WO2023170173A1 - Polypeptides capable of inhibiting sars-cov-2 viruses - Google Patents

Polypeptides capable of inhibiting sars-cov-2 viruses Download PDF

Info

Publication number
WO2023170173A1
WO2023170173A1 PCT/EP2023/055929 EP2023055929W WO2023170173A1 WO 2023170173 A1 WO2023170173 A1 WO 2023170173A1 EP 2023055929 W EP2023055929 W EP 2023055929W WO 2023170173 A1 WO2023170173 A1 WO 2023170173A1
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
cov
sars
alphabody
polypeptide
Prior art date
Application number
PCT/EP2023/055929
Other languages
French (fr)
Inventor
Ignace Lasters
Johan Desmet
Stefan Loverix
Philippe ALARD
Thomas D´HUYS
Silvia PANDOLFI
Karen VANDENBROUCKE
Kurt Vermeire
Original Assignee
Complix Nv
Katholieke Universiteit Leuven
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Complix Nv, Katholieke Universiteit Leuven filed Critical Complix Nv
Publication of WO2023170173A1 publication Critical patent/WO2023170173A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/08—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from RNA viruses
    • C07K16/1002—Coronaviridae
    • C07K16/1003—Severe acute respiratory syndrome coronavirus 2 [SARS‐CoV‐2 or Covid-19]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62—DNA sequences coding for fusion proteins
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2318/00—Antibody mimetics or scaffolds
    • C07K2318/20—Antigen-binding scaffold molecules wherein the scaffold is not an immunoglobulin variable region or antibody mimetics
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/20011—Coronaviridae
    • C12N2770/20022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/20011—Coronaviridae
    • C12N2770/20033—Use of viral protein as therapeutic agent other than vaccine, e.g. apoptosis inducing or anti-inflammatory

Definitions

  • the present invention relates to agents capable of inhibiting betacoronaviruses, preferably SARS-CoV- 2, which agents are suitable for use in prophylactic or therapeutic applications.
  • Coronaviruses are enveloped single-stranded RNA viruses.
  • the envelope consists of a lipid bilayer in which viral glycoproteins are embedded, including the spike protein (S protein) that plays a key role in the viral infection process.
  • S protein spike protein
  • coronaviruses cause mild respiratory illnesses generally referred to as common cold.
  • SARS-CoV first observed in 2002 in China and associated with a mortality rate of 10% and in 2013 MERS-CoV emerging in the Middle East with very high ( ⁇ 35%) case-fatality rate as reported by World Health Organization (WHO).
  • COVID-19 The disease caused by SARS-CoV-2, referred to as COVID-19, first spread in China and rapidly grew into a pandemic. In the spring of 2020, the mortality numbers peaked, with case fatality rates (CFR) exceeding 10% in some countries (https://ourworldindata.org/mortality-risk-covid), where CFR is the ratio of confirmed deaths over confirmed disease cases. While this number is far from easy to interpret, it was well recognized that although a relatively small fraction of COVID-19 patients needed hospitalization in an Intensive Care Unit (ICU), each country faced a severe ICU capacity strain.
  • ICU Intensive Care Unit
  • a polypeptide comprising an N-terminal extension region directly fused to the N-terminus of HRS1 of an Alphabody sequence wherein the N-terminal extension region comprises a sequence having at least 70% sequence identity with the sequence VDLGDISGIEASSVNIQAEISQLN (SEQ ID NO: 1)
  • HRS1 of the Alphabody sequence comprises a sequence having at least 70% sequence identity with the sequence IVAISLGITAIQYSIQSL (SEQ. ID NO: 2)
  • a beta-coronavirus infection such as a severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection.
  • present inventors found that such polypeptide is able to block the formation of the post-fusion 6-helix bundle structure of HRS1 and HRS2 of SARS-CoV-2, thereby impairing effective viral entry of SARS-CoV-2 into a host cell. This is because the N-terminal extension region and the HRSl of the Alphabody sequence of present invention, which together mimic the HR2 region of SARS-CoV-2, effectively compete with HR2 for binding to trimeric HR1.
  • a first aspect provides a polypeptide capable of inhibiting a beta-coronavirus, comprising an Alphabody sequence, wherein the Alphabody sequence has the general formula HRS1-L1-HRS2-L2-HRS3,
  • each of HRS1, HRS2 and HRS3 is independently an alpha-helical heptad repeat sequence (HRS) comprising 2 to 4 consecutive heptad repeat units,
  • heptad repeat units are 7-residue (poly)peptide fragments represented as 'abcdefg' or 'defgabc', wherein the symbols 'a 1 to 'g' denote conventional heptad positions,
  • each HRS starts and ends with an aliphatic or aromatic amino acid residue located at a heptad a-position or d-position
  • each of LI and L2 are independently a linker fragment, which covalently connect HRS1 to HRS2 and HRS2 to HRS3, respectively, characterized in that
  • the polypeptide comprises an N-terminal extension region directly fused to the N-terminus of HRS1 of the Alphabody sequence, wherein the N-terminal extension region comprises a sequence having at least 70% sequence identity with the sequence VDLGDISGIEASSVNIQAEISQLN (SEQ ID NO: 1), and
  • - HRS1 of the Alphabody sequence comprises a sequence having at least 70% sequence identity with the sequence IVAISLGITAIQYSIQSL (SEQ ID NO: 2).
  • the beta-coronavirus is severe acute respiratory syndrome coronavirus 1 (SARS-CoV-1) or severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), preferably SARS-CoV-
  • a glycan binding domain is fused to the N-terminal extension region or to the Alphabody sequence via a flexible spacer sequence, preferably wherein the flexible spacer sequence comprises from 15 to 35 amino acid residues.
  • the glycan binding domain is fused to the N-terminus of the N-terminal extension region.
  • the glycan binding domain is fused to the C-terminus of the HRS3 of the Alphabody sequence.
  • the glycan binding domain is a lectin chosen from the group consisting of Griffithsin and Human Surfactant Protein D.
  • a further aspect provides a nucleic acid sequence encoding the polypeptide as taught herein.
  • a further aspect provides a pharmaceutical composition
  • a pharmaceutical composition comprising the polypeptide as taught herein or the nucleic acid sequence as taught herein, and a pharmaceutically acceptable carrier.
  • a further aspect provides the polypeptide as taught herein, the nucleic acid sequence as taught herein or the pharmaceutical composition as taught herein for use as a medicament.
  • a further aspect provides the polypeptide as taught herein, the nucleic acid sequence as taught herein or the pharmaceutical composition as taught herein for use in the treatment and/or prevention of a betacoronavirus infection, preferably a SARS-CoV-2 infection.
  • Figure 1 Layout of the S protein.
  • SP signal peptide
  • SI subunit 1
  • FP fusion peptide
  • HR1 heptad repeat domain 1
  • HR2 heptad repeat domain 2
  • TM transmembrane domain
  • CP cytoplasmic domain Figure 2. Definition and structural features of the SARS-CoV-2 HR2 sequence and corresponding sequence elements in anti-SARS-CoV-2 Alphabody constructs.
  • Line 1 secondary structure of the SARS- CoV-2 HR2 sequence as observed in the structure coordinates (PDB file 6LXT) of the post fusion core of 2019-nCoV S2 subunit as annotated under Protein Data Bank (PDB) under DOI: 10.2210/pdb6LXT/pdb; E, extended; H, alpha-helical.
  • Line 2 the SARS-CoV-2 (SARS2) HR2 sequence (amino acid residues 1164 to 1205 of the SARS-CoV-2 surface glycoprotein sequence as annotated under NCBI GenBank accession number sequence YP_009724390.1).
  • Line 4 definition of the N-terminal extension and HRS1 parts (Nt- HRS1 sequences) in the anti-SARS-CoV-2 Alphabody constructs listed thereunder.
  • Line 5 annotation of heptad a- and d-positions in the HRS1 sequences of anti-SARS-CoV-2 Alphabody constructs.
  • Lines 6-12 Nt-HRSl sequences of CMPX-587B, -583Q., -599B, -614D, -624N, -626C and -633D, respectively. Differences with the SARS-CoV-2 HR2 sequence in line 2 are highlighted in grey.
  • Alphabody 626C inhibits infection of U87.ACE2+ cells with different SARS-CoV-2 variants of concern.
  • U87.ACE2+ cells were infected with different variants of SARS-CoV-2 (Wuhan-Hu-1, MOI 0.04; Delta, MOI 0.008; Omicron, MOI 0.05) in the presence of increasing concentrations of test compound.
  • Cells were incubated with virus and test compound for 4 days.
  • Virus-induced cytopathic effect was quantified by an MTS-based viability measurement at day 4 post infection.
  • OD values were used to calculate the % inhibition of viral replication and to plot a concentration-response curve.
  • FIG. 1 Alphabodies inhibit Omicron SARS-CoV-2 infection of differentiated Calu-3 cells in an air-liquid- interface (ALI) culture.
  • ALI cultured Calu-3 cells were exposed apically to live SARS-CoV-2 virus (Omicron strain; MOI 0.01) in the absence or presence of test compound for 1.5 hour.
  • SARS-CoV-2 virus Omicron strain; MOI 0.01
  • cells were washed apically with PBS to remove virus input (and test compound) and re-exposed to air to maintain the ALI culture.
  • At 3 days post infection cells were washed apically with PBS to collect the released virus particles and SARS-CoV-2 replication was assessed by RT-qPCR analysis of the viral copy numbers of the N gene in the apical wash.
  • one or more or “at least one”, such as one or more members or at least one member of a group of members, is clear per se, by means of further exemplification, the term encompasses inter alia a reference to any one of said members, or to any two or more of said members, such as, e.g., any >3, >4, >5, >6 or >7 etc. of said members, and up to all said members.
  • “one or more” or “at least one” may refer to 1, 2, 3, 4, 5, 6, 7 or more.
  • any of the claimed embodiments can be used in any combination.
  • the coronavirus surface especially the envelope spike (S) glycoprotein.
  • S envelope spike
  • Each spike comprises three S proteins associated as a trimeric complex.
  • the S protein is a class I transmembrane glycoprotein composed of the SI and S2 subunits, as shown schematically in Figure 1.
  • the SI subunit contains the receptor binding domain (RBD), and the S2 subunit, which harbors the fusion machinery, is anchored via the TM in the viral membrane.
  • the spike is involved in the target cell attachment via the RBD binding to the host cell receptor angiotensin converting enzyme 2 (ACE2) for SARS-CoV-1 and SARS-CoV-2 and dipeptidyl peptidase 4 (DPP4) for MERS-CoV.
  • ACE2 angiotensin converting enzyme 2
  • DPP4 dipeptidyl peptidase 4
  • TMPRSS2 a type II transmembrane-bound serine protease
  • SARS-CoV-2 for priming (i.e., processing by proteolytic cleavage) the S protein.
  • Receptor binding and priming of S protein by host proteases leads to a cascade of conformational rearrangements that drive the viral fusion process, eventually leading to cell entry through a pre- to postfusion conformational transition.
  • fusion entry mechanism applies to enveloped viruses having a class-1 viral transmembrane fusion glycoprotein such as CoV, HIV, RSV and Influenza.
  • FP fusion peptide
  • a polypeptide comprising an N-terminal extension region directly fused to the N-terminus of HRS1 of an Alphabody sequence wherein the N-terminal extension region comprises a sequence having at least 70% sequence identity with the sequence VDLGDISGIEASSVNIQAEISQLN (SEQ ID NO: 1)
  • HRS1 of the Alphabody sequence comprises a sequence having at least 70% sequence identity with the sequence IVAISLGITAIQYSIQSL (SEQ. ID NO: 2) is able to block the formation of the post-fusion 6-helix bundle structure of HRS1 and HRS2 of SARS- CoV-2, thereby impairing effective viral entry of SARS-CoV-2.
  • the N-terminal extension region and the HRS1 of the Alphabody sequence of present invention which together mimic the HR2 region of SARS-CoV-2, effectively compete with HR2 for binding to trimeric HR1.
  • the Alphabody's coiled coil structure is structurally extremely stable.
  • the alphahelical region formed by (part of) the N-terminal extension region and HRS1 will at any time remain alpha-helical, even when not bound to its target region, the HRl-trimer.
  • the helical regions within the polypeptides of the present invention do not entail an entropic cost as a result of folding as an alpha-helix only upon binding to the HR1 trimer.
  • stable alpha-helical regions are less susceptible to proteolytic cleavage.
  • polypeptides of the present invention are engineered within, or onto the non-binding part of the Alphabody scaffold region, such as, for example, fusion domains endowing the Alphabody constructs with the capacity to bind to viral spike regions other than HR1, such as for example a glycan binding domain, thereby allowing the Alphabody constructs to increase their local concentration in the immediate vicinity of the virus.
  • the inventors have found that it is possible to mimic a specific helical part of HR2 by one of the Alphabody helices so as to generate a polypeptide comprising an Alphabody sequence which impedes the coronavirus machinery. Furthermore, present inventors have also found that additional parts from HR2 may be added to the Alphabody to enhance binding to trimeric HR1. Such polypeptides are able to block the formation of the post-fusion 6-helix bundle structure, thereby impairing viral entry.
  • HRS alpha-helical heptad repeat sequences
  • a structural alignment of one of the alpha-helical heptad repeat sequences (HRS) of the Alphabody scaffold with an alpha-helical part observed within a HR2 structure in particular an X-ray structure of a postfusion 6-helix bundle structure, such as the structure of the postfusion core of the 2019-nCoV S2 subunit having PDB code 6LXT as annotated under Protein Data Bank (PDB) under DOI: 10.2210/pdb6LXT/pdb; they then selected, from that structural alignment, amino acids from the HR2 sequence that can be transferred onto corresponding amino acid positions within the aligned Alphabody heptad repeat sequence and identified accompanying substitutions to optimally accommodate the transferred moieties within the complex; they then further identified additional interactions with the target, including N- or C-terminal extensions flanking the designed alpha-helical region.
  • HRS alpha-helical heptad repeat sequences
  • an 'Alphabody' or 'Alphabodies' can generally be defined as sequences of amino acids which are single-chain, triple-stranded, predominantly alpha-helical, coiled coil amino acid sequences. More particularly, an Alphabody structure as used in the context of the present invention can be defined as an amino acid sequence having the general formula HRS1-L1-HRS2-L2-HRS3, wherein
  • each of HRS1, HRS2 and HRS3 is independently a heptad repeat sequence (HRS) comprising or consisting of 2 to 7, preferably 2 to 4, consecutive heptad repeat units, at least 50% of all heptad a- and d-positions are occupied by isoleucine residues, each HRS starts and ends with an aliphatic or aromatic amino acid residue located at a heptad a-position or d-position;
  • HRS heptad repeat sequence
  • each of LI and L2 are independently a linker fragment, as further defined hereinafter, which covalently connect HRS1 to HRS2 and HRS2 to HRS3, respectively.
  • the consecutive heptad repeat units are not necessarily identical.
  • HRS with 2 to 4 consecutive heptad repeats are preferred over HRS with more consecutive heptad repeats as these provide less steric hindrance when used for inhibiting SARS- CoV-2.
  • HRS1, HRS2 and HRS3 will together form a triple-stranded, alpha-helical, coiled coil structure.
  • an 'antiparallel Alphabody' refers to an Alphabody as defined above, further characterized in that the alpha-helices of the triple-stranded, alpha-helical, coiled coil structure together form an antiparallel coiled coil structure, i.e., a coiled coil wherein two alpha-helices are parallel and the third alpha-helix is antiparallel with respect to these two helices.
  • polypeptides comprising an amino acid sequence with the general formula HRS1-L1-HRS2-L2-HRS3, but which in certain particular embodiments may comprise additional residues, moieties and/or groups which are covalently linked, more particularly N- and/or C-terminally covalently linked, to a basic Alphabody sequence structure having the formula HRS1-L1-HRS2-L2-HRS3.
  • HRS1-L1-HRS2-L2-HRS3 e.g., '(Alphabody) polypeptides' which comprise or consist of an Alphabody as defined above, which may be covalently linked to additional sequences.
  • the binding features described for an Alphabody herein can generally also be applied to polypeptides comprising said Alphabody.
  • 'heptad 1 , 'heptad unit' or 'heptad repeat unit' are used interchangeably herein and shall herein have the meaning of a 7-residue (poly)peptide motif that is repeated two or more times within each heptad repeat sequence of an Alphabody structure, and is represented as 'abcdefg' or 'defgabc', wherein the symbols 'a' to 'g' denote conventional heptad positions.
  • heptad positions are assigned to specific amino acid residues within a heptad, a heptad unit, or a heptad repeat unit, present in an Alphabody structure, for example, by using specialized software such as the COILS method of Lupas et al. (Science 1991, 252:1162-1164; https://embnet.vital-it.ch/software/COILS_form.html).
  • COILS method of Lupas et al. Science 1991, 252:1162-1164; https://embnet.vital-it.ch/software/COILS_form.html.
  • the heptads or heptad units as present in the Alphabody structure are not strictly limited to the above-cited representations (i.e.
  • 'heptad a-positions', 'heptad b-positions', 'heptad c-positions', 'heptad d-positions', 'heptad e-positions', 'heptad f-positions' and 'heptad g-positions' refer respectively to the conventional 'a', 'b', 'c', 'd ', 'e', 'f' and 'g' amino acid positions in a heptad, heptad repeat or heptad repeat unit.
  • a heptad motif (as defined herein) of the type 'abcdefg' is typically represented as 'HPPHPPP' (SEQ ID NO: 3
  • a 'heptad motif of the type 'defgabc' is typically represented as 'HPPPHPP', wherein the symbol ' H ' denotes an apolar or hydrophobic amino acid residue and the symbol 'P' denotes a polar or hydrophilic amino acid residue.
  • Typical hydrophobic residues located at a- or d-positions include aliphatic (e.g., leucine, isoleucine, valine, methionine) or aromatic (e.g., phenylalanine) amino acid residues.
  • Heptads within coiled coil sequences do not always comply with the ideal pattern of hydrophobic and polar residues, as polar residues are occasionally located at 'H' positions and hydrophobic residues at 'P' positions.
  • the patterns 'HPPHPPP' (SEQ. ID NO: 3) and 'HPPPHPP' (SEQ ID NO: 4) are to be considered as ideal patterns or characteristic reference motifs.
  • a 'heptad repeat sequence' as used herein shall have the meaning of an amino acid sequence or sequence fragment comprising or consisting of n consecutive heptads, where n is a number equal to or greater than 2.
  • a heptad repeat sequence can thus generally be represented by (abcdefg) n or (defgabc) n in notations referring to conventional heptad positions, or by (HPPHPPP) n (SEQ ID NO: 3) or (HPPPHPP) n (SEQ ID NO: 4) in notations referring to the heptad motifs, with the proviso that a) the amino acids at positions a-g or H and P need not be identical amino acids in the different heptads, b) not all amino acid residues in a HRS should strictly follow the ideal pattern of hydrophobic and polar residues, and c) the HRS may end with an incomplete or partial heptad motif.
  • the HRS may contain an additional sequence "a”, “ab”, “abc”, “abed”, “abede”, or “abedef” following C-terminally of the (abcdefg) n sequence.
  • a 'heptad repeat sequence' is an amino acid sequence or sequence fragment comprising n consecutive (but not necessarily identical) heptads generally represented by abcdefg or defgabc, where n is a number equal to or greater than 2, wherein at least 50% of all heptad a- and d-positions are occupied by isoleucine residues, each HRS starting with a full heptad sequence abcdefg or defgabc, and ending with a partial heptad sequence abed or defga, such that each HRS starts and ends with an aliphatic or aromatic amino acid residue located at either a heptad a- or d-position.
  • heptad repeat sequences comprising amino acids or amino acid sequences that deviate from the consensus motif, and if only amino acid sequence information is at hand, then the COILS method of Lupas et al. (Science 1991, 252:1162-1164) is a suitable method for the determination or prediction of heptad repeat sequences and their boundaries, as well as for the assignment of heptad positions.
  • the heptad repeat sequences can be resolved based on knowledge at a higher level than the primary structure (i.e., the amino acid sequence).
  • heptad repeat sequences can be identified and delineated on the basis of secondary structural information (i.e.
  • HRS alpha-helicity
  • tertiary structural i.e., protein folding
  • a typical characteristic of a putative HRS is an alpha-helical structure.
  • Another (strong) criterion is the implication of a sequence or fragment in a coiled coil structure. Any sequence or fragment that is known to form a regular coiled coil structure, i.e., without stutters or stammers as described in Brown et al. Proteins 1996, 26:134-145, is herein considered a HRS.
  • the identification of HRS fragments can be based on high-resolution 3-D structural information (X-ray or NMR structures).
  • the boundaries to an HRS fragment may be defined as the first a- or d-position at which a standard hydrophobic amino acid residue (selected from the group valine, isoleucine, leucine, methionine, phenylalanine, tyrosine or tryptophan) is located.
  • the boundaries to an HRS fragment can be defined by the presence of an isoleucine amino acid residue.
  • the terms 'linker', 'linker fragment' or 'linker sequence' are used interchangeably herein and refer to an amino acid sequence fragment that is part of the contiguous amino acid sequence of a single-chain Alphabody, and which covalently interconnect the HRS sequences of that Alphabody structure.
  • linkers within a single-chain structure of the Alphabodies thus interconnect the HRS sequences, and more particularly the first to the second HRS, and the second to the third HRS in an Alphabody structure.
  • Each linker sequence in an Alphabody structure commences with the residue following the last heptad residue of the preceding HRS and ends with the residue preceding the first heptad residue of the next HRS.
  • a linker fragment in an Alphabody structure is preferably flexible in conformation to ensure relaxed (unhindered) association of the three heptad repeat sequences as an alpha-helical coiled coil structure.
  • 'Ll' shall denote the linker fragment one, i.e., the linker between HRS1 and HRS2, whereas ' L2' shall denote the linker fragment two, i.e., the linker between HRS2 and HRS3.
  • Suitable linkers for use in the polypeptides envisaged herein will be clear to the skilled person, and may generally be any linker used in the art to link amino acid sequences, as long as the linkers are structurally flexible, in the sense that they do not affect the characteristic three dimensional coiled coil structure of the Alphabody.
  • the two linkers LI and L2 in a particular Alphabody structure may be the same or may be different.
  • the linkers LI and L2 may be rigid or flexible peptide linkers.
  • the linkers LI and L2 are amino acid sequences consisting of at least 4, in particular at least 8, more particularly at least 12 amino acid residues, with a non-critical upper limit chosen for reasons of convenience being about 30 amino acid residues
  • amino acid residues will be indicated either by their full name or according to the standard three-letter or one-letter amino acid code.
  • the '(percentage of) sequence identity' between a first nucleotide sequence and a second nucleotide sequence may be calculated using methods known by the person skilled in the art, e.g. by dividing the number of nucleotides in the first nucleotide sequence that are identical to the nucleotides at the corresponding positions in the second nucleotide sequence by the total number of nucleotides in the first nucleotide sequence and multiplying by 100% or by using a known computer algorithm for sequence alignment such as NCBI Blast.
  • the skilled person may take into account so-called 'conservative' amino acid substitutions, which can generally be described as amino acid substitutions in which an amino acid residue is replaced with another amino acid residue of similar chemical structure and which has little or essentially no influence on the function, activity or other biological properties of the polypeptide. Possible conservative amino acid substitutions will be clear to the person skilled in the art.
  • the percentage sequence identity is calculated over the entire length of the sequence.
  • substantially identical denotes at least 90%, preferably at least 95%, such as 95%, 96%, 97%, 98% or 99%, sequence identity.
  • Alphabodies and nucleic acid sequences are said to be 'exactly the same' if they have 100% sequence identity over their entire length.
  • a first aspect of the invention provides a polypeptide capable of inhibiting SARS-CoV-2, comprising an Alphabody sequence, wherein the Alphabody sequence has the general formula HRS1-L1-HRS2-L2-HRS3,
  • each of HRS1, HRS2 and HRS3 is independently an alpha-helical heptad repeat sequence (HRS) comprising 2 to 4 consecutive heptad repeat units, - wherein said heptad repeat units are 7-residue (poly)peptide fragments represented as 'abcdefg' or 'defgabc', wherein the symbols 'a 1 to 'g' denote conventional heptad positions,
  • each HRS starts and ends with an aliphatic or aromatic amino acid residue located at a heptad a-position or d-position
  • each of LI and L2 are independently a linker fragment, which covalently connect HRS1 to HRS2 and HRS2 to HRS3, respectively, characterized in that
  • the polypeptide comprises an N-terminal extension region directly fused to the N-terminus of HRS1 of the Alphabody sequence, wherein the N-terminal extension region comprises, consists essentially of, or consists of a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, such as at least 96%, at least 97%, at least 98%, or at least 99%, preferably at least 95%, more preferably at least 99%, even more preferably 100%, sequence identity with the sequence VDLGDISGIEASSVNIQAEISQLN (SEQ ID NO: 1), and
  • - HRS1 of the Alphabody sequence comprises, consists of or consists essentially of a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, such as at least 96%, at least 97%, at least 98%, or at least 99%, preferably at least 95%, more preferably at least 99%, even more preferably 100%, sequence identity with the sequence IVAISLGITAIQYSIQSL (SEQ. ID NO: 2).
  • the polypeptide comprises an N-terminal extension region directly fused to the N-terminus of HRS1 of the Alphabody sequence, wherein the N-terminal extension region comprises, consists essentially of, or consists of a sequence VDLGDISGIEASSVNIQAEISQLN (SEQ ID NO: 1), or a sequence that differs by at most 7, at most 6, at most 5, at most 4, at most 3, at most 2 or at most 1 amino acid residue(s) from said sequence defined by SEQ ID NO: 1.
  • HRS1 of the Alphabody sequence comprises, consists essentially of or consists of a sequence IVAISLGITAIQYSIQSL (SEQ ID NO: 2), or a sequence that differs by at most 6, at most 5, at most 4, at most 3, at most 2 or at most 1 amino acid residue(s) from said sequence defined by SEQ ID NO: 2.
  • the term "differ by” may refer to amino acid substitutions, additions and/or deletions, preferably substitutions.
  • the terms 'inhibiting' or 'reducing' may refer to (the use of) a polypeptide as used herein that specifically binds to a betacoronavirus, and particularly inhibits, reduces and/or prevents the infection of a cell by the betacoronavirus, preferably by inhibiting, reducing and/or preventing entry of the betacoronavirus into the cell.
  • the terms 'inhibiting' or 'reducing' may refer to (the use of) a polypeptide as used herein that specifically binds to trimeric HR1 of SARS-CoV-2 and inhibits, reduces and/or prevents the interaction between trimeric HR1 and HR2 of SARS-CoV-2, and as a result thereof, inhibits, reduces and/or prevents infection of a cell by the SARS-CoV-2 virus.
  • the betacoronavirus is a betacoronavirus using class I viral entry mechanism.
  • the betacoronavirus is severe acute respiratory syndrome coronavirus (SARS-CoV or SARS-CoV-1) or severe acute respiratory syndrome coronavirus 2 (SARS-CoV2), or any variant thereof.
  • SARS-CoV-2 may be any variant of the SARS-CoV-2 virus.
  • the SARS-CoV-2 isolate Wuhan- Hu-1 the Delta variant of the SARS-CoV-2 virus (e.g. B.l.617.2), the Omicron variant of the SARS-CoV-2 virus (e.g. B.1.1.529), the Alpha variant (also known as the UK variant) of the SARS-CoV-2 virus (e.g. VOC 202012/01, B.1.1.7), the Gamma variant (also known as the Brazilian-Japanese variant) of the SARS- CoV-2 virus (e.g. B.1.1.28 or Pl), the Beta variant (also known as the South African variant) of the SARS- CoV-2 virus (e.g.
  • VOC 501Y.V2, B. 1.351 the Lambda variant of the SARS-CoV-2 virus (e.g. C. 37), the Mu variant of the SARS-CoV-2 virus (e.g. B.1.621), the Epsilon variant (also known as the Californian variant) of the SARS-CoV-2 virus (e.g. B.1.429, B.1.427, or CAL.20.C), the Zeta variant (also known as the Brazilian variant ) of the SARS-CoV-2 virus (e.g. P.2), the Eta variant (also known as the UK/Nigeria variant) of the SARS-CoV-2 virus (e.g.
  • the SARS-CoV-2 virus is the SARS-CoV-2 isolate Wuhan-Hu-1, the Delta variant of the SARS-CoV-2 virus (e.g. B.l.617.2), the Omicron variant of the SARS-CoV-2 virus (e.g. B.1.1.529).
  • the indication that the N-terminal extension region is directly fused to the N-terminus of HRS1 of the Alphabody sequence means that there is no additional amino acid or linker present between the N- terminal extension region and the N-terminus of HRS1 of the Alphabody.
  • the most C-terminal amino acid of the N-terminal extension region is bound to the most N-terminal amino acid of the HRS1 of the Alphabody sequence via a peptide-bond.
  • the HRS1 of the Alphabody sequence is N-terminally extended by the N-terminal extension region.
  • the polypeptide as taught herein comprises a sequence having at least 70%, at least 80%, at least 90%, at least 95%, such as at least 96%, at least 97%, at least 98%, or at least 99%, preferably 100%, sequence identity with the sequence VDLGDISGIEASSVNIQAEISQLNIVAISLGITAIQYSIQSL (SEQ ID NO: 5).
  • the polypeptide as taught herein comprises a sequence VDLGDISGIEASSVNIQAEISQLNIVAISLGITAIQYSIQ.SL (SEQ. ID NO: 5), or a sequence that differs by at most 13, at most 12, at most 11, at most 10, at most 9, at most 8, at most 7, at most 6, at most 5, at most 4, at most 3, at most 2 or at most 1 amino acid residue(s) from said sequence defined by SEQ ID NO: 5.
  • the C-terminal part of the N-terminal extension region forms together with the HRS1 of the Alphabody sequence one alpha-helix.
  • the sequence QAEISQLNIVAISLGITAIQYSIQSL (SEQ ID NO: 6) or a sequence that differs by at most 8, at most 7, at most 6, at most 5, at most 4, at most 3, at most 2 or at most 1 amino acid residue(s) from said sequence defined by SEQ ID NO: 6, forms an alpha-helix.
  • the N-terminal extension region comprises, consists essentially of or consists of at most 24 amino acids.
  • the N-terminal extension region comprises, consists essentially of or consists of a sequence as defined by SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 30.
  • the HRS1 of the Alphabody sequence comprises a Valine at the heptad b- position of the first heptad repeat unit of HRS1, an Alanine at the heptad c-position of the first heptad repeat unit of HRS1, and a Leucine at the heptad f-position of the first heptad repeat unit of HRS1.
  • the HRS1 of the Alphabody sequence may comprise a Serine at the heptad e-position of the first heptad repeat unit of HRS1.
  • the HRS1 of the Alphabody sequence comprises, consists essentially of or consists of a sequence as defined by SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13 or SEQ ID NO: 31.
  • polypeptide as described herein comprises a sequence as defined by SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 5, SEQ ID NO: 36 or SEQ ID NO: 32.
  • the polypeptide as described herein comprises, consists essentially of or consists of a sequence as defined by SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, or SEQ ID NO: 29.
  • polypeptides of present invention also are able to inhibit betacoronavirus variants, preferably SARS-CoV-2 variants, which enter cells via the endosomal route, such as the Omicron variant of SARS-CoV-2, when being fused to a glycan binding domain via a flexible spacer sequence.
  • betacoronavirus variants preferably SARS-CoV-2 variants
  • enter cells via the endosomal route such as the Omicron variant of SARS-CoV-2
  • the polypeptide comprises a glycan binding domain fused, coupled or conjugated, preferably covalently connected, to the N-terminal extension region or to the Alphabody sequence via a flexible spacer sequence.
  • the glycan binding domain is capable of binding to glycan, preferably N- linked glycan, at the surface of a Class-1 viral spike protein, such as those of SARS-CoV-2.
  • flexible spacer sequence refers to a flexible connecting element or linker that serves to link other elements.
  • the flexible spacer sequence is a (poly) peptide linker.
  • the flexible spacer sequence comprises from 15 to 35, from 20 to 30, such as about 25, amino acid residues.
  • the nature of amino acids constituting the flexible spacer sequence or linker is typically not of particular relevance so long as the biological activity of the polypeptide segments linked thereby is not substantially impaired and the linker provides for the intended spatial separation of the linked polypeptide segments.
  • Preferred linkers are essentially non-immunogenic and/or not prone to proteolytic cleavage.
  • the flexible spacer sequence is a glycine and serine-rich sequence.
  • flexible spacer sequence comprises from 3 to 7, preferably 5, repeats of a "glycine/serine-rich" sequence such as GGGGS (SEQ ID NO: 21).
  • the flexible spacer sequence consists of the sequence GGGGSGGGGSGGGGSGGGGSGGGGS (SEQ. ID NO: 22).
  • the glycan binding domain is fused, coupled or conjugated to the N-terminus of the N-terminal extension region. In particular embodiments, the glycan binding domain is fused, coupled or conjugated to the C-terminus of the HRS3 of the Alphabody sequence. In particular embodiments, the glycan binding domain is a lectin, preferably a lectin chosen from the group consisting of Griffithsin and Human Surfactant Protein D. In particular embodiments, the glycan binding domain is Griffithsin with a sequence as defined by SEQ ID NO: 28.
  • polypeptide as described herein comprising a glycan binding domain comprises, consists essentially of or consists of a sequence as defined by SEQ ID NO: 19 or SEQ ID NO: 20.
  • the polypeptide is capable of specifically binding to trimeric HR1 of SARS- CoV-2, preferably to one or more grooves formed at the surface of trimeric HR1 of SARS-CoV-2.
  • a polypeptide (or the Alphabody structure comprised therein) is said to 'specifically bind to' a particular target when that polypeptide has affinity for, specificity for, and/or is specifically directed against that target (i.e., against at least one part or fragment thereof).
  • the 'specificity' of a polypeptide as used herein can be determined based on affinity and/or avidity.
  • the 'affinity' of a polypeptide is represented by the equilibrium constant for the dissociation of the polypeptide and trimeric HR1 of SARS-CoV-2. The lower the K D value, the stronger the binding strength between the polypeptide and trimeric HR1 of SARS-CoV-2.
  • the affinity can also be expressed in terms of the affinity constant (KA), which corresponds to 1/K D .
  • KA affinity constant
  • the binding affinity of a polypeptide as used herein can be determined in a manner known to the skilled person, depending on the specific target protein of interest.
  • a K D value greater than about 1 millimolar is generally considered to indicate non-binding or non-specific binding.
  • a polypeptide as envisaged herein is said to be 'specific for a first target protein of interest as opposed to a second target protein of interest' when it binds to the first target protein of interest with an affinity that is at least 5 times, such as at least 10 times, such as at least 100 times, and preferably at least 1000 times higher than the affinity with which that polypeptide binds to the second target protein of interest. Accordingly, in certain embodiments, when a polypeptide is said to be 'specific for' a first target protein of interest as opposed to a second target protein of interest, it may specifically bind to (as defined herein) the first target protein of interest, but not to the second target protein of interest.
  • the application also envisages parts, fragments, analogs, mutants, variants, and/or derivatives of the polypeptides described herein comprising or essentially consisting of one or more of such parts, fragments, analogs, mutants, variants, and/or derivatives, as long as these parts, fragments, analogs, mutants, variants, and/or derivatives are suitable for the prophylactic, therapeutic and/or diagnostic purposes envisaged herein.
  • Such parts, fragments, analogs, mutants, variants, and/or derivatives are still capable of inhibiting SARS- CoV-2.
  • nucleic acid sequences encoding single-chain Alphabodies or Alphabody polypeptides which are obtainable by the methods according to the invention as well as vectors and host cells comprising such nucleic acid sequences.
  • the present invention provides nucleic acid sequences encoding the Alphabodies or the polypeptides of the invention (or suitable fragments thereof). These nucleic acid sequences are also referred to herein as nucleic acid sequences of the invention and can also be in the form of a vector or a genetic construct or polynucleotide.
  • the nucleic acid sequences of the invention may be synthetic or semi-synthetic sequences, nucleotide sequences that have been isolated from a library (and in particular, an expression library), nucleotide sequences that have been prepared by PCR using overlapping primers, or nucleotide sequences that have been prepared using techniques for DNA synthesis known per se.
  • the genetic constructs of the invention may be DNA or RNA, and are preferably double-stranded DNA.
  • the genetic constructs of the invention may also be in a form suitable for transformation of the intended host cell or host organism in a form suitable for integration into the genomic DNA of the intended host cell or in a form suitable for independent replication, maintenance and/or inheritance in the intended host organism.
  • the genetic constructs of the invention may be in the form of a vector, such as for example a plasmid, cosmid, YAC, a viral vector or transposon.
  • the vector may be an expression vector, i.e., a vector that can provide for expression in vitro and/or in vivo (e.g. in a suitable host cell, host organism and/or expression system).
  • the genetic constructs of the invention may comprise a suitable leader sequence to direct the expressed Alphabody to an intended intracellular or extracellular compartment.
  • the genetic constructs of the invention may be inserted in a suitable vector at a pelB leader sequence site to direct the expressed Alphabody to the bacterial periplasmic space.
  • the vector may be equipped with a suitable promoter system to, for example, optimize the yield of the Alphabody.
  • the application also provides vectors and host cells comprising nucleic acids described above.
  • Suitable examples of hosts or host cells for expression of the Alphabodies or polypeptides of the invention will be clear to the skilled person and include any suitable eukaryotic or prokaryotic cell (e.g., bacterial cells such as E. coli, yeast cells, mammalian cells, avian cells, amphibian cells, plant cells, fish cells, and insect cells), whether located in vitro or in vivo.
  • the production of the polypeptides envisaged herein may comprise the step of expressing a nucleotide sequence encoding said polypeptide in a host organism under suitable conditions, so as to produce said polypeptide. This step can be performed by methods known to the person skilled in the art.
  • polypeptides envisaged herein may be synthesized as soluble protein construct, optionally after their sequence has been identified by, for instance, in silico modelling.
  • the polypeptides envisaged herein can be synthesized using recombinant or chemical synthesis methods known in the art.
  • the polypeptides envisaged herein can be produced by genetic engineering techniques.
  • methods for synthesizing the polypeptides envisaged herein may comprise transforming or infecting a host cell with a nucleic acid or a vector encoding a polypeptide sequence having detectable binding affinity for, or detectable in vitro activity on, trimeric HR1 (or a mimic thereof, such as trimeric GCN4-N50) and being able to inhibit SARS-CoV-2.
  • the polypeptide sequences as described herein can be made by recombinant DNA methods.
  • DNA encoding the polypeptides can be readily synthesized using conventional procedures. Once prepared, the DNA can be introduced into expression vectors, which can then be transformed or transfected into host cells such as E. coli or any suitable expression system, in order to obtain the expression of polypeptides in the recombinant host cells and/or in the medium in which these recombinant host cells reside.
  • host cells such as E. coli or any suitable expression system
  • the polypeptide produced from an expression vector using a suitable expression system may be tagged (typically at the N-terminal or C-terminal end of the Alphabody) with e.g. a Histidine or other sequence tag for easy purification.
  • the tag is a cleavable or non-cleavable tag.
  • His-tag cleavage may be possible due to the presence of a FXa recognition motif present between an N-terminal His-tag and the N-terminus of the polypeptide as taught herein.
  • the presence of a His-tag may simplify purification, allowing a 2-step column purification process.
  • An exemplary 2-step column purification process may be as follows.
  • the first step of a 2-step column purification process may comprise an immobilized metal affinity chromatography (IMAC) capturing step allowing removal of most host cell contaminants.
  • the IMAC step may be performed under denaturing conditions since host cell pellet fractions require solubilization in 4M GuHCl. GuHCI removal (including slow refolding if needed) and extra contaminant removal may be performed by overnight dialysis of the IMAC eluate (at 4°C) against acidic buffer conditions.
  • IMAC immobilized metal affinity chromatography
  • the polypeptides as taught herein may be brought in final buffer conditions on a size exclusion chromatography (SEC) column, allowing in addition of the buffer exchange, separation from residual contamination and determination of the homogeneity of the protein sample. Purity of the polypeptides as taught herein may be determined by SDS-PAGE.
  • SEC size exclusion chromatography
  • the cell lysate may be immediately applied on IMAC in the absence of denaturing agents. No extra dialysis step is required before the SEC polishing step.
  • Transformation or transfection of nucleic acids or vectors into host cells may be accomplished by a variety of means known to the person skilled in the art including calcium phosphate-DNA coprecipitation, DEAE-dextran-mediated transfection, polybrene-mediated transfection, electroporation, microinjection, liposome fusion, lipofection, protoplast fusion, retroviral infection, and biolistics.
  • Suitable host cells for the expression of the desired polypeptides may be any eukaryotic or prokaryotic cell (e.g., bacterial cells such as E. coli, yeast cells, mammalian cells, avian cells, amphibian cells, plant cells, fish cells, and insect cells), whether located in vitro or in vivo.
  • host cells may be located in a transgenic animal.
  • methods for the production of polypeptides herein comprising transforming, transfecting or infecting a host cell with nucleic acid sequences or vectors encoding such polypeptides and expressing the polypeptides under suitable conditions.
  • the methods of production comprise a step of determining whether the polypeptide binds to trimeric HR1 (or a mimic thereof, such as trimeric GCN4-N50) with a dissociation constant (K D ) of less than about 1 nanomolar (1 nM), preferably less than about 100 picomolar (100 pM).
  • the method comprises determining whether said binding affinity for trimeric HR1 (or a mimic thereof, such as trimeric GCN4-N50) is equal to or better than the binding affinity of a polypeptide comprising, consisting essentially of or consisting of an amino acid sequence as set forth in SEQ. ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, 20 or SEQ ID NO: 29.
  • a further aspect provides a pharmaceutical composition
  • a pharmaceutical composition comprising the polypeptide as taught herein or the nucleic acid sequence, and a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable as used herein is consistent with the art and means compatible with the other ingredients of a pharmaceutical composition and not deleterious to the recipient thereof.
  • “Acceptable carrier, diluent or excipient” refers to an additional substance that is acceptable for use in human and/or veterinary medicine.
  • an acceptable carrier, diluent or excipient may be a solid or liquid filler, diluent or encapsulating substance that may be safely used in systemic administration.
  • a variety of carriers, well known in the art may be used.
  • These carriers may be selected from a group including sugars, starches, cellulose and its derivatives, malt, gelatine, talc, calcium sulphate and carbonates, vegetable oils, synthetic oils, polyols, alginic acid, phosphate buffered solutions, emulsifiers, isotonic saline and salts such as mineral acid salts including hydrochlorides, bromides and sulphates, organic acids such as acetates, propionates and malonates and pyrogen-free water.
  • Any safe route of administration may be employed for providing a patient with the polypeptide as taught herein or the pharmaceutical composition as taught herein.
  • oral, rectal, parenteral, sublingual, buccal, intravenous, intra-articular, intra-muscular, intra-dermal, subcutaneous, inhalational, intraocular, intraperitoneal, intracerebroventricular, transdermal and the like may be employed.
  • Intra-muscular and subcutaneous injection may be appropriate.
  • the pharmaceutical composition as taught herein is formulated for inhalation, such as in the form of an aerosol spray, mist or powder.
  • a further aspect provides the polypeptide as taught herein, the nucleic acid sequence as taught herein or the pharmaceutical composition as taught herein for use as a medicament. Accordingly the invention provides the use of the polypeptide as taught herein, the nucleic acid sequence as taught herein, or the pharmaceutical composition as taught herein in the manufacture of a medicament.
  • a further aspect provides the polypeptide as taught herein, the nucleic acid sequence as taught herein, or the pharmaceutical composition as taught herein for use in the prevention of a betacoronavirus infection, preferably a SARS-CoV-1 or SARS-CoV-2 infection, more preferably a SARS-CoV-2 infection.
  • a betacoronavirus infection preferably a SARS-CoV-1 or SARS-CoV-2 infection
  • a method for preventing a betacoronavirus infection more preferably a SARS-CoV-2 infection
  • a method for preventing a betacoronavirus infection, more preferably a SARS-CoV-2 infection in a subject comprising administering a prophylactically effective amount of the polypeptide as taught herein, the nucleic acid sequence as taught herein, or the pharmaceutical composition as taught herein.
  • prevention refers to a reduction in risk of acquiring a disease or disorder (i.e., causing at least one of the clinical symptoms of the disease not to develop in a subject, in particular a human subject, that may be exposed to or predisposed to the disease but does not yet experience or display symptoms of the disease).
  • prevention also encompasses reducing or preventing transmission of the causative agent and/or reducing or preventing infection with the causative agent, thereby actively preventing infection and/or disease development and progression.
  • a further aspect provides the polypeptide as taught herein, the nucleic acid sequence as taught herein, or the pharmaceutical composition as taught herein for use in the treatment of a betacoronavirus infection, more preferably a SARS-CoV-1 or SARS-CoV-2 infection, more preferably a SARS-CoV-2 infection.
  • a method for treating a betacoronavirus infection, more preferably a SARS-CoV-2 infection, in a subject comprising administering a therapeutically effective amount of the polypeptide as taught herein, the nucleic acid sequence as taught herein, or the pharmaceutical composition as taught herein.
  • treating or “treatment 1 of any disease or disorder includes, in one embodiment, to improve the disease or disorder (i.e., arresting or reducing the development of the disease or at least reducing one of the clinical symptoms of the disease).
  • “treating” or “treatment” refers to improve at least one physical parameter, which may or may not be discernible by the subject, in particular a human subject, but which is based on or associated with the disease or disorder to be treated.
  • “treating” or “treatment” refers to modulating or alleviating the disease or disorder, either physically (e. g. stabilization of a discernible on non-discernible symptom), physiologically (e. g. stabilization of a physiological parameter), or both.
  • treating refers to delaying the onset or progression of the disease or disorder. Accordingly, “treating” or “treatment' includes any causal treatment of the underlying disease or disorder (i.e., disease modification), as well as any treatment of signs and symptoms of the disease or disorder (whether with or without disease modification), as well as any alleviation or amelioration of the disease or disorder, or its signs and symptoms.
  • disease(s) and “disorders)” are used largely interchangeably herein.
  • an effective amount may refer to a prophylactically effective amount, which is an amount of an active compound or pharmaceutical agent, more particularly a prophylactic agent, that inhibits or delays in a subject the onset of a disorder as being sought by a researcher, veterinarian, medical doctor or other clinician, or may refer to a therapeutically effective amount, which is an amount of active compound or pharmaceutical agent, more particularly a therapeutic agent, that elicits the biological or medicinal response in a subject that is being sought by a researcher, veterinarian, medical doctor or other clinician, which may include inter alia alleviation of the symptoms of the disease or condition being treated.
  • Methods are known in the art for determining therapeutically and prophylactically effective doses for the agents as taught herein.
  • the effective amount can vary depending on the compound, the disease and its severity, and the condition, age, weight, gender etc. of the subject, in particular a human subject, to be treated. More particularly, “therapeutically effective amount” or “therapeutically effective dose” indicates an amount of polypeptide, nucleic acid sequence or pharmaceutical composition as taught herein that when administered brings about a clinical positive response with respect to treatment of a subject afflicted by an infectious disease. Similarly, a “prophylactically effective amount” or “prophylactically effective dose” refers to an amount of polypeptide, nucleotide or pharmaceutical composition as taught herein that inhibits or delays the onset of clinical manifestation of an infectious disease as being sought by a researcher, veterinarian, medical doctor or other clinician.
  • the SARS-CoV-1 or SARS-CoV-2 infection may be an infection with any variant of the SARS-CoV-1 or SARS-CoV-2 virus, such as the SARS-CoV-2 variants as described elsewhere herein.
  • subject or “patient” can be used interchangeably and refer to animals, preferably warm-blooded animals, more preferably vertebrates, even more preferably mammals, still more preferably primates, and specifically includes human patients and non-human mammals and primates.
  • Preferred subjects are human subjects.
  • said subject in which the betacoronavirus infection is to be prevented is at risk of a betacoronavirus infection.
  • said subject is a subject at greater risk of a serious course of said betacoronavirus infection, and/or wherein a conventional treatment may not be effective enough.
  • said subject in which the disease is to be treated/prevented is 60 years or older, preferably 65 years or older, such as 70 years or older.
  • said subject in which the disease is to be treated/prevented is a subject with severe immune disorders (immunocompromised).
  • said subject in which the disease is to be treated/prevented has a disease or condition selected from the group consisting of hypertension, diabetes, kidney disease, human immunodeficiency virus infection, obesitas, Down syndrome, cardiovascular disease, cancer, and chronic respiratory disease.
  • the subject in which the disease is to be treated/prevented does not respond well to vaccination with mRNA vaccines or any other vaccine.
  • the subject to be treated has mild, moderate or severe symptoms or mild, moderate or severe clinical manifestation of a beta-coronavirus infection.
  • the treatment and/or prevention comprises administering the polypeptide as taught herein, the nucleic acid sequence as taught herein, or the pharmaceutical composition as taught herein via inhalation.
  • the polypeptide as taught herein, the nucleic acid sequence as taught herein, or the pharmaceutical composition as taught herein may be administered using an inhalation delivery device.
  • an inhalation delivery device comprising the polypeptide as taught herein, the nucleic acid sequence as taught herein, or the pharmaceutical composition as taught herein.
  • Alphabody can be used in the example section to refer to the Alphabody structure perse or the polypeptide comprising the at least one Alphabody structure.
  • Alphabodies were recombinantly produced as reported previously (J. Desmet, K. Verstraete, Y. Bloch, E. Lorent, Y. Wen, B. Devreese, K. Vandenbroucke, S. Loverix, T. Hettmann, S. Deroo, K. Somers, P. Henderikx, I. Lasters, S. N. Savvides, Structural basis of IL-23 antagonism by an Alphabody protein scaffold, Nat. Commun. 5, 5237 (2014)).
