WO2023171448A1

WO2023171448A1 - Pharmaceutical composition for preventing or treating disease to be prevented or treated by deactivation of myofibroblasts

Info

Publication number: WO2023171448A1
Application number: PCT/JP2023/007095
Authority: WO
Inventors: 豊稲垣; 令明平山; 享世柳川
Original assignee: 学校法人東海大学
Priority date: 2022-03-11
Filing date: 2023-02-27
Publication date: 2023-09-14

Abstract

The present invention addresses the problem of providing a technique for deactivating myofibroblasts. The problem is solved by a pharmaceutical composition for preventing or treating a disease which can be prevented or treated by the deactivation of myofibroblasts, the pharmaceutical composition comprising, as an active ingredient, a compound having molecular descriptors vsurf_DD12, vsurf_HB7, vsurf_IW7, KierA3, PEOE_VSA+2, PEOE_VSA_FPPOS and SlogP_VSA5 that satisfy the following formulae (I) and/or (II). 71.344 + 2.358 * vsurf_DD12 + 2.5787 * vsurf_HB7 + 3.529 * vsurf_IW7 < 81.9 ···(I) 93.595000 - 14.48520 * KierA3 + 0.50487 * PEOE_VSA+2 + 326.76600 * PEOE_VSA_FPPOS + 0.23285 * SlogP_VSA5 < 98.4 ···(II)

Description

Pharmaceutical composition for the prevention or treatment of diseases that can be prevented or treated by deactivation of myofibroblasts

The present invention relates to a pharmaceutical composition for preventing or treating diseases that can be prevented or treated by deactivating myofibroblasts.

Organ fibrosis, as typified by liver cirrhosis, is a pathological condition in which matrix components such as collagen are excessively deposited in organs and tissues, resulting in organ and tissue dysfunction. In the liver, stellate cells are the main collagen-producing cells, and when inflammation occurs in the liver, stellate cells transform (activate) from resting vitamin A storage cells to collagen-producing myofibroblasts. To date, many attempts have been made to treat liver fibrosis, including reducing hepatocellular damage, suppressing inflammation, inhibiting stellate cell activation, and suppressing collagen production by activated stellate cells (for example, patent literature 1-3), have not yet reached clinical application.

On the other hand, recent basic research using mice with liver fibrosis has reported that when fibrotic stimulation is interrupted, approximately half of the activated stellate cells become "deactivated" and return to a state close to the resting phase. (Non-patent Documents 1 and 2). However, whether it is possible to artificially induce deactivation of stellate cells under conditions of sustained liver fibrotic stimulation, and elucidation of the molecular mechanism that induces deactivation are major challenges for therapeutic application. be.

A transcription regulatory factor called Tcf21 (transcription factor 21) is known. It has been reported that Tcf21 forms a dimer with Tcf3, which belongs to the same basic helix-loop-helix (bHLH) transcription factor family, and controls the expression of target genes by binding to DNA (non-patent References 3-5). The present inventors focused on Tcf21, whose expression gradually increases during the functional maturation process of immature hepatic stellate cells during the embryonic period, but whose expression decreases markedly in activated hepatic stellate cells that have changed into myofibroblast-like cells. Therefore, we have developed and already reported a method for deactivating activated hepatic stellate cells, which includes a step of introducing the Tcf21 gene and/or Tcf21 protein into activated hepatic stellate cells (Patent Documents 4 to 5). It has also been reported that by inducing deactivation of activated hepatic stellate cells, it is possible to prevent or treat hepatitis, liver fibrosis, liver cirrhosis, liver cancer, or liver failure due to any of these diseases. (Patent Documents 4 to 5, Non-Patent Document 6).

It is known that stellate cells exist not only in the liver but also in the pancreas, and play an important role in the onset and progression of pancreatic fibrosis (Non-Patent Document 7). In addition, Tcf21-expressing cells are present not only in hepatic stellate cells but also in the kidney (Non-patent Document 8), lung (Non-Patent Document 9), heart (Non-Patent Document 10), and coronary artery (Non-patent Document 11), which produce collagen. It has also been reported that it originates from cells. Among these, for example, abnormal expression (reduction in expression level) of Tcf21 in activated myofibroblasts has been confirmed in cardiac fibrosis (Non-patent Document 12) and coronary artery atherosclerosis (Non-patent Document 13). It has been reported that Tcf21 expression in coronary artery smooth muscle cells may suppress the progression of atherosclerosis.

JP 2019-150075 Publication Japanese Patent Application Publication No. 2019-108291 JP2020-070250A International Publication No. 2020/121546 International Publication No. 2020/121366

An object of the present invention is to provide a technique for deactivating myofibroblasts.

In order to solve the above problems, the present inventors searched for compounds that can mimic the action of Tcf21 protein, and found that the above problems could be solved by using a compound having a specific structure. It was completed. The invention is as follows.

The present invention provides myofibroblasts whose molecular descriptors vsurf_DD12, vsurf_HB7, vsurf_IW7, KierA3, PEOE_VSA+2, PEOE_VSA_FPPOS, and SlogP_VSA5 contain as an active ingredient a compound satisfying the following formula (I) and/or (II). Pharmaceutical compositions for the prevention or treatment of diseases that can be prevented or treated by deactivation are provided.
71.344 + 2.358 * vsurf_DD12 + 2.5787 * vsurf_HB7 + 3.529 * vsurf_IW7 < 81.9 ・・・(I)
93.595000 - 14.48520 * KierA3 + 0.50487 * PEOE_VSA+2 + 326.76600 * PEOE_VSA_FPPOS + 0.23285 * SlogP_VSA5 < 98.4 ...(II)

In a preferred embodiment of the pharmaceutical composition, at least one of the molecular descriptors VSA, vol, ASA, ASA ⁺ , and apol of the compound is within the following range.
376.1≦VSA≦515.7
341.3≦vol≦466.6
597.8≦ASA≦793.0
487.9≦ASA ⁺ ≦646.9
56.6≦apol≦79.5

The present invention relates to compounds represented by any of the following formulas (1) to (8) (excluding compounds represented by the following formulas (1'), (1''), or (2')). Provided is a pharmaceutical composition for preventing or treating a disease that can be prevented or treated by deactivating myofibroblasts, the composition comprising the present invention or a pharmaceutically acceptable salt thereof as an active ingredient.

(In the above formula (1),
P ¹ may have an alkyl group having 1 to 3 carbon atoms, is a 9- or 10-membered aromatic heterocyclic group containing nitrogen and consisting of 2 rings,
Q ¹ may have an -OH group and is a 5- or 6-membered alicyclic heterocyclic group containing nitrogen,
R ¹ is a substituent represented by the following formula (1a) or (1b),

In the above formula (1a),
Sp ¹ is an aliphatic hydrocarbon group having 1 to 4 carbon atoms, and one or more -CH ₂ - of the aliphatic hydrocarbon group may be substituted with -O-. )

(In the above formula (2),
^P2 is an alicyclic hydrocarbon group having 5 or 6 carbon atoms,
Q ² is hydrogen or a straight chain or branched alkyl group having 1 to 5 carbon atoms. )

In the pharmaceutical composition, in the formula (1), P ¹ is represented by any of the following formulas (9a) to (9e), and Q ¹ is represented by any of the following formulas (10a) to (10c). The preferred embodiment is to

In a preferred embodiment of the pharmaceutical composition, the compound is a compound represented by any of the following formulas (11) to (18) or a pharmaceutically acceptable salt thereof.

The above pharmaceutical composition can be used in combination with a composition containing Tcf3 protein and/or a polynucleotide encoding it.

In a preferred embodiment of the pharmaceutical composition, the disease that can be prevented or treated by deactivating myofibroblasts is a disease selected from the group consisting of (a) to (f) below.
(a) hepatitis, liver fibrosis, liver cirrhosis, or liver cancer, or liver failure due to any of these diseases;
(b) pancreatic secretory insufficiency due to pancreatitis or pancreatic fibrosis, or any of these diseases;
(c) nephritis, renal fibrosis, or glomerulosclerosis, or renal failure due to any of these diseases;
(d) interstitial pneumonia or pulmonary fibrosis, or respiratory failure due to any of these diseases;
(e) Fibrosis after myocardial infarction; myocarditis or cardiomyopathy, or heart failure due to any of these diseases;
(f) Coronary artery stenosis due to arterial atherosclerosis, coronary artery restenosis after balloon dilation, or coronary artery restenosis after stent placement, or ischemic heart disease due to any of these diseases.

The present invention treats myofibroblasts using a compound whose molecular descriptors vsurf_DD12, vsurf_HB7, vsurf_IW7, KierA3, PEOE_VSA+2, PEOE_VSA_FPPOS, and SlogP_VSA5 satisfy the following formula (I) and/or (II). A method of deactivating myofibroblasts can be provided, comprising the step of:
71.344 + 2.358 * vsurf_DD12 + 2.5787 * vsurf_HB7 + 3.529 * vsurf_IW7 < 81.9 ・・・(I)
93.595000 - 14.48520 * KierA3 + 0.50487 * PEOE_VSA+2 + 326.76600 * PEOE_VSA_FPPOS + 0.23285 * SlogP_VSA5 < 98.4 ...(II)

In a preferred embodiment of the myofibroblast deactivation method, at least one of the molecular descriptors VSA, vol, ASA, ASA ⁺ and apol of the compound falls within the following range.
376.1≦VSA≦515.7
341.3≦vol≦466.6
597.8≦ASA≦793.0
487.9≦ASA ⁺ ≦646.9
56.6≦apol≦79.5

The present invention relates to compounds represented by any of the following formulas (1) to (8) (excluding compounds represented by the following formulas (1'), (1''), or (2')). A method for deactivating myofibroblasts can be provided, which includes the step of treating myofibroblasts using the present invention or a pharmaceutically acceptable salt thereof.

The present invention is a method for predicting whether a target compound has Tcf21 protein-like activity, comprising:
generating values of molecular descriptors associated with the action from the structure of the target compound; and applying the values of the molecular descriptors associated with the action to a predictive model expressed as a function of the molecular descriptors associated with the action. and predicting whether the target compound has the effect,
A method can be provided, wherein the molecular descriptor associated with the action includes one or more selected from vsurf_DD12, vsurf_HB7, vsurf_IW7, KierA3, PEOE_VSA+2, PEOE_VSA_FPPOS, and SlogP_VSA5.

The method for predicting whether or not a target compound has a Tcf21 protein-like action includes the prediction model:
f = k + l * vsurf_DD12 + m * vsurf_HB7 + n * vsurf_IW7;
g = k + l * KierA3 + m * PEOE_VSA+2 + n * PEOE_VSA_FPPOS + o * SlogP_VSA5
(In the formula, k to o are numbers determined by multiple regression analysis.)
In a preferred embodiment, if f or g is less than 100, the model predicts that the target compound has the above-mentioned effect.

The present invention is a method for predicting whether a target compound has Tcf21 protein-like activity, comprising:
Based on the structure of a compound that is known to have or does not have a Tcf21 protein-like effect, creating a predictive model expressed as a function of molecular descriptors associated with said effect;
generating a value of a molecular descriptor associated with the action from the structure of the target compound; and applying the value of the molecular descriptor associated with the action to the prediction model to determine whether or not the target compound has the action. A method can be provided that includes the step of predicting.

The present invention can provide a system comprising means for executing the method for predicting whether or not a target compound has Tcf21 protein-like activity.
The present invention can provide a program for executing the method for predicting whether a target compound has a Tcf21 protein-like action, and a recording medium on which the program is recorded.

According to the present invention, a technique for deactivating myofibroblasts can be provided. Furthermore, according to the present invention, by deactivating myofibroblasts in fibrotic organs and tissues, it is possible to prevent and treat various myofibroblast-related diseases. Furthermore, it becomes possible to predict whether a target compound has a Tcf21 protein-like effect.

Graph showing the relative expression level of the Acta2 gene when each compound was added to a rat activated hepatic stellate cell clone. Graph showing the relative expression level of ACTA2 gene when each compound was added to human activated hepatic stellate cells. Graph showing the dose dependence of each compound on the relative expression level of ACTA2 gene in human activated hepatic stellate cells. Graph showing changes over time in the relative expression level of the ACTA2 gene when each compound was added to human activated hepatic stellate cells. Sirius red stained image of a liver tissue section obtained when Compound 3 was administered to a mouse with liver fibrosis induced (photograph substituted for a drawing). Graph showing the relative expression level of Acta2 gene in liver tissue when Compound 3 was administered to mice in which liver fibrosis was induced. Graph showing the relative expression level of the Ngfr gene in liver tissue when Compound 3 was administered to mice in which liver fibrosis was induced. Sirius red stained image of a liver tissue section obtained when Compound 37 was administered to a mouse in which liver fibrosis was induced (photograph substituted for a drawing). Graph showing the relative expression level of Acta2 gene in liver tissue when Compound 37 was administered to mice in which liver fibrosis was induced. Graph showing the relative expression level of the Col1a1 gene in liver tissue when Compound 37 was administered to mice in which liver fibrosis was induced.

<Method for predicting whether a target compound has Tcf21 protein-like activity>
One aspect of the present invention is a method for predicting whether a target compound has Tcf21 protein-like activity, comprising:
(A) generating values of molecular descriptors associated with the action from the structure of the target compound; and
(B) applying the value of the molecular descriptor associated with the action to a prediction model expressed as a function of the molecular descriptor associated with the action to predict whether or not the target compound has the action; including.

In this specification, Tcf21 protein-like action refers to the action of Tcf3 protein and the action of Tcf21 protein and Tcf3 protein to form a three-dimensional structure that can bind to the DNA of a target gene and form and maintain a complex that can control the function of that gene. Point.

[Step (A)]
The target compound is not particularly limited as long as its structure can be specified, and examples thereof include low-molecular organic compounds and high-molecular organic compounds such as synthetic resins, proteins, and polysaccharides. The molecular weight of the low-molecular organic compound is not particularly limited, but is usually 50 or more, preferably 100 or more. On the other hand, it is usually 2,000 or less, preferably 1,000 or less, and more preferably 500 or less. The molecular weight of the high-molecular organic compound is not particularly limited, but is usually 1,000 or more, preferably 10,000 or more. On the other hand, it is usually 10,000,000 or less, preferably 100,000 or less. The target compound is preferably a low-molecular organic compound. Furthermore, in this embodiment, it is preferable from the viewpoint of prediction accuracy that the target compound is a compound that does not significantly change the expression level of housekeeping genes such as Gapdh and β-actin.

The type and number of molecular descriptors related to the above action are not particularly limited as long as they are molecular descriptors that can predict the presence or absence of Tcf21 protein-like action. In this embodiment, the molecular descriptor related to Tcf21 protein-like action is preferably a molecular descriptor extracted by multiple regression analysis, and more specifically, a molecular descriptor extracted in step (C) described below. Preferably a child.

In this embodiment, the molecular descriptor related to the action is preferably at least one selected from 0- to 4-dimensional molecular descriptors. Examples of zero-dimensional molecular descriptors include the number of atoms such as C, H, O, N, and halogen, the number of bonds, and molecular weight. Examples of one-dimensional molecular descriptors include the number of functional groups such as alkyl groups, aryl groups, arylalkyl groups, hydroxy groups, ester groups, and amino groups, and the number of aromatic rings. Examples of two-dimensional molecular descriptors include those characterized by structural formulas such as SMR_VSA1-10, PEOE_VSA1-14, SlogP_VSA1-12, Estate_VSA1-11, AM1_dipole, and b_1rotN. Examples of the three-dimensional molecular descriptor include those that are geometrically characterized, such as 3D-MoRSE, WHIM, GETAWAY, VSA, vol, ASA, ASA+, AM1_dipole, vsurf_DD12, vsurf_HB7, vsurf_IW7, and vsurf_EWmin3. Examples of the four-dimensional molecular descriptor include those calculated by GRID, CoMFA, Volsurf, etc. and characterized by interaction energy.

In this aspect, the molecular descriptor associated with the action is preferably at least one type selected from 0- to 3-dimensional molecular descriptors, and preferably at least one type selected from 2- to 3-dimensional molecular descriptors. More preferred. The number of molecular descriptors related to the action is not particularly limited, but from the viewpoint of increasing prediction accuracy, it is preferably 2 or more, and more preferably 3 or more. Further, the number of molecular descriptors related to the action is preferably 10 or less, more preferably 8 or less, and even more preferably 6 or less, from the viewpoint of constructing a simple predictive model.

In this embodiment, the molecular descriptors related to the action preferably include molecular descriptors regarding hydrophilicity or polarizability and the number of freely rotatable single bonds, and include vsurf_DD12, vsurf_HB7, vsurf_IW7, KierA3, PEOE_VSA+2 , PEOE_VSA_FPPOS, and SlogP_VSA5.

The molecular descriptor vsurf_DD12 indicates the distance between the lattice points with the lowest and second lowest hydrophobic energies. This value becomes smaller for molecules in which highly hydrophobic regions are located close together within the molecule.
The molecular descriptor vsurf_HB7 exhibits hydrogen bond donating properties at the level of 5.0 kcal/mol. This value decreases as the hydrogen bond donating property decreases. In other words, this value becomes smaller for molecules with fewer functional groups capable of donating strong hydrogen bonds.
The molecular descriptor vsurf_IW7 indicates a hydrophilic integy moment at the -5.0 kcal/mol level. Hydrophilic integy moment refers to the distribution of hydrophilic regions relative to the center of mass of a molecule. A molecule with a small value indicates that the hydrophilic region is distributed near the center of mass, or that the polar region is on the opposite side of the molecule to the center of mass and is balanced.

The molecular descriptor KierA3 becomes smaller when atoms form a ring structure and the molecular shape becomes compact (Hall, LH, Kier, LB; The Molecular Connectivity Chi Indices and Kappa Shape Indices in Structure-Property Modeling; Reviews of Computational Chemistry 2 (1991)). The fact that this coefficient is negative indicates that an elongated molecular structure is more advantageous in improving activity than a compact molecular structure.
The molecular descriptor PEOE_VSA+2 indicates the sum of the van der Waals surface areas of atoms with charges in the range [0.10, 0.15].
The molecular descriptor PEOE_VSA_FPPOS is the ratio of the sum of the van der Waals surface areas of atoms with a charge of 0.2 or more to the total surface area of the molecule. The fact that PEOE_VSA+2 and PEOE_VSA_FPPOS are positive indicates that molecules with fewer positive charges on the surface have higher activity. Partial charges were determined by Gasteiger's method (Gasteiger, J., Marsili, M.; Iterative Partial Equalization of Orbital Electronegativity - A Rapid Access to Atomic Charges; Tetrahedron 36 (1980) 3219.).
The molecular descriptor SlogP_VSA5 is the partition function of the molecule between octanol and water, SlogP(Wildman, SA, Crippen, GM; Prediction of Physiochemical Parameters by Atomic Contributions; J. Chem. Inf. Comput. Sci. 39 No. 5 ( 1999) 868-873.) between (0.15, 0.20] (indicating that this range does not significantly contribute to the overall hydrophobicity of the molecule).The coefficient is The small positive value suggests that less exposure of atoms with this level of hydrophobicity to the molecular surface leads to improved activity.

The vsurf molecular descriptor is a structure prepared in the integrated computational chemistry system Molecular Operating Environment (MOE, 2020.09; Chemical Computing Group ULC, 1010 Sherbrooke St. West, Suite #910, Montreal, QC, Canada, H3A 2R7, 2020.) It is a descriptor. The vsurf molecular descriptor is calculated as follows. First, lattice points (usually 0.5 Å spacing) are created around the molecule, and water, a hydrophobic probe, and a hydrogen bond acceptor probe (O) are placed at each lattice point to evaluate the molecular interaction field that these lattice points receive from the molecule. demand. Next, the value of each molecular descriptor is calculated based on the action experienced at each grid point.

[Step (B)]
The predictive model expressed as a function of the molecular descriptor related to the above-mentioned action is not particularly limited as long as it is a model that can predict whether or not the target compound has the above-mentioned action. In this aspect, the predictive model is preferably a predictive model created by multiple regression analysis, and more specifically, preferably a predictive model created in step (C) described below.

In this aspect, the prediction model is
f = k + l * vsurf_DD12 + m * vsurf_HB7 + n * vsurf_IW7
g = k + l * KierA3 + m * PEOE_VSA+2 + n * PEOE_VSA_FPPOS + o * SlogP_VSA5
(In the formula, k to o are numbers determined by multiple regression analysis.)
In this case, if f or g is less than 100, it is preferable that the model predicts that the target compound has the above-mentioned effect.

More preferably,
f' = 71.344 + 2.358 * vsurf_DD12 + 2.5787 * vsurf_HB7 + 3.529 * vsurf_IW7
g' = 93.595000 - 14.48520 * KierA3 + 0.50487 * PEOE_VSA+2 + 326.76600 * PEOE_VSA_FPPOS + 0.23285 * SlogP_VSA5
If f' or g' is less than 100, the model predicts that the target compound has the above-mentioned effect, and particularly preferably, if g' is less than 100, the model predicts that the target compound has the above-mentioned effect. This is a model that

f and f' are preferably less than 81.9, more preferably 80 or less, even more preferably 75 or less, even more preferably 70 or less, particularly preferably 60 or less, and most preferably 50 or less.
g and g' are preferably less than 98.4, more preferably 90 or less, even more preferably 80 or less, even more preferably 70 or less, particularly preferably 60 or less, and most preferably 50 or less.

Prediction accuracy of the prediction model (rate of agreement between the prediction of whether the target compound has the above-mentioned effect and the result of confirming the presence or absence of Tcf21 protein-like effect by the method described below) is preferably 75% or more, and 80% or more. % or more, more preferably 85% or more, even more preferably 90% or more, particularly preferably 95% or more, and most preferably 100%.

Another aspect of the present invention is a method for predicting whether a target compound has Tcf21 protein-like activity, which comprises, in addition to steps (A) and (B) above,
(C) creating a predictive model based on the structure of a compound that is known to have or does not have a Tcf21 protein-like effect, expressed as a function of molecular descriptors associated with said effect;
including.

[Step (C)]
Compounds that are known to have Tcf21 protein-like activity are not particularly limited as long as they have been confirmed to have Tcf21 protein-like activity, but multiple compounds with different basic skeletons, functional groups, etc. may be used. is preferred. Specific examples include, but are not limited to, the compounds described in Examples below.

Tcf21 protein controls target gene expression by interacting with Tcf3 protein and target gene DNA through a specific region to form and maintain a complex (hereinafter referred to as Tcf21/Tcf3/DNA complex structure). Among them, the site where the Tcf21 protein interacts with Tcf3 and DNA is sometimes referred to as the "Tcf21 protein action site".) Therefore, a compound having a Tcf21 protein-like action is required to be able to form and maintain a compound/Tcf3/DNA complex in a form that binds to the Tcf21 protein action site with sufficient affinity. Therefore, the compound for which it is known whether or not it has Tcf21 protein-like activity is selected from those capable of forming and maintaining a compound/Tcf3/DNA complex in a form that binds to the Tcf21 protein action site with sufficient affinity. It is preferable.

The method for determining whether a compound/Tcf3/DNA complex can be formed and maintained in a form that binds to the Tcf21 protein action site with sufficient affinity is not particularly limited, but the binding affinity of the compound/Tcf3/DNA complex Compounds with a certain level or more can be determined by docking simulation as compounds that can form and maintain a compound/Tcf3/DNA complex by binding to the Tcf21 protein action site with sufficient affinity.
The software used for docking simulation is “ASEDock-docking based on alpha spheres and excluded volumes” (Goto, J.; Kataoka, R.; Muta, H.; Hirayama, N. J Chem Inf Model., 2008, 48(3 ), 583-590.).
The binding affinity of a compound/Tcf3/DNA complex can be determined using GBVI/WSA_dG, which corresponds to the binding free energy. The smaller the value of GBVI/WSA_dG, the higher the binding affinity of the compound/Tcf3/DNA complex. The upper limit of GBVI/WSA_dG is -4.000 kcal/mol, preferably -5.000 kcal/mol. On the other hand, the lower limit of GBVI/WSA_dG is -12.500 kcal/mol, although it is not particularly limited. The calculation method for GBVI/WSA_dG is based on Variability in docking success rates due to dataset preparation. (Corbeil, C. R.; Williams, C. I.; Labute, P. J. Comput.-Aided Mol. Des. 2012, 26, 775-786.) You can refer to it.

As mentioned above, Tcf21 protein-like action refers to the action of Tcf3 protein and the action of Tcf21 protein and Tcf3 protein to form a three-dimensional structure that can bind to the DNA of the target gene and form and maintain a complex that can control the function of that gene. . Here, controlling the function of the target gene may mean enhancing or decreasing the expression of the target gene. Therefore, whether a certain compound has a Tcf21 protein-like effect can be evaluated using the expression level of the target gene.
Examples of the target genes include genes involved in fibrosis in organs and tissues, marker genes for stationary phase cells that do not produce or have low collagen production, and the like.

In this embodiment, it is preferable to reduce the expression of target genes involved in promoting fibrosis of organs and tissues. Examples of such target genes include Acta2 gene, Col1a1 gene, Col1a2 gene, and the like.
For example, in myofibroblasts, the expression level of the Acta2 gene after treatment with the compound is preferably 0.9 or less, more preferably 0.8, with the expression level before treatment with the compound being 1. Below, it is more preferably 0.7 or less, even more preferably 0.6 or less, particularly preferably 0.5 or less. On the other hand, the lower limit is not particularly limited, but is, for example, 0.1 or more.
For example, in myofibroblasts, the expression level of the Col1a1 gene after treatment with the compound is preferably 0.8 or less, more preferably 0.7, with the expression level before treatment with the compound being 1. It is more preferably 0.6 or less, even more preferably 0.5 or less. On the other hand, the lower limit is not particularly limited, but is, for example, 0.1 or more.
For example, in myofibroblasts, the expression level of the Col1a2 gene after treatment with the compound is preferably 0.8 or less, more preferably 0.7, with the expression level before treatment with the compound being 1. It is more preferably 0.6 or less, even more preferably 0.5 or less. On the other hand, the lower limit is not particularly limited, but is, for example, 0.1 or more.
Based on the fact that the expression level of the target gene is, for example, above, it can be determined that the compound has a Tcf21 protein-like effect. Alternatively, the value of the expression level of the target gene may be used as an index of the strength of Tcf21 protein-like action in multiple regression analysis described below.

It is also preferable to enhance the expression of marker genes in stationary phase cells that do not produce or have low collagen production in organs and tissues. Examples of such marker genes include the Gfap gene and the Ngfr gene.
For example, in myofibroblasts, the expression level of the Gfap gene after treatment with the compound is preferably 1.2 or more, more preferably 1.5, with the expression level before treatment with the compound being 1. above, more preferably 2.0 or more, even more preferably 3.0 or more. On the other hand, the upper limit is not particularly limited, but is, for example, 20 or less.
For example, in myofibroblasts, the expression level of the Ngfr gene after treatment with the compound is preferably 1.2 or more, more preferably 1.5, with the expression level before treatment with the compound being 1. above, more preferably 2.0 or more, even more preferably 3.0 or more. On the other hand, the upper limit is not particularly limited, but is, for example, 20 or less.
Based on the fact that the expression level of the target gene is, for example, above, it can be determined that the compound has a Tcf21 protein-like effect. Alternatively, the value of the expression level of the target gene may be used as an index of the strength of Tcf21 protein-like action in multiple regression analysis described below.

Whether or not it has Tcf21 protein-like action may be determined from the expression level of one of the Acta2 gene, Col1a1 gene, Col1a2 gene, Gfap gene, Ngfr gene, etc., or it may be determined by combining two or more genes. .

As a method for confirming the expression of the target gene, conventional methods can be used, such as known methods for measuring the expression level of mRNA or protein, which is a gene product.
The expression level of mRNA can be confirmed by, for example, RT-PCR, quantitative PCR, microarray method, or Northern blotting method. It can also be confirmed by evaluating the promoter activity of the target gene, for example, by incorporating the promoter fragment of the target gene into a luciferase reporter vector containing the luciferase gene and evaluating the luciferase activity.
Furthermore, the expression level of a protein, which is a gene product, can be confirmed by, for example, Western blotting, ELISA, or the like.

In this embodiment, the prediction model is simplified by not including compounds that greatly change the expression levels of housekeeping genes such as Gapdh and β-actin among the compounds for which it is known whether or not they have Tcf21 protein-like action. and preferred from the viewpoint of improving prediction accuracy.
The lower limit of the number of compounds for which it is known whether or not they have Tcf21 protein-like activity is not particularly limited, but from the point of view of increasing prediction accuracy, it is preferably at least 3 times the number of molecular descriptors used, and more preferably at least 5 times the number of molecular descriptors used. It is preferably 15 times or more, more preferably 20 times or more, and particularly preferably 20 times or more. Further, the more the better, and the upper limit is not particularly limited, but can be 10,000 times or less.

In this embodiment, step (C) generates a set of molecular descriptor values from the structure of a compound whose presence or absence is known to have a Tcf21 protein-like action, and from which values are associated with said action by multiple regression analysis. Preferably, the step is to extract molecular descriptors and create a predictive model.
The expression levels of target genes of Tcf21 protein and Tcf3 protein can be used in the multiple regression analysis.

In this embodiment, the group of molecular descriptors is preferably selected from 0 to 3 dimensional molecular descriptors, more preferably selected from 2 to 3 dimensional molecular descriptors.
When extracting molecular descriptors related to the action from a group of molecular descriptors, the number is not particularly limited, but from the viewpoint of improving prediction accuracy, 2 or more is preferable, and 3 or more is more preferable. Furthermore, the number of compounds for which it is known whether or not they have Tcf21 protein-like activity is preferably 1/3 or less, more preferably 1/5 or less, even more preferably 1/15 or less, particularly preferably 1/20 or less. Further, the number of molecular descriptors related to the action is preferably 10 or less, more preferably 8 or less, and even more preferably 6 or less, from the viewpoint of constructing a simple predictive model.

In this aspect, the prediction model expressed as a function of molecular descriptors related to the action is preferably a function expressed as a linear combination of molecular descriptors related to the action.

<System equipped with means for executing a method for predicting whether or not a target compound has Tcf21 protein-like action>
Another aspect of the present invention is a system comprising means for executing a method for predicting whether a target compound has Tcf21 protein-like activity. The method for predicting whether or not a protein has Tcf21 protein-like activity is as described above.
In this aspect, the means for executing the method preferably includes an input device, a main storage device, an auxiliary storage device, an arithmetic device, an output device, and a control device.

The input device is not particularly limited as long as the structure of the learning compound and/or target compound can be input, and examples thereof include a keyboard, mouse, touch panel, etc. The main storage device is not particularly limited as long as it can capture and store data input through an input device, data stored in an auxiliary storage device, programs, etc., and examples thereof include RAM, ROM, and the like. The auxiliary storage device is not particularly limited as long as it can store data, programs, etc., and includes, for example, a hard disk drive, an optical disk, an SSD, and the like. The control device is not particularly limited as long as it can control the arithmetic device and the like according to the program stored in the main storage device. The output device is not particularly limited as long as it can display the results calculated by the calculation device, and examples thereof include a display.

A system including the above-mentioned means, for example, imports structural data inputted by an input device and a program for creating a molecular descriptor, a predictive model, a predictive result, etc. related to the action from the structural data into the main memory. The data and program can be stored in a computer, loaded into an arithmetic device, operated on based on arithmetic instructions sent from a control device, and returned to the main storage device and outputted by an output device.

<A program for executing a method for predicting whether a target compound has a Tcf21 protein-like action, and a recording medium on which the program is recorded>
Another aspect of the present invention is a program for executing a method for predicting whether a target compound has a Tcf21 protein-like action, and a recording medium on which the program is recorded. The method for predicting whether or not a protein has Tcf21 protein-like activity is as described above.
The program is not particularly limited as long as it can execute the above method. In this aspect, the program includes CD (Compact Disc)-ROM, CD-R, CD-RW, DVD (Digital Versatile Disc), DVD-RAM, BD (Blu-ray (registered trademark) Disc), MO (Magneto Optical disc). ), SSD, magnetic tape, various memory cards (USB flash memory, SD memory card, etc.), etc., are stored in computer-readable storage media, or are provided in the form of downloads from cloud computers, etc. It is also possible to store the program in an auxiliary storage device of a computer connected via a network, and to transfer the program to another computer via the network.

<Pharmaceutical composition>
One aspect of the present invention provides muscle fibers in which the molecular descriptors vsurf_DD12, vsurf_HB7, vsurf_IW7, KierA3, PEOE_VSA+2, PEOE_VSA_FPPOS, and SlogP_VSA5 contain as an active ingredient a compound satisfying the following formula (I) and/or (II). A pharmaceutical composition for the prevention or treatment of diseases that can be prevented or treated by deactivating blast cells.
71.344 + 2.358 * vsurf_DD12 + 2.5787 * vsurf_HB7 + 3.529 * vsurf_IW7 < 81.9 ・・・(I)
93.595000 - 14.48520 * KierA3 + 0.50487 * PEOE_VSA+2 + 326.76600 * PEOE_VSA_FPPOS + 0.23285 * SlogP_VSA5 < 98.4 ...(II)

The molecular descriptors vsurf_DD12, vsurf_HB7, vsurf_IW7, KierA3, PEOE_VSA+2, PEOE_VSA_FPPOS, and SlogP_VSA5 are as explained in the above embodiment, and are values calculated from the structure of the compound. That is, the compound satisfying the above formula (I) and/or (II) has a specific structure to have Tcf21 protein-like activity, as explained in the above embodiment.

In the compound, at least one of the molecular descriptors VSA, vol, ASA, ASA ⁺ , and apol is preferably within the following range, and more preferably all of them are within the following range.
376.1≦VSA≦515.7
341.3≦vol≦466.6
597.8≦ASA≦793.0
487.9≦ASA ⁺ ≦646.9
56.6≦apol≦79.5

The molecular descriptor VSA is the surface area of a molecule determined using the commonly used van der Waals radius for each atom.
The molecular descriptor vol is the value obtained by adding the molecular volumes represented by van der Waals spheres of atoms at a lattice spacing of 0.75 Å.
The molecular descriptor ASA is the area of the molecular surface that can be contacted by the surface of a sphere with radius 1.4 Å. Here, a sphere with a radius of 1.4 Å is used as an approximation of a water molecule.
The molecular descriptor ASA ⁺ is the ASA determined for a positively charged atom.
The molecular descriptor apol is the sum of the atomic polarizabilities of all atoms in the molecule.

It is thought that the above compound can control the expression of target genes of Tcf21 protein and Tcf3 protein by binding to the action site of Tcf21 protein.
In order for the compound to bind to the Tcf21 protein action site described above with a certain level of affinity or higher, it is considered preferable that the compound has a certain range of molecular volume (vol) and molecular surface area (VSA). In addition, in order to interact with the Tcf3 protein and the DNA of the target gene, the molecular surface must be exposed to the solvent (that is, ASA is above a certain level), and the surface charge (ASA ⁺ ) must be equal to the charge on the Tcf3/DNA surface. It is considered preferable to have a specific range that is complementary to . Furthermore, in order to interact with the Tcf3 protein and DNA through sufficient hydrogen bonding and electrostatic interaction, it is considered preferable that the molecule contains a certain proportion of atomic species with high polarizability (apol). That is, in order for the above compound to bind with sufficient affinity to the Tcf21 protein action site in the Tcf21/Tcf3/DNA complex and to form and maintain a complex with specific chemical and steric characteristics, these five types are required. It is preferable that at least one of the molecular descriptors satisfies the above range, and it is more preferable that all five types of molecular descriptors satisfy the above range.

Another aspect of the present invention is a compound represented by any of the following formulas (1) to (8) (provided that the compound represented by the following formula (1'), (1'') or (2') This is a pharmaceutical composition for the prevention or treatment of diseases that can be prevented or treated by deactivation of myofibroblasts, which contains as an active ingredient a compound (excluding compounds in which the present invention is used) or a pharmaceutically acceptable salt thereof. The compounds represented by formulas (1) to (8) will be explained in order below.

In the above formula (1), the number of nitrogen atoms contained in P ¹ is not particularly limited, but is usually 1 to 5, preferably 1 to 3, and particularly preferably 2.
Further, P ¹ may have an alkyl group having 1 to 3 carbon atoms, or may not have an alkyl group. A preferred alkyl group is a methyl group.
More specifically, P ¹ is preferably one of the following formulas (9a) to (9e).

In the above formula (1), Q ¹ is a 5- or 6-membered alicyclic heterocyclic group containing nitrogen, and may or may not have an -OH group.
Q ¹ may or may not have an unsaturated bond. Preferably, it is a saturated alicyclic heterocyclic group.
The number of nitrogen atoms contained in Q ¹ is not particularly limited, but is usually 1 to 3, preferably 1 to 2, and particularly preferably 1.
The number of --OH groups that Q ¹ has is not particularly limited, but is usually 1 to 3, preferably 1 to 2, and particularly preferably 1.
More specifically, in the above formula (1), Q ¹ is preferably represented by one of the following formulas (10a) to (10c).

In the above formula (1), R ¹ is a substituent represented by the following formula (1a) or (1b).

In the above formula (1a), Sp ¹ is an aliphatic hydrocarbon group having 1 to 4 carbon atoms, and one or more -CH ₂ - of the aliphatic hydrocarbon group may be substituted with -O-. .
Sp ¹ is preferably a methylene group or an oxyalkylene group having 1 to 3 carbon atoms, more preferably a methylene group or an oxyalkylene group represented by -OC ₂ H ₄ - or -OC ₃ H ₆ -, Particularly preferred is an oxyalkylene group represented by -OC ₃ H ₆ -.

Specific examples of the compound represented by the above formula (1) include the following compounds.

Among the above compounds, compounds represented by any of the following formulas (11) to (18) are particularly preferred.

In the above formula (2), P ² is an alicyclic hydrocarbon group having 5 or 6 carbon atoms, and may or may not have an unsaturated bond. Preferably it is a saturated alicyclic hydrocarbon group, more preferably a saturated alicyclic hydrocarbon group having 5 carbon atoms.
^Q2 is hydrogen or a straight chain or branched alkyl group having 1 to 5 carbon atoms, preferably a straight chain or branched alkyl group having 3 to 5 carbon atoms, particularly preferably a straight chain or branched alkyl group having 3 or 4 carbon atoms. Or it is a branched alkyl group.

Specific examples of the compound represented by the above formula (2) include the following compounds.

Further, the compounds represented by formulas (3) to (8) are as follows.

Among the compounds represented by formulas (1) to (8) above, the compound represented by formula (1) is particularly preferred because myofibroblasts tend to be more easily deactivated.

[Diseases that can be prevented or treated by deactivation of myofibroblasts]
Tcf21 protein-like action refers to the action of Tcf3 protein and the action of Tcf21 protein and Tcf3 protein to form a three-dimensional structure that can bind to the DNA of a target gene and form and maintain a complex that can control the function of that gene. Endogenous Tcf3 protein is normally expressed in myofibroblasts, but it has been confirmed that myofibroblasts express Tcf3 protein in order to suitably exert the above effects. It is preferable that there be. That is, the myofibroblasts are preferably myofibroblasts that express Tcf3 protein.
The method for confirming that myofibroblasts express Tcf3 protein is not particularly limited, and conventional methods can be used. For example, known methods for measuring the expression level of mRNA or protein, which is a gene product, can be used. Can be mentioned. It can be inferred that Tcf3 protein is expressed based on the fact that mRNA encoding Tcf3 protein is expressed.

Examples of diseases that can be prevented or treated by deactivating myofibroblasts include the following:

(a) When the myofibroblasts are present in the liver, examples include hepatitis, liver fibrosis, liver cirrhosis, liver cancer, or liver failure due to any of these diseases. Specific examples of hepatitis include viral hepatitis, drug-induced hepatitis, autoimmune hepatitis, alcoholic hepatitis, nonalcoholic steatohepatitis (NASH), and the like. In addition to the diseases that cause hepatitis mentioned above, specific examples of liver fibrosis and cirrhosis include primary biliary cholangitis, primary sclerosing cholangitis, congenital biliary atresia, common bile duct stricture type pancreatitis, and liver cirrhosis. Examples include congestion and metal metabolism abnormalities.

(b) When the myofibroblasts are present in the pancreas, examples include pancreatitis, pancreatic fibrosis, or pancreatic secretory insufficiency due to any of these diseases. Specific examples of pancreatitis include alcoholic pancreatitis, autoimmune pancreatitis; pancreatitis associated with cholelithiasis; pancreatitis secondary to dyslipidemia, and the like. Specific examples of pancreatic fibrosis include the aforementioned diseases that cause pancreatitis, as well as diabetes, pancreatic duct obstruction, and the like. Pancreatic secretory insufficiency may be exocrine pancreatic insufficiency, endocrine pancreatic insufficiency, or both.

(c) When the myofibroblasts are present in the kidney, examples include nephritis, renal fibrosis, glomerulosclerosis, or renal failure due to any of these diseases. Specific examples of nephritis include glomerulonephritis, interstitial nephritis, and the like. Specific examples of renal fibrosis and glomerulosclerosis include, in addition to the aforementioned diseases that cause nephritis, diabetic nephropathy; renal fibrosis associated with urinary tract obstruction, and the like.

