WO2023168541A1

WO2023168541A1 - Chitosan nanoparticles (cnps) and preparation method thereof

Info

Publication number: WO2023168541A1
Application number: PCT/CN2022/000037
Authority: WO
Inventors: Xiaolin Liu; Hongliang LIV; Wenhong Zhang; Shengli BI
Original assignee: Shenzhen Genius Biotech Service Co., Ltd.
Priority date: 2022-03-09
Filing date: 2022-03-09
Publication date: 2023-09-14

Abstract

Disclosed are the chitosan nanoparticles (CNPs) and preparation method thereof. The chitosan nanoparticles (CNPs) for mucosal administration comprised chitosan and an antigen, wherein the chitosan has a molecular weight from 10 kDa to 500 kDa. Disclosed is the microparticles containing such nanoparticles as well as the method for preparation of such nanoparticles.

Description

Chitosan nanoparticles (CNPs) and preparation method thereof

FIELD OF THE INVENTION

The present invention relates to the chitosan nanoparticles (CNPs) and preparation method thereof, and their use in treating diseases and conditions.

BACKGROUND OF THE INVENTION

Vaccines are usually administered parenterally via injections. Traditional parenteral immunization regimes are known to have a number of drawbacks. For example, many individuals possess a natural fear of injections and may experience psychological discomfort as a result. Furthermore, many individuals find injections physically uncomfortable. Moreover, parenteral vaccination (e.g intramuscular, sub-cutaneous etc. ) is not an effective means of eliciting local immune response production. An effective local and/or topical administration regime is therefore desirable. In order to do this, the vaccine must be applied topically to a mucosal surface. Thus, in certain cases (e.g. in the case of infections of the upper respiratory tract) , it would be beneficial to obtain more effective stimulation of the local mucosal immune system of the respiratory tract.

A number of attempts have been made to develop mucosal vaccines. One drawback, however, is that subunit or inactivated vaccines are often poorly immunogenic when given mucosally. In order to overcome this problem, different approaches to improving the efficacy of vaccine given orally or intranasally have been adopted, included the use of adjuvants, encapsulation of the antigen in a variety of nanoparticles and so on.

SUMMARY OF THE INVENTION

The purpose of the present invention is to provide chitosan nanoparticles (CNPs) and preparation method thereof, and their use in treating diseases and conditions.

In order to achieve the above objectives, the present invention provides the following technical solutions:

Firstly, the present invention provides Chitosan nanoparticles (CNPs) comprising an antigen mixed with an effective amount of a chitosan, wherein the chitosan has a molecular weight in a range of 10 kD to 500 kD, and the chitosan is more than 40% deacetylated. preferably, the chitosanis present in a range of 0.02%to 10%by weight, preferably, the chitosan is present in a range of 0.1%to 5%by weight, more preferably, the chitosan is present in a range of 0.25%to 2%by weight.

Preferably, the chitosan is a water-soluble chitosan.

Preferably, the chitosan is 50%to 90%deacetylated.

Preferably, the molecular weight of the chitosan is in a range of 50 kD to 300 kD, more preferably, the molecular weight of the chitosan is in a range of 100 kD to 300 kD.

Preferably, the nanoparticles have a pH in a range of 5.5 to 6.5, more preferably, the pH is about 6.

Preferably, the antigen is a SARS-CoV-2 recombinant spike protein, consisted of the truncated spike protein Val308 -Gly548.

Preferably, the antigen is incorporated into the nanoparticles.

Furtherly, the present invention also provides a method of producing the Chitosan nanoparticles (CNPs) capable of enhancing an IgA mucosal immune response, the method comprising, (a) preparing a polymer substrate with a biodegradable polymer, wherein the biodegradable polymer is chitosan, wherein the chitosan is a natural or synthetic chitosan; (b) selecting an antigen that in cooperation with chitosan is capable of eliciting an antibody response specific to the antigen in a subject; and (c) encapsulating the selected antigen with the polymer substrate to produce the nanoparticle capable of eliciting greater mucosal immune response specific to antigen.

BRIEF DESCRIPTION OF THE DRAWINGS

Fig. 1 shows serumSARS-COV-2 Neutralizing antibody;

Fig. 2 shows nasal swabs IgA;

Fig. 3 shows mice weight;

Fig. 4 shows mice temperature;

Fig. 5 shows mice bronchoalveolar lavage (BAL) virus load;

Fig. 6 shows nasal virus load;

Fig. 7 shows throat virus load;

Fig. 8 shows pathological changes in high dose vaccinated mouse lung after challenge;

Fig. 9 shows pathological changes in low dose vaccinated mouse lung after challenge;

Fig. 10 shows mice type I pneumocyte hyperplasia score (TII PH) .

DETAILED DESCRIPTION OF THE INVENTION

One aspect of the invention, nanoparticles are provided that include a polymer substrate, wherein the polymer substrate includes a biodegradable polymer and at least one antigen in the nanoparticle core. In some embodiments, the biodegradable polymer is chitosan. In some embodiments, the nanoparticle has a diameter of less than 100 nm. In some embodiments, the nanoparticle has a diameter between 100 nm and 900 nm. In certain embodiments, the adjuvant is a natural or synthetic chitosan or functional variant thereof. The antigen is a microbial antigen, a cancer antigen, an autoimmune antigen, or an environmental antigen. In some embodiments, the microbial antigen is a bacterial antigen, a fungal antigen, a parasitic antigen, or a viral antigen. In certain embodiments, the bacterial antigen is an encapsulated bacteria antigen. In some embodiments, the antigen is a Streptococcal antigen, a Candida antigen, a Cryptococcus antigen, a Brucella antigen, a Salmonella antigen, a Staphylococcal antigen, a Porphyromonas antigen, a Burkholderia antigen, a Bacillus antigen, a Mycobacteria antigen, a Shigella antigen, a Pseudomonas antigen, a Bordetella antigen, a Clostridium antigen, a Norwalk virus antigen, a Bacillus anthracis antigen, a Mycobacterium tuberculosis antigen, a human immunodeficiency virus (HIV) antigen, a Chlamydia antigen, a Human papillomavirus antigen, a Coronavirus antigen, an Influenza virus antigen, a Paramyxovirus antigen, a Herpes virus antigen, a Cytomegalovirus antigen, a Varicella-Zoster virus antigen, an Epstein-Barr virus antigen, a Hepatitis virus antigen, a Plasmodium antigen, a Trichomonas antigen, a sexually transmitted discase antigen, an aerosol-transmitted disease antigen, a viral encephalitis disease antigen, a protozoan disease antigen, a fungal disease antigen, a bacterial disease antigen, a rumor antigen, or a cancer antigen. In some embodiments, the encapsulated bacteria is Haemophilus influenza type B, Streptococcus pneumoniae, Neisseria meningitidis, Group B streptococcus (GBS) , Klebsiella pneumonia, Staphylococcus aureus, Pseudomonas aeruginosa, Burkholderia pseudomallei, Burkholderia mallei, Escherichia coli, Bacteroides fragilis, or Salmonella typhi. In some embodiments, the nanoparticle also includes a B-cell population-targeting antigen. In certain embodiments, the B-cell population-targeting antigen includes a polysaccharide, a glycan, an oligonucleotide, a lipopeptide, a protein, a peptide, or a combination of two or more thereof. In some embodiments, the nanoparticle also includes a pathogen-derived polysaccharide antigen. In some embodiments, the polymer substrate includes at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 25, 50, 60, 70, 80, 90, 100, 125, 150, 175, or 200 different antigens. In certain embodiments, wherein the nanoparticle core includes at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 different adjuvants. In some embodiments, the nanoparticle is not a liposome, does not include a lipid bilayer, is not modified on the surface with polyethylene glycol (PEG) , and is not associated with a lipid bilayer.

Another aspect of the invention, methods of immune stimulation in a subject are provided. The methods include administering to a subject in need of immune stimulation a composition that includes any aforementioned embodiment of a nanoparticle of the invention, in a dose effective to stimulate in the subject an immune response specific to the nanoparticle′sat least one antigen. The invention, in certain aspects also provides methods of treating a disease or condition in a subject, and the methods include administering to a subject in need of such treatment a composition including any embodiment of an aforementioned nanoparticle of the invention, in a dose effective to treat the disease or condition in the subject. In some embodiments, the dose is effective to prevent or treat a microbial disease or condition, cancer, or an autoimmune disease or condition in the subject. In certain embodiments of the aforementioned aspects, the subject is a human. In some embodiments of the aforementioned aspects, the at least one antigen and the least one adjuvant function cooperatively to elicit the immune response. In some embodiments of the aforementioned aspects, the method also includes administering one or more additional nanoparticles of any of the aforementioned embodiments.

According to another aspect of the invention, pharmaceutical compositions are provided that include one or more of any of the aforementioned embodiments of a nanoparticle of the invention, and a pharmaceutically acceptable carrier.

According to another aspect of the invention, methods of producing a nanoparticle are provided. The methods include (a) preparing a polymer substrate including a biodegradable polymer and at least one antigen; (b) selecting an antigen that in cooperation with the polymer is capable of eliciting an enhance immune response in a subject; and (c) encapsulating the selected antigen with the polymer substrate to produce the nanoparticle. In certain embodiments, at least a portion of the at least one antigen in the prepared polymer substrate is positioned external to the outer surface of the produced nanoparticle. In some embodiments, at least a portion of the at least one antigen in the prepared polymer substrate is positioned internal to the outer surface of the produced nanoparticle.

According to another aspect of the invention, methods of enhance immune response in a subject are provided. The methods include administering to a subject in need of immune stimulation a composition that includes any of the a forementioned nanoparticle embodiments in a dose effective to stimulate in the subject an immune response specific to the nanoparticle′sat least one antigen. The invention, in certain aspects also provides methods of treating a disease or condition in a subject, and the methods include administering to a subject in need of such treatment a composition including any embodiment of an aforementioned nanoparticle of the invention, in a dose effective to treat the discase or condition in the subject. In some embodiments of the aforementioned aspects, the dose is effective to prevent or treat a microbial disease or condition, cancer, or an autoimmune disease or condition in the subject. In some embodiments of the aforementioned aspects, the dose is between 1 femtogram and 5 milligrams of antigen. In certain embodiments of the aforementioned aspects, the subject is a human. In some embodiments of the aforementioned aspects, the polymer includes at least one bacterial polysaccharide. In some embodiments of the aforementioned aspects, the method also includes administering one or more additional nanoparticles of any of the aforementioned embodiments of the invention.

According to another aspect of the invention, pharmaceutical compositions are provided that include any of the aforementioned embodiments of a nanoparticle and a pharmaceutically acceptable carrier.

According to another aspect of the invention, methods of producing a nanoparticle are provided. The methods include preparing a polymer substrate that includes a biodegradable polymer and at least one antigen. In certain embodiments, at least a portion of the at least one antigen in the prepared polymer substrate is positioned external to the outer surface of the produced nanoparticle. In some embodiments, at least a portion of the at least one antigen in the prepared polymer substrate is positioned internal to the outer surface of the produced nanoparticle. In some embodiments, the biodegradable polymer is chitosan. In certain embodiments, the antigen is derived from a pathogenic bacterial, fungal, parasitic, or viral organism. In some embodiments, the antigen is derived from an encapsulated bacteria, a Streptococcus species, a Candida species, a Cryptococcus species, a Brucella species, a Salmonella species, a Staphylococcal species, a Porphyromonas species, a Burkholderia species, a Bacillus species, a Mycobacteria species, a Shigella species, a Pseudomonas species, a Bordetella species, a Clostridium species, a Norwalk virus, Bacillus anthracis, a coronavirus, Mycobacterium tuberculosis, human immunodeficiency virus (HIV) , Chlamydia species, human Papillomaviruses, Influenza virus, a Paramyxovirus species, Herpes virus, Cytomegalovirus, Varicella-Zoster virus, Epstein-Barr virus, a Hepatitis virus, a Plasmodium species, a Trichomonas species, a sexually transmitted disease agent, an aerosol-transmitted disease agent, a viral encephalitis disease agent, a protozoan disease agent, a fungal disease agent, a bacterial disease agent, a cancer cell, or a mixture thereof. In certain embodiments, the encapsulated bacteria is Haemophilus influenza type B, Streptococcus pneumoniae, Neisseria meningitidis, Group B streptococcus (GBS) , Klebsiella pneumonia, Staphylococcus aureus, Pseudomonas aeruginosa, Burkholderia pseudomallei, Burkholderia mallei, Escherichia coli, Bacteroides fragilis, or Salmonella typhi. In some embodiments, the nanoparticle includes a B-cell population-targeting antigen. In some embodiments, the B-cell population-targeting antigen includes a polysaccharide, a glycan, an oligonucleotide, a lipopeptide, a protein, a peptide, or a combination of two or more thereof. In certain embodiments, the nanoparticle also includes a pathogen-derived polysaccharide antigen in the nanoparticle. In some embodiments, the nanoparticle also includes including at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 25, 50, 60, 70, 80, 90, 100, 125, 150, 175, or 200 different antigens in the polymer substrate. In some embodiments, the produced nanoparticle is not a liposome, does not include a lipid bilayer.

According to another aspect of the invention, nanoparticles are provided that include a biodegradable polymer and at least one antigen in the nanoparticle core. In some embodiments, the biodegradable polymer is chitosan. In some embodiments, the nanoparticle has a diameter of less than 100 nm. In certain embodiments, the nanoparticle has a diameter between 100 nm and 900 nm. In some embodiments, the adjuvant is a natural or synthetic chitosan or functional variant thereof. In some embodiments, the nanoparticle also includes a B-cell population-targeting antigen. In some embodiments, the B-cell population-targeting antigen includes polysaccharide, a glycan, an oligonucleotide, a lipopeptide, a protein, a peptide, or a combination of two or more thereof. In certain embodiments, the nanoparticle is not a liposome, does not include a lipid bilayer, is not modified on the surface with polyethylene glycol (PEG) , and is not associated with a lipid bilayer.

According to another aspect of the invention, methods of treating a discase or condition using immune stimulation are provided. The methods include administering to a subject in need of immune stimulation a composition including any of the a forementioned nanoparticle embodiments, in a dose effective to stimulate in the subject an immune response in the subject. The invention, in some aspects also provides methods of treating a disease or condition in a subject, and the methods include administering to a subject in need of such treatment a composition including any embodiment of an aforementioned nanoparticle of the invention, in a dose effective to treat the disease or condition in the subject. In certain embodiments of the aforementioned aspects, the dose is effective to prevent or treat a microbial discase or condition, cancer, or an autoimmune disease or condition in the subject. The subject is a human. In some embodiments, In some embodiments of the aforementioned aspects, the nanoparticle also includes a B-cell population-targeting antigen. In certain embodiments of the aforementioned aspects, the B-cell population-targeting antigen includes a polysaccharide, a glycan, an oligonucleotide, a lipopeptide, a protein, a peptide, or a combination of two or more thereof. In some embodiments of the aforementioned aspects, the nanoparticle is administered to the subject in conjunction with at least one additional vaccine. In some embodiments of the aforementioned aspects, the method also includes administering one or more additional nanoparticles of any of the aforementioned embodiments of the invention.

According to another aspect of the invention, pharmaceutical compositions are provided that include any aforementioned embodiments of a nanoparticle and a pharmaceutically acceptable carrier.

According to another aspect of the invention, methods of producing a nanoparticle are provided. The methods include (a) preparing a polymer, (b) selecting an antigen; and (c) encapsulating the selected antigen with the polymer substrate to produce the nanoparticle. In certain embodiments, the biodegradable polymer is chitosan. In some embodiments, the diameter of the nanoparticle is less than or equal to 100 nm, or is between 100 nm and 900 nm. In some embodiments, the adjuvant is a natural or synthetic chitosan or functional variant thereof. In certain embodiments, the nanoparticle also includes a B-cell population-targeting antigen. In some embodiments, the B-cell population-targeting antigen includes a polysaccharide, a glycan, an oligonucleotide, a lipopeptide, a protein, a peptide, or a combination of two or more thereof. In some embodiments, the method also includes encapsulating at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 different adjuvants in the polymer substrate. In certain embodiments, the produced nanoparticle is not a liposome, does not include a lipid bilayer.

EXAMPLE 1 Crude chitin preparation

Eighty kilograms of dry chitin obtained from King crab shell was ground to an average particle diameter of 0.0278 inches (24 mesh) and mixed with 320 kilogram of 50 percent sodium hydroxide solution and 80 kilograms of water using a kneading apparatus. The mixture (5 parts of 40%NaOH per part of chitin) was heated in the mixer to 70℃. and was packed in a polyethylene lined steel dram to expel entrapped air and yield a continuous liquid phase. The drum was sealed and head space air was displaced with nitrogen. It was then held in a chamber at 70℃ for 72 hours. The mixture was then transferred to a screen bottom stainless steel tank and was washed with water by downward displacement. Effluent to 35 percent sodium hydroxide average concentration was collected separately for reuse. Washings to five percent average concentration were also separately collected for protein extraction. The partially washed chitosan was re-slurried in water and was collected, washed, dewatered in a centrifuge and dried. Yield equaled 60 kilogram or 94 percent of theory.

Eighty kilogram of dry ground chitin as above was mixed with 267kilogram of 35 percent sodium hydroxide solution recovered from a previous deacetylation run and 133 kilogram of 50 percent sodium hydroxide solution.

The mixture was treated as above yielding a product with nearly the same characteristics.

One hundred kilogram of recovered alkali solution from repeated chitin deacetylations was found to contain 27 percent sodium hydroxide and 20 percent sodium acetate. The solution was cooled to 15 ℃, held 16 hours and filtered, yielding 19 kilogram of crystalline sodium acetate trihydrate and 81kilogram of a solution containing 33 percent sodium hydroxide and 9.5 percent anhydrous sodium acetate. The solution was recycled to the deacetylation process.

EXAMPLE 2

2.1 Preparation of chitosan Glutamate

A solution of 1%chitosan glutamate, a medium viscosity deacetylated chitin having approximately 11%residual N-acetyl groups, was prepared by dissolving the chitosan glutamate in 0.8%sodium chloride.

Chitosan was dissolved in hydrochloric acid media; the undissolved constituents were removed by filtration. Chitosan solution was precipitated with 0.2M NaOH solution. The purified chitosan was washed with distilled water. The obtained chitosan was dissolved in hydrochloric acid to produce chitosan solution, concentration is 1 mg/ml. The pH was adjusted to 6.5 with NaOH.

Into a 2000 ml volumetric flask weighed 10 kg of chitosan glutamate 500ml of water was added to the chitosan which was left to stir overnight.

600 g of potassium dihydrogen phosphate and 28000 g of sodium chloride. The salts were dissolved in 8000 ml of water, the solution adjusted to pH 5.7 using 2N NaOH solution and then made to 10000 ml with water. When the chitosan had dissolved, 500 ml of the phosphate buffer solution was added.

2.2 Preparation of Ultra-High-Molecular-Weight Poly-Gamma-Glutamic Acid

A basal medium (supplemented with 3%L-glutamic acid; containing glucose 3%, (NH4) 2SO4 1%, KH2PO4 0.27%, Na2HPO4.12H2O, 0.17%, NaCl 0.1%, sodium citrate 0.5%, soy peptone 0.02%, MgSO4. 7H2O 0.7%, vitamin solution 10 mi/L, pH 6.8) for production of poly-gamma-glutamic acid was prepared and sterilized. A culture broth (LB medium) of Bacillus subtilis was inoculated into the medium in a 5-L Jar fermentor (working vol. 3 L) at a concentration of 4%and fermented at an agitation rate of 500 rpm, an air injection rate of 1.0 wm and 37℃ for 48 hours. Then, the bacterial cells were removed using a small filter press (1%celite) , and the remaining material was used as a sample solution containing poly-gamma-glutamic acid.

The sample solution containing poly-gamma-glutamic acid was adjusted to pH 2.0 with a 2 N sulfuric acid solution, and then allowed to stand at 10℃ or below for 15 hours, thereby obtaining a poly-gamma-glutamic acid precipitate. The resulting material was washed with a sufficient amount of cold distilled water (10℃ or below) having a pH of 3.5 or more, and then filtered through a Nutsche filter to collect a poly-gamma-glutamic acid which was then freeze-dried, thereby preparing an ultra-high-molecular-weight poly-gamma-glutamic acid.

2.3 Chitin Nanoparticles Suspension Preparation

Chitin nanoparticles were prepared from purified chitin by sonication of a suspension of 10 mg/ml in endotoxin free PBS at maximum output for 20 min with cooling on ice every 5 min. The slurry was centrifuged at 1000xg for 10 min to remove large particles and the nanoparticles were collected by centrifugation at 4000xg and washed 3 times with PBS to remove any solubilized chitin. The supernatant contained a uniform suspension of small particles as judged by light nanoscopy using a haemocytometer with 50 μm squares and were comparable in size to 1 μm latex spheres (Polysciences, Inc., Warrington, Pa., USA) . Particles less than 5 μm in diameter were quantified with a Celltac Hematology Analyser (Nihon Kohden, Inc. ) . Preparations were found to contain 99.9%nanoparticles less than 5 μm in diameter and at a concentration in the order of 1011/ml. Endotoxin was measured by Limulus Amebocyte Lysate Assay (BioWhittaker Co, ) and shown to be ＜1 EU/ml.

2.4 Preparation of Mannosylated Chitosan

Two molar equivalents of mannose in one volume of 0.1 M sodium acetate, pH 4.0 were heated at 60℃ for two hours. The solution was then added to two volumes of one molar equivalent of 2%chitosan in 0.15%acetic acid and allowed to react for 10 min at room temperature to produce a 1.5%mannosylated chitosan solution. This can then be mixed with broth cultures such that 2 volumes of culture are mixed with one volume of 1.5%mannosylated chitosan. Concentrated antigens can be diluted as minimal as possible or as desired. Tris-HCl can be added to a final concentration 0.5 g/L.

2.5 Preparation of chitosan adjuvant

The nanoparticles of chitosan were prepared base on the modified ionic gelation method with some modification. Briefly, after the detection of chitosan deacetylation and molecular weight, the chitosan solution was prepared by being dissolved in acetic acid (0.1 M) and heated at 37℃. The solution was filtered using prefilter membranes under vacuum, and acetate sodium (0.1 M) was added. Chitosan derivatives in 0.2 M glutamate buffer were dissolved in acetic acid, and the pH reached 4.6-4.8 using sodium hydroxide. Tween 80 (0.01%) (Sigma-Aldrich, St. Louis, MO, USA) was added to the emulsion. Then, sodium tripolyphosphate (TPP) was separately dissolved in deionized water (0.1%w/v) . The nanoparticles were formed while the TPP solution was dropwise pumped to the chitosan solution and gently stirred for 60 min.

Example 3. Preparation of SARS-CoV-2 subunit vaccine antigen

1. Primary seed lots established

Step (i) : Synthesis of SARS-CoV-2 RBD fragment Gene:

Full length protein gene was optimized according to Escherichia coli codon usage. The following parameters were used for RBD gene optimization: Codon Usage Bias, GC content, mRNA Secondary Structure, Custom Desired Patterns, Custom Undesired Patterns, Repeat Sequences (direct repeat, inverted repeat, and dyad repeat) , Restriction Enzyme Recognition Sites (deletion or insertion) .

Optimized RBD gene was cloned at multiple cloning site of PET-3a plasmid vector using BamH1 and Sapl restriction sites, generating PET-3a-RBD. The vectors PET-3a-RBD was transformed in Escherichia coli BL-21 (DE3) host and clones was selected on LB+Kanamycin plate. The presence and correctness of RBD gene in PET-3a was confirmed by restriction digestion of PET-3a -RBD plasmid by Age I (located in RBD gene) and Nde I (located in PET-3a plasmid) . Further the sequence of rRBD protein was confirmed by PCR and DNA sequencing. The SARS-CoV-2 subunit immunogen, designated as rSAg, consisted of the truncated spike protein Val308 -Gly548.

The expected Molecular Weight (MW) of S1-RBD were 27.0 kDa. The positive plasmids were confirmed by restriction endonuclease analysis and sequencing, while the positive colonies of freshly transformed BL21 (DE3) were chosen depending on the SDS-PAGE analysis of small-scale expression.

The fragments S1-RBD obtained by enzyme cleavage were linked into the prokaryotic expression vector pTO-T7 digested by NcolI /Xhol enzyme and were transformed into E. coli ER2566 (purchased from Invitrogen Co. ) ; after extraction of plasmids, as identified by NcolI/Xhol enzyme cleavage, the positive plasmids pTO-T7-rSAg were obtained.

1 μL of plasmids pTO-T7-rSAg (0.12 mg/ml) were separately used to transform 40 μL competent E. coli ER2566 (purchased from Invitrogen) prepared by the Calcium chloride method, and then the bacteria were plated on solid LB medium (the components of the LB medium: 10 g/L peptone, 5 g/L yeast powder, and 10 g/L NaCl, the same below) containing kanamycin (at a final concentration of 100 mg/ml, the same below) . The plates were statically incubated at 25℃ for about 10-12 h until individual colonies could be observed clearly. Individual colonies from the plates were transferred to a tube containing 4 ml liquid LB medium containing kanamycin. The cultures were incubated in a shaking incubator at 180 rpm for 10 h at 25 ℃ and then 1 ml bacterial solutions were taken and stored at -70 ℃.

Step (ii) : Preparation of Master engineered bacteria Seed.

pTO-T7-rSAg/E. coli ER2566 from one vial of the PCB at PN18 were thawed, was seeded to 100mL liquid LB medium containing ampicillin, and then was cultured at 30℃, 180 rpm under shaking until OD600 reached about 0.5, and the culture were harvested, pooled and distributed amongst 4 centrifuge bottles. The crude harvest material was centrifuged at 1,424 X g for 10 minutes and the supernatants discarded and each bottles was resuspended in 5 mL of LB medium containing ampicillin , was pooled and added 30%glycerel This bulk MVS solution was aliquoted into 506 cryovials (5 mL) at a volume of 4 mL per vial. All vials were transferred to controlled storage at -80 ℃.

Step (iii) Vaccine Antigen Manufacture

Step1. rSAg expression

5 mL bacterial solution, taken from an ultralow temperature freezer at -70 ℃ was seeded to 5 L liquid LB medium containing ampicillin, and then was cultured at 25 ℃, 180 rpm until OD600 reached about 0.5. The resultant solution was transferred to 500 L LB medium containing ampicillin, and then was cultured at 30℃, 180 rpm for 4-5 h. When OD600 reached about 1.5, IPTG was added to a final concentration of 0.4 mM, and the bacteria were induced under stirring at 30℃ for 4 h.

Step2: Harvest, Sonication and Benzonase Treatment

After induction, centrifugation was performed at 8000 g for 5 min to collect the bacteria, and then the bacteria were re-suspended in a lysis solution at a ratio of 1 g bacteria to 10 mL lysis solution (20 mM Tris buffer pH7.2, 300 mM NaCl) , in ice-bath. The bacteria were treated with a sonicator (Sonics VCX750 Type Sonicator) (conditions: operating time 15 min, pulse 2s, intermission 4s, output power 55%) . The bacterial lysate was centrifuged at 12000 rpm, 4℃ for 5 min (the same below) , the supernatant was kept and the precipitate (i.e. inclusion body) was discarded;

The appropriate amounts of a 250,000 U/mL benzonase solution and a 1M MgC12 solution were aseptically added through the injection port of the 20 L Stedim bag containing the crude harvest to achieve a final concentration of 20 U/ml and 2 mM respectively. The contents of the bag were mixed, followed by incubation at 37±1C. for 18-24 h.

Step 3: Clarification

The benzonase treated, rSAg pool was clarified using a 4-stage filtration assembly. The assembly consists of a Sartorius Sartoclean GF filter capsule upstream and in series with a Sartorious Sartopore 2 filter capsule. The first two filtration stages were housed in the Sartoclean GF capsule with nominal 3.0 μm and 0.8 μm cellulose acetate filters. The third and fourth stages were housed in the Sartopore 2 filter capsule with nominal 0.45 μm and 0.2 μm polyethersulfone membrane filter. The virus pool was pumped through the filtration assembly and collected in 5 X 5 L Flexboy bags (approximately 4 L each) . A final 5 L Flexboy bag was connected to the outlet of the filtration assembly and 3 L of PBST was pumped through the assembly to wash the filters and collect any residual inactivated virus.

Step 4: Concentration and Diafiltration

Three Sartorius Slice disposable crossflow filtration cassettes, each with a 0.1m2, 100-kDa molecular weight cutoff Sartorius Hydrosart membrane, were connected in parallel to concentrate the clarified inactivated virus pool 10-fold in volume via tangential flow filtration (TFF) . TFF was followed by constant volume diafiltration with 10 volumes of PBS-Tween 80 (10 mM NaPO4, 150 mM NaCl, 0.002%Tween 80) , pH 7.5. A constant flux of 300 L/m2/hour (LMH) and transmembrane pressure (TMP) of 0.40 to 0.45 bar was maintained throughout the run. An equal volume of buffer was used to wash the TFF cassette assembly in order to improve protein recovery. The final retentate concentration was approximately 5-fold prior to filtration through sterile 0.45 μm and 0.2 μm filters. The filtered retentate was stored at 5±3C. for not more than 7 days or-60 C. up to 4 weeks prior to chromatographic purification.

Step 5: Anion Exchange Chromatography

The first purification step was performed using anion exchange chromatography with Fractogel. RTM. EMD TMAE (Merck) media to capture the SARS-COV-2 recombinant protein, which partially removes contaminating host cell proteins and any residual host nucleic acids. At this stage of product development, the anion exchange chromatography (AEX) medium was considered single-use and a product-dedicated column was re-packed for each production run. A GE Healthcare 70 X 500 mm (ID Xheight) INdEX column was packed with approximately 390 mL of Fractogel. RTM. EMD TMAE chromatography medium to yield a bed height of approximately 100 mm. Once packed, the column was loaded with 4 mL of AEX testing solution (20 mM Na-phosphate buffer, 2 mM MgCl2, 1 M NaCl, pH 7.5) to measure the height equivalent to a theoretical plate (HETP) and asymmetry (As) . A column was accepted for use if the HETP and As were ＞3,000 plates/m and 0.8-1.8 respectively. The column was operated at room temperature with a linear flow rate of 150 cm/h (approximately 96 mL/min) and the absorbance of the column eluate was monitored using a GE Healthcare UVis 920 detector at 215 nm set at 2,000 mAU range. The column was sanitized with 2 column volumes (CV) of 0.5 M NaOH and equilibrated with 3-5 CV of binding buffer (20 mM Na-phosphate buffer, 2 mM MgCl2, 100 mM NaCl, pH 7.5) prior to loading of the filtered retentate from step 13. Binding capacity of this column was approximately 1.96 mg protein/mL of resin and the sample was loaded at 40-80%of column breakthrough. The filtered retentate from step 13 was loaded onto the AEX column with the flow rate being reduced (if necessary) to avoid the introduction of air. Once the filtered retentate was loaded, the column was washed with binding buffer until a baseline absorbance was obtained (approximately 2-5 CV) . The SARS-COV-2 recombinant spike protein containing material was eluted in a step gradient fashion with elution buffer (20 mM Na-phosphate buffer, 2 mM MgCl2, 250 mM NaCl, pH 7.5) . Fraction collection was initiated when the detector indicated 100 mAU and continued until the absorbance fell below 100 mAU (approximately 2-4 CV) . The volume size and protein concentration of the filtered retentate from step 13, taken together with the AEX column dimensions and binding capacity, typically necessitated 2 cycles of AEX chromatography to complete the processing of all material. At the end of the first run, the AEX column was stripped with 5 CV of regeneration buffer (20 mM Na-phosphate buffer, 2 mM MgCl2, 2M NaCl, pH 7.5) , followed by equilibration with 3-5 CV of binding buffer (until baseline absorbance was obtained) prior to loading the remainder of the filtered retentate. Once all AEX runs were complete, theSARS-COV-2 containing eluant fractions were pooled and the column was stripped with 5 CV of regeneration buffer and sanitized with 2 CV of 0.5m NaOH and 5 CV of 0.01 M NaOH prior to storage. The pooled AEX eluate fractions were stored at 5±3 ℃ for not more than 3 days prior to cation exchange chromatography as described below.

Step 6: Cation Exchange Chromatography

The second purification step was performed using cation exchange chromatography with Fractogel. RTM. EMD SO3 (Merck) media to further remove impurities, which was in the flow-through fraction (s) . At this stage of product development, the cation exchange chromatography (CEX) medium was considered single-use and a product-dedicated column was re-packed for each production run. An Omnifit 35X250 mm (ID Xheight) BenchMark column was packed with approximately 100 mL of Fractogel. RTM. EMD SO3 chromatography medium to yield a bed height of approximately 100 mm. The binding buffer, elution buffer, regeneration buffer, linear flow rate (150 cm/h, approximately 24 mL/min) and monitoring conditions were the same as those used in anion exchange purification step 14 above. Once packed, the column was loaded with 0.5 mL of regeneration buffer to measure the HETP and As. A column was accepted for use if the HETP and As were ＞4,000 plates/m and 0.8-1.8 respectively. The column was sanitized with 2 column volumes (CV) of 0.5 M NaOH and equilibrated with 3-5 column volumes (CV) of binding buffer prior to sample loading. TheSARS-COV-2 -containing eluate fraction (250 mM NaCl) from the anion exchange step above was diluted (approximately 3 X) with 20 mM Na- phosphate buffer, 2 mM MgCl2, pH 7.5 prior to loading to reduce the salt concentration. Binding capacity of this column was 2.7 mg protein/mL of resin and the dilutedSARS-COV-2 eluate was loaded at 40-80%of column breakthrough onto the CEX column with the flow rate being reduced (if necessary) to avoid the introduction of air. Once the diluted AEX sample was loaded, the column was washed with binding buffer until a baseline absorbance was obtained (approximately 2-5 CV) . The SARS-COV-2 antigen containing material was eluted from the cation exchange column with elution buffer. Fraction collection was initiated when the detector indicated 50 mAU and continued until the absorbance fell below 50 mAU (approximately 3-5 CV) . The volume size and protein concentration of the pooled AEX eluate fractions from step 14, taken together with the CEX column dimensions and binding capacity, typically necessitated 2 cycles of CEX chromatography to complete the processing of all material. At the end of the first run, the CEX column was stripped with 5 CV of regeneration buffer, followed by equilibration with 3-5 CV of binding buffer (until baseline absorbance was obtained) prior to loading the remainder of the pooled AEX eluate fraction. Once all CEX runs were complete, the recombiant SARS-COV-2 spike protein containing eluant fractions were pooled and the column was stripped with 5 CV of regeneration buffer and sanitized with 2 CV of 0.5m NaOH and 5 CV of 0.01 M NaOH prior to storage. The pooled CEX eluate fractions were stored at 5±3 ℃ for no longer than 3 days prior to size exclusion chromatography as described below.

Step 7: Size Exclusion Chromatography

Size exclusion chromatography with Sephacryl S-400 HR (GE healthcare) media was used as a final polishing step in the SARS-COV-2 antigen purification process. At this stage of product development, the size exclusion chromatography (SEC) medium was considered single-use and product-dedicated columns were re-packed for each production run. Two GE Healthcare 100 X 500 mm (ID X height) BPG columns were packed with approximately 2.35 L each of Sephacryl S-400 HR chromatography medium to yield a bed height of 250-300 mm per column. Once packed, the columns were individually loaded with 25 mL each of SEC testing solution (10 mM Na--PO4, 2 M NaCl, 0.002%Tween 80, pH 7.5) to measure the HETP and As. A column was accepted for use if the HETP and As were ＞4,000 plates/m and 0.8-1.8 respectively. The two columns were individually sanitized with 1 CV of 0.5 M NaOH, equilibrated with 3-5 CV of running buffer (PBST: 10 mM Na--PO4, 150 mM NaCl, 0.002%Tween 80, pH 7.5) and then assembled in series for use. The pooled CEX eluate fractions from step 16 above were loaded onto the SEC column assembly at 2.5-5.0%of the total column volume and the column was operated isocratically at room temperature with linear flow rate of 24 cm/h (31.4 mL/min) . The absorbance of the column eluate was monitored using a GE Healthcare UV is 920 detector at 215 nm set at 100 mAU range. Fractions of 50-100 mL each were collected from the observed elution peaks. Fraction sizes were adjusted based on the appearance of the chromatogram. From previous experience, the 90%purity recombinant SARS-COV-2 spike protein fractions were eluted at approximately 0.45 0.60 CV. The volume size of the pooled CEX eluate fractions and the column dimensions typically necessitated 4 cycles of SEC chromatography to complete the processing of all material. At the end of each cycle the column was re-equilibrated with 3-5 CV of running buffer until baseline absorbance was obtained. Once all SEC runs were complete, the column was sanitized with 1 CV of 0.5m NaOH followed by 2 CV of 0.01 M NaOH prior to storage. Individual fractions were analyzed by SDS PAGE and Western blot to permit selection and pooling of those fractions which contain ≥ 90%purity of the SARS-COV-2 antigen. The selected ≥ 90%purity recombinant SARS-COV-2 spike protein (r-S1-RBD) eluate fractions were pooled and stored at 5±3 ℃ for not more than 3 days prior to concentration.

Step 8: Concentration

Concentration was performed using TFF with a 2 X 30 kDa molecular weight cut off Sartorius Hydrosart membrane cassettes assembled in a Sartorius Sartocon. RTM. Slice 200 holder. A constant flux of 300 LMH was maintained throughout the process and the TMP fluctuated between 0.40-0.45 bar. The concentration fold was in the range of 10-40 X, depending on the total protein concentration in the selected pooled SEC fractions from step 16 and the formulation requirements. The concentrated solution was filtered through a 0.2 m filter, and stored at ≤-60 ℃ for up to 6 months or at 5±2 ℃ for up to 2 weeks.

EXAMPLES 4.

4.1 Preparation of Chitosan-Protein Cross-Linked with Formaldehyde vaccine antigen

After the detection of chitosan deacetylation and molecular weight, the chitosan solution was prepared by being dissolved in acetic acid (0.1 M) and heated at 37℃. The solution was filtered using prefilter membranes under vacuum, and acetate sodium (0.1 M) was added. Chitosan derivatives in 0.2 M glutamate buffer were dissolved in acetic acid, and the pH reached 4.6-4.8 using sodium hydroxide. Tween 80 (0.01%) (Sigma-Aldrich, St. Louis, MO, USA) was added to the emulsion. Then, sodium tripolyphosphate (TPP) was separately dissolved in deionized water (0.1%w/v) . The nanoparticles were formed while the TPP solution was dropwise pumped to the chitosan solution and gently stirred for 60 min. After three times washing with distilled water to discard the acid, the chitosan was added to the antigen (1/10) while the suspension was gently stirred for 30 min.

The final product of chitosan without mannose can range from a minimum final concentration of 0.5%chitosan and maximal final concentration of 2%chitosan in the vaccine formulation. Chitosan is dissolved in a solution containing 15 ml of glacial acetic acid per L deionized water at the appropriate concentration (1.5%acetic acid in water) . Typically for broth cultures 2 volumes of culture are mixed with one volume of 1.5%chitosan (0.5%chitosan in the final vaccine formulation) . Other antigens are diluted as minimal as possible giving a final concentration of up to 1.5%chitosan. The formaldehyde is then added to the antigen-dissolved chitosan mixture such that the final concentration is 0.2%formaldehyde or 0.008 M formaldehyde. In the Examples above, a 37%solution of formaldehyde is used. Tris-HCl can be added to a final concentration 0.5 g/L.

4.2 Preparation of Chitosan-Based Nano Antigen and In Vitro Characterization

Chitosan NPs-loaded-recombinant subunit antigen (rSAg) (CNPs-rSAg) formulation was prepared by the ionic gelation method.

1.0% (w/v) low-molecular weight chitosan polymeric solution was prepared in an aqueous solution of 4.0%acetic acid under magnetic stirring until the solution became clear. The chitosan solution was sonicated; pH was adjusted to 4.3 and filtered via a 0.44-μm syringe filter. Five milliliters of 1.0%chitosan solution was added to 5.0-mL deionized water and incubated with 3.0 mg rSAg dissolved in 1.0 mL 3- (N-morpholino) propanesulfonic acid (MOPS) buffer at pH 7.4. Consequently, 2.5 mL of 1.0% (w/v) tripolyphosphate (TPP) (Sigma, MO, USA) dissolved in 2.5-mL deionized water was added into the chitosan polymer solution with continuous magnetic stirring at room temperature (RT) (22℃) . The formulated SARS-COV-2 vaccine antigen was centrifuged at 10,000 rpm for 10 min, dispersed in MOPS buffer at pH 7.4, lyophilized with a cryoprotectant, and stored at -80℃.

Particle size and zeta potential of empty and vaccine antigen loaded NPs were measured after dispersion in PBS (pH 7.4) and stored at 4℃ for at least 30 h by dynamic light-scattering (DLS) method using a zeta-sizer coupled with an MPT-2 titrator (Malvern) . During each vaccination, CNPs-rSAg were freshly prepared and used.

The morphology of NPs was obtained by using the cold field emission Hitachi S-4700 scanning electron microscope (SEM) . Briefly, the powder form of NPs was loaded on to aluminum stubs and coated with platinum prior to examination under the microscope. Protein loading efficiency in CNPs-rSAg was estimated indirectly by determining the difference between the initial amount of protein used for loading CNPs and the protein left in the supernatant. In vitro protein release profile in CNPs-rSAg suspended in PBS for up to 15 days was estimated and expressed as the cumulative percentage release of SARS-COV-2 antigen at each time point. In brief, CNPs-rSAg suspended in 500 μL PBS (pH 7.4) in triplicate in Eppendorf tubes was incubated at 37℃ in a revolving roller apparatus. At indicated time point, tubes were centrifuged, supernatant collected, and pellet was resuspended in fresh 500 μL PBS. Protein released on to the supernatant was estimated by micro-BCA protein assay kit (Thermo Scientific, MA, USA) and expressed as the percentage of cumulative protein released over the initial amount at time zero.

4.3.1 Preparation of Poly-Gamma-Glutamic Acid-Chitosan Nanoparticles

Using the poly-gamma-glutamic acid prepared in Example 1 and chitosan, nanoparticles to be used as an adjuvant were prepared.

Specifically, the poly-gamma-glutamic acid and chitosan were dissolved in a 0.85%NaC1 solution. The poly-gamma-glutamic acid solution and the chitosan solution were mixed with each other at a ratio of 1∶1-8∶1 (poly-gamma-glutamic acid: chitosan) , thereby preparing poly-gamma-glutamic acid-chitosan nanoparticles having a negatively charged surface. The particle size and surface charge of the prepared nanoparticles were measured using DLS (Dynamic Light Scattering) . As a result, it was seen that the prepared nanoparticles had a particle size of 200-300 nm and a surface charge of-20.8 mV (TABLE 1) . In addition, the surface morphology of the prepared nanoparticles was observed with an electron microscope.

TABLE 1 Particle size and surface charge of poly-gamma-glutamic acid-chitosan nanoparticles

4.3.2 Preparation of Poly-Gamma-Glutamic Acid-Chitosan Nanoparticles Using Various Orders of Addition of Target Protein

In order to verify whether the poly-gamma-glutamic acid-chitosan nanoparticles function as an adjuvant for increasing the production of an antibody to a corresponding protein, the pI value of the corresponding protein was examined and nanoparticles were prepared using various orders of addition of the protein. First, rSAg-FITC obtained by bonding the fluorescent material FITC to an rSAg protein having a pI value of 5.9 was bonded to poly-gamma-glutamic acid-nanoparticles. Specifically, the following two kinds of nanoparticles were prepared: nanoparticles prepared by mixing poly-gamma-glutamic acid with rSAg-FITC, then adding chitosan thereto; and nanoparticles prepared by mixing chitosan with rSAg-FITC, and then adding poly-gamma-glutamic acid thereto. The degree of bonding of rSAg in the prepared nanoparticles was observed with a fluorescence microscope.

The nanoparticle sample prepared by mixing chitosan with rSAg-FITC and then adding poly-gamma-glutamic acid thereto showed lighter fluorescence on the surface and inside thereof. This was believed to be because rSAg had a negative charge at neutral pH, and thus a larger amount of rSAg was introduced into the nanoparticle sample prepared by bonding rSAg to positively charged chitosan and then adding poly-gamma-glutamic acid.

4.4 Encapsulation of a Water-Soluble Antigen Dissolved in a Microemulsion System.

4.4.1 A water/oil microemulsion was prepared as follows: 1.0 ml isopropyl myristate was added to 1.4 ml of a surfactant mixture consisting of polyoxyethylene sorbitan monooleate (Tween 80) ∶sorbitan monolaurate (Span 20) ∶ethanol in a 45∶30∶25 volume ratio. Next, 0.6 ml of a 6% (w/v) rSAg solution was added and the mixture briefly vortexed until an optically clear, single phase solution resulted (it was confirmed that eosin was not soluble in the oil or the ethyl acetate prior to formulation of the microemulsion nanocapsules) .

Next, 1.0 ml of the microemulsion was dispersed into 10 ml of water-saturated ethyl acetate containing 250 mg poly (Chitosan) in a 50∶50 mole ratio (Chitosan low molecular) by using a Powergen 125 laboratory homogenizer (Fisher Scientific, Pittsburgh) at low speed. The mixture was then homogenized for two minutes followed by the addition of 20 ml of ethyl acetate-saturated water containing 1% (w/v) polyvinyl alcohol. The mixture was further homogenized for an additional 5 min. to form a coarse oil/water emulsion. This emulsion was poured slowly into 200 ml of distilled water while stirring with a magnetic stir bar. Stirring was continued overnight at room temperature and ambient pressure to allow evaporation of the organic solvent. Unencapsulated eosin was spectrophotometrically measured in the filtrate after filtering the nanoparticle suspension through a 0.02 micrometer pore diameter membrane (Whatman Anodisk) .

The resulting nanoparticles were found to contain 89.2%of the initial eosin, which represents a 2.9%eosin content by weight. Scanning electron micrographs indicated that the particles ranged from 200 to 600 nm in diameter.

4.4.2 Variation of Example 4.3.1

A water/oil microemulsion was prepared by adding 0.5 ml hexadecane to a surfactant mixture consisting of polyoxyethylene sorbitan monooleate (Tween 80) ∶sorbitan monolaurate (Span 20) ∶ethanol in a 45∶30∶25 volume ratio. To that mixture, 0.35 ml of a 6% (w/v) rSAg solution was added. Eosin was found not to be soluble in hexadecane under these conditions. Nanoparticles were formed and the eosin encapsulation was measured as described in Example 4.4.1. The amount of eosin incorporated into nanocapsules was 98%of the initial quantity added. The particle size distribution measured in electron micrographs was similar to that found in 4.4.1.

4.4.3. Variation of Example 4.4.1

Encapsulation of rSAg into Nanospheres Using Conventional Single Emulsion Techniques

For purposes of comparing the rSAg loading (encapsulation) efficiency of microparticles formed using the microemulsion technique of the present invention (e.g., as described in Examples 5 and 6 below) , microparticles formed using prior art techniques were formed as follows. This technique was used to compare drug loading levels with the present invention because the polymer solvent is miscible with water and will allow the admixture of aqueous rSAg solutions, whereas other related nanoparticle formation techniques are not compatible with the incorporation of aqueous drug solutions.

A solution was prepared containing 1.2 mg of rSAg in 0.5 ml distilled water. This solution was admixed with a polymer solution consisting of 120 mg poly (chitosan) 50∶50 mole ratio, 15.0 ml acetone, 0.5 ml methylene chloride, and 1.0 ml water. The mixture formed a clear, single phase. The solution was poured into 50 ml of water containing 250 mg polyvinyl alcohol with moderate stirring (magnetic stir bar rotating at approximately 100 rpm) . A bluish opalescent suspension immediately formed. The suspension was stirred overnight at ambient temperature and pressure to allow the organic solvents to evaporate.

A portion of the suspension was next separated from the surrounding liquid by filtration through a 0.02 micrometer pore membrane. The solids were washed with distilled water and solubilized with dimethyl sulfoxide (DMSO) . The DMSO solution was diluted with a solution of 0.1%sodium dodecyl sulfate (SDS) in 50 mM aqueous sodium hydroxide. Aliquots were assayed for rSAg activity using ACE2 antibody competitive inhibit assay. Encapsulation efficiency was determined by comparing the rSAg content of the washed nanoparticle suspension to the rSAg content of an equivalent volume of the unfractionated suspension that was solubilized with DMSO and diluted with the alkaline SDS solution. The encapsulation efficiency was calculated to be the ratio between the rSAg content of the washed nanoparticles and the whole suspension, and was found to be 0.5%. rSAg content was 0.01%by weight.

4.4.4 Variation of Example 4.4.1

Encapsulation of a Microemulsion Containing rSAg

A water/oil microemulsion was prepared by adding 2.5 ml isopropyl myristate to 3.65 ml of a surfactant mixture consisting of polyoxyethylene sorbitan monooleate (Tweon 80) ∶sorbitan monolaurate (Span 20) ∶ethanol in a 45∶30∶25 volume ratio. The oil and surfactant were blended together using a laboratory benchtop vortexer. Water, 1.45 mi, containing 250μg of rSAg was subsequently mixed with the oil/surfactant blend by brief vortexing to form the microemulsion.

A 1.0 ml aliquot of the microemulsion containing rSAg was then added to 10.0 ml of water-saturated ethyl acetate containing 250 mg poly (chitosan) in a 50∶50 mole ratio. The mixture was homogenized for ninety seconds, added to 20 ml of ethyl acetate-saturated water containing 5%(w/v) polyvinyl alcohol and then further homogenized for 5 min. until a coarse oil/water emulsion formed. This emulsion was next poured slowly into 200 ml of distilled water while stirring with a magnetic stir bar. Stirring was allowed to continue overnight at room temperature and ambient pressure to facilitate evaporation of the organic solvent.

The following morning, a 10 ml aliquot of the nanoparticle suspension was added to a dialysis bag composed of cellulose ester with a nominal molecular weight cutoff of 300 kD. The bag was dialyzed to equilibrium against distilled water. rSAg activity in the water was measured. The quantity of rSAg measured in the dialysate represented 0.1%of the total quantity of rSAg added, thus providing an encapsulation efficiency of 99.9%. rSAg loading was 1.7%by weight.

Accordingly, the results showed that the rSAg content of nanoparticles made using the microemulsion encapsulation technique was 170-fold higher than that of matrix-type nanoparticles made using the spontaneous emulsification method detailed in Example 4.4.3.

4.4.5 Variation of Example 4.4.1

A water/oil microemulsion was prepared by adding 1.5 ml ethyl oleate to 2.625 ml of a surfactant mixture consisting of polyoxyethylene sorbitan monooleate (Tween 80) ∶sorbitan monolaurate (Span 20) ∶ethanol in a 45∶30∶25 volume ratio. The oil and surfactant were blended together using a laboratory benchtop vortexer. Water, 0.975 ml, containing 168 μg of rSAg was subsequently mixed with the oil/surfactant blend by brief vortexing to form the microemulsion.

A 1.0 ml aliquot of the microemulsion containing rSAg was added to 10.0 ml of water-saturated ethyl acetate containing 250 mg poly (chitosan) in a 50∶50 mole ratio. The mixture was homogenized for ninety seconds, then added to 20 ml of ethyl acetate-saturated water containing 1%(w/v) poloxamer 188 (Pluronic F68) and further homogenized for 5 min. forming a coarse oil/water emulsion. This emulsion was poured slowly into 200 ml of distilled water while stirring with a magnetic stir bar. Stirring was allowed to continue overnight at room temperature and ambient pressure to facilitate the evaporation of the organic solvent. rSAg encapsulation was measured by the dialysis method described in example 3. The encapsulation efficiency was 91%and the rSAg loading was 2.6%by weight.

4.4.6 In Vitro Release ofrSAg from Nanoparticles Containing Microemulsion

A microemulsion was produced consisting of 2.5 ml isopropyl myristate, 4.7 ml of a Tween 80∶Span 20∶Ethanol (45∶20∶35) surfactant mixture, and 1.75 ml water containing 300 μg rSAg. Next, a 1.5 ml aliquot of this microemulsion was dispersed into 15 ml ethyl acetate containing 375 μg chitosan (50∶50 L∶G, mw 17,000 Daltons) using a liquid shear homogenizer for 1.5 min. While continuing homogenization, the dispersion was slowly poured into 30 ml aqueous 1%(w/v) polyvinyl alcohol which had been pre saturated with ethyl acetate. Homogenization was continued for an additional five minutes before pouting the resulting emulsion into 200 ml of distilled water while stirring with a magnetic bar. Stirring was continued overnight to allow evaporation of the organic solvent before the removal of unencapsulated rSAg from the nanoparticles by gel filtration. A quantity of mannitol, 2.5 g, was added to the cleaned nanoparticle suspension prior to freeze-drying to facilitate handling of the dried particles.

Approximately one gram of the dried nanoparticle formulation was added to 100 ml phosphate buffered saline containing 25%ethanol, covered, and incubated at 37℃. One ml of the particle suspension was removed at prescribed intervals and centrifuged at 20,000 X g for 30 min. Supernatants were collected and the rSAg content was measured using a commercial assay.

4.4.7 In Vivo Release of rSAg from Nanoparticles Containing Microemulsion

A microemulsion was produced consisting of 1.8 ml isopropyl myristate, 2.7 ml of a Tween 80∶Span 20∶Ethanol (45∶30∶25) surfactant mixture, and 0.9 ml water containing 135 mg rSAg. One ml of this microemulsion was dispersed into 10 ml of a 2.5% (w/v) chitosan solution in water-saturated ethyl acetate. The dispersion was mixed using a liquid shear homogenizer for 1.5 min. Next, the dispersion was slowly poured into 20 ml ethyl acetate-saturated water containing 0.1% (w/v) polyvinyl alcohol, and homogenized under the same conditions for an additional 5 minutes. An additional 170 ml of distilled water was slowly poured into the emulsion. The vessel was stirred on a magnetic stir plate at room temperature overnight to allow evaporation of the organic solvent.

After evaporation, an aliquot of the suspension was filtered through a 0.02 micron filter, and the rSAg content of the filtrate was measured using ? assay. Encapsulated rSAg was found to be 94%of the total amount of drug added at the beginning of the encapsulation process. The formulation was freeze-dried and resuspended in a small volume of water to a concentration of 812 μg rSAg per ml, and injected subcutaneously into male Sprague Dawley rats weighing approximately 300 grams. One ml of blood was drawn from the tail vein prior to nanocapsule injection and at intervals thereafter. Plasma was separated and assayed for rSAg content using. Table2 shows rSAg blood levels in Units/ml plasma at each time point.

TABLE 2 rSAg concentration in rat plasma after subcutaneous injection

The increase in plasma rSAg noted at 48 hours post injection is significant at P ∠0.05.

4.5 Preparation of SARS-COV-2 Vaccine antigen Antigen/chitosan Composition

4.5.1 2%w/v aqueous solution of medium viscosity chitosan glutamate was prepared. 1L of chitosan solution was emulsified (8000 rpm/10 min) into 1Lof soya oil. 10L of 10%w/v sodium hydroxide solution was added and stirring continued at 8000 rpm for 5 min. The mixture was then mixed with a magnetic stirrer bar for a further 30 min. The nanospheres were collected by centrifugation and washed with petroleum ether, then ethanol, and finally hot distilled water. Nanospheres of mean diameter 25μm were obtained with a surface charge of +3.7 mV.

4.5.2 3%w/v aqueous solution of medium viscosity chitosan glutamate was prepared. 1L of chitosan solution was emulsified (8000 rprn/2 min) into a mixture of 1L of toluene and 10 g of Span 85.20 ml of 8%w/v glutaraldehyde solution was added and the emulsion left to gently mix, using a magnetic stirrer bar, for 12 hours. The nanospheres were collected by filtration, washed with toluene, and then ethanol, and left to dry.

4.5.3 2.5L of a solution of 0.2%w/v chitosan in 1%acetic acid was prepared. 20 ml of 4%glutaraldehyde solution was added and the solution was spray-dried (Lab-Plant SD 04 spray-drier) using a drying temperature of 160℃ and a flow rate of 5-10 ml/min. Chitosan nanospheres of 5μm diameter and a zeta potential of +5.7 mV were obtained.

4.5.5 A solution of 1%chitosan glutamate, a medium viscosity deacetylated chitin having approximately 11%residual N-acetyl groups, was prepared by dissolving the chitosan glutamate in 0.8%sodium chloride. SARS-COV-2 purified surface antigen (rSAg) containing δ variant recombinant S1 protein, was made up in phosphate buffered saline to give a protein concentration of approximately 1mg/ml. The rSAg consists almost entirely of the spike proteinl (rSAg) .

A 1∶1 mixture of the chitosan glutamate solution, and the rSAg solution was prepared to give an intranasal spray antigen delivery platform containing 0.3 %chitosan glutamate (11%acetylated) , 0.8%NaCl, 0.05%rSAg, and phosphate buffer to give a solution pH of 6.

B. Control solutions containing the same concentrations of rSAg but not chitosan glutamate, containing the same concentrations of chitosan but not rSAg, were also prepared.

4.6 Preparation of Chitosan Associated Antigen

2%solution of practical grade chitosan derived from crab shells, was prepared in 0.5 N sodium acetate at pH 5.0. Approximately 10-14 mg rSAg was dissolved in 4-5 ml 0.5 M sodium acetate buffer, pH 5.0, and 2 ml of the 2%chitosan solution. This antigen/chitosan mixture was added drop by drop to a beaker containing 25 ml 2-butanol, saturated with sodium acetate, with simultaneous stirring and sonication. After mixing, 2 ml 1 N NaOH was added one drop at a time to the mixture and sonication continued for 1-3 minutes. The resulting emulