WO2023170109A1 - Methods of treatment of gnaq and gna11 driven disease - Google Patents

Methods of treatment of gnaq and gna11 driven disease Download PDF

Info

Publication number
WO2023170109A1
WO2023170109A1 PCT/EP2023/055817 EP2023055817W WO2023170109A1 WO 2023170109 A1 WO2023170109 A1 WO 2023170109A1 EP 2023055817 W EP2023055817 W EP 2023055817W WO 2023170109 A1 WO2023170109 A1 WO 2023170109A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
acid molecule
nucleic acid
strand
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2023/055817
Other languages
English (en)
French (fr)
Inventor
Veronica KINSLER
Davide ZECCHIN
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Francis Crick Institute Ltd
Original Assignee
Francis Crick Institute Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GBGB2203164.5A external-priority patent/GB202203164D0/en
Priority claimed from GBGB2203233.8A external-priority patent/GB202203233D0/en
Application filed by Francis Crick Institute Ltd filed Critical Francis Crick Institute Ltd
Priority to US18/844,507 priority Critical patent/US20250230435A1/en
Priority to AU2023232895A priority patent/AU2023232895A1/en
Priority to EP23710004.5A priority patent/EP4490290A1/en
Priority to JP2024553192A priority patent/JP2025509242A/ja
Priority to CN202380026446.9A priority patent/CN118843690A/zh
Publication of WO2023170109A1 publication Critical patent/WO2023170109A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/313Phosphorodithioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar

Definitions

  • the present invention relates to novel compositions and methods of treating clinical conditions arising from GNAQ and GNA11 somatic mutations including cancer, Sturge-Weber syndrome (SWS), Phakomatosis Pigmentovascularis (PPV), Extensive Dermal Melanocytosis (EDM) and congenital hemangiomas (including rapidly involuting congenital hemangioma (RICH), partially involuting congenital hemangioma (PICH) and non-involuting congenital hemangioma (NICH)).
  • SWS Sturge-Weber syndrome
  • PDV Phakomatosis Pigmentovascularis
  • EDM Extensive Dermal Melanocytosis
  • congenital hemangiomas including rapidly involuting congenital hemangioma (RICH), partially involuting congenital hemangioma (PICH) and non-involuting congenital hemangioma (NICH)).
  • Sturge-Weber syndrome SWS
  • Phakomatosis Pigmentovascularis Phakomatosis Pigmentovascularis
  • EDM Extensive Dermal Melanocytosis
  • EDM represents the purely pigmentary end of this vascular-pigmentary disease spectrum.
  • the neurovascular abnormalities in SWS and PPV can lead to neurodevelopmental impairment, seizures, headaches and stroke-like episodes [3], Symptoms often worsen in the first year of life, thought to be related to cerebral perfusion defects as well as seizure-related damage. Such frequent post-natal progression suggests a window at which to target therapy.
  • GNAQ vascular phenotype
  • PPV and EDM are likely to come from the same genetic variants occurring in different embryonic precursors.
  • GNA11 mainly affecting codon 209 have also been described in congenital haemangiomas, a benign vascular tumour which may or may not involute spontaneously after birth (RICH, PICH and NICH variants, rapidly involuting, non-involuting and partially involuting) [10], and in other tumours of vasculature [11],
  • Somatic GNAQ and GNA11 mutations have also been described in a wide variety of non- congenital tumours, particularly uveal, leptomeningeal and hepatic, and encompassing both benign and malignant tumours [12,13], Germline, as opposed to somatic, mutations in GNA11 which affect codons other than 183 and 209 have been described in types of familial hypo- and hypercalcaemia [14], Lastly, inherited variants of gene GNA11 are known to cause familial hypo- and hyper-calcaemia [15,16] by affecting intracellular calcium signalling, although this is in the distinct and specific context of coupling to the calcium-sensing receptor (CaSR) in parathyroid glands.
  • CaSR calcium-sensing receptor
  • neurovascular disease pathogenesis and/or progression in SWS and PPV may relate to disturbed local or systemic calcium homeostasis caused by abnormal intracellular calcium signalling in endothelial variant cells.
  • This hypothesis was based on several observations. Firstly, neurovascular mural calcification develops over time, leading to the classical ‘tram-lining’ sign of blood vessels first described on plain skull radiography [19], Secondly, the proteins encoded by the GNAQ and GNA11 genes, G subunit a q and 11 respectively, are known regulators of intracellular calcium signalling.
  • GPCR G-protein coupled receptors
  • IP3 inositol tris-phosphate
  • ER emptying then triggers replenishment of calcium stores via activation of calcium-release-activated channels (CRAC) and intracellular influx of extracellular calcium.
  • CRAC calcium-release-activated channels
  • the present invention provides a nucleic acid molecule comprising a first strand of 10 to 50 linked nucleosides, wherein the first strand comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding GNAQ or GNA11.
  • the first strand comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding a gain-of-function variant of GNAQ or GNA11. In some embodiments, the first strand comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding GNAQ. In some embodiments, the first strand comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding a gain-of-function variant of GNAQ.
  • the first strand comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding GNA11. In some embodiments, the first strand comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding a gain-of-function variant of GNA11.
  • the first strand consists of 10 to 40 linked nucleosides. In some embodiments, the first strand consists of 10 to 30 linked nucleosides. In some embodiments, the first strand consists of 15 to 30 linked nucleosides. In some embodiments, the first strand consists of 15 to 25 linked nucleosides. In some embodiments, the first strand consists of 15 to 20 linked nucleosides. In some embodiments, the first strand consists of 10 to 20 linked nucleosides. In some embodiments, the first strand consists of 20 to 30 linked nucleosides. In some embodiments, the first strand consists of 20 to 25 linked nucleosides. In some embodiments, the first strand consists of 21 linked nucleosides.
  • the first strand comprises a sequence that is fully complementary to a sequence having at least 95% identity to an equal length portion of an mRNA encoding variant GNAQ p.(R183Q), p.(R183G), p.(R183L) or p.(R183*). In some embodiments, the first strand comprises a sequence that is fully complementary to a sequence having 100% identity to an equal length portion of an mRNA encoding variant GNAQ p.(R183Q), p.(R183G), p.(R183L) or p.(R183*).
  • the nucleic acid molecule is capable of inhibiting the expression of variant GNAQ p.(R183Q/G/L/*) in vitro by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90%. In some embodiments, the nucleic acid molecule inhibits the expression of variant GNAQ p.(R183Q/G/L/*) in vitro to a greater extent relative to inhibition of the expression of wild type GNAQ in vitro. In some embodiments, the nucleic acid molecule is capable of partially or completely rescuing aberrant cell differentiation signalling in cells expressing variant GNAQ p.(R183Q/G/L/*).
  • the variant GNAQ p.(R183Q) is caused by a C.G548A mutation in the GNAQ genomic sequence.
  • the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 13-18.
  • the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 13-18.
  • the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 13-18.
  • the variant GNAQ p.(R183G) is caused by a C.C547G mutation in the GNAQ genomic sequence.
  • the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 33-38.
  • the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 33-38.
  • the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 33-38.
  • the variant GNAQ p.(R183L) is caused by a C.G548T mutation in the GNAQ genomic sequence.
  • the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 45-50.
  • the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 45-50.
  • the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 45-50.
  • the variant GNAQ p.(R183*) is caused by a C.C547T mutation in the GNAQ genomic sequence.
  • the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 57-62.
  • the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 57-62.
  • the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 57-62.
  • the first strand comprises a sequence that is fully complementary to a sequence having at least 95% identity to an equal length portion of an mRNA encoding variant GNA11 p.(R183C) or p.(R183H). In some embodiments, the first strand comprises a sequence that is fully complementary to a sequence having 100% identity to an equal length portion of an mRNA encoding variant GNA11 p.(R183C) or p.(R183H).
  • the nucleic acid molecule is capable of inhibiting the expression of variant GNA11 p.(R183C/H) in vitro by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90%. In some embodiments, the nucleic acid molecule inhibits the expression of variant GNA11 p.(R183C/H) in vitro to a greater extent relative to inhibition of the expression of wild type GNA11 in vitro. In some embodiments, the nucleic acid molecule is capable of partially or completely rescuing aberrant cell differentiation signalling in cells expressing variant GNA11 p.(R183C/H).
  • the variant GNA11 p.(R183C) is caused by a C.C547T mutation in the GNA11 genomic sequence.
  • the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 19-24.
  • the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 19-24.
  • the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 19-24.
  • the variant GNA11 p.(R183C) is caused by a c.546_547delinsTT mutation in the GNA11 genomic sequence.
  • the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 69-74.
  • the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 69-74.
  • the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 69-74.
  • the variant GNA11 p.(R183H) is caused by a C.G548A mutation in the GNA11 genomic sequence.
  • the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 81-86.
  • the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 81-86.
  • the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 81-86.
  • the nucleic acid molecule is a single stranded nucleic acid molecule. In some embodiments, the nucleic acid molecule is a double stranded nucleic acid molecule.
  • the double stranded nucleic acid molecule comprises a second strand of 10 to 50 linked nucleosides, wherein the second strand is at least partially complementary to the first strand.
  • the second strand is at least 80% complementary to the first strand.
  • the second strand is at least 90% complementary to the first strand.
  • the second strand is at least 95% complementary to the first strand.
  • the second strand is fully complementary to the first strand.
  • the second strand consists of 10 to 40 linked nucleosides.
  • the second strand consists of 10 to 30 linked nucleosides.
  • the second strand consists of 15 to 30 linked nucleosides.
  • the second strand consists of 15 to 25 linked nucleosides.
  • the second strand consists of 15 to 20 linked nucleosides. In some embodiments, the second strand consists of 10 to 20 linked nucleosides. In some embodiments, the second strand consists of 20 to 30 linked nucleosides. In some embodiments, the second strand consists of 20 to 25 linked nucleosides. In some embodiments, the second strand consists of 21 linked nucleosides.
  • the first strand is longer than the second strand.
  • the nucleic acid comprises an overhang at the 3’ end of the first strand of 1 , 2, 3, 4, 5 or more nucleosides. In some embodiments, the nucleic acid comprises an overhang at the 3’ end of the first strand of 2 nucleosides. In some embodiments, the nucleic acid comprises an overhang at the 5’ end of the first strand of 1 , 2, 3, 4, 5 or more nucleosides. In some embodiments, the nucleic acid comprises an overhang at the 5’ end of the first strand of 2 nucleosides.
  • the second strand is longer than the first strand.
  • the nucleic acid comprises an overhang at the 3’ end of the second strand of 1 , 2, 3, 4, 5 or more nucleosides. In some embodiments, the nucleic acid comprises an overhang at the 3’ end of the second strand of 2 nucleosides. In some embodiments, the nucleic acid comprises an overhang at the 5’ end of the second strand of 1 , 2, 3, 4, 5 or more nucleosides. In some embodiments, the nucleic acid comprises an overhang at the 5’ end of the second strand of 2 nucleosides.
  • the nucleic acid comprises an overhang at both the 5’ end and the 3’ end of the first strand of 1 , 2, 3, 4, 5 or more nucleosides. In some embodiments, the nucleic acid comprises an overhang at both the 5’ end and the 3’ end of the first strand of 2 nucleosides. In some embodiments, the overhang comprises two thymine nucleotides (TT). In some embodiments, the overhang consists of two thymine nucleotides (TT).
  • the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:1 and SEQ ID NO:13, SEQ ID NO:2 and SEQ ID NO:14, SEQ ID NO:3 and SEQ ID NO:15, SEQ ID NO:4 and SEQ ID NO:16, SEQ ID NO:5 and SEQ ID NO:17; and SEQ ID NO:6 and SEQ ID NO:18.
  • the nucleic acid molecule comprises a first strand and a second strand consisting a pair of sequences selected from the list consisting of: SEQ ID NO:1 and SEQ ID NO:13, SEQ ID NO:2 and SEQ ID NO:14, SEQ ID NO:3 and SEQ ID NO:15, SEQ ID NO:4 and SEQ ID NO:16, SEQ ID NO:5 and SEQ ID NO:17; and SEQ ID NO:6 and SEQ ID NO:18.
  • the nucleic acid molecule consists of a first strand and a second strand consisting a pair of sequences selected from the list consisting of: SEQ ID NO:1 and SEQ ID NO:13, SEQ ID NO:2 and SEQ ID NO:14, SEQ ID NO:3 and SEQ ID NO:15, SEQ ID NO:4 and SEQ ID NO:16, SEQ ID NO:5 and SEQ ID NO:17; and SEQ ID NO:6 and SEQ ID NO:18.
  • the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:7 and SEQ ID NO:19, SEQ ID NO:8 and SEQ ID NQ:20, SEQ ID NO:9 and SEQ ID NO:21 , SEQ ID NO:10 and SEQ ID NO:22, SEQ ID NO:11 and SEQ ID NO:23; and SEQ ID NO:12 and SEQ ID NO:24.
  • the nucleic acid molecule comprises a first strand and a second strand consisting a pair of sequences selected from the list consisting of: SEQ ID NO:7 and SEQ ID NO:19, SEQ ID NO:8 and SEQ ID NQ:20, SEQ ID NO:9 and SEQ ID NO:21 , SEQ ID NQ:10 and SEQ ID NO:22, SEQ ID NO:11 and SEQ ID NO:23; and SEQ ID NO:12 and SEQ ID NO:24.
  • the nucleic acid molecule consists of a first strand and a second strand consisting a pair of sequences selected from the list consisting of: SEQ ID NO:7 and SEQ ID NO:19, SEQ ID NO:8 and SEQ ID NQ:20, SEQ ID NO:9 and SEQ ID NO:21 , SEQ ID NQ:10 and SEQ ID NO:22, SEQ ID NO:11 and SEQ ID NO:23; and SEQ ID NO:12 and SEQ ID NO:24.
  • the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:27 and SEQ ID NO:33, SEQ ID NO:28 and SEQ ID NO:34, SEQ ID NO:29 and SEQ ID NO:35, SEQ ID NQ:30 and SEQ ID NO:36, SEQ ID NO:31 and SEQ ID NO:37; and SEQ ID NO:32 and SEQ ID NO:38.
  • the nucleic acid molecule comprises a first strand and a second strand consisting a pair of sequences selected from the list consisting of: SEQ ID NO:27 and SEQ ID NO:33, SEQ ID NO:28 and SEQ ID NO:34, SEQ ID NO:29 and SEQ ID NO:35, SEQ ID NQ:30 and SEQ ID NO:36, SEQ ID NO:31 and SEQ ID NO:37; and SEQ ID NO:32 and SEQ ID NO:38.
  • the nucleic acid molecule consists of a first strand and a second strand consisting a pair of sequences selected from the list consisting of: SEQ ID NO:27 and SEQ ID NO:33, SEQ ID NO:28 and SEQ ID NO:34, SEQ ID NO:29 and SEQ ID NO:35, SEQ ID NQ:30 and SEQ ID NO:36, SEQ ID NO:31 and SEQ ID NO:37; and SEQ ID NO:32 and SEQ ID NO:38.
  • the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:39 and SEQ ID NO:45, SEQ ID NQ:40 and SEQ ID NO:46, SEQ ID NO:41 and SEQ ID NO:47, SEQ ID NO:42 and SEQ ID NO:48, SEQ ID NO:43 and SEQ ID NO:49; and SEQ ID NO:44 and SEQ ID NQ:50.
  • the nucleic acid molecule comprises a first strand and a second strand consisting a pair of sequences selected from the list consisting of: SEQ ID NO:39 and SEQ ID NO:45, SEQ ID NQ:40 and SEQ ID NO:46, SEQ ID NO:41 and SEQ ID NO:47, SEQ ID NO:42 and SEQ ID NO:48, SEQ ID NO:43 and SEQ ID NO:49; and SEQ ID NO:44 and SEQ ID NQ:50.
  • the nucleic acid molecule consists of a first strand and a second strand consisting a pair of sequences selected from the list consisting of: SEQ ID NO:39 and SEQ ID NO:45, SEQ ID NQ:40 and SEQ ID NO:46, SEQ ID NO:41 and SEQ ID NO:47, SEQ ID NO:42 and SEQ ID NO:48, SEQ ID NO:43 and SEQ ID NO:49; and SEQ ID NO:44 and SEQ ID NQ:50.
  • the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:51 and SEQ ID NO:57, SEQ ID NO:52 and SEQ ID NO:58, SEQ ID NO:53 and SEQ ID NO:59, SEQ ID NO:54 and SEQ ID NQ:60, SEQ ID NO:55 and SEQ ID NO:61 ; and SEQ ID NO:56 and SEQ ID NO:62.
  • the nucleic acid molecule comprises a first strand and a second strand consisting a pair of sequences selected from the list consisting of: SEQ ID NO:51 and SEQ ID NO:57, SEQ ID NO:52 and SEQ ID NO:58, SEQ ID NO:53 and SEQ ID NO:59, SEQ ID NO:54 and SEQ ID NQ:60, SEQ ID NO:55 and SEQ ID NO:61 ; and SEQ ID NO:56 and SEQ ID NO:62.
  • the nucleic acid molecule consists of a first strand and a second strand consisting a pair of sequences selected from the list consisting of: SEQ ID NO:51 and SEQ ID NO:57, SEQ ID NO:52 and SEQ ID NO:58, SEQ ID NO:53 and SEQ ID NO:59, SEQ ID NO:54 and SEQ ID NQ:60, SEQ ID NO:55 and SEQ ID NO:61 ; and SEQ ID NO:56 and SEQ ID NO:62.
  • the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:63 and SEQ ID NO:69, SEQ ID NO:64 and SEQ ID NO:70, SEQ ID NO:65 and SEQ ID NO:71 , SEQ ID NO:66 and SEQ ID NO:72, SEQ ID NO:67 and SEQ ID NO:73; and SEQ ID NO:68 and SEQ ID NO:74.
  • the nucleic acid molecule comprises a first strand and a second strand consisting a pair of sequences selected from the list consisting of: SEQ ID NO:63 and SEQ ID NO:69, SEQ ID NO:64 and SEQ ID NQ:70, SEQ ID NO:65 and SEQ ID NO:71 , SEQ ID NO:66 and SEQ ID NO:72, SEQ ID NO:67 and SEQ ID NO:73; and SEQ ID NO:68 and SEQ ID NO:74.
  • the nucleic acid molecule consists of a first strand and a second strand consisting a pair of sequences selected from the list consisting of: SEQ ID NO:63 and SEQ ID NO:69, SEQ ID NO:64 and SEQ ID NQ:70, SEQ ID NO:65 and SEQ ID NO:71 , SEQ ID NO:66 and SEQ ID NO:72, SEQ ID NO:67 and SEQ ID NO:73; and SEQ ID NO:68 and SEQ ID NO:74.
  • the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:75 and SEQ ID NO:81 , SEQ ID NO:76 and SEQ ID NO:82, SEQ ID NO:77 and SEQ ID NO:83, SEQ ID NO:78 and SEQ ID NO:84, SEQ ID NO:79 and SEQ ID NO:85; and SEQ ID NQ:80 and SEQ ID NO:86.
  • the nucleic acid molecule comprises a first strand and a second strand consisting a pair of sequences selected from the list consisting of: SEQ ID NO:75 and SEQ ID NO:81 , SEQ ID NO:76 and SEQ ID NO:82, SEQ ID NO:77 and SEQ ID NO:83, SEQ ID NO:78 and SEQ ID NO:84, SEQ ID NO:79 and SEQ ID NO:85; and SEQ ID NQ:80 and SEQ ID NO:86.
  • the nucleic acid molecule consists of a first strand and a second strand consisting a pair of sequences selected from the list consisting of: SEQ ID NO:75 and SEQ ID NO:81 , SEQ ID NO:76 and SEQ ID NO:82, SEQ ID NO:77 and SEQ ID NO:83, SEQ ID NO:78 and SEQ ID NO:84, SEQ ID NO:79 and SEQ ID NO:85; and SEQ ID NQ:80 and SEQ ID NO:86.
  • the present invention also provides compound comprising a nucleic acid molecule according to the invention and a targeting moiety.
  • the targeting moiety comprises a lipid nanoparticle, a liposome, an exosome, an antibody or fragment thereof, an antigen binding domain or fragment thereof, a peptide, a cell-penetrating peptide, a conjugate group, or any combination thereof.
  • the targeting moiety comprises a conjugate group and wherein the conjugate group comprises one or more carbohydrates.
  • the conjugate group comprises a monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, polysaccharide, modified polysaccharide, mannose, galactose, a mannose derivative, a galactose derivative, D- mannopyranose, L-Mannopyranose, D-Arabinose, L-Galactose, D-xylofuranose, L-xylofuranose, D- glucose, L-glucose, D-Galactose, L-Galactose, a-D-Mannofuranose, p-D-Mannofuranose, a-D- Mannopyranose, p-D-Mannopyranose, a-D-Glucopyranose, p-D-Glucopyranose, a-D-Glucofuranose, p-D-Glucofuranose, a-D-D-Glu
  • the targeting moiety is linked to the 3’ end of the second strand. In some embodiments, the targeting moiety is linked to the 5’ end of the second strand. In some embodiments, the targeting moiety is linked to the 5’ end of the first strand. In some embodiments, the targeting moiety is linked to the 3’ end of the first strand.
  • At least one nucleoside of the nucleic acid comprises a modified sugar.
  • at least one internucleoside linkage of the nucleic acid is a modified internucleoside linkage.
  • the modified internucleoside linkage is a phosphorothioate or phosphorodithioate internucleoside linkage.
  • the nucleic acid comprises 1 to 40 phosphorothioate or phosphorodithioate internucleoside linkages. .
  • the nucleic acid comprises 1 to 30 phosphorothioate or phosphorodithioate internucleoside linkages. .
  • the nucleic acid comprises 1 to 20 phosphorothioate or phosphorodithioate internucleoside linkages. . In some embodiments, the nucleic acid comprises 1 to 10 phosphorothioate or phosphorodithioate internucleoside linkages.
  • the nucleic acid molecule specifically targets a DNA sequence selected from the list consisting of SEQ ID NO:89 (G/VAQ c.548G>A_p.R183Q), SEQ ID NO:91 (G/VAQ c.547C>G_p.R183G), SEQ ID NO:93 (G/VAQ c.548G>T_p.R183L), SEQ ID NO:95 (G/VAQ c.547C>T_p.R183*), SEQ ID NO:99 (GNA11 c.547C>T_p.R183C), SEQ ID NO: 101 (GNA11 c.546_547delinsTT _p.R183C) and SEQ ID NO: 103 (GNA11 c.548G>A_p.R183H).
  • SEQ ID NO:89 G/VAQ c.548G>A_p.R183Q
  • SEQ ID NO:91 G/VAQ c.547C>G_p
  • the present invention also provides a composition comprising the single-stranded nucleic acid molecule or compound according to the invention or salt thereof and at least one of a pharmaceutically acceptable carrier or diluent.
  • the present invention also provides a prodrug comprising the nucleic acid molecule or compound of the invention.
  • the present invention also provides a nucleic acid molecule comprising a nucleotide sequence encoding a CRISPR guide RNA (gRNA), wherein the gRNA hybridizes with a target sequence in a cell and wherein the target sequence encodes a variant allele of GNAQ or GNA11.
  • gRNA CRISPR guide RNA
  • the present invention also provides a CRISPR nuclease system comprising one or more vectors comprising: (a) a promoter operably linked to at least one nucleotide sequence encoding a CRISPR guide RNA (gRNA), wherein the gRNA hybridizes a target DNA sequence in a cell of the subject, and wherein the target sequence encodes a variant allele of GNAQ or GNA11 and
  • gRNA CRISPR guide RNA
  • nuclease for example a Cas nuclease
  • components (a) and (b) are located on the same or different vectors of the system, wherein the gRNA targets and hybridizes with the target DNA sequence and the nuclease cleaves the target sequence to alter expression of the variant allele of GNAQ or GNA11.
  • CRISPR nuclease system is packaged into a single adeno-associated virus (AAV) particle.
  • the nuclease is codon optimized for expression in the cell.
  • the promoter is operably linked to at least one, two, three, four, five, six, seven, eight, nine, or ten gRNA.
  • the gRNA targets a DNA sequence encoding variant GNAQ p.(R183Q), p.(R183G), p.(R183L) or p.(R183*).
  • the gRNA targets a DNA sequence encoding variant GNA11 p.(R183C) or p.(R183H).
  • the present invention also provides a method of treating a patient having a disease or disorder associated with or driven by variants in GNAQ and/or GNA11, the method comprising administering to the patient a nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to the invention.
  • the present invention also provides a method of treating a patient having Sturge-Weber syndrome (SWS), Phakomatosis Pigmentovascularis (PPV) or Extensive Dermal Melanocytosis (EDM), the method comprising administering to the patient a nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to the invention.
  • SWS Sturge-Weber syndrome
  • PV Phakomatosis Pigmentovascularis
  • EDM Extensive Dermal Melanocytosis
  • the present invention also provides a method of treating a patient having a congenital hemangioma, the method comprising administering to the patient a nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to the invention.
  • the congenital hemangioma is a rapidly involuting congenital hemangioma (RICH), a partially involuting congenital hemangioma (PICH) or a non-involuting congenital hemangioma (NICH).
  • the present invention also provides a method of treating a patient having cancer, the method comprising administering to the patient a nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to the invention.
  • the cancer is selected from the list consisting of: Adrenal gland cancer, Autonomic ganglia cancer, Biliary tract cancer, Bone cancer, Breast cancer, Central nervous system cancer, Cervix cancer, Endometrium cancer, Eye cancer, Fallopian tube cancer, Female genital tract cancer, Gastrointestinal tract cancer, Genital tract cancer, Haematopoietic cancer, lymphoid cancer, Kidney cancer, Large intestine cancer, Liver cancer, Lung cancer, Meninges cancer, NS cancer, Oesophagus cancer, Ovary cancer, Pancreas cancer, Parathyroid cancer, Penis cancer, Perineum cancer, Peritoneum cancer, Pituitary cancer, Placenta cancer, Pleura cancer, Prostate cancer, Salivary gland
  • the present invention also provides a method of treating a patient having melanoma, the method comprising administering to the patient a nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to the invention.
  • the present invention also provides a nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to the invention for use as a medicament.
  • the present invention also provides a nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to the invention for use in a method of treating Sturge-Weber syndrome (SWS), Phakomatosis Pigmentovascularis (PPV) or Extensive Dermal Melanocytosis (EDM) in a patient in need thereof, the method comprising, administering to the patient a nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to the invention.
  • SWS Sturge-Weber syndrome
  • PV Phakomatosis Pigmentovascularis
  • EDM Extensive Dermal Melanocytosis
  • the present invention also provides a nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to the invention for use in a method of treating a patient having a congenital hemangioma, the method comprising administering to the patient a nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to the invention.
  • the congenital hemangioma is a rapidly involuting congenital hemangioma (RICH), a partially involuting congenital hemangioma (PICH) or a non-involuting congenital hemangioma (NICH).
  • the present invention also provides a nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to the invention for use in a method of treating cancer in a patient in need thereof, the method comprising, administering to the patient a nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to the invention.
  • the present invention also provides a nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to the invention for use in a method of treating melanoma in a patient in need thereof, the method comprising, administering to the patient a nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to the invention.
  • the present invention also provides an expression construct comprising a nucleic acid molecule encoding the nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to the invention.
  • the present invention also provides an isolated nucleic acid molecule encoding the nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to the invention.
  • the present invention also provides a vector comprising an isolated nucleic acid molecule of the invention.
  • the vector is a viral vector, retroviral vector, expression cassette, or plasmid.
  • the vector further comprises an RNA Polymerase III or RNA Polymerase II promoter.
  • the RNA Polymerase III promoter is the U6 or H1 promoter.
  • the present invention also provides a host cell comprising the nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to the invention, the isolated nucleic acid molecule according to the invention or vector according to the invention.
  • the host cell is a mammalian host cell. In some embodiments, the host cell is a human host cell.
  • the nucleic acid molecule, compound, composition or prodrug is formulated for delivery with a lipid-based nanoparticle, a liposome, an exosome, a polymeric nanoparticle, an inorganic nanoparticle or a ruxolitinib and thalidomide co-delivered polyelectrolyte nanocomplex (RTNP).
  • RTNP thalidomide co-delivered polyelectrolyte nanocomplex
  • the nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system is not packaged for delivery (gymnotic delivery).
  • the nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system is administered by injection.
  • the nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system is injected using a microneedle. In some embodiments, the nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system is administered topically. [0051] In some embodiments, the administration further comprises electroporation or ultrasound.
  • the nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system is conjugated to docosanoic acid (DCA).
  • DCA docosanoic acid
  • the nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system is not packaged for delivery (gymnotic delivery).
  • the nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system is administered by injection.
  • the nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system is injected using a microneedle.
  • the nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system is formulated for delivery with a lipid-based nanoparticle and is injected using a microneedle.
  • the nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system is conjugated to docosanoic acid (DCA) and is injected using a microneedle.
  • DCA docosanoic acid
  • the present invention provides a double-stranded ribonucleic acid molecule comprising a sense strand consisting of 15 to 30 linked nucleosides and an antisense strand consisting of 15 to 30 linked nucleosides, wherein the anti-sense strand comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of a pregenomic RNA and/or an mRNA encoding gain-of-function variant of G/VAQ or a gain-of-function variant of GNA11 and wherein the sense strand is at least partially complementary to the antisense strand.
  • the present invention provides a double-stranded ribonucleic acid molecule comprising a sense strand consisting of 15 to 30 linked nucleosides and an antisense strand consisting of 15 to 30 linked nucleosides, wherein the anti-sense strand comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of a pregenomic RNA and/or an mRNA encoding variant GNAQ or variant GNA11 and wherein the sense strand is at least partially complementary to the antisense strand.
  • the present invention provides a double-stranded ribonucleic acid molecule comprising a sense strand consisting of 15 to 30 linked nucleosides and an antisense strand consisting of 15 to 30 linked nucleosides, wherein the anti-sense strand comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of a pregenomic RNA and/or an mRNA encoding variant GNAQ p.(R183Q) or variant GNA11 p.(R183C) and wherein the sense strand is at least partially complementary to the antisense strand.
  • the present invention provides a double-stranded ribonucleic acid molecule comprising a sense strand consisting of 15 to 30 linked nucleosides and an antisense strand consisting of 15 to 30 linked nucleosides, wherein the anti-sense strand comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of a pregenomic RNA and/or an mRNA encoding variant GNAQ p.(R183Q) and wherein the sense strand is at least partially complementary to the antisense strand.
  • the present invention provides a double-stranded ribonucleic acid molecule comprising a sense strand consisting of 15 to 30 linked nucleosides and an antisense strand consisting of 15 to 30 linked nucleosides, wherein the anti-sense strand comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of a pregenomic RNA and/or an mRNA encoding variant GNA11 p.(R183C) and wherein the sense strand is at least partially complementary to the antisense strand.
  • the anti-sense strand consists of 15 to 20 linked nucleosides. In some embodiments, the anti-sense strand consists of 15 to 25 linked nucleosides. In some embodiments, the anti-sense strand consists of 20 to 30 linked nucleosides. In some embodiments, the anti-sense strand consists of 20 to 25 linked nucleosides. In some embodiments, the antisense strand consists of 19 linked nucleosides.
  • the anti-sense strand comprises a sequence that is fully complementary to a sequence having at least 95% identity to an equal length portion of a pregenomic RNA and/or an mRNA encoding variant GNAQ p.(R183Q) or GNA11 p.(R183C). In some embodiments, the anti-sense strand comprises a sequence that is fully complementary to a sequence having 100% identity to an equal length portion of a pregenomic RNA and/or an mRNA encoding variant GNAQ p.(R183Q) or GNA11 p.(R183C).
  • the sense strand is at least 80% complementary to the antisense strand. In some embodiments, the sense strand is at least 90% complementary to the antisense strand. In some embodiments, the sense strand is at least 95% complementary to the antisense strand. In some embodiments, the sense strand is fully complementary to the antisense strand. [0061] In some embodiments, the double-stranded ribonucleic acid molecule or compound is capable of inhibiting the expression of variant GNAQ p.(R183Q) or GNA11 p.(R183C) in vitro by at least 50%, at least 60%, at least 70%, at least 80% or preferably at least 90%.
  • the compound is capable of partially or completely rescuing aberrant calcium signalling in cells expressing variant GNAQ p.(R183Q) or GNA11 p.(R183C).
  • the GNAQ R183Q variant is caused by a C.G548A mutation in the GNAQ genomic sequence.
  • the antisense strand comprises a sequence that is fully complementary to the C.G548A mutation.
  • the GNA11 R183C variant is caused by a C.C547T mutation in the GNA11 genomic sequence.
  • the antisense strand comprises a sequence that is fully complementary to the C.C547T mutation.
  • the anti-sense strand is longer than the sense strand.
  • the double-stranded ribonucleic acid molecule has an overhang at the 3’ end of the antisense strand of 1 , 2, 3, 4, 5 or more nucleosides.
  • the double-stranded ribonucleic acid molecule has an overhang at the 3’ end of the antisense strand of 2 nucleosides.
  • the double-stranded ribonucleic acid molecule has an overhang at the 5’ end of the antisense strand of 1 , 2, 3, 4, 5 or more nucleosides.
  • the double-stranded ribonucleic acid molecule has an overhang at the 5’ end of the antisense strand of 2 nucleosides.
  • the sense strand is longer than the antisense strand.
  • the double-stranded ribonucleic acid molecule has an overhang at the 3’ end of the sense strand of 1 , 2, 3, 4, 5 or more nucleosides.
  • the double-stranded ribonucleic acid molecule has an overhang at the 3’ end of the sense strand of 2 nucleosides.
  • the double-stranded ribonucleic acid molecule has an overhang at the 5’ end of the sense strand of 1 , 2, 3, 4, 5 or more nucleosides.
  • the double-stranded ribonucleic acid molecule has an overhang at the 5’ end of the sense strand of 2 nucleosides.
  • the sense strand comprises a nucleobase sequence comprising any one of SEQ ID NO:1 (UGCUUAGAGUUCAAGUCCC), SEQ ID NO:2 (GCUUAGAGUUCAAGUCCCC), SEQ ID NO:3 (CUUAGAGUUCAAGUCCCCA), SEQ ID NO:4 (UUAGAGUUCAAGUCCCCAC), SEQ ID NO:5 (UAGAGUUCAAGUCCCCACC), SEQ ID NO:6 (AGAGUUCAAGUCCCCACCA), SEQ ID NO:7 (GUGCUGCGGGUCUGCGUGC), SEQ ID NO:8 (UGCUGCGGGUCUGCGUGCC), SEQ ID NO:9 (GCUGCGGGUCUGCGUGCCC), SEQ ID NQ:10 (CUGCGGGUCUGCGUGCCCA), SEQ ID NO:11 (UGCGGGUCUGCGUGCCCAC) or SEQ ID NO:12 (CGGGUCUGCGUGCCCACCA).
  • the sense strand comprises a nucleobase sequence comprising any one of SEQ ID NO:1 (UGCUUAGAGUUCAAGUCCC) or SEQ ID NO:3 (CUUAGAGUUCAAGUCCCCA).
  • the sense strand comprises a nucleobase sequence comprising SEQ ID NQ:10 (CUGCGGGUCUGCGUGCCCA).
  • the sense strand consists of a nucleobase sequence having any one of SEQ ID NO:1 (UGCUUAGAGUUCAAGUCCC), SEQ ID NO:2 (GCUUAGAGUUCAAGUCCCC), SEQ ID NO:3 (CUUAGAGUUCAAGUCCCCA), SEQ ID NO:4 (UUAGAGUUCAAGUCCCCAC), SEQ ID NO:5 (UAGAGUUCAAGUCCCCACC), SEQ ID NO:6 (AGAGUUCAAGUCCCCACCA), SEQ ID NO:7 (GUGCUGCGGGUCUGCGUGC), SEQ ID NO:8 (UGCUGCGGGUCUGCGUGCC), SEQ ID NO:9 (GCUGCGGGUCUGCGUGCCC), SEQ ID NQ:10 (CUGCGGGUCUGCGUGCCCA), SEQ ID NO:11
  • the sense strand consists of a nucleobase sequence having any one of SEQ ID NO:1 (UGCUUAGAGUUCAAGUCCC) or SEQ ID NO:3 (CUUAGAGUUCAAGUCCCCA).
  • the sense strand consists of a nucleobase sequence having SEQ ID NQ:10 (CUGCGGGUCUGCGUGCCCA).
  • the antisense strand comprises a nucleobase sequence comprising any one of SEQ ID NO:13 (GGGACUUGAACUCUAAGCA), SEQ ID NO:14 (GGGGACUUGAACUCUAAGC), SEQ ID NO:15 (UGGGGACUUGAACUCUAAG), SEQ ID NO:16 (GUGGGGACUUGAACUCUAA), SEQ ID NO:17 (GGUGGGGACUUGAACUCUA), SEQ ID NO:18 (UGGUGGGGACUUGAACUCU), SEQ ID NO:19 (GCACGCAGACCCGCAGCAC), SEQ ID NQ:20 (GGCACGCAGACCCGCAGCA), SEQ ID NO:21 (GGGCACGCAGACCCGCAGC), SEQ ID NO:22 (UGGGCACGCAGACCCGCAG), SEQ ID NO:23 (GUGGGCACGCAGACCCGCA), SEQ ID NO:24 (UGGUGGGCACGCAGACCCG).
  • the antisense strand comprises a nucleobase sequence comprising any one of SEQ ID NO:13 (GGGACUUGAACUCUAAGCA) or SEQ ID NO:15 (UGGGGACUUGAACUCUAAG).
  • the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:22 (UGGGCACGCAGACCCGCAG).
  • the antisense strand consists of a nucleobase sequence having any one of SEQ ID NO:13 (GGGACUUGAACUCUAAGCA), SEQ ID NO:14 (GGGGACUUGAACUCUAAGC), SEQ ID NO:15 (UGGGGACUUGAACUCUAAG), SEQ ID NO:16 (GUGGGGACUUGAACUCUAA), SEQ ID NO:17 (GGUGGGGACUUGAACUCUA), SEQ ID NO:18 (UGGUGGGGACUUGAACUCU), SEQ ID NO:19 (GCACGCAGACCCGCAGCAC), SEQ ID NQ:20 (GGCACGCAGACCCGCAGCA), SEQ ID NO:21 (GGGCACGCAGACCCGCAGC), SEQ ID NO:22 (UGGGCACGCAGACCCGCAG), SEQ ID NO:23 (GUGGGCACGCAGACCCGCA), SEQ ID NO:24 (UGGUGGGCACGCAGACCCG).
  • the antisense strand consists of a nucleobase sequence having any one of SEQ ID NO:13 (GGGACUUGAACUCUAAGCA) or SEQ ID NO:15 (UGGGGACUUGAACUCUAAG).
  • the antisense strand consists of a nucleobase sequence having SEQ ID NO:22 (UGGGCACGCAGACCCGCAG).
  • the sense strand comprises a nucleobase sequence comprising SEQ ID NO:1 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:13; the sense strand comprises a nucleobase sequence comprising SEQ ID NO:2 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:14; the sense strand comprises a nucleobase sequence comprising SEQ ID NO:3 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:15; the sense strand comprises a nucleobase sequence comprising SEQ ID NO:4 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:16; the sense strand comprises a nucleobase sequence comprising SEQ ID NO:5 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:17; the sense strand comprises a nucleobase sequence comprising SEQ ID NO:6 and the antisense strand comprises a nucleobase
  • the sense strand comprises a nucleobase sequence comprising SEQ ID NO:1 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:13; or the sense strand comprises a nucleobase sequence comprising SEQ ID NO:3 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:15.
  • the sense strand comprises a nucleobase sequence comprising SEQ ID NQ:10 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:22.
  • the sense strand comprises a nucleobase sequence consists of SEQ ID NO:1 and the antisense strand comprises a nucleobase sequence consists of SEQ ID NO:13; the sense strand comprises a nucleobase sequence consists of SEQ ID NO:2 and the antisense strand comprises a nucleobase sequence consists of SEQ ID NO:14; the sense strand comprises a nucleobase sequence consists of SEQ ID NO:3 and the antisense strand comprises a nucleobase sequence consists of SEQ ID NO:15; the sense strand comprises a nucleobase sequence consists of SEQ ID NO:4 and the antisense strand comprises a nucleobase sequence consists of SEQ ID NO:16; the sense strand comprises a nucleobase sequence consists of SEQ ID NO:5 and the antisense strand comprises a nucleobase sequence consists of SEQ ID NO:17; the sense strand comprises a nucleobase sequence consists of SEQ ID NO:13; the sense
  • the sense strand comprises a nucleobase sequence consists of SEQ ID NO:1 and the antisense strand comprises a nucleobase sequence consists of SEQ ID NO:13; or the sense strand comprises a nucleobase sequence consists of SEQ ID NO:3 and the antisense strand comprises a nucleobase sequence consists of SEQ ID NO:15.
  • the sense strand comprises a nucleobase sequence consists of SEQ ID NQ:10 and the antisense strand comprises a nucleobase sequence consists of SEQ ID NO:22.
  • the present invention provides a compound comprising a double-stranded ribonucleic acid molecule according to any preceding claim and a conjugate group.
  • the conjugate group comprises one or more carbohydrates.
  • the conjugate group comprises a mono-saccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, polysaccharide, modi-fied polysaccharide, mannose, galactose, a mannose derivative, a galactose derivative, D-mannopyranose, L-Mannopyranose, D- Arabinose, L-Galactose, D-xylofuranose, L-xylofuranose, D-glucose, L-glucose, D-Galactose, L- Galactose, a-D-Man nofuranose, p-D-Mannofuranose, a-D-Mannopyranose, p-D-Mannopyranose, a-D- Glucopyranose, p-D-Glucopyranose, a-D-Glucofuranose, p-D-D-
  • the conjugate group is linked to the 3’ end of the sense strand. In some embodiments, the conjugate group is linked to the 5’ end of the sense strand. In some embodiments, the conjugate group is linked to the 5’ end of the antisense strand. In some embodiments, the conjugate group is linked to the 3’ end of the antisense strand.
  • At least one nucleoside comprises a modified sugar.
  • at least one internucleoside linkage is a modified internucleoside linkage.
  • the modified internucleoside linkage is a phosphorothioate or phosphorodithioate internucleoside linkage.
  • the double-stranded ribonucleic acid molecule or compound comprises 1 to 15 phosphorothioate or phosphorodithioate internucleoside linkages.
  • the present invention provides a composition comprising the double-stranded ribonucleic acid molecule or compound according to any preceding claim or salt thereof and at least one of a pharmaceutically acceptable carrier or diluent.
  • the present invention provides a prodrug comprising the double-stranded ribonucleic acid molecule or compound of the invention.
  • the present invention provides a method of treating a patient having a disease or disorder associated with or driven by variants in GNAQ and/or GNA11, the method comprising administering to the patient a compound or composition that specifically targets the variant GNAQ and/or GNA11 allele.
  • the present invention provides a method of treating a patient having a disease or disorder associated with or driven by variants in GNAQ and/or GNA11, the method comprising administering to the patient a double-stranded ribonucleic acid molecule or compound according to the invention, a composition according the invention or a prodrug according to the invention.
  • the present invention provides a method of treating a patient having Sturge-Weber syndrome (SWS), Phakomatosis Pigmentovascularis (PPV) or Extensive Dermal Melanocytosis (EDM), the method comprising administering to the patient a double-stranded ribonucleic acid molecule or compound according to the invention, a composition according the invention or a prodrug according to the invention.
  • SWS Sturge-Weber syndrome
  • PV Phakomatosis Pigmentovascularis
  • EDM Extensive Dermal Melanocytosis
  • the present invention provides a method of treating a patient having cancer, the method comprising administering to the patient a double-stranded ribonucleic acid molecule or compound according to the invention, a composition according the invention or a prodrug according to the invention.
  • the present invention provides a method of treating a patient having melanoma, the method comprising administering to the patient a double-stranded ribonucleic acid molecule or compound according to the invention, a composition according the invention or a prodrug according to the invention.
  • the present invention provides a double-stranded ribonucleic acid molecule or compound according to the invention, a composition according the invention or a prodrug according to the invention for use as a medicament.
  • the present invention provides a double-stranded ribonucleic acid molecule or compound according to the invention, a composition according to the invention or a prodrug according to the invention for use in a method of treating Sturge-Weber syndrome (SWS), Phakomatosis Pigmentovascularis (PPV) or Extensive Dermal Melanocytosis (EDM) in a patient in need thereof, the method comprising, administering to the patient a double-stranded ribonucleic acid molecule or compound according to the invention, a composition according to the invention or a prodrug according to the invention.
  • SWS Sturge-Weber syndrome
  • PV Phakomatosis Pigmentovascularis
  • EDM Extensive Dermal Melanocytosis
  • the present invention provides a double-stranded ribonucleic acid molecule or compound according to the invention, a composition according to the invention or a prodrug according to the invention for use in a method of treating cancer in a patient in need thereof, the method comprising, administering to the patient a double-stranded ribonucleic acid molecule or compound according to the invention, a composition according to the invention or a prodrug according to the invention.
  • the present invention provides a double-stranded ribonucleic acid molecule or compound according to the invention, a composition according to the invention or a prodrug according to the invention for use in a method of treating melanoma in a patient in need thereof, the method comprising, administering to the patient a double-stranded ribonucleic acid molecule or compound according to the invention, a composition according to the invention or a prodrug according to the invention.
  • the present invention provides a method of treating a patient having Sturge-Weber syndrome (SWS), Phakomatosis Pigmentovascularis (PPV) or Extensive Dermal Melanocytosis (EDM), the method comprising administering to the patient a compound or composition that specifically targets a variant allele of GNAQ and/or GNA11.
  • SWS Sturge-Weber syndrome
  • PV Phakomatosis Pigmentovascularis
  • EDM Extensive Dermal Melanocytosis
  • the present invention provides a method of treating a patient having cancer, the method comprising administering to the patient a compound or composition that specifically targets a variant allele of GNAQ and/or GNA11.
  • the present invention provides method of treating a patient having melanoma, the method comprising administering to the patient a compound or composition that specifically targets a variant allele of GNAQ and/or GNA11.
  • the variant allele of GNAQ comprises a mutation that causes a R183Q substitution.
  • the variant allele of GNA11 comprises a mutation that causes a R183C substitution.
  • the compound or composition that specifically targets a variant allele of GNAQ and/or GNA11 is capable of inhibiting the expression of variant GNAQ or variant GNA11 in vitro by at least 50%, at least 60%, at least 70%, at least 80% or preferably at least 90%.
  • the compound or composition that specifically targets a variant allele of GNAQ and/or GNA11 is capable of partially or completely rescuing aberrant calcium signalling in cells expressing variant GNAQ or variant GNA11.
  • the present invention provides an expression construct comprising a nucleic acid molecule encoding the double-stranded ribonucleic acid molecule or compound according to the invention.
  • the present invention provides an isolated nucleic acid molecule encoding the double-stranded ribonucleic acid molecule or compound according to the invention.
  • the present invention provides a vector comprising the isolated nucleic acid molecule of the invention.
  • the vector is a viral vector, retroviral vector, expression cassette, or plasmid.
  • the vector further comprises an RNA Polymerase III or RNA Polymerase II promoter.
  • the RNA Polymerase III promoter is the U6 or H1 promoter.
  • the present invention provides a host cell comprising the double-stranded ribonucleic acid molecule or compound according to the invention, an isolated nucleic acid molecule according to the invention or a vector according to the invention.
  • the host cell is a mammalian host cell. In some embodiments, the host cell is a human host cell.
  • RNAi agent can encode an interfering ribonucleic acid, e.g., an shRNA, as described above.
  • the RNAi agent can be a transcriptional template of the interfering ribonucleic acid.
  • RNAi agents of the present invention can also include small hairpin RNAs (shRNAs), and expression constructs engineered to express shRNAs. Upon expression, shRNAs are thought to fold into a stem-loop structure with 3' UU-overhangs; subsequently, the ends of these shRNAs are processed, converting the shRNAs into siRNA-like molecules.
  • Microneedles or microneedle patches or microarray patches are micron-scaled medical devices used to administer therapeutic agents.
  • Microneedles can be used for transdermal drug delivery applications, and also for intraocular, vaginal, transungual, cardiac, vascular, gastrointestinal, and intracochlear delivery of drugs.
  • Microneedles are constructed through various methods, usually involving photolithographic processes or micromolding. These methods involve etching microscopic structure into resin or silicon in order to cast microneedles.
  • Microneedles are made from a variety of material ranging from silicon, titanium, stainless steel, and polymers. Some microneedles are made of a drug to be delivered to the body but are shaped into a needle so they will penetrate the skin. The microneedles range in size, shape, and function but are all used as an alternative to other delivery methods like the conventional hypodermic needle or other injection apparatus.
  • Microneedles are usually applied through even single needle or small arrays.
  • the arrays used are a collection of microneedles, ranging from only a few microneedles to several hundred, attached to an applicator, sometimes a patch or other solid stamping device.
  • the arrays are applied to the skin of patients and are given time to allow for the effective administration of drugs.
  • the size of individual microneedles may be optimized depending upon the desired size of the microneedle, for instance depending upon the targeting depth of the microneedle, the strength requirements of the needle to avoid breakage in a particular tissue type, etc.
  • Solid microneedles are designed as a two part system; the microneedle array is first applied to the skin to create microscopic wells just deep enough to penetrate the outermost layer of skin, and then the drug is applied via transdermal patch.
  • Solid microneedles are already used by dermatologists in collagen induction therapy, a method which uses repeated puncturing of the skin with microneedles to induce the expression and deposition of the proteins collagen and elastin in the skin.
  • Hollow microneedles are similar to solid microneedles in material. They contain reservoirs that deliver the drug directly into the site. Since the delivery of the drug is dependent on the flow rate of the microneedle, there is a possibility that this type of array could become clogged by excessive swelling or flawed design.
  • Coated microneedles are usually designed from polymers or metals. In this method the drug is applied directly to the microneedle array instead of being applied through other patches or applicators. Coated microneedles are often covered in other surfactants or thickening agents to assure that the drug is delivered properly.
  • Dissolvable microneedles encapsulate the drug in a nontoxic polymer which dissolves once inside the skin. This polymer allows the drug to be delivered into the skin and can be broken down once inside the body. Polymers such as Fibroin, a silk-based protein that can be molded into structures like microneedles and dissolved once in the body.
  • Hydrogel-forming microneedles have medications enclosed in a polymer.
  • the microneedles can penetrate the stratum corneum and draw up interstitial fluid leading to polymer swelling. Drugs enter the skin from the swollen matrix.
  • lipid-encapsulated RNA nanoparticles are known to the skilled person. Techniques are known for preparing lipid-encapsulated RNA nanoparticles using an ethanol injection-type process with a static mixer that provides a turbulent environment, which after vesicle formation are combined with a therapeutic molecule. Other techniques are known for forming lipid- encapsulated RNA nanoparticles using non-turbulent mixing and a series of sequential stepwise dilutions. Particles can also be formed by spraying lipids in an organic solution pipe through an orifice into nucleic acids in an aqueous solution flowing past the orifice. The parameters for generating an lipid- encapsulated RNA nanoparticle can be varied according to the desired properties.
  • Nanodelivery systems such as ruxolitinib and thalidomide co-delivered polyelectrolyte nanocomplexes (RTNPs) can be engineered to mimic viruses whilst retaining the safety of a non-viral particle.
  • RTNPs thalidomide co-delivered polyelectrolyte nanocomplexes
  • One approach is to encourage delivery to specific cell types by incorporating peptides into the particle that have affinity for cell surface receptors or other proteins specific to the cell type of interest. Quite often peptides targeting specific cell types are not already known and experiments (e.g. phage display library biopanning) can be used to identify novel amino acid sequences with affinity for specific cell types of interest.
  • reconstituted viral envelopes are used to encapsulate and deliver siRNAs.
  • the reconstituted membrane vesicles may contain viral spike proteins and additionally added cationic lipids.
  • the siRNA-loaded vesicles are taken up by receptor-mediated endocytosis, and are able to escape endosomal degradation by fusion with the endosomal membrane.
  • Functional siRNA delivery has been demonstrated in vitro and in vivo. As with some viral approaches, drawbacks of the systems are the difficulties of repeated administration and limited control over transduced cell type.
  • DNA encoding for siRNA may be delivered by viruses for gene silencing in vivo.
  • the natural tropism of viruses for certain cell types may be used.
  • FGFR1 fibroblast growth factor ligand
  • RGD-peptides binding alpha v-integrins adenoviral delivery to angiogenic endothelium via RGD-peptides binding alpha v-integrins.
  • compounds of the invention may be delivered via nonviral delivery.
  • viral vectors provide many of the desired characteristics for efficient nucleic acid delivery
  • nonviral vectors provide other advantages. Important benefits of synthetic vector systems are the safety (related to their lack of immunogenicity and low frequency of integration) and ease of large-scale production. In addition, they can accommodate a wide variety of nucleic acid sizes and they allow easy modification.
  • Non-viral delivery systems may require functional groups to be incorporated into compounds of the invention.
  • a cationic functional group is usually required to bind and condense the nucleic acid, thereby protecting it against nucleases and (importantly for siRNA) increasing the apparent molecular weight above the renal clearance cut-off.
  • DCA-siRNA Conjugating siRNAs to docosanoic acid (DCA) enables productive delivery to all major skin cell types local to the injection site, with a single dose of injection.
  • DCA-siRNA efficiently inhibits the induction of IFN-y-inducible chemokines, CXCL9 and CXCL10, in skin biopsies from the injection site. It has been demonstrated that DCA-siRNAs can be engineered for functional gene silencing in skin and establish a path toward siRNA treatment of autoimmune skin diseases [24].
  • Sturge-Weber Syndrome(SWS) and Phakomatosis Pigmentovascularis(PPV) form a spectrum of severe untreatable rare diseases characterised by vascular malformations of skin, CNS and eye. They are caused by mosaic variants in GNAQ/GNA11, encoding Gaq/11 protein subunits integral to intracellular signalling pathways. How pathogenic variants affect vascular endothelium is unknown. The classical finding of progressive neurovascular calcification led us to hypothesise that deranged calcium handling may be involved in disease pathogenesis and amenable to therapy.
  • Figure 1 - SWS and PPV patients have disrupted systemic calcium homeostasis.
  • A. Clinical features of a Sturge-Weber syndrome patient with a capillary malformation of the head involving the critical forehead area, associated with glaucoma in the right eye. This patient had hypocalcaemia with low levels of ionised and total calcium (1.15 mmol/L and 2.08 mmol/L, respectively) and increased PTH (7.4 pmol/L), consistent with secondary hyperparathyroidism.
  • Ionised calcium reference range 1 .22-1 .31 mmol/L.
  • G. Correlation between age and urine calcium/creatinine ratio from the patients’ cohort. Linear regression analysis showed statistically significant negative correlation (p 0.019).
  • FIG. 1 Figure 2 - GNAQIGNA11 variants cause constitutive activation and amplify thrombin- induced intracellular calcium signalling in endothelial cells.
  • B Densitometric analysis performed on three or four independent western blot experiments on TIME recombinant cell lines in complete medium or following one hour acute starvation. Two-tailed unpaired t-tests did not reveal statistically significant differences between GNAQ or GNA11 WT and variant cell lines in any condition.
  • HEK DKO Gaq/11 CaSR;NFAT-Luc cells were transfected with the GNAQ' m , GA/AQ R183Q , GNA11' m or G/VA77 R183C constructs and treated with vehicle or three concentrations of extracellular calcium to stimulate activation of CaSR and downstream G-protein signalling. Luciferase activity was measured 4h after stimulation. The graph represents the mean of three independent experiments. Statistical comparison between different conditions was performed by two-tailed paired t-test (*p ⁇ 0.05). D.
  • TIME-G/VAQ WT or GA/AQR 183Q were loaded with intracellular calcium probe Fluo-8 and stimulated with thrombin (1 U/MI) in HBSS standard buffer (yellow and blue lines) or following 100-second long exposure to HBSS calcium-free buffer (black and red lines). Changes in fluorescence over the time were recorded and normalised to maximum and minimum responses to calculate cytosolic [Ca2+], The graph represents an average of three independent experiments performed with six technical replicates. Statistical test performed by two-way ANOVA (**** p ⁇ 0.0001).
  • FIG. 3 Figure 3 - CRAC channel inhibition and variant-specific siRNAs rescue aberrant calcium signalling in variant cells.
  • A-B TIME-GA/AQ WT (A) or -GA/AQ R183Q (B) were loaded with intracellular calcium probe Fluo-8 and treated for 20 minutes with vehicle or 1 pM CX4620. Following treatment, cells were stimulated with thrombin 1 U/ml and fluorescence recorded for 300 seconds. The graphs represent an avarage of three independent experiments performed in technical quadruplicates.
  • TIME-G/VAQ R183Q or -GNA17 R183C were not transfected or transfected with 10nM non-target siRNAs (siSCRA) or 10nM siRNAs for specific silencing of the variant alleles (siGA/AQmut 1 and siGA/AQmut 3 for targeting of GNAQ variant allele and siG/VA77mut 4 for silencing of GNA11 variant allele).
  • IP1 concentration was measured 48 hours after transfection and shown as mean +/- SD of three independent experiments. Statistical comparisons were performed by two-tailed unpaired t- test (** p ⁇ 0.005).
  • TIME cells harbouring GA/AQ R183Q mutation were transfected with NFAT- luciferase reporter and a stable clone was obtained after antibiotic selection.
  • TIME-G/VAQ p.(R183Q); NFAT-Luc were transfected with non-target siRNA (siSCRA) or two siRNAs for specific silencing of the variant GNAQ allele (siGA/AQmut 1 and 3) and luciferase reporter activity was measured 48 hours after transfection in complete medium or after four hours of starvation, shown as mean +/- SD of % change of cells transfected with mock in three independent experiments.
  • Statistical comparisons were performed by two-tailed unpaired t test (* p ⁇ 0.05; ** p ⁇ 0.01).
  • TIME cells harbouring G/VAQ R183Q were transfected with non-target siRNA (siSCRA) or two siRNAs for specific silencing of the variant GNAQ allele. Forty-eight hours after transfection they were loaded with Fluo-8 intracellular calcium dye and stimulated by thrombin 1 U/ml while recording fluorescent signal at 1 second intervals for up to 300 seconds. The graph represents the mean of three independent experiments. Statistical tests performed by two-way ANOVA (***p ⁇ 0.001 ; **** p ⁇ 0.0001). G.
  • UPMM-1 uveal melanoma cell line harbouring GA/AQR183Q were transfected with 25nM non-target siRNA (siSCRA) or two siRNAs for specific silencing of the variant GNAQ allele ((siGA/AQmut 1 and siGA/AQmut 6).
  • IP1 concentration was measured 48 hours after transfection and shown as mean +/- SD of three independent experiments. Statistical comparisons were performed by two-tailed unpaired t- test.
  • FIG. 4 Figure 4 - Generation and validation of TIME transgenic cell lines stably expressing GNAQ WJ , GNAQ R ' S2Q , GNA11 WJ or GNA11 S3C alleles.
  • A Schematic representation of the lentiviral expression vectors used to infect the TIME cell line and generate stable recombinant derivatives.
  • B Sanger sequencing performed on TIME recombinant models using primers annealing to exon 4 of GNAQ or GNA11 genes. Chromatogram of GNAQ and GNA11 codon-183 for mutation confirmation.
  • C
  • FIG. 5 Designing and testing siRNA specific for GNAQ c.548G>A, p.(R183Q)
  • siRNAs siG/VAQmut #1 and 3 (squared) showed specific knock-down of variant protein over wild-type counterparts.
  • FIG. 6 Patient deep phenotyping and serum calcium metabolic profile in SWS (patients 1-28) and PPV (patients 29-35) *indicates a patient previously reported in [7].
  • Paediatric range references of ionised calcium 1.15-1.41 mmol/L ( ⁇ 2 years), 1.19-1.37 mmol/L (2-5 years), 1.22-1.31 mmol/L (5-15 years).
  • FIG. 7 Systemic calcium metabolic profiling in patients with SWS and PPV types with dermal melanocytosis. Abbreviations: WT, wild-type. Total calcium value was corrected to Albumin and ionised calcium to pH. Age-adjusted ionised calcium reference ranges: 1.15-1.41 mmol/L ( ⁇ 2y), 1.19-1.37 mmol/L (2-5y), 1.22-1.31 mmol/L (5-15y).
  • Age-adjusted total calcium reference ranges: 1.96- 2.66 mmol/L (0-5d), 2.17-2.44 mmol/L (5d-3y), 2.22-2.51 mmol/L (3-1 Oy), 2.19-2.66 mmol/L (10-15y), 2.10-2.55 mmol/L (>15y).
  • Age-adjusted phosphate reference ranges: 1.5-2.6 mmol/L (0-5d), 1 .2-2.1 mmol/L (5d-3y), 1.2-1 .8 mmol/L (3-10y), 1.1-1.75 mmol/L (10-15y), 0.8-1.45 mmol/L (>15y).
  • Total vitamin D reference range insufficiency (25-50 nmol/L), deficiency ( ⁇ 25 nmol/L).
  • PTH reference range 0.7-5.6 pmol/L.
  • FIG. 8 In vitro angiogenesis is disrupted by mutant GNAQ and rescued by CRAC channel inhibition.
  • A Representative images captured with EVOS Floid Imaging System following Calcein AM staining during in vitro endothelial cell tube formation of TIME cells stably expressing either GNAQ WT or GNAQ R183Q.
  • B Quantification of angiogenesis assay shown in (A) (one representative experiment of three, mean+/- SD) demonstrates significant difference between WT and mutant cells in total length of the network, defined as combined lengths of segments, branches and isolated elements. Statistical significance calculated using two-tailed unpaired t-test on three independent experiments (**** p ⁇ 0.0001).
  • FIG. 9 Localised intravascular, perivascular and parenchymal patterns of mineral (calcium) deposition and disruption of calcium homeostasis in patients with GNAQIGNA11 mosaicism.
  • A Image of the cortex with extensive foci of mineralisation.
  • B A small cortical vessel (likely to be a capillary) with granular mineralisation of the wall.
  • C A white matter vessel encircled by mineral and fibrosis.
  • (F) Correlation between occurrence of seizures and serum ionised calcium corrected to pH from the patients’ cohort. The scatter plot shows the mean of the two groups, and red dots correspond to ionised calcium measurements below normal range. Linear regression analysis showed statistically significant correlation (p 0.05).
  • (G) Correlation between status epilepticus and serum ionised calcium corrected to pH in the patients’ cohort. The scatter plot shows the mean of the two groups, and red dots correspond to ionised calcium measurements below normal range. Linear regression analysis showed statistically significant correlation (p 0.01).
  • UPMM1 cells were non- transfected or transfected with non-target control siRNA (siSCRA) or with 2 distinct G/VAQR183Q-mutant specific siRNAs (siG/VAQmut3 and siG/VAQmut6) and expression of the mutant allele was measured by using G/VAQR183Q-mutant specific primers previously validated (forward primer: CAACAAGATGTGCTTAGAGTTCA (SEQ ID NO:25); reverse primer: CCCTACATCGACCATTCTGAAA (SEQ ID NO:26).
  • forward primer CAACAAGATGTGCTTAGAGTTCA (SEQ ID NO:25
  • reverse primer CCCTACATCGACCATTCTGAAA
  • CM4620 Treatment by the CRAC channel inhibitor CM4620 reduced the GPCR ligand- induced accumulation of intracellular calcium in UPMM1. Cells loaded with Fluo-8 calcium probe were treated by CM4620 1 , 3 or 10 pM, stimulated by the GPCR ligand leukotriene D4 (LTD4) and fluorescence was recorded over the time.
  • GNAQ/11 mosaicism SWS and PPV types with dermal melanocytosis and EDM are now understood to be manifestations of the same disease, a spectrum of vascular and/or pigmentary abnormalities affecting skin, brain and eye, with other organs potentially involved.
  • the vascular disease spectrum of SWS and PPV often has a severe and progressive neurological phenotype, confirmed in this study with the mean and median onset of seizures at 1 .05 and 0.71 years respectively (range 0.08-5.9y) , which has led to attempts to reduce deterioration using prophylactic aspirin and/or anti-epileptic drugs [25], Calcium deposition in and around abnormal neurovasculature has long been known to be a feature of this disease process.
  • Calcium is known as a stabiliser of excitable membranes, and although the levels of serum calcium were not sufficiently abnormal to be expected to cause symptoms in a healthy individual, in the context of a seizure disorder they could be an important contributory factor. Furthermore, a measurable systemic effect on calcium in the context of a mosaic disease, where only a proportion of cells in the body are affected by the mutation, is strongly suggestive that localised calcium imbalances, for example around the affected neurovasculature, could be much more extreme. The variability in calcium metabolic profiles would be entirely consistent with a mosaic disease, where patients are unique in both the number and location of the variant cells.
  • CM4620 is already in phase 2 clinical trials for the treatment of pancreatitis (trial NCT04195347), another disease associated with perturbed local calcium homeostasis and CRAC channel activity [33],
  • mosaicism or “genetic mosaicism” refers to a condition in multi-cellular organisms in which a single organism possesses more than one genetic line as the result of genetic mutation to a single cell during development of the embryo or fetus. The offspring of that cell then all contain the same mutation, and will only be present in those cells.
  • a recent consensus definition is the coexistence of more than one genotype in an individual derived from a single zygote by the time of birth, and producing a disease phenotype [34] (which may not appear until any time after birth).
  • mosaicism can result from many different mechanisms, leading to mosaicism at different genetic levels - for example mosaicism can relate to a single point mutation or to a whole chromosome aneuploidy.
  • Mosaic mutations can be passed on to future generations as a germline heterozygous mutation if two conditions are met - firstly that it affects the germ cells (usually not ascertainable) and secondly if the mutation is compatible with life in the germline (often but not always known from epidemiological studies) [34,35],
  • GNAQ refers to the GNAQ gene, also known as CMC1 , G-ALPHA-q, GAQ, SWS and G protein subunit alpha q (which may consist or comprise of exemplary RefSeq human protein sequences: NP_002063 and/or NP_002063.2, RefSeq mouse protein sequence: NP_032165, RefSeq human mRNA sequence: NP_032165, RefSeq mouse mRNA sequence: NM_008139).
  • Guanine nucleotide-binding proteins are a family of heterotrimeric proteins that couple cell surface, 7- transmembrane domain receptors to intracellular signaling pathways.
  • Receptor activation catalyzes the exchange of GDP for GTP bound to the inactive G protein alpha subunit resulting in a conformational change and dissociation of the complex.
  • the G protein alpha and beta-gamma subunits are capable of regulating various cellular effectors.
  • Activation is terminated by a GTPase intrinsic to the G-alpha subunit.
  • G-alpha-q is the alpha subunit of one of the heterotrimeric GTP-binding proteins that mediates stimulation of phospholipase C-beta.
  • GNA11 refers to the GNA11 gene, also known as FBH, FBH2, FHH2, GNA-11 , HHC2, HYPOC2, G protein subunit alpha 11 and HG1 K (which may consist or comprise of exemplary RefSeq human protein sequence: NP_002058, RefSeq mouse protein sequence: NP_034431 , RefSeq human mRNA sequence: NP_034431 , RefSeq mouse mRNA sequence: NP_034431).
  • gain-of-function variant refers to any mutation in a gene in which the protein encoded by said gene (i.e., the variant protein) has a mutation that confers new or enhanced function on a protein with respect either to its intrinsic function or to its effect on interacting molecules or cascades of molecular interactions, which may in itself act via changes in the protein's intrinsic activity, or via alteration of its interactions with other molecules.
  • the gain-of-function mutation can be a deletion, addition, or substitution of a nucleotide or nucleotides in the gene which gives rise to the change in the function of the encoded protein.
  • the gain-of-function mutation changes the function of the variant protein or causes interactions with other proteins.
  • the gain-of- function mutation causes a decrease in or removal of normal wild-type protein, for example, by interaction of the altered, variant protein with said normal, wild-type protein.
  • the gain-of-function variant causes an increase or decrease in the normal function of the protein such that its activity or some or all of its downstream effects are increased or exaggerated or accentuated, constitutively and/or under relevant physiological stimuli.
  • variant may encompass both disease causing genetic mutations and benign mutations with no effect on the function of the gene. All types of DNA changes that produce that protein change are included, such as a deletion, addition, or substitution of a nucleotide or nucleotides in the gene which gives rise to the change in the amino acid sequence of the encoded protein.
  • An “expression construct” can be for example, a viral vector, retroviral vector, expression cassette or plasmid.
  • the expression construct can also have an RNA polymerase II promoter sequence or RNA Polymerase II promoter sequence, such as, U6 snRNA promoter of H1 promoter.
  • Expression constructs of the present invention include any construct suitable for use in the appropriate expression system and include, but are not limited to, retroviral vectors, linear expression cassettes, plasmids and viral or virally-derived vectors, as known in the art.
  • Such expression constructs can include one or more inducible promoters, RNA Pol III promoter systems such as U6 snRNA promoters or HI RNA polymerase III promoters, or other promoters known in the art.
  • the constructs can include one or both strands of the siRNA.
  • Expression constructs expressing both strands can also include loop structures linking both strands, or each strand can be separately transcribed from separate promoters within the same construct. Each strand can also be transcribed from a separate expression construct.
  • amelioration means the prevention, reduction or palliation of a state, or improvement of the state of a subject or in disease biomarkers of severity or outcome. Amelioration includes, but does not require, complete recovery or complete prevention of a disease condition.
  • the term "comparable”, as used herein, refers to a system, set of conditions, effects, or results that is/are sufficiently similar to a test system, set of conditions, effects, or results, to permit scientifically legitimate comparison. Those of ordinary skill in the art will appreciate and understand which systems, sets of conditions, effects, or results are sufficiently similar to be “comparable” to any particular test system, set of conditions, effects, or results as described herein.
  • correlation has its ordinary meaning of "showing a correlation with”. Those of ordinary skill in the art will appreciate that two features, items or values show a correlation with one an-other if they show a tendency to appear and/or to vary, together.
  • a correlation is statistically significant when its p-value is less than 0.05; in some embodiments, a correlation is statistically significant when its p-value is less than 0.01 .
  • correlation is assessed by regression analysis.
  • a correlation is a correlation coefficient.
  • the terms “improve,” “increase” or “reduce,” or grammatical equivalents indicate values that are relative to a reference (e.g., baseline) measurement, such as a measurement taken under comparable conditions (e.g., in the same individual prior to initiation of treatment described herein, or a measurement in a control individual (or multiple control individuals) in the absence of treatment) described herein.
  • a reference e.g., baseline
  • comparable conditions e.g., in the same individual prior to initiation of treatment described herein, or a measurement in a control individual (or multiple control individuals) in the absence of treatment
  • a "polypeptide” is a string of at least two amino acids attached to one another by a peptide bond.
  • a polypeptide may include at least 3-5 amino acids, each of which is attached to others by way of at least one peptide bond.
  • polypeptides sometimes include "non-natural" amino acids or other entities that nonetheless are capable of integrating into a polypeptide chain, optionally.
  • the term "protein” refers to a polypeptide (i.e., a string of at least two amino acids linked to one another by peptide bonds).
  • Proteins may include moieties other than amino acids (e.g., may be glycoproteins, proteoglycans, etc.) and/or may be otherwise processed or modified.
  • a "protein” can be a complete polypeptide chain as produced by a cell (with or without a signal sequence), or can be a characteristic portion thereof.
  • a protein can sometimes include more than one polypeptide chain, for example linked by one or more disulfide bonds or associated by other means.
  • Polypeptides may contain L-amino acids, D- amino acids, or both and may contain any of a variety of amino acid modifications or analogs known in the art.
  • proteins may comprise natural amino acids, non-natural amino acids, synthetic amino acids, and combinations thereof.
  • peptide is generally used to refer to a polypeptide having a length of less than about 100 amino acids, less than about 50 amino acids, less than 20 amino acids, or less than 10 amino acids.
  • the term "subject”, “individual”, or “patient” refers to any organism upon which embodiments of the invention may be used or administered, e.g. , for experimental, diagnostic, prophylactic, and/or therapeutic purposes.
  • Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans; insects; worms; etc.).
  • animals e.g., mammals such as mice, rats, rabbits, non-human primates, and humans; insects; worms; etc.
  • the subject is a human.
  • target cell refers to any cell, cell type, tissue, or organism.
  • the target cell or target tissue is a vascular cell, a melanocytic cell, and/or any other cell type which contains the mutation.
  • a therapeutic regimen refers to any method used to partially or completely alleviate, ameliorate, relieve, inhibit, prevent, delay onset of, reduce severity of and/or reduce incidence of one or more symptoms or features of a particular disease, disorder, and/or condition. It may include administration of one or more doses, optionally spaced apart by regular or varied time intervals.
  • a therapeutic regimen is one whose performance is designed to achieve and/or is correlated with achievement of (e.g., across a relevant population of cells, tissues, or organisms) a particular effect, e.g., reduction or elimination of a detrimental condition or disease.
  • treatment includes administration of one or more therapeutic agents either simultaneously, sequentially or at different times, for the same or different amounts of time.
  • a "treatment regimen" includes genetic methods such as gene therapy, gene ablation or other methods known to induce or reduce expression (e.g. transcription, processing, and/or translation of a particular gene product, such as a primary transcript or mRNA).
  • the term "therapeutically effective amount” refers to an amount of a therapeutic agent which confers a therapeutic effect on the treated subject, at a reasonable benefit/risk ratio applicable to any medical treatment.
  • a therapeutic effect may be objective (i.e., measurable by some test or marker) or subjective (i.e., subject gives an indication of or feels an effect).
  • therapeutically effective amount refers to an amount of a therapeutic agent or composition effective to treat, ameliorate, or prevent (e.g., delay onset of or reduce risk of) a relevant disease or condition, and/or to exhibit a detectable therapeutic or preventative effect, such as by ameliorating symptoms associated with the disease, preventing or delaying onset of the disease, and/or also lessening severity or frequency of symptoms of the disease.
  • a therapeutically effective amount is commonly administered in a dosing regimen that may comprise multiple unit doses.
  • a therapeutically effective amount and/or an appropriate unit dose within an effective dosing regimen) may vary, for example, de-pending on route of administration, or on combination with other therapeutic agents.
  • a specific therapeutically effective amount (and/or unit dose) for any particular patient may depend upon a variety of factors including the activity of the specific therapeutic agent employed; the specific composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, and/or rate of excretion or metabolism of the specific therapeutic agent employed; the duration of the treatment; and like factors as is well known in the medical arts.
  • treatment refers to any administration of a therapeutic agent according to a therapeutic regimen that achieves a desired effect in that it partially or completely alleviates, ameliorates, relieves, inhibits, delays onset of, reduces severity of and/or reduces incidence of one or more symptoms or features of a particular disease, disorder, and/or condition.
  • administration of the therapeutic agent according to the therapeutic regimen is correlated with achievement of the desired effect.
  • Such treatment may be of a subject who does not exhibit signs of the relevant disease, disorder and/or condition and/or of a subject who exhibits only early signs of the disease, disorder, and/or condition.
  • treatment may be of a subject who exhibits one or more established signs of the relevant disease, disorder and/or condition.
  • treatment may be of a subject who has been diagnosed as suffering from the relevant disease, disorder, and/or condition.
  • treatment may be of a subject known to have one or more susceptibility factors that are statistically correlated with increased risk of development of the relevant disease, disorder, and/or condition.
  • antisense compound means an oligomeric compound that is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.
  • antisense compounds include single-stranded and double-stranded compounds, such as, antisense oligonucleotides, siRNAs, shRNAs, ssRNAs, and occupancy-based compounds.
  • antisense inhibition means reduction of target nucleic acid levels in the presence of an antisense compound complementary to a target nucleic acid compared to target nucleic acid levels in the absence of the antisense compound.
  • antisense mechanisms are all those mechanisms involving hybridization of a compound with target nucleic acid, wherein the outcome or effect of the hybridization is either target degradation or target occupancy with concomitant stalling of the cellular machinery involving, for example, transcription or splicing.
  • Antisense oligonucleotide means a single-stranded oligonucleotide having a nucleobase sequence that permits hybridization to a corresponding region or segment of a target nucleic acid.
  • portion means a defined number of contiguous (i.e., linked) nucleobases of a nucleic acid. In some embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In some embodiments, a portion is a defined number of contiguous nucleobases of an antisense compound
  • prevent refers to delaying or forestalling the onset, development or progression of a disease, disorder, or condition for a period of time from minutes to indefinitely. “Prevent” also means reducing the risk of developing a disease, disorder, or condition.
  • nucleoside means a compound comprising a nucleobase moiety and a sugar moiety. Nucleosides include, but are not limited to, naturally occurring nucleosides (as found in DNA and RNA) and modified nucleosides. Nucleosides may be linked to a phosphate moiety.
  • chemical modification means a chemical difference in a compound when compared to a naturally occurring counterpart.
  • Chemical modifications of oligonucleotides include nucleoside modifications (including sugar moiety modifications and nucleobase modifications) and internucleoside linkage modifications. In reference to an oligonucleotide, chemical modification does not include differences only in nucleobase sequence.
  • furanosyl means a structure comprising a 5-membered ring comprising four carbon atoms and one oxygen atom.
  • naturally occurring sugar moiety means a ribofuranosyl as found in naturally occurring RNA or a deoxyribofuranosyl as found in naturally occurring DNA.
  • a “naturally occurring sugar moiety” as referred to herein is also termed as an "unmodified sugar moiety".
  • such a “naturally occurring sugar moiety” or an “unmodified sugar moiety” as referred to herein has a -H (DNA sugar moiety) or -OH (RNA sugar moiety) at the 2'-position of the sugar moiety, especially a -H (DNA sugar moiety) at the 2'-position of the sugar moiety.
  • sugar moiety means a naturally occurring sugar moiety or a modified sugar moiety of a nucleoside.
  • modified sugar moiety means a substituted sugar moiety or a sugar surrogate.
  • substituted sugar moiety means a furanosyl that has been substituted.
  • Substituted sugar moieties include, but are not limited to furanosyls comprising substituents at the 2'- position, the 3'-position, the 5'-position and I or the 4'-position. Certain substituted sugar moieties are bicyclic sugar moieties.
  • 2'-substituted sugar moiety means a furanosyl comprising a substituent at the 2'- position otherthan H or OH. Unless otherwise indicated, a 2'-substituted sugar moiety is not a bicyclic sugar moiety (i.e., the 2' -substituent of a 2'-substituted sugar moiety does not form a bridge to another atom of the furanosyl ring).
  • MOE means -OCH2CH2OCH3.
  • 2'-F nucleoside refers to a nucleoside comprising a sugar comprising fluorine at the 2' position. Unless otherwise indicated, the fluorine in a 2'-F nucleoside is in the ribo position (replacing the OH of a natural ribose). Duplexes of uniformly modified 2'-fluorinated (ribo) oligonucleotides hybridized to RNA strands are not RNase H substrates while the ara analogs retain RNase H activity.
  • sucrose surrogate means a structure that does not comprise a furanosyl and that is capable of replacing the naturally occurring sugar moiety of a nucleoside, such that the resulting nucleoside sub-units are capable of linking together and I or linking to other nucleosides to form an oligomeric compound which is capable of hybridizing to a complementary oligomeric compound.
  • Such structures include rings comprising a different number of atoms than furanosyl (e.g., 4, 6, or 7- membered rings); replacement of the oxygen of a furanosyl with a non-oxygen atom (e.g., carbon, sulfur, or nitrogen); or both a change in the number of atoms and a replacement of the oxygen.
  • Such structures may also comprise substitutions corresponding to those described for substituted sugar moieties (e.g., 6-membered carbocyclic bicyclic sugar surrogates optionally comprising additional substituents).
  • Sugar surrogates also include more complex sugar replacements (e.g., the non-ring systems of peptide nucleic acid).
  • Sugar surrogates include without limitation morpholinos, cyclohexenyls and cyclohexitols.
  • bicyclic sugar moiety means a modified sugar moiety comprising a 4 to 7 membered ring (including but not limited to a furanosyl) comprising a bridge connecting two atoms of the 4 to 7 membered ring to form a second ring, resulting in a bicyclic structure.
  • the 4 to 7 membered ring is a sugar ring.
  • the 4 to 7 membered ring is a furanosyl.
  • the bridge connects the 2 '-carbon and the 4 '-carbon of the furanosyl.
  • nucleotide means a nucleoside further comprising a phosphate linking group.
  • linked nucleosides may or may not be linked by phosphate linkages and thus includes, but is not limited to “linked nucleotides.”
  • linked nucleosides are nucleosides that are connected in a continuous sequence (i.e. no additional nucleosides are present between those that are linked).
  • nucleobase means a group of atoms that can be linked to a sugar moiety to create a nucleoside that is capable of incorporation into an oligonucleotide, and wherein the group of atoms is capable of bonding with a complementary naturally occurring nucleobase of another oligonucleotide or nucleic acid. Nucleobases may be naturally occurring or may be modified.
  • unmodified nucleobase or “naturally occurring nucleobase” means the naturally occurring heterocyclic nucleobases of RNA or DNA: the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) (including 5-methyl C), and uracil (U).
  • modified nucleobase means any nucleobase that is not a naturally occurring nucleobase.
  • modified nucleoside means a nucleoside comprising at least one chemical modification compared to naturally occurring RNA or DNA nucleosides. Modified nucleosides can comprise a modified sugar moiety and / or a modified nucleobase.
  • bicyclic nucleoside or “BNA” means a nucleoside comprising a bicyclic sugar moiety.
  • locked nucleic acid nucleoside or “LNA” means a nucleoside comprising a bicyclic sugar moiety comprising a 4'-CH2-0-2'bridge.
  • 2 '-substituted nucleoside means a nucleoside comprising a substituent at the 2'- position of the sugar moiety other than H or OH. Unless otherwise indicated, a 2 '-substituted nucleoside is not a bicyclic nucleoside.
  • deoxynucleoside means a nucleoside comprising 2'-H furanosyl sugar moiety, as found in naturally occurring deoxyribonucleosides (DNA).
  • a 2'- deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (e.g., uracil).
  • oligonucleotide means a compound comprising a plurality of linked nucleosides.
  • an oligonucleotide comprises one or more unmodified ribonucleosides (RNA) and I or unmodified deoxyribonucleosides (DNA) and I or one or more modified nucleosides.
  • modified oligonucleotide means an oligonucleotide comprising at least one modified nucleoside and I or at least one modified internucleoside linkage.
  • linkage or “linking group” means a group of atoms that link together two or more other groups of atoms.
  • internucleoside linkage means a covalent linkage between adjacent nucleosides in an oligonucleotide.
  • naturally occurring internucleoside linkage means a 3' to 5' phosphodiester linkage.
  • modified internucleoside linkage means any internucleoside linkage other than a naturally occurring internucleoside linkage.
  • a "modified internucleoside linkage" as referred to herein can include a modified phosphorous linking group such as a phosphorothioate or phosphorodithioate internucleoside linkage.
  • terminal internucleoside linkage means the linkage between the last two nucleosides of an oligonucleotide or defined region thereof.
  • phosphorus linking group means a linking group comprising a phosphorus atom and can include naturally occurring phosphorous linking groups as present in naturally occurring RNA or DNA, such as phosphodiester linking groups, or modified phosphorous linking groups that are not generally present in naturally occurring RNA or DNA, such as phosphorothioate or phosphorodithioate linking groups.
  • Phosphorus linking groups can therefore include without limitation, phosphodiester, phos-phorothioate, phosphorodithioate, phosphonate, phosphoramidate, phosphorothioamidate, thionoal-kylphosphonate, phosphotriesters, thionoalkylphosphotriester and boranophosphate.
  • nucleoside phosphorus linking group means a phosphorus linking group that directly links two nucleosides
  • oligomeric compound means a polymeric structure comprising two or more substructures.
  • an oligomeric compound comprises an oligonucleotide, such as a modified oligonucletide.
  • an oligomeric compound further comprises one or more conjugate groups and I or terminal groups and I or ligands.
  • an oligomeric compound consists of an oligonucleotide.
  • an oligomeric compound comprises a backbone of one or more linked monomeric sugar moieties, where each linked monomeric sugar moiety is directly or indirectly attached to a heterocyclic base moiety.
  • oligomeric compounds may also include monomeric sugar moieties that are not linked to a heterocyclic base moiety, thereby providing abasic sites.
  • terminal group means one or more atom attached to either, or both, the 3 ' end or the 5' end of an oligonucleotide.
  • a terminal group comprises one or more terminal group nucleosides.
  • conjugate means an atom or group of atoms bound to an oligo-nucleotide or oligomeric compound.
  • a conjugate group links a ligand to a modified oligonucleotide or oligomeric compound.
  • conjugate groups can modify one or more properties of the compound to which they are attached, including, but not limited to pharmacodynamic, pharmacokinetic, binding, absorption, cellular distribution, cellular uptake, charge and I or clearance properties.
  • conjugate linker or “linker” in the context of a conjugate group means a portion of a conjugate group comprising any atom orgroup of atoms and which covalently link an oligonucleotide to another portion of the conjugate group.
  • the point of attachment on the oligomeric compound is the 3 '-oxygen atom of the 3'-hydroxyl group of the 3' terminal nucleoside of the oligonucleotide.
  • the point of attachment on the oligomeric compound is the 5'- oxygen atom of the 5'-hydroxyl group of the 5' terminal nucleoside of the oligonucleotide.
  • the bond for forming attachment to the oligomeric compound is a cleavable bond. In certain such embodiments, such cleavable bond constitutes all or part of a cleavable moiety.
  • conjugate groups comprise a cleavable moiety (e.g., a cleavable bond or cleavable nucleoside) and ligand portion that can comprise one or more ligands, such as a carbohydrate cluster portion, such as an N-Acetyl-Galactosamine, also referred to as "GalNAc", cluster portion.
  • a carbohydrate cluster portion such as an N-Acetyl-Galactosamine, also referred to as "GalNAc", cluster portion.
  • the carbohydrate cluster portion is identified by the number and identity of the ligand.
  • the carbohydrate cluster portion comprises 2 GalNAc groups.
  • the carbohydrate cluster portion comprises 3 GalNAc groups and this is particularly preferred.
  • the carbohydrate cluster portion comprises 4 GalNAc groups.
  • Such ligand portions are attached to an oligomeric compound via a cleavable moiety, such as a cleavable bond or cleavable nucleoside.
  • the ligands can be arranged in a linear or branched configuration, such as a biantennary or triantennary configurations.
  • cleavable moiety means a bond or group that is capable of being cleaved under physiological conditions.
  • a cleavable moiety is cleaved inside a cell or sub-cellular compartments, such as an endosome or lysosome.
  • a cleavable moiety is cleaved by endogenous enzymes, such as nucleases.
  • a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds.
  • a cleavable moiety is a phosphodiester linkage.
  • cleavable bond means any chemical bond capable of being broken.
  • carbohydrate cluster means a compound having one or more carbohydrate residues attached to a linker group.
  • modified carbohydrate means any carbohydrate having one or more chemical modifications relative to naturally occurring carbohydrates.
  • carbohydrate derivative means any compound which may be synthesized using a carbohydrate as a starting material or intermediate.
  • carbohydrate means a naturally occurring carbohydrate, a modified carbohydrate, or a carbohydrate derivative.
  • a carbohydrate is a biomolecule including carbon (C), hydrogen (H) and oxygen (O) atoms.
  • Carbohydrates can include monosaccharide, disaccharides, trisaccharides, tetrasaccharides, oligosaccharides or polysaccharides, such as one or more galactose moieties, one or more lactose moieties, one or more N-Acetyl-Galactosamine moieties, and I or one or more mannose moieties.
  • a particularly preferred carbohydrate is N-Acetyl-Galactosamine moieties.
  • strand means an oligomeric compound comprising linked nucleosides.
  • single strand or “single-stranded” means an oligomeric compound comprising linked nucleosides that are connected in a continuous sequence without a break therebetween. Such single strands may include regions of sufficient self-complementarity so as to be capable of forming a stable self-duplex in a hairpin structure.
  • hairpin means a single stranded oligomeric compound that includes a duplex formed by base pairing between sequences in the strand that are self-complementary and opposite in directionality.
  • hairpin loop means an unpaired loop of linked nucleosides in a hairpin that is created as a result of hybridization of the self-complementary sequences. The resulting structure looks like a loop or a U-shape.
  • directionality means the end-to-end chemical orientation of an oligonucleotide based on the chemical convention of numbering of carbon atoms in the sugar moiety meaning that there will be a 5'-end defined by the 5' carbon of the sugar moiety, and a 3'-end defined by the 3' carbon of the sugar moiety.
  • the respective strands run in opposite 5' to 3' directions to permit base pairing between them.
  • duplex means two or more complementary strand regions, or strands, of an oligonucleotide or oligonucleotides, hybridized together by way of non-covalent, sequence-specific interaction therebetween. Most commonly, the hybridization in the duplex will be between nucleobases adenine (A) and thymine (T), and I or (A) adenine and uracil (U), and I or guanine (G) and cytosine (C).
  • the duplex may be part of a single stranded structure, wherein self-complementarity leads to hybridization, or as a result of hybridization between respective strands in a double stranded construct.
  • double strand or “double stranded” means a pair of oligomeric compounds that are hybridized to one another.
  • a double-stranded oligomeric compound comprises a first and a second oligomeric compound.
  • expression means the process by which a gene ultimately results in a protein. Expression includes, but is not limited to, transcription, post-transcriptional modification (e.g., splicing, polyadenlyation, addition of 5 '-cap), and translation.
  • transcription or “transcribed” refers to the first of several steps of DNA based gene expression in which a target sequence of DNA is copied into RNA (especially mRNA) by the enzyme RNA polymerase. During transcription, a DNA sequence is read by an RNA polymerase, which produces a complementary, antiparallel RNA sequence called a primary transcript.
  • target sequence means a nucleoside sequence to which an oligomeric compound is intended to hybridize to result in a desired activity with respect to the disease or gene function of interest. Oligonucleotides have sufficient complementarity to their target sequences to allow hybridization under physiological conditions.
  • nucleobase complementarity when in reference to nucleobases means a nucleobase that is capable of base pairing with another nucleobase.
  • adenine (A) is complementary to thymine (T).
  • adenine (A) is complementary to uracil (U).
  • guanine (G) is complementary to cytosine (C).
  • complementary nucleobase means a nucleobase of an oligomeric compound that is capable of base pairing with a nucleobase of its target sequence.
  • nucleobases at a certain position of an oligomeric compound are capable of hydrogen bonding with a nucleobase at a certain position of a target sequence
  • the position of hydrogen bonding between the oligomeric compound and the target sequence is considered to be complementary at that nucleobase pair.
  • Nucleobases comprising certain modifications may maintain the ability to pair with a counterpart nucleobase and thus, are still capable of nucleobase complementarity.
  • non-complementary in reference to nucleobases means a pair of nucleobases that do not form hydrogen bonds with one another.
  • complementary in reference to oligomeric compounds (e.g., linked nucleosides, oligonucleotides) means the capacity of such oligomeric compounds or regions thereof to hybridize to a target sequence, or to a region of the oligomeric compound itself, through nucleobase complementarity.
  • complementary oligomeric compounds need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated.
  • complementary oligomeric compounds or regions are complementary at 70% of the nucleobases (70% complementary).
  • complementary oligomeric compounds or regions are at least 80% complementary.
  • complementary oligomeric compounds or regions are at least 90% complementary.
  • complementary oligomeric compounds or regions are at least 95% complementary.
  • complementary oligomeric compounds or regions are at least 100% complementary.
  • self-complementarity in reference to oligomeric compounds means a compound that may fold back on itself, creating a duplex as a result of nucleobase hybridization of internal complementary strand regions. Depending on how close together and / or how long the strand regions are, then the compound may form hairpin loops, junctions, bulges or internal loops.
  • mismatch means a nucleobase of an oligomeric compound that is not capable of pairing with a nucleobase at a corresponding position of a target sequence, or at a corresponding position of the oligomeric compound itself when the oligomeric compound hybridizes as a result of selfcomplementarity, when the oligomeric compound and the target sequence and I or self-complementary regions of the oligomeric compound, are aligned.
  • hybridization means the pairing of complementary oligomeric compounds (e.g., an oligomeric compound and its target sequence). While not limited to a particular mechanism, the most common mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.
  • oligomeric compound or region thereof is capable of pairing with a nucleobase of a complementary nucleic acid target sequence or a self-complementary region of the oligomeric compound.
  • a fully complementary oligomeric compound or region thereof comprises no mis-matches or unhybridized nucleobases with respect to its target sequence or a self- complementary region of the oligomeric compound.
  • percent complementarity means the percentage of nucleobases of an oligomeric compound that are complementary to an equal-length portion of a target nucleic acid. Percent complementarity is calculated by dividing the number of nucleobases of the oligomeric compound that are complementary to nucleobases at corresponding positions in the target nucleic acid by the total length of the oligomeric compound.
  • percent identity means the number of nucleobases in a first nucleic acid that are the same type (independent of chemical modification) as nucleobases at corresponding positions in a second nucleic acid, divided by the total number of nucleobases in the first nucleic acid.
  • modulation means a change of amount or quality of a molecule, function, or activity when compared to the amount or quality of a molecule, function, or activity prior to modulation. For example, modulation includes the change, either an increase (stimulation or induction) or a decrease (inhibition or reduction) in gene expression.
  • type of modification in reference to a nucleoside or a nucleoside of a “type” means the chemical modification of a nucleoside and includes modified and unmodified nucleosides. Accordingly, unless otherwise indicated, a "nucleoside having a modification of a first type" may be an unmodified nucleoside.
  • RNA nucleosides are “differently modified,” even though the naturally occurring nucleoside is unmodified.
  • DNA and RNA oligonucleotides are “differently modified,” even though both are naturally-occurring unmodified nucleosides. Nucleosides that are the same but for comprising different nucleobases are not differently modified.
  • nucleoside comprising a 2'-OMe modified sugar moiety and an unmodified adenine nucleobase and a nucleoside comprising a 2'-OMe modified sugar moiety and an unmodified thymine nucleobase are not differently modified.
  • the same type of modifications refers to modifications that are the same as one another, including absence of modifications.
  • two unmodified RNA nucleosides have “the same type of modification,” even though the RNA nucleosides are unmodified.
  • Such nucleosides having the same type modification may comprise different nucleobases.
  • region or “regions”, or “portion” or “portions”, mean a plurality of linked nucleosides that have a function or character as defined herein, in particular with reference to the claims and definitions as provided herein.
  • regions or portions comprise at least 10, at least 11 , at least 12 or at least 13 linked nucleosides.
  • regions can comprise 13 to 20 linked nucleosides, such as 13 to 16 or 18 to 20 linked nucleosides.
  • a first region as defined herein consists essentially of 18 to 20 nucleosides and a second region as defined herein consists essentially of 13 to 16 linked nucleosides.
  • pharmaceutically acceptable carrier or diluent means any substance suitable for use in administering to an animal.
  • a pharmaceutically acceptable carrier or diluent is sterile saline.
  • such sterile saline is pharmaceutical grade saline.
  • substituted nucleoside and “substituent group,” means an atom or group that replaces the atom or group of a named parent compound.
  • a substituent of a modified nucleoside is any atom or group that differs from the atom or group found in a naturally occurring nucleoside (e.g., a modified 2'- substituent is any atom or group at the 2 '-position of a nucleoside other than H or OH).
  • Substituent groups can be protected or unprotected.
  • compounds of the present disclosure have substituents at one or at more than one position of the parent compound.
  • Substituents may also be further substituted with other substituent groups and may be attached directly or via a linking group such as oxygen or an alkyl or hydrocarbyl group to a parent compound.
  • substituents can be present as the modification on the sugar moiety, in particular a substituent present at the 2'-position of the sugar moiety.
  • groups amenable for use as substituents include without limitation, one or more of halo, hydroxyl, alkyl, alkenyl, alkynyl, acyl, carboxyl, alkoxy, alkoxyalkylene and amino substituents.
  • substituents as described herein can represent modifications directly attached to a ring of a sugar moiety (such as a halo, such as fluoro, directly attached to a sugar ring), or a modification indirectly linked to a ring of a sugar moiety by way of an oxygen linking atom that itself is directly linked to the sugar moiety (such as an alkoxyalkylene, such as methoxyethylene, linked to an oxygen atom, overall providing an MOE substituent as described herein attached to the 2'-position of the sugar moiety).
  • alkyl as used herein, means a saturated straight or branched monovalent C1- 6 hydro-carbon radical, with methyl being a most preferred alkyl as a substituent at the 2'-position of the sugar moiety.
  • the alkyl group typically attaches to an oxygen linking atom at the 2'poisition of the sugar, therefore, overall providing a -Oalkyl substituent, such as an -OCH3 substituent, on a sugar moiety of an oligomeric compound according to the present invention. This will be well understood be a person skilled in the art.
  • alkylene means a saturated straight or branched divalent hydrocarbon radical of the general formula -CnH2n- where n is 1-6. Methylene or ethylene are preferred alkylenes.
  • alkenyl means a straight or branched unsaturated monovalent C2-6 hydrocarbon radical, with ethenyl or propenyl being most preferred alkenyls as a substituent at the 2'- position of the sugar moiety.
  • degree of unsaturation that is present in an alkenyl radical is the presence of at least one carbon to carbon double bond.
  • alkynyl means a straight or branched unsaturated C2-6 hydrocarbon radical, with ethynyl being a most preferred alkynyl as a substituent at the 2'-position of the sugar moiety.
  • degree of unsaturation that is present in an alkynyl radical is the presence of at least one carbon to carbon triple bond.
  • the alkynyl group typically attaches to an oxygen linking atom at the 2'-position of the sugar, therefore, overall providing a -Oalkynyl substituent on a sugar moiety of an oligomeric compound according to the present invention. This will be well understood be a per-son skilled in the art.
  • Carboxyl is a radical having a general formula -CO2H.
  • acyl means a radical formed by removal of a hydroxyl group from a carboxyl radical as defined herein and has the general Formula -C(O)-X where X is typically C1-6 alkyl.
  • alkoxy means a radical formed between an alkyl group, such as a C1-6 alkyl group, and an oxygen atom wherein the oxygen atom is used to attach the alkoxy group either to a parent molecule (such as at the 2'-position of a sugar moiety), or to another group such as an alkylene group as defined herein.
  • alkoxy groups include without limitation, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy and tert-butoxy.
  • Alkoxy groups as used herein may optionally include further substituent groups.
  • alkoxyalkylene means an alkoxy group as defined herein that is attached to an alkylene group also as defined herein, and wherein the oxygen atom of the alkoxy group attaches to the alkylene group and the alkylene attaches to a parent molecule.
  • the alkylene group typically attaches to an oxygen linking atom at the 2'-position of the sugar, therefore, overall providing a -Oalkylenealkoxy substituent, such as an -OCH2CH2OCH3 substituent, on a sugar moiety of an oligomeric compound according to the present invention.
  • MOE substituent as defined herein and as known in the art.
  • amino includes primary, secondary and tertiary amino groups.
  • nucleic acid molecules or compounds as described herein may have one or more non-hybridizing nucleosides at one or both ends of one or both strands (overhangs) and I or one or more internal non-hybridizing nucleosides (mismatches) provided there is sufficient complementarity to maintain hybridization under physiologically relevant conditions.
  • oligomeric compounds as described herein may be blunt ended at at least one end.
  • pharmaceutical composition means a mixture of substances suitable for administering to an individual.
  • a pharmaceutical composition may comprise one or more active pharmaceutical agents and a sterile aqueous solution.
  • pharmaceutically acceptable salts means physiologically and pharmaceutically acceptable salts of antisense compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxicological effects thereto.
  • compositions according to the invention or a nucleic acid according to the invention comprising a composition according to the invention or a nucleic acid according to the invention and, where appropriate, suitable excipients and additives, such as, for example, a physiological saline solution, stabilizers or proteinase inhibitors.
  • antisense compounds have chemically modified subunits arranged in patterns, or motifs, to conferto the antisense compounds properties such as enhanced inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases.
  • Chimeric antisense compounds typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and/or increased inhibitory activity.
  • a second region of a chimeric antisense compound may confer another desired property e.g., serve as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an RNA:DNA duplex.
  • Antisense activity may result from any mechanism involving the hybridization of the antisense compound (e.g., oligonucleotide) with a target nucleic acid, wherein the hybridization ultimately results in a biological effect.
  • the amount and/or activity of the target nucleic acid is modulated.
  • the amount and/or activity of the target nucleic acid is reduced.
  • hybridization of the antisense compound to the target nucleic acid ultimately results in target nucleic acid degradation.
  • hybridization of the antisense compound to the target nucleic acid does not result in target nucleic acid degradation.
  • the presence of the antisense compound hybridized with the target nucleic acid results in a modulation of antisense activity.
  • antisense compounds having a particular chemical motif or pattern of chemical modifications are particularly suited to exploit one or more mechanisms.
  • antisense compounds function through more than one mechanism and/or through mechanisms that have not been elucidated. Accordingly, the antisense compounds described herein are not limited by a particular mechanism.
  • Antisense mechanisms include, without limitation, RNase H mediated antisense; RNAi mechanisms, which utilize the RISC pathway and include, without limitation, siRNA, ssRNA and microRNA mechanisms; and occupancy based mechanisms. Certain antisense compounds may act through more than one such mechanism and/or through additional mechanisms.
  • RNase H-Mediated Antisense results at least in part from degradation of target RNA by RNase H.
  • RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. It is known in the art that single-stranded antisense compounds which are "DNA-like" elicit RNase H activity in mammalian cells.
  • antisense compounds comprising at least a portion of DNA or DNA-like nucleosides may activate RNase H, resulting in cleavage of the target nucleic acid.
  • antisense compounds that utilize RNase H comprise one or more modified nucleosides.
  • such antisense compounds comprise at least one block of 1-8 modified nucleosides.
  • the modified nucleosides do not support RNase H activity.
  • such antisense compounds are gapmers, as described herein.
  • RNAi Compounds are interfering RNA compounds (RNAi), which include double-stranded RNA compounds (also referred to as shortinterfering RNA or siRNA) and single- stranded RNAi compounds (or ssRNA). Such compounds work at least in part through the RISC pathway to degrade and/orsequester a target nucleic acid (thus, include microRNA/microRNA-mimic compounds). In some embodiments, antisense compounds comprise modifications that make them particularly suited for such mechanisms.
  • RNAi interfering RNA compounds
  • siRNA double-stranded RNA compounds
  • ssRNAi compounds single- stranded RNAi compounds
  • antisense compounds comprise modifications that make them particularly suited for such mechanisms.
  • the present disclosure provides conjugated antisense compounds. In some embodiments, the present disclosure provides conjugated antisense compounds comprising an antisense oligonucleotide complementary to a nucleic acid transcript. In some embodiments, the present disclosure provides methods comprising contacting a cell with a conjugated antisense compound comprising an antisense oligonucleotide complementary to a nucleic acid transcript. In some embodiments, the present disclosure provides methods comprising contacting a cell with a conjugated antisense compound comprising an antisense oligonucleotide and reducing the amount or activity of a nucleic acid transcript in a cell.
  • the asialoglycoprotein receptor (ASGP-R) has been described previously. See e.g., Park et al., PNAS vol. 102, No. 47, pp 17125-17129 (2005). Such receptors are expressed on liver cells, particularly hepatocytes. Further, it has been shown that compounds comprising clusters of three N-acetylgalactosamine (GalNAc) ligands are capable of binding to the ASGP-R, resulting in uptake of the compound into the cell. See e.g., Khorev et al., Bioorganic and Medicinal Chemistry, 16, 9, pp 5216- 5231 (May 2008).
  • GalNAc N-acetylgalactosamine
  • conjugates comprising such GalNAc clusters have been used to facilitate uptake of certain compounds into liver cells, specifically hepatocytes.
  • certain GalNAc-containing conjugates increase activity of duplex siRNA compounds in liver cells in vivo.
  • the GalNAc-containing conjugate is typically attached to the sense strand of the siRNA duplex. Since the sense strand is discarded before the antisense strand ultimately hybridizes with the target nucleic acid, there is little concern that the conjugate will interfere with activity.
  • conjugated single-stranded antisense compounds having improved potency in liver cells in vivo compared with the same antisense compound lacking the conjugate.
  • conjugate groups herein comprise a cleavable moiety.
  • the conjugate should remain on the compound long enough to provide enhancement in uptake, but after that, it is desirable for some portion or, ideally, all of the conjugate to be cleaved, releasing the parent compound (e.g., antisense compound) in its most active form.
  • the cleavable moiety is a cleavable nucleoside.
  • Such embodiments take advantage of endogenous nucleases in the cell by attaching the rest of the conjugate (the cluster) to the antisense oligonucleotide through a nucleoside via one or more cleavable bonds, such as those of a phosphodiester linkage.
  • the cluster is bound to the cleavable nucleoside through a phosphodiester linkage.
  • the cleavable nucleoside is attached to the antisense oligonucleotide (antisense compound) by a phosphodiester linkage.
  • the conjugate group may comprise two or three cleavable nucleosides.
  • such cleavable nucleosides are linked to one another, to the antisense compound and/or to the cluster via cleavable bonds (such as those of a phosphodiester linkage).
  • cleavable bonds such as those of a phosphodiester linkage.
  • Certain conjugates herein do not comprise a cleavable nucleoside and instead comprise a cleavable bond. It is shown that that sufficient cleavage of the conjugate from the oligonucleotide is provided by at least one bond that is vulnerable to cleavage in the cell (a cleavable bond).
  • conjugated antisense compounds are prodrugs. Such prodrugs are administered to an animal and are ultimately metabolized to a more active form. For example, conjugated antisense compounds are cleaved to remove all or part of the conjugate resulting in the active (or more active) form of the antisense compound lacking all or some of the conjugate.
  • conjugates are attached at the 5' end of an oligonucleotide. Certain such 5'- conjugates are cleaved more efficiently than counterparts having a similar conjugate group attached at the 3 ' end. In some embodiments, improved activity may correlate with improved cleavage. In some embodiments, oligonucleotides comprising a conjugate at the 5' end have greater efficacy than oligonucleotides comprising a conjugate at the 3' end. In some embodiments, oligonucleotides comprising a conjugate at the 3' end have greater efficacy than oligonucleotides comprising a conjugate at the 5' end. 5'-attachment allows simpler oligonucleotide synthesis.
  • oligonucleotides are synthesized on a solid support in the 3 ' to 5' direction.
  • To make a 3'-conjugated oligonucleotide typically one attaches a pre-conjugated 3' nucleoside to the solid support and then builds the oligonucleotide as usual.
  • attaching that conjugated nucleoside to the solid support adds complication to the synthesis.
  • the conjugate is then present throughout the synthesis of the oligonucleotide and can become degraded during subsequent steps or may limit the sorts of reactions and reagents that can be used.
  • conjugates and conjugated oligonucleotides are easier and/or requires few steps, and is therefore less expensive than that of conjugates previously disclosed, providing advantages in manufacturing.
  • the synthesis of certain conjugate groups consists of fewer synthetic steps, resulting in increased yield, relative to conjugate groups previously described.
  • the conjugate groups comprise a linker.
  • the linker is covalently bound to the cleavable moiety.
  • the linker is covalently bound to the antisense oligonucleotide.
  • the linker is covalently bound to a cell- targeting moiety.
  • the linker further comprises a covalent attachment to a solid support.
  • the linker further comprises a covalent attachment to a protein binding moiety.
  • the linker further comprises a covalent attachment to a solid support and further comprises a covalent attachment to a protein binding moiety.
  • the linker includes multiple positions for attachment of tethered ligands. In some embodiments, the linker includes multiple positions for attachment of tethered ligands and is not attached to a branching group. In some embodiments, the linker further comprises one or more cleavable bond. In some embodiments, the conjugate group does not include a linker.
  • the linker includes at least a linear group comprising groups selected from alkyl, amide, disulfide, polyethylene glycol, ether, thioether (-S-) and hydroxylamino (-O-N(H)-) groups.
  • the linear group comprises groups selected from alkyl, amide and ether groups.
  • the linear group comprises groups selected from alkyl and ether groups.
  • the linear group comprises at least one phosphorus linking group.
  • the linear group comprises at least one phosphodiester group.
  • the linear group includes at least one neutral linking group.
  • the linear group is covalently attached to the cell-targeting moiety and the cleavable moiety. In some embodiments, the linear group is covalently attached to the cell-targeting moiety and the antisense oligonucleotide. In some embodiments, the linear group is covalently attached to the cell-targeting moiety, the cleavable moiety and a solid support. In some embodiments, the linear group is covalently attached to the celltargeting moiety, the cleavable moiety, a solid support and a protein binding moiety. In some embodiments, the linear group includes one or more cleavable bond.
  • the linker includes the linear group covalently attached to a scaffold group.
  • the scaffold includes a branched aliphatic group comprising groups selected from alkyl, amide, disulfide, polyethylene glycol, ether, thioether and hydroxylamino groups.
  • the scaffold includes a branched aliphatic group comprising groups selected from alkyl, amide and ether groups.
  • the scaffold includes at least one mono or polycyclic ring system. In some embodiments, the scaffold includes at least two mono or polycyclic ring systems.
  • the linear group is covalently attached to the scaffold group and the scaffold group is covalently attached to the cleavable moiety and the linker. In some embodiments, the linear group is covalently attached to the scaffold group and the scaffold group is covalently attached to the cleavable moiety, the linker and a solid support. In some embodiments, the lineargroup is covalently attached to the scaffold group and the scaffold group is covalently attached to the cleavable moiety, the linker and a protein binding moiety. In some embodiments, the linear group is covalently attached to the scaffold group and the scaffold group is covalently attached to the cleavable moiety, the linker, a protein binding moiety and a solid support. In some embodiments, the scaffold group includes one or more cleavable bonds.
  • the linker includes a protein binding moiety.
  • the protein binding moiety is a lipid such as for example including but not limited to cholesterol, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1 ,3-Bis-0(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1 ,3-propanediol, heptadecyl group, palmitic acid, myristic acid, 03-(oleoyl)lithocholic acid, 03-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine), a vitamin (e.g., folate, vitamin A, vitamin E, biotin, pyridoxal), a peptide, a carbohydrate (e
  • the invention features a composition (e.g., one or more compositions, formulations or dosage formulations) or a pharmaceutical combination, comprising a double-stranded ribonucleic acid molecule or compound or composition comprising a double-stranded ribonucleic acid molecule and a conjugate according to the invention and a second therapeutic agent.
  • the invention features a composition (e.g., one or more compositions, formulations or dosage formulations) or a pharmaceutical combination, comprising a therapeutic agent according to the invention and a second therapeutic agent.
  • the composition comprises a pharmaceutically acceptable carrier or diluent.
  • the double-stranded ribonucleic acid molecule or compound comprising a double-stranded ribonucleic acid molecule and a conjugate and the second agent can be present in a single composition or as two or more different compositions.
  • the double-stranded ribonucleic acid molecule or compound comprising a double-stranded ribonucleic acid molecule and a conjugate and the second agent can be administered via the same administration route or via different administration routes.
  • the double-stranded ribonucleic acid molecule or compound comprising a double-stranded ribonucleic acid molecule and a conjugate and the second agent can be administered simultaneously or sequentially.
  • the pharmaceutical combination comprises the double-stranded ribonucleic acid molecule or compound comprising a double-stranded ribonucleic acid molecule and a conjugate and the second agent separately or together.
  • the agent or pharmaceutical composition can be administered by different routes including orally, parenterally, sublingually, intradermally, transdermally, rectally, transmucosally, topically, via inhalation, via buccal administration, intrapleurally, intravenously, intraarterially, intraperitoneally, subcutaneously, intramuscularly, intranasally, intrathecally, and/or intraarticularly, or combinations thereof.
  • the agent or pharmaceutical composition is administered orally.
  • the agent or pharmaceutical composition is administered intravenously.
  • the agent or pharmaceutical composition is administered via microneedle injection.
  • the agent or pharmaceutical composition is administered via microneedle injection into the dermis.
  • the agent or pharmaceutical composition may be formulated in a lipid nanoparticle and administered via microneedle injection.
  • CT computed tomography
  • MRI magnetic resonance imaging
  • T2* susceptibility-weighted imaging or the bO map of the diffusion-weighted sequence, in case the former were not available
  • Blood indices measured were ionised calcium, total calcium, phosphate, magnesium, parathyroid hormone (PTH), active Vitamin D and urea and electrolytes. Urinary index measured was calcium:creatinine ratio.
  • hTERT-immortalised microvascular endothelial cells TIME-ATCC CRL-4025TM, “TIME” cells
  • EBMTM-2 Endothelial Cell Growth Basal Medium-2 Libco
  • EGMTM-2 BulletKit Libco CC-3162
  • Gibco fetal bovine serum
  • TIME cells were transduced with lentiviral vectors to induce stable expression of HA-tagged forms of GNAQ WT, GNAQ p.(R183Q), GNA11 WT, GNA11 p.(R183C) cDNAs (Fig. 4), and we confirmed presence of the mutations in the genomic DNA by Sanger sequencing (Fig. 4B).
  • Transduced lines expressed WT or variant forms of HA-tagged transgenes at similar levels, and total expression of G/VAQ-encoded protein Gaq in both GNAQ transgenic models was close to endogenous expression observed in parental TIME cells (Fig. 4C).
  • HEK DKO Gaq/11 CasR;NFAT-Luc cells were derived as follows: HEK DKO Gaq/11 , which lacked functional GNAQ and GNA11 genes [36], were engineered to stably integrate NFAT-Luciferase calcium reporter and to overexpress the calcium sensing receptor (CaSR). CaSR senses calcium as its extracellular ligand and signals downstream through Gaq and Ga11 to activate the intracellular calcium pathway.
  • CaSR calcium sensing receptor
  • HEK DKO Gaq/11 ; CaSR;NFAT-Luc were maintained in DMEM-GlutamaxTM media (Thermo Fisher) with 10% fetal bovine serum (Gibco), 400 pg/mL GeneticinTM (Thermo Fisher) and 100ug/mL hygromycin (Thermo Fisher).
  • GNAQ WT, GNAQ c.548G>A, p.(R183Q), GNA11 WT and GNA11 C.547OT, p.(R183C) cDNAs were synthesized and cloned into a pcDNA3.1 + N-HA plasmid, fused in-frame at their N- terminus with an HA tag (Genscript).
  • Luciferase ORF was excised from pLenti PGK V5-LUC Puro (Addgene 21471) by Sall and Xbal combined restriction digestion, and HA-tagged G/VAQ/11 cDNAs were amplified and cloned into the digested pLenti-vector using the In-Fusion HD Cloning kit (Takara Bio cat. 638947), following the online primer design tool and the manufacturer's instructions.
  • the following antibodies were used: anti-phospho-ERK T202/Y204 (cat. 9101 , 1 :1000) and anti-ERK (cat. 9107, 1 :1000) from Cell Signaling Technology; anti-vinculin (cat.
  • CM4620 was obtained from MedChemExpress (cat. HY-101942).
  • Lentiviral particles were produced by transfecting HEK293T cells in 10cm tissue culture dishes with 0.93 pg pCMV-VSVG, 2.79 pg delta-8.2 (Addgene) and 3.72 pg pLenti GNAQWT, GA/AQR183Q, GNA11WT or G/VA77R183C mixture (LipofectamineTM, Invitrogen). 48 hours after transfection, virus particles in the supernatant were harvested and stored at -80°C.
  • TIME cells were transduced with GNAQWT, GA/AQR183Q, GNA11WT or G/VA77R183C lentiviral particles in 6-well tissue culture dishes, in the presence of 8 pg/ml polybrene and then selected using 4pg/MI puromycin.
  • IP1 inositol monophosphate
  • HTRF-IP-One kit Cisbio Bioassays
  • TIME cells were transfected with siRNAs in antibiotic-free complete medium, medium was replaced 18 hours after transfection and the IP-One assay performed 48 hours post-transfection.
  • TIME cells were trypsinized, and cell pellets resuspended in complete medium and transferred to a 384-well microtitre plate at a density of 50,000 cells/7 pl in each well, and a total of 5-6 wells were used as technical replicates for each experimental condition. 7 pl of stimulation buffer were then added to each well. After 90mins of incubation at 37°C, 3 pl of IP1 -d2 conjugate and 3 pl of europium cryptate-labelled anti-IP1 antibody dissolved in lysis buffer were added to the cells. After incubation in the dark for one hour at room temperature, fluorescence was sequentially measured at 620 and 665 nm in every well by Tecan Spark® plate reader.
  • HEK DKO Gaq/11 ;CaSR;NFAT-Luc cells were seeded at density of 10,000 cells/well in 96 well plates and transfected with pcDNA3.1 GNAQ W GNAQ P ' 830 , GNA11 m or G/VA77 R183C plasmids (LipofectamineTM 2000) using 40ng, 5ng, 5ng and 4ng of constructs, respectively, to obtain similar expression levels of cDNAs. The day following transfection, cells were starved for 16 hours in DMEM containing 25mM HEPES, 0.45mM CaCh and 0.01 % FBS.
  • siG/VAQmut #1 UGCUUAGAGUUCAAGUCCC[dT][dT];
  • siG/VAQmut #2 GCUUAGAGUUCAAGUCCCC[dT][dT];
  • siGA/AQmut #3 CUUAGAGUUCAAGUCCCCA[dT][dT];
  • siGA/AQmut #4 UUAGAGUUCAAGUCCCCAC[dT][dT];
  • siGA/AQmut #5 UAGAGUUCAAGUCCCCACC[dT][dT];
  • siGA/AQmut #6 AGAGUUCAAGUCCCCACCA[dT][dT]
  • siRNAs specifically annealing to variant GNA11 c.547C>T, p.(R183C) transcript were synthesized with the following sense strand sequences:
  • siG/VA77mut #1 GUGCUGCGGGUCUGCGUGC[dT][dT];
  • siG/VA77mut #2 UGCUGCGGGUCUGCGUGCC[dT][dT];
  • siG/VA77mut #3 GCUGCGGGUCUGCGUGCCC[dT][dT];
  • siG/VA77mut #4 CUGCGGGUCUGCGUGCCCA[dT][dT];
  • siG/VA77mut #5 UGCGGGUCUGCGUGCCCAC[dT][dT];
  • siG/VA77mut #6 CGGGUCUGCGUGCCCACCA[dT][dT],
  • TIME transgenic cells were transfected with siRNAs using Lipofectamine RNAiMAXTM (Invitrogen) following manufacturer’s instructions.
  • Example 1 - SWS and PPV patients have disrupted systemic calcium homeostasis
  • Example 2 - GNAQ/GNA11 variants cause constitutive activation of intracellular calcium signalling in endothelial cells
  • Basal calcium signalling was significantly increased in both G/VAQR183Q and G/VA77R183C variant TIME cells compared to wildtype (WT) controls, as demonstrated by a sharp increase in IP-One accumulation in both complete and nutrient-deprived medium (Figure 2A).
  • Basal MAPK pathway activation was not significantly different between G/VAQ-variant and WT or between GA/A77-variant and WT TIME cells, as demonstrated by western-blot analysis of ERK phosphorylation in both complete and starvation medium conditions (Figure 2B).
  • Example 4 CRAC channel inhibition and variant-specific siRNAs rescue aberrant calcium signalling in variant cells.
  • siRNAs were designed for specific knockdown of GNAQ c.548G>A, p.(R183Q) or GNA11 c.547C>T, p.(R183C) transcripts whilst sparing the WT alleles (Fig. 5A-D), as a further molecular tool to study the biological effects of these mutations.
  • TIME GA/AQR183Q were transfected with variant-specific oligos and intracellular calcium accumulation measured following thrombin stimulation.
  • constitutive signalling the aberrantly-prolonged response of TIME G/VAQ-variant cells to thrombin was rescued by silencing of the variant transcript ( Figure 3F), strongly tying the mutation to all aspects of the signalling abnormality.
  • Example 5 In vitro angiogenesis is disrupted by mutant GNAQ and rescued by CRAC channel inhibition
  • TIME endothelial cell models were used to assess angiogenesis using a standard in vitro angiogenesis assay [38], G/VAQR183Q cells had significantly impaired tubule formation in basement membrane matrix ( Figure 8A-B), linking the mutation to the pathogenesis of the vascular malformations. Furthermore, thrombin GPCR activation disrupted angiogenesis in G/VAQR183Q more than in G/ ⁇ MQWT( Figure 8C).
  • Example 6 Serum ionised calcium is significantly inversely associated with seizures, status epilepticus and anti-epileptics.
  • Example 7 - SWS/PPV patients have fluctuating levels of serum ionised calcium with normal 25-hydroxy-vitamin D levels.
  • Example 8 - SWS/PPV patients have no major abnormalities of calcium metabolic functioning of parathyroids, kidneys and skeletal systems
  • E-GFR Estimated glomerular filtration rate
  • a nucleic acid molecule comprising a first strand of 10 to 50 linked nucleosides, wherein the first strand comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding GNAQ or GNA11.
  • the nucleic acid molecule of embodiment 1 wherein the first strand comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding a gain-of-function variant of GNAQ or GNA11.
  • the first strand comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding a gain-of-function variant of GNAQ.
  • nucleic acid molecule according to any one of embodiments 1 or 2, wherein the first strand comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding GNA11.
  • nucleic acid molecule according to any one of embodiments 1 , 2 or 5, wherein the first strand comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding a gain-of-function variant of GNA11.
  • nucleic acid molecule according to any preceding embodiment, wherein the first strand consists of 10 to 40 linked nucleosides.
  • nucleic acid molecule according to any preceding embodiment, wherein the first strand consists of 10 to 30 linked nucleosides.
  • nucleic acid molecule according to any preceding embodiment, wherein the first strand consists of 15 to 30 linked nucleosides.
  • nucleic acid molecule according to any preceding embodiment, wherein the first strand consists of 15 to 25 linked nucleosides.
  • nucleic acid molecule according to any preceding embodiment, wherein the first strand consists of 15 to 20 linked nucleosides.
  • nucleic acid molecule according to any preceding embodiment, wherein the first strand consists of 10 to 20 linked nucleosides.
  • nucleic acid molecule according to any preceding embodiment, wherein the first strand consists of 20 to 30 linked nucleosides.
  • nucleic acid molecule according to any preceding embodiment, wherein the first strand consists of 20 to 25 linked nucleosides.
  • the first strand comprises a sequence that is fully complementary to a sequence having 100% identity to an equal length portion of an mRNA encoding variant GNAQ p.(R183Q), p.(R183G), p.(R183L) or p.(R183*).
  • nucleic acid molecule capable of inhibiting the expression of variant GNAQ p.(R183Q/G/L/*) in vitro by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90%.
  • nucleic acid molecule according to any preceding embodiment, wherein the nucleic acid molecule inhibits the expression of variant GNAQ p.(R183Q/G/L/*) in vitro to a greater extent relative to inhibition of the expression of wild type GNAQ in vitro.
  • nucleic acid molecule according to any preceding embodiment, wherein the nucleic acid molecule is capable of partially or completely rescuing aberrant cell differentiation signalling in cells expressing variant GNAQ p.(R183Q/ G/L/*).
  • nucleic acid molecule according to any one of embodiments 16-20, wherein the variant GNAQ p.(R183Q) is caused by a C.G548A mutation in the GNAQ genomic sequence.
  • nucleic acid molecule according to embodiment 21 wherein the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 13-18.
  • nucleic acid molecule according to embodiment 21 or 22, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 13-18.
  • nucleic acid molecule according to any one of embodiments 21-23, wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 13-18.
  • nucleic acid molecule according to any one of embodiments 16-20, wherein the variant GNAQ p.(R183G) is caused by a C.C547G mutation in the GNAQ genomic sequence.
  • nucleic acid molecule according to embodiment 25 wherein the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 33-38.
  • nucleic acid molecule according to any one of embodiments 25-27, wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 33-38.
  • nucleic acid molecule according to any one of embodiments 16-20, wherein the variant GNAQ p.(R183L) is caused by a C.G548T mutation in the GNAQ genomic sequence.
  • nucleic acid molecule according to embodiment 29, wherein the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 45-50.
  • nucleic acid molecule according to embodiment 29 or 30, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 45-50.
  • nucleic acid molecule according to any one of embodiments 29-30, wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 45-50.
  • nucleic acid molecule according to any one of embodiments 16-20, wherein the variant GNAQ p.(R183*) is caused by a C.C547T mutation in the GNAQ genomic sequence.
  • nucleic acid molecule according to embodiment 33 wherein the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 57-62.
  • nucleic acid molecule according to embodiment 33 or 34, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 57-62.
  • nucleic acid molecule according to any one of embodiments 33-35, wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 57-62.
  • nucleic acid molecule according to any one of embodiments 1-2 or 5-15, wherein the first strand comprises a sequence that is fully complementary to a sequence having at least 95% identity to an equal length portion of an mRNA encoding variant GNA11 p.(R183C) or p.(R183H).
  • nucleic acid molecule according to any one of embodiments 1-2 or 5-15 or 37, wherein the first strand comprises a sequence that is fully complementary to a sequence having 100% identity to an equal length portion of an mRNA encoding variant GNA11 p.(R183C) or p.(R183H).
  • the nucleic acid molecule is capable of inhibiting the expression of variant GNA11 p.(R183C/H) in vitro by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90%.
  • nucleic acid molecule according to any one of embodiments 1-2 or 5-15 or 37-39, wherein the nucleic acid molecule inhibits the expression of variant GNA11 p.(R183C/H) in vitro to a greater extent relative to inhibition of the expression of wild type GNA11 in vitro.
  • nucleic acid molecule according to any one of embodiments 1-2 or 5-15 or 37-40, wherein the nucleic acid molecule is capable of partially or completely rescuing aberrant cell differentiation signalling in cells expressing variant GNA11 p.(R183C/H).
  • nucleic acid molecule according to embodiment 42 wherein the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 19-24.
  • nucleic acid molecule according to embodiment 42 or 43, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 19-24.
  • nucleic acid molecule according to any one of embodiments 42-44, wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 19-24.
  • nucleic acid molecule according to any one of embodiments 37-41 , wherein the variant GNA11 p.(R183C) is caused by a c.546_547delinsTT mutation in the GNA11 genomic sequence.
  • nucleic acid molecule according to embodiment 46 wherein the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 69-74.
  • nucleic acid molecule according to embodiment 46 or 47, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 69-74.
  • nucleic acid molecule according to any one of embodiments 46-48, wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 69-74.
  • nucleic acid molecule according to any one of embodiments 37-41 , wherein the variant GNA11 p.(R183H) is caused by a C.G548A mutation in the GNA11 genomic sequence.
  • the first strand comprises a sequence having at least 80%, at least 90% or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 81-86.
  • nucleic acid molecule according to embodiment 50 or 51 wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 81-86.
  • nucleic acid molecule according to any one of embodiments 50-52, wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 81-86.
  • nucleic acid molecule according to any preceding embodiment, wherein the nucleic acid molecule is a single stranded nucleic acid molecule.
  • nucleic acid molecule according to any one of embodiments 1 to 54, wherein the nucleic acid molecule is a double stranded nucleic acid molecule.
  • nucleic acid molecule according to embodiment 55 wherein the double stranded nucleic acid molecule comprises a second strand of 10 to 50 linked nucleosides, wherein the second strand is at least partially complementary to the first strand.
  • nucleic acid molecule according to embodiment 56 wherein the second strand is at least 80% complementary to the first strand.
  • nucleic acid molecule according to embodiment 56 or 57, wherein the second strand is at least 90% complementary to the first strand.
  • nucleic acid molecule according to any one of embodiments 56-58, wherein the second strand is at least 95% complementary to the first strand.
  • nucleic acid molecule according to any one of embodiments 56-59, wherein the second strand is fully complementary to the first strand.
  • nucleic acid molecule according to any one of embodiments 56-60, wherein the second strand consists of 10 to 40 linked nucleosides.
  • nucleic acid molecule according to any one of embodiments 56-60, wherein the second strand consists of 10 to 30 linked nucleosides.
  • nucleic acid molecule according to any one of embodiments 56-60, wherein the second strand consists of 15 to 30 linked nucleosides.
  • nucleic acid molecule according to any one of embodiments 56-60, wherein the second strand consists of 10 to 20 linked nucleosides.
  • nucleic acid molecule according to any one of embodiments 56-60, wherein the second strand consists of 20 to 30 linked nucleosides.
  • nucleic acid molecule according to any one of embodiments 56-60, wherein the second strand consists of 20 to 25 linked nucleosides.
  • nucleic acid molecule according to any one of embodiments 56-60, wherein the second strand consists of 21 linked nucleosides.
  • nucleic acid molecule according to any one of embodiments 56-69, wherein the first strand is longer than the second strand.
  • nucleic acid molecule according to any one of embodiments 56-70 having an overhang at the 3’ end of the first strand of 1 , 2, 3, 4, 5 or more nucleosides.
  • nucleic acid molecule according to any one of embodiments 56-71 having an overhang at the 3’ end of the first strand of 2 nucleosides.
  • nucleic acid molecule according to any one of embodiments 56-72 having an overhang at the 5’ end of the first strand of 1 , 2, 3, 4, 5 or more nucleosides.
  • nucleic acid molecule according to any one of embodiments 56-73 having an overhang at the 5’ end of the first strand of 2 nucleosides.
  • nucleic acid molecule according to any one of embodiments 56-69, wherein the second strand is longer than the first strand.
  • nucleic acid molecule according to embodiment 56-69 or 75 having an overhang at the 3’ end of the second strand of 1 , 2, 3, 4, 5 or more nucleosides.
  • nucleic acid molecule according to any one of embodiments 56-69 or 75-76 having an overhang at the 3’ end of the second strand of 2 nucleosides.
  • nucleic acid molecule according to any one of embodiments 56-69 or 75-77 having an overhang at the 5’ end of the second strand of 1 , 2, 3, 4, 5 or more nucleosides.
  • nucleic acid molecule according to any one of embodiments 56-69 or 75-78 having an overhang at the 5’ end of the second strand of 2 nucleosides.
  • nucleic acid molecule according to any one of embodiments 56-69 or 75-79 having an overhang at both the 5’ end and the 3’ end of the first strand of 1 , 2, 3, 4, 5 or more nucleosides.
  • nucleic acid molecule according to any one of embodiments 56-69 or 75-80 having an overhang at both the 5’ end and the 3’ end of the first strand of 2 nucleosides.
  • nucleic acid molecule according to any one of embodiments 71-74 or 75-81 wherein the overhang comprises two thymine nucleotides (TT).
  • TT thymine nucleotides
  • nucleic acid molecule according to any one of embodiments 71-74 or 75-81 wherein the overhang consists of two thymine nucleotides (TT).
  • nucleic acid molecule according to any one of embodiments 55-83, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:1 and SEQ ID NO:13, SEQ ID NO:2 and SEQ ID NO:14, SEQ ID NO:3 and SEQ ID NO:15, SEQ ID NO:4 and SEQ ID NO:16, SEQ ID NO:5 and SEQ ID NO:17; and SEQ ID NO:6 and SEQ ID NO:18.
  • nucleic acid molecule according to any one of embodiments 55-83, wherein the nucleic acid molecule comprises a first strand and a second strand consisting a pair of sequences selected from the list consisting of: SEQ ID NO:1 and SEQ ID NO:13, SEQ ID NO:2 and SEQ ID NO:14, SEQ ID NO:3 and SEQ ID NO:15, SEQ ID NO:4 and SEQ ID NO:16, SEQ ID NO:5 and SEQ ID NO:17; and SEQ ID NO:6 and SEQ ID NO:18.
  • nucleic acid molecule according to any one of embodiments 55-83, wherein the nucleic acid molecule consists of a first strand and a second strand consisting a pair of sequences selected from the list consisting of: SEQ ID NO:1 and SEQ ID NO:13, SEQ ID NO:2 and SEQ ID NO:14, SEQ ID NO:3 and SEQ ID NO:15, SEQ ID NO:4 and SEQ ID NO:16, SEQ ID NO:5 and SEQ ID NO:17; and SEQ ID NO:6 and SEQ ID NO:18.
  • nucleic acid molecule according to any one of embodiments 55-83, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NOT and SEQ ID NO:19, SEQ ID NO:8 and SEQ ID NQ:20, SEQ ID NO:9 and SEQ ID NO:21 , SEQ ID NQ:10 and SEQ ID NO:22, SEQ ID NO:1 1 and SEQ ID NO:23; and SEQ ID NO:12 and SEQ ID NO:24. 88.
  • nucleic acid molecule according to any one of embodiments 55-83, wherein the nucleic acid molecule comprises a first strand and a second strand consisting a pair of sequences selected from the list consisting of: SEQ ID NO:7 and SEQ ID NO:19, SEQ ID NO:8 and SEQ ID NQ:20, SEQ ID NO:9 and SEQ ID NO:21 , SEQ ID NQ:10 and SEQ ID NO:22, SEQ ID NO:1 1 and SEQ ID NO:23; and SEQ ID NO:12 and SEQ ID NO:24.
  • nucleic acid molecule according to any one of embodiments 55-83, wherein the nucleic acid molecule consists of a first strand and a second strand consisting a pair of sequences selected from the list consisting of: SEQ ID NO:7 and SEQ ID NO:19, SEQ ID NO:8 and SEQ ID NQ:20, SEQ ID NO:9 and SEQ ID NO:21 , SEQ ID NQ:10 and SEQ ID NO:22, SEQ ID NO:1 1 and SEQ ID NO:23; and SEQ ID NO:12 and SEQ ID NO:24.
  • nucleic acid molecule according to any one of embodiments 55-83, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:27 and SEQ ID NO:33, SEQ ID NO:28 and SEQ ID NO:34, SEQ ID NO:29 and SEQ ID NO:35, SEQ ID NQ:30 and SEQ ID NO:36, SEQ ID NO:31 and SEQ ID NO:37; and SEQ ID NO:32 and SEQ ID NO:38.
  • nucleic acid molecule according to any one of embodiments 55-83, wherein the nucleic acid molecule comprises a first strand and a second strand consisting a pair of sequences selected from the list consisting of: SEQ ID NO:27 and SEQ ID NO:33, SEQ ID NO:28 and SEQ ID NO:34, SEQ ID NO:29 and SEQ ID NO:35, SEQ ID NQ:30 and SEQ ID NO:36, SEQ ID NO:31 and SEQ ID NO:37; and SEQ ID NO:32 and SEQ ID NO:38.
  • nucleic acid molecule according to any one of embodiments 55-83, wherein the nucleic acid molecule consists of a first strand and a second strand consisting a pair of sequences selected from the list consisting of: SEQ ID NO:27 and SEQ ID NO:33, SEQ ID NO:28 and SEQ ID NO:34, SEQ ID NO:29 and SEQ ID NO:35, SEQ ID NQ:30 and SEQ ID NO:36, SEQ ID NO:31 and SEQ ID NO:37; and SEQ ID NO:32 and SEQ ID NO:38.
  • nucleic acid molecule according to any one of embodiments 55-83, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:39 and SEQ ID NO:45, SEQ ID NQ:40 and SEQ ID NO:46, SEQ ID NO:41 and SEQ ID NO:47, SEQ ID NO:42 and SEQ ID NO:48, SEQ ID NO:43 and SEQ ID NO:49; and SEQ ID NO:44 and SEQ ID NQ:50.
  • nucleic acid molecule according to any one of embodiments 55-83, wherein the nucleic acid molecule comprises a first strand and a second strand consisting a pair of sequences selected from the list consisting of: SEQ ID NO:39 and SEQ ID NO:45, SEQ ID NQ:40 and SEQ ID NO:46, SEQ ID NO:41 and SEQ ID NO:47, SEQ ID NO:42 and SEQ ID NO:48, SEQ ID NO:43 and SEQ ID NO:49; and SEQ ID NO:44 and SEQ ID NQ:50. 95.
  • nucleic acid molecule according to any one of embodiments 55-83, wherein the nucleic acid molecule consists of a first strand and a second strand consisting a pair of sequences selected from the list consisting of: SEQ ID NO:39 and SEQ ID NO:45, SEQ ID NO:40 and SEQ ID NO:46, SEQ ID NO:41 and SEQ ID NO:47, SEQ ID NO:42 and SEQ ID NO:48, SEQ ID NO:43 and SEQ ID NO:49; and SEQ ID NO:44 and SEQ ID NQ:50.
  • nucleic acid molecule according to any one of embodiments 55-83, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:51 and SEQ ID NO:57, SEQ ID NO:52 and SEQ ID NO:58, SEQ ID NO:53 and SEQ ID NO:59, SEQ ID NO:54 and SEQ ID NQ:60, SEQ ID NO:55 and SEQ ID NO:61 ; and SEQ ID NO:56 and SEQ ID NO:62.
  • nucleic acid molecule according to any one of embodiments 55-83, wherein the nucleic acid molecule comprises a first strand and a second strand consisting a pair of sequences selected from the list consisting of: SEQ ID NO:51 and SEQ ID NO:57, SEQ ID NO:52 and SEQ ID NO:58, SEQ ID NO:53 and SEQ ID NO:59, SEQ ID NO:54 and SEQ ID NQ:60, SEQ ID NO:55 and SEQ ID NO:61 ; and SEQ ID NO:56 and SEQ ID NO:62.
  • nucleic acid molecule according to any one of embodiments 55-83, wherein the nucleic acid molecule consists of a first strand and a second strand consisting a pair of sequences selected from the list consisting of: SEQ ID NO:51 and SEQ ID NO:57, SEQ ID NO:52 and SEQ ID NO:58, SEQ ID NO:53 and SEQ ID NO:59, SEQ ID NO:54 and SEQ ID NQ:60, SEQ ID NO:55 and SEQ ID NO:61 ; and SEQ ID NO:56 and SEQ ID NO:62.
  • nucleic acid molecule according to any one of embodiments 55-83, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:63 and SEQ ID NO:69, SEQ ID NO:64 and SEQ ID NQ:70, SEQ ID NO:65 and SEQ ID NO:71 , SEQ ID NO:66 and SEQ ID NO:72, SEQ ID NO:67 and SEQ ID NO:73; and SEQ ID NO:68 and SEQ ID NO:74.
  • nucleic acid molecule according to any one of embodiments 55-83, wherein the nucleic acid molecule comprises a first strand and a second strand consisting a pair of sequences selected from the list consisting of: SEQ ID NO:63 and SEQ ID NO:69, SEQ ID NO:64 and SEQ ID NQ:70, SEQ ID NO:65 and SEQ ID NO:71 , SEQ ID NO:66 and SEQ ID NO:72, SEQ ID NO:67 and SEQ ID NO:73; and SEQ ID NO:68 and SEQ ID NO:74.
  • nucleic acid molecule according to any one of embodiments 55-83, wherein the nucleic acid molecule consists of a first strand and a second strand consisting a pair of sequences selected from the list consisting of: SEQ ID NO:63 and SEQ ID NO:69, SEQ ID NO:64 and SEQ ID NQ:70, SEQ ID NO:65 and SEQ ID NO:71 , SEQ ID NO:66 and SEQ ID NO:72, SEQ ID NO:67 and SEQ ID NO:73; and SEQ ID NO:68 and SEQ ID NO:74. .
  • nucleic acid molecule according to any one of embodiments 55-83, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:75 and SEQ ID NO:81 , SEQ ID NO:76 and SEQ ID NO:82, SEQ ID NO:77 and SEQ ID NO:83, SEQ ID NO:78 and SEQ ID NO:84, SEQ ID NO:79 and SEQ ID NO:85; and SEQ ID NQ:80 and SEQ ID NO:86. .
  • nucleic acid molecule according to any one of embodiments 55-83, wherein the nucleic acid molecule comprises a first strand and a second strand consisting a pair of sequences selected from the list consisting of: SEQ ID NO:75 and SEQ ID NO:81 , SEQ ID NO:76 and SEQ ID NO:82, SEQ ID NO:77 and SEQ ID NO:83, SEQ ID NO:78 and SEQ ID NO:84, SEQ ID NO:79 and SEQ ID NO:85; and SEQ ID NQ:80 and SEQ ID NO:86. .
  • nucleic acid molecule according to any one of embodiments 55-83, wherein the nucleic acid molecule consists of a first strand and a second strand consisting a pair of sequences selected from the list consisting of: SEQ ID NO:75 and SEQ ID NO:81 , SEQ ID NO:76 and SEQ ID NO:82, SEQ ID NO:77 and SEQ ID NO:83, SEQ ID NO:78 and SEQ ID NO:84, SEQ ID NO:79 and SEQ ID NO:85; and SEQ ID NQ:80 and SEQ ID NO:86.
  • a compound comprising a nucleic acid molecule according to any preceding embodiment and a targeting moiety.
  • the targeting moiety comprises a lipid nanoparticle, a liposome, an exosome, an antibody or fragment thereof, an antigen binding domain or fragment thereof, a peptide, a cell-penetrating peptide, a conjugate group, or any combination thereof.
  • the targeting moiety comprises a conjugate group and wherein the conjugate group comprises one or more carbohydrates.
  • the conjugate group comprises a monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, polysaccharide, modified polysaccharide, mannose, galactose, a mannose derivative, a galactose derivative, D-mannopyranose, L-Mannopyranose, D-Arabinose, L-Galactose, D- xylofuranose, L-xylofuranose, D-glucose, L-glucose, D-Galactose, L-Galactose, a-D- Mannofuranose, p-D-Mannofuranose, a-D-Mannopyranose, p-D-Mannopyranose, a-D- Glucopyranose, p-D-Glucopyranose, a-D-Glucofuranose, p-D-Gluco
  • nucleic acid molecule or compound according to any preceding embodiment wherein at least one nucleoside comprises a modified sugar.
  • nucleic acid molecule or compound according to any preceding embodiment wherein at least one internucleoside linkage is a modified internucleoside linkage.
  • nucleic acid molecule or compound according to embodiment 114 or 115 comprising 1 to 40 phosphorothioate or phosphorodithioate internucleoside linkages.
  • nucleic acid molecule or compound according to embodiment 114 or 115 comprising 1 to 30 phosphorothioate or phosphorodithioate internucleoside linkages.
  • nucleic acid molecule or compound according to embodiment 114 or 115 comprising 1 to 20 phosphorothioate or phosphorodithioate internucleoside linkages.
  • nucleic acid molecule or compound according to embodiment 114 or 115 comprising 1 to 10 phosphorothioate or phosphorodithioate internucleoside linkages.
  • nucleic acid molecule specifically targets a DNA sequence selected from the list consisting of SEQ ID NO:89 (GNAQ c.548G>A_p.R183Q), SEQ ID NO:91 GNAQ c.547C>G_p.R183G), SEQ ID NO:93 (GNAQ c.548G>T_p.R183L), SEQ ID NO:95 (GNAQ c.547C>T_p.R183*), SEQ ID NO:99 (GNA11 c.547C>T_p.R183C), SEQ ID NO: 101 (GNA11 c.546_547delinsTT_p.R183C) and SEQ ID NO: 103 (GNA11 c.548G>A_p.R183H).
  • SEQ ID NO:89 GNAQ c.548G>A_p.R183Q
  • SEQ ID NO:91 GNAQ c.547C>G_p.R183G
  • SEQ ID NO:93
  • a composition comprising the single-stranded nucleic acid molecule or compound according to any preceding embodiment or salt thereof and at least one of a pharmaceutically acceptable carrier or diluent.
  • a prodrug comprising the nucleic acid molecule or compound of any of embodiments 1 to 120.
  • a nucleic acid molecule comprising a nucleotide sequence encoding a CRISPR guide RNA (gRNA), wherein the gRNA hybridizes with a target sequence in a cell and wherein the target sequence encodes a variant allele of GNAQ or GNA11.
  • gRNA CRISPR guide RNA
  • a CRISPR nuclease system comprising one or more vectors comprising:
  • a promoter operably linked to at least one nucleotide sequence encoding a CRISPR guide RNA (gRNA), wherein the gRNA hybridizes a target DNA sequence in a cell of the subject, and wherein the target sequence encodes a variant allele of GNAQ or GNA11 and
  • a nucleotide sequence encoding a nuclease for example a Cas nuclease, wherein components (a) and (b) are located on the same or different vectors of the system, wherein the gRNA targets and hybridizes with the target DNA sequence and the nuclease cleaves the target sequence to alter expression of the variant allele of GNAQ or GNA 11.
  • the CRISPR nuclease system according to embodiment 124 where in the system is packaged into a single adeno-associated virus (AAV) particle.
  • AAV adeno-associated virus
  • the CRISPR nuclease system according to any one of embodiments 124 or 125, wherein the nuclease is codon optimized for expression in the cell. .
  • the CRISPR nuclease system according to any one of embodiments 124-126, wherein the promoter is operably linked to at least one, two, three, four, five, six, seven, eight, nine, or ten gRNA. .
  • 129 The CRISPR nuclease system according to any one of embodiments 124-128, wherein the gRNA targets a DNA sequence encoding variant GNA11 p.(R183C) or p.(R183H).
  • a method of treating a patient having a disease or disorder associated with or driven by variants in GNAQ and/or GNA11 comprising administering to the patient a nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to any one of embodiments 1-129.
  • SWS Sturge-Weber syndrome
  • PV Phakomatosis Pigmentovascularis
  • EDM Extensive Dermal Melanocytosis
  • a method of treating a patient having a congenital hemangioma comprising administering to the patient a nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to any one of embodiments 1-129.
  • congenital hemangioma is a rapidly involuting congenital hemangioma (RICH), a partially involuting congenital hemangioma (PICH) or a non-involuting congenital hemangioma (NICH).
  • RICH rapidly involuting congenital hemangioma
  • PICH partially involuting congenital hemangioma
  • NICH non-involuting congenital hemangioma
  • a method of treating a patient having cancer comprising administering to the patient a nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to any one of embodiments 1-129.
  • a method according to embodiment 230 wherein the cancer is selected from the list consisting of: Adrenal gland cancer, Autonomic ganglia cancer, Biliary tract cancer, Bone cancer, Breast cancer, Central nervous system cancer, Cervix cancer, Endometrium cancer, Eye cancer, Fallopian tube cancer, Female genital tract cancer, Gastrointestinal tract cancer, Genital tract cancer, Haematopoietic cancer, lymphoid cancer, Kidney cancer, Large intestine cancer, Liver cancer, Lung cancer, Meninges cancer, NS cancer, Oesophagus cancer, Ovary cancer, Pancreas cancer, Parathyroid cancer, Penis cancer, Perineum cancer, Peritoneum cancer, Pituitary cancer, Placenta cancer, Pleura cancer, Prostate cancer, Salivary gland cancer, Skin cancer, Small intestine cancer, Soft tissue cancer, Stomach cancer, Testis cancer, Thymus cancer, Thyroid cancer, Upper aerodigestive tract cancer, Urinary tract cancer, Uterine adnex
  • a method of treating a patient having melanoma comprising administering to the patient a nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to any one of embodiments 1-129.
  • a nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to any one of embodiments 1-129 for use in a method of treating a patient having a congenital hemangioma, the method comprising administering to the patient a nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to any one of embodiments 1-129. .
  • RICH rapidly involuting congenital hemangioma
  • PICH partially involuting congenital hemangioma
  • NICH non-involuting congenital hemangioma
  • a nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to any one of embodiments 1-129 for use in a method of treating cancer in a patient in need thereof, the method comprising, administering to the patient a nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to any one of embodiments 1-129.
  • a nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to any one of embodiments 1-129 for use in a method of treating melanoma in a patient in need thereof, the method comprising, administering to the patient a nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to any one of embodiments 1-129.
  • An expression construct comprising a nucleic acid molecule encoding the nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to any one of embodiments 1-129.
  • a vector comprising the isolated nucleic acid molecule of embodiment 144. 146.
  • the vector of embodiment 144 which is a viral vector, retroviral vector, expression cassette, or plasmid.
  • invention 147 The vector of embodiment 144 or embodiment 145, further comprising an RNA Polymerase III or RNA Polymerase II promoter.
  • RNA Polymerase III promoter is the U6 or H1 promoter.
  • a host cell comprising the nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to any one of embodiments 1 -129, the isolated nucleic acid molecule according to embodiment 144 or vector according to any one of embodiments 145 to 148.
  • the host cell of embodiment 149 which is a mammalian host cell.
  • the host cell of embodiment 149 or embodiment 150 which is a human host cell.
  • nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system for use according to any one of embodiments 130-142 wherein the nucleic acid molecule, compound, composition or prodrug is formulated for delivery with a lipid-based nanoparticle, a liposome, an exosome, a polymeric nanoparticle, an inorganic nanoparticle or a ruxolitinib and thalidomide co-delivered polyelectrolyte nanocomplex (RTNP).
  • lipid-based nanoparticle a liposome, an exosome, a polymeric nanoparticle, an inorganic nanoparticle or a ruxolitinib and thalidomide co-delivered polyelectrolyte nanocomplex (RTNP).
  • RTNP thalidomide co-delivered polyelectrolyte nanocomplex
  • nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system for use according to any one of embodiments 130-142 wherein the nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system is not packaged for delivery (gymnotic delivery).
  • nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system for use according to any one of embodiments 130-142 or 254-257 wherein the nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system is administered by injection.
  • nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system for use according to any one of embodiments 130-142 or 254-258, wherein the nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system is injected using a microneedle.
  • DCA docosanoic acid
  • nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system for use according to any one of embodiments 130-142 or 254-262, wherein the nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system is formulated for delivery with a lipid-based nanoparticle and is injected using a microneedle.
  • nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system for use according to any one of embodiments 130-142 or 254-262, wherein the nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system is conjugated to docosanoic acid (DCA) and is injected using a microneedle.
  • DCA docosanoic acid
  • a double-stranded ribonucleic acid molecule comprising a sense strand consisting of 15 to 30 linked nucleosides and an antisense strand consisting of 15 to 30 linked nucleosides, wherein the antisense strand comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of a pregenomic RNA and/or an mRNA encoding gain-of-function variant of GNAQ or a gain-of-function variant of GNA11 and wherein the sense strand is at least partially complementary to the antisense strand.
  • a double-stranded ribonucleic acid molecule comprising a sense strand consisting of 15 to 30 linked nucleosides and an antisense strand consisting of 15 to 30 linked nucleosides, wherein the antisense strand comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of a pregenomic RNA and/or an mRNA encoding variant GNAQ or variant GNA11 and wherein the sense strand is at least partially complementary to the antisense strand.
  • a double-stranded ribonucleic acid molecule comprising a sense strand consisting of 15 to 30 linked nucleosides and an antisense strand consisting of 15 to 30 linked nucleosides, wherein the antisense strand comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of a pregenomic RNA and/or an mRNA encoding variant GNAQ p.(R183Q) or variant GNA11 p.(R183C) and wherein the sense strand is at least partially complementary to the antisense strand.
  • a double-stranded ribonucleic acid molecule comprising a sense strand consisting of 15 to 30 linked nucleosides and an antisense strand consisting of 15 to 30 linked nucleosides, wherein the antisense strand comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of a pregenomic RNA and/or an mRNA encoding variant GNAQ p.(R183Q) and wherein the sense strand is at least partially complementary to the antisense strand.
  • a double-stranded ribonucleic acid molecule comprising a sense strand consisting of 15 to 30 linked nucleosides and an antisense strand consisting of 15 to 30 linked nucleosides, wherein the antisense strand comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of a pregenomic RNA and/or an mRNA encoding variant GNA11 p.(R183C) and wherein the sense strand is at least partially complementary to the antisense strand.
  • the antisense strand comprises a sequence that is fully complementary to a sequence having at least 95% identity to an equal length portion of a pregenomic RNA and/or an mRNA encoding variant GNAQ p.(R183Q) or GNA11 p.(R183C).
  • the antisense strand comprises a sequence that is fully complementary to a sequence having 100% identity to an equal length portion of a pregenomic RNA and/or an mRNA encoding variant GNAQ p.(R183Q) or GNA11 p.(R183C).
  • GNAQ R183Q variant is caused by a C.G548A mutation in the GNAQ genomic sequence.
  • the double-stranded ribonucleic acid molecule according to any preceding embodiment having an overhang at the 3’ end of the antisense strand of 1 , 2, 3, 4, 5 or more nucleosides.
  • the double-stranded ribonucleic acid molecule according to any preceding embodiment having an overhang at the 5’ end of the antisense strand of 1 , 2, 3, 4, 5 or more nucleosides.
  • the double-stranded ribonucleic acid molecule according to embodiment 191 having an overhang at the 3’ end of the sense strand of 1 , 2, 3, 4, 5 or more nucleosides.
  • the sense strand comprises a nucleobase sequence comprising any one of SEQ ID NO:1 (UGCUUAGAGUUCAAGUCCC), SEQ ID NO:2 (GCUUAGAGUUCAAGUCCCC), SEQ ID NO:3 (CUUAGAGUUCAAGUCCCCA), SEQ ID NO:4 (UUAGAGUUCAAGUCCCCAC), SEQ ID NO:5 (UAGAGUUCAAGUCCCCACC), SEQ ID NO:6 (AGAGUUCAAGUCCCCACCA), SEQ ID NO:7 (GUGCUGCGGGUCUGCGUGC), SEQ ID NO:8 (UGCUGCGGGUCUGCGUGCC), SEQ ID NO:9 (GCUGCGGGUCUGCGUGCCC), SEQ ID NQ:10 (CUGCGGGUCUGCGUGCCCA), SEQ ID NO:11 (UGCGGGUCUGCGUGCCCAC) or SEQ ID NO:12 (CGGGUCUGC
  • the double-stranded ribonucleic acid molecule according to any preceding embodiment, wherein the sense strand consists of a nucleobase sequence having any one of SEQ ID NO:1 (UGCUUAGAGUUCAAGUCCC), SEQ ID NO:2 (GCUUAGAGUUCAAGUCCCC), SEQ ID NO:3 (CUUAGAGUUCAAGUCCCCA), SEQ ID NO:4 (UUAGAGUUCAAGUCCCCAC), SEQ ID NO:5 (UAGAGUUCAAGUCCCCACC), SEQ ID NO:6 (AGAGUUCAAGUCCCCACCA), SEQ ID NO:7 (GUGCUGCGGGUCUGCGUGC), SEQ ID NO:8 (UGCUGCGGGUCUGCGUGCC), SEQ ID NO:9 (GCUGCGGGUCUGCGUGCCC), SEQ ID NQ:10 (CUGCGGGUCUGCGUGCCCA), SEQ ID NO:11 (UGCGGGUCUGCGUGCCCAC) or SEQ ID NO:12 (CGGGUCUGCGU
  • the antisense strand comprises a nucleobase sequence comprising any one of SEQ ID NO:13 (GGGACUUGAACUCUAAGCA), SEQ ID NO:14 (GGGGACUUGAACUCUAAGC), SEQ ID NO:15 (UGGGGACUUGAACUCUAAG), SEQ ID NO:16 (GUGGGGACUUGAACUCUAA), SEQ ID NO:17 (GGUGGGGACUUGAACUCUA), SEQ ID NO:18 (UGGUGGGGACUUGAACUCU), SEQ ID NO:19 (GCACGCAGACCCGCAGCAC), SEQ ID NO:20 (GGCACGCAGACCCGCAGCA), SEQ ID NO:21 (GGGCACGCAGACCCGCAGC), SEQ ID NO:22 (UGGGCACGCAGACCCGCAG), SEQ ID NO:23 (GUGGGCACGCAGACCCGCA), SEQ ID NO:24 (UGGUGGGCACGCAGACCCG).
  • the double-stranded ribonucleic acid molecule according to any preceding embodiment, wherein the antisense strand comprises a nucleobase sequence comprising any one of SEQ ID NO:13 (GGGACUUGAACUCUAAGCA) or SEQ ID NO:15 (UGGGGACUUGAACUCUAAG).
  • the double-stranded ribonucleic acid molecule according to any preceding embodiment, wherein the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:22 (UGGGCACGCAGACCCGCAG).
  • the double-stranded ribonucleic acid molecule according to any preceding embodiment, wherein the antisense strand consists of a nucleobase sequence having any one of SEQ ID NO:13 (GGGACUUGAACUCUAAGCA), SEQ ID NO:14 (GGGGACUUGAACUCUAAGC), SEQ ID NO:15 (UGGGGACUUGAACUCUAAG), SEQ ID NO:16 (GUGGGGACUUGAACUCUAA), SEQ ID NO:17 (GGUGGGGACUUGAACUCUA), SEQ ID NO:18 (UGGUGGGGACUUGAACUCU), SEQ ID NO:19 (GCACGCAGACCCGCAGCAC), SEQ ID NQ:20 (GGCACGCAGACCCGCAGCA), SEQ ID NO:21 (GGGCACGCAGACCCGCAGC), SEQ ID NO:22 (UGGGCACGCAGACCCGCAG), SEQ ID NO:23 (GUGGGCACGCAGACCCGCA), SEQ ID NO:24 (UGGUGGGCAC
  • the double-stranded ribonucleic acid molecule according to any preceding embodiment, wherein the antisense strand consists of a nucleobase sequence having any one of SEQ ID NO:13 (GGGACUUGAACUCUAAGCA) or SEQ ID NO:15 (UGGGGACUUGAACUCUAAG).
  • the double-stranded ribonucleic acid molecule according to any preceding embodiment, wherein the antisense strand consists of a nucleobase sequence having SEQ ID NO:22 (UGGGCACGCAGACCCGCAG).
  • the sense strand comprises a nucleobase sequence comprising SEQ ID NO:1 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:13; b. the sense strand comprises a nucleobase sequence comprising SEQ ID NO:2 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:14; c. the sense strand comprises a nucleobase sequence comprising SEQ ID NO:3 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:15; d.
  • the sense strand comprises a nucleobase sequence comprising SEQ ID NO:4 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:16; e. the sense strand comprises a nucleobase sequence comprising SEQ ID NO:5 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:17; f. the sense strand comprises a nucleobase sequence comprising SEQ ID NO:6 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:18; g. the sense strand comprises a nucleobase sequence comprising SEQ ID NO:7 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:19; h.
  • the sense strand comprises a nucleobase sequence comprising SEQ ID NO:8 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NQ:20; i. the sense strand comprises a nucleobase sequence comprising SEQ ID NO:9 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:21 ; j. the sense strand comprises a nucleobase sequence comprising SEQ ID NQ:10 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:22; k. the sense strand comprises a nucleobase sequence comprising SEQ ID NO:11 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:23; or l. the sense strand comprises a nucleobase sequence comprising SEQ ID NO:12 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:24.
  • the sense strand comprises a nucleobase sequence comprising SEQ ID NO:1 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:13; or b. the sense strand comprises a nucleobase sequence comprising SEQ ID NO:3 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:15.
  • the double-stranded ribonucleic acid molecule according to any preceding embodiment, wherein: a. the sense strand comprises a nucleobase sequence comprising SEQ ID NQ:10 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:22.
  • the sense strand comprises a nucleobase sequence consists of SEQ ID NO:1 and the antisense strand comprises a nucleobase sequence consists of SEQ ID NO:13; b. the sense strand comprises a nucleobase sequence consists of SEQ ID NO:2 and the antisense strand comprises a nucleobase sequence consists of SEQ ID NO:14; c. the sense strand comprises a nucleobase sequence consists of SEQ ID NO:3 and the antisense strand comprises a nucleobase sequence consists of SEQ ID NO:15; d.
  • the sense strand comprises a nucleobase sequence consists of SEQ ID NO:4 and the antisense strand comprises a nucleobase sequence consists of SEQ ID NO:16; e. the sense strand comprises a nucleobase sequence consists of SEQ ID NO:5 and the antisense strand comprises a nucleobase sequence consists of SEQ ID NO:17; f. the sense strand comprises a nucleobase sequence consists of SEQ ID NO:6 and the antisense strand comprises a nucleobase sequence consists of SEQ ID NO:18; g.
  • the sense strand comprises a nucleobase sequence consists of SEQ ID NO:7 and the antisense strand comprises a nucleobase sequence consists of SEQ ID NO:19; h. the sense strand comprises a nucleobase sequence consists of SEQ ID NO:8 and the antisense strand comprises a nucleobase sequence consists of SEQ ID NQ:20; i. the sense strand comprises a nucleobase sequence consists of SEQ ID NO:9 and the antisense strand comprises a nucleobase sequence consists of SEQ ID NO:21 ; j.
  • the sense strand comprises a nucleobase sequence consists of SEQ ID NO:10 and the antisense strand comprises a nucleobase sequence consists of SEQ ID NO:22; k. the sense strand comprises a nucleobase sequence consists of SEQ ID NO:11 and the antisense strand comprises a nucleobase sequence consists of SEQ ID NO:23; or l. the sense strand comprises a nucleobase sequence consists of SEQ ID NO:12 and the antisense strand comprises a nucleobase sequence consists of SEQ ID NO:24.
  • the double-stranded ribonucleic acid molecule according to any preceding embodiment, wherein: a.
  • the sense strand comprises a nucleobase sequence consists of SEQ ID NO:1 and the antisense strand comprises a nucleobase sequence consists of SEQ ID NO:13; or b. the sense strand comprises a nucleobase sequence consists of SEQ ID NO:3 and the antisense strand comprises a nucleobase sequence consists of SEQ ID NO:15.
  • the double-stranded ribonucleic acid molecule according to any preceding embodiment, wherein: a. the sense strand comprises a nucleobase sequence consists of SEQ ID NO:10 and the antisense strand comprises a nucleobase sequence consists of SEQ ID NO:22.
  • the conjugate group comprises one or more carbohydrates.
  • the conjugate group comprises a monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, polysaccharide, modified polysaccharide, mannose, galactose, a mannose derivative, a galactose derivative, D-mannopyranose, L-Mannopyranose, D-Arabinose, L- Galactose, D-xylofuranose, L-xylofuranose, D-glucose, L-glucose, D-Galactose, L-Galactose, a-D-Mannofuranose, p-D-Mannofuranose, a-D
  • composition comprising the double-stranded ribonucleic acid molecule or compound according to any preceding embodiment or salt thereof and at least one of a pharmaceutically acceptable carrier or diluent.
  • a prodrug comprising the double-stranded ribonucleic acid molecule or compound of any of embodiments 1 to 224.
  • a method of treating a patient having a disease or disorder associated with or driven by variants in GNAQ and/or GNA11 comprising administering to the patient a compound or composition that specifically targets the variant GNAQ and/or GNA11 allele.
  • a method of treating a patient having a disease or disorder associated with or driven by variants in GNAQ and/or GNA11 comprising administering to the patient a doublestranded ribonucleic acid molecule or compound according to any one of embodiments 1 to 224 a composition according to embodiment 225 or a prodrug according to embodiment 226.
  • SWS Sturge-Weber syndrome
  • PV Phakomatosis Pigmentovascularis
  • EDM Extensive Dermal Melanocytosis
  • a method of treating a patient having cancer comprising administering to the patient a double-stranded ribonucleic acid molecule or compound according to any one of embodiments 1 to 224, a composition according to embodiment 225 or a prodrug according to embodiment 226.
  • a method according to embodiment 230 wherein the cancer is selected from the list consisting of: Adrenal gland cancer, Autonomic ganglia cancer, Biliary tract cancer, Bone cancer, Breast cancer, Central nervous system cancer, Cervix cancer, Endometrium cancer, Eye cancer, Fallopian tube cancer, Female genital tract cancer, Gastrointestinal tract cancer, Genital tract cancer, Haematopoietic cancer, lymphoid cancer, Kidney cancer, Large intestine cancer, Liver cancer, Lung cancer, Meninges cancer, NS cancer, Oesophagus cancer, Ovary cancer, Pancreas cancer, Parathyroid cancer, Penis cancer, Perineum cancer, Peritoneum cancer, Pituitary cancer, Placenta cancer, Pleura cancer, Prostate cancer, Salivary gland cancer, Skin cancer, Small intestine cancer, Soft tissue cancer, Stomach cancer, Testis cancer, Thymus cancer, Thyroid cancer, Upper aerodigestive tract cancer, Urinary tract cancer, Uterine ad
  • a method of treating a patient having melanoma comprising administering to the patient a double-stranded ribonucleic acid molecule or compound according to any one of embodiments 1 to 224, a composition according to embodiment 225 or a prodrug according to embodiment 226.
  • SWS Sturge-Weber syndrome
  • PV Phakomatosis Pigmentovascularis
  • EDM Extensive Dermal Melanocytosis
  • SWS Sturge-Weber syndrome
  • PV Phakomatosis Pigmentovascularis
  • EDM Extensive Dermal Melanocytosis
  • a method of treating a patient having melanoma comprising administering to the patient a compound or composition that specifically targets a variant allele of GNAQ and/or GNA11.
  • An expression construct comprising a nucleic acid molecule encoding the doublestranded ribonucleic acid molecule or compound according to any one of embodiments 1 to 224.
  • a vector comprising the isolated nucleic acid molecule of embodiment 246.
  • the vector of embodiment 247 which is a viral vector, retroviral vector, expression cassette, or plasmid.
  • a host cell comprising the double-stranded ribonucleic acid molecule or compound according to any one of embodiments 1 to 224, isolated nucleic acid molecule according to embodiment 246 or vector according to any one of embodiments 247 to 250.
  • the host cell of embodiment 251 which is a mammalian host cell. .
  • the host cell of embodiment 251 or embodiment 252 which is a human host cell..
  • a lipid- based nanoparticle a liposome, an exosome, a polymeric nanoparticle, an inorganic nanoparticle or a ruxolitinib and thalidomide co-delivered polyelectrolyte nanocomplex (RTNP).
  • DCA docosanoic acid
  • DCA docosanoic acid
  • nucleic acid molecule, compound, composition, prodrug for use according to any one of embodiments 164-244 or 254-261 , wherein the nucleic acid molecule, compound, composition, prodrug is administered topically.

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Epidemiology (AREA)
  • Dermatology (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicinal Preparation (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
PCT/EP2023/055817 2022-03-07 2023-03-07 Methods of treatment of gnaq and gna11 driven disease Ceased WO2023170109A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
US18/844,507 US20250230435A1 (en) 2022-03-07 2023-03-07 Methods of treatment of gnaq and gna11 driven disease
AU2023232895A AU2023232895A1 (en) 2022-03-07 2023-03-07 Methods of treatment of gnaq and gna11 driven disease
EP23710004.5A EP4490290A1 (en) 2022-03-07 2023-03-07 Methods of treatment of gnaq and gna11 driven disease
JP2024553192A JP2025509242A (ja) 2022-03-07 2023-03-07 Gnaq及びgna11駆動疾患の治療方法
CN202380026446.9A CN118843690A (zh) 2022-03-07 2023-03-07 治疗gnaq和gna11驱动的疾病的方法

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
GB2203164.5 2022-03-07
GBGB2203164.5A GB202203164D0 (en) 2022-03-07 2022-03-07 Methods of treatment of gnaq and gna11 mosaicism
GBGB2203233.8A GB202203233D0 (en) 2022-03-08 2022-03-08 Methods of treatment of GNAQ and GNA11 driven disease
GB2203233.8 2022-03-08

Publications (1)

Publication Number Publication Date
WO2023170109A1 true WO2023170109A1 (en) 2023-09-14

Family

ID=85556425

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2023/055817 Ceased WO2023170109A1 (en) 2022-03-07 2023-03-07 Methods of treatment of gnaq and gna11 driven disease

Country Status (5)

Country Link
US (1) US20250230435A1 (cg-RX-API-DMAC7.html)
EP (1) EP4490290A1 (cg-RX-API-DMAC7.html)
JP (1) JP2025509242A (cg-RX-API-DMAC7.html)
AU (1) AU2023232895A1 (cg-RX-API-DMAC7.html)
WO (1) WO2023170109A1 (cg-RX-API-DMAC7.html)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2025245193A1 (en) * 2024-05-21 2025-11-27 The University Of North Carolina At Chapel Hill Methods and compositions for inhibition of mutant gnaq and gna11

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010068816A1 (en) * 2008-12-10 2010-06-17 Alnylam Pharmaceuticals, Inc. Gnaq targeted dsrna compositions and methods for inhibiting expression
WO2014172434A1 (en) * 2013-04-16 2014-10-23 The Johns Hopkins University Diagnostic and prognostic test for sturge-weber syndrome, klippel-trenaunay-weber syndrome, and port-wine stains (pwss)
CN105218668A (zh) * 2015-10-30 2016-01-06 山东农业大学 马耳他型布氏杆菌的EF-Tu蛋白单克隆抗体MAb及其制备方法与应用
WO2020097023A1 (en) * 2018-11-06 2020-05-14 Memorial Sloan Kettering Cancer Center METHODS AND COMPOSITIONS FOR TREATING ACTIVATED GαQ MUTANT CANCERS OR MELANOCYTIC MALIGNANCIES

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010068816A1 (en) * 2008-12-10 2010-06-17 Alnylam Pharmaceuticals, Inc. Gnaq targeted dsrna compositions and methods for inhibiting expression
WO2014172434A1 (en) * 2013-04-16 2014-10-23 The Johns Hopkins University Diagnostic and prognostic test for sturge-weber syndrome, klippel-trenaunay-weber syndrome, and port-wine stains (pwss)
CN105218668A (zh) * 2015-10-30 2016-01-06 山东农业大学 马耳他型布氏杆菌的EF-Tu蛋白单克隆抗体MAb及其制备方法与应用
WO2020097023A1 (en) * 2018-11-06 2020-05-14 Memorial Sloan Kettering Cancer Center METHODS AND COMPOSITIONS FOR TREATING ACTIVATED GαQ MUTANT CANCERS OR MELANOCYTIC MALIGNANCIES

Non-Patent Citations (44)

* Cited by examiner, † Cited by third party
Title
AYTURK UMCOUTO JAHANN S ET AL.: "Somatic Activating Mutations in GNAQ and GNA11 Are Associated with Congenital Hemangioma", AMERICAN JOURNAL OF HUMAN GENETICS, vol. 98, 2016, pages 789 - 95, XP029496615, DOI: 10.1016/j.ajhg.2016.03.009
COMI AM: "Sturge-Weber syndrome and epilepsy: an argument for aggressive seizure management in these patients", EXPERT REV NEUROTHER, vol. 7, 2007, pages 951 - 6
COOPER MSGITTOES NJ: "Diagnosis and management of hypocalcaemia", BMJ, vol. 336, 2008, pages 1298 - 302
DAY AMHAMMILL AMJUHASZ C ET AL.: "Hypothesis: Presymptomatic treatment of Sturge-Weber Syndrome With Aspirin and Antiepileptic Drugs May Delay Seizure Onset", PEDIATRIC NEUROLOGY, vol. 90, 2019, pages 8 - 12, XP085565077, DOI: 10.1016/j.pediatrneurol.2018.04.009
DI TRAPANI GDI ROCCO CABBAMONDI ALCALDARELLI MPOCCHIARI M: "Light microscopy and ultrastructural studies of Sturge-Weber disease", CHILDS BRAIN, vol. 9, 1982, pages 23 - 36
FJAER RMARCINIAK KSUNDNES O ET AL.: "A novel somatic mutation in GNB2 provides new insights to the pathogenesis of Sturge-Weber syndrome", HUMAN MOLECULAR GENETICS, vol. 30, 2021, pages 1919 - 31
FORBES SABEARE DGUNASEKARAN P ET AL.: "COSMIC: exploring the world's knowledge of somatic mutations in human cancer", NUCLEIC ACIDS RESEARCH, vol. 43, 2015, pages 805 - 11
GERASIMENKO JVGRYSHCHENKO OFERDEK PE ET AL.: "Ca2+ release-activated Ca2+ channel blockade as a potential tool in antipancreatitis therapy", PROC NATL ACAD SCI U S A, vol. 110, 2013, pages 13186 - 91, XP055541173, DOI: 10.1073/pnas.1300910110
GORVIN CMHANNAN FMHOWLES SA ET AL.: "Galpha11 mutation in mice causes hypocalcemia rectifiable by calcilytic therapy", JCI INSIGHT, vol. 2, 2017, pages e91103
GUSEO A: "Ultrastructure of calcification in Sturge-Weber Disease", VIRCHOWS ARCH A PATHOL ANAT HISTOL, vol. 366, 1975, pages 353 - 6
HAPPLE R: "Lethal genes surviving by mosaicism: a possible explanation for sporadic birth defects involving the skin", JOURNAL OF THE AMERICAN ACADEMY OF DERMATOLOGY, vol. 16, 1987, pages 899 - 906, XP022693641, DOI: 10.1016/S0190-9622(87)80249-9
HAPPLE R: "Phacomatosis pigmentovascularis revisited and reclassified", ARCHIVES OF DERMATOLOGY, vol. 141, 2005, pages 385 - 8
HART: "Multifunctional nanocomplexes for gene transfer and gene therapy", CELL BIOL TOXICOL, vol. 26, no. 1, February 2010 (2010-02-01), pages 69 - 81, XP019767528, DOI: 10.1007/s10565-009-9141-y
HASEGAWA YYASUHARA, M: "A variant of phakomatosis pigmentovascularis", SKIN RESEARCH, vol. 21, 1979, pages 178 - 86
HUANG LCOUTO JAPINTO A ET AL.: "Somatic GNAQ Mutation is Enriched in Brain Endothelial Cells in Sturge-Weber Syndrome", PEDIATR NEUROL, vol. 67, 2017, pages 59 - 63
HUGHES STEVEN ET AL: "Using siRNA to define functional interactions between melanopsin and multiple G Protein partners", CMLS CELLULAR AND MOLECULAR LIFE SCIENCES, BIRKHAUSER VERLAG, HEIDELBERG, DE, vol. 72, no. 1, 24 June 2014 (2014-06-24), pages 165 - 179, XP035417320, ISSN: 1420-682X, [retrieved on 20140624], DOI: 10.1007/S00018-014-1664-6 *
I. ARNAOUTOVAH. K. KLEINMAN: "In vitro angiogenesis: endothelial cell tube formation on gelled basement membrane extract", NAT PROTOC, vol. 5, 2010, pages 628 - 635
JORDAN MCARMIGNAC VSORLIN A ET AL.: "Reverse Phenotyping in Patients with Skin Capillary Malformations and Mosaic GNAQ or GNA11 Mutations Defines a Clinical Spectrum with Genotype-Phenotype Correlation", THE JOURNAL OF INVESTIGATIVE DERMATOLOGY, vol. 140, 2020, pages 1106 - 10
JUNG HYEON CHOJEONG YI KANGSEULGI KIMHWI RA BAEKJUNOH KIMKWANG-SUK JANGJIN WOONG KIM: "Skin protein-derived peptide-conjugated vesicular nanocargos for selected skin cell targeting and consequent activation", J MATER CHEM B, vol. 9, no. 24, 23 June 2021 (2021-06-23), pages 4956 - 4962, XP093031174, DOI: 10.1039/D1TB00935D
KELLEY TMHATFIELD LALIN DDCOMI AM: "Quantitative analysis of cerebral cortical atrophy and correlation with clinical severity in unilateral Sturge-Weber syndrome", J CHILD NEUROL, vol. 20, 2005, pages 867 - 70
KHOREV ET AL., BIOORGANIC AND MEDICINAL CHEMISTRY, vol. 16, no. 9, May 2008 (2008-05-01), pages 5216 - 5231
KINSLER VABOCCARA OFRAITAG STORRELO AVABRES PDIOCIAUTI A: "Mosaic abnormalities of the skin - review and guidelines from the European Reference Network for rare skin diseases (ERN-Skin", THE BRITISH JOURNAL OF DERMATOLOGY, 2019
KORHONEN HFISSLTHALER BMOERS A ET AL.: "Anaphylactic shock depends on endothelial Gq/G11", J EXP MED, vol. 206, 2009, pages 411 - 20
LI YONGYUN ET AL: "The oncolytic virus H101 combined with GNAQ siRNA-mediated knockdown reduces uveal melanoma cell viability", JOURNAL OF CELLULAR BIOCHEMISTRY, vol. 120, no. 4, 15 October 2018 (2018-10-15), Hoboken, USA, pages 5766 - 5776, XP093051660, ISSN: 0730-2312, Retrieved from the Internet <URL:https://onlinelibrary.wiley.com/doi/full-xml/10.1002/jcb.27863> DOI: 10.1002/jcb.27863 *
LIM YHBACCHIOCCHI AQIU J ET AL.: "GNA14 Somatic Mutation Causes Congenital and Sporadic Vascular Tumors by MAPK Activation", AMERICAN JOURNAL OF HUMAN GENETICS, vol. 99, 2016, pages 443 - 50, XP029670941, DOI: 10.1016/j.ajhg.2016.06.010
LIN DDBARKER PBHATFIELD LACOMI AM: "Dynamic MR perfusion and proton MR spectroscopic imaging in Sturge-Weber syndrome: correlation with neurological symptoms", J MAGN RESON IMAGING, vol. 24, 2006, pages 274 - 81
MICHELL RH: "Inositol phospholipids and cell surface receptor function", BIOCHIM BIOPHYS ACTA, vol. 415, 1975, pages 81 - 47, XP025785997, DOI: 10.1016/0304-4157(75)90017-9
MICHELL RHKIRK CJJONES LMDOWNES CPCREBA JA: "The stimulation of inositol lipid metabolism that accompanies calcium mobilization in stimulated cells: defined characteristics and unanswered questions", PHILOS TRANS R SOC LOND B BIOL SCI, vol. 296, 1981, pages 123 - 38
NESBIT MAHANNAN FMHOWLES SA ET AL.: "Mutations affecting G-protein subunit alpha1 1 in hypercalcemia and hypocalcemia", N ENGL J MED, vol. 368, 2013, pages 2476 - 86
NESBIT MAHANNAN FMHOWLES SA ET AL.: "Mutations affecting G-protein subunit alpha11 in hypercalcemia and hypocalcemia", THE NEW ENGLAND JOURNAL OF MEDICINE, vol. 368, 2013, pages 2476 - 86
PARK ET AL., PNAS, vol. 102, no. 47, 2005, pages 17125 - 17129
PILLI VKBEHEN MEHU J ET AL.: "Clinical and metabolic correlates of cerebral calcifications in Sturge-Weber syndrome", DEVELOPMENTAL MEDICINE AND CHILD NEUROLOGY, vol. 59, 2017, pages 952 - 8, XP071197644, DOI: 10.1111/dmcn.13433
POLUBOTHU SAL-OLABI LCARMEN DEL BOENTE M ET AL.: "GNA11 Mutation as a Cause of Sturge-Weber Syndrome: Expansion of the Phenotypic Spectrum of Galpha/11 Mosaicism and the Associated Clinical Diagnoses", THE JOURNAL OF INVESTIGATIVE DERMATOLOGY, vol. 140, 2020, pages 1110 - 3
POSCH CHRISTIAN ET AL: "Detection of GNAQ mutations and reduction of cell viability in uveal melanoma cells with functionalized gold nanoparticles", BIOMEDICAL MICRODEVICES, SPRINGER US, NEW YORK, vol. 17, no. 1, 31 January 2015 (2015-01-31), pages 1 - 9, XP035493645, ISSN: 1387-2176, [retrieved on 20150131], DOI: 10.1007/S10544-014-9908-7 *
POSCH CHRISTIAN ET AL: "Supporting information Detection of GNAQ Mutations and Reduction of Cell Viability in Uveal Melanoma Cells with Functionalized Gold Nanoparticles", 31 January 2015 (2015-01-31), pages 1 - 18, XP093052384, Retrieved from the Internet <URL:https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4586106/> [retrieved on 20230607] *
QI TANGJACQUELYN SOUSADIMAS ECHEVERRIAXUELI FANYING-CHAO HSUEHKHASHAYAR AFSHARINICHOLAS MEHUGHDAVID A. COOPERLORENC VANGJELIKATHRY: "RNAi-based modulation of IFN-γ signaling in skin", MOLECULAR THERAPY, vol. 30, 2022, pages 2709 - 2721, XP093020956, DOI: 10.1016/j.ymthe.2022.04.019
SCHRAGE RSCHMITZ ALGAFFAL E ET AL.: "The experimental power of FR900359 to study Gq-regulated biological processes", NAT COMMUN, vol. 6, 2015, pages 10156
SHIRLEY MDTANG HGALLIONE CJ ET AL.: "Sturge-Weber syndrome and port-wine stains caused by somatic mutation in GNAQ", N ENGL J MED, vol. 368, 2013, pages 1971 - 9
THOMAS ACZENG ZRIVIERE JB ET AL.: "Mosaic Activating Mutations in GNA11 and GNAQ Are Associated with Phakomatosis Pigmentovascularis and Extensive Dermal Melanocytosis", THE JOURNAL OF INVESTIGATIVE DERMATOLOGY, vol. 136, no. 4, 2016, pages 770 - 8
WAELCHLI RAYLETT SEROBINSON KCHONG WKMARTINEZ AEKINSLER VA: "New vascular classification of port-wine stains: improving prediction of Sturge-Weber risk", BR J DERMATOL, vol. 171, 2014, pages 861 - 7
WAELCHLI RWILLIAMS JCOLE T ET AL.: "Growth and hormone profiling in children with congenital melanocytic naevi", THE BRITISH JOURNAL OF DERMATOLOGY, vol. 173, 2015, pages 1471 - 8, XP071094437, DOI: 10.1111/bjd.14091
WEBER FP: "Right-sided hemi-hypotrophy resulting from right-sided congenital spastic hemiplegia, with a morbid condition of the left side of the brain, revealed by radiograms", J NEUROL PSYCHOPATHOL, vol. 3, 1922, pages 134 - 9
WETTSCHURECK NLEE ELIBUTTI SKOFFERMANNS SROBEY PGSPIEGEL AM: "Parathyroid-specific double knockout of Gq and G11 alpha-subunits leads to a phenotype resembling germline knockout of the extracellular Ca2+ -sensing receptor", MOL ENDOCRINOL, vol. 21, 2007, pages 274 - 80
ZHOU JAZIZAN EABCABRERA CP ET AL.: "Somatic mutations of GNA11 and GNAQ in CTNNB1-mutant aldosterone-producing adenomas presenting in puberty, pregnancy or menopause", NATURE GENETICS, vol. 53, 2021, pages 1360 - 72, XP037557969, DOI: 10.1038/s41588-021-00906-y

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2025245193A1 (en) * 2024-05-21 2025-11-27 The University Of North Carolina At Chapel Hill Methods and compositions for inhibition of mutant gnaq and gna11

Also Published As

Publication number Publication date
JP2025509242A (ja) 2025-04-11
AU2023232895A1 (en) 2024-08-29
US20250230435A1 (en) 2025-07-17
EP4490290A1 (en) 2025-01-15

Similar Documents

Publication Publication Date Title
JP7749645B2 (ja) Angptl3発現を阻害する組成物及び方法
JP6637121B2 (ja) 被験体におけるsmn2スプライシングのモジュレーションのための組成物および方法
ES2543004T3 (es) Composiciones y métodos para inhibir la expresión de transtiretina
ES2984631T3 (es) Composiciones y procedimientos para disminuir la expresión de tau
JP2019500345A (ja) 肝臓病の処置のための組成物および方法
TWI857290B (zh) 用於調節pnpla3表現之組合物及方法
CN104302768A (zh) 治疗β-联蛋白相关疾病的有机组合物
JP7560616B2 (ja) 膜貫通型セリンプロテアーゼ6(tmprss6)発現を阻害するための組成物および方法
US20250230435A1 (en) Methods of treatment of gnaq and gna11 driven disease
CN103764173A (zh) 用于治疗骨骼肌病的组合物和方法
CN118843690A (zh) 治疗gnaq和gna11驱动的疾病的方法
JP2024532019A (ja) アルファ-1アンチトリプシン発現を阻害するための組成物及び方法
WO2025088215A1 (en) Methods of treatment of melanocytic disease
AU2023366354A1 (en) Methods of treatment of melanocytic disease
WO2024089274A2 (en) Methods of treatment of melanocytic disease
US20090004660A1 (en) Method for detecting neuroblastoma and its malignancy and method for suppressing the same
JP2026513654A (ja) メラノサイト性疾患の治療方法
US20250283086A1 (en) Compositions and methods for treatment of kidney disease
TW202345873A (zh) 調節scap活性之組合物及方法
WO2026041910A2 (en) Compositions and methods for inhibiting xdh expression

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23710004

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: AU23232895

Country of ref document: AU

ENP Entry into the national phase

Ref document number: 2023232895

Country of ref document: AU

Date of ref document: 20230307

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2024553192

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 202380026446.9

Country of ref document: CN

WWE Wipo information: entry into national phase

Ref document number: 2023710004

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2023710004

Country of ref document: EP

Effective date: 20241007

WWP Wipo information: published in national office

Ref document number: 18844507

Country of ref document: US