(d) When the myofibroblasts are present in the lungs, examples include interstitial pneumonia, pulmonary fibrosis, or respiratory failure due to any of these diseases. Specific examples of interstitial pneumonia and pulmonary fibrosis include idiopathic interstitial pneumonia; interstitial pneumonia associated with collagen disease; bacterial pneumonia, viral pneumonia, drug-induced pneumonia, radiation pneumonia, and asbestos lung disease; Examples include interstitial pneumonia caused by toxic substances in the environment.

(e) When the myofibroblasts are present in the heart, examples include fibrosis after myocardial infarction; myocarditis or cardiomyopathy; or heart failure due to any of these diseases. Specific examples of myocarditis include viral myocarditis, drug-induced myocarditis, and the like. Cardiomyopathy may be idiopathic cardiomyopathy or secondary cardiomyopathy.

(f) When the myofibroblasts are present in the coronary artery, coronary artery stenosis due to atherosclerosis, coronary artery restenosis after balloon dilation, or coronary artery restenosis after stent placement, or any of these. Examples include ischemic heart disease caused by these diseases.

(a1) Since the pharmaceutical composition according to this aspect has an anti-fibrotic effect on the liver, when the myofibroblasts are present in the liver, the pharmaceutical composition for anti-fibrotic liver, It can be used as a pharmaceutical composition for improving liver function.
For example, subjects to whom the pharmaceutical composition according to the present embodiment has been administered have lower serum ALT and AST values, which are indicators of liver function, than subjects to which the pharmaceutical composition has not been administered.
At this time, the ALT of the subject to whom the pharmaceutical composition according to the present embodiment has been administered is preferably 0.7 or less, more preferably 0.6 or less, and even more preferably 0.5 or less, with ALT of the subject not administered as 1. On the other hand, the lower limit is not particularly limited, but is, for example, 0.1 or more.
Further, the AST of the subject to whom the pharmaceutical composition according to the present embodiment has been administered is preferably 0.7 or less, more preferably 0.6 or less, and even more preferably 0.5 or less, with the AST of the subject not administered being 1. On the other hand, the lower limit is not particularly limited, but is, for example, 0.1 or more.

(b1) Since the pharmaceutical composition according to this aspect has an anti-fibrotic effect on the pancreas, when the myofibroblasts are present in the pancreas, the pharmaceutical composition for pancreatic anti-fibrosis, It can be used as a pharmaceutical composition for improving pancreatic function.
For example, subjects to whom the pharmaceutical composition according to the present embodiment has been administered have lower serum levels of amylase, elastase, and lipase, which are indicators of pancreatic function, than subjects to which the pharmaceutical composition has not been administered.
At this time, the amylase of the subject to whom the pharmaceutical composition according to the present embodiment has been administered is preferably 0.7 or less, more preferably 0.6 or less, and still more preferably 0.5 or less, with the amylase of the subject not administered being 1. On the other hand, the lower limit is not particularly limited, but is, for example, 0.1 or more.
Further, the elastase of the subject to whom the pharmaceutical composition according to the present embodiment has been administered is preferably 0.7 or less, more preferably 0.6 or less, and even more preferably 0.5 or less, with elastase of the subject not administered being 1. On the other hand, the lower limit is not particularly limited, but is, for example, 0.1 or more.
Similarly, the lipase of a subject to whom the pharmaceutical composition according to the present embodiment has been administered is preferably 0.7 or less, more preferably 0.6 or less, and even more preferably 0.5 or less, with the lipase of a subject not administered as 1. On the other hand, the lower limit is not particularly limited, but is, for example, 0.1 or more.

(c1) Since the pharmaceutical composition according to this embodiment has an anti-fibrotic effect on the kidney, when the myofibroblasts are present in the kidney, the pharmaceutical composition for anti-fibrosis on the kidney, It can be used as a pharmaceutical composition for improving renal function.
For example, subjects to whom the pharmaceutical composition according to the present embodiment has been administered have lower values of serum urea nitrogen, creatinine, and glomerular filtration rate, which are indicators of renal function, than subjects to which the pharmaceutical composition has not been administered.
At this time, the urea nitrogen of the subject to whom the pharmaceutical composition according to the present embodiment has been administered is preferably 0.7 or less, more preferably 0.6 or less, and even more preferably 0.5 or less, with the urea nitrogen of the subject not administered being 1. . On the other hand, the lower limit is not particularly limited, but is, for example, 0.1 or more.
Furthermore, the creatinine of the subject to whom the pharmaceutical composition according to the present embodiment has been administered is preferably 0.7 or less, more preferably 0.6 or less, and still more preferably 0.5 or less, with creatinine of the subject not administered as 1. On the other hand, the lower limit is not particularly limited, but is, for example, 0.1 or more.
Similarly, the glomerular filtration rate of a subject to whom the pharmaceutical composition according to the present embodiment has been administered is preferably 0.7 or less, more preferably 0.6 or less, and even more preferably It is 0.5 or less. On the other hand, the lower limit is not particularly limited, but is, for example, 0.1 or more.

(d1) Since the pharmaceutical composition according to this aspect has an anti-fibrotic effect on the lungs, when the myofibroblasts are present in the lungs, the pharmaceutical composition for anti-fibrotic lungs, It can be used as a pharmaceutical composition for improving lung function.
For example, subjects to whom the pharmaceutical composition according to the present embodiment has been administered have higher values of oxygen partial pressure in arterial blood, oxygen saturation, and vital capacity, which are indicators of lung function, than subjects to which the pharmaceutical composition has not been administered.
At this time, the arterial blood oxygen partial pressure of the subject to whom the pharmaceutical composition according to the present embodiment has been administered is preferably 1.1 or more, more preferably 1.3 or more, with the arterial blood oxygen partial pressure of the subject not administered being 1. Preferably it is 1.5 or more. On the other hand, the upper limit is not particularly limited, but is, for example, 3.0 or less.
Further, the arterial blood oxygen saturation of the subject to whom the pharmaceutical composition according to the present embodiment has been administered is preferably 1.1 or more, more preferably 1.3 or more, and even more preferably is greater than or equal to 1.5. On the other hand, the upper limit is not particularly limited, but is, for example, 3.0 or less.
Similarly, the lung capacity of the subject to whom the pharmaceutical composition according to the present embodiment is administered is preferably 1.1 or more, more preferably 1.3 or more, and even more preferably 1.5 or more, with the lung capacity of the subject not administered being 1. On the other hand, the upper limit is not particularly limited, but is, for example, 3.0 or less.

(e1) Since the pharmaceutical composition according to this aspect has a cardiac anti-fibrotic effect, when the myofibroblasts are present in the heart, the pharmaceutical composition for cardiac anti-fibrosis, It can be used as a pharmaceutical composition for improving cardiac function.
For example, subjects to whom the pharmaceutical composition according to the present embodiment has been administered have lower values of CPK, troponin, and BNP in serum, which are indicators of cardiac function, than subjects to which the pharmaceutical composition has not been administered.
At this time, the CPK of the subject to whom the pharmaceutical composition according to the present embodiment has been administered is preferably 0.7 or less, more preferably 0.6 or less, and even more preferably 0.5 or less, with the CPK of the subject not administered being 1. On the other hand, the lower limit is not particularly limited, but is, for example, 0.1 or more.
Further, the troponin of the subject to whom the pharmaceutical composition according to the present embodiment has been administered is preferably 0.7 or less, more preferably 0.6 or less, and even more preferably 0.5 or less, with troponin of the subject not administered being 1. On the other hand, the lower limit is not particularly limited, but is, for example, 0.1 or more.
Similarly, the BNP of a subject to whom the pharmaceutical composition according to the present embodiment has been administered is preferably 0.7 or less, more preferably 0.6 or less, and even more preferably 0.5 or less, with BNP of a subject not administered as 1. On the other hand, the lower limit is not particularly limited, but is, for example, 0.1 or more.

(f1) Since the pharmaceutical composition according to this aspect has an anti-atherosclerotic effect on coronary arteries, when the myofibroblasts are present in the coronary arteries, the pharmaceutical composition for anti-atherosclerotic coronary arteries It can also be used as a pharmaceutical composition for improving coronary blood flow.
For example, subjects to whom the pharmaceutical composition according to the present embodiment is administered have expanded coronary artery inner diameter, which is an index of coronary artery atherosclerosis and coronary artery blood flow, compared to subjects to which it has not been administered.
At this time, the inner diameter of the coronary artery of the subject to whom the pharmaceutical composition according to the present embodiment has been administered is preferably 10 or more, more preferably 50 or more, and even more preferably 100 or more, with the coronary artery inner diameter of the subject to which it has not been administered being 1. . On the other hand, the upper limit is not particularly limited, but is, for example, 1,000 or less.

[Usage mode of pharmaceutical composition]
The pharmaceutical composition according to this embodiment is usually used by formulating it with a physiologically acceptable liquid or solid pharmaceutical carrier.
The dosage form of the pharmaceutical composition according to this embodiment is not particularly limited, and specific examples include tablets, granules, powders, sugar-coated tablets, capsules, liquids, suspensions, emulsions, and injections. In addition, during formulation, excipients, binders, disintegrating agents, lubricants, stabilizers, flavoring agents, diluents, surfactants, or solvents for injections, which are commonly used as pharmaceutical carriers, may be added. Liposomes, exosomes, and the like can be used as agents and as means of delivery to target cells.

The dosage of the pharmaceutical composition according to this embodiment can be appropriately selected depending on the dosage form, usage, age, sex, body weight of the subject, type of disease, degree of disease, symptoms, administration route, administration schedule, formulation form, etc.
The dosage of the pharmaceutical composition according to this embodiment is, for example, 0.001 mg/kg or more, 0.01 mg/kg or more, or 0.1 mg/kg or more as a total amount of the compound, while preferably It is 1,000 mg/kg or less, more preferably 500 mg/kg or less, even more preferably 100 mg/kg or less.

Administration routes include oral administration and intrarectal injection, and examples of injection include subcutaneous injection, intramuscular injection, peripheral intravenous injection, intrahepatic artery injection, intracoronary artery injection, and intraperitoneal injection. , but not necessarily limited to these.

The timing of administration of the pharmaceutical composition according to this embodiment is not particularly limited, and the timing of administration can be appropriately selected according to the method of prevention or treatment of the target disease. It may also be administered prophylactically or used for maintenance therapy. Further, the dosage form is preferably determined depending on the formulation, the age, sex, and other conditions of the subject, the severity of the subject's symptoms, and the like. In any case, the pharmaceutical composition according to this aspect can be administered once a day or divided into multiple doses, or may be administered once every few days or weeks. Furthermore, irregular administration may be performed while evaluating the therapeutic effect.

[Tcf3 protein and/or polynucleotide encoding it]
The pharmaceutical composition according to this embodiment can be used in combination with a composition containing the Tcf3 protein and/or a polynucleotide encoding it. A composition comprising the Tcf3 protein and/or a polynucleotide encoding it is preferably a pharmaceutical composition.
As described in the Background section, Tcf21 protein forms a dimer with Tcf3 protein, which belongs to the same basic helix-loop-helix (bHLH) transcription factor family, and controls the expression of target genes by binding to DNA. . Endogenous Tcf3 protein is normally expressed in myofibroblasts, and it is expected that the myofibroblasts will be further deactivated by further expressing Tcf3 protein.

The Tcf3 protein is preferably a Tcf3 protein derived from the subject to be administered.

For example, the amino acid sequence of mouse Tcf3 protein can be used as a reference. If the amino acid sequence of the Tcf3 protein of interest has been identified, it can be determined by comparing the amino acid sequence of mouse Tcf3 protein with the Tcf3 protein of interest.
For example, there is a protein consisting of an amino acid sequence corresponding to the amino acid sequence of the mouse Tcf3 protein specified by NCBI accession No. NP_001157619.1, but in addition to this protein, there is also a protein consisting of an amino acid sequence corresponding to the amino acid sequence of the mouse Tcf3 protein specified by NCBI accession No. It may be a protein consisting of an amino acid sequence corresponding to any amino acid sequence of a protein.
In addition, when the subject is a mouse, the above-mentioned "amino acid sequence corresponding to the amino acid sequence of the mouse Tcf3 protein specified by NCBI accession No. NP_001157619.1" refers to the "amino acid sequence corresponding to the amino acid sequence of the mouse Tcf3 protein specified by NCBI accession No. The above-mentioned "amino acid sequence corresponding to any amino acid sequence of the mouse Tcf3 protein specified by the NCBI accession No. described below" may be "the amino acid sequence of the mouse Tcf3 protein specified by the NCBI accession No. described later". It may be any amino acid sequence of the mouse Tcf3 protein specified by No.

If the target is a mouse, for example, the mouse Tcf3 protein identified by NCBI accession No. NP_001157619.1, the mouse Tcf3 protein identified by NCBI accession No. NP_001157620.1, or the mouse Tcf3 protein identified by NCBI accession No. NP_001157621.1. Mouse Tcf3 protein identified by NCBI accession No. NP_001157622.1, Mouse Tcf3 protein identified by NCBI accession No. NP_001157623.1, Mouse Tcf3 protein identified by NCBI accession No. NP_001157624.1 , Mouse Tcf3 protein identified by NCBI accession No. NP_001157625.1, Mouse Tcf3 protein identified by NCBI accession No. NP_035678.3, Mouse Tcf3 protein identified by NCBI accession No. NP_001365832.1, NCBI accession No. Mouse Tcf3 protein identified by NP_001365833.1, Mouse Tcf3 protein identified by NCBI accession No. NP_001365834.1, Mouse Tcf3 protein identified by NCBI accession No. NP_001365837.1, Mouse Tcf3 protein identified by NCBI accession No. NP_001365839.1 Examples include mouse Tcf3 protein identified by NCBI accession No. NP_001365841.1, mouse Tcf3 protein identified by NCBI accession No. NP_001365842.1, and mouse Tcf3 protein identified by NCBI accession No. NP_001365843.1.

