a partial wildty pe HBB sequence (SEQ ID NO: 126 is shown, as well as SEQ ID NO: 126 comprising a 3 base pair deletion (SEQ ID NO: 127) and SEQ ID NO: 126 comprising a 5 base pair deletion (SEQ ID NO: 128).
  • the top image show the peaks of deletions and the bottom image shows the most frequently observed deletions.
  • Microhomology is underlined. Asterisks (*) indicate microhomology at the predicted cleavage size, which is indicated by a vertical dashed line. Carets ( A ) indicate microhomology away from the predicted cleavage site. Each group has three biological replicates.
  • FIG. 4D shows examination of suppressed deletions targeting DMD exon 44 in human myoblasts. * and *** indicate p ⁇ 0.05 and p ⁇ 0.001, respectively, between Cas9 and Cas9-Klenow (Bonferroni posttests following two-way ANOVA).
  • a partial wildtype DMD44 sequence (SEQ ID NO: 129) is shown, as well as SEQ ID NO: 129 comprising a 10 base pair deletion (SEQ ID NO: 130), SEQ ID NO: 129 comprising a 7 base pair deletion (SEQ ID NO: 131), and SEQ ID NO: 129 comprising a different 7 base pair deletion (SEQ ID NO: 132).
  • the top image show the peaks of deletions and the bottom image shows the most frequently observed deletions.
  • Microhomology is underlined. Asterisks (*) indicate microhomology at the predicted cleavage size, which is indicated by a vertical dashed line. Carets ( A ) indicate microhomology away from the predicted cleavage site. Each group has three biological replicates.
  • FIG. 5A shows the large deletions generated by Cas9 and Cas9-Klenow targeting CLCN5 gene in HEK293T cells.
  • the data were combined from three replicates.
  • the regions labeled 434 asnd 4534 indicate the two 25-bp sequence used for calculating distance for deletion detection.
  • the regions labeled 2471, 2481, and 2487 indicate the sgRNA target and the region labeled 2494 indicates the PAM.
  • the asterisks indicate the identical deletions independently observed in two different experiments.
  • FIG. 5B shows the large deletions generated by Cas9 and Cas9-Klenow targeting CLCN5 gene in IMR90 cells. The data were combined from three replicates.
  • the regions labeled 434 and 4534 indicate the two 25-bp sequence used for calculating distance for deletion detection.
  • the regions labeled 2471, 2489, and 2488 indicate the sgRNA target and the region labeled 2494 indicates the PAM.
  • the asterisks indicate the identical deletions independently observed in two different experiments
  • FIG. 6 is a next generation sequencing (NGS) analysis of the integrated target sequence in GFP-reporter cells treated with CLCN5 sgRNA and Cas9-pol. SEQ ID NOs: 133- 141 are shown.
  • FIG. 7 is a graph showing that Cas9 and various exonuclease fusions had similar mutation profdes as Cas9. Numbers in parentheses indicate replicate numbers.
  • FIG. 8A is a graph showing the effects of different pol I domains on 2-bp TIS.
  • the data for exo, 3’ exo and 5’ exo fusion proteins targeting CLCN5 in HEK293T cells were pooled into one group. Each dot indicates one datum point. ** and *** indicate p ⁇ 0.05 and p ⁇ 0.001, respectively, compared with Cas9 group. Tukey's Multiple Comparison Test was performed following one-way ANOVA. Cas9-pol showed a trend of increase but did not reach statistical significance due to large intra group variation.
  • FIG. 8B is a graph showing the effects of different pol I domains on 3-bp TIS.
  • the data for exo, 3’ exo and 5’ exo fusion proteins targeting CLCN5 in HEK293T cells were pooled into one group. Each dot indicates one datum point. ** and *** indicate p ⁇ 0.05 and p ⁇ 0.001, respectively, compared with Cas9 group. Tukey’s Multiple Comparison Test was performed following one-way ANOVA. Cas9-pol showed a trend of increase but did not reach statistical significance due to large mtra group variation.
  • FIG. 9 is a graph showing that the overall INDEL rates did not have an effect on the percentages of different mutation types.
  • FIG. 10A is a graph showing the Effects of MRE11 or RBBP8 Knockdown on CLCN5 mutation profiles (% of all INDELs) in IMR90 cells. Each group had 3 biological replicates. Two-way ANOVA was followed by Bonferroni posttests. ** and *** indicate p ⁇ 0.01 and p ⁇ 0.001, respectively, between the indicated groups.
  • FIG. 10B is a graph showing the Effects of MRE11 or RBBP8 Knockdown on CLCN5 mutation profiles (% of all insertions) in IMR90 cells. Each group had 3 biological replicates. Two-way ANOVA was followed by Bonferroni posttests. ** and *** indicate p ⁇ 0.01 and p ⁇ 0.001, respectively, between the indicated groups.
  • FIG. 11A shows deletions that were decreased by Cas9-Klenow when targeting HBB in HEK293T cells.
  • the graph (top image) show's the percentages of deletion sizes.
  • the bottom image show the sequences of the most commonly observed deletions.
  • a partial wildtype HBB sequence (SEQ ID NO: 142) is shown, as well as SEQ ID NO: 142 comprising a 3 base pair deletion (SEQ ID NO: 143), SEQ ID NO: 142 comprising a 5 base pair deletion (SEQ ID NO: 144), and SEQ ID NO: 142 comprising a 10 base pair deletion (SEQ ID NO: 145).
  • the regions underlined with green tines indicate microhomology at the predicted cleavage site which is indicated by vertical dashed lines.
  • Two-way ANOVA was followed by Bonferroni posttests. * and *** indicates p ⁇ 0.05 and PO.OOl, respectively, between the two groups.
  • FIG. 11B shows deletions that were decreased by Cas9-Klenow when targeting Intergenic 1 in IMR90 cells.
  • the graph (top image) show the percentages of deletion sizes.
  • the bottom image show the sequences of the most commonly observed deletions.
  • a partial wildtype Intergenic 1 sequence (SEQ ID NO: 146) is shown, as well as SEQ ID NO: 146 comprising a 4 base pair deletion (SEQ ID NO: 147).
  • the sgRNA is shown shaded (in gray).
  • PAM is indicated by overline.
  • FIG. 11C shows deletions that were decreased by Cas9-Klenow when targeting CLCN5 in IMR90 cells.
  • the graph (top image) shows the percentages of deletion sizes.
  • the bottom image show the sequences of the most commonly observed deletions. No sequence could be listed for CLCAG7IMR90 since no major deletion peaks were observed.
  • the sgRNA is shown shaded (in gray).
  • PAM is indicated by overline.
  • the transitional phrase "consisting essentially of' (and grammatical variants) is to be interpreted as encompassing the recited materials or steps "and those that do not materially affect the basic and novel characteristic(s)" of the claimed invention. See In re Herz, 537 F.2d 549, 551-52, 190 U.S.P.Q. 461, 463 (CCPA 1976) (emphasis in the original); see also MPEP ⁇ 2111.03. Thus, the term “consisting essentially of' as used herein should not be interpreted as equivalent to "comprising.”
  • nucleic acid refers to deoxyribonucleic acids (DNA) or ribonucleic acids (RNA) (e.g., mRNA) and polymers thereof in either single- or doublestranded form. It is understood that when an RNA is described, its corresponding DNA is also described, wherein uridine is represented as thymidine. Similarly, when a DNA is described, its corresponding RNA is also described wherein thymidine is represented by uridine.
  • nucleic acids containing known analogues of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides.
  • a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences as well as the sequence explicitly indicated.
  • degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer et al., Nucleic Acid Res.
  • polynucleotides of the invention also encompass all forms of sequences including, but not limited to, single-stranded forms, double-stranded forms, hairpins, stem-and-loop structures, and the like.
  • the term “gene” can refer to the segment of DNA involved in producing or encoding a polypeptide chain. It may include regions preceding and following the coding region (leader and trailer) as well as intervening sequences (introns) between individual coding segments (exons). Alternatively, the term “gene” can refer to the segment of DNA involved in producing or encoding a non-translated RNA, such as an rRNA, tRNA, guide RNA, or micro RNA
  • Treating refers to any indicia of success in the treatment or amelioration or prevention of the disease, condition, or disorder, including any objective or subjective parameter such as abatement; remission; diminishing of symptoms or making the disease condition more tolerable to the patient; slowing in the rate of degeneration or decline; or making the final point of degeneration less debilitating.
  • the treatment or amelioration of symptoms can be based on objective or subjective parameters; including the results of an examination by a physician.
  • the term “treating” includes the administration of the compounds or agents of the present disclosure to prevent or delay, to alleviate, or to arrest or inhibit development of the symptoms or conditions associated with a disease, condition or disorder as described herein.
  • therapeutic effect refers to the reduction, elimination, or prevention of the disease, symptoms of the disease, or side effects of the disease in the subject.
  • “Treating” or “treatment” using the methods of the present disclosure includes preventing the onset of symptoms in a subject that can be at increased risk of a disease or disorder associated with a disease, condition or disorder as described herein, but does not yet experience or exhibit symptoms, inhibiting the symptoms of a disease or disorder (slowing or arresting its development), providing relief from the symptoms or side effects of a disease (including palliative treatment), and relieving the symptoms of a disease (causing regression).
  • Treatment can be prophylactic (to prevent or delay the onset of the disease, or to prevent the manifestation of clinical or subclinical symptoms thereof) or therapeutic suppression or alleviation of symptoms after the manifestation of the disease or condition.
  • treatment includes preventative (e g., prophylactic), curative, or palliative treatment.
  • a “promoter” is defined as one or more a nucleic acid control sequences that direct transcription of a nucleic acid.
  • a promoter includes necessary nucleic acid sequences near the start site of transcription, such as, in the case of a polymerase II type promoter, a TATA element.
  • a promoter also optionally includes distal enhancer or repressor elements, which can be located as much as several thousand base pairs from the start site of transcription.
  • Polypeptide “peptide,” and “protein” are used interchangeably herein to refer to a polymer of ammo acid residues. All three terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymers As used herein, the terms encompass full-length proteins, truncated proteins, and fragments thereof, and amino acid chains, wherein the amino acid residues are linked by covalent peptide bonds.
  • fusion polypeptide or “fusion protein” is a polypeptide comprising two or more proteins or fragments thereof. In some embodiments, a linker comprising about 3 to 10 amino acids can be positioned between any two proteins or fragments thereof to help facilitate proper folding of the proteins upon expression.
  • identity refers to a sequence that has at least 60% sequence identity to a reference sequence.
  • percent identity can be any integer from 60% to 100%.
  • Exemplary embodiments include at least: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, as compared to a reference sequence using the programs described herein; preferably BLAST using standard parameters, as described below.
  • sequences having at 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to any nucleotide or polypeptide sequence set forth herein, for example, any one of SEQ ID NOs: 1- 110, can be used in the compositions and methods provided herein.
  • a nucleic acid sequence can comprise, consist of, or consist essentially of any nucleic acid sequence described herein.
  • a polypeptide can comprise, consist of, or consist essentially of, any polypeptide sequence described herein.
  • For sequence comparison typically one sequence acts as a reference sequence to which test sequences are compared.
  • test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated.
  • sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.
  • a “comparison window”, as used herein, includes reference to a segment of any one of the number of contiguous positions selected from the group consisting of from 20 to 600, about 20 to 50, about 20 to 100, about 50 to about 200 or about 100 to about 150, in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned.
  • Methods of alignment of sequences for comparison are well-known in the art. Optimal alignment of sequences for comparison may be conducted by the local homology algorithm of Smith and Waterman Add. APL. Math. 2:482 (1981), by the homology alignment algorithm of Needleman and Wunsch J. Mol. Biol.
  • HSPs high scoring sequence pairs
  • T is referred to as the neighborhood word score threshold (Altschul et al, supra).
  • These initial neighborhood word hits acts as seeds for initiating searches to find longer HSPs containing them.
  • the word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always ⁇ 0). Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached.
  • the BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment.
  • the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Nat'l. Acad. Sci. USA 90:5873-5787 (1993)).
  • One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance.
  • P(N) the smallest sum probability
  • a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.01, more preferably less than about 10-5, and most preferably less than about 10-20.
  • subject an individual.
  • the subject is a mammal, such as a primate, and, more specifically, a human.
  • Non-human primates are subjects as well.
  • subject includes domesticated animals, such as cats, dogs, etc., livestock (for example, cattle, horses, pigs, sheep, goats, etc.) and laboratory animals (for example, ferret, chinchilla, mouse, rabbit, rat, gerbil, guinea pig, etc.).
  • livestock for example, cattle, horses, pigs, sheep, goats, etc.
  • laboratory animals for example, ferret, chinchilla, mouse, rabbit, rat, gerbil, guinea pig, etc.
  • veterinary uses and medical uses and formulations are contemplated herein.
  • the term does not denote a particular age or sex. Thus, adult and newborn subjects, whether male or female, are intended to be covered.
  • patient or subject may be used interchangeably and can refer to a subject afflicted with a
  • An “expression cassette” is a nucleic acid construct, generated recombinantly or synthetically, with a series of specified nucleic acid elements that permit transcription of a particular polynucleotide sequence in a host cell.
  • An expression cassette may be part of a plasmid, viral genome, or nucleic acid fragment.
  • an expression cassette includes a polynucleotide to be transcribed, operably linked to a promoter, followed by a transcription termination signal sequence.
  • An expression cassette may or may not include specific regulatory sequences, such as 5’ or 3’ untranslated regions from human globin genes.
  • a “reporter gene” encodes proteins that are readily detectable due to their biochemical characteristics, such as enzymatic activity or chemifluorescent features. These reporter proteins can be used as selectable markers.
  • One specific example of such a reporter is green fluorescent protein. Fluorescence generated from this protein can be detected with various commercially-available fluorescent detection systems. Other reporters can be detected by staining.
  • the reporter can also be an enzyme that generates a detectable signal when contacted with an appropriate substrate.
  • the reporter can be an enzyme that catalyzes the formation of a detectable product. Suitable enzymes include, but are not limited to, proteases, nucleases, lipases, phosphatases and hydrolases.
  • the reporter can encode an enzyme whose substrates are substantially impermeable to eukaryotic plasma membranes, thus making it possible to tightly control signal formation.
  • suitable reporter genes that encode enzymes include, but are not limited to, CAT (chloramphenicol acetyl transferase; Alton and Vapnek (1979) Nature 282: 864-869); luciferase (lux); (3-galactosidase; LacZ; (3.- glucuromdase; and alkaline phosphatase (Toh, et al. (1980) Eur. J. Biochem. 182: 231-238; and Hall et al. (1983) J. Mol. Appl. Gen. 2: 101), each of which are incorporated by reference herein in its entirety.
  • Other suitable reporters include those that encode for a particular epitope that can be detected with a labeled antibody that specifically recognizes the epitope.
  • CRISPR/Cas refers to a widespread class of bacterial systems for defense against foreign nucleic acid.
  • CRISPR/Cas systems are found in a wide range of eubacterial and archaeal organisms.
  • CRISPR/Cas systems include type I, II, and III sub-types.
  • the CRISPR/Cas system classification as described in by Makarova, et al. defines five types and 16 subtypes based on shared characteristics and evolutionary similarity. These are grouped into two large classes based on the structure of the effector complex that cleaves genomic DNA.
  • the Type II CRISPR/Cas system was the first used for genome engineering, with Type V following in 2015.
  • Wild-type type II CRISPR/Cas systems utilize an RNA-mediated nuclease Cas protein or homolog (referred to herein as a “CRISPR-associated endonuclease”) in complex with guide RNA to recognize and cleave foreign nucleic acid.
  • Cas9 proteins also use an activating RNA (also referred to as a transactivating or tracr RNA).
  • Guide RNAs having the activity of either a guide RNA or both a guide RNA and an activating RNA, depending on the type of CRISPR-associated endonuclease used therewith, are also known in the art.
  • sgRNA single guide RNA
  • Synthetic guide RNAs that do not contain an activating RNA sequence may also be referred to as sgRNAs.
  • sgRNA and gRNA are used interchangeably to refer to an RNA molecule that complexes with a CRISPR-associated endonuclease and localizes the CRISPR-associated endonuclease, for example, a CRISPR-associated endonuclease in a ribonucleoprotein complex, to a target DNA sequence.
  • activity in the context of sgRNA activity, or RNP activity, i.e., RNP activity of a complex comprising: (1) a gRNA and (2) a fusion protein comprising a CRISPR-associated endonuclease and a DNA polymerase domain, refers to the ability of a sgRNA to bind to a target genetic element.
  • activity also refers to the ability of an RNP (i.e., an sgRNA complexed with a fusion protein comprising a CRISPR-associated endonuclease and a DNA polymerase domain) to edit the genome of a cell.
  • the phrase “editing” in the context of editing of a genome of a cell refers to inducing a structural change in the sequence of the genome at a target genomic region, for example, cleaving a genomic sequence and inserting a donor sequence into the genome of a cell, at the cleavage site, via homology directed repair (HDR), or cleaving a sequence and allowing repair via non- homologous end joining (NHEJ).
  • HDR homology directed repair
  • NHEJ non- homologous end joining
  • ribonucleoprotein complex refers to a complex between: (1) a fusion protein comprising a CRISPR-associated endonuclease (e.g., Cas9) and a DNA polymerase domain, and a crRNA (e.g., guide RNA or single guide RNA), (2) a fusion protein comprising a CRISPR-associated endonuclease and a DNA polymerase domain; and a trans-activating crRNA (tracrRNA), (3) a fusion protein comprising a CRISPR-associated endonuclease and a DNA polymerase domain, and a guide RNA, or (4) a combination thereof (e.g., a complex containing the fusion protein comprising a CRISPR- associated endonuclease and a DNA polymerase domain, a tracrRNA, and a crRNA guide).
  • a fusion protein comprising a CRISPR-associated endonuclease (e.g., Cas9) and
  • a “cell” can be any eukaryotic cell, for example, human T cell or a cell capable of differentiating into a T cell, for example, a T cell that expresses a TCR receptor molecule. These include hematopoietic stem cells and cells derived from hematopoietic stem cells. Populations of cells, for example, populations of cells comprising viral particles or genetically modified cells made by any of the genomic editing methods provided herein, are also provided.
  • hematopoietic stem cell refers to a type of stem cell that can give rise to a blood cell. Hematopoietic stem cells can give rise to cells of the myeloid or lymphoid lineages, or a combination thereof. Hematopoietic stem cells are predominantly found in the bone marrow, although they can be isolated from peripheral blood, or a fraction thereof. Various cell surface markers can be used to identify, sort, or punfy hematopoietic stem cells. In some cases, hematopoietic stem cells are identified as c-kit+ and lin-.
  • human hematopoietic stem cells are identified as CD34+, CD59+, Thy 1/CD90+, CD381o/-, C- kit/CD117+, lin-. In some cases, human hematopoietic stem cells are identified as CD34-, CD59+, Thyl/CD90+, CD381o/-, C-kit/CDl 17+, lin-. In some cases, human hematopoietic stem cells are identified as CD133+, CD59+, Thyl/CD90+, CD381o/-, C-kit/CDl 17+, lin-.
  • mouse hematopoietic stem cells are identified as CD341o/-, SCA-1+, Thyl+/lo, CD38+, C-kit +, lin-.
  • the hematopoietic stem cells are CD150+CD48-CD244-.
  • the phrase “hematopoietic cell” refers to a cell derived from a hematopoietic stem cell. The hematopoietic cell may be obtained or provided by isolation from an organism, system, organ, or tissue (e.g., blood, or a fraction thereof).
  • an hematopoietic stem cell can be isolated and the hematopoietic cell obtained or provided by differentiating the stem cell.
  • Hematopoietic cells include cells with limited potential to differentiate into further cell types. Such hematopoietic cells include, but are not limited to, multipotent progenitor cells, lineage-restricted progenitor cells, common myeloid progenitor cells, granulocyte-macrophage progenitor cells, or megakaryocyte-erythroid progenitor cells.
  • Hematopoietic cells include cells of the lymphoid and myeloid lineages, such as lymphocytes, erythrocytes, granulocytes, monocytes, and thrombocytes.
  • the hematopoietic cell is an immune cell, such as a T cell, B cell, macrophage, a natural killer (NK) cell or dendritic cell.
  • the cell is an innate immune cell.
  • T cell refers to a lymphoid cell that expresses a T cell receptor molecule.
  • T cells include human alpha beta (a(3) T cells and human gamma delta (y5) T cells.
  • T cells include, but are not limited to, naive T cells, stimulated T cells, primary T cells (e.g., uncultured), cultured T cells, immortalized T cells, helper T cells, cytotoxic T cells, memory T cells, regulatory T cells, natural killer T cells, combinations thereof, or subpopulations thereof.
  • T cells can be CD4+, CD8+, or CD4+ and CD8+.
  • T cells can also be CD4- , CD8-, or CD4- and CD8-.
  • T cells can be helper cells, for example helper cells of type TH1, TH2, TH3, TH9, TH17, or TFH.
  • T cells can be cytotoxic T cells.
  • Regulatory T cells can be FOXP3+ or FOXP3-.
  • T cells can be alpha/beta T cells or gamma/delta T cells.
  • the T cell is a CD4+CD25hiCD1271o regulatory T cell.
  • the T cell is a regulatory T cell selected from the group consisting of type 1 regulatory (Tri), TH3, CD8+CD28-, Tregl7, and Qa-1 restricted T cells, or a combination or sub-population thereof.
  • the T cell is a FOXP3+ T cell.
  • the T cell is a CD4+CD251oCD127hi effector T cell. In some cases, the T cell is a CD4+CD251oCD127hiCD45RAhiCD45RO- naive T cell.
  • a T cell can be a recombinant T cell that has been genetically manipulated.
  • the phrase “primary” in the context of a primary cell is a cell that has not been transformed or immortalized. Such primary' cells can be cultured, sub-cultured, or passaged a limited number of times (e.g., cultured 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 times). In some cases, the primary cells are adapted to in vitro culture conditions. In some cases, the primary cells are isolated from an organism, system, organ, or tissue, optionally sorted, and utilized directly without culturing or sub-culturing. In some cases, the primary cells are stimulated, activated, or differentiated. For example, primary T cells can be activated by contact with (e.g., culturing in the presence of) CD3, CD28 agonists, IL-2, IFN- y, or a combination thereof.
  • compositions and methods recites various aspects and embodiments of the present compositions and methods. No particular embodiment is intended to define the scope of the compositions and methods. Rather, the embodiments merely provide non-limiting examples of various compositions and methods that are at least included within the scope of the disclosed compositions and methods The description is to be read from the perspective of one of ordinary skill in the art; therefore, information well known to the skilled artisan is not necessarily included.
  • the CRISPR/Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats and CRISPR-associated protein 9) system uses a single effector protein to make DNA doublestrand breaks (DSBs) guided by single guide RNA (sgRNA), and has been used to make specific genetic changes in human cells.
  • Streptococcus pyogenes Cas9 (SpCas9) mainly generates blunt ends via cleaving the both DNA strands 3 nucleotides (nt) upstream of the “NGG” Protospacer Adjacent Motif (PAM). It can also generate staggered ends with 1, 2 or 3 nt 5’ overhangs via cleaving the targeting strand 3 nt, and the non-targeting strand 4, 5, or 6 nt upstream of the PAM.
  • PAM Protospacer Adjacent Motif
  • DSBs double stranded breaks
  • HDR homology-directed repair
  • cNHEJ or NHEJ canonic non- homologous end joining
  • MMEJ microhomology-mediated end joining
  • SSA single strand annealing
  • Pol X family members Pol X, p. and (3 and terminal transferase
  • TISs templated insertions
  • HDR, MMEJ and SSA repair pathways all depend on DNA resection to generate 3 ’ overhangs.
  • DNA resection is initiated by the MRE11-RAD50-NBS1 complex and stimulated by CUP (encoded by RBBP8).
  • CUP encoded by RBBP8.
  • MRE1 l’s endonuclease activity generates a nick 3’ to the DSB, and the 3’-5’ exonucleolytic activity generates a 3'-single stranded DNA overhang from the nick.
  • HDR uses long 3’ overhangs and the DNA template to faithfully repair the DSBs.
  • MMEJ and SSA use microhomology (2-5 nt) and short homology (10-15 nt), respectively, in the two 3’ overhangs to facilitate DNA synthesis, generating DNA deletions with sizes depending on the distances between the homologous regions.
  • Long 3’ overhangs from excessive DNA resection can also be filled in by DNA pola and associated complexes. This fill-in reaction explains the observed small tandem duplicates at DSBs with 3‘ overhangs generated by Cas9 nickases.
  • compositions, systems, methods of manufacture, and methods for genome editing are provided herein.
  • the genome of a cell can be efficiently edited using a CRISPR-associated endonuclease, while reducing the number of long deletions generated in the genome of the cell, for example, by increasing non- homologous end joining (NHEJ) in the cell as compared to non-NHEJ (for example, microhomology -mediated end joining (MMEJ) or single strand annealing (SSA)) in the cell.
  • NHEJ non- homologous end joining
  • MMEJ microhomology -mediated end joining
  • SSA single strand annealing
  • Exemplary components, systems, methods of manufacture, and methods for editing the genome of a cell using an RNP comprising (1) a fusion protein comprising a CRISPR-associated endonuclease and a polypeptide comprising a DNA polymerase domain; and (2) an sgRNA are provided herein.
  • mammalian expression plasmids that are used to deliver CRISPR component coding sequences, i.e., an sgRNA and a fusion protein comprising a CRISPR-associated endonuclease and a DNA polymerase domain, into mammalian cells being used to generate the lentivirus-like particles of this disclosure.
  • CRISPR component coding sequences i.e., an sgRNA and a fusion protein comprising a CRISPR-associated endonuclease and a DNA polymerase domain
  • a mammalian expression plasmid comprising a eukaryotic promoter operably linked to a non- viral nucleic acid sequence
  • the non-viral nucleic acid sequence comprises: (i) a nucleic acid sequence encoding a fusion protein, wherein the fusion protein comprises: (a) a polypeptide comprising a DNA polymerase domain; and (b) a CRISPR-associated endonuclease coding sequence; and (ii) a guide RNA (gRNA) coding sequence, wherein the gRNA coding sequence comprises at least one aptamer coding sequence.
  • gRNA guide RNA
  • the polypeptide comprising a DNA polymerase domain can be fused or linked to a CRISPR-associate endonuclease.
  • the CRISPR-associated endonuclease is linked to the polypeptide comprising a DNA polymerase domain via a peptide linker.
  • the linker can be between about 2 and about 25 amino acids in length.
  • the CRISPR-associated endonuclease coding sequence encodes a Cas9 protein.
  • Full-length Cas9 is an endonuclease comprising a recognition domain and two nuclease domains (HNH and RuvC, respectively) that creates double-stranded breaks in DNA sequences.
  • Cas9 is targeted to a genomic site in a cell by interacting with a guide RNA that hybridizes to a 20-nucleotide DNA sequence that immediately precedes an NGG motif recognized by Cas9. This results in a double-strand break in the genomic DNA of the cell.
  • a Cas9 nuclease that requires an NGG protospacer adjacent motif (PAM) immediately 3 ’ of the region targeted by the guide RNA can be utilized.
  • PAM NGG protospacer adjacent motif
  • Cas9 proteins with orthogonal PAM motif requirements can be utilized to target sequences that do not have an adjacent NGG PAM sequence.
  • Exemplary Cas9 proteins with orthogonal PAM sequence specificities include, but are not limited to those described in Esvelt et al., Nature Methods 10: 1116-1121 (2013).
  • Cas9 nucleases can be utilized in the methods described herein.
  • a Cas9 nuclease that requires an NGG protospacer adjacent motif (PAM) immediately 3’ of the region targeted by the guide RNA such as SpCas9
  • PAM NGG protospacer adjacent motif
  • Such Cas9 nucleases can be targeted to any region of a genome that contains an NGG sequence.
  • a Cas9 nuclease that requires an NNGRRT or NNGRR(N) PAM immediately 3’ of the region targeted by the guide RNA, such as SaCas9 can be utilized.
  • Cas9 proteins with orthogonal PAM motif requirements can be utilized to target sequences that do not have an adjacent NGG PAM sequence.
  • Exemplary Cas9 proteins with orthogonal PAM sequence specificities include, but are not limited to those described in Nature Methods 10, 1116-1121 (2013), and those described in Zetsche et al., Cell, Volume 163, Issue 3, p759-771, 22 October 2015.
  • An exemplary amino acid sequence for a Cas9 protein is set forth herein as SEQ ID NO: 29
  • the Cas9 protein is a nickase, such that when bound to target nucleic acid as part of a complex with a guide RNA, a single strand break or nick is introduced into the target nucleic acid.
  • a pair of Cas9 nickases, each bound to a structurally different guide RNA, can be targeted to two proximal sites of a target genomic region and thus introduce a pair of proximal single stranded breaks into the target genomic region.
  • nickase pairs can provide enhanced specificity because off-target effects are likely to result in single nicks, which are generally repaired without lesion by base-excision repair mechanisms.
  • Exemplary Cas9 nickases include Cas9 nucleases having a D10A or H840A mutation.
  • the CRISPR-associated endonuclease is a Cpfl polypeptide.
  • Cpfl protein is a Class TI, Type V CRTSPR/Cas system protein.
  • Cpfl is a smaller and simpler endonuclease than Cas9 (such as the spCas9).
  • the Cpfl protein has a RuvC-like endonuclease domain that is similar to the RuvC domain of Cas9 but does not have a HNH endonuclease domain.
  • the N-terminal domain of Cpfl also does not have the alpha-helical recognition lobe like the Cas9 protein.
  • Cpfl introduces a sticky-end-like DNA doublestranded break with a 4 or 5 nucleotide overhang.
  • the Cpfl protein does not need a tracrRNA; rather, the Cpfl protein functions with only a crRNA.
  • the sgRNA does not comprise a tracr sequence.
  • the sgRNA used with the Cpfl protein may comprise only a crRNA sequence (constant region).
  • a Cpfl protein that requires an TTTN or TTN PAM (depending on the species, where “N” is an nucleobase) immediately 5’ of the region targeted by the guide RNA can be utilized.
  • TTTN or TTN PAM depending on the species, where “N” is an nucleobase
  • N is an nucleobase
  • Known Cpfl proteins and derivatives thereof may be used in the context of this disclosure.
  • the CRISPR-associated endonuclease is FnCpflp and the PAM is 5' TTN, where N is A/C/G or T.
  • the CRISPR-associated endonuclease is PaCpflp and the PAM is 5' TTTV, where V is A/C or G
  • the CRISPR-associated endonuclease is FnCpflp and the PAM is 5' TTN, where N is A/C/G or T, and the PAM is located upstream of the 5' end of the protospacer.
  • the CRISPR-associated endonuclease is FnCpflp and the PAM is 5' CTA and is located upstream of the 5' end of the protospacer or the target locus.
  • the CRISPR-associated endonuclease is AsCpflp and the PAM is 5' TTTN.
  • An exemplary' amino acid sequence for Cpfl is set forth herein as SEQ ID NO: 30.
  • a DNA polymerase domain is a fragment of a full-length DNA polymerase that catalyzes the 5'-3’ polymerization of nucleotides into duplex DNA, in the presence of a nucleic acid template.
  • Any DNA polymerase domain or polypeptide comprising a DNA poly merase domain can be used to make the fusion proteins described herein.
  • the DNA polymerase domain is targeted to the site of the double-stranded break made by the CRISPR-associated endonuclease in the genome of the cell.
  • the DNA polymerase domain is catalytically active.
  • the catalytic activity of the DNA polymerase domain is reduced (e.g., relative to a corresponding wild-type DNA polymerase domain), for example, but at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 80%, 90% or 100%.
  • the DNA polymerase domain comprises one or more mutations, for example, a D705A mutation, that abolishes catalytic activity
  • the polypeptide comprising the DNA polymerase domain has polymerase activity and 3 ’-5’ exonuclease activity. In some cases, the polypeptide comprising the DNA polymerase domain has 3 ’-5' exonuclease activity, but has reduced or lacks polymerase activity (e.g., relative to a corresponding wild-type DNA polymerase domain).
  • DNA polymerase I DNA polymerase I
  • DNA Pol I is an enzyme that has 5 ’-3’ DNA dependent DNA polymerase activity, 3’-5’ exonuclease activity', 5’-3’ exonuclease activity and 5’-3’ RNA- dependent DNA polymerase activity.
  • An exemplary sequence for DNA Pol I is provided herein as SEQ ID NO: 27.
  • a DNA pol I fragment comprising a DNA polymerase domain is fused to the CRISPR-associated endonuclease.
  • the fragment comprises an amino acid sequence having 5’-3’DNA polymerase activity and an ammo acid sequence having 3’-5’ exonuclease activity (e.g., the Klenow fragment of DNA Pol I).
  • An exemplary sequence for the Klenow fragment of DNA Pol I is provided herein as SEQ ID NO: 28.
  • Other exemplary DNA polymerases include, but are not limited to Thermus aquaticus DNA Pol I and Bacillus stearothermophihis DNA pol I.
  • the mammalian expression plasmids provided herein comprise CRISPR component coding sequences, e.g., the coding sequence for a fusion protein comprising a CRISPR-associated endonuclease and a polypeptide comprising a DNA polymerase domain; and a gRNA.
  • the gRNA coding sequence comprises at least one aptamer coding sequence.
  • the at least one aptamer coding sequence may be positioned at the 5’ end or the 3’ end of the gRNA.
  • the at least one aptamer coding sequence may be inserted at an internal position within the gRNA such as, for example, at one or more of the loops formed in the folded gRNA.
  • the at least one aptamer coding sequence may be positioned at the tetra loop, the stem loop 2 (ST2), or the 3’ end of the gRNA.
  • a spacer of 1-30 nucleotides may be positioned between the gRNA the at least one aptamer coding sequence, or flanking the at least one aptamer coding sequence.
  • the mammalian expression vector comprises at least one aptamer coding sequence that encodes an aptamer sequence that is bound specifically by an aptamerbinding protein (ABP).
  • an aptamer sequence is an RNA sequence that forms a tertiary loop structure that is specifically bound by an ABP.
  • ABPs are RNA-binding proteins or RNA-binding protein domains.
  • Suitable aptamer coding sequences include polynucleotide sequences that encode known bacteriophage aptamer sequences.
  • Exemplary aptamer coding sequences include those encoding the aptamer sequences provided above in Table 1. In some instances, the aptamers are bound by a dimer of ABP.
  • aptamer sequences are RNA sequences known to be bound specifically by bacteriophage proteins.
  • the at least one aptamer coding sequence encodes an aptamer sequence bound specifically by an ABP selected from the group consisting of MS2 coat protein, PP7 coat protein, lambda N RNA-binding domain, or Com protein.
  • the mammalian expression vector comprises a sgRNA that comprises one aptamer coding sequence downstream thereof.
  • the gRNA may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 aptamer coding sequences.
  • the gRNA may comprise two aptamer coding sequences in tandem.
  • a sgRNA is a single guide RNA sequence that interacts with a CRISPR-associated endonuclease (a CRISPR site-directed nuclease) and specifically binds to or hybridizes to a target nucleic acid within the genome of a cell (genomic target sequence), such that the sgRNA and the CRISPR-associated endonuclease co-localize to the target nucleic acid in the genome of the cell.
  • Each sgRNA includes a DNA targeting sequence or protospacer sequence of about 10 to 50 nucleotides in length that specifically binds to or hybridizes to a target DNA sequence in the genome.
  • the DNA targeting sequence may be about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length.
  • the DNA targeting sequence may be about 15-30 nucleotides, about 15-25 nucleotides, about 10-25 nucleotides, or about 18-23 nucleotides.
  • the DNA targeting sequence is about 20 nucleotides.
  • the sgRNA comprises a crRNA sequence and a transactivating crRNA (tracrRNA) sequence. In some embodiments, the sgRNA does not comprise a tracrRNA sequence.
  • the DNA targeting sequence is designed to complement (e.g., perfectly complement) or substantially complement (e.g., having 1-4 mismatches) to the target DNA sequence.
  • the DNA targeting sequence can incorporate wobble or degenerate bases to bind multiple genetic elements.
  • the 19 nucleotides at the 3’ or 5’ end of the binding region are perfectly complementary to the target genetic element or elements.
  • the binding region can be altered to increase stability. For example, non-natural nucleotides, can be incorporated to increase RNA resistance to degradation.
  • the binding region can be altered or designed to avoid or reduce secondary structure formation in the binding region.
  • the binding region can be designed to optimize G-C content.
  • G-C content is preferably between about 40% and about 60% (e.g., 40%, 45%, 50%, 55%, 60%).
  • the binding region can be selected to begin with a sequence that facilitates efficient transcription of the sgRNA.
  • the binding region can begin at the 5’ end with a G nucleotide.
  • the binding region can contain modified nucleotides such as, without limitation, methylated or phosphorylated nucleotides.
  • complementary refers to base pairing between nucleotides or nucleic acids, for example, and not to be limiting, base pairing between a sgRNA and a target sequence.
  • Complementary nucleotides are, generally, A and T (or A and U), and G and C.
  • the guide RNAs described herein can comprise sequences, for example, DNA targeting sequence that are perfectly complementary or substantially complementary (e.g., having 1-4 mismatches) to a genomic sequence.
  • the sgRNA includes a sgRNA constant region that interacts with or binds to the CRISPR-associated endonuclease.
  • the constant region of an sgRNA can be from about 75 to 250 nucleotides in length.
  • the constant region is a modified constant region comprising one, two, three, four, five, six, seven, eight, nine, ten or more nucleotide substitutions in the stem, the stem loop, a hairpin, a region in between hairpins, and/or the nexus of a constant region.
  • a modified constant region that has at least 80%, 85%, 90%, or 95% activity , as compared to the activity of the natural or wild-type sgRNA constant region from which the modified constant region is derived, may be used in the constructs described herein.
  • modifications should not be made at nucleotides that interact directly with a CRISPR-associated endonuclease or at nucleotides that are important for the secondary structure of the constant region.
  • the mammalian expression plasmids comprise a eukaryotic promoter operably linked to the non-viral nucleic acid sequence.
  • RNA polymerase IT promoter is operably linked to the nucleic acid encoding the fusion protein comprising the CRISPR-associated endonuclease and the polypeptide comprising the DNA polymerase domain; and a RNA polymerase ITT promoter is operably linked to the gRNA coding sequence.
  • the RNA polymerase IT promoter sequence is selected from a mammalian species.
  • the RNA polymerase ITT promoter sequences is selected from a mammalian species. For example, these promoter sequences can be selected from a human, cow, sheep, buffalo, pig, or mouse, to name a few.
  • the RNA polymerase IT promoter sequence is a CMV, FEla, or SV40 sequence.
  • the RNA polymerase III promoter sequence is a U6 or an Hl sequence.
  • the RNA polymerase II sequence is a modified RNA polymerase II sequence.
  • the RNA polymerase II sequences having at least 80%, 85%, 90%, 95%, or 99% identity to a wild-type RNA polymerase II promoter sequence from any mammalian species can be used in the constructs provided herein.
  • the RNA polymerase III sequence is a modified RNA polymerase III sequence.
  • RNA polymerase III sequences having at least 80%, 85%, 90%, 95%, or 99% identity to a wild-type RNA polymerase III promoter sequence from any mammalian species can be used in the constructs provided herein.
  • identity can be calculated after aligning the two sequences so that the identity is at its highest level.
  • Another way of calculating identity can be performed by published algorithms. For example, optimal alignment of sequences for comparison can be conducted using the algorithm of Needleman and Wunsch, J. Mol. Biol. 48(3): 443-453 (1970).
  • the eukaryotic promoter is an inducible or regulatable promoter.
  • Coding sequences transcribed from a RNA pol II promoter include a poly(A) signal and a transcription terminator sequence downstream of the coding sequence.
  • Commonly used mammalian terminators include the sequence motif AAUAAA (SEQ ID NO: 31) which promotes both polyadenylation and termination.
  • Coding sequences transcribed from a RNA pol III promoter include a simple run of T residues downstream of the coding sequence as a terminator sequence.
  • the role of the terminator, a sequence-based element is to define the end of a transcriptional unit (such as a gene) and initiate the process of releasing the newly synthesized RNA from the transcription machinery. Terminators are found downstream of the gene to be transcribed, and typically occur directly after any 3’ regulatory elements, such as the polyadenylation or poly(A) signal
  • the mammalian expression plasmid may also include at least one polynucleotide sequence encoding a RNA-stabilizing sequence positioned downstream of the CRISPR component coding sequence or the aptamer coding sequence if positioned downstream of the CRISPR component coding sequence.
  • the polynucleotide sequence encoding the RNA-stabilizing sequence is transcribed downstream of the CRISPR/Cas system component coding sequence and stabilizes the longevity of the transcribed RNA sequence.
  • the polynucleotide sequence encoding the RNA-stabilizing sequence is positioned downstream of the catalytically impaired CRISPR-associated endonuclease coding sequence.
  • the polynucleotide sequence encoding the RNA-stabilizing sequence is positioned downstream of the gRNA coding sequence.
  • An exemplary RNA- stabilizing sequence is the sequence of the 3’ UTR of human beta globin gene as set forth in SEQ ID NO: 20 (DNA) and SEQ ID NO: 21 (RNA).
  • Another example of an RNA-stabilizing sequence is SEQ ID NO: 22 which comprises two copies of SEQ ID NO: 20.
  • Other RNA- stabilizing sequences are described in Hayashi, T. et al., Developmental Dynamics 239(7):2034-2040 (2010) andNewbuiy, S. et al., Cell 48(2):297-310 (1987).
  • a spacer of 1-30 nucleotides may be positioned between the CRISPR component coding sequence and the at least one polynucleotide sequence encoding RNA-stabilizmg sequence.
  • the mammalian expression plasmid may comprise one or more expression cassettes.
  • the mammalian expression plasmid comprises a first expression cassette that encodes any of the fusion proteins described herein and a second expression cassette that encodes the gRNA comprising at least one aptamer.
  • the mammalian expression plasmid may also comprise a reporter gene.