  • Alphabody constructs with either an N- or C-terminal histidine tag was performed in BL21(DE3)pLysS cells (Life Technologies), grown in Luria-Bertani medium at 37 °C. At an OD600 nm of 0.6, expression was induced by addition of 1 mM isopropylthio-p-galactoside. Expression was allowed for 4 h at 37 °C, after which cells were harvested by centrifugation, resuspended in Tris buffer and frozen at -80 °C. Cell lysis was performed by thawing and sonication in presence of DNAsel and MgCL, after which the suspension was cleared by centrifugation at 40 000 rpm.
  • Alphabodies were isolated from the soluble fraction using a 5-ml IMAC HP Ni sepharose column (GE Healthcare), followed by a polishing and desalting step, performed on a Superdex 75 size-exclusion column (GE Healthcare) equilibrated in phosphate buffered saline (PBS).
  • PBS phosphate buffered saline
  • Biotinylated GCN4-N50 (SEQ ID NO: 23), i.e., the HRl-trimer-micking target peptide, as well as biotinylated SARS-C36 peptide (SEQ. ID NO: 25) were synthetically produced by Thermo Scientific.
  • the N50 sequence corresponds to the last 50 amino acid residues of HR1 (SEQ ID NO: 27).
  • affinities of different anti-SARS-CoV-2 Alphabody constructs were determined by a solution inhibition ELISA assay.
  • a Nunc plate was coated by adding 100 pL of 10 pg/mL neutravidin (Thermo Scientific) in PBS for 2 h at room temperature (RT). The plate was then blocked with 2% (m/v) skimmed milk in PBS for 1 h at RT while shaking. After washing, 100 pL of 100 nM biotinylated SARS-C36 peptide in PBS + 1% (m/v) skimmed milk was added. After washing, free biotin binding sites were blocked with 200 nM biotin in PBS + 1% (m/v) BSA for 1 h at RT.
  • the GCN4-N50-Alphabody mixtures and the calibrator series were then transferred to the ELISA plate in duplicate (two columns for each series) and incubated for 40 min at RT. After washing, detection of bound GCN4-N50 was performed with 1/5000 streptavidin-horseradish peroxidase (HRP) conjugate (BioLegend) in PBS + 1% (m/v) skimmed milk for 30 min at RT. The plate was developed with SureBlue and the reaction was stopped with 0.5 M H2SO4. Each incubation step was performed while shaking. Optical densities (ODs) were read at 450 nm.
  • HRP streptavidin-horseradish peroxidase
  • the OD signals from the calibrator series were first fitted to a sigmoid function, the latter providing the relationship between the measured ODs and free GCN4- N50 peptide concentrations. Using this relationship, the OD values measured for the Alphabody-GCN4- N50 mixtures were converted to free GCN4-N50 concentrations, and the latter were then fitted to the quadratic equation for Alphabody-GCN4-N50 binding, using the solution K D as parameter.
  • Biotinylated SARS-C36 peptide essentially corresponds to the SARS-CoV-2 HR2 sequence.
  • Biotinylated GCN4-N50 (SEQ ID NO: 24) corresponds to a fragment (N50) of the SARS-CoV-2 HR1 sequence, preceded by a trimerizing GCN4 peptide.
  • GCN4 is a fragment of the 'GCN4 isoleucine zipper (GCN4-IZ) peptide' (Suzuki et al. 1998 Protein engineering 11:1051-1055), which forms a stable trimeric alpha-helical coiled coil structure, thereby assisting in trimerization of the N50 peptide.
  • Trimeric GCN4- N50 is therefore a stable mimic of the HR1 target region in a SARS-CoV-2 spike during the fusion process.
  • biotinylated SARS-C36 peptide SEQ ID NO: 25
  • biotinylated GCN4-N50 is added (1) in a calibrator series and (2) in parallel, at a fixed concentration in the presence of a dilution series of inhibitory Alphabody construct, which samples had been preincubated to equilibrium for 4 h.
  • Alphabody constructs and SARS-C36 peptide occupy the same binding sites on GCN4-N50, the Alphabody constructs act in an inhibitory way for the binding to immobilized SARS-C36 peptide. Consequently, the stronger the binding, the less biotinylated GCN4-N50 will be detected in the readout step. Eventually, the observed inhibition curve can be converted into a binding curve by applying the relationship between OD and free GCN4-N50 concentration, as derived from the calibration curve.
  • Alphabody constructs of the present invention Since the main purpose of the Alphabody constructs of the present invention is to avoid binding of HR2 to trimeric HR1 during the fusion process, this assay is considered a representative technique for evaluating potentially antiviral Alphabody constructs.
  • Alphabody constructs of the present invention referred to as CMPX-587B (SEQ. ID NO: 14), -583Q (SEQ ID NO: 15), -599B (SEQ ID NO: 16), -614D (SEQ ID NO: 17) and -624N (SEQ ID NO: 18), were designed by first performing a structural alignment of the alpha-helical heptad repeat sequence 1 (HRS1) of the Alphabody scaffold with an alpha-helical part observed within a HR2 structure, in particular an X-ray structure of a postfusion 6-helix bundle structure, more in particular the structure of the postfusion core of the 2019-nCoV S2 subunit having PDB code 6LXT as annotated under Protein Data Bank (PDB) under DOI: 10.2210/pdb6LXT/pdb ( Figure 2).
  • HRS1 alpha-helical heptad repeat sequence 1
  • PDB code 6LXT as annotated under Protein Data Bank (PDB) under DOI: 10.2210
  • amino acids from the HR2 sequence were selected and were transferred onto corresponding amino acid positions within the aligned Alphabody heptad repeat sequence.
  • accompanying substitutions were designed by in silico modeling so as to optimally accommodate the transferred moieties within the complex.
  • additional interactions with the target were identified, in particular the N-terminal extension within HR2 flanking the designed alpha-helical region.
  • the binding affinities of the panel of Alphabody constructs to the HR1 mimicking target construct GCN4- N50 are listed in Table 1. It was found that all of Alphabody constructs CMPX-587B (SEQ ID NO: 14), - 583Q (SEQ ID NO: 15), -599B (SEQ ID NO: 16), -614D (SEQ ID NO: 17) and -624N (SEQ ID NO: 18) are strong binders, with K D s in the nanomolar or picomolar range. The best construct was CMPX-624N, with a solution binding K D of about 40 picomolar. Even the 'worst' binder, construct CMPX-587B, had an excellent affinity, with a K D of about 1 nanomolar.
  • the antiviral potencies of different anti-SARS-CoV-2 Alphabody constructs were determined by a pseudovirus (PV) assay using vesicular stomatitis virus (VSV) particles pseudotyped with spikes from different SARS-CoV-2 variants, namely the Wuhan SARS-CoV-2 variant with a nucleotide sequence as annotated under NCBI GenBank accession number sequence NC_045512.2, the Delta SARS-CoV-2 variant with sequence reference EPI _ISL_2356230 and the Omicron SARS-CoV-2 variant with sequence reference EPI_ISL_6841980.
  • PV pseudovirus
  • VSV vesicular stomatitis virus
  • live virus inhibition assay was conducted as follows. One day prior to the experiment, U87.ACE2+ cells were seeded at 20,000 cells/well in 96 well-plates. Serial dilutions of the test compound were prepared in cell infectious media (DMEM + 2% (v/v) FCS), overlaid on cells, and then virus was added to each well (MOI indicated in the figure legends). Cells were incubated at 37 °C under 5% CO2 for the duration of the experiment (96 h).
  • DMEM + 2% (v/v) FCS cell infectious media
  • the optical density (OD) of the samples was compared with enough cell control replicates (cells without virus and compounds) and virus control wells (cells with virus but without compounds).
  • a VSV pseudovirus was constructed carrying the spike protein of one of the different SARS-CoV-2 variants, as described above.
  • the spike gene mutant of SARS-CoV-2 with a C-terminal 19 aa truncation (SARS-CoV-2 dC19) was cloned into either the plasmid pCAG or pUNOl (Invivogen).
  • the plasmids carrying SARS-CoV-2 spike cDNA were transfected into HEK293T cells. Twenty-four hours post transfection, the VSVdG-Luc-G (Kerafast) virus was inoculated into cells expressing the SARS-CoV-2 dC19 spike protein and incubated for two hours.
  • VSVdG-Luc-G virus was removed from the supernatant, and anti-VSV-G monoclonal antibody (Absolute antibody) was added to block the infectivity of residual VSVdG-Luc-G.
  • the progeny virus would be enveloped by SARS-CoV-2 dC19 spike protein to generate a VSV pseudovirus carrying the foreign spike protein of SARS-CoV-2.
  • the supernatant was harvested at 24h post VSVdG-Luc-G infection and then centrifuged and filtered (0.45-pm pore size, Millipore) to remove cell debris and stored at -80°C until use.
  • the viral titer (CCID30) was determined by measuring the luminescence from luciferase activity after A549.ACE2.TMPRSS2 (Invivogen) cell infection with gradient diluted supernatant.
  • A549.ACE2.TMPRSS2 cells were seeded the day before experiment onset.
  • the experimental Alphabodies were mixed with diluted VSV-SARS-CoV-2-dC19 virus (CCID30). All samples and viruses were diluted with DMEM 10% (v/v) FBS 1% (v/v) PenStrep. The mixture was added to seeded A549.ACE2.TMPRSS2 cells. After 22h of incubation at 37°C and 5% CO2, a read-out of luminescence was done on the GloMax Discover reader (Promega) as a measurement to compare pseudovirus infection with or without compounds. For this, the Bright-Glo Luciferase Assay System (Promega Cat.# E2620) was used according to manufacturer's guidelines.
  • IC 5 o values were obtained by a pseudovirus-based infection assay using indicated Wuhan and Delta spike-pseudotyped VSV particles and A549.ACE2.TMPRSS2 target cells.
  • the IC50S range from about 3.6 pM to about 0.04 pM.
  • the antiviral potencies (IC 5 os) of the panel of Alphabody constructs for which the binding affinities are listed in Table 1 were also tested in a pseudovirus (PV) based infection assay with the Wuhan and Delta SARS-CoV-2 strains.
  • the target cells were A549 cells expressing the ACE2 receptor and TMPRSS2 protease (A549.ACE2.TMPRSS2 cells).
  • Table 2 lists the IC50S obtained by these experiments. It was found that all of Alphabody constructs CMPX-587B (SEQ ID NO: 14), -583Q (SEQ ID NO: 15), -599B (SEQ ID NO: 16), -614D (SEQ ID NO: 17) and -624N (SEQ ID NO: 18) inhibited viral infection, albeit with different potencies.
  • the best performing construct was CM PX-624N, with an IC 5 o of about 0.09 pM and 0.04 pM for the Wuhan and Delta variants, respectively.
  • the worst performing construct was CMPX-587B, with an IC 5 o of about 3.6 pM and 2.2 pM for the Wuhan and Delta variants, respectively.
  • GRFT griffithsin
  • GGGGS Gly/Ser spacer
  • Binding affinities and antiviral potencies for tested anti-SARS-CoV-2 Alphabody constructs The listed binding affinities (K D values) were obtained by the solution inhibition ELISA assay described above. The listed inhibition potencies (IC 5 o values) were obtained with respectively the PV and live virus assays for the indicated virus strains.
  • Alphabody constructs CMPX-626C and CMPX-626D are GRFT fusions. The non-GRFT fused construct CMPX-624N is shown for comparison.
  • Table 3 shows the binding and antiviral activity results for CMPX-624N, i.e. the non-GRFT fused Alphabody construct which performed the best in binding and PV assays (Tables 1 and 2). Here it was also tested in the live virus inhibition assay with the Omicron variant.
  • Alphabody constructs CMPX-626C and CMPX-626D are essentially the same Alphabody construct as CMPX-624N, but with N- and C- terminal GRFT fusions, respectively. The latter's binding and antiviral activities were tested in parallel in the same assays as for CMPX-624N. Construct CMPX-626D was only tested in the binding assay.
  • the non-fused construct CMPX-624N which performed very well in the binding assay and in PV assays with Wuhan and Delta strains, showed a remarkably poor activity with a 20 pM IC 5 o on the Omicron variant in the live virus assay (Table 3).
  • the GRFT protein only (O'Keefe et al., Proc Natl Acad Sci USA, 2009, 160(15):6099-104) was tested as a control in the live virus assay with the Omicron variant, and not any onset of activity was observed at the highest tested concentration of 4 pM.
  • the 0.17 pM IC 5 o of CMPX-626C is essentially due to the synergy between the glycan binding GRFT domain and the HR1 trimer binding Alphabody part, and not to the GRFT domain alone.
  • GRFT-fused Alphabody constructs may outbeat non-fused constructs, and the rationale behind the disclosed design constructs, is the ability of lectin domains to bind to N- linked glycans, which are abundantly present at the surface of Class-1 viral spike proteins including those of SARS-CoV-2. This was hypothesized to increase the local concentration of the inhibitory constructs of the present invention at the viral surface and thus in the immediate vicinity of the trimeric HR1 target region.
  • a second possible beneficial effect of lectin fusion was hypothesized to be related to the path of viral entry into a target cell: SARS-CoV variants are known to enter with diverse rates directly through the plasma membrane and/or indirectly via the endosomal pathway. The first hypothesis, i.e.
  • the increase of local concentration may be at the basis of improved potencies of CMPX-626C compared to CMPX-624N in the PV assays with the Wuhan and Delta variants.
  • the second hypothesis may be in line with the recently reported preferential entry pathway of the Omicron variant via endocytosis rather than via direct plasma membrane fusion. Indeed, the remarkably poor activity of CMPX-624N on the live Omicron variant (Table 3) appears to be compensated >100-fold by the N-terminally fused GRFT domain.
  • GRFT fusion domain Since the role of the GRFT fusion domain is essentially to allow the Alphabody construct to 'home' onto the viral spike surface, this concept can in principle also be extended to fusion between specific HR1- targeting Alphabody constructs and alternative domains with glycan binding capacity.
  • alternative glycan binding protein domain is human surfactant protein D (hSP-D).
  • hSP-D human surfactant protein D
  • the advantage of such human protein is the fact that it is likely less immunogenic than for example the griffithsin protein from red algae.
  • Another, specific, advantage of human surfactant protein D is the fact that it is naturally occurring in the lungs of human beings, so it should be well tolerated.
  • hSP-D to Alphabody constructs of the present invention in a similar manner as for CMPX- 626C and CMPX-626D, is expected to enhance antiviral activity, including for SARS-CoV-2 variants that enter target cells via the endosomal pathway.
  • Example 5 Alphabodies as taught herein inhibit infection of U87.ACE2 + cells and Calu-3 cells with different SARS-CoV2 variants
  • Alphabody 626C (see Table 3) and 633D (SEQ ID NO: 29) were expressed and purified as described in Example 1.
  • Alphabody 633D is not fused to Griffithsin (GRFT).
  • Alphabody 633D comprises a C-terminal myc-tag (EQKUSEEDL; SEQ. ID NO: 39) for Alphabody detection in, for example ELISA assays, and a His-tag (HHHHHH; SEQ ID NO: 40) for purification purposes by, for example, IMAC chromatography.
  • Both Alphabody 626C and 633D comprise a Serine at the heptad e-position of the first heptad repeat unit of HRS1 to improve the "on-rate" of binding.
  • Human glioblastoma U87 MG cells (Cat. No. HTB-14), human adenocarcinomic alveolar epithelial cells A549 (Cat. No. CCL-185), human Embryonic Kidney 293T (HEK293T) cells (Cat. No. CRL- 3216), human adenocarcinomic bronchial epithelial cells Calu3 (Cat. No. HTB-55) and African green monkey kidney Vero E6 cells (Cat. No.
  • CRL-1586 were obtained from ATCC as mycoplasma-free stocks and grown in Dulbecco's Modified Eagle Medium (DMEM, Thermo Fisher Scientific) supplemented with 10% (v/v) fetal bovine serum (FBS; HyClone).
  • DMEM Dulbecco's Modified Eagle Medium
  • FBS fetal bovine serum
  • U87 MG cells were stably transfected with the ACE2 receptor to generate the U87.ACE2+ cells as described in detail in Vanhulle E. et al., SARS-CoV-2 Permissive glioblastoma cell line for high throughput antiviral screening, Antiviral Res. 2022 Jul; 203:105352.
  • A549 cells were stably transfected with the ACE2 receptor to generate the A549.ACE2+ cells as reported in a recent publication (Vanhulle E. et al., Carbohydrate-binding protein from stinging nettle as fusion inhibitor for SARS-CoV-2 variants of concern, Front. Cell. Infect. Microbiol., 30 August 2022, Sec. Virus and Host, vol. 12. 12:989534.
  • SARS-CoV 2 Severe Acute Respiratory Syndrome coronavirus 2 isolates
  • SARS-CoV-2 variants of concern were used in this study: Wuhan-Hu-1 strain hCoV19/Belgium/GHB-03021/2020 (GISAID accession number EPI_ISL_407976), 20A.EU2 strain (clinical isolate Al), Delta strain (IND-B.1.617.2; EPI_ISL_2425097) and Omicron strain (RSA-B.l.1.529; EPI_ISL_7413964).
  • SARS-CoV-2 viral stocks were prepared by inoculation of confluent Vero E6 cells in a 150 cm 2 culture flask at MOI of 0.02 in viral growth medium (DMEM supplemented with 2 % heat-inactivated FBS, 1 mM sodium Pyruvate and lx MEM NEAA). After one hour incubation at 37 °C, viral growth media was added to bring the final volume to 25 mL. Virus-exposed cells were monitored by microscopy for the generation of cytopathic effect (CPE) on consecutive days. When all cells were infected and full CPE was obtained (i.e., at peak of infection), cell supernatant was harvested, cleared by centrifugation and supernatant was aliquoted and stored at -80 °C.
  • CPE cytopathic effect
  • the different SARS-CoV-2 strains were added to Vero E6 cells at an MOI of 0.02, as determined by end-point dilution titration on Vero E6 cells and calculated by the tissue culture infectious dose 50 (TCID50) method of Reed and Muench. The viral genome sequence was verified, and all infections were performed with passage 3 to 5.
  • TCID50 tissue culture infectious dose 50
  • U87.ACE2+ cells were seeded one day prior to infection (20 000 cells/0.1 mL in a 96-well plate). Next day, supernatant was removed and virus (0.1 mL) and a dilution range of test compound (0.1 mL) were added to the cells, and cells were incubated at 37°C for another 4 days. Virus input was not removed from the cells. At day 4 post infection, cell viability was quantified (by MTS) as a measure of virus- induced cytopathic effect (CPE).
  • CPE virus- induced cytopathic effect
  • SARS-CoV-2 strain Wuhan-Hu-1 (MOI of 0.03)
  • SARS-CoV-2 strain Omicron BA.l (MOI of 0.08) 5.1.4 SARS-CoV-2 infection of differentiated Calu-3 cells
  • Calu-3 cells were grown in EMEM medium (Lonza), supplemented with 10% FBS (Hyclone) and 1 % L- glutamine (TFS). Once cells reached 70-80% confluency, cells were detached and seeded on 24 Well ThincertTM transwell inserts with a 0.4 pm pore size (Greiner Bio-One) at a density of 100 000 cells/well. Cells were submerged for 7 days until a confluent monolayer was formed. Next, by removing the medium of the apical compartment, cells were placed in air-liquid interface (ALI) for 21 days to further differentiate the cells. During this differentiation phase, every other day the basolateral medium of the ALI cultures was replaced by fresh medium, and the transepithelial/transendothelial electrical resistance (TEER) was measured the monitor the monolayer integrety.
  • ALI air-liquid interface
  • Fully differentiated Calu-3 cells were exposed apically with virus or a mixture of virus and compound (in 100 pl medium) for 1.5h. Then, the medium solution with virus (and compound) was removed from the cells, and the cells were washed once with PBS (200 pl). Next, the apical side of the cell culture was exposed to air again. At 24h post infection, cells were washed apically with 200 pl PBS, and 140 pl of this collected apical wash fraction is mixed with lysis buffer and analyzed for virus release (RT-qPCR, see below). After the wash, the apical side of the cell culture was exposed to air again. The same wash procedure was repeated at 72h post infection.
  • SARS-CoV-2 strain 20A.EU2 (MOI of 1)
  • the cell viability of mock- and virus-infected cells was assessed spectrophotometrically via the in situ reduction of the tetrazolium compound 3-(4,5-dimethylthiazol-2- yl)-5-(3-carboxy-methoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium inner salt, using the CellTiter 96 AQueous One Solution Cell Proliferation Assay (Promega).
  • the absorbances were read in an eightchannel computer-controlled photometer (Multiscan Ascent Reader, Labsystem, Helsinki, Finland) at two wavelengths (490 and 700 nm).
  • the optical density (OD) of the samples was compared with sufficient cell control replicates (cells without virus and compound) and virus control wells (cells with virus but without compound).
  • Primers and probes for a duplex RT-qPCR were designed to detect the nucleocapsid (N) and envelope (E) gene of SARS-CoV-2 according to Centers for Disease Control and Prevention (CDC, USA; Cat. n° 2019- nCoVEUA-01) and Charite (Berlin, Germany), respectively. Those primer sequences were selected to target conserved regions of the viral genome of SARS-CoV-2 specifically and no other human coronaviruses. Primers and probes were obtained from Integrated DNA Technologies (IDT, Leuven, Belgium). In order to perform a duplex RT-qPCR, probes with matching fluorescent dyes (i.e., FAM and HEX) were designed accordingly.
  • FAM and HEX fluorescent dyes
  • N2 the following probe was used: FAM- ACAATTTGCCCCCAGCGCTTCAG(BHQl) (SEQ ID NO.: 37) and for E: HEX- ACACTAGCC(ZEN)ATCCTTACTGCGCTTCG(3IABkFQ) (SEQ. ID NO.: 38).
  • Final concentration of combined primer/probe mix consist of 500 nM forward and reverse primer and 250 nM probe.
  • the qPCR plate was sealed and read in the FAM and HEX channels using a QuantstudioTM 5 Real- Time PCR system (TFS) under the following cycling protocol: 50°C for 5 min (reverse transcription), 95°C for 20 seconds (DNA polymerase activation), followed by 45 cycles of 95°C for 3 seconds (denaturation) and 55°C for 30 seconds (annealing and fluorescence collection) followed by an infinite 4°C hold.
  • TFS QuantstudioTM 5 Real- Time PCR system
  • Transfection mixes were prepared with 2.5 pg pCAGGS.SARS-CoV-2_SA19_fpl_mNG2(ll)_opt plasmid encoding for SARS-CoV-2 spike protein for HEK293T transfection; and 2.5 pg pcDNA3.1.mNG2(l-10) for A549.ACE2+ transfection.
  • HEK293T cells were allowed to incubate for 24h for efficient exogenous spike protein expression.
  • transfected A549.ACE2+ cells were digested with 0.05% trypsin, washed, resuspended and counted on a Luna cell counter (Logos Biosystems), added to a 96- well plate at 2.2 x 10 4 cells per well and incubated for 18h.
  • transfected HEK293T cells were collected, digested with 0.25% trypsin, washed, resuspended, counted and administered to the A549.ACE2+ cells at 2 x 10 4 cells per well. Fusion events were visualized for 24h at 20 min intervals using the IncuCyte® S3 Live-Cell Analysis System (Sartorius).
  • Phase contrast and GFP images (4 per well) were taken using a 20x objective lens at 10-minute intervals for a 5 hours period, and 1 hour intervals afterwards. Image processing was performed using the IncuCyte® software. 5.1.8 Cellular Electrical Impedance cell-cell fusion assay
  • RTCA Real-Time Cell Analyzer
  • E-plates were placed at room temperature for 15 min and then transferred to the xCELLigence RTCA instrument, located in an incubator at 37 °C and 5% CO2. The attachment and overnight growth of the cells was monitored (measurement every 20 min). Cell adherence and growth result in an increase in Cl followed by a flattening of the curve when the cells reach confluency.
  • HEK293T cells 400 000 cells per well in growth medium supplemented with 10% FBS
  • S-expressing plasmid were transfected with an S-expressing plasmid.
  • a short CEI normalisation measurement (5 consecutive measurements, every 5 s) was performed on the A549 cell monolayer.
  • overlay step 15 000 cells per well
  • an equal number of HEK293T cells mock-transfected with empty vector is added to the A549.ACE2+ cells instead.
  • the A549.ACE2+ monolayer is monitored over time for 24h and data points are displayed every 2 minutes.
  • the CEI biosensor monitors the Cell Index (Cl), a dimensionless parameter derived from the frequencydependent resistance (R) component of the impedance value (Z) at 10, 25 and 50 kHz frequency.
  • Cl Cell Index
  • R frequencydependent resistance
  • Z impedance value
  • Raw Cl values were used as a starting point for data manipulations. All data are first normalized to the baseline before the overlay step, to reduce inter-well variation. Spike-dependent fusion was calculated by subtracting the Cl values of A549.ACE2+:HEK293T.empty_vector overlay (spike independent) from the Cl changes of the A549.ACE2+:HEK293T.spike overlay (spike-dependent + independent). This results in a baseline-corrected normalized Cl measure.
  • AB 626C exerted a clear concentration-dependent inhibition of Wuhan-Hu-1 replication in the U87.ACE2+ cells, with an IC 5 o value of 0.27 pM.
  • AB 633D had no antiviral effect up to 5 pM, and the inhibitory effect of Griffithsin (GRFT) on Wuhan-Hu-1 in these cells was rather limited (17% reduction in CPE with 5 pM GRFT).
  • ALI air-liquid-interface cultures of differentiated human lung epithelial Calu-3 cells were used that represent a more physiologically relevant infection model for SARS-CoV-2.
  • ALI cultures of Calu-3 cells were briefly exposed (1.5 hour) at the apical side to the Omicron variant of SARS-CoV-2 together with the test compound. After the 1.5 hour infection, virus input (and compound) was removed, cells were washed with PBS and exposed again to air for the duration of the experiment. At 3 days post infection, the virus particles that were released at the apical side of the ALI cultures were collected (PBS wash), and the viral content of the apical wash was determined by RT-qPCR detection of the viral genome.
  • AB 626C exerted a clear concentration-dependent inhibition of Omicron infection of the ALI culture, with nearly full protection at 0.1 pM concentration.
  • AB 633D also showed a profound antiviral effect, whereas GRFT (at 1 pM) was inactive against Omicron in the ALI infection culture.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Virology (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Physics & Mathematics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Plant Pathology (AREA)
  • Oncology (AREA)
  • Microbiology (AREA)
  • Communicable Diseases (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Pulmonology (AREA)
  • Immunology (AREA)
  • Peptides Or Proteins (AREA)