If the subject is a human, for example, human Tcf3 protein identified by NCBI accession No. NP_003191.1, human Tcf3 protein identified by NCBI accession No. NP_001129611.1, human Tcf3 protein identified by NCBI accession No. NP_001338707.1 Examples include human Tcf3 protein identified by NCBI accession No. NP_001338708.1.

When the target is a rat, examples include rat Tcf3 protein specified by NCBI accession No. NP_598208.2, rat Tcf3 protein specified by NCBI accession No. NP_001030314.1, etc.

If the target is a dog, for example, canine Tcf3 protein estimated by NCBI accession No. XP_038285196.1, dog Tcf3 protein estimated by NCBI accession No. Canine Tcf3 protein estimated by NCBI accession No. XP_038285201.1, Canine Tcf3 protein estimated by NCBI accession No. XP_038285202.1, Canine Tcf3 protein estimated by NCBI accession No. , Canine Tcf3 protein estimated by NCBI accession No. XP_038285204.1, Canine Tcf3 protein estimated by NCBI accession No. XP_038285205.1, Canine Tcf3 protein estimated by NCBI accession No. Examples include canine Tcf3 protein estimated by XP_038285207.1 and canine Tcf3 protein estimated by NCBI accession No. XP_038285211.1.

If the target is a cat, for example, cat Tcf3 protein estimated by NCBI accession No. XP_023098869.1, cat Tcf3 protein estimated by NCBI accession No. Feline Tcf3 protein estimated by NCBI accession No. XP_023098881.1, Feline Tcf3 protein estimated by NCBI accession No. , Feline Tcf3 protein estimated according to NCBI accession No. XP_023098902.1, Feline Tcf3 protein estimated according to NCBI accession No. Examples include cat Tcf3 protein estimated by XP_023098928.1 and cat Tcf3 protein estimated by NCBI accession No. XP_023098955.1.

When the target is a cow, examples include the bovine Tcf3 protein specified by NCBI accession No. NP_001179627.1.

If the target is a horse, for example, horse Tcf3 protein estimated by NCBI accession No. XP_023502072.1, horse Tcf3 protein estimated by NCBI accession No. Equine Tcf3 protein estimated by NCBI accession No. XP_023502075.1, Equine Tcf3 protein estimated by NCBI accession No. XP_023502076.1, Equine Tcf3 protein estimated by NCBI accession No. , horse Tcf3 protein estimated according to NCBI accession No. XP_023502079.1, and horse Tcf3 protein estimated according to NCBI accession No. XP_023502080.1.

If the target is a goat, for example, goat Tcf3 protein estimated by NCBI accession No. XP_017905900.1, goat Tcf3 protein estimated by NCBI accession No. Goat Tcf3 protein estimated according to NCBI accession No. XP_017905903.1, goat Tcf3 protein estimated according to NCBI accession No. XP_017905904.1, etc.

If the target is sheep, for example, sheep Tcf3 protein estimated by NCBI accession No. XP_027826020.1, sheep Tcf3 protein estimated by NCBI accession No. Sheep Tcf3 protein estimated by NCBI accession No. XP_027826023.1, Sheep Tcf3 protein estimated by NCBI accession No. , sheep Tcf3 protein estimated in NCBI accession No. XP_027826026.1.

When the target is a pig, examples include the pig Tcf3 protein specified by NCBI accession No. ALS88204.1, the pig Tcf3 protein specified by NCBI accession No. ALS88207.1, and the like.

When the target is chicken, examples include chicken Tcf3 protein specified by NCBI accession No. NP_989817.2.

Furthermore, as mentioned above, the Tcf3 protein can have the following embodiments based on the amino acid sequence corresponding to the amino acid sequence of the mouse Tcf3 protein specified in NCBI accession No. NP_001157619.1.
When introduced into myofibroblasts, Tcf21 and Tcf3 proteins bind to the DNA of their target genes, forming a three-dimensional structure that allows them to form and maintain a complex that can control the function of that gene. There is no particular restriction as long as myofibroblasts are further deactivated, but the amino acid sequence corresponding to the amino acid sequence of the mouse Tcf3 protein specified in NCBI accession No. NP_001157619.1 is not limited to the same sequence; An amino acid sequence having an identity of 80% or more, preferably 85% or more, more preferably 90% or more, still more preferably 95% or more, with the amino acid sequence corresponding to the amino acid sequence of the mouse Tcf3 protein specified by NP_001157619.1. It may be a protein consisting of

In addition, one or more amino acids are substituted or deleted, or one or more amino acids are inserted or added in the amino acid sequence corresponding to the amino acid sequence of the mouse Tcf3 protein specified in NCBI accession No. NP_001157619.1. It may also be a protein consisting of a different amino acid sequence. Note that 1 to a plurality of numbers is preferably 1 to 65, more preferably 1 to 30, and still more preferably 10. The same applies when amino acids are added to the N-terminal side and/or the C-terminal side.
The same holds true when other mouse Tcf3 proteins mentioned above are used as standards.

When the target is a mouse and the mouse Tcf3 protein specified by NCBI accession No. NP_001157619.1 is taken as an example, the following embodiment can be adopted.
When introduced into myofibroblasts, Tcf21 and Tcf3 proteins bind to the DNA of their target genes, forming a three-dimensional structure that allows them to form and maintain a complex that can control the function of that gene. The amino acid sequence of the mouse Tcf3 protein specified in NCBI accession No. NP_001157619.1 is not limited to the same sequence as long as the myofibroblasts are further deactivated, but It may be a protein consisting of an amino acid sequence having an identity of 80% or more, preferably 85% or more, more preferably 90% or more, even more preferably 95% or more with the amino acid sequence of the specified mouse Tcf3 protein.

In addition, the amino acid sequence of the mouse Tcf3 protein specified in NCBI accession No. NP_001157619.1 consists of an amino acid sequence in which one or more amino acids are substituted or deleted, or one or more amino acids are inserted or added. It may also be a protein. Note that 1 to a plurality of numbers is preferably 1 to 65, more preferably 1 to 30, and still more preferably 10. The same applies when amino acids are added to the N-terminal side and/or the C-terminal side.
This also applies to other mouse Tcf3 proteins that have been described.

When the subject is a human, the human Tcf3 protein specified by NCBI accession No. NP_003191.1 can be cited as an example, and the above explanation is the same when the subject is a mouse. This also applies to other human Tcf3 proteins that have been described.
When the subject is a rat, an example can be rat Tcf3 protein specified by NCBI accession No. NP_598208.2, and the same as the above explanation when the subject is a mouse. This also applies to other rat Tcf3 proteins that have been described.
When the subject is a dog, the canine Tcf3 protein estimated in NCBI accession No. This also applies to other previously described canine Tcf3 proteins.
When the subject is a cat, an example can be the cat Tcf3 protein estimated in NCBI accession No. XP_023098869.1, and the same as the above explanation when the subject is a mouse. This also applies to other cat Tcf3 proteins that have been described.
When the subject is a cow, the bovine Tcf3 protein specified by NCBI accession No. NP_001179627.1 can be cited as an example, and the above explanation is the same when the subject is a mouse. This also applies to other previously described bovine Tcf3 proteins.
When the subject is a horse, the horse Tcf3 protein estimated in NCBI accession No. This also applies to other horse Tcf3 proteins that have been described.
When the subject is a goat, the goat Tcf3 protein estimated in NCBI accession No. This also applies to other goat Tcf3 proteins that have been described.
When the subject is a sheep, the sheep Tcf3 protein estimated in NCBI accession No. This also applies to other sheep Tcf3 proteins that have already been described.
When the target is a pig, an example can be taken of the pig Tcf3 protein specified by NCBI accession No. ALS88204.1, and the same as the above explanation when the target is a mouse. This also applies to other previously described porcine Tcf3 proteins.
When the subject is a chicken, the chicken Tcf3 protein specified by NCBI accession No. NP_989817.2 can be cited as an example, and the above explanation is the same when the subject is a mouse. This also applies to other previously described chicken Tcf3 proteins.

Conservative substitutions are preferred, and conservative substitutions include between Phe, Trp, and Tyr when the substitution site is an aromatic amino acid, and between Leu, Ile, and Tyr when the substitution site is a hydrophobic amino acid. Between Val, between Gln and Asn for polar amino acids, between Lys, Arg, and His for basic amino acids, and between Asp and Glu for acidic amino acids. In the case of an amino acid having a group, this refers to mutual substitution between Ser and Thr.
Specifically, conservative substitutions include Ala to Ser or Thr, Arg to Gln, His, or Lys, Asn to Glu, Gln, Lys, His, or Asp, Asp to Asn, Substitution of Glu or Gln, substitution of Cys with Ser or Ala, substitution of Gln with Asn, Glu, Lys, His, Asp or Arg, substitution of Glu with Gly, Asn, Gln, Lys or Asp, substitution of Gly with Substitution of Pro, substitution of His with Asn, Lys, Gln, Arg or Tyr, substitution of Ile with Leu, Met, Val or Phe, substitution of Leu with Ile, Met, Val or Phe, substitution of Lys with Asn, Substitution of Glu, Gln, His or Arg, Substitution of Met with Ile, Leu, Val or Phe, Substitution of Phe with Trp, Tyr, Met, Ile or Leu, Substitution of Ser with Thr or Ala, Substitution of Thr Examples include, but are not limited to, substitutions of Ser or Ala, Trp with Phe or Tyr, Tyr with His, Phe or Trp, and Val with Met, Ile or Leu.

The Tcf3 protein may be modified. Such modifications include amidation, addition of lipid chains (aliphatic acylation (palmitoylation, myristoylation, etc.), prenylation (farnesylation, geranylgeranylation, etc.), etc.), phosphorylation (serine residue, threonine residue, Examples include, but are not limited to, phosphorylation at tyrosine residues, etc.), acetylation, and addition of sugar chains (N-glycosylation, O-glycosylation).

The Tcf3 protein may have an amino acid sequence added to it for selective delivery to organs and tissues including myofibroblasts. For example, such an amino acid sequence includes the amino acid sequence described in Nature Communications 3:951 doi: 10.1038/ncomms1952.2012 Kondo E et al.

As a method for producing Tcf3 protein, for example, a recombinant expression vector can be constructed using a polynucleotide encoding the Tcf3 protein described below, introduced into a host, expressed, and purified. Alternatively, it may be synthesized artificially. In either case, a known method can be used.

The polynucleotide encoding Tcf3 protein is not particularly limited as long as it produces Tcf3 protein and exhibits the same effect as Tcf3 protein when introduced into myofibroblasts.
Furthermore, the base sequence of the polynucleotide encoding the Tcf3 protein may be a base sequence that includes an untranslated region, as long as the Tcf3 protein is produced when introduced into myofibroblasts, or a base sequence that includes an untranslated region. It may be a base sequence (for example, a cDNA sequence encoding Tcf3 protein, etc.) that does not exist.
Those skilled in the art at the time of filing this application can easily understand that the base sequence of the polynucleotide encoding the Tcf3 protein can be determined based on the above-mentioned amino acid sequence of the Tcf3 protein.

The polynucleotide encoding the Tcf3 protein is preferably a polynucleotide encoding the amino acid sequence of the Tcf3 protein derived from the subject to be administered.

For example, as the Tcf3 protein, an amino acid sequence corresponding to the amino acid sequence of the mouse Tcf3 protein specified by NCBI accession No. NP_001157619.1 can be used as a reference. In this case, a polynucleotide encoding an amino acid sequence corresponding to the amino acid sequence of mouse Tcf3 protein specified by NCBI accession No. NP_001157619.1 may be mentioned.
In addition, when the subject is a mouse, the above-mentioned "amino acid sequence corresponding to the amino acid sequence of the mouse Tcf3 protein specified by NCBI accession No. NP_001157619.1" refers to the "amino acid sequence corresponding to the amino acid sequence of the mouse Tcf3 protein specified by NCBI accession No. The amino acid sequence of the mouse Tcf3 protein may be the amino acid sequence of the mouse Tcf3 protein.

When the subject is a mouse, and the Tcf3 protein is the mouse Tcf3 protein specified by NCBI accession No. NP_001157619.1, the polynucleotide encoding it is, for example, the mouse Tcf3 protein specified by NCBI accession No. NP_001157619.1. Examples include the polynucleotide specified by NM_001164147.2.

If the subject is a human, and the Tcf3 protein is the human Tcf3 protein specified in NCBI accession No. NP_003191.1, the polynucleotide encoding it is, for example, the human Tcf3 protein specified in NCBI accession No. NP_003191.1. Examples include the polynucleotide specified by NM_003200.5.

When the subject is a rat, and the Tcf3 protein is the rat Tcf3 protein specified by NCBI accession No. NP_598208.2, the polynucleotide encoding it is, for example, the rat Tcf3 protein specified by NCBI accession No. NP_598208.2. Examples include the polynucleotide specified by NM_133524.2.

If the subject is a dog, and the Tcf3 protein is the canine Tcf3 protein estimated in NCBI accession No. The polynucleotide deduced by XM_038429268.1 is included.

When the subject is a cat, for example, if the Tcf3 protein is the feline Tcf3 protein estimated in NCBI accession No. The polynucleotide deduced by XM_023243101.1 is included.

If the target is a cow, and the Tcf3 protein is the bovine Tcf3 protein specified in NCBI accession No. NP_001179627.1, the polynucleotide encoding it is, for example, the bovine Tcf3 protein specified in NCBI accession No. NP_001179627.1. Examples include the polynucleotide specified by NM_001192698.1.

If the subject is a horse, and the Tcf3 protein is estimated to be the horse Tcf3 protein according to NCBI accession No. The polynucleotide deduced by XM_023646304.1 is included.

When the target is a goat, for example, if the Tcf3 protein is the goat Tcf3 protein estimated in NCBI accession No. The polynucleotide deduced by XM_018050411.1 is included.

When the target is sheep, for example, if the Tcf3 protein is the sheep Tcf3 protein estimated in NCBI accession No. The polynucleotide deduced by XM_027970219.1 is included.

If the subject is a pig, and the Tcf3 protein is the pig Tcf3 protein specified in NCBI accession No. ALS88204.1, the polynucleotide encoding it is, for example, the one specified in NCBI accession No. ALS88204.1. Examples include the polynucleotide specified by KR818872.1.

When the target is a chicken, the polynucleotide encoding the Tcf3 protein is, for example, the chicken Tcf3 protein specified in NCBI accession No. NP_989817.2. Examples include the polynucleotide specified by NM_204486.2.

Furthermore, as mentioned above, the amino acid sequence corresponding to the amino acid sequence of the Tcf3 protein specified in NCBI accession No. NP_001157619.1 is not limited to the same sequence, but also the amino acid sequence of the Tcf3 protein specified in NCBI accession No. NP_001157619.1. According to this, it may be a protein consisting of an amino acid sequence having an identity of 80% or more, preferably 85% or more, more preferably 90% or more, even more preferably 95% or more with the amino acid sequence corresponding to the sequence. , the base sequence of the polynucleotide may be designed.
Furthermore, as mentioned above, the amino acid sequence corresponding to the amino acid sequence of the Tcf3 protein specified in NCBI accession No. NP_001157619.1 is not limited to the same sequence, but also the amino acid sequence of the Tcf3 protein specified in NCBI accession No. NP_001157619.1. According to this, the protein may consist of an amino acid sequence in which one or more amino acids are substituted or deleted, or one or more amino acids are inserted or added in the amino acid sequence corresponding to the sequence. The base sequence of the polynucleotide may be designed.
The same holds true when other mouse Tcf3 proteins mentioned above are used as standards.

In addition, as mentioned above, when the target is a mouse, the mouse Tcf3 protein specified by NCBI accession No. NP_001157619.1 is not limited to the same sequence, but has at least 80%, preferably 85%, of the amino acid sequence of the same protein. % or more, more preferably 90% or more, still more preferably 95% or more, the base sequence of the polynucleotide may be designed accordingly.
In addition, as mentioned above, when the target is a mouse, the mouse Tcf3 protein specified by NCBI accession No. NP_001157619.1 is not limited to the same sequence, but has one or more amino acids in the amino acid sequence of the same protein. Since the polynucleotide may be a protein consisting of an amino acid sequence in which the polynucleotide has been substituted or deleted, or one or more amino acids have been inserted or added, the base sequence of the polynucleotide may be designed accordingly.
This also applies to other mouse Tcf3 proteins mentioned above.

When the subject is a human, the human Tcf3 protein specified in NCBI accession No. NP_003191.1 can be used as a reference, and the same as the above explanation when the subject is a mouse. This also applies when other previously mentioned human Tcf3 proteins are used as a standard.

When the subject is a rat, the rat Tcf3 protein specified by NCBI accession No. NP_598208.2 can be cited as a reference, and the same as the above explanation when the subject is a mouse. This also applies when other previously mentioned rat Tcf3 proteins are used as a standard.

If the subject is a dog, the canine Tcf3 protein estimated in NCBI accession No. This also applies when other previously described canine Tcf3 proteins are used as a standard.

If the subject is a cat, the feline Tcf3 protein estimated in NCBI accession No. This also applies when other cat Tcf3 proteins mentioned above are used as a standard.

When the subject is a cow, the bovine Tcf3 protein specified by NCBI accession No. NP_001179627.1 can be cited as a standard, and the same as the above explanation when the subject is a mouse. This also applies when other bovine Tcf3 proteins are used as standards.

If the subject is a horse, the horse Tcf3 protein estimated in NCBI accession No. This also applies when other horse Tcf3 proteins mentioned above are used as a standard.

If the target is a goat, the goat Tcf3 protein estimated in NCBI accession No. This also applies when other goat Tcf3 proteins mentioned above are used as a standard.

If the target is a sheep, the sheep Tcf3 protein estimated in NCBI accession No. This also applies when other sheep Tcf3 proteins mentioned above are used as a standard.

If the target is a pig, the pig Tcf3 protein specified by NCBI accession No. ALS88204.1 can be cited as a reference, and the same as the above explanation when the target is a mouse. This also applies when other previously described porcine Tcf3 proteins are used as a standard.

When the target is a chicken, the chicken Tcf3 protein specified by NCBI accession No. NP_989817.2 can be used as a reference, and the same as the above explanation when the target is a mouse. This also applies when other chicken Tcf3 proteins are used as standards.

The composition containing the Tcf3 protein and/or the polynucleotide encoding it is preferably a pharmaceutical composition, and is usually used by formulating it with a physiologically acceptable liquid or solid pharmaceutical carrier.
Descriptions regarding the dosage form, additives for formulation, means of delivery to target cells, route of administration, timing of administration, and mode of administration of the composition containing the Tcf3 protein and/or the polynucleotide encoding it are included in this aspect. Reference is made to the explanations previously given for such pharmaceutical compositions. Note that the composition containing the Tcf3 protein and/or the polynucleotide encoding it may be administered simultaneously with the pharmaceutical composition according to this embodiment, may be administered sequentially, or may be administered at intervals. good.

The dosage of the composition containing the Tcf3 protein and/or the polynucleotide encoding it depends on the dosage form, usage, subject's age, sex, body weight, type of disease, degree of disease, symptoms, administration route, administration schedule, formulation, etc. It can be selected as appropriate depending on the form, etc.
The amount of Tcf3 protein to be administered is, for example, 0.1 mg/kg or more, 1 mg/kg or more, or 10 mg/kg or more in terms of body weight, while preferably 1,000 mg/kg or less, more preferably 1,000 mg/kg or less. is 500 mg/kg or less, more preferably 100 mg/kg or less.
The amount when administering the polynucleotide encoding the Tcf3 protein is, for example, 1×10 ¹⁰ viral genome/kg or more, 1×10 ¹¹ viral genome/kg in terms of the amount of adeno-associated virus genome based on body weight. or 1×10 ¹² viral genomes/kg or more, while preferably 1×10 ¹⁶ viral genomes/kg or less, more preferably 1×10 ¹⁵ viral genomes/kg or less, and even more preferably 1×10 ¹⁴ Virus genome/kg or less.

Specific forms of Tcf3 protein include, for example, liposomes and exosomes containing Tcf3 protein. Specific forms of the polynucleotide encoding the Tcf3 protein include, for example, expression vectors, adeno-associated viruses, and the like containing the polynucleotide encoding the Tcf3 protein.

The pharmaceutical composition according to this embodiment may be administered alone or in combination with other pharmaceutical compositions or drugs. Furthermore, even when used in combination with a composition containing the Tcf3 protein and/or a polynucleotide encoding it, it may be used in combination with other pharmaceutical compositions or drugs.

<Method for deactivating myofibroblasts>
One aspect of the present invention is to use a compound in which the molecular descriptors vsurf_DD12, vsurf_HB7, vsurf_IW7, KierA3, PEOE_VSA+2, PEOE_VSA_FPPOS, and SlogP_VSA5 satisfy the following formulas (I) and/or (II) to generate myofibroblast cells. A method for deactivating myofibroblasts, comprising the step of treating.
71.344 + 2.358 * vsurf_DD12 + 2.5787 * vsurf_HB7 + 3.529 * vsurf_IW7 < 81.9 ・・・(I)
93.595000 - 14.48520 * KierA3 + 0.50487 * PEOE_VSA+2 + 326.76600 * PEOE_VSA_FPPOS + 0.23285 * SlogP_VSA5 < 98.4 ...(II)

Regarding compounds whose molecular descriptors vsurf_DD12, vsurf_HB7, vsurf_IW7, KierA3, PEOE_VSA+2, PEOE_VSA_FPPOS, and SlogP_VSA5 satisfy formula (I) and/or (II), the content described in the above embodiment is incorporated. Therefore, in the deactivation method according to this embodiment, the pharmaceutical composition according to the above embodiment can be used as the compound. In this case, the content described in the above-mentioned aspect is used for the specific usage mode, etc.
Further, in the compound, at least one of the molecular descriptors VSA, vol, ASA, ASA ⁺ and apol is preferably within the following range, and more preferably all of them are within the following range.
376.1≦VSA≦515.7
341.3≦vol≦466.6
597.8≦ASA≦793.0
487.9≦ASA ⁺ ≦646.9
56.6≦apol≦79.5

[Myofibroblasts]
Tcf21 protein-like action refers to the action of Tcf3 protein and the action of Tcf21 protein and Tcf3 protein to form a three-dimensional structure that can bind to the DNA of a target gene and form and maintain a complex that can control the function of that gene. Endogenous Tcf3 protein is normally expressed in myofibroblasts, but it has been confirmed that myofibroblasts express Tcf3 protein in order to suitably exert the above effects. It is preferable that there be. That is, the myofibroblasts are preferably myofibroblasts that express Tcf3 protein.
The method for confirming that myofibroblasts express Tcf3 protein is not particularly limited, and conventional methods can be used. For example, known methods for measuring the expression level of mRNA or protein, which is a gene product, can be used. Can be mentioned. It can be inferred that Tcf3 protein is expressed based on the fact that mRNA encoding Tcf3 protein is expressed.

The myofibroblasts in this embodiment are not particularly limited in the subject, organ, tissue, etc. in which they exist or are derived. For example, it may be myofibroblasts in a target organ or tissue that have not yet been collected, myofibroblasts that have just been collected from the target organ or tissue, or primary culture of myofibroblasts. It may be a cell or a cultured cell line. That is, the system does not matter; for example, it may be an in vivo system, an in vitro system, or an ex vivo system.

In the case of an in vivo system, treating myofibroblasts with the compound may mean administering the compound to a living body.
In the case of an in vitro system or an ex vivo system, treating myofibroblasts with the compound may mean adding the compound to the culture supernatant of myofibroblasts.

In this embodiment, the myofibroblasts exist or are derived from mammals such as humans, mice, rats, dogs, cats, rabbits, cows, horses, goats, sheep, and pigs, and animals such as chickens. Examples include birds. Preferably a mammal such as a human, mouse, dog, cat, cow, horse, or pig, more preferably a human, mouse, dog, or cat, still more preferably a human or a mouse, and most preferably a human. It is. Further, the subject may be a subject (excluding humans). Furthermore, the age and gender of the target are not considered.
In addition, when treating myofibroblasts using the above-mentioned compound, and when the myofibroblasts are in a target organ or tissue and have not been collected, , the myofibroblasts may be myofibroblasts present in one organ and/or one tissue, or may be myofibroblasts present in multiple organs and/or multiple tissues. good.
In addition, when myofibroblasts are treated with the above compound, the myofibroblasts may be myofibroblasts immediately after being collected from a target organ or tissue, or primary culture of myofibroblasts. In the case of cells or cultured cell lines, the myofibroblasts may be myofibroblasts derived from one subject or from multiple subjects. Moreover, myofibroblasts may be derived from one organ and/or one tissue, or may be myofibroblasts derived from multiple organs and/or multiple tissues.

In this embodiment, the myofibroblasts exist or are derived from myofibroblasts, which can be deactivated by increasing the amount of Tcf21 protein, as described in the background art. or the organ from which it is derived, such as the liver, pancreas, kidney, lung, heart, etc.
Note that myofibroblasts present in or derived from the liver are sometimes referred to as activated hepatic stellate cells. Additionally, myofibroblasts present in or derived from the pancreas are sometimes referred to as activated pancreatic stellate cells.

In this embodiment, the myofibroblasts exist or are derived from myofibroblasts, which can be deactivated by increasing the amount of Tcf21 protein, as described in the background art. Or a tissue from which it is derived, such as a coronary artery.

In addition, primary cultured cells or cultured cell lines of myofibroblasts include cells in which stationary phase cells have been activated for purposes such as testing. For example, primary cultured myofibroblasts are activated by culturing stationary phase cells on a culture dish, and cultured myofibroblasts are the above-mentioned stationary phase cells that are forced to express myofibroblast marker genes. Examples include stocks. The latter can be produced by, for example, incorporating a myofibroblast marker gene into a plasmid or virus vector for introducing it into mammalian cells, and transfecting it into cells using a conventional method such as lipofection. Examples include cells. Transfection may be transient or stable.

In the step of treating myofibroblasts with the compound, the amount of the compound to be used is determined whether the myofibroblasts are treated immediately after being collected from the target organ or tissue or the primary cultured myofibroblasts are treated with the compound. When the target is a cultured myofibroblast cell line or a cultured myofibroblast cell line, the amount usually used when treating cells with a compound may be used.
Furthermore, when administering the compound to myofibroblasts in a target organ or tissue that have not been collected, the dosage may be within the same range as the dosage of the pharmaceutical composition according to the above aspect. Can be mentioned.

The method according to this aspect may include a step of measuring the expression levels of target genes of Tcf21 protein and Tcf3 protein after the step of treating myofibroblasts with the compound.
Regarding specific examples of target genes, the explanations described in the above embodiments are referred to.
Further, a conventional method can be used to measure the expression level of the target gene, and examples thereof include known methods for measuring the expression level of mRNA and protein, which is a gene product. Specifically, the explanation described in the above embodiment is used.

[Tcf3 protein and/or polynucleotide encoding it]
This embodiment may further include the step of introducing the Tcf3 protein and/or the polynucleotide encoding it into the myofibroblasts.
In this step, a composition containing the Tcf3 protein described in the above embodiment and/or a polynucleotide encoding the same can be used.
Regarding the explanation regarding the amino acid sequence of Tcf3 protein, the production method, etc., the explanation described in the above embodiment is referred to.
Regarding the explanation regarding the base sequence of the polynucleotide encoding the Tcf3 protein, etc., the explanation described in the above embodiment is referred to.

When targeting myofibroblasts immediately after harvesting from the target organ or tissue, or when targeting primary cultured myofibroblasts or cultured myofibroblast cell lines, Tcf3 protein can be added to myofibroblasts. For example, known introduction techniques using liposomes, exosomes, etc. can be used.
A polynucleotide encoding Tcf3 protein when targeting myofibroblasts immediately after harvesting from the target organ or tissue, and when targeting primary cultured myofibroblasts or cultured myofibroblast cell lines. For example, an expression vector or an adeno-associated virus containing a polynucleotide encoding the Tcf3 protein can be created and introduced into myofibroblasts using a conventional method such as lipofection. A known method such as can be used.
In addition, when a composition containing the Tcf3 protein and/or a polynucleotide encoding it is introduced into myofibroblasts in a target organ or tissue that have not been collected, the dosage form of the composition, For explanations regarding additives for formulation, means of delivery to target cells, administration route, administration timing, administration form, etc., the explanations described in the above embodiments are referred to.

In the step of introducing the Tcf3 protein and/or the polynucleotide encoding the same into myofibroblasts, the amount of the Tcf3 protein and/or the polynucleotide encoding the same to be introduced into the myofibroblasts is determined by Whether targeting fibroblasts, primary cultured myofibroblasts, or cultured myofibroblast cell lines, the amount to be introduced may be the amount normally used for gene introduction or protein introduction into cells.
Furthermore, when the Tcf3 protein and/or the polynucleotide encoding it is introduced into uncollected myofibroblasts in a target organ or tissue, the amount of introduction is determined by the composition of the pharmaceutical composition according to the above embodiment. A similar range for the dosage of a composition comprising a Tcf3 protein and/or a polynucleotide encoding the same in a product may be mentioned.

One embodiment of the present invention provides a compound represented by any of the following formulas (1) to (8) (provided that a compound represented by the following formula (1'), (1'') or (2')) ) or a pharmaceutically acceptable salt thereof.

For preferred embodiments of the compounds represented by formulas (1) to (8), the contents described in the above embodiments are incorporated.
Furthermore, regarding myofibroblasts, specific aspects of treatment, etc., the contents described in the above aspects are incorporated.
Furthermore, this embodiment may further include a step of introducing the Tcf3 protein and/or a polynucleotide encoding it into the myofibroblasts, and the specific embodiment thereof is referred to as described in the above embodiment.

Hereinafter, the present invention will be described with reference to specific examples, but the present invention is not limited to the following embodiments.

In the Examples, the following compounds were used that are expected to bind to the Tcf21 protein action site with sufficient affinity.

[Experiment example 1]
(Culture of active hepatic stellate cell clone derived from rat cirrhotic liver and addition of compounds)
Cirrhotic liver was produced in rats by repeated administration of carbon tetrachloride. The activated hepatic stellate cells isolated from this cirrhotic liver were immortalized by subculturing, and the activated hepatic stellate cell clone CFSC-8B cells were established. The cells were cultured at 37°C under a 5% carbon dioxide concentration. The culture solution was prepared by autoclaving 4.75 g of powdered Dulbecco's Modified Eagle (DMEM) medium (Nissui) dissolved in 500 mL of pure water, followed by 10 mL of sodium bicarbonate solution (Gibco) and L-glutamine solution (Gibco). It was prepared by mixing 10 mL of non-essential amino acid solution (Gibco), 50 mL of fetal bovine serum (Gibco), and 5 mL of penicillin-streptomycin solution (Gibco). 24 hours after seeding CFSC-8B cells at a cell density of 15% confluence in each well of a 24-well plate, compound 3, 8-10, 23, 32, 37, 42, 43, or 61 was added to a final concentration of 10. µM,

compound

28 or 29 to a final concentration of 1 µM, or compound 36 to a final concentration of 0.1 µM to the culture supernatant. In addition, a control was prepared in which only demethyl sulfoxide (DMSO), which was used to dissolve the compound, was added at the same final concentration of 0.1 vol% as in the compound addition group.

(RNA extraction and reverse transcription reaction from rat active hepatic stellate cell clone)
40 hours after compound addition, the culture supernatant was removed by aspiration, washed once with phosphate buffered saline, and then added to Buffer RLT plus (2-mercapto, which is included in the RNeasy plus mini kit (QIAGEN) immediately before use). 300 μL of ethanol (BioRad) (mixed to a final concentration of 1 vol%) was added per well, and the lysed cells were collected in a 1.5 mL tube. Total RNA was extracted from each of the obtained cell lysates using the RNeasy plus mini kit described above, and the RNA concentration in the solution was measured using a NanoDrop ultratrace spectrometer (Thermo Fisher Scientific). ReverTra Ace qPCR RT Master Mix with gDNA Remover (Toyobo) was added to 50 ng of RNA per sample, stirred gently, and incubated at 37°C for 5 minutes. Next, add 2 μL of 5× RT Master Mix II, stir gently to make it homogeneous, and then react at 37°C for 15 minutes, at 50°C for 5 minutes, and at 98°C for 5 minutes to synthesize cDNA. Ta.

(Quantitative PCR analysis using rat activated hepatic stellate cell clone)
SYBR Green real-time PCR master mix (Applied Biosystems) and the oligo DNA primers shown below were added to the cDNA obtained by the above method, and the mixture was incubated at 95°C for 1 second for 60 min using a StepOnePlus real-time PCR system (Applied Biosystems). The expression of the rat Acta2 gene was quantitatively analyzed by repeating the reaction cycle at ℃ for 20 seconds 40 times. Two wells were prepared for each sample in one experiment, and the relative expression level of each was corrected based on the expression level of the Gapdh gene, and the average value was used. This was repeated three times independently to determine the average value and standard deviation of the sample. Table 7 and FIG. 1 show the calculated relative values when the expression level of the control sample is taken as 100%.
rActa2-Forward primer: ATCCGATAGAACACGGCATC (NCBI accession No. NM_031004.2) (SEQ ID NO: 1)
rActa2-Reverse primer: GCCACGCGAAGCTCGTT (same as above) (SEQ ID NO: 2)
rGapdh-Forward primer: GCTACACTGAGGACCAGGTTGT (NCBI accession No. NM_017008.4) (SEQ ID NO: 3)
rGapdh-Reverse primer: TCATACCAGGAAATGAGCTTCA (same as above) (SEQ ID NO: 4)

(result)
In cells to which compounds other than compound 42 were added, the expression level of Acta2 gene decreased. Therefore, it was considered that these compounds bind to the Tcf21 protein action site, form and maintain a complex with the Tcf3 protein and the DNA of the target gene, and control the expression of that gene.

(Creation of a predictive model based on quantitative PCR analysis using rat activated hepatic stellate cell clones)
Among the above compounds, the following formula consisting of a linear combination of three molecular descriptors that can best express the Acta2 gene expression level of compounds 3, 8-10, 23, 32, 37, 42, 43, and 61 is Obtained by multiple regression analysis. The ^R2 value of the multiple regression equation is 0.975.
f' = 71.344 + 2.358 * vsurf_DD12 + 2.5787 * vsurf_HB7 + 3.529 * vsurf_IW7
In the above formula, f' corresponds to the relative expression level of the Acta2 gene. In other words, if the value of f' is less than 100, it can be said that the compound has Tcf21 protein-like activity, and compounds with vsurf_DD12, vsurf_HB7, and vsurf_IW7 that have a smaller value of f' are considered to have higher activity. It will be done.

[Experiment example 2]
(Primary culture of human hepatic stellate cells and addition of compounds)
HHSteC cells (ScienceCell), which were isolated from a human liver surgical specimen and subjected to primary culture, were used. The cells were cultured in a special medium (ScienceCell) at 37°C and 5% carbon dioxide concentration, and activated by repeated passage. 24 hours after seeding activated HHSteC cells (hereinafter sometimes referred to as "human activated hepatic stellate cells") into each well of a 24-well plate at a cell density of 15% of confluence, compounds 3 and 8 were added to each well of a 24-well plate. -11, 14, 16-18, 21-23, 26-27, 30-33, 37-38, 42-45, 53, 57-58, or 61 in the culture supernatant to a final concentration of 10 μM. added to. In addition, a control was prepared in which only DMSO, which was used to dissolve the compound, was added at the same final concentration of 0.1 vol% as in the compound addition group.

(Quantitative PCR analysis using human activated hepatic stellate cells)
Extract total RNA from cells collected 40 hours after adding the compound using the same method as above, perform a reverse transcription reaction, and then quantitatively analyze the expression of the human ACTA2 gene using the oligo DNA primers shown below. did. Two wells were prepared for each sample in one experiment, and the relative expression level of each was corrected based on the expression level of the GAPDH gene, and the average value was used. This was repeated 3 to 6 times independently, and the average value and standard deviation for the sample were determined. Table 8 and FIG. 2 show the calculated relative values when the expression level of the control sample is taken as 100%.
hACTA2-Forward primer: CCTATCCCCGGGACTAAGAC (NCBI accession No. NM_001141945.2) (SEQ ID NO: 5)
hACTA2-Reverse primer: AGAGCCATTGTCACACACCA (same as above) (SEQ ID NO: 6)
hGAPDH-Forward primer: TGGGTGTGAACCATGAGAAGTA (NCBI accession No. NM_002046.7) (SEQ ID NO: 7)
hGAPDH-Reverse primer: AGTCCTTCCACGATACCAAAG (same as above) (SEQ ID NO: 8)

(result)
In cells to which compounds 3, 8-11, 16, 17, 22, 23, 27, 30-33, 37, 43, 44, 57, 58, 61 were added, the expression level of ACTA2 gene was decreased. Therefore, it was considered that these compounds bind to the Tcf21 protein action site, form and maintain a complex with the Tcf3 protein and the DNA of the target gene, and control the expression of that gene.

(Creation of a predictive model based on quantitative PCR analysis using human activated hepatic stellate cells)
For the above compound, the following formula, which is a linear combination of four molecular descriptors that can best represent the expression level of the ACTA2 gene, was obtained by multiple regression analysis from among 260 two-dimensional molecular structure descriptors. The ^R2 value of the multiple regression equation is 0.883.
g' = 93.595000 - 14.48520 * KierA3 + 0.50487 * PEOE_VSA+2 + 326.76600 * PEOE_VSA_FPPOS + 0.23285 * SlogP_VSA5
In the above formula, g' corresponds to the relative expression level of the ACTA2 gene. In other words, if the value of g' is less than 100, it can be said that the compound has Tcf21 protein-like activity, and compounds with KierA3, PEOE_VSA+2, PEOE_VSA_FPPOS, and SlogP_VSA5 that have smaller g' values have high activity. It is thought that it has.

[Experiment example 3]
(Verification of dose dependence of compound in human activated hepatic stellate cells)
Compounds were added to activated HHSteC cells in the same manner as in Experimental Example 2, except that

Compound

3, 23, or 37 was used as the compound, and the final concentration was 3, 10, or 30 μM, and the relative expression level of the human ACTA2 gene was determined. Quantitative analysis was performed. The results are shown in Figure 3.

(result)

Compounds

3, 23, and 37 decreased the expression level of ACTA2 gene in a dose-dependent manner.

[Experiment example 4]
(Verification of time dependence of compounds in human activated hepatic stellate cells)
Regarding

Compound

3, 23, or 37, the compound was added to HHSteC cells activated in the same manner as in Experimental Example 2. RNA was extracted from cells collected 0, 12, 24, or 48 hours after addition of the compound using the same method as above, and the relative expression level of the human ACTA2 gene was quantitatively analyzed. Figure 4 shows the calculated relative values when the expression level in the sample 0 hours after addition was taken as 100%.

(result)
It can be seen that when any compound was added, the expression level of the ACTA2 gene was suppressed compared to the Control after 12 hours from addition.

[Experiment example 5]
(Verification of the range of molecular descriptors related to the presence or absence of Tcf21 protein-like action)
As mentioned above, the characteristics of small molecules expressed by the molecular descriptors VSA, vol, ASA, ASA ⁺ , and apol are that they bind with sufficient affinity to the Tcf21 protein action site in the Tcf21/Tcf3/DNA complex. , are considered favorable conditions for forming and maintaining complexes with specific chemical and steric characteristics.
For the compounds used in Experimental Examples 1 to 4, the values of the five molecular descriptors were generated and shown in Table 9. Also, the values of f' and g' are shown for the compounds used in Experimental Examples 1 to 4.

From the above table, compound 42, which did not reduce the expression level of the rat Acta2 gene in Experiment 1, had an f' value of 100 or more, whereas among the 12 compounds that decreased the expression level of the rat Acta2 gene, It can be seen that compounds 3, 23, 29, 32, and 37 whose expression levels were reduced to less than 81% had f' values of less than 81.9.
In addition, compounds 14, 18, 21, 26, 38, 42, 45, and 53 that did not reduce the expression level of the human ACTA2 gene in Experiment 2 had g' values of 98.4 or higher; Among the 20 compounds that decreased the expression level of , compounds 3, 8-11, 16, 22, 23, 27, 30-32, 37, 43, 44, 57, and 61 had a g' value of less than 98.4. It can be seen that it is.
In addition, from the above table, the molecular descriptors VSA, vol, ASA, ASA ⁺ , and apol of compounds that have Tcf21 protein-like activity (compounds other than compounds 14, 18, 21, 26, 38, 42, 45, and 53) It can be seen that the values are within the following range.
376.1≦VSA≦515.7
341.3≦vol≦466.6
597.8≦ASA≦793.0
487.9≦ASA ⁺ ≦646.9
56.6≦apol≦79.5

[Experiment example 6]
(Creation of liver fibrosis model mouse and administration of compound 3)
Six-week-old male C57Bl/6J mice were used. By injecting 1 mL/kg body weight of a 4-fold diluted solution of carbon tetrachloride (Fujifilm Wako Pure Chemical Industries) and olive oil at a volume ratio of 1:3 into the back of mice subcutaneously every 3 days for a total of 25 times. induced liver fibrosis. After 16 doses of carbon tetrachloride, mice were divided into three groups, and the compound 3 treatment group received 3 mg/kg body weight/day or 15 mg/kg body weight/day of compound 3 in DMSO followed by phosphate-buffered saline. It was diluted with water (PBS) and administered intraperitoneally every day. The control group received PBS containing DMSO used to dissolve Compound 3 at the same final concentration as the compound-administered group.

(Sirius red staining)
48 hours after the 25th administration of carbon tetrachloride, the liver was removed, fixed in formalin, and paraffin sections with a thickness of 4 μm were created. Dissolve Direct Red 80 (Sigma-Aldrich) to 0.5% with saturated picric acid (Fujifilm Wako Pure Chemical Industries), place this Sirius Red staining solution on the deparaffinized tissue section, and let it stand at room temperature for 5 minutes. The collagen fibers were stained azuki red. Next, a 0.1% Fast green (Sigma-Aldrich) solution dissolved in pure water was placed on the tissue and allowed to stand at room temperature for 5 minutes to stain the entire tissue green. After washing with water for 30 seconds, the samples were sealed with Marinol coverslips and observed and photographed using an optical microscope BX63 (Olympus).

(result)
A micrograph of Sirius red staining is shown in FIG. Compared to the control group (Control) administered with DMSO-containing PBS, the hepatic fibrosis area was significantly lower in the groups administered Compound 3 at 3 mg/kg body weight/day (Low) and 15 mg/kg body weight/day (High). decreased in a dose-dependent manner.

(RNA extraction and cDNA synthesis from liver tissue)
A portion of the liver tissue described above was collected into a 1.5 mL tube, 300 μL of TRIzol solution (ThermoFisher) was added thereto, and the tissue was crushed and suspended using a homogenizer. Next, total RNA was purified using the RNeasy plus mini kit (QIAGEN), and the concentration of the obtained RNA was measured using a NanoDrop ultratrace spectrometer (ThermoFisher). For each RNA sample, 50 ng of RNA was added to 8 tubes (Japan Genetics) and diluted with pure water to a total volume of 6 μL. This was incubated at 65°C for 5 minutes and then rapidly cooled on ice. Next, cDNA synthesis was performed using High-Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (Applied Biosystems).

(Quantitative PCR analysis)
The expression of the mouse Acta2 gene and the mouse Ngfr gene was quantitatively analyzed using the cDNA obtained by the above method, SYBR Green real-time PCR master mix (Applied Biosystems), and the oligo DNA primers shown below. Two wells were prepared for each sample in one experiment, and the relative expression level of each was corrected based on the expression level of the Gapdh gene, and the average value was used. This was performed using 4 to 6 mice in each group, and the relative value was calculated when the expression level in normal mouse liver tissue (Normal) was taken as 100%. Statistical significance testing was performed using the Mann-Whitney U test.
mActa2-Forward primer: ATCCGATAGAACACGGCATC (NCBI accession No. NM_007392.3) (SEQ ID NO: 9)
mActa2-Reverse primer: GCCACACGAAGCTCGTTATAG (same as above) (SEQ ID NO: 10)
mNgfr-Forward primer: CATCTCTGTGGACAGCCAGA (NCBI accession No. NM_033217.3) (SEQ ID NO: 11)
mNgfr-Reverse primer: GGGGCAGGCTACTGTAGAGG (same as above) (SEQ ID NO: 12)
mGapdh-Forward primer: GCTACACTGAGGACCAGGTTGT (NCBI accession No. NM_001289726.1) (SEQ ID NO: 13)
mGapdh-Reverse primer: TCATACCAGGAAATGAGCTTGA (same as above) (SEQ ID NO: 14)

(result)
Table 10 shows the relative expression levels of Acta2 gene and Ngfr gene in each group.

The expression changes of both genes are shown in FIGS. 6 and 7. Compared to Normal, the expression level of Acta2 gene increased and the expression level of Ngfr gene decreased at the start of treatment after 16 doses of carbon tetrachloride (PreTx) and in Control after 25 doses of carbon tetrachloride. . In other words, it was thought that repeated administration of carbon tetrachloride activated stellate cells and progressed liver fibrosis. On the other hand, in mice treated with Compound 3 at 3 mg/kg body weight/day (Low) or 15 mg/kg body weight/day (High), the expression level of the Acta2 gene decreased in a dose-dependent manner compared to the control, and Ngfr The expression level of the gene was increased. That is, it is considered that administration of Compound 3 decreased the expression of marker genes of active stellate cells, and instead increased the expression of marker genes of stationary stellate cells.

[Experiment example 7]
(Verification of the fibrosis-inhibiting effect of compound 37 in liver fibrosis model mice)
Using the same method as in Experimental Example 6, liver fibrosis was induced in mice by subcutaneously injecting carbon tetrachloride six times every three days. The compound 37 administration group received three doses of carbon tetrachloride followed by two optical isomers of compound 37 (YT3701 and YT3702) at 3 mg/kg body weight/day or 15 mg/kg body weight/day, respectively. was administered intraperitoneally every day. Thereafter, the liver was removed, stained with Sirius red using the same method as in Experimental Example 6, and observed under a microscope.

(result)
A micrograph of Sirius red staining is shown in FIG. In contrast to the control group (Control) administered with DMSO-containing PBS, the liver fibrosis area decreased in a dose-dependent manner in both groups administered with the two optical isomers of Compound 37.

(Quantitative PCR analysis)
RNA was extracted from the liver tissue using the same method as in Experimental Example 6, and the expression of mouse Acta2 gene and mouse Col1a1 gene was quantitatively analyzed. The oligo DNA primers shown below were used for PCR of the mouse Col1a1 gene. The experiment was performed using four mice in each group, and the relative value was calculated when the expression level in the control to which DMSO-containing PBS was administered was set as 100%. Statistical significance testing was performed using the Mann-Whitney U test.
mCol1a1-Forward primer: CATGTTCAGCTTTGTGGACCT (NCBI accession No. NM_007742.4) (SEQ ID NO: 15)
mCol1a1-Reverse primer: GCAGCTGACTTCAGGGATGT (same as above) (SEQ ID NO: 16)

(result)
Table 11 shows the relative expression level of each gene.

The expression changes of each gene are shown in FIGS. 9 and 10. In mice administered 3 mg/kg body weight/day (Low) or 15 mg/kg body weight/day (High) of YT3702, one of the optical isomers of Compound 37, the Acta2 gene and Col1a1 gene were increased compared to controls. The expression level was significantly decreased. Furthermore, in mice administered with the other isomer, YT3701, the expression level of the Col1a1 gene was significantly reduced in both the Low and High groups compared to the Control. In other words, administration of Compound 37 seems to have suppressed the activation of stellate cells and improved liver fibrosis.

Claims

By deactivation of myofibroblasts, the molecular descriptors vsurf_DD12, vsurf_HB7, vsurf_IW7, KierA3, PEOE_VSA+2, PEOE_VSA_FPPOS, and SlogP_VSA5 contain as an active ingredient a compound satisfying the following formula (I) and/or (II). A pharmaceutical composition for the prevention or treatment of a disease that can be prevented or treated.
71.344 + 2.358 * vsurf_DD12 + 2.5787 * vsurf_HB7 + 3.529 * vsurf_IW7 < 81.9 ・・・(I)
93.595000 - 14.48520 * KierA3 + 0.50487 * PEOE_VSA+2 + 326.76600 * PEOE_VSA_FPPOS + 0.23285 * SlogP_VSA5 < 98.4 ...(II)
The pharmaceutical composition according to claim 1, wherein in the compound, at least one of the molecular descriptors VSA, vol, ASA, ASA + , and apol is within the following range.
376.1≦VSA≦515.7
341.3≦vol≦466.6
597.8≦ASA≦793.0
487.9≦ASA + ≦646.9
56.6≦apol≦79.5
Compounds represented by any of the following formulas (1) to (8) (however, excluding compounds represented by the following formulas (1'), (1'') or (2')) or their pharmaceutical A pharmaceutical composition for the prevention or treatment of a disease that can be prevented or treated by deactivation of myofibroblasts, the composition comprising as an active ingredient a salt acceptable to .

(In the above formula (1),
P 1 may have an alkyl group having 1 to 3 carbon atoms, is a 9- or 10-membered aromatic heterocyclic group containing nitrogen and consisting of 2 rings,
Q 1 may have an -OH group and is a 5- or 6-membered alicyclic heterocyclic group containing nitrogen,
R 1 is a substituent represented by the following formula (1a) or (1b),

In the above formula (1a),
Sp 1 is an aliphatic hydrocarbon group having 1 to 4 carbon atoms, and one or more -CH 2 - of the aliphatic hydrocarbon group may be substituted with -O-. )

(In the above formula (2),
P2 is an alicyclic hydrocarbon group having 5 or 6 carbon atoms,
Q 2 is hydrogen or a straight chain or branched alkyl group having 1 to 5 carbon atoms. )
In claim 3, in the formula (1), P 1 is represented by any of the following formulas (9a) to (9e), and Q 1 is represented by any of the following formulas (10a) to (10c). Pharmaceutical compositions as described.
The pharmaceutical composition according to any one of claims 1 to 4, wherein the compound is a compound represented by any of the following formulas (11) to (18) or a pharmaceutically acceptable salt thereof.
The pharmaceutical composition according to any one of claims 1 to 5, which is used in combination with a composition containing a Tcf3 protein and/or a polynucleotide encoding the same.
The disease according to any one of claims 1 to 6, wherein the disease that can be prevented or treated by deactivation of myofibroblasts is a disease selected from the group consisting of the following (a) to (f). Pharmaceutical composition.
(a) liver failure due to hepatitis, liver fibrosis, liver cirrhosis, or liver cancer, or any of these diseases;
(b) pancreatic secretory insufficiency due to pancreatitis or pancreatic fibrosis, or any of these diseases;
(c) nephritis, renal fibrosis, or glomerulosclerosis, or renal failure due to any of these diseases;
(d) interstitial pneumonia or pulmonary fibrosis, or respiratory failure due to any of these diseases;
(e) Fibrosis after myocardial infarction; myocarditis or cardiomyopathy, or heart failure due to any of these diseases;
(f) Coronary artery stenosis due to arterial atherosclerosis, coronary artery restenosis after balloon dilation, or coronary artery restenosis after stent placement, or ischemic heart disease due to any of these diseases.
Molecular descriptors vsurf_DD12, vsurf_HB7, vsurf_IW7, KierA3, PEOE_VSA+2, PEOE_VSA_FPPOS, and SlogP_VSA5 include a step of treating myofibroblasts using a compound satisfying the following formula (I) and/or (II), A method for deactivating myofibroblasts.
71.344 + 2.358 * vsurf_DD12 + 2.5787 * vsurf_HB7 + 3.529 * vsurf_IW7 < 81.9 ・・・(I)
93.595000 - 14.48520 * KierA3 + 0.50487 * PEOE_VSA+2 + 326.76600 * PEOE_VSA_FPPOS + 0.23285 * SlogP_VSA5 < 98.4 ...(II)
9. The method for deactivating myofibroblasts according to claim 8, wherein the compound has at least one of the molecular descriptors VSA, vol, ASA, ASA + , and apol within the following range.
376.1≦VSA≦515.7
341.3≦vol≦466.6
597.8≦ASA≦793.0
487.9≦ASA + ≦646.9
56.6≦apol≦79.5
Compounds represented by any of the following formulas (1) to (8) (however, excluding compounds represented by the following formulas (1'), (1'') or (2')) or their pharmaceutical A method for deactivating myofibroblasts, the method comprising treating the myofibroblasts with a salt acceptable to .

(In the above formula (1),
P 1 may have an alkyl group having 1 to 3 carbon atoms, is a 9- or 10-membered aromatic heterocyclic group containing nitrogen and consisting of 2 rings,
Q 1 may have an -OH group and is a 5- or 6-membered alicyclic heterocyclic group containing nitrogen,
R 1 is a substituent represented by the following formula (1a) or (1b),

In the above formula (1a),
Sp 1 is an aliphatic hydrocarbon group having 1 to 4 carbon atoms, and one or more -CH 2 - of the aliphatic hydrocarbon group may be substituted with -O-. )

(In the above formula (2),
P2 is an alicyclic hydrocarbon group having 5 or 6 carbon atoms,
Q 2 is hydrogen or a straight chain or branched alkyl group having 1 to 5 carbon atoms. )
A method for predicting whether a target compound has Tcf21 protein-like action, the method comprising:
generating values of molecular descriptors associated with the action from the structure of the target compound; and applying the values of the molecular descriptors associated with the action to a predictive model expressed as a function of the molecular descriptors associated with the action. and predicting whether the target compound has the effect,
The method, wherein the molecular descriptor associated with the action includes one or more selected from vsurf_DD12, vsurf_HB7, vsurf_IW7, KierA3, PEOE_VSA+2, PEOE_VSA_FPPOS, and SlogP_VSA5.
The prediction model is
f = k + l * vsurf_DD12 + m * vsurf_HB7 + n * vsurf_IW7;
g = k + l * KierA3 + m * PEOE_VSA+2 + n * PEOE_VSA_FPPOS + o * SlogP_VSA5
(In the formula, k to o are numbers determined by multiple regression analysis.)
12. The method according to claim 11, wherein the model predicts that the target compound has the effect if f or g is less than 100.
A method for predicting whether a target compound has Tcf21 protein-like action, the method comprising:
Based on the structure of a compound that is known to have or does not have a Tcf21 protein-like effect, creating a predictive model expressed as a function of molecular descriptors associated with said effect;
generating a value of a molecular descriptor associated with the action from the structure of the target compound; and applying the value of the molecular descriptor associated with the action to the prediction model to determine whether or not the target compound has the action. A method, comprising the steps of predicting.
A system comprising means for carrying out the method according to any one of claims 11 to 13.
A program for executing the method according to any one of claims 11 to 13.
A recording medium on which the program according to claim 15 is recorded.