  • lentiviral packaging systems include the mammalian expression plasmids described in this disclosure. These systems are useful in providing components for introduction into mammalian cells to generate the lentivirus-like particles described in this disclosure.
  • the system includes a lentiviral packaging plasmid comprising a eukaryotic promoter operably linked to a viral sequence, for example, a Gag nucleotide sequence, wherein the Gag nucleotide sequence comprises a nucleocapsid (NC) coding sequence and a matrix protein (MA) coding sequence, wherein one or both of the NC coding sequence or the MA coding sequence comprise at least one non-viral aptamer-binding protein (ABP) nucleotide sequence, and wherein the packaging plasmid does not encode a functional integrase protein.
  • a lentiviral packaging plasmid comprising a eukaryotic promoter operably linked to a viral sequence, for example, a Gag nucleotide sequence, wherein the Gag nucleotide sequence comprises a nucleocapsid (NC) coding sequence and a matrix protein (MA) coding sequence, wherein one or both of the NC coding sequence or the MA
  • a lentiviral packaging system comprising: (a) a packaging plasmid comprising a eukaryotic promoter operably linked to a Gag nucleotide sequence, wherein the Gag nucleotide sequence comprises a nucleocapsid (NC) coding sequence and a matrix protein (MA) coding sequence, wherein one or both of the NC coding sequence or the MA coding sequence comprises at least one non-viral aptamer-binding protein (ABP) nucleotide sequence, and wherein the packaging plasmid does not encode a functional integrase protein; (b) at least one mammalian expression plasmid comprising (i) a nucleic acid sequence encoding a fusion protein comprising a CRISPR-associated endonuclease and a DNA polymerase domain; and (ii) a gRNA described herein; and (c) an envelope plasmid comprising an envelope glycoprotein coding
  • the system may include a second generation packaging plasmid or third generation packaging plasmids or modified versions thereof.
  • the packaging plasmid includes the Gag nucleotide sequence as described above and further comprises a Rev nucleotide sequence and a Tat nucleotide sequence.
  • the system includes a first packaging plasmid including a Gag nucleotide sequence as described above and a second packaging plasmid comprising a Rev nucleotide sequence.
  • the viral protein coding sequences are operably linked to a eukaryotic promoter for example, each individually or one promoter for multiple protein coding sequences.
  • the system may include a second generation packaging plasmid or third generation packaging plasmids or modified versions thereof.
  • the ABP coding sequence is at the 5’ end or 3’ end of the viral protein coding sequence, i.e., at the 5’ end or the 3’ end of the NC or MA coding sequence.
  • the ABP coding sequence may be inserted into the viral protein coding sequence such that the encoded ABP is fused to the viral protein.
  • the ABP coding sequence may be inserted in frame at an internal position within the viral protein coding sequence. When positioned in frame at an internal position near the 5’ or 3’ end of the viral protein coding sequence, the ABP coding sequence is positioned so as not to disrupt processing sequences such as those described in Tritch, R.J. et al., J. Virol.
  • the Gag nucleotide sequence encodes, inter alia, the NC coding sequence and the MA coding sequence, and the Gag precursor protein is processed by proteolytic cleavage into separate mature viral proteins.
  • the in frame insertion of the ABP coding sequence would not disrupt the nucleotides encoding the processing sequences for proteolytic cleavage.
  • nucleotides in the viral protein coding sequence may be replaced with the ABP protein coding sequence.
  • a linker sequence encoding 3-6 amino acids may be positioned between the viral protein coding sequence and the ABP coding sequence, or flanking the ABP coding sequence, to help facilitate proper folding of the protein domains upon expression.
  • the modified viral protein is NC and the ABP coding sequence is inserted at the 5 ’ end or the 3 ’ end of the NC coding sequence.
  • the modified viral protein is NC and the ABP coding sequence is inserted before or after one of the zinc finger (ZF) domains.
  • the ABP coding sequence may be inserted after the last codon of the second ZF (ZF2) domain.
  • the ABP coding sequence may be inserted before the first codon of the ZF2 domain.
  • the ABP coding sequence may be inserted before the first codon of the first ZF (ZF1) domain.
  • the ABP coding sequence may be inserted after the last codon of the first ZF (ZF1) domain. In some instances, the ABP coding sequence is inserted into the NC coding sequence in a manner that does not disrupt the highly positive stretch of amino acids in the NC protein.
  • the modified viral protein is MA and the ABP coding sequence is inserted at the 5’ end or the 3’ end of the MA coding sequence. In another example, the ABP coding sequence is inserted in frame at an internal position within the MA coding sequence. In some instances, nucleotides in the MA coding sequence may be replaced with the ABP protein coding sequence.
  • the nucleotides encoding amino acids 44-132 of the MA protein may be replaced with the ABP coding sequence.
  • the ABP coding sequence is inserted prior to the codon encoding amino acid 44 of the MA protein.
  • the ABP coding sequence is inserted after the codon encoding amino acid 132 of the MA protein.
  • the system includes a packaging plasmid comprising a eukaryotic promoter operably linked to a NEF coding sequence or a VPR coding sequence, wherein the NEF coding sequence or the VPR coding sequence comprises at least one non- viral ABP nucleotide sequence.
  • the system may include a second generation packaging plasmid or third generation packaging plasmids or modified versions thereof.
  • the packaging plasmid includes a Gag nucleotide sequence, a Rev nucleotide sequence, and a Tat nucleotide sequence.
  • the system includes a first packaging plasmid including a Gag nucleotide sequence and a second packaging plasmid comprising a Rev nucleotide sequence.
  • the modified viral protein is VPR and the ABP coding sequence is inserted at the 5’ end or the 3’ end of the VPR coding sequence.
  • the ABP coding sequence is inserted at the 5’ end of the VPR coding sequence.
  • the modified viral protein is NEF and the ABP coding sequence is inserted at the 5’ end or the 3’ end of the NEF coding sequence. In one example, the ABP coding sequence is inserted at the 3’ end of the NEF coding sequence.
  • the coding sequence of the viral protein may be one of SEQ ID NO: 19, SEQ ID NO:20, SEQ ID NO:21, or SEQ ID NO:25.
  • the amino acid sequence of the the viral protein may be one of SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, or SEQ ID NO:26.
  • the lentiviral packaging plasmid comprises a sequence encoding at least one of SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, or SEQ ID NO:26 operably linked to a eukaryotic promoter.
  • the polypeptide may comprise three mutations that enhances packaging in the viral capsid such as, for example, the following substitution mutations: G3C, V153L, and E177G.
  • the plasmids may encode one or more viral proteins that comprise two or more aptamer-binding proteins fused thereto.
  • the Gag nucleotide sequence of the lentiviral packaging plasmid may comprise a NC coding sequence and a MA coding sequence and where one or both of the NC coding sequence or the MA coding sequence comprises a first non-viral ABP nucleotide sequence and a second non-viral ABP nucleotide sequence.
  • the first non-viral ABP nucleotide sequence and the second non-viral ABP nucleotide sequence may both encode the same ABP.
  • the first non-viral ABP nucleotide sequence and the second non-viral ABP nucleotide sequence encode different ABPs.
  • the Gag nucleotide sequence of the lentiviral packaging plasmid may comprise a NC coding sequence comprising at least one first non-viral ABP nucleotide sequence and a MA coding sequence comprising at least one second non-viral ABP nucleotide sequence .
  • the at least one first non-viral ABP nucleotide sequence and the at least one second non-viral ABP nucleotide sequence may both encode the same ABP.
  • the at least one first non-viral ABP nucleotide sequence and the at least one second non-viral ABP nucleotide sequence encode different ABPs.
  • the packaging plasmid may encode a VPR coding sequence or a NEF coding sequence and where the VPR coding sequence or the NEF coding sequence comprises a first non-viral ABP nucleotide sequence and a second non-viral ABP nucleotide sequence.
  • the first non-viral ABP nucleotide sequence and the second non-viral ABP nucleotide sequence may both encode the same ABP.
  • the first non-viral ABP nucleotide sequence and the second non-viral ABP nucleotide sequence encode different ABPs.
  • a non-viral aptamer-binding protein (ABP) nucleotide sequence encodes a polypeptide sequence that binds to an RNA aptamer sequence.
  • suitable ABPs include bacteriophage RNA- binding proteins that bind specifically to RNA sequences that form stem-loop structures referred to as RNA aptamer sequences.
  • Exemplary non-viral aptamer binding protein include MS2 coat protein, PP7 coat protein, lambda N peptide, and Com (Control of mom) protein.
  • the lambda N peptide may be amino acids 1-22 of the lambda N protein, which are the RNA- bmding domain of the protein.
  • the ABPs bind to their aptamers as dimers. Information about these ABP and the aptamer sequences to which they bind is provided in Table 1.
  • the at least one non-viral ABP nucleotide sequence encodes a polypeptide having the sequence set forth in any of SEQ ID NOTO, SEQ ID NO: 12, SEQ ID NO: 14, or SEQ ID NO: 16.
  • the at least one non-viral ABP nucleotide sequence comprises any of SEQ ID NO : 9, SEQ ID NO : 11 , SEQ ID NO : 13 , or SEQ ID NO : 15.
  • a feature of the lentiviral packaging plasmids provided herein is that they may not encode a functional integrase protein.
  • the packaging plasmids do not encode a functional integrase protein and they are used in the systems and methods described herein, there is substantially reduced risk the nucleic acid molecules carried by the lentivirus-like particles produced using these packaging plasmids will integrate into the genome of the transduced eukaryotic cell.
  • the lentiviral packaging plasmid comprises an integrase coding sequence with an integrase-inactivating mutation therein.
  • the integraseinactivating mutation may be an aspartic acid to valine mutation at amino acid position 64 (D64V) of the integrase protein encoded by the integrase coding sequence.
  • the lentiviral packaging plasmid comprises a deletion of all or a portion of an integrase coding sequence.
  • the lentiviral packaging plasmids comprise a eukaryotic promoter operably linked to the Gag nucleotide sequence.
  • the mammalian expression plasmids comprise a eukaryotic promoter operably linked to the VPR coding sequence or the NEF coding sequence.
  • the eukaryotic promoter is a RNA polymerase II promoter.
  • the RNA polymerase II promoter sequence is selected from a mammalian species.
  • the promoter sequence can be selected from a human, cow, sheep, buffalo, pig, or mouse, to name a few.
  • the RNA polymerase II promoter sequence is a CMV, FEla, or SV40 sequence. In some examples, the RNA polymerase II sequence is a modified RNA polymerase II sequence.
  • the RNA polymerase II sequences having at least 80%, 85%, 90%, 95%, or 99% identity to a wild-type RNA polymerase II promoter sequence from any mammalian species can be used in the constructs provided herein. Those of skill in the art readily understand how to determine the identity of two polypeptides or nucleic acids, as described above.
  • Coding sequences transcribed from a RNA pol II promoter include a poly(A) signal and a transcription terminator sequence downstream of the coding sequence.
  • Commonly used mammalian terminators e.g., SV40, hGH, BGH, and rbGlob
  • sequence motif AAUAAA which promotes both poly adenylation and termination.
  • the role of the terminator, a sequence-based element, is to define the end of a transcriptional unit (such as a gene) and initiate the process of releasing the newly synthesized RNA from the transcription machinery. Terminators are found downstream of the gene to be transcribed, and typically occur directly after any 3’ regulatory elements, such as the polyadenylation or poly(A) signal.
  • the lentiviral packaging plasmids may comprise one or more expression cassettes.
  • the system also can include an envelope plasmid having an envelope coding sequence that encodes a viral envelope glycoprotein.
  • the Env nucleotide sequence may encode VSV-G.
  • the envelope coding sequence is operably linked to a eukaryotic promoter. Appropriate eukaryotic promoters are described above. In some instances, the eukaryotic promoter is a RNA pol II promoter.
  • the system can comprise any of the packaging plasmids, envelope plasmids and mammalian expression plasmids, i.e., a mammalian expresson plasmid comprising (i) anucleic acid sequence encoding a fusion protein comprising a CRISPR-associated endonuclease and a polpeptide comprising a DNA polymerase domain: and (ii) a gRNA comprising at least one aptamer, described herein.
  • a mammalian expresson plasmid comprising (i) anucleic acid sequence encoding a fusion protein comprising a CRISPR-associated endonuclease and a polpeptide comprising a DNA polymerase domain: and (ii) a gRNA comprising at least one aptamer, described herein.
  • the gRNA expressed by the mammalian expression plasmid forms a complex with the CRISPR- associated endonuclease expressed by the mammalian expression plasmids to form an RNP that is packaged by the viral particles produced by the eukaryotic cells, via the interaction between the aptamer fused or linked to the gRNA and the ABP linked to the viral protein expressed by the packaging plasmid.
  • kits include the components of the systems described in this disclosure.
  • the kits include one or more of the plasmids described herein.
  • lentivirus-like particles for example, lentivirus-like particles made by any of the methods described herein.
  • a lentivirus-like particle is multiprotein structure that mimics the organization and conformation of authentic native viruses but lacks the viral genome.
  • a plurality of lentivirus-like particles are also provided.
  • the lentivirus-like particles contain a modified lentiviral protein that is a fusion protein in which at least one aptamer-binding protein is fused to one or more viral proteins.
  • the modified viral protein may be structural or non-structural.
  • Exemplary structural proteins are lentiviral nucleocapsid (NC) protein and matrix (MA) protein.
  • non-structural proteins are viral protein R (VPR) and negative regulatory factor (NEF).
  • the particles contain a fusion protein comprising a NC protein and a MA protein where one or both thereof are fused with at least one non-viral aptamer binding protein (ABP).
  • the NC protein of the particles may have two functional zinc finger protein domains. In particular, retention of the second NC zinc finger domain may preserve the efficiency of viral assembly and budding.
  • the particles contain a fusion protein comprising a VPR protein or a NEF protein where the VPR protein or the NEF protein are fused with at least one non-viral ABP.
  • the particles also contain an RNP comprising: (i) a fusion protein comprising a CRISPR-associated endonuclease and a polypeptide comprising a DNA polymerase domain; and (ii) a gRNA.
  • RNP comprising: (i) a fusion protein comprising a CRISPR-associated endonuclease and a polypeptide comprising a DNA polymerase domain; and (ii) a gRNA.
  • Any of the mammalian expression plasmids described herein comprising a non-viral nucleic acid sequence, wherein at least one aptamer is attached or inserted into the gRNA sequence can be used to generated lentivirus-like particles containing RNPs.
  • the lentivirus-like particles do not contain a functional integrase protein These virus-like particles are useful to transduce eukaryotic cells of interest.
  • the particles may comprise a viral fusion protein comprising one or more ABPs.
  • the particles contain a NC protein, a MA protein, or both, where one or both of the NC protein or MA protein are fused with one or more non-viral ABP.
  • lentivirus-like particles comprise aNC protein fused with at least one non-viral ABP.
  • lentivirus-like particles comprise a MA protein fused with at least one non-viral ABP.
  • the lentivirus-like particles may comprise a NC protein and a MA protein, where one or both of the NC protein or the MA protein may be fused with two non- viral ABP proteins, a first non-viral ABP and a second non-viral ABP fused to a C’ terminal end of the first non-viral ABP (i.e. in tandem).
  • the particles may contain one or both of a NC protein or a MA protein fused with a first non-viral ABP and a second non-viral ABP.
  • the lentivirus-like particle contains a VPR protein or a NEF protein, where the VPR protein or the NEF protein is fused to one or more non-viral ABP.
  • the lentivirus-like particle contains a VPR protein or a NEF protein fused to two non-viral ABP, a first non-viral ABP and a second non-viral ABP fused to a C’ terminal end of the first non-viral ABP (i.e. in tandem).
  • the lentivirus-like particle contains a VPR protein or a NEF protein fused to a first non-viral ABP and a second non-viral ABP.
  • the first non-viral ABP and the second non-viral ABP may both be the same ABP.
  • the first non-viral ABP and the second non-viral ABP may be different ABPs.
  • the lentivirus-like particles may comprise a NC protein with at least one first non-viral ABP fused to MA protein with at least one second non-viral ABP fused to its C’ terminal end.
  • the at least one first non-viral ABP and the at least one second non-viral ABP both be the same ABP.
  • the at least one first non-viral ABP protein and the at least one second non-viral ABP may be different ABPs.
  • the first non-viral ABP and the second non-viral ABP may both be the same ABP.
  • the first non-viral ABP and the second non-viral ABP may be different ABPs.
  • a non-viral ABP is a polypeptide sequence that binds to an RNA aptamer sequence.
  • suitable ABPs include bacteriophage RNA-binding proteins that bind specifically to known RNA aptamer sequences, which are RNA sequences that form stem-loop structures.
  • Exemplary non-viral aptamer binding protein include MS2 coat protein, PP7 coat protein, lambda N peptide, and Com (Control of mom) protein.
  • the lambda N peptide may be amino acids 1-22 of the lambda N protein, which are the RNA-binding domain of the protein. Information about these ABP and the aptamer sequences to which they bind is provided above in Table 1.
  • the lentivirus-like particles may comprise various lentiviral proteins. However, in some instances, the lentivirus-like particles do not comprise all of the types of proteins or nucleic acids found in native lentiviruses. In some instances, the particles may contain NC, MA, CA, SP1 , SP2, P6, POL, ENV, TAT, REV, VTF, VPU, VPR, and/or NEF proteins, or a derivative, combination, or portion of any thereof. In some instances, the particles may contain NC, MA, CA, SP1, SP2, P6, and POL. In some instances, the lentivirus-like particles may comprise only those proteins that form the viral shell (capsid).
  • one or more lentiviral proteins may be excluded in full or in part from the lentivirus-like particles.
  • the lentivirus-like particles may not contain a POL protein or may comprise a non-functional version of a POL protein such as, for example, a POL protein with an inactivating point mutation or an inactivating truncation.
  • the lentivirus- like particles may not contain an integrase protein or may comprise a non-functional version of an integrase protein such as, for example, an integrase protein with an inactivating point mutation or an inactivating truncation.
  • the lentivirus-like particle may contain a non-functional integrase protein comprising an aspartic acid to valine mutation at amino acid position 64 (D64V).
  • the lentivirus-like particles may not contain a reverse transcriptase protein or may comprise a non-functional version of a reverse transcriptase protein such as, for example, a reverse transcriptase protein with an inactivating point mutation or an inactivating truncation.
  • gRNA generally comprises a DNA targeting sequence and a constant region that interacts with the CRISPR-associated endonuclease.
  • the gRNA may comprise a transactivating crRNA (tracrRNA) sequence.
  • the gRNA may comprise a tracrRNA where it is to be used in conjunction with a Cas9 protein or derivative.
  • the gRNA does not comprise a tracrRNA sequence.
  • the gRNA may not comprise a tracrRNA sequence where it is to be used in conjunction with a Cpfl protein or derivative.
  • the gRNA comprises at least one aptamer sequence.
  • the at least one aptamer sequence may be positioned at the 5 ’ end or the 3 ’ end of the gRNA.
  • the at least one aptamer sequence may be inserted at an internal position within the gRNA such as, for example, at one or more of the loops formed in the folded gRNA.
  • the at least one aptamer sequence may be positioned at the tetra loop, the stem loop 2 (ST2), or the 3’ end of the gRNA.
  • a spacer of 1-30 ribonucleotides may be positioned between the gRNA and the at least one aptamer sequence, or flanking the at least one aptamer sequence.
  • at least one aptamer sequence does not interfere with lentivirus-like particle transduction of eukaryotic cells.
  • at least one non-viral ABP fused to one or more of the NC protein, the MA protein, the VPR protein, or theNEF protein may not interfere with lentivirus- like particle transduction of eukaryotic cells.
  • eukaryotic cells comprising a target genomic sequence of interest to be modified are transduced with lentivirus-like particles that contain a viral fusion protein comprising a viral protein fused to at least one aptamer-binding protein (ABP) and an RNP comprising (1) a gRNA and (2) a fusion protein comprising a CRISPR-associated endonuclease and a polypeptide comprising a DNA polymerase domain.
  • ABSP aptamer-binding protein
  • the methods described herein can be used to edit the genome of the cell, while reducing on-target deletions of any size. For example, deletions of less than 100 bp, 90bp, 80 bp, 70 bp, 60 bp, 50 bp, 40 bp 30 bp, 20 bp, 10 bp, 9 bp, 8 bp, 7 bp, 6 bp, 5 bp, 4 bp, 3 bp, 2 bp or 1 bp can be reduced. In some embodiments, large genomic deletions of over 100 bp, 200 bp, 300 bp, 400 bp, or 500 bp in size can be reduced.
  • on-target deletion refers to a deletion that occurs at or near an sgRNA target site in the genome of the cell, i.e., in the proximity of the target genomic sequence of interest to be modified.
  • large genomic deletions can be reduced by at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 90%, 95%, 99% or greater, as compared to the number of large genomic deletions when the cells are edited with a CRISPR-associated endonuclease that is not fused or linked to a polypeptide comprising a DNA polymerase domain.
  • the provided methods increase non-homologous end joining (NHEJ), as compared to non-NHEJ in a cell edited with a CRISPR-associated endonuclease that is not fused or associated with a polypeptide comprising a DNA polymerase domain.
  • NHEJ non-homologous end joining
  • NJEH is increased as compared to non-NHEJ end joining in the cell.
  • non-NJEH is microhomology -mediated end joining (MMEJ) and/or single-stranded annealing (SSA).
  • MMEJ microhomology -mediated end joining
  • SSA single-stranded annealing
  • the increase is at least a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, or 400% increase.
  • the increase is a 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10- fold, 20-fold, 30-fold, 40-fold
  • the ratio of NHEJ to non-NHEJ increases in the cell.
  • the ratio of on-target one base pair ( 1 -bp) deletions to on-target deletions greater than 1 -bp is increased in the cell.
  • the ratio of on-target one base pair (1 -bp) deletions to deletions greater than 500 base pairs is increased in the cell.
  • the number of non-templated insertions decreases in the cell. In some embodiments, the decrease is at least 10%, 20%, 30%, 40%, 50%, 60%, 80%, 90%, 95%, 99%, or 100%,
  • the number of 1-bp templated insertions increases in the cell.
  • the increase is at least a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, or 400% increase.
  • the increase is a 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 20-fold, 30-fold, 40- fold, 50-fold increase or greater.
  • the ratio of 1-bp TIS to 1-bp non-TIS increases in the cell.
  • a templated insertion is a nonrandom insertion that occurs after Cas9-induced double stranded breakage leaves a 1-nt 5' overhanging base that is subsequently filled in by a DNA polymerase, and ligated.
  • the exonuclease activity of MRE11 Double Strand Break Repair Nuclease is reduced (e.g., relative to wild-type MRE11).
  • the exonuclease activity of MRE11 can be reduced by at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 90%, 95%, 99% or more.
  • the lentiviral-particles used lack portions of the lentiviral genomic sequences that are essential for viral replication and, as such, reduce the risk of continued particle production.
  • the viral fusion protein may increase packaging of RNPs, into the lentivirus-like particles, which in turn increase genome editing efficiency.
  • the transduced eukaryotic cells are mammalian cells.
  • the eukaryotic cells may be in vitro cultured cells.
  • the eukaryotic cells may be ex vivo cells obtained from a subject.
  • the eukaryotic cells are present in a subject.
  • subject is meant an individual.
  • the subject is a mammal, such as a primate, and, more specifically, a human. Non-human primates are subjects as well.
  • subject includes domesticated animals, such as cats, dogs, etc., livestock (for example, cattle, horses, pigs, sheep, goats, etc.) and laboratory animals (for example, ferret, chinchilla, mouse, rabbit, rat, gerbil, guinea pig, etc ).
  • livestock for example, cattle, horses, pigs, sheep, goats, etc.
  • laboratory animals for example, ferret, chinchilla, mouse, rabbit, rat, gerbil, guinea pig, etc.
  • patient or subject may be used interchangeably and can refer to a subject afflicted with a disease or disorder.
  • the lentivirus-like particles provided herein may be administered to the subject, for example, injected into a subject, according to known, routine methods.
  • Exemplary modes of administration include oral, rectal, transmucosal, topical, intranasal, inhalation (e.g., via an aerosol), buccal (e.g., sublingual), vaginal, intrathecal, intraocular, transdermal, intradermal, intrapleural, intracerebral, and intraarticular), topical, and the like, as well as direct tissue or organ injection.
  • Administration can also be to a tumor.
  • the most suitable route in any given case will depend on the nature and severity of the condition being treated and on the nature of the particular lentivirus-like particle that is being used.
  • the lentivirus-like particles are injected intravenously (IV), intraperitoneally (IP), intramuscularly, or into a specific organ or tissue.
  • IV intravenously
  • IP intraperitoneally
  • more than one administration e.g., two, three, four or more administrations
  • an effective amount of any of the recombinant lentivirus-like particles described herein will vary and can be determined by one of skill in the art through experimentation and/or clinical trials.
  • an effective dose can be from about 10 6 to about 10 15 lentivirus- like particles, for example, from about IO 6 to about 10 14 , from about 10 6 to about 10 13 , from about 10 6 to about 10 12 lentivirus-like particles, from about 10 6 to about 10 12 , from about 10 6 to about 10 11 , or fromabout IO 6 to about 10 11 lentivirus-like particles.
  • Other effective dosages can be readily established by one of ordinary skill in the art through routine trials establishing dose response curves. See, for example, Mangeot et al.
  • the provided methods are for modifying atarget locus of interest, the method comprising transducing a plurality of eukaryotic cells with a plurality of viral particles, wherein the plurality of viral particles comprise (i) a fusion protein comprising a viral protein, for example, NC, MA, VRP, or NEF, wherein the viral protein comprises at least one non-viral aptamer binding protein (ABP); and (ii) a ribonucleotide protein (RNP) complex comprising (1) a gRNA and (2) a fusion protein comprising a CRISPR-associated endonuclease and a polypeptide comprising a DNA polymerase domain, wherein the RNP complex is capable of binding (e.g., preferentially binding) via the gRNA, to the genomic target sequence in genomic DNA of the cell and the CRISPR-associated endonuclease alters the genomic DNA of the cell.
  • the RNP complexes are packaged into the viral
  • the sgRNA is targeted to specific regions at or near a gene.
  • the sgRNA can be targeted to a region where single base changes are necessary, for example, to correct a single base mutation in the human beta-globin gene that causes sickle cell anemia.
  • the sgRNA allows the RNP complexes described herein to a specific site in the genomic sequence of a cell.
  • the modifications to the system components as described in this disclosure do not impair how the system components function following transduction into eukaryotic cells. Rather, the components may function similarly or better than unmodified components upon transduction into eukaryotic cells.
  • the viral fusion proteins in the lentivirus-like particles may not interfere with the lentivirus-like particle transduction of eukaryotic cells.
  • the RNP complexes packaged in the lentivirus-like particles comprise at least one aptamer sequence
  • the at least one aptamer sequence may not interfere with the lentivirus-like particle transduction of eukaryotic cells.
  • the lentivirus-hke proteins containing viral fusion protein may result in greater gene editing upon transduction into eukaryotic cells relative to lentivirus-like particles that do not comprise a viral fusion protein.
  • the viral fusion protein may be a NC-ABP fusion protein, such as a NC-MS2 fusion protein or NC-PP7 fusion protein.
  • the NC fusion protein is fused to one or two ABPs, such as one or two MS2 proteins, one or two PP7 proteins, or one MS2 protein and one PP7 protein.
  • the eukaryotic cells can be in vitro, ex vivo or in vivo.
  • the cell is a primary cell (isolated from a subject).
  • a primary cell is a cell that has not been transformed or immortalized.
  • Such primary' cells can be cultured, sub-cultured, or passaged a limited number of times (e.g., cultured 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 times).
  • the primary cells are adapted to in vitro culture conditions.
  • the primary cells are isolated from an organism, system, organ, or tissue, optionally sorted, and utilized directly without culturing or sub-culturing.
  • the primary' cells are stimulated, activated, or differentiated.
  • the cells are cultured under conditions effective for expanding the population of modified cells.
  • cells modified by any of the methods provided herein are purified.
  • cells are removed from a subject, modified using any of the methods described herein and readministered to the patient.
  • the cells are cultured for a sufficient amount of time to allow for gene editing to occur, such that a pool of cells expressing a detectable phenotype can be selected from the plurality of transduced cells.
  • the phenotype can be, for example, cell growth, survival, or proliferation.
  • the phenotype is cell growth, survival, or proliferation in the presence of an agent, such as a cytotoxic agent, an oncogene, a tumor suppressor, a transcription factor, a kinase (e.g., a receptor tyrosine kinase), a gene (e.g., an exogenous gene) under the control of a promoter (e.g., a heterologous promoter), a checkpoint gene or cell cycle regulator, a growth factor, a hormone, a DNA damaging agent, a drug, or a chemotherapeutic.
  • the phenotype can also be protein expression, RNA expression, protein activity, or cell motility, migration, or invasiveness.
  • the selecting the cells on the basis of the phenotype comprises fluorescence activated cell sorting, affinity purification of cells, or selection based on cell motility.
  • the selecting the cells comprises analysis of the genomic DNA of the cells such as by amplification, sequencing, SNP analysis, etc.
  • Sequencing methods include, but are not limited to, shotgun sequencing, bridge PCR, Sanger sequencing (including microfluidic Sanger sequencing), pyrosequencing, massively parallel signature sequencing, nanopore DNA sequencing, single molecule real-time sequencing (SMRT) (Pacific Biosciences, Menlo Park, CA), ion semiconductor sequencing, ligation sequencing, sequencing by synthesis (Illumina, San Diego, Ca), Polony sequencing, 454 sequencing, solid phase sequencing, DNA nanoball sequencing, heliscope single molecule sequencing, mass spectroscopy sequencing, pyrosequencing, Supported Oligo Ligation Detection (SOLiD) sequencing, DNA microarray sequencing, RNAP sequencing, tunneling currents DNA sequencing, and any other DNA sequencing method identified in the future.
  • SMRT single molecule real-time sequencing
  • ion semiconductor sequencing ligation sequencing
  • sequencing by synthesis Illumina, San Diego,
  • high throughput sequencing refers to all methods related to sequencing nucleic acids where more than one nucleic acid sequence is sequenced at a given time.
  • any of the methods and compositions described herein can be used to treat a disease (e.g., cancer, a blood disorder (for example, sickle cell anemia or beta thalassemia), an infectious disease, an autoimmune disease, transplantation rejection, graft vs. host disease or other inflammatory disorder) in a subject.
  • a disease e.g., cancer, a blood disorder (for example, sickle cell anemia or beta thalassemia), an infectious disease, an autoimmune disease, transplantation rejection, graft vs. host disease or other inflammatory disorder
  • the infectious disease is a viral infection, for example, but not limited to human immunodeficiency virus (HIV), herpes simplex virus type 1 (herpetic stromal keratitis), and human papilloma virus (HPV).
  • the disease is a neurodegerative or myodegemerative disease, for example, Duchenne muscular dystrophy.
  • the cancer to be treated is selected from a cancer of B-cell origin, breast cancer, gastric cancer, neuroblastoma, osteosarcoma, lung cancer, colon cancer, chronic myeloid cancer, leukemia (e.g., acute myeloid leukemia, chronic lymphocytic leukemia (CLL) or acute lymphocytic leukemia (ALL)), prostate cancer, colon cancer, renal cell carcinoma, liver cancer, kidney cancer, ovarian cancer, stomach cancer, testicular cancer, rhabdomyosarcoma, and Hodgkin's lymphoma.
  • leukemia e.g., acute myeloid leukemia, chronic lymphocytic leukemia (CLL) or acute lymphocytic leukemia (ALL)
  • prostate cancer colon cancer
  • renal cell carcinoma liver cancer
  • kidney cancer ovarian cancer
  • stomach cancer testicular cancer
  • rhabdomyosarcoma rhabdomyosarcoma
  • Hodgkin's lymphoma Hod
  • the cancer of B-cell origin is selected from the group consisting of B-lineage acute lymphoblastic leukemia, B-cell chronic lymphocytic leukemia, and B-cell non-Hodgkin's ly mphoma.
  • the cells of the subject are modified in vivo.
  • the method of treating a disease in a subject comprises: a) obtaining cells from the subject; b) modifying the cells using any of the methods provided herein; and c) administering the modified cells to the subject See, for example, Milone and O’Doherty “Clinical sue of lentiviral vectors,” Leukemia 32, 1529-1541 (2016).
  • the disease is selected from the group consisting of cancer, a blood disorder (for example, sickle cell anemia or beta thalassemia), an infectious disease, an autoimmune disease, transplantation rejection, graft vs. host disease or other inflammatory' disorder in a subject.
  • the cells obtained from the subject are modified to express a tumor specific antigen.
  • tumor-specific antigen means an antigen that is unique to cancer cells or is expressed more abundantly in cancer cells than in in non-cancerous cells.
  • the cells obtained from the subject are T cells.
  • the modified cells are expanded prior to administration to the subject.
  • the lentivirus-like particles or cells described herein can be formulated as a pharmaceutical composition. Therefore, provided herein is a pharmaceutical composition comprising any of the lentivirus-like particles described herein. Also provided is a pharmaceutical composition comprising any of the modified cells described herein Optionally, the pharmaceutical composition can further comprise a carrier.
  • the term carrier means a compound, composition, substance, or structure that, when in combination with lentivirus-like particles or cells, aids or facilitates preparation, storage, administration, delivery, effectiveness, selectivity, or any other feature of the lentivirus-like particles or cells for its intended use or purpose.
  • a carrier can be selected to minimize any degradation of the active ingredient and to minimize any adverse side effects in the subject.
  • Such pharmaceutically acceptable carriers include sterile biocompatible pharmaceutical carriers, including, but not limited to, saline, buffered saline, artificial cerebral spinal fluid, dextrose, and water.
  • pharmaceutically acceptable is meant a material that is not biologically or otherwise undesirable, which can be administered to an individual along with the selected agent without causing unacceptable biological effects or interacting in a deleterious manner with the other components of the pharmaceutical composition in which it is contained.
  • a mammalian expression plasmid comprising a eukaryotic promoter operably linked to a non-viral nucleic acid sequence, wherein the non-viral nucleic acid sequence comprises: (i) a nucleic acid sequence encoding a fusion protein, wherein the fusion protein comprises: (a) a polypeptide comprises a DNA polymerase domain; and (b) a CRISPR- associated endonuclease coding sequence; and (h) a guide RNA (gRNA) coding sequence, wherein the gRNA coding sequence comprises at least one aptamer coding sequence.
  • sgRNA coding sequence comprises at least one aptamer inserted into the tetraloop or the ST2 loop of the sgRNA coding sequence.
  • a lentiviral packaging system comprising: a) a packaging plasmid comprising a eukaryotic promoter operably linked to a Gag nucleotide sequence, wherein the Gag nucleotide sequence comprises a nucleocapsid (NC) coding sequence and a matrix protein (MA) coding sequence, wherein one or both of the NC coding sequence or the MA coding sequence comprises at least one non-viral aptamer-binding protein (ABP) nucleotide sequence, and wherein the packaging plasmid does not encode a functional integrase protein; b) at least one mammalian expression plasmid of any one of embodiments 1-9; and c) an envelope plasmid comprising an envelope glycoprotein coding sequence.
  • a packaging plasmid comprising a eukaryotic promoter operably linked to a Gag nucleotide sequence, wherein the Gag nucleotide sequence comprises a nucleocapsid (NC)
  • a lentiviral particle comprising: A) a fusion protein comprising a nucleocapsid
  • NC non-viral aptamer binding protein
  • RNP ribonucleotide protein
  • gRNA guide RNA
  • the polypeptide comprising a DNA polymerase domain is an E. coli DNA polymerase 1 (DNA Poll).
  • a method of producing a lentiviral particle comprising: a) transfecting a plurality of eukaryotic cells with the packaging plasmid, the at least one mammalian expression plasmid, and the envelope plasmid of the system of any one of embodiments 10-13; and b) culturing the transfected eukaryotic cells for sufficient time for lentiviral particles to be produced.
  • the lentiviral particle comprises a ribonucleotide protein (RNP) complex comprising: (i) nucleic acid sequence encoding a fusion protein, wherein the fusion protein comprises: (a) a polypeptide comprising a DNA polymerase domain; and (b) a CRISPR-associated endonuclease coding sequence; and (ii) a guide RNA.
  • RNP ribonucleotide protein
  • a method of modifying a genomic target sequence in a cell comprising transducing a plurality of eukaryotic cells with a plurality of viral particles, wherein the plurality of viral particles comprise a lentivirus-like particle according to any one of embodiments 14-18, wherein the RNP complex binds to the genomic target sequence in genomic DNA of the cell, wherein the CRISPR-associated endonuclease cleaves the genomic target sequence to create a double-stranded break, thereby modifying the genomic target sequence.
  • a method for treating a disease in a subject comprising: a) obtaining cells from the subject; b) modifying the cells of the subject using the method of any one of embodiments 23-36; and c) administering the modified cells to the subject.
  • a single component may be replaced by multiple components, and multiple components may be replaced by a single component, to provide an element or structure or to perform a given function or functions. Except where such substitution would not be operative to practice certain embodiments of the disclosure, such substitution is considered within the scope of the disclosure.
  • Escherichia, coll DNA polymerase I (pol I) functions in DNA repair and in replication of the lagging-strand chromosomal DNA. Its small N-terminal domain contains the 5 ’-3’ exonuclease activity, and the large C-terminal KI enow fragment, which can be generated by partial digestion of the full length polymerase carries the polymerase and 3’-5‘ exonuclease activities Since MMEJ and SSA can generate large DNA deletions and both rely on DNA resection, it was hypothesized that counteracting DNA resection with DNA polymerase I could favor canonic NHEJ over MMEJ and SSA, and decrease the generation of large deletions. Therefore, E.
  • coli pol I was targeted to DSMs to counteract DNA resection, and decrease the chances of generating large deletions (Figure 1A). Studies were also conducted to determine if 5’ overhangs generated by CRISPR/Cas9 were filled in and the proportion of TISs (Figure IB) was increased, further refining the TNDELs.
  • Constructs Constructs used in this study are described in Table 2.
  • the envelope plasmid pMD2.G for lenti viral pscudotyping was purchased from Addgene (Addgene 12259, Watertown, MA). Some of the plasmids used for this study are available from Addgene (plasmids ID: 176234, 76235, 176236, 176237, 176238). Others are available from authors upon request Sequences for primers used in this study are listed in Table 3.
  • Single guide RNA (sgRNA) sequences are listed in Table 4.
  • HEK293T ATCC CRL-3216TM
  • HEK293T-derived CLCN5 GFP-reporter cells reported recently (Lu et al. Lentiviral Capsid-Mediated Streptococcus pyogenes Cas9 Ribonucleoprotein Delivery for Efficient and Safe Multiplex Genome Editing. CRISPR J 4(6): 914-928 (2021)) were cultured in DMEM with 10% FBS, 2 mM L-glutamine, 100 U/ml penicillin and 100 ⁇ g/ml streptomycin (ThermoFisher Scientific, Waltham, MA) at 37°C in an incubator with 5% CO2.
  • Human lung fibroblast IMR90 cells (ATCC CCL-186) were cultured in Eagle's Minimum Essential Medium supplemented with 10% FBS, 2 mM L- glutamine, 100 U/ml penicillin and 100 pg/ml streptomycin.
  • Human CD34+ Progenitor Cells from Mobilized Peripheral Blood (Lonza, Catalog #: 4Y-101C, Basel, Switzerland) were cultured in serum-free medium (Stemcell Technology, Catalog # 09605, Vancouver, CA) supplemented with lx StemSpanTM CD34+ Expansion Supplement (Stemcell Technology, Catalog #02691).
  • Human skeletal muscle myoblasts (Lonza, Catalog #: CC-2580) were cultured in SkGMTM-2 Skeletal Muscle Cell Growth Medium-2 BulletKitTM (Lonza, Catalog #: CC-3245).
  • HEK293T cells were transfected in 24-well plates using FuGENE HD (Promega, Catalog#: E2312, Madison, WI). The day before transfection, 1.25 x 10 5 cells were seeded in 24-well plates. For DNA transfection, 0.5 pg plasmid DNA was added to 50 pl of OPTI-MEM. In a different tube, 1.5 pl FuGENE HD was added to 50 jxl OPTI-MEM. The two mixtures were mixed and incubated at room temperature for 15 mins before adding to the cells, whose medium was changed to OPTI-MEM, just before DNA transfection. Twenty-four hours after transfection, the medium was changed to normal growth medium and the cells were analyzed 72 hours after transfection.
  • FuGENE HD Promega, Catalog#: E2312, Madison, WI
  • Nucleofection of human primary cells The NucleofectorTM 2b device (Lonza) was used for nucleofection of human primary cells. IMR90 cells, human myoblasts and Human CD34+ hematopoietic cells were nucleofected with the Cell Line NucleofectorTM Kit R (Lonza, Catalog #: VCA-1001, program X-001), Human Dermal Fibroblast NucleofectorTM Kit (Lonza, Catalog #: VPD-1001, program P-022), and the Human CD34+ Cell NucleofectorTM Kit (Lonza, Catalog #: VPA-1003), respectively. Cell number for each nucleofection was 2 x 10 5 .
  • 4.5 pg of target plasmid DNA (expressing sgRNA/Cas9 or sgRNA/Cas9-Klenow) and 0.5 pg GFP-expressing plasmid DNA (CmiR0001-MR03, GeneCopoeia, Inc., Rockville, MD) were used for each nucleofection, where the GFP-expressing plasmid DNA was used as an indicator for nucleofection efficiency.
  • the transfected cells were checked for similar GFP positive percentage under a fluorescent microscope before further experiments.
  • the DNA ratio for CLCN5 sgRNA- and MRE11/RBBP8 sgRNA-expressing plasmids was 1:2.
  • the DNA mixture was co-transfected into HEK293T cells by FuGENE HD and into IMR90 cells by nucleofection as described above.
  • Lentivirus-like particles were produced as described previously (Lu et al. (2021)).
  • the packaging plasmid, pspAX2-D64V-NC-COM has the aptamer-binding protein Com inserted in the nucleocapsid protein, and the sgRNA’ s ST2 loop was replaced by a com aptamer to enable the packaging of the Cas9 RNP into the lentiviral capsids via the interactions between aptamer com and aptamer-binding protein Com.
  • 5 million HEK293T cells were seeded in 10-cm tissue culture dishes.
  • OPTI-MEM 7.5 pg pspAX2-D64V-NC-COM, 7.5 pg plasmids DNA expressing CLCN5 sgRNA and Cas9 (or Cas9-Klenow), and 3 pg pMD2.G.
  • 500 pl of OPTI-MEM was mixed with 54 pl of 1 mg/ml Polyethylenimine (PEI, Polysciences Inc., Warrington, PA). The mixture was incubated at room temperature for 15 mins before adding the mixture to the cells seeded the previous day, with the medium changed to OPTI -MEM just before DNA transfection.
  • PEI Polyethylenimine
  • the medium was changed to normal growth medium and the culture medium containing the virus-like particles was collected 48 hours after medium change.
  • concentrations of the particles were quantitated by p24 based ELISA (Cell Biolabs, QuickTiterTM Lentivirus Titer Kit Catalog Number VPK-107, San Diego, CA).
  • Genomic DNA was isolated with the DNeasy Blood & Tissue Kit (Qiagen, Germantown, MD) according to the manufacturer’s instructions.
  • the primer sequences used for amplifying target DNAs are set forth in Table 3.
  • Genomic DNA template input for PCR was up to 0.5 pg.
  • 0.2 pg DNA was used.
  • Pre-determmed minimal cycle numbers 25- 30 were used to reduce amplification bias.
  • the proofreading CloneAmp HiFi PCR Premix (Takara, Mountain View, USA; catalog #639298) was used for PCR.
  • NGS and data analysis were done by Genewiz Inc. (Morrisville, NC) using their “Amplicon EZ” service. Approximately 50,000 reads were obtained per sample. After removing the 3’ linker and 5’ barcode sequences, the resulting reads w'ere submitted to the online software Cas-Analyzer (Park et al., “Cas-analyzer: an online tool for assessing genome editing results using NGS data. Bioinformatics, 33, 286-288 (2017)), and CRISPResso2 (Clement et al., CRISPResso2 provides accurate and rapid genome editing sequence analysis.
  • SMRT Single-molecule real-time sequencing
  • PacBio Single-molecule real-time sequencing
  • Single-molecule realtime (SMRT) sequencing was performed to detect large deletions targeting the human CLCN5 gene.
  • a region of 4862 bp was amplified by LongAmp® Hot Start Taq 2X Master Mix (New England Biolab Catalog Number: M0533, Ipswich, MA) with primers hCLCN5-F3 and hCLCN5-R3.
  • the DNA was submitted to GCB Sequencing and Genomic Technologies Shared Resource (Duke University, Durham, NC) for SMRT sequencing (Sequel I).
  • One SMRTcell was used for eight barcoded samples.
  • CCS Circular Consensus
  • E. coli DNA polymerase I was targeted to DNA double-stranded breaks (DSBs) by fusing it to the C-terminus of Streptococcus pyogenes Cas9 with a linker peptide used in EvolvR in E. coli and yeast (FIG. IB). To enhance fusion protein expression in human cells, the codons of the pol A gene coding for pol I were optimized.
  • a fusion protein was used to target the 5’ untranslated region (5’ UTR) of human Chloride Voltage-Gated Channel 5 (CI.CN5). whose mutation causes a rare kidney disease named Dent’s disease, in GFP-reporter cells that were developed for sensitively detecting genome editing activities (Lu et al. (2021)). These GFP-reporter cells express no GFP due to the disruption of the GFP reading frame by inserting the CLCN5 sgRNA target sequence (from the CLCN5 5’ UTR region) between the start codon and the second codon of GFP coding sequence. GFP will only be expressed if genome editing restores the GFP reading frame by the in-frame INDELs ( ⁇ 1 in 3 chance).
  • INDEL profiles induced by Cas9 and Cas9-pol targeting CLCN5 were analyzed, and it was found that Cas9-pol caused a significant increase of 1-base pair (bp) deletions, a decrease of >l-bp deletions (FIG. 1C), and an increase of 1-bp TIS versus 1-bp non-TIS ratio (FIG. ID).
  • the data supported the hypothesis that targeting polymerase I to DSBs favors the generation of short deletions over long deletions, and TIS over non-TIS.
  • NLS-pol protein which was a deletion mutant of Cas9-pol that contained full length pol I and the nuclear localization signals (NLS), but lacked majority of the Cas9 functional domains (part of REC and RuvC, the whole HNH and part of PAM-interacting domain of Cas9) (FIG. 2A), was made. Since NLS-pol contained the NLS and linker sequences of Cas9-pol, it was expected to fold properly and be targeted to the nuclei.
  • Cas9 DNA-binding and nuclease activities due to the deletion of multiple Cas9 domains.
  • Cas9, CLCN5 gRNA, and NLS-pol were co-expressed in HEK293T cells, and it was found that cells treated with Cas9 and NLS-pol had 1 -bp deletion percentages between those of Cas9 treated cells and Cas9-pol treated cells, and had increased DNA substitution rates in a region 20bp 5’ and 20bp 3’ of the predicted cleavage site for unknown mechanisms (FIG. 2B).
  • co-expression of Cas9 and NLS-pol did not increase TIS to the level of Cas9-pol (FIG. 2C).
  • Cas9 was fused to various mutants and truncated pol proteins, including pol D705A with the polymerase activity inactivated. Klenow fragment, Klenow D705A with the polymerase activity inactivated, the 5’ exonuclease domain (5Exo), the 3’ exonuclease domain (3Exo), and both of the 5’ exonuclease and the 3’ exonuclease domains (Exo) (FIG. 2A).
  • CLCN5 was targeted in HEK293T cells using these Cas9 fusion proteins, and it was found that all fusion proteins without the DNA polymerase domain failed to increase 1-bp deletions and decrease >l -bp deletions. All fusion proteins with the DNA polymerase domain, regardless of whether the polymerase activity was inactivated, increased 1-bp deletions and decreased >l-bp deletions (FIG. 2B). Since Cas9-5exo, Cas9-3exo and Cas9-exo showed very similar mutation profiles with each other (FIG. 7), they were treated as one group (Cas9-all Exo) in FIG. 2B. Thus the polymerase domain, rather than the polymerase activity was enough to perturb the ratio of 1- bp and >l-bp deletions.
  • CLCN5 was similarly targeted in human primary IMR90 cells with various fusion proteins. In these cells, all fusion proteins with the Klenow domain (with or without polymerase activity) significantly increased 1-bp deletion frequency, but decreased insertion frequency rather >l-bp deletion frequency ( FIG. 2D). Again, targeting the polymerase activity to the DSBs were necessary for increasing TIS ( FIG. 2E).
  • the sgRNA-expressing constructs also contained Cas9 or Cas9-Klenow- expressing cassettes (see supplementary Table 1 for DNA constructs used).
  • INDEL rates of the co-transfected genes (RBBP8 and CLCN5) were very similar (Supplementary Table S4), consistent with co-transfection.
  • RBBP8 and CLCN5 co-transfected genes
  • Cas9-Klenow increased 1-bp deletions on multiple loci in multiple human cell types. Whether pol I or Klenow’s effects on DNA mutation profiles were target sequence- or cell type- specific was examined. The Cas9-Klenow fusion protein was used in subsequent experiments considering its smaller size and prominent effects on increasing 1 -bp deletions and TIS. Four more loci were examined, including Duchenne muscular dystrophy (DMD) exon 53 and DMD exon 44 (537 kb away from each other), the 5’ coding region of PIBB, and an intergenic locus intragenic 1 (GRCh38.pl3, chromosome 20, 32752960-32752979).
  • DMD Duchenne muscular dystrophy
  • DMD exons 53 and 44 were picked because targeting these exons with a single-cut sgRNA might restore dystrophin in DMD patients caused by exon deletion.
  • the HBB 5’ coding region was picked for possible application of genome editing in treating sickle cell disease.
  • this region has been targeted with CRISPR/Cas9 to examine Cas9-indcued gene conversion in human somatic cells (Parsijani et al. “CRISPR/Cas9 increases mitotic gene conversion in human cells,” Gene Ther, 27, 281-296 (2020)).
  • the intragenic intragenic 1 was picked to rule out possible contributions of target gene product on the observed effects.
  • Lentivirus-like particles containing the Cas9 RNPs or the Cas9-Klenow RNPs were generated, and similar percentages of GFP-positive cells after treating the CLCN5 GFP-reporter cells with the two types of RNPs, suggesting equivalent genome editing activities were observed.
  • HEK293T cells were treated with Cas9 RNPs or Cas9-Klenow RNPs.
  • DNA was amplified 72 hours after treatment and single-molecule real-time (SMRT) sequencing (PacBio) was perfored. More reads with >0.5 kb, >1 kb and >2 kb deletions in Cas9 treated cells than in Cas9-Klenow treated cells (Table 6 and FIG. 5) were found. Table 6. Large deletions generated by Cas9 and Cas9-Klenow targeting CLCN5. a Only those CCSs containing both the 5’ and 3’ index sequences (boxes in FIG. 5) were analyzed CCS: Circular Consensus
  • CLCN5 waas targeted in 1MR90 cells by nucleofection of plasmid DNA expressing CLCN5 sgRNA/Cas9 or CLCN5 sgRNA/Cas9-Klenow. Even though Cas9-treated cells had lower short INDEL rates than Cas9-Klenow-treated cells (See Table 7, which used the same DNA samples for NGS analysis), they had more >0.5kb, >lkb and >2kb deletions compared with Cas9-Klenow treated cells.
  • CCS reads with >0.5 kb deletions were examined, and it was found that the deleted regions either span or involved the sgRNA target site (FIG. 5), confirming that they were on- target deletions. Only limited types of deletions were observed. Cas9 generated more types of deletions and often more CCS reads for each type of deletion than Cas9-Klenow did. Both phenomenon could be explained by Cas9 being more prone to generate large deletions than did Cas9-Klenow. Multiple CCS reads for the same type of deletion could be the result of a single deletion event in one cell or multiple deletion events in multiple cells. Our observations of the same deletion type in Cas9-treated and Cas9-Klenow-treated IMR90 cells (indicated by * in FIG. 5B) supported the possibility of multiple deletion events for the same deletion type. Alternatively, Cas9 could have induced the large deletions sooner after treatment than Cas9- Klenow, which increased the representation of the deletions.
  • Cas9-Klenow increased INDEL rates in human primary cells. Whereas in HEK293T cells Cas9 and Cas9-Klenow (or Cas9-pol) generated similar levels of INDEL rates, in human primary cells Cas9-Klenow generated significantly higher INDEL rates in 5 of 6 loci/cells (Table 7). In general, the INDEL rates were relatively low in primary cells and the reason was unclear. The observed INDELs were confirmed as authentic INDELs, since the background INDELs of cells treated with non-targeting sgRNA were very low, and all the INDELs were around the predicted cleavage sites.
  • Cas9-Klenow did not increase DNA substitution rates or off-targets. Whether targeting DNA polymerase to DSBs could increase DNA mutation rates around DSBs was examined. DNA substitution rates in a 40 bps region around the predicted cleavage sites (20 bps on each side) were examined for the following reasons: 1) MRE11 nicks 15-20 nt away from the DSBs (18), 2) pol I showed a processivity of 15-20 nucleotide (61), and 3) EvolR (the fusion protein between Cas9 nickase and error prone DNA pol I) showed a mutation window of 15-20 bp (47). Cas9-Klenow did not cause increase in DNA substitution rates (Table 4).
  • GFP-reporter cells were used for detecting CRISPR/Cas9 induced INDELs in a HBB sickle mutant sequence, which has a one nucleotide difference with the HBB sgRNA, and is an “off- target” for the HBB sgRNA.
  • These cells contain HBB sgRNA authentic targets in the endogenous HBB gene and off-targets in the integrated GFP-reporter cassette.
  • the endogenous HBB gene with the perfectly matching HBB sgRNA was targeted, and TNDEL rates in the sickle mutant sequence as an off-target were examined.
  • Cas9 fusion proteins increased the ratio of small deletions versus large deletions, and the ratio of TIS versus non-TIS Importantly, doing so suppressed the generation of on-target deletions larger than 500 bp. These effects were observed in all loci analyzed (8 loci/cell), involving 4 cell types (one cell line and three primary cell types) and 5 target sites. The effects of reducing deletion sizes and increasing TIS over non-TIS are not cell type or target site specific. In primary cells, fusing Klenow to Cas9 caused a significant increase in overall INDEL rates in 4 out of 5 cases.
  • DNA resection is necessary for HDR, MMEJ and SSA.
  • the latter two alternative NHEJ DNA repair pathways will generate short and long deletions.
  • the MRE11-RAD50- NBS1 complex is responsible for initiating DNA resection, and EXO1, BLM and DNA2 are responsible for extensive resection.
  • An attempt waa made to suppress the generation of large deletions via counteracting DNA resection.
  • the data provided herein suggest that interfering with DNA resection is one of the mechanisms for Klenow’s effects on deletion sizes. First, it was determined that knocking down MRE1 1 or CtlP, proteins involved in DNA resection, increased 1-bp deletions and decreased >l-bp deletions.
  • pol D705A and Klenow D705A with inactivated polymerase activity had similar effects on deletion sizes as pol I and Klenow fragment. It is possible that these proteins interfered with DNA resection via the following two non-exclusive mechanisms: 1) the addition of a bulk peptide (>629 AA) to the C-terminus of Cas9 may prevent the recruitment of the DNA resection complex or regulatory' proteins, and 2) the residual DNA binding activity of pol D705A or Klenow D705A may interfere with the DNA resection. Since pol D705A an j Klenow D705A d 0 no t affect the percentage of TIS, they could be useful when one only needing to increase small deletions and decrease large deletions. Although counteracting DNA resection appears to be be the mechanism underlying the observations, other cellular DNA damage repair machineries cannot be entirely ruled out.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Virology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Mycology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
PCT/US2023/063954 2022-03-08 2023-03-08 Compositions, systems and methods for eukaryotic gene editing Ceased WO2023172966A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
JP2024553395A JP2025510574A (ja) 2022-03-08 2023-03-08 真核生物遺伝子編集のための組成物、システムおよび方法
EP23767652.3A EP4489772A4 (en) 2022-03-08 2023-03-08 EUKARYOTIC GENE EDITING COMPOSITIONS, SYSTEMS AND METHODS
KR1020247032958A KR20240155953A (ko) 2022-03-08 2023-03-08 진핵 유전자 편집을 위한 조성물, 시스템 및 방법
AU2023232138A AU2023232138A1 (en) 2022-03-08 2023-03-08 Compositions, systems and methods for eukaryotic gene editing
CA3245468A CA3245468A1 (en) 2022-03-08 2023-03-08 Compositions, systems and methods for eukaryotic gene editing

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202263317720P 2022-03-08 2022-03-08
US63/317,720 2022-03-08

Publications (1)

Publication Number Publication Date
WO2023172966A1 true WO2023172966A1 (en) 2023-09-14

Family

ID=87935949

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2023/063954 Ceased WO2023172966A1 (en) 2022-03-08 2023-03-08 Compositions, systems and methods for eukaryotic gene editing

Country Status (6)

Country Link
EP (1) EP4489772A4 (https=)
JP (1) JP2025510574A (https=)
KR (1) KR20240155953A (https=)
AU (1) AU2023232138A1 (https=)
CA (1) CA3245468A1 (https=)
WO (1) WO2023172966A1 (https=)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2025072446A1 (en) * 2023-09-27 2025-04-03 Keith Brown Cell specific activation

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100173365A1 (en) * 2003-03-25 2010-07-08 Michael Borns DNA polymerase fusions and uses thereof
US20170292156A1 (en) * 2010-02-26 2017-10-12 Life Technologies Corporation Modified proteins and methods of making and using same
US20210047375A1 (en) * 2018-05-01 2021-02-18 Wake Forest University Health Sciences Lentiviral-based vectors and related systems and methods for eukaryotic gene editing

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10947517B2 (en) * 2019-02-15 2021-03-16 Sigma-Aldrich Co. Llc CRISPR/Cas fusion proteins and systems
WO2020191233A1 (en) * 2019-03-19 2020-09-24 The Broad Institute, Inc. Methods and compositions for editing nucleotide sequences

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100173365A1 (en) * 2003-03-25 2010-07-08 Michael Borns DNA polymerase fusions and uses thereof
US20170292156A1 (en) * 2010-02-26 2017-10-12 Life Technologies Corporation Modified proteins and methods of making and using same
US20210047375A1 (en) * 2018-05-01 2021-02-18 Wake Forest University Health Sciences Lentiviral-based vectors and related systems and methods for eukaryotic gene editing

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See also references of EP4489772A4 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2025072446A1 (en) * 2023-09-27 2025-04-03 Keith Brown Cell specific activation

Also Published As

Publication number Publication date
KR20240155953A (ko) 2024-10-29
AU2023232138A1 (en) 2024-09-26
EP4489772A1 (en) 2025-01-15
JP2025510574A (ja) 2025-04-15
EP4489772A4 (en) 2026-03-25
CA3245468A1 (en) 2023-09-14

Similar Documents

Publication Publication Date Title
JP7832700B2 (ja) 真核生物の遺伝子編集のためのレンチウイルスベースのベクターならびに関連システムおよび方法
JP2019530467A (ja) 安全性向上のための自己制限Cas9回路網(SLiCES)プラスミドおよびそのレンチウイルス系
CA3026110A1 (en) Novel crispr enzymes and systems
CN104480144A (zh) 用于艾滋病基因治疗的CRISPR/Cas9重组慢病毒载体及其慢病毒
WO2024155741A9 (en) Prime editing-mediated readthrough of premature termination codons (pert)
RU2752529C9 (ru) Улучшенные эукариотические клетки для получения белка и способы их получения
US20240108757A1 (en) Engineered extracellular vesicles and their uses
WO2019173248A1 (en) Engineered nucleic acid-targeting nucleic acids
JP7843231B2 (ja) 遺伝子発現を増強させる哺乳動物配列への標的組込み
Yoo et al. Targeting DNA polymerase to DNA double-strand breaks reduces DNA deletion size and increases templated insertions generated by CRISPR/Cas9
Zhang et al. Interfering with retrotransposition by two types of CRISPR effectors: Cas12a and Cas13a
US20230405116A1 (en) Vectors, systems and methods for eukaryotic gene editing
AU2023232138A1 (en) Compositions, systems and methods for eukaryotic gene editing
WO2025096936A2 (en) Use of prime editing in correcting mutations in cdkl5
WO2026085201A2 (en) Base editing to correct inborn errors of immunity
WO2025049792A1 (en) Compositions and methods for epigenetic regulation of tgfbr2 expression
WO2025049877A1 (en) Chemo-sensitive dominant clone for adaptive therapy
WO2024206125A1 (en) Use of prime editing for treating sickle cell disease
CN120897761A (zh) 用于使用基因组工程产生调节性t细胞(treg)的方法
CA3250173A1 (en) IMPROVING THE SAFETY AND PRECISION OF CRISPR-CAS-INDUCED GENE EDITING WITH DNA POLYMERASE VARIANTS USING CAS-PLUS VARIANTS
CN113215157A (zh) 特异性靶向人AXL基因的sgRNA及其应用
Tasca Shepherding precision gene editing ith CRISPR-Cas9 ariants and adeno iral ectors

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23767652

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2024553395

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: AU23232138

Country of ref document: AU

ENP Entry into the national phase

Ref document number: 2023232138

Country of ref document: AU

Date of ref document: 20230308

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20247032958

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 1020247032958

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 2023767652

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2023767652

Country of ref document: EP

Effective date: 20241008