Abstract

Present invention provides polypeptides capable of inhibiting a betacoronavirus, such as SARS-CoV-2 variants, comprising an N-terminal extension region directly fused to the N-terminus of HRS1 of the Alphabody sequence, wherein the N-terminal extension region comprises a sequence having at least 70% sequence identity with SEQ ID NO: 1 and the HRS1 of the Alphabody sequence comprises a sequence having at least 70% sequence identity with SEQ ID NO: 2. Also provided herein is a nucleic acid sequence encoding such polypeptide and a pharmaceutical composition comprising said polypeptide. Further provided herein is the use of such polypeptide or pharmaceutical composition as a medicament and for use in the treatment and/or prevention of a betacoronavirus infection.

Description

POLYPEPTIDES CAPABLE OF INHIBITING SARS-COV-2 VIRUSES
FIELD OF THE INVENTION
The present invention relates to agents capable of inhibiting betacoronaviruses, preferably SARS-CoV- 2, which agents are suitable for use in prophylactic or therapeutic applications.
BACKGROUND OF THE INVENTION
Coronaviruses (CoVs) are enveloped single-stranded RNA viruses. The envelope consists of a lipid bilayer in which viral glycoproteins are embedded, including the spike protein (S protein) that plays a key role in the viral infection process. Most often, coronaviruses cause mild respiratory illnesses generally referred to as common cold. However, in this century, prior to 2019, severe acute respiratory diseases caused by coronaviruses from the beta-group of HCoVs have emerged at two time points: SARS-CoV first observed in 2002 in China and associated with a mortality rate of 10% and in 2013 MERS-CoV emerging in the Middle East with very high (~35%) case-fatality rate as reported by World Health Organisation (WHO). These disastrous disease outbreaks are qualified as zoonotic diseases resulting from coronavirus interspecies jumping. Such interspecies jumping is likely also at the basis of the appearance in 2019 of SARS-CoV-2 (initially named 2019-nCoV) and causing a first outbreak in late 2019 of viral pneumonia in Wuhan. This beta-coronavirus showed ~89% nucleotide identity with bat SARS- like-CoVZXC21, suggesting that bats may have been the source leading to the emergence of SARS-CoV- 2.
The disease caused by SARS-CoV-2, referred to as COVID-19, first spread in China and rapidly grew into a pandemic. In the spring of 2020, the mortality numbers peaked, with case fatality rates (CFR) exceeding 10% in some countries (https://ourworldindata.org/mortality-risk-covid), where CFR is the ratio of confirmed deaths over confirmed disease cases. While this number is far from easy to interpret, it was well recognized that although a relatively small fraction of COVID-19 patients needed hospitalization in an Intensive Care Unit (ICU), each country faced a severe ICU capacity strain. The latter necessitated a nation-wide lock-down of economic and social activities in many countries across the world, aiming to dampen the spread of the disease and preventing a collapse of the medical system. The severity of this pandemic is a strong motivator for pharmaceutical companies and academic institutions across the world to discover and develop effective solutions to prevent or cure COVID-19. In addition, the inherent possibility that new SARS-CoV-2 variants or even other pathogenic human coronaviruses may emerge, is expected to result in a long-lasting interest from pharma companies with regard to the discovery and development of new anti-coronavirus compounds.
There thus remains a need in the art for improved agents capable of inhibiting betacoronavirusses, such as SARS-CoV-2. SUMMARY OF THE INVENTION
Present inventors have found that a polypeptide comprising an N-terminal extension region directly fused to the N-terminus of HRS1 of an Alphabody sequence, wherein the N-terminal extension region comprises a sequence having at least 70% sequence identity with the sequence VDLGDISGIEASSVNIQAEISQLN (SEQ ID NO: 1), and HRS1 of the Alphabody sequence comprises a sequence having at least 70% sequence identity with the sequence IVAISLGITAIQYSIQSL (SEQ. ID NO: 2) can be used in the treatment and/or prevention of a beta-coronavirus infection, such as a severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection. More particularly, present inventors found that such polypeptide is able to block the formation of the post-fusion 6-helix bundle structure of HRS1 and HRS2 of SARS-CoV-2, thereby impairing effective viral entry of SARS-CoV-2 into a host cell. This is because the N-terminal extension region and the HRSl of the Alphabody sequence of present invention, which together mimic the HR2 region of SARS-CoV-2, effectively compete with HR2 for binding to trimeric HR1.
A first aspect provides a polypeptide capable of inhibiting a beta-coronavirus, comprising an Alphabody sequence, wherein the Alphabody sequence has the general formula HRS1-L1-HRS2-L2-HRS3,
- wherein each of HRS1, HRS2 and HRS3 is independently an alpha-helical heptad repeat sequence (HRS) comprising 2 to 4 consecutive heptad repeat units,
- wherein said heptad repeat units are 7-residue (poly)peptide fragments represented as 'abcdefg' or 'defgabc', wherein the symbols 'a1 to 'g' denote conventional heptad positions,
- wherein at least 50% of all heptad a- and d-positions are occupied by isoleucine residues,
- wherein each HRS starts and ends with an aliphatic or aromatic amino acid residue located at a heptad a-position or d-position,
- wherein each of LI and L2 are independently a linker fragment, which covalently connect HRS1 to HRS2 and HRS2 to HRS3, respectively, characterized in that
- the polypeptide comprises an N-terminal extension region directly fused to the N-terminus of HRS1 of the Alphabody sequence, wherein the N-terminal extension region comprises a sequence having at least 70% sequence identity with the sequence VDLGDISGIEASSVNIQAEISQLN (SEQ ID NO: 1), and
- HRS1 of the Alphabody sequence comprises a sequence having at least 70% sequence identity with the sequence IVAISLGITAIQYSIQSL (SEQ ID NO: 2).
In particular embodiments, the beta-coronavirus is severe acute respiratory syndrome coronavirus 1 (SARS-CoV-1) or severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), preferably SARS-CoV- In particular embodiments, a glycan binding domain is fused to the N-terminal extension region or to the Alphabody sequence via a flexible spacer sequence, preferably wherein the flexible spacer sequence comprises from 15 to 35 amino acid residues.
In particular embodiments, the glycan binding domain is fused to the N-terminus of the N-terminal extension region.
In particular embodiments, the glycan binding domain is fused to the C-terminus of the HRS3 of the Alphabody sequence.
In particular embodiments, the glycan binding domain is a lectin chosen from the group consisting of Griffithsin and Human Surfactant Protein D.
A further aspect provides a nucleic acid sequence encoding the polypeptide as taught herein.
A further aspect provides a pharmaceutical composition comprising the polypeptide as taught herein or the nucleic acid sequence as taught herein, and a pharmaceutically acceptable carrier.
A further aspect provides the polypeptide as taught herein, the nucleic acid sequence as taught herein or the pharmaceutical composition as taught herein for use as a medicament.
A further aspect provides the polypeptide as taught herein, the nucleic acid sequence as taught herein or the pharmaceutical composition as taught herein for use in the treatment and/or prevention of a betacoronavirus infection, preferably a SARS-CoV-2 infection.
These and further aspects and preferred embodiments of the invention are described in the following sections and in the appended claims. The subject-matter of the appended claims is hereby specifically incorporated in this specification.
DESCRIPTION OF THE DRAWINGS
Figure 1. Layout of the S protein. SP: signal peptide, SI: subunit 1, FP: fusion peptide, HR1: heptad repeat domain 1, HR2: heptad repeat domain 2, TM: transmembrane domain, CP: cytoplasmic domain Figure 2. Definition and structural features of the SARS-CoV-2 HR2 sequence and corresponding sequence elements in anti-SARS-CoV-2 Alphabody constructs. Line 1: secondary structure of the SARS- CoV-2 HR2 sequence as observed in the structure coordinates (PDB file 6LXT) of the post fusion core of 2019-nCoV S2 subunit as annotated under Protein Data Bank (PDB) under DOI: 10.2210/pdb6LXT/pdb; E, extended; H, alpha-helical. Line 2: the SARS-CoV-2 (SARS2) HR2 sequence (amino acid residues 1164 to 1205 of the SARS-CoV-2 surface glycoprotein sequence as annotated under NCBI GenBank accession number sequence YP_009724390.1). Line 4: definition of the N-terminal extension and HRS1 parts (Nt- HRS1 sequences) in the anti-SARS-CoV-2 Alphabody constructs listed thereunder. Line 5: annotation of heptad a- and d-positions in the HRS1 sequences of anti-SARS-CoV-2 Alphabody constructs. Lines 6-12: Nt-HRSl sequences of CMPX-587B, -583Q., -599B, -614D, -624N, -626C and -633D, respectively. Differences with the SARS-CoV-2 HR2 sequence in line 2 are highlighted in grey.
Figure 3. Correlation between antiviral potency (Wuhan SARS-CoV-2 strain) and binding affinity.
Figure 4. Alphabody 626C inhibits infection of U87.ACE2+ cells with different SARS-CoV-2 variants of concern. U87.ACE2+ cells were infected with different variants of SARS-CoV-2 (Wuhan-Hu-1, MOI 0.04; Delta, MOI 0.008; Omicron, MOI 0.05) in the presence of increasing concentrations of test compound. Cells were incubated with virus and test compound for 4 days. Virus-induced cytopathic effect was quantified by an MTS-based viability measurement at day 4 post infection. OD values were used to calculate the % inhibition of viral replication and to plot a concentration-response curve.
Figure 5. Alphabodies inhibit Omicron SARS-CoV-2 infection of differentiated Calu-3 cells in an air-liquid- interface (ALI) culture. ALI cultured Calu-3 cells were exposed apically to live SARS-CoV-2 virus (Omicron strain; MOI 0.01) in the absence or presence of test compound for 1.5 hour. Next, cells were washed apically with PBS to remove virus input (and test compound) and re-exposed to air to maintain the ALI culture. At 3 days post infection, cells were washed apically with PBS to collect the released virus particles and SARS-CoV-2 replication was assessed by RT-qPCR analysis of the viral copy numbers of the N gene in the apical wash.
DETAILED DESCRIPTION OF THE INVENTION
As used herein, the singular forms "a", "an", and "the" include both singular and plural referents unless the context clearly dictates otherwise.
The terms "comprising", "comprises" and "comprised of" as used herein are synonymous with "including", "includes" or "containing", "contains", and are inclusive or open-ended and do not exclude additional, non-recited members, elements or method steps. The terms also encompass "consisting of" and "consisting essentially of", which enjoy well-established meanings in patent terminology.
The recitation of numerical ranges by endpoints includes all numbers and fractions subsumed within the respective ranges, as well as the recited endpoints.
The terms "about" or "approximately" as used herein when referring to a measurable value such as a parameter, an amount, a temporal duration, and the like, are meant to encompass variations of and from the specified value, such as variations of ± 10% or less, preferably ± 5% or less, more preferably ± 1% or less, and still more preferably ± 0.1% or less of and from the specified value, insofar such variations are appropriate to perform in the disclosed invention. It is to be understood that the value to which the modifier "about" refers is itself also specifically, and preferably, disclosed.
Whereas the terms "one or more" or "at least one", such as one or more members or at least one member of a group of members, is clear per se, by means of further exemplification, the term encompasses inter alia a reference to any one of said members, or to any two or more of said members, such as, e.g., any >3, >4, >5, >6 or >7 etc. of said members, and up to all said members. In another example, "one or more" or "at least one" may refer to 1, 2, 3, 4, 5, 6, 7 or more.
The discussion of the background to the invention herein is included to explain the context of the invention. This is not to be taken as an admission that any of the material referred to was published, known, or part of the common general knowledge in any country as of the priority date of any of the claims.
Throughout this disclosure, various publications, patents and published patent specifications are referenced by an identifying citation. All documents cited in the present specification are hereby incorporated by reference in their entirety. In particular, the teachings or sections of such documents herein specifically referred to are incorporated by reference.
Unless otherwise defined, all terms used in disclosing the invention, including technical and scientific terms, have the meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. By means of further guidance, term definitions are included to better appreciate the teaching of the invention. When specific terms are defined in connection with a particular aspect of the invention or a particular embodiment of the invention, such connotation is meant to apply throughout this specification, i.e., also in the context of other aspects or embodiments of the invention, unless otherwise defined.
In the following passages, different aspects or embodiments of the invention are defined in more detail. Each aspect or embodiment so defined may be combined with any other aspect(s) or embodiment(s) unless clearly indicated to the contrary. In particular, any feature indicated as being preferred or advantageous may be combined with any other feature or features indicated as being preferred or advantageous.
Reference throughout this specification to "one embodiment", "an embodiment" means that a particular feature, structure or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention. Thus, appearances of the phrases "in one embodiment" or "in an embodiment" in various places throughout this specification are not necessarily all referring to the same embodiment, but may. Furthermore, the particular features, structures or characteristics may be combined in any suitable manner, as would be apparent to a person skilled in the art from this disclosure, in one or more embodiments. Furthermore, while some embodiments described herein include some but not other features included in other embodiments, combinations of features of different embodiments are meant to be within the scope of the invention, and form different embodiments, as would be understood by those in the art. For example, in the appended claims, any of the claimed embodiments can be used in any combination. Of particular relevance for the present invention is the coronavirus surface, especially the envelope spike (S) glycoprotein. Each spike comprises three S proteins associated as a trimeric complex. The S protein is a class I transmembrane glycoprotein composed of the SI and S2 subunits, as shown schematically in Figure 1. The SI subunit contains the receptor binding domain (RBD), and the S2 subunit, which harbors the fusion machinery, is anchored via the TM in the viral membrane.
The spike is involved in the target cell attachment via the RBD binding to the host cell receptor angiotensin converting enzyme 2 (ACE2) for SARS-CoV-1 and SARS-CoV-2 and dipeptidyl peptidase 4 (DPP4) for MERS-CoV. As evidenced by cryo-EM, only one RBD of the SARS-CoV trimeric S glycoprotein binds ACE2. In addition, it was shown that TMPRSS2, a type II transmembrane-bound serine protease, is used by SARS-CoV-2 for priming (i.e., processing by proteolytic cleavage) the S protein. Receptor binding and priming of S protein by host proteases leads to a cascade of conformational rearrangements that drive the viral fusion process, eventually leading to cell entry through a pre- to postfusion conformational transition.
The same fusion entry mechanism applies to enveloped viruses having a class-1 viral transmembrane fusion glycoprotein such as CoV, HIV, RSV and Influenza. As described by Xia et al. (2019), after receptor engagement and subsequent conformational rearrangements in the S2 subunit of the coronavirus S protein, the fusion peptide (FP) inserts into the host membrane. Upon formation of a trimeric assembly of heptad repeat region 1 (HR1), three grooves are formed at the surface of trimeric HR1. Heptad repeat region 2 (HR2) binds onto these grooves, leading to a 6-helix bundle (post-fusion) structure that brings the viral and cellular membranes together, culminating in viral entry in the cell.
Present inventors have found that a polypeptide comprising an N-terminal extension region directly fused to the N-terminus of HRS1 of an Alphabody sequence, wherein the N-terminal extension region comprises a sequence having at least 70% sequence identity with the sequence VDLGDISGIEASSVNIQAEISQLN (SEQ ID NO: 1), and HRS1 of the Alphabody sequence comprises a sequence having at least 70% sequence identity with the sequence IVAISLGITAIQYSIQSL (SEQ. ID NO: 2) is able to block the formation of the post-fusion 6-helix bundle structure of HRS1 and HRS2 of SARS- CoV-2, thereby impairing effective viral entry of SARS-CoV-2. This is because the N-terminal extension region and the HRS1 of the Alphabody sequence of present invention, which together mimic the HR2 region of SARS-CoV-2, effectively compete with HR2 for binding to trimeric HR1.
Furthermore, the Alphabody's coiled coil structure is structurally extremely stable. Hence, the alphahelical region formed by (part of) the N-terminal extension region and HRS1 will at any time remain alpha-helical, even when not bound to its target region, the HRl-trimer. Moreover, the helical regions within the polypeptides of the present invention do not entail an entropic cost as a result of folding as an alpha-helix only upon binding to the HR1 trimer. In addition, it is also well known that stable alpha-helical regions are less susceptible to proteolytic cleavage. Yet a further advantage of the polypeptides of the present invention is that additional functional properties can be engineered within, or onto the non-binding part of the Alphabody scaffold region, such as, for example, fusion domains endowing the Alphabody constructs with the capacity to bind to viral spike regions other than HR1, such as for example a glycan binding domain, thereby allowing the Alphabody constructs to increase their local concentration in the immediate vicinity of the virus.
The inventors have found that it is possible to mimic a specific helical part of HR2 by one of the Alphabody helices so as to generate a polypeptide comprising an Alphabody sequence which impedes the coronavirus machinery. Furthermore, present inventors have also found that additional parts from HR2 may be added to the Alphabody to enhance binding to trimeric HR1. Such polypeptides are able to block the formation of the post-fusion 6-helix bundle structure, thereby impairing viral entry.
More particularly they have performed a structural alignment of one of the alpha-helical heptad repeat sequences (HRS) of the Alphabody scaffold with an alpha-helical part observed within a HR2 structure, in particular an X-ray structure of a postfusion 6-helix bundle structure, such as the structure of the postfusion core of the 2019-nCoV S2 subunit having PDB code 6LXT as annotated under Protein Data Bank (PDB) under DOI: 10.2210/pdb6LXT/pdb; they then selected, from that structural alignment, amino acids from the HR2 sequence that can be transferred onto corresponding amino acid positions within the aligned Alphabody heptad repeat sequence and identified accompanying substitutions to optimally accommodate the transferred moieties within the complex; they then further identified additional interactions with the target, including N- or C-terminal extensions flanking the designed alpha-helical region.
As used herein, an 'Alphabody' or 'Alphabodies' can generally be defined as sequences of amino acids which are single-chain, triple-stranded, predominantly alpha-helical, coiled coil amino acid sequences. More particularly, an Alphabody structure as used in the context of the present invention can be defined as an amino acid sequence having the general formula HRS1-L1-HRS2-L2-HRS3, wherein
• each of HRS1, HRS2 and HRS3 is independently a heptad repeat sequence (HRS) comprising or consisting of 2 to 7, preferably 2 to 4, consecutive heptad repeat units, at least 50% of all heptad a- and d-positions are occupied by isoleucine residues, each HRS starts and ends with an aliphatic or aromatic amino acid residue located at a heptad a-position or d-position;
• each of LI and L2 are independently a linker fragment, as further defined hereinafter, which covalently connect HRS1 to HRS2 and HRS2 to HRS3, respectively. The consecutive heptad repeat units are not necessarily identical.
Present inventors found that HRS with 2 to 4 consecutive heptad repeats are preferred over HRS with more consecutive heptad repeats as these provide less steric hindrance when used for inhibiting SARS- CoV-2. In the Alphabody or Alphabody structure as defined above, HRS1, HRS2 and HRS3 will together form a triple-stranded, alpha-helical, coiled coil structure.
As used herein, an 'antiparallel Alphabody' refers to an Alphabody as defined above, further characterized in that the alpha-helices of the triple-stranded, alpha-helical, coiled coil structure together form an antiparallel coiled coil structure, i.e., a coiled coil wherein two alpha-helices are parallel and the third alpha-helix is antiparallel with respect to these two helices.
As will become clear from the further description herein, the application envisages polypeptides comprising an amino acid sequence with the general formula HRS1-L1-HRS2-L2-HRS3, but which in certain particular embodiments may comprise additional residues, moieties and/or groups which are covalently linked, more particularly N- and/or C-terminally covalently linked, to a basic Alphabody sequence structure having the formula HRS1-L1-HRS2-L2-HRS3. Thus reference is made herein generally to '(Alphabody) polypeptides' which comprise or consist of an Alphabody as defined above, which may be covalently linked to additional sequences. The binding features described for an Alphabody herein can generally also be applied to polypeptides comprising said Alphabody.
The terms 'heptad1, 'heptad unit' or 'heptad repeat unit' are used interchangeably herein and shall herein have the meaning of a 7-residue (poly)peptide motif that is repeated two or more times within each heptad repeat sequence of an Alphabody structure, and is represented as 'abcdefg' or 'defgabc', wherein the symbols 'a' to 'g' denote conventional heptad positions. As understood by the skilled person this implies that the consecutive heptad units within a repeat need not contain the same amino acids but will contain the same type of amino acid (hydrophobic vs. polar, as detailed below) at the same position. Conventional heptad positions are assigned to specific amino acid residues within a heptad, a heptad unit, or a heptad repeat unit, present in an Alphabody structure, for example, by using specialized software such as the COILS method of Lupas et al. (Science 1991, 252:1162-1164; https://embnet.vital-it.ch/software/COILS_form.html). However, it is noted that the heptads or heptad units as present in the Alphabody structure are not strictly limited to the above-cited representations (i.e. 'abcdefg' or 'defgabc') as will become clear from the further description herein and in their broadest sense constitute a 7-residue (poly)peptide fragment per se, comprising at least assignable heptad positions a and d.
The terms 'heptad a-positions', 'heptad b-positions', 'heptad c-positions', 'heptad d-positions', 'heptad e-positions', 'heptad f-positions' and 'heptad g-positions' refer respectively to the conventional 'a', 'b', 'c', 'd ', 'e', 'f' and 'g' amino acid positions in a heptad, heptad repeat or heptad repeat unit. A heptad motif (as defined herein) of the type 'abcdefg' is typically represented as 'HPPHPPP' (SEQ ID NO: 3, whereas a 'heptad motif of the type 'defgabc' is typically represented as 'HPPPHPP', wherein the symbol ' H ' denotes an apolar or hydrophobic amino acid residue and the symbol 'P' denotes a polar or hydrophilic amino acid residue. Typical hydrophobic residues located at a- or d-positions include aliphatic (e.g., leucine, isoleucine, valine, methionine) or aromatic (e.g., phenylalanine) amino acid residues. Heptads within coiled coil sequences do not always comply with the ideal pattern of hydrophobic and polar residues, as polar residues are occasionally located at 'H' positions and hydrophobic residues at 'P' positions. Thus, the patterns 'HPPHPPP' (SEQ. ID NO: 3) and 'HPPPHPP' (SEQ ID NO: 4) are to be considered as ideal patterns or characteristic reference motifs.
A 'heptad repeat sequence' ('HRS') as used herein shall have the meaning of an amino acid sequence or sequence fragment comprising or consisting of n consecutive heptads, where n is a number equal to or greater than 2.
A heptad repeat sequence (HRS) can thus generally be represented by (abcdefg)n or (defgabc)n in notations referring to conventional heptad positions, or by (HPPHPPP)n (SEQ ID NO: 3) or (HPPPHPP)n (SEQ ID NO: 4) in notations referring to the heptad motifs, with the proviso that a) the amino acids at positions a-g or H and P need not be identical amino acids in the different heptads, b) not all amino acid residues in a HRS should strictly follow the ideal pattern of hydrophobic and polar residues, and c) the HRS may end with an incomplete or partial heptad motif. With regard to the latter, in particular embodiments, the HRS may contain an additional sequence "a", "ab", "abc", "abed", "abede", or "abedef" following C-terminally of the (abcdefg)n sequence. However, in particular embodiments of the Alphabody structure as envisaged herein, a 'heptad repeat sequence' ('HRS') is an amino acid sequence or sequence fragment comprising n consecutive (but not necessarily identical) heptads generally represented by abcdefg or defgabc, where n is a number equal to or greater than 2, wherein at least 50% of all heptad a- and d-positions are occupied by isoleucine residues, each HRS starting with a full heptad sequence abcdefg or defgabc, and ending with a partial heptad sequence abed or defga, such that each HRS starts and ends with an aliphatic or aromatic amino acid residue located at either a heptad a- or d-position.
In order to identify heptad repeat sequences, and/or their boundaries, these heptad repeat sequences comprising amino acids or amino acid sequences that deviate from the consensus motif, and if only amino acid sequence information is at hand, then the COILS method of Lupas et al. (Science 1991, 252:1162-1164) is a suitable method for the determination or prediction of heptad repeat sequences and their boundaries, as well as for the assignment of heptad positions. Furthermore, the heptad repeat sequences can be resolved based on knowledge at a higher level than the primary structure (i.e., the amino acid sequence). Indeed, heptad repeat sequences can be identified and delineated on the basis of secondary structural information (i.e. alpha-helicity) or on the basis of tertiary structural (i.e., protein folding) information. A typical characteristic of a putative HRS is an alpha-helical structure. Another (strong) criterion is the implication of a sequence or fragment in a coiled coil structure. Any sequence or fragment that is known to form a regular coiled coil structure, i.e., without stutters or stammers as described in Brown et al. Proteins 1996, 26:134-145, is herein considered a HRS. Also and more particularly, the identification of HRS fragments can be based on high-resolution 3-D structural information (X-ray or NMR structures). Finally, in particular embodiments, the boundaries to an HRS fragment may be defined as the first a- or d-position at which a standard hydrophobic amino acid residue (selected from the group valine, isoleucine, leucine, methionine, phenylalanine, tyrosine or tryptophan) is located. In particular embodiments, the boundaries to an HRS fragment can be defined by the presence of an isoleucine amino acid residue.
In the context of the single-chain structure of the Alphabodies (as defined herein) the terms 'linker', 'linker fragment' or 'linker sequence' are used interchangeably herein and refer to an amino acid sequence fragment that is part of the contiguous amino acid sequence of a single-chain Alphabody, and which covalently interconnect the HRS sequences of that Alphabody structure.
The linkers within a single-chain structure of the Alphabodies (as defined herein) thus interconnect the HRS sequences, and more particularly the first to the second HRS, and the second to the third HRS in an Alphabody structure. Each linker sequence in an Alphabody structure commences with the residue following the last heptad residue of the preceding HRS and ends with the residue preceding the first heptad residue of the next HRS. Connections between HRS fragments via disulfide bridges or chemical cross-linking or, in general, through any means of inter-chain linkage (as opposed to intra-chain linkage), are explicitly excluded from the definition of a linker fragment (at least, in the context of an Alphabody) because such would be in contradiction with the definition of a single-chain Alphabody. A linker fragment in an Alphabody structure is preferably flexible in conformation to ensure relaxed (unhindered) association of the three heptad repeat sequences as an alpha-helical coiled coil structure. Further in the context of an Alphabody, 'Ll' shall denote the linker fragment one, i.e., the linker between HRS1 and HRS2, whereas ' L2' shall denote the linker fragment two, i.e., the linker between HRS2 and HRS3. Suitable linkers for use in the polypeptides envisaged herein will be clear to the skilled person, and may generally be any linker used in the art to link amino acid sequences, as long as the linkers are structurally flexible, in the sense that they do not affect the characteristic three dimensional coiled coil structure of the Alphabody. The two linkers LI and L2 in a particular Alphabody structure may be the same or may be different. Based on the further disclosure herein, the skilled person will be able to determine the optimal linkers, optionally after performing a limited number of routine experiments. In particular embodiments, the linkers LI and L2 may be rigid or flexible peptide linkers. In particular embodiments, the linkers LI and L2 are amino acid sequences consisting of at least 4, in particular at least 8, more particularly at least 12 amino acid residues, with a non-critical upper limit chosen for reasons of convenience being about 30 amino acid residues
In the present application, reference to a 'coiled coil' or 'coiled coil structure' shall be used interchangeably herein and will be clear to the person skilled in the art based on the common general knowledge and the description and further references cited herein. Particular reference in this regard is made to review papers concerning coiled coil structures, such as for example, Cohen and Parry Proteins 1990, 7:1-15; Kohn and Hodges Trends Biotechnol 1998, 16:379-389; Schneider et al Fold Des 1998, 3:R29-R40; Harbury et al. Science 1998, 282:1462-1467; Mason and Arndt ChemBioChem 2004, 5:170-176; Lupas and Gruber Adv Protein Chem 2005, 70:37-78; Woolfson Adv Protein Chem 2005, 70:79-112; Parry et al. J Struct Biol 2008, 163:258-269; McFarlane et al. Eur J Pharmacol 2009:625:101- 107.
As used herein, amino acid residues will be indicated either by their full name or according to the standard three-letter or one-letter amino acid code.
For comparing two or more nucleotide sequences, the '(percentage of) sequence identity' between a first nucleotide sequence and a second nucleotide sequence may be calculated using methods known by the person skilled in the art, e.g. by dividing the number of nucleotides in the first nucleotide sequence that are identical to the nucleotides at the corresponding positions in the second nucleotide sequence by the total number of nucleotides in the first nucleotide sequence and multiplying by 100% or by using a known computer algorithm for sequence alignment such as NCBI Blast. In determining the degree of sequence identity between two Alphabodies, the skilled person may take into account so- called 'conservative' amino acid substitutions, which can generally be described as amino acid substitutions in which an amino acid residue is replaced with another amino acid residue of similar chemical structure and which has little or essentially no influence on the function, activity or other biological properties of the polypeptide. Possible conservative amino acid substitutions will be clear to the person skilled in the art. Typically, the percentage sequence identity is calculated over the entire length of the sequence. As used herein, the term "substantially identical" denotes at least 90%, preferably at least 95%, such as 95%, 96%, 97%, 98% or 99%, sequence identity. Alphabodies and nucleic acid sequences are said to be 'exactly the same' if they have 100% sequence identity over their entire length.
A first aspect of the invention provides a polypeptide capable of inhibiting SARS-CoV-2, comprising an Alphabody sequence, wherein the Alphabody sequence has the general formula HRS1-L1-HRS2-L2-HRS3,
- wherein each of HRS1, HRS2 and HRS3 is independently an alpha-helical heptad repeat sequence (HRS) comprising 2 to 4 consecutive heptad repeat units, - wherein said heptad repeat units are 7-residue (poly)peptide fragments represented as 'abcdefg' or 'defgabc', wherein the symbols 'a1 to 'g' denote conventional heptad positions,
- wherein at least 50% of all heptad a- and d-positions are occupied by isoleucine residues,
- wherein each HRS starts and ends with an aliphatic or aromatic amino acid residue located at a heptad a-position or d-position,
- wherein each of LI and L2 are independently a linker fragment, which covalently connect HRS1 to HRS2 and HRS2 to HRS3, respectively, characterized in that
- the polypeptide comprises an N-terminal extension region directly fused to the N-terminus of HRS1 of the Alphabody sequence, wherein the N-terminal extension region comprises, consists essentially of, or consists of a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, such as at least 96%, at least 97%, at least 98%, or at least 99%, preferably at least 95%, more preferably at least 99%, even more preferably 100%, sequence identity with the sequence VDLGDISGIEASSVNIQAEISQLN (SEQ ID NO: 1), and
- HRS1 of the Alphabody sequence comprises, consists of or consists essentially of a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, such as at least 96%, at least 97%, at least 98%, or at least 99%, preferably at least 95%, more preferably at least 99%, even more preferably 100%, sequence identity with the sequence IVAISLGITAIQYSIQSL (SEQ. ID NO: 2).
In particular embodiments, the polypeptide comprises an N-terminal extension region directly fused to the N-terminus of HRS1 of the Alphabody sequence, wherein the N-terminal extension region comprises, consists essentially of, or consists of a sequence VDLGDISGIEASSVNIQAEISQLN (SEQ ID NO: 1), or a sequence that differs by at most 7, at most 6, at most 5, at most 4, at most 3, at most 2 or at most 1 amino acid residue(s) from said sequence defined by SEQ ID NO: 1.
In particular embodiments, HRS1 of the Alphabody sequence comprises, consists essentially of or consists of a sequence IVAISLGITAIQYSIQSL (SEQ ID NO: 2), or a sequence that differs by at most 6, at most 5, at most 4, at most 3, at most 2 or at most 1 amino acid residue(s) from said sequence defined by SEQ ID NO: 2. The term "differ by" may refer to amino acid substitutions, additions and/or deletions, preferably substitutions.
As used herein, the terms 'inhibiting' or 'reducing' may refer to (the use of) a polypeptide as used herein that specifically binds to a betacoronavirus, and particularly inhibits, reduces and/or prevents the infection of a cell by the betacoronavirus, preferably by inhibiting, reducing and/or preventing entry of the betacoronavirus into the cell.
As used herein, and particularly in regard of SARS-CoV-2, the terms 'inhibiting' or 'reducing' may refer to (the use of) a polypeptide as used herein that specifically binds to trimeric HR1 of SARS-CoV-2 and inhibits, reduces and/or prevents the interaction between trimeric HR1 and HR2 of SARS-CoV-2, and as a result thereof, inhibits, reduces and/or prevents infection of a cell by the SARS-CoV-2 virus.
In particular embodiments, the betacoronavirus is a betacoronavirus using class I viral entry mechanism. In particular embodiments, the betacoronavirus is severe acute respiratory syndrome coronavirus (SARS-CoV or SARS-CoV-1) or severe acute respiratory syndrome coronavirus 2 (SARS-CoV2), or any variant thereof.
SARS-CoV-2 may be any variant of the SARS-CoV-2 virus. For example, the SARS-CoV-2 isolate Wuhan- Hu-1, the Delta variant of the SARS-CoV-2 virus (e.g. B.l.617.2), the Omicron variant of the SARS-CoV-2 virus (e.g. B.1.1.529), the Alpha variant (also known as the UK variant) of the SARS-CoV-2 virus (e.g. VOC 202012/01, B.1.1.7), the Gamma variant (also known as the Brazilian-Japanese variant) of the SARS- CoV-2 virus (e.g. B.1.1.28 or Pl), the Beta variant (also known as the South African variant) of the SARS- CoV-2 virus (e.g. VOC 501Y.V2, B. 1.351), the Lambda variant of the SARS-CoV-2 virus (e.g. C. 37), the Mu variant of the SARS-CoV-2 virus (e.g. B.1.621), the Epsilon variant (also known as the Californian variant) of the SARS-CoV-2 virus (e.g. B.1.429, B.1.427, or CAL.20.C), the Zeta variant (also known as the Brazilian variant ) of the SARS-CoV-2 virus (e.g. P.2), the Eta variant (also known as the UK/Nigeria variant) of the SARS-CoV-2 virus (e.g. B.1.525), the Theta variant of the SARS-CoV-2 virus (e.g. P3), the lota variant (also known as the New York variant) of the SARS-CoV-2 virus (e.g. B.1.526), the Kappa variant (also known as the Indian variant) of the SARS-CoV-2 virus (e.g. B.1.617.1), the 20A.EU1 variant of the SARS-CoV-2 virus, or the 20A.EU2 variant of the SARS-CoV-2 virus , preferably the SARS-CoV-2 virus is the SARS-CoV-2 isolate Wuhan-Hu-1, the Delta variant of the SARS-CoV-2 virus (e.g. B.l.617.2), the Omicron variant of the SARS-CoV-2 virus (e.g. B.1.1.529).
The indication that the N-terminal extension region is directly fused to the N-terminus of HRS1 of the Alphabody sequence means that there is no additional amino acid or linker present between the N- terminal extension region and the N-terminus of HRS1 of the Alphabody. In particular embodiments, the most C-terminal amino acid of the N-terminal extension region is bound to the most N-terminal amino acid of the HRS1 of the Alphabody sequence via a peptide-bond. In other words, in particular embodiments, the HRS1 of the Alphabody sequence is N-terminally extended by the N-terminal extension region.
In particular embodiments, the polypeptide as taught herein comprises a sequence having at least 70%, at least 80%, at least 90%, at least 95%, such as at least 96%, at least 97%, at least 98%, or at least 99%, preferably 100%, sequence identity with the sequence VDLGDISGIEASSVNIQAEISQLNIVAISLGITAIQYSIQSL (SEQ ID NO: 5).
In particular embodiments, the polypeptide as taught herein comprises a sequence VDLGDISGIEASSVNIQAEISQLNIVAISLGITAIQYSIQ.SL (SEQ. ID NO: 5), or a sequence that differs by at most 13, at most 12, at most 11, at most 10, at most 9, at most 8, at most 7, at most 6, at most 5, at most 4, at most 3, at most 2 or at most 1 amino acid residue(s) from said sequence defined by SEQ ID NO: 5.
Present inventors found that the C-terminal part of the N-terminal extension region forms together with the HRS1 of the Alphabody sequence one alpha-helix. In particular embodiments, the sequence having at least 70%, at least 80%, at least 90%, at least 95%, such as at least 96%, at least 97%, at least 98%, or at least 99%, preferably 100%, sequence identity with the sequence QAEISQLNIVAISLGITAIQYSIQSL (SEQ. ID NO: 6) forms an alpha-helix. In particular embodiments, the sequence QAEISQLNIVAISLGITAIQYSIQSL (SEQ ID NO: 6) or a sequence that differs by at most 8, at most 7, at most 6, at most 5, at most 4, at most 3, at most 2 or at most 1 amino acid residue(s) from said sequence defined by SEQ ID NO: 6, forms an alpha-helix. In particular embodiments, the sequence having at least 70%, at least 80%, at least 90%, at least 95%, such as at least 96%, at least 97%, at least 98%, or at least 99%, preferably 100%, sequence identity with the sequence as defined by SEQ ID NO: 6, HRS2 and HRS3 form together a triple-stranded, alpha-helical, coiled coil structure.
In particular embodiments, the N-terminal extension region comprises, consists essentially of or consists of at most 24 amino acids.
In particular embodiments, the N-terminal extension region comprises, consists essentially of or consists of a sequence as defined by SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 30.
In particular embodiments, the HRS1 of the Alphabody sequence comprises a Valine at the heptad b- position of the first heptad repeat unit of HRS1, an Alanine at the heptad c-position of the first heptad repeat unit of HRS1, and a Leucine at the heptad f-position of the first heptad repeat unit of HRS1.
In particular embodiments, the HRS1 of the Alphabody sequence may comprise a Serine at the heptad e-position of the first heptad repeat unit of HRS1.
In particular embodiments, the HRS1 of the Alphabody sequence comprises, consists essentially of or consists of a sequence as defined by SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13 or SEQ ID NO: 31.
In particular embodiments, the polypeptide as described herein comprises a sequence as defined by SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 5, SEQ ID NO: 36 or SEQ ID NO: 32.
In particular embodiments, the polypeptide as described herein comprises, consists essentially of or consists of a sequence as defined by SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, or SEQ ID NO: 29.
Present inventors have found that the polypeptides of present invention also are able to inhibit betacoronavirus variants, preferably SARS-CoV-2 variants, which enter cells via the endosomal route, such as the Omicron variant of SARS-CoV-2, when being fused to a glycan binding domain via a flexible spacer sequence.
Accordingly, in particular embodiments, the polypeptide comprises a glycan binding domain fused, coupled or conjugated, preferably covalently connected, to the N-terminal extension region or to the Alphabody sequence via a flexible spacer sequence.
In particular embodiments, the glycan binding domain is capable of binding to glycan, preferably N- linked glycan, at the surface of a Class-1 viral spike protein, such as those of SARS-CoV-2.
The term "flexible spacer sequence" as used herein refers to a flexible connecting element or linker that serves to link other elements.
In particular embodiments, the flexible spacer sequence is a (poly) peptide linker.
In particular embodiments, the flexible spacer sequence comprises from 15 to 35, from 20 to 30, such as about 25, amino acid residues. The nature of amino acids constituting the flexible spacer sequence or linker is typically not of particular relevance so long as the biological activity of the polypeptide segments linked thereby is not substantially impaired and the linker provides for the intended spatial separation of the linked polypeptide segments. Preferred linkers are essentially non-immunogenic and/or not prone to proteolytic cleavage.
In particular embodiments, the flexible spacer sequence is a glycine and serine-rich sequence. In particular embodiments, flexible spacer sequence comprises from 3 to 7, preferably 5, repeats of a "glycine/serine-rich" sequence such as GGGGS (SEQ ID NO: 21). In particular embodiments, the flexible spacer sequence consists of the sequence GGGGSGGGGSGGGGSGGGGSGGGGS (SEQ. ID NO: 22).
In particular embodiments, the glycan binding domain is fused, coupled or conjugated to the N-terminus of the N-terminal extension region. In particular embodiments, the glycan binding domain is fused, coupled or conjugated to the C-terminus of the HRS3 of the Alphabody sequence. In particular embodiments, the glycan binding domain is a lectin, preferably a lectin chosen from the group consisting of Griffithsin and Human Surfactant Protein D. In particular embodiments, the glycan binding domain is Griffithsin with a sequence as defined by SEQ ID NO: 28.
In particular embodiments, the polypeptide as described herein comprising a glycan binding domain comprises, consists essentially of or consists of a sequence as defined by SEQ ID NO: 19 or SEQ ID NO: 20.
In particular embodiments, the polypeptide is capable of specifically binding to trimeric HR1 of SARS- CoV-2, preferably to one or more grooves formed at the surface of trimeric HR1 of SARS-CoV-2.
A polypeptide (or the Alphabody structure comprised therein) is said to 'specifically bind to' a particular target when that polypeptide has affinity for, specificity for, and/or is specifically directed against that target (i.e., against at least one part or fragment thereof). The 'specificity' of a polypeptide as used herein can be determined based on affinity and/or avidity. The 'affinity' of a polypeptide is represented by the equilibrium constant for the dissociation of the polypeptide and trimeric HR1 of SARS-CoV-2. The lower the KD value, the stronger the binding strength between the polypeptide and trimeric HR1 of SARS-CoV-2. Alternatively, the affinity can also be expressed in terms of the affinity constant (KA), which corresponds to 1/KD. The binding affinity of a polypeptide as used herein can be determined in a manner known to the skilled person, depending on the specific target protein of interest. A KD value greater than about 1 millimolar is generally considered to indicate non-binding or non-specific binding.
A polypeptide as envisaged herein is said to be 'specific for a first target protein of interest as opposed to a second target protein of interest' when it binds to the first target protein of interest with an affinity that is at least 5 times, such as at least 10 times, such as at least 100 times, and preferably at least 1000 times higher than the affinity with which that polypeptide binds to the second target protein of interest. Accordingly, in certain embodiments, when a polypeptide is said to be 'specific for' a first target protein of interest as opposed to a second target protein of interest, it may specifically bind to (as defined herein) the first target protein of interest, but not to the second target protein of interest.
It has been determined that the remaining positions of the Alphabody structure of the polypeptides are less critical.
The application also envisages parts, fragments, analogs, mutants, variants, and/or derivatives of the polypeptides described herein comprising or essentially consisting of one or more of such parts, fragments, analogs, mutants, variants, and/or derivatives, as long as these parts, fragments, analogs, mutants, variants, and/or derivatives are suitable for the prophylactic, therapeutic and/or diagnostic purposes envisaged herein.
Such parts, fragments, analogs, mutants, variants, and/or derivatives are still capable of inhibiting SARS- CoV-2.
Also provided herein are nucleic acid sequences encoding single-chain Alphabodies or Alphabody polypeptides, which are obtainable by the methods according to the invention as well as vectors and host cells comprising such nucleic acid sequences.
In a further aspect, the present invention provides nucleic acid sequences encoding the Alphabodies or the polypeptides of the invention (or suitable fragments thereof). These nucleic acid sequences are also referred to herein as nucleic acid sequences of the invention and can also be in the form of a vector or a genetic construct or polynucleotide. The nucleic acid sequences of the invention may be synthetic or semi-synthetic sequences, nucleotide sequences that have been isolated from a library (and in particular, an expression library), nucleotide sequences that have been prepared by PCR using overlapping primers, or nucleotide sequences that have been prepared using techniques for DNA synthesis known per se. The genetic constructs of the invention may be DNA or RNA, and are preferably double-stranded DNA. The genetic constructs of the invention may also be in a form suitable for transformation of the intended host cell or host organism in a form suitable for integration into the genomic DNA of the intended host cell or in a form suitable for independent replication, maintenance and/or inheritance in the intended host organism. For instance, the genetic constructs of the invention may be in the form of a vector, such as for example a plasmid, cosmid, YAC, a viral vector or transposon. In particular, the vector may be an expression vector, i.e., a vector that can provide for expression in vitro and/or in vivo (e.g. in a suitable host cell, host organism and/or expression system). The genetic constructs of the invention may comprise a suitable leader sequence to direct the expressed Alphabody to an intended intracellular or extracellular compartment. For example, the genetic constructs of the invention may be inserted in a suitable vector at a pelB leader sequence site to direct the expressed Alphabody to the bacterial periplasmic space. Also the vector may be equipped with a suitable promoter system to, for example, optimize the yield of the Alphabody.
The application also provides vectors and host cells comprising nucleic acids described above. Suitable examples of hosts or host cells for expression of the Alphabodies or polypeptides of the invention will be clear to the skilled person and include any suitable eukaryotic or prokaryotic cell (e.g., bacterial cells such as E. coli, yeast cells, mammalian cells, avian cells, amphibian cells, plant cells, fish cells, and insect cells), whether located in vitro or in vivo.
The production of the polypeptides envisaged herein may comprise the step of expressing a nucleotide sequence encoding said polypeptide in a host organism under suitable conditions, so as to produce said polypeptide. This step can be performed by methods known to the person skilled in the art.
In addition, the polypeptides envisaged herein may be synthesized as soluble protein construct, optionally after their sequence has been identified by, for instance, in silico modelling.
For instance, the polypeptides envisaged herein can be synthesized using recombinant or chemical synthesis methods known in the art. Also, the polypeptides envisaged herein can be produced by genetic engineering techniques. Thus, for an Alphabody capable of inhibiting SARS-CoV-2, methods for synthesizing the polypeptides envisaged herein may comprise transforming or infecting a host cell with a nucleic acid or a vector encoding a polypeptide sequence having detectable binding affinity for, or detectable in vitro activity on, trimeric HR1 (or a mimic thereof, such as trimeric GCN4-N50) and being able to inhibit SARS-CoV-2. Accordingly, the polypeptide sequences as described herein can be made by recombinant DNA methods. DNA encoding the polypeptides can be readily synthesized using conventional procedures. Once prepared, the DNA can be introduced into expression vectors, which can then be transformed or transfected into host cells such as E. coli or any suitable expression system, in order to obtain the expression of polypeptides in the recombinant host cells and/or in the medium in which these recombinant host cells reside.
It should be understood, as known by someone skilled in the art of protein expression and purification, that the polypeptide produced from an expression vector using a suitable expression system may be tagged (typically at the N-terminal or C-terminal end of the Alphabody) with e.g. a Histidine or other sequence tag for easy purification. In particular embodiments, the tag is a cleavable or non-cleavable tag. For example, His-tag cleavage may be possible due to the presence of a FXa recognition motif present between an N-terminal His-tag and the N-terminus of the polypeptide as taught herein.
The presence of a His-tag (N-terminal or C-terminal) may simplify purification, allowing a 2-step column purification process. An exemplary 2-step column purification process may be as follows. The first step of a 2-step column purification process may comprise an immobilized metal affinity chromatography (IMAC) capturing step allowing removal of most host cell contaminants. The IMAC step may be performed under denaturing conditions since host cell pellet fractions require solubilization in 4M GuHCl. GuHCI removal (including slow refolding if needed) and extra contaminant removal may be performed by overnight dialysis of the IMAC eluate (at 4°C) against acidic buffer conditions. In the second column purification step (polishing step), the polypeptides as taught herein may be brought in final buffer conditions on a size exclusion chromatography (SEC) column, allowing in addition of the buffer exchange, separation from residual contamination and determination of the homogeneity of the protein sample. Purity of the polypeptides as taught herein may be determined by SDS-PAGE. In a further exemplary 2-step column purification process, such as for use when sufficient presence of the polypeptide as taught herein in the soluble fraction after cell lysis of the host cells and clarification is observed, the cell lysate may be immediately applied on IMAC in the absence of denaturing agents. No extra dialysis step is required before the SEC polishing step. In a further exemplary 2-step column purification process, such as for use when only expression of the polypeptide as taught herein in the cell pellet of the host cells was observed, solubilization in 2M urea and subsequent freeze/tawing may result in soluble material for downstream purification. No extra dialysis step is required before the SEC polishing step.
Transformation or transfection of nucleic acids or vectors into host cells may be accomplished by a variety of means known to the person skilled in the art including calcium phosphate-DNA coprecipitation, DEAE-dextran-mediated transfection, polybrene-mediated transfection, electroporation, microinjection, liposome fusion, lipofection, protoplast fusion, retroviral infection, and biolistics. Suitable host cells for the expression of the desired polypeptides may be any eukaryotic or prokaryotic cell (e.g., bacterial cells such as E. coli, yeast cells, mammalian cells, avian cells, amphibian cells, plant cells, fish cells, and insect cells), whether located in vitro or in vivo. For example, host cells may be located in a transgenic animal. Thus, the methods for the production of polypeptides herein are also provided, comprising transforming, transfecting or infecting a host cell with nucleic acid sequences or vectors encoding such polypeptides and expressing the polypeptides under suitable conditions.
Where the Alphabody peptide is intended to bind to trimeric HR1, particular screening steps can further be envisaged. In particular embodiments, the methods of production comprise a step of determining whether the polypeptide binds to trimeric HR1 (or a mimic thereof, such as trimeric GCN4-N50) with a dissociation constant (KD) of less than about 1 nanomolar (1 nM), preferably less than about 100 picomolar (100 pM). Preferably the method comprises determining whether said binding affinity for trimeric HR1 (or a mimic thereof, such as trimeric GCN4-N50) is equal to or better than the binding affinity of a polypeptide comprising, consisting essentially of or consisting of an amino acid sequence as set forth in SEQ. ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, 20 or SEQ ID NO: 29.
A further aspect provides a pharmaceutical composition comprising the polypeptide as taught herein or the nucleic acid sequence, and a pharmaceutically acceptable carrier.
The term "pharmaceutically acceptable" as used herein is consistent with the art and means compatible with the other ingredients of a pharmaceutical composition and not deleterious to the recipient thereof. "Acceptable carrier, diluent or excipient" refers to an additional substance that is acceptable for use in human and/or veterinary medicine.
By way of example, an acceptable carrier, diluent or excipient may be a solid or liquid filler, diluent or encapsulating substance that may be safely used in systemic administration. Depending upon the particular route of administration, a variety of carriers, well known in the art may be used. These carriers may be selected from a group including sugars, starches, cellulose and its derivatives, malt, gelatine, talc, calcium sulphate and carbonates, vegetable oils, synthetic oils, polyols, alginic acid, phosphate buffered solutions, emulsifiers, isotonic saline and salts such as mineral acid salts including hydrochlorides, bromides and sulphates, organic acids such as acetates, propionates and malonates and pyrogen-free water.
Any safe route of administration may be employed for providing a patient with the polypeptide as taught herein or the pharmaceutical composition as taught herein. For example, oral, rectal, parenteral, sublingual, buccal, intravenous, intra-articular, intra-muscular, intra-dermal, subcutaneous, inhalational, intraocular, intraperitoneal, intracerebroventricular, transdermal and the like may be employed. Intra-muscular and subcutaneous injection may be appropriate.
In particular embodiments, the pharmaceutical composition as taught herein is formulated for inhalation, such as in the form of an aerosol spray, mist or powder. A further aspect provides the polypeptide as taught herein, the nucleic acid sequence as taught herein or the pharmaceutical composition as taught herein for use as a medicament. Accordingly the invention provides the use of the polypeptide as taught herein, the nucleic acid sequence as taught herein, or the pharmaceutical composition as taught herein in the manufacture of a medicament.
A further aspect provides the polypeptide as taught herein, the nucleic acid sequence as taught herein, or the pharmaceutical composition as taught herein for use in the prevention of a betacoronavirus infection, preferably a SARS-CoV-1 or SARS-CoV-2 infection, more preferably a SARS-CoV-2 infection. In other words, provided herein is a method for preventing a betacoronavirus infection, more preferably a SARS-CoV-2 infection, in a subject comprising administering a prophylactically effective amount of the polypeptide as taught herein, the nucleic acid sequence as taught herein, or the pharmaceutical composition as taught herein.
The term "preventing" or "prevention" as used herein refers to a reduction in risk of acquiring a disease or disorder (i.e., causing at least one of the clinical symptoms of the disease not to develop in a subject, in particular a human subject, that may be exposed to or predisposed to the disease but does not yet experience or display symptoms of the disease). In the present case, the term prevention also encompasses reducing or preventing transmission of the causative agent and/or reducing or preventing infection with the causative agent, thereby actively preventing infection and/or disease development and progression.
A further aspect provides the polypeptide as taught herein, the nucleic acid sequence as taught herein, or the pharmaceutical composition as taught herein for use in the treatment of a betacoronavirus infection, more preferably a SARS-CoV-1 or SARS-CoV-2 infection, more preferably a SARS-CoV-2 infection. In other words, provided herein is a method for treating a betacoronavirus infection, more preferably a SARS-CoV-2 infection, in a subject comprising administering a therapeutically effective amount of the polypeptide as taught herein, the nucleic acid sequence as taught herein, or the pharmaceutical composition as taught herein.
The term "treating" or "treatment1 of any disease or disorder includes, in one embodiment, to improve the disease or disorder (i.e., arresting or reducing the development of the disease or at least reducing one of the clinical symptoms of the disease). In another embodiment "treating" or "treatment" refers to improve at least one physical parameter, which may or may not be discernible by the subject, in particular a human subject, but which is based on or associated with the disease or disorder to be treated. In yet another embodiment, "treating" or "treatment" refers to modulating or alleviating the disease or disorder, either physically (e. g. stabilization of a discernible on non-discernible symptom), physiologically (e. g. stabilization of a physiological parameter), or both. In yet another embodiment, "treating" or "treatment" refers to delaying the onset or progression of the disease or disorder. Accordingly, "treating" or "treatment' includes any causal treatment of the underlying disease or disorder (i.e., disease modification), as well as any treatment of signs and symptoms of the disease or disorder (whether with or without disease modification), as well as any alleviation or amelioration of the disease or disorder, or its signs and symptoms. The terms "disease(s)" and "disorders)" are used largely interchangeably herein.
The term "effective amount" as used herein may refer to a prophylactically effective amount, which is an amount of an active compound or pharmaceutical agent, more particularly a prophylactic agent, that inhibits or delays in a subject the onset of a disorder as being sought by a researcher, veterinarian, medical doctor or other clinician, or may refer to a therapeutically effective amount, which is an amount of active compound or pharmaceutical agent, more particularly a therapeutic agent, that elicits the biological or medicinal response in a subject that is being sought by a researcher, veterinarian, medical doctor or other clinician, which may include inter alia alleviation of the symptoms of the disease or condition being treated. Methods are known in the art for determining therapeutically and prophylactically effective doses for the agents as taught herein. The effective amount can vary depending on the compound, the disease and its severity, and the condition, age, weight, gender etc. of the subject, in particular a human subject, to be treated. More particularly, "therapeutically effective amount" or "therapeutically effective dose" indicates an amount of polypeptide, nucleic acid sequence or pharmaceutical composition as taught herein that when administered brings about a clinical positive response with respect to treatment of a subject afflicted by an infectious disease. Similarly, a "prophylactically effective amount" or "prophylactically effective dose" refers to an amount of polypeptide, nucleotide or pharmaceutical composition as taught herein that inhibits or delays the onset of clinical manifestation of an infectious disease as being sought by a researcher, veterinarian, medical doctor or other clinician.
In particular embodiments, the SARS-CoV-1 or SARS-CoV-2 infection may be an infection with any variant of the SARS-CoV-1 or SARS-CoV-2 virus, such as the SARS-CoV-2 variants as described elsewhere herein.
Except when noted, the terms "subject" or "patient" can be used interchangeably and refer to animals, preferably warm-blooded animals, more preferably vertebrates, even more preferably mammals, still more preferably primates, and specifically includes human patients and non-human mammals and primates. Preferred subjects are human subjects.
In particular embodiments, said subject in which the betacoronavirus infection is to be prevented is at risk of a betacoronavirus infection. In further particular embodiments, said subject is a subject at greater risk of a serious course of said betacoronavirus infection, and/or wherein a conventional treatment may not be effective enough. Accordingly, in particular embodiments, said subject in which the disease is to be treated/prevented is 60 years or older, preferably 65 years or older, such as 70 years or older. In particular embodiments, said subject in which the disease is to be treated/prevented is a subject with severe immune disorders (immunocompromised). In particular embodiments, said subject in which the disease is to be treated/prevented has a disease or condition selected from the group consisting of hypertension, diabetes, kidney disease, human immunodeficiency virus infection, obesitas, Down syndrome, cardiovascular disease, cancer, and chronic respiratory disease.
In particular embodiments, the subject in which the disease is to be treated/prevented does not respond well to vaccination with mRNA vaccines or any other vaccine.
In particular embodiments, the subject to be treated has mild, moderate or severe symptoms or mild, moderate or severe clinical manifestation of a beta-coronavirus infection.
In particular embodiments, the treatment and/or prevention comprises administering the polypeptide as taught herein, the nucleic acid sequence as taught herein, or the pharmaceutical composition as taught herein via inhalation. For example, the polypeptide as taught herein, the nucleic acid sequence as taught herein, or the pharmaceutical composition as taught herein may be administered using an inhalation delivery device.
Accordingly, a further aspect provides an inhalation delivery device comprising the polypeptide as taught herein, the nucleic acid sequence as taught herein, or the pharmaceutical composition as taught herein.
While the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications, and variations will be apparent to those skilled in the art in light of the foregoing description. Accordingly, it is intended to embrace all such alternatives, modifications, and variations as follows in the spirit and scope of the appended claims.
The herein disclosed aspects and embodiments of the invention are further supported by the following non-limiting examples.
EXAMPLES
Example 1. Expression and purification of Alphabodies
The term "Alphabody" can be used in the example section to refer to the Alphabody structure perse or the polypeptide comprising the at least one Alphabody structure.
Expression and purification of Alphabodies
Alphabodies were recombinantly produced as reported previously (J. Desmet, K. Verstraete, Y. Bloch, E. Lorent, Y. Wen, B. Devreese, K. Vandenbroucke, S. Loverix, T. Hettmann, S. Deroo, K. Somers, P. Henderikx, I. Lasters, S. N. Savvides, Structural basis of IL-23 antagonism by an Alphabody protein scaffold, Nat. Commun. 5, 5237 (2014)). Briefly, recombinant production of Alphabody constructs with either an N- or C-terminal histidine tag was performed in BL21(DE3)pLysS cells (Life Technologies), grown in Luria-Bertani medium at 37 °C. At an OD600 nm of 0.6, expression was induced by addition of 1 mM isopropylthio-p-galactoside. Expression was allowed for 4 h at 37 °C, after which cells were harvested by centrifugation, resuspended in Tris buffer and frozen at -80 °C. Cell lysis was performed by thawing and sonication in presence of DNAsel and MgCL, after which the suspension was cleared by centrifugation at 40 000 rpm. Alphabodies were isolated from the soluble fraction using a 5-ml IMAC HP Ni sepharose column (GE Healthcare), followed by a polishing and desalting step, performed on a Superdex 75 size-exclusion column (GE Healthcare) equilibrated in phosphate buffered saline (PBS).
Biotinylated GCN4-N50 (SEQ ID NO: 23), i.e., the HRl-trimer-micking target peptide, as well as biotinylated SARS-C36 peptide (SEQ. ID NO: 25) were synthetically produced by Thermo Scientific. The N50 sequence corresponds to the last 50 amino acid residues of HR1 (SEQ ID NO: 27).
Example 2. Determination of binding affinities
2.1. Materials and methods
2.1.1 Enzyme-linked immunosorbent assay (ELISA) assay
The affinities of different anti-SARS-CoV-2 Alphabody constructs were determined by a solution inhibition ELISA assay.
A Nunc plate was coated by adding 100 pL of 10 pg/mL neutravidin (Thermo Scientific) in PBS for 2 h at room temperature (RT). The plate was then blocked with 2% (m/v) skimmed milk in PBS for 1 h at RT while shaking. After washing, 100 pL of 100 nM biotinylated SARS-C36 peptide in PBS + 1% (m/v) skimmed milk was added. After washing, free biotin binding sites were blocked with 200 nM biotin in PBS + 1% (m/v) BSA for 1 h at RT. In parallel with previous steps, a mixture of 5 nM biotinylated GCN4- N50 and a dilution series of test Alphabody (seven 2-fold dilutions starting at 10 nM plus a blank) in PBS + 1% (m/v) skimmed milk + 10 pM biotin was preincubated in a deep-well plate for 4 h at RT. In addition, a 'calibrator' dilution series of biotinylated GCN4-N50 (seven 2-fold dilutions starting at 20 nM plus a blank) in PBS + 1% (m/v) skimmed milk was prepared. The GCN4-N50-Alphabody mixtures and the calibrator series were then transferred to the ELISA plate in duplicate (two columns for each series) and incubated for 40 min at RT. After washing, detection of bound GCN4-N50 was performed with 1/5000 streptavidin-horseradish peroxidase (HRP) conjugate (BioLegend) in PBS + 1% (m/v) skimmed milk for 30 min at RT. The plate was developed with SureBlue and the reaction was stopped with 0.5 M H2SO4. Each incubation step was performed while shaking. Optical densities (ODs) were read at 450 nm. For the calculation of Alphabody-target affinity, the OD signals from the calibrator series were first fitted to a sigmoid function, the latter providing the relationship between the measured ODs and free GCN4- N50 peptide concentrations. Using this relationship, the OD values measured for the Alphabody-GCN4- N50 mixtures were converted to free GCN4-N50 concentrations, and the latter were then fitted to the quadratic equation for Alphabody-GCN4-N50 binding, using the solution KD as parameter.
The biotinylated SARS-C36 peptide essentially corresponds to the SARS-CoV-2 HR2 sequence. Biotinylated GCN4-N50 (SEQ ID NO: 24) corresponds to a fragment (N50) of the SARS-CoV-2 HR1 sequence, preceded by a trimerizing GCN4 peptide. GCN4 is a fragment of the 'GCN4 isoleucine zipper (GCN4-IZ) peptide' (Suzuki et al. 1998 Protein engineering 11:1051-1055), which forms a stable trimeric alpha-helical coiled coil structure, thereby assisting in trimerization of the N50 peptide. Trimeric GCN4- N50 is therefore a stable mimic of the HR1 target region in a SARS-CoV-2 spike during the fusion process. In the assay, biotinylated SARS-C36 peptide (SEQ ID NO: 25) is immobilized onto neutravidin. After blocking of free biotin sites, biotinylated GCN4-N50 is added (1) in a calibrator series and (2) in parallel, at a fixed concentration in the presence of a dilution series of inhibitory Alphabody construct, which samples had been preincubated to equilibrium for 4 h. Since Alphabody constructs and SARS-C36 peptide occupy the same binding sites on GCN4-N50, the Alphabody constructs act in an inhibitory way for the binding to immobilized SARS-C36 peptide. Consequently, the stronger the binding, the less biotinylated GCN4-N50 will be detected in the readout step. Eventually, the observed inhibition curve can be converted into a binding curve by applying the relationship between OD and free GCN4-N50 concentration, as derived from the calibration curve.
Since the main purpose of the Alphabody constructs of the present invention is to avoid binding of HR2 to trimeric HR1 during the fusion process, this assay is considered a representative technique for evaluating potentially antiviral Alphabody constructs.
2.1.2 Alpha body constructs
Alphabody constructs of the present invention, referred to as CMPX-587B (SEQ. ID NO: 14), -583Q (SEQ ID NO: 15), -599B (SEQ ID NO: 16), -614D (SEQ ID NO: 17) and -624N (SEQ ID NO: 18), were designed by first performing a structural alignment of the alpha-helical heptad repeat sequence 1 (HRS1) of the Alphabody scaffold with an alpha-helical part observed within a HR2 structure, in particular an X-ray structure of a postfusion 6-helix bundle structure, more in particular the structure of the postfusion core of the 2019-nCoV S2 subunit having PDB code 6LXT as annotated under Protein Data Bank (PDB) under DOI: 10.2210/pdb6LXT/pdb (Figure 2). Subsequently, from that structural alignment, amino acids from the HR2 sequence were selected and were transferred onto corresponding amino acid positions within the aligned Alphabody heptad repeat sequence. Next, accompanying substitutions were designed by in silico modeling so as to optimally accommodate the transferred moieties within the complex. Finally, additional interactions with the target were identified, in particular the N-terminal extension within HR2 flanking the designed alpha-helical region.
The differences in the sequences of these constructs correspond to mutations inspired by in silico computer modeling of the corresponding complexes with trimeric SARS-CoV-2 HR1. They were introduced for the purpose of testing specific design ideas.
2.3 Results
The binding affinities of the panel of Alphabody constructs to the HR1 mimicking target construct GCN4- N50 are listed in Table 1. It was found that all of Alphabody constructs CMPX-587B (SEQ ID NO: 14), - 583Q (SEQ ID NO: 15), -599B (SEQ ID NO: 16), -614D (SEQ ID NO: 17) and -624N (SEQ ID NO: 18) are strong binders, with KDs in the nanomolar or picomolar range. The best construct was CMPX-624N, with a solution binding KD of about 40 picomolar. Even the 'worst' binder, construct CMPX-587B, had an excellent affinity, with a KD of about 1 nanomolar. These data show that the design process implemented by present inventors, aiming at high-affinity HRl-binding Alphabody constructs, was very successful. Moreover, since the binding affinities are derived from the inhibition curve of trimeric GCN4- N50 binding to HR2 peptide, these data can be expected to correlate with inhibition data on live or pseudo-viruses.
Affinity data:
CMPX- SEQ. ID NO: KD (nM)
587B 14 1.04
5830. 15 0.80
599B 16 0.33
614D 17 0.20
624N 18 0.04
Table 1. Solution affinities for tested anti-SARS-CoV-2 Alphabody constructs. The listed KD values were obtained by a solution inhibition ELISA assay, as described in section 2.1 above. The affinities range from about 1 nM (CMPX-587B) to about 40 pM (CMPX-624N).
Example 3. Antiviral potencies
3.1 Material and methods
The antiviral potencies of different anti-SARS-CoV-2 Alphabody constructs were determined by a pseudovirus (PV) assay using vesicular stomatitis virus (VSV) particles pseudotyped with spikes from different SARS-CoV-2 variants, namely the Wuhan SARS-CoV-2 variant with a nucleotide sequence as annotated under NCBI GenBank accession number sequence NC_045512.2, the Delta SARS-CoV-2 variant with sequence reference EPI _ISL_2356230 and the Omicron SARS-CoV-2 variant with sequence reference EPI_ISL_6841980.
3.1.1 Wild type virus inhibition assay
All live virus-related work was conducted in the high-containment biosafety level 3 facilities of the Rega Institute from the Katholieke Universiteit (KU) Leuven (Leuven, Belgium), according to institutional guidelines. The wild type virus inhibition assay (live virus inhibition assay) was conducted as follows. One day prior to the experiment, U87.ACE2+ cells were seeded at 20,000 cells/well in 96 well-plates. Serial dilutions of the test compound were prepared in cell infectious media (DMEM + 2% (v/v) FCS), overlaid on cells, and then virus was added to each well (MOI indicated in the figure legends). Cells were incubated at 37 °C under 5% CO2 for the duration of the experiment (96 h). Four days after infection, the cell viability of mock- and virus-infected cells was assessed spectrophotometrically via the in-situ reduction of the tetrazolium compound 3-(4,5-dimethylthiazol- 2-yl)-5-(3-carboxy-methoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium inner salt, using the CellTiter 96 AQueous One Solution Cell Proliferation Assay (Promega Cat.# G3580) according to manufacturer's protocol. The absorbances were read in an eight-channel computer-controlled photometer (Multiscan Ascent Reader, Labsystem, Helsinki, Finland) at two wavelengths (490 and 700 nm). The optical density (OD) of the samples was compared with enough cell control replicates (cells without virus and compounds) and virus control wells (cells with virus but without compounds). The 50% inhibitory concentration (IC5o), or the concentration that inhibited SARS-CoV-2-induced cell death by 50%, was calculated from the concentration-response curve.
3.1.2 Plasmids and pseudovirus
A VSV pseudovirus was constructed carrying the spike protein of one of the different SARS-CoV-2 variants, as described above. The spike gene mutant of SARS-CoV-2 with a C-terminal 19 aa truncation (SARS-CoV-2 dC19) was cloned into either the plasmid pCAG or pUNOl (Invivogen). The plasmids carrying SARS-CoV-2 spike cDNA were transfected into HEK293T cells. Twenty-four hours post transfection, the VSVdG-Luc-G (Kerafast) virus was inoculated into cells expressing the SARS-CoV-2 dC19 spike protein and incubated for two hours. Then, VSVdG-Luc-G virus was removed from the supernatant, and anti-VSV-G monoclonal antibody (Absolute antibody) was added to block the infectivity of residual VSVdG-Luc-G. The progeny virus would be enveloped by SARS-CoV-2 dC19 spike protein to generate a VSV pseudovirus carrying the foreign spike protein of SARS-CoV-2.
The supernatant was harvested at 24h post VSVdG-Luc-G infection and then centrifuged and filtered (0.45-pm pore size, Millipore) to remove cell debris and stored at -80°C until use. The viral titer (CCID30) was determined by measuring the luminescence from luciferase activity after A549.ACE2.TMPRSS2 (Invivogen) cell infection with gradient diluted supernatant.
3.1.3 Pseudovirus-based infection assay
A549.ACE2.TMPRSS2 cells were seeded the day before experiment onset. The experimental Alphabodies were mixed with diluted VSV-SARS-CoV-2-dC19 virus (CCID30). All samples and viruses were diluted with DMEM 10% (v/v) FBS 1% (v/v) PenStrep. The mixture was added to seeded A549.ACE2.TMPRSS2 cells. After 22h of incubation at 37°C and 5% CO2, a read-out of luminescence was done on the GloMax Discover reader (Promega) as a measurement to compare pseudovirus infection with or without compounds. For this, the Bright-Glo Luciferase Assay System (Promega Cat.# E2620) was used according to manufacturer's guidelines.
3.2 Results 1
Inhibition data:
Wuhan-Hu-1 Delta variant
SEQ ID NO: PV PV
CMPX-
ICso (pM) ICso (pM)
587B 14 3.59 2.21
583Q 15 1.37 0.66
599B 16 0.27 0.26
614D 17 0.19 0.11
624N 18 0.086 0.038
Table 2. Antiviral potencies for tested anti-SARS-CoV-2 Alphabody constructs in the pseudovirus (PV) assay. The listed IC5o values were obtained by a pseudovirus-based infection assay using indicated Wuhan and Delta spike-pseudotyped VSV particles and A549.ACE2.TMPRSS2 target cells. The IC50S range from about 3.6 pM to about 0.04 pM.
The antiviral potencies (IC5os) of the panel of Alphabody constructs for which the binding affinities are listed in Table 1 were also tested in a pseudovirus (PV) based infection assay with the Wuhan and Delta SARS-CoV-2 strains. The target cells were A549 cells expressing the ACE2 receptor and TMPRSS2 protease (A549.ACE2.TMPRSS2 cells).
Table 2 lists the IC50S obtained by these experiments. It was found that all of Alphabody constructs CMPX-587B (SEQ ID NO: 14), -583Q (SEQ ID NO: 15), -599B (SEQ ID NO: 16), -614D (SEQ ID NO: 17) and -624N (SEQ ID NO: 18) inhibited viral infection, albeit with different potencies. The best performing construct was CM PX-624N, with an IC5o of about 0.09 pM and 0.04 pM for the Wuhan and Delta variants, respectively. The worst performing construct was CMPX-587B, with an IC5o of about 3.6 pM and 2.2 pM for the Wuhan and Delta variants, respectively. Interestingly, the ranking of constructs based on their binding KDs (Table 1) was the same as the ranking based on IC5o values (Table 2). The latter can also be inferred from the correlation plot in figure 3. These results show that the computational design approach applied by present inventors does not only yield strong binders, but also strong inhibitors. The fact that the IC50S in Table 2 are in general about three orders of magnitude higher than the equilibrium binding affinities in Table 1 can be explained by the fact that the target region in a spike, i.e. trimeric HR1, is exposed for only a very short period during the fusion process, likely in the seconds range. The latter has also been observed by Kahle KM, Steger HK, Root MJ (2009) Asymmetric Deactivation of HIV-1 gp41 following Fusion Inhibitor Binding. PLoS Pathog 5(11): el000674) for HIV-1 gp41 inhibition, who concluded that 'Because gp41 inhibitors target a transient intermediate state, their potency is not simply determined by eguilibrium binding affinity (...). Noneguilibrium parameters, such as the rate of inhibitor association and the lifetime of the intermediate state also influence the degree of inhibition'. They found the lifetime of the gp41 fusion intermediate state to be equal to ln(2)/0.054 = 12.8 sec. While the 'HR1 trimer lifetime' in the SARS-CoV-2 fusion intermediate state is presently not known, it may be similar, thereby explaining the offset of IC5o vs KD values in figure 3.
Example 4. Fusion constructs with GRFT
4.1 Materials and methods
Two anti-SARS-CoV-2 Alphabody constructs with a lectin domain fused to, respectively, the N- and C- terminal ends of CMPX-624N were produced (SEQ ID NO: 19 and 20). The chosen lectin domain was griffithsin (GRFT) (SEQ. ID NO: 28), which is a 121 amino acids long polypeptide, derived from the red alga Griffithsia sp.. GRFT and the Alphabody construct were coupled by a 25-residues long, Gly/Ser spacer (GGGGS)5 (SEQ ID NO: 22). The unfused GRFT control protein was a kind gift from Kenneth Palmer, Louisville, Kentucky, USA (O'Keefe et al. , Proc Natl Acad Sci USA, 2009, 160(15):6099-104).
4.2 Results
Figure imgf000029_0001
Table 3. Binding affinities and antiviral potencies for tested anti-SARS-CoV-2 Alphabody constructs. The listed binding affinities (KD values) were obtained by the solution inhibition ELISA assay described above. The listed inhibition potencies (IC5o values) were obtained with respectively the PV and live virus assays for the indicated virus strains. Alphabody constructs CMPX-626C and CMPX-626D are GRFT fusions. The non-GRFT fused construct CMPX-624N is shown for comparison.
Table 3 shows the binding and antiviral activity results for CMPX-624N, i.e. the non-GRFT fused Alphabody construct which performed the best in binding and PV assays (Tables 1 and 2). Here it was also tested in the live virus inhibition assay with the Omicron variant. Alphabody constructs CMPX-626C and CMPX-626D are essentially the same Alphabody construct as CMPX-624N, but with N- and C- terminal GRFT fusions, respectively. The latter's binding and antiviral activities were tested in parallel in the same assays as for CMPX-624N. Construct CMPX-626D was only tested in the binding assay.
The non-fused construct CMPX-624N, which performed very well in the binding assay and in PV assays with Wuhan and Delta strains, showed a remarkably poor activity with a 20 pM IC5o on the Omicron variant in the live virus assay (Table 3). In contrast, the N-terminally GRFT-fused Alphabody construct CMPX-626C showed a somewhat weaker binding (KD = 0.16 nM), yet a much better antiviral activity in both the PV and live virus assays, with IC50S ranging from as low as 0.009 pM on the Wuhan variant to 0.17 pM on the Omicron variant (Table 3). It is remarked that IC50S obtained with the PV and live virus assays cannot be directly compared because of the difference in infectious particles, but the comparison with the non-fused reference construct CMPX-624N should be meaningful. It is thus found that the N- terminal GRFT fusion construct CMPX-626C is more potent than the non-fused reference construct CMPX-624N by roughly a factor 2 (PV, Delta) to >100 (Live, Omicron). The C-terminally GRFT-fused Alphabody construct CMPX-626D was only tested in the binding assay, wherein it was found that the affinity compared to the N-terminal fusion is somewhat decreased (KD = 0.40 nM). In addition, the GRFT protein only (O'Keefe et al., Proc Natl Acad Sci USA, 2009, 160(15):6099-104) was tested as a control in the live virus assay with the Omicron variant, and not any onset of activity was observed at the highest tested concentration of 4 pM. Thus, the 0.17 pM IC5o of CMPX-626C is essentially due to the synergy between the glycan binding GRFT domain and the HR1 trimer binding Alphabody part, and not to the GRFT domain alone.
The most logical explanation why GRFT-fused Alphabody constructs may outbeat non-fused constructs, and the rationale behind the disclosed design constructs, is the ability of lectin domains to bind to N- linked glycans, which are abundantly present at the surface of Class-1 viral spike proteins including those of SARS-CoV-2. This was hypothesized to increase the local concentration of the inhibitory constructs of the present invention at the viral surface and thus in the immediate vicinity of the trimeric HR1 target region. A second possible beneficial effect of lectin fusion was hypothesized to be related to the path of viral entry into a target cell: SARS-CoV variants are known to enter with diverse rates directly through the plasma membrane and/or indirectly via the endosomal pathway. The first hypothesis, i.e. the increase of local concentration, may be at the basis of improved potencies of CMPX-626C compared to CMPX-624N in the PV assays with the Wuhan and Delta variants. The second hypothesis may be in line with the recently reported preferential entry pathway of the Omicron variant via endocytosis rather than via direct plasma membrane fusion. Indeed, the remarkably poor activity of CMPX-624N on the live Omicron variant (Table 3) appears to be compensated >100-fold by the N-terminally fused GRFT domain.
Since the role of the GRFT fusion domain is essentially to allow the Alphabody construct to 'home' onto the viral spike surface, this concept can in principle also be extended to fusion between specific HR1- targeting Alphabody constructs and alternative domains with glycan binding capacity. An interesting example of such alternative glycan binding protein domain is human surfactant protein D (hSP-D). The advantage of such human protein is the fact that it is likely less immunogenic than for example the griffithsin protein from red algae. Another, specific, advantage of human surfactant protein D is the fact that it is naturally occurring in the lungs of human beings, so it should be well tolerated. Consequently, the fusion of hSP-D to Alphabody constructs of the present invention in a similar manner as for CMPX- 626C and CMPX-626D, is expected to enhance antiviral activity, including for SARS-CoV-2 variants that enter target cells via the endosomal pathway.
Example 5. Alphabodies as taught herein inhibit infection of U87.ACE2+ cells and Calu-3 cells with different SARS-CoV2 variants
5.1 Materials and methods
Alphabody 626C (see Table 3) and 633D (SEQ ID NO: 29) were expressed and purified as described in Example 1.
Unlike Alphabody 626C, Alphabody 633D is not fused to Griffithsin (GRFT). Alphabody 633D comprises a C-terminal myc-tag (EQKUSEEDL; SEQ. ID NO: 39) for Alphabody detection in, for example ELISA assays, and a His-tag (HHHHHH; SEQ ID NO: 40) for purification purposes by, for example, IMAC chromatography.
Both Alphabody 626C and 633D comprise a Serine at the heptad e-position of the first heptad repeat unit of HRS1 to improve the "on-rate" of binding.
5.1.1 Cells
Cell lines were maintained at 37°C in a humidified environment with 5% CO2. Cells were passaged every 3 to 4 days. Human glioblastoma U87 MG cells (Cat. No. HTB-14), human adenocarcinomic alveolar epithelial cells A549 (Cat. No. CCL-185), human Embryonic Kidney 293T (HEK293T) cells (Cat. No. CRL- 3216), human adenocarcinomic bronchial epithelial cells Calu3 (Cat. No. HTB-55) and African green monkey kidney Vero E6 cells (Cat. No. CRL-1586) were obtained from ATCC as mycoplasma-free stocks and grown in Dulbecco's Modified Eagle Medium (DMEM, Thermo Fisher Scientific) supplemented with 10% (v/v) fetal bovine serum (FBS; HyClone).
U87 MG cells were stably transfected with the ACE2 receptor to generate the U87.ACE2+ cells as described in detail in Vanhulle E. et al., SARS-CoV-2 Permissive glioblastoma cell line for high throughput antiviral screening, Antiviral Res. 2022 Jul; 203:105352.
A549 cells were stably transfected with the ACE2 receptor to generate the A549.ACE2+ cells as reported in a recent publication (Vanhulle E. et al., Carbohydrate-binding protein from stinging nettle as fusion inhibitor for SARS-CoV-2 variants of concern, Front. Cell. Infect. Microbiol., 30 August 2022, Sec. Virus and Host, vol. 12. 12:989534.
5.1.2 Viruses
All virus-related work was conducted in the high-containment biosafety level 3 facilities of the Rega Institute from the Katholieke Universiteit (KU) Leuven (Leuven, Belgium), according to institutional guidelines. Severe Acute Respiratory Syndrome coronavirus 2 isolates (SARS-CoV 2) were recovered from nasopharyngeal swabs of RT-qPCR-confirmed human cases obtained from the University Hospital Leuven (Leuven, Belgium). The following SARS-CoV-2 variants of concern were used in this study: Wuhan-Hu-1 strain hCoV19/Belgium/GHB-03021/2020 (GISAID accession number EPI_ISL_407976), 20A.EU2 strain (clinical isolate Al), Delta strain (IND-B.1.617.2; EPI_ISL_2425097) and Omicron strain (RSA-B.l.1.529; EPI_ISL_7413964).
SARS-CoV-2 viral stocks were prepared by inoculation of confluent Vero E6 cells in a 150 cm2 culture flask at MOI of 0.02 in viral growth medium (DMEM supplemented with 2 % heat-inactivated FBS, 1 mM sodium Pyruvate and lx MEM NEAA). After one hour incubation at 37 °C, viral growth media was added to bring the final volume to 25 mL. Virus-exposed cells were monitored by microscopy for the generation of cytopathic effect (CPE) on consecutive days. When all cells were infected and full CPE was obtained (i.e., at peak of infection), cell supernatant was harvested, cleared by centrifugation and supernatant was aliquoted and stored at -80 °C.
To determine replication efficiency, the different SARS-CoV-2 strains were added to Vero E6 cells at an MOI of 0.02, as determined by end-point dilution titration on Vero E6 cells and calculated by the tissue culture infectious dose 50 (TCID50) method of Reed and Muench. The viral genome sequence was verified, and all infections were performed with passage 3 to 5.
5.1.3 SARS-CoV-2 infection of U87.ACE2 cells
U87.ACE2+ cells were seeded one day prior to infection (20 000 cells/0.1 mL in a 96-well plate). Next day, supernatant was removed and virus (0.1 mL) and a dilution range of test compound (0.1 mL) were added to the cells, and cells were incubated at 37°C for another 4 days. Virus input was not removed from the cells. At day 4 post infection, cell viability was quantified (by MTS) as a measure of virus- induced cytopathic effect (CPE).
The following virus input was used:
SARS-CoV-2 strain Wuhan-Hu-1 (MOI of 0.03)
SARS-CoV-2 strain 20A.EU2 (MOI of 2)
SARS-CoV-2 strain Omicron BA.l (MOI of 0.08) 5.1.4 SARS-CoV-2 infection of differentiated Calu-3 cells
Calu-3 cells were grown in EMEM medium (Lonza), supplemented with 10% FBS (Hyclone) and 1 % L- glutamine (TFS). Once cells reached 70-80% confluency, cells were detached and seeded on 24 Well Thincert™ transwell inserts with a 0.4 pm pore size (Greiner Bio-One) at a density of 100 000 cells/well. Cells were submerged for 7 days until a confluent monolayer was formed. Next, by removing the medium of the apical compartment, cells were placed in air-liquid interface (ALI) for 21 days to further differentiate the cells. During this differentiation phase, every other day the basolateral medium of the ALI cultures was replaced by fresh medium, and the transepithelial/transendothelial electrical resistance (TEER) was measured the monitor the monolayer integrety.
Fully differentiated Calu-3 cells were exposed apically with virus or a mixture of virus and compound (in 100 pl medium) for 1.5h. Then, the medium solution with virus (and compound) was removed from the cells, and the cells were washed once with PBS (200 pl). Next, the apical side of the cell culture was exposed to air again. At 24h post infection, cells were washed apically with 200 pl PBS, and 140 pl of this collected apical wash fraction is mixed with lysis buffer and analyzed for virus release (RT-qPCR, see below). After the wash, the apical side of the cell culture was exposed to air again. The same wash procedure was repeated at 72h post infection.
The following virus input was used:
SARS-CoV-2 strain 20A.EU2 (MOI of 1)
SARS-CoV-2 strain Omicron BA.l (MOI of 0.01)
5.1.5 MTS-PES assay
Four days after infection, the cell viability of mock- and virus-infected cells was assessed spectrophotometrically via the in situ reduction of the tetrazolium compound 3-(4,5-dimethylthiazol-2- yl)-5-(3-carboxy-methoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium inner salt, using the CellTiter 96 AQueous One Solution Cell Proliferation Assay (Promega). The absorbances were read in an eightchannel computer-controlled photometer (Multiscan Ascent Reader, Labsystem, Helsinki, Finland) at two wavelengths (490 and 700 nm). The optical density (OD) of the samples was compared with sufficient cell control replicates (cells without virus and compound) and virus control wells (cells with virus but without compound). The median inhibitory concentration (IC5o), or the concentration that inhibited SARS-CoV-2-induced cell death by 50%, was calculated from the concentration-response curve.
5.1.6 RT-qPCR detection of SARS-CoV-2
Primers and probes for a duplex RT-qPCR were designed to detect the nucleocapsid (N) and envelope (E) gene of SARS-CoV-2 according to Centers for Disease Control and Prevention (CDC, USA; Cat. n° 2019- nCoVEUA-01) and Charite (Berlin, Germany), respectively. Those primer sequences were selected to target conserved regions of the viral genome of SARS-CoV-2 specifically and no other human coronaviruses. Primers and probes were obtained from Integrated DNA Technologies (IDT, Leuven, Belgium). In order to perform a duplex RT-qPCR, probes with matching fluorescent dyes (i.e., FAM and HEX) were designed accordingly. More specifically, for N2 the following probe was used: FAM- ACAATTTGCCCCCAGCGCTTCAG(BHQl) (SEQ ID NO.: 37) and for E: HEX- ACACTAGCC(ZEN)ATCCTTACTGCGCTTCG(3IABkFQ) (SEQ. ID NO.: 38). Final concentration of combined primer/probe mix consist of 500 nM forward and reverse primer and 250 nM probe. A stabilized in vitro transcribed universal synthetic single stranded RNA of 880 nucleotides in buffer with known copy number concentration (Joint Research Centre, European Commission, Cat. n° EURM-019) was used as a standard to quantitatively measure viral copy numbers.
Total RNA was extracted from cell culture supernatants using QIAamp viral RNA mini kit (Qiagen) following manufacturer's instruction. Viral E and N genes are simultaneously amplified and tested using a multiplex RT-qPCR. All the procedures follow the manufacturer's instructions of the Applied Biosystems TaqMan Fast Virus one-step mastermix (TFS). Briefly, a 20 pl reaction mix was set up containing 5 pl of template, 7 pl of dH2O, 1.5 pl of each combined primer/probe mix (final concentrations of 500 and 250 nM, respectively) and 5 pl of 4X TaqMan Fast Virus 1-step mastermix (TFS). The qPCR plate was sealed and read in the FAM and HEX channels using a Quantstudio™ 5 Real- Time PCR system (TFS) under the following cycling protocol: 50°C for 5 min (reverse transcription), 95°C for 20 seconds (DNA polymerase activation), followed by 45 cycles of 95°C for 3 seconds (denaturation) and 55°C for 30 seconds (annealing and fluorescence collection) followed by an infinite 4°C hold.
5.1.7 Split neongreen cell-cell fusion assay
Transfection mixes were prepared with 2.5 pg pCAGGS.SARS-CoV-2_SA19_fpl_mNG2(ll)_opt plasmid encoding for SARS-CoV-2 spike protein for HEK293T transfection; and 2.5 pg pcDNA3.1.mNG2(l-10) for A549.ACE2+ transfection. HEK293T cells were allowed to incubate for 24h for efficient exogenous spike protein expression. At 6h post transfection, transfected A549.ACE2+ cells were digested with 0.05% trypsin, washed, resuspended and counted on a Luna cell counter (Logos Biosystems), added to a 96- well plate at 2.2 x 104 cells per well and incubated for 18h. Next day, transfected HEK293T cells were collected, digested with 0.25% trypsin, washed, resuspended, counted and administered to the A549.ACE2+ cells at 2 x 104 cells per well. Fusion events were visualized for 24h at 20 min intervals using the IncuCyte® S3 Live-Cell Analysis System (Sartorius). Phase contrast and GFP images (4 per well) were taken using a 20x objective lens at 10-minute intervals for a 5 hours period, and 1 hour intervals afterwards. Image processing was performed using the IncuCyte® software. 5.1.8 Cellular Electrical Impedance cell-cell fusion assay
The xCELLigence Real-Time Cell Analyzer (RTCA) DP instrument (Agilent, Santa Clara, CA, USA) was used to measure changes in cellular impedance following addition of cells on top of the monolayer. Briefly, RTCA E-plate VIEW 16 plates with embedded golden electrodes (#300600880, Agilent, Santa Clara, CA, USA) were used for the experiments. First a blank measurement of a sensor E-Plate VIEW 16 PET was performed (only medium). This was followed by the addition of 15 000 A549.ACE2+ cells (in growth medium supplemented with 2% FBS) to each well. E-plates were placed at room temperature for 15 min and then transferred to the xCELLigence RTCA instrument, located in an incubator at 37 °C and 5% CO2. The attachment and overnight growth of the cells was monitored (measurement every 20 min). Cell adherence and growth result in an increase in Cl followed by a flattening of the curve when the cells reach confluency. In parallel, HEK293T cells (400 000 cells per well in growth medium supplemented with 10% FBS) were transfected with an S-expressing plasmid. Following overnight incubation, a short CEI normalisation measurement (5 consecutive measurements, every 5 s) was performed on the A549 cell monolayer. In parallel, spike-expressing transfected HEK293T cells were collected, digested with 0.25% trypsin, washed, resuspended, counted and administered to the A549.ACE2+ cells at 15 000 cells per well (= overlay step), simultaneously with the test compounds or vehicle control. To quantify spike-independent Cl changes resulting from the overlay, an equal number of HEK293T cells mock-transfected with empty vector is added to the A549.ACE2+ cells instead. After the overlay, the A549.ACE2+ monolayer is monitored over time for 24h and data points are displayed every 2 minutes.
5.1.9 CEI data analysis
The CEI biosensor monitors the Cell Index (Cl), a dimensionless parameter derived from the frequencydependent resistance (R) component of the impedance value (Z) at 10, 25 and 50 kHz frequency. Raw Cl values were used as a starting point for data manipulations. All data are first normalized to the baseline before the overlay step, to reduce inter-well variation. Spike-dependent fusion was calculated by subtracting the Cl values of A549.ACE2+:HEK293T.empty_vector overlay (spike independent) from the Cl changes of the A549.ACE2+:HEK293T.spike overlay (spike-dependent + independent). This results in a baseline-corrected normalized Cl measure. The maximal Cl change of the A549.ACE2+:HEK293T.spike overlay (of the baseline corrected Cl value) in the absence of compound, is then set to 100% and the maximal Cl change of the conditions with compound are reported relative to this value. CEI data were preprocessed, normalized and baseline-corrected using an in-house built Matlab script (version R2016b, Mathworks). IC5o calculation was done in GraphPad Prism (version 9) using nonlinear regression: log[inh ibitor] vs. normalized response variable slope. 5.2 Results
To further validate the antiviral potency of the alphabodies as taught herein (and particularly Alphabody 626C (see Table 3) and 633D ), infection experiments were performed with authentic SARS-CoV-2 virus. First, human glioblastoma U87.ACE2+ cells were used for the infection with the original Wuhan-Hu-1 strain. The U87.ACE2+ cells have been reported as being permissive to SARS-CoV-2 with the induction of a strong cytopathic effect (CPE) that can be utilized for cell viability quantification (Vanhulle E. et al., SARS-CoV-2 Permissive glioblastoma cell line for high throughput antiviral screening, Antiviral Res. 2022 Jul; 203:105352). As these cells express low levels of TMPRSS2 but high levels of cathepsins, they might accommodate a mainly endosomal entry route for SARS-CoV-2. As shown in Figure 4, AB 626C exerted a clear concentration-dependent inhibition of Wuhan-Hu-1 replication in the U87.ACE2+ cells, with an IC5o value of 0.27 pM. In contrast, AB 633D had no antiviral effect up to 5 pM, and the inhibitory effect of Griffithsin (GRFT) on Wuhan-Hu-1 in these cells was rather limited (17% reduction in CPE with 5 pM GRFT). Interestingly, a similar inhibitory effect of 626C was observed against the Delta variant (Figure 4; IC50 value of 0.28 pM), whereas both 633D and GRFT remained inactive at a 5 pM concentration. Moreover, 626C potently inhibited the infection of the U87.ACE2+ cells with the Omicron variant, with an IC50 value in the low nanomolar range (Figure 4; IC50 value of 33 nM), whereas in contrast both 633D and GRFT exerted minimal antiviral effect (< 10% inhibition of CPE) at a 5 pM concentration.
Secondly, air-liquid-interface (ALI) cultures of differentiated human lung epithelial Calu-3 cells were used that represent a more physiologically relevant infection model for SARS-CoV-2. ALI cultures of Calu-3 cells were briefly exposed (1.5 hour) at the apical side to the Omicron variant of SARS-CoV-2 together with the test compound. After the 1.5 hour infection, virus input (and compound) was removed, cells were washed with PBS and exposed again to air for the duration of the experiment. At 3 days post infection, the virus particles that were released at the apical side of the ALI cultures were collected (PBS wash), and the viral content of the apical wash was determined by RT-qPCR detection of the viral genome. As shown in Figure 5, AB 626C exerted a clear concentration-dependent inhibition of Omicron infection of the ALI culture, with nearly full protection at 0.1 pM concentration. Of note, AB 633D also showed a profound antiviral effect, whereas GRFT (at 1 pM) was inactive against Omicron in the ALI infection culture.

Claims

1. A polypeptide capable of inhibiting a betacoronavirus, comprising an Alphabody sequence, wherein the Alphabody sequence has the general formula
HRS1-L1-HRS2-L2-HRS3,
-wherein each of HRS1, HRS2 and HRS3 is independently an alpha-helical heptad repeat sequence (HRS) comprising 2 to 4 consecutive heptad repeat units,
- wherein said heptad repeat units are 7-residue (poly)peptide fragments represented as 'abcdefg' or 'defgabc', wherein the symbols 'a1 to 'g' denote conventional heptad positions,
- wherein at least 50% of all heptad a- and d-positions are occupied by isoleucine residues,
- wherein each HRS starts and ends with an aliphatic or aromatic amino acid residue located at a heptad a-position or d-position,
- wherein each of LI and L2 are independently a linker fragment, which covalently connect HRS1 to HRS2 and HRS2 to HRS3, respectively, characterized in that
- the polypeptide comprises an N-terminal extension region directly fused to the N-terminus of HRS1 of the Alphabody sequence, wherein the N-terminal extension region comprises a sequence having at least 70% sequence identity with the sequence VDLGDISGIEASSVNIQAEISQLN (SEQ ID NO: 1), and
- HRS1 of the Alphabody sequence comprises a sequence having at least 70% sequence identity with the sequence IVAISLGITAIQYSIQSL (SEQ. ID NO: 2).
2. The polypeptide according to claim 1, wherein the betacoronavirus is severe acute respiratory syndrome coronavirus 1 (SARS-CoV-1) or severe acute respiratory syndrome coronavirus 2 (SARS-CoV- 2), preferably SARS-CoV-2.
3. The polypeptide according to claim 1 or 2, wherein a glycan binding domain is fused to the N-terminal extension region or to the Alphabody sequence via a flexible spacer sequence, preferably wherein the flexible spacer sequence comprises from 15 to 35 amino acid residues.
4. The polypeptide according to claim 3, wherein the glycan binding domain is fused to the N-terminus of the N-terminal extension region.
5. The polypeptide according to claim 3, wherein the glycan binding domain is fused to the C-terminus of the HRS3 of the Alphabody sequence.
6. The polypeptide according to any one of claims 3-5, wherein the glycan binding domain is a lectin chosen from the group consisting of Griffithsin and Human Surfactant Protein D.
7. A nucleic acid sequence encoding the polypeptide as defined in any one of claims 1 to 6.
8. A pharmaceutical composition comprising the polypeptide according to any one of claims 1 to 6 or the nucleic acid sequence according to claim 7, and a pharmaceutically acceptable carrier.
9. The polypeptide according to any one of claims 1 to 6, the nucleic acid sequence according to claim 7 or the pharmaceutical composition according to claim 8 for use as a medicament.
10. The polypeptide according to any one of claims 1 to 6, the nucleic acid sequence according to claim 7 or the pharmaceutical composition according to claim 8 for use in the treatment and/or prevention of a beta- coronavirus infection, preferably a SARS-CoV-2 infection.
PCT/EP2023/055929 2022-03-08 2023-03-08 Polypeptides capable of inhibiting sars-cov-2 viruses WO2023170173A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP22160768 2022-03-08
EP22160768.2 2022-03-08

Publications (1)

Publication Number Publication Date
WO2023170173A1 true WO2023170173A1 (en) 2023-09-14

Family

ID=80685020

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2023/055929 WO2023170173A1 (en) 2022-03-08 2023-03-08 Polypeptides capable of inhibiting sars-cov-2 viruses

Country Status (1)

Country Link
WO (1) WO2023170173A1 (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012093013A1 (en) * 2011-01-06 2012-07-12 Complix Nv Alphabodies specifically binding to class-i viral fusion proteins and methods for producing the same
WO2021203044A2 (en) * 2020-04-03 2021-10-07 Icahn School Of Medicine At Mount Sinai High-throughput assay for circulating antibodies against severe acute respiratory syndrome coronavirus 2
EP3892298A1 (en) * 2020-04-09 2021-10-13 PreviPharma Consulting GmbH Epitopes having sequence homology to coronavirus spike protein subunit and uses thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012093013A1 (en) * 2011-01-06 2012-07-12 Complix Nv Alphabodies specifically binding to class-i viral fusion proteins and methods for producing the same
WO2021203044A2 (en) * 2020-04-03 2021-10-07 Icahn School Of Medicine At Mount Sinai High-throughput assay for circulating antibodies against severe acute respiratory syndrome coronavirus 2
EP3892298A1 (en) * 2020-04-09 2021-10-13 PreviPharma Consulting GmbH Epitopes having sequence homology to coronavirus spike protein subunit and uses thereof

Non-Patent Citations (16)

* Cited by examiner, † Cited by third party
Title
"NCBI GenBank", Database accession no. YP_009724390.1
BROWN ET AL., PROTEINS, vol. 26, 1996, pages 134 - 145
COHENPARRY, PROTEINS, vol. 7, 1990, pages 1 - 15
HARBURY ET AL., SCIENCE, vol. 282, 1998, pages 1462 - 1467
J. DESMETK. VERSTRAETEY. BLOCHE. LORENTY. WENB. DEVREESEK. VANDENBROUCKES. LOVERIXT. HETTMANNS. DEROO: "Structural basis of IL-23 antagonism by an Alphabody protein scaffold", NAT. COMMUN., vol. 5, 2014, pages 5237
KOHNHODGES, TRENDS BIOTECHNOL, vol. 16, 1998, pages 379 - 389
LUPAS ET AL., SCIENCE, vol. 252, 1991, pages 1162 - 1164
LUPASGRUBER, ADV PROTEIN CHEM, vol. 70, 2005, pages 79 - 112
MASONARNDT, CHEMBIOCHEM, vol. 5, 2004, pages 170 - 176
MCFARLANE ET AL., EURJ PHARMACOL, vol. 625, 2009, pages 101 - 107
O'KEEFE ET AL., PROC NATL ACAD SCI USA, vol. 160, no. 15, 2009, pages 6099 - 104
PARRY ET AL., J STRUCT BIOL, vol. 163, 2008, pages 258 - 269
SCHNEIDER ET AL., FOLD DES, vol. 3, 1998, pages R29 - R40
SUZUKI ET AL., PROTEIN ENGINEERING, vol. 11, 1998, pages 1051 - 1055
VANHULLE E. ET AL.: "Carbohydrate-binding protein from stinging nettle as fusion inhibitor for SARS-CoV-2 variants of concern", FRONT. CELL. INFECT. MICROBIOL., vol. 12, no. 12, 30 August 2022 (2022-08-30), pages 989534
VANHULLE E. ET AL.: "SARS-CoV-2 Permissive glioblastoma cell line for high throughput antiviral screening", ANTIVIRAL RES, vol. 203, July 2022 (2022-07-01), pages 105352

Similar Documents

Publication Publication Date Title
Senapati et al. Contributions of human ACE2 and TMPRSS2 in determining host–pathogen interaction of COVID-19
US10117925B2 (en) Influenza virus vaccines and uses thereof
US10328144B2 (en) Influenza virus vaccines and uses thereof
WO2009062348A1 (en) Methods for inhibiting influenza virus infection and their drugs
WO2022096899A1 (en) Viral spike proteins and fusion thereof
WO2012093013A1 (en) Alphabodies specifically binding to class-i viral fusion proteins and methods for producing the same
JP5823296B2 (en) Mutated protein of F protein of PIV-5 and PIV-2
WO2023170173A1 (en) Polypeptides capable of inhibiting sars-cov-2 viruses
AU2022346446A1 (en) Multivalent polypeptide constructs capable of binding viral spike proteins and methods of using the same
TW202317600A (en) Multivalent vaccine for protection against multiple virus infection
JP5813509B2 (en) Mutated protein of F protein of PIV-5 and PIV-2
US20080069830A1 (en) Dna Sequences, Peptides, Antibodies and Vaccines for Prevention and Treatment of Sars
Lamb et al. Highly specific inhibition of leukaemia virus membrane fusion by interaction of peptide antagonists with a conserved region of the coiled coil of envelope
JP7167088B2 (en) Influenza virus vaccine and its use
Ma et al. Spike substitution T813S increases Sarbecovirus fusogenicity by enhancing the usage of TMPRSS2
US20240239868A1 (en) Polymeric immunoglobulin receptor mutants and uses thereof
AU2018342997C1 (en) Cutaneous papilloma virus vaccine
JP2023551821A (en) Methods and compositions for treating viral infections
EP4127191A1 (en) Vectors for producing virus-like particles and uses thereof
EP2661444B1 (en) Alphabodies specifically binding to class-i viral fusion proteins and methods for producing the same
Heald-Sargent Host Entry Factors for Human Coronaviruses

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23711960

Country of ref document: EP

Kind code of ref document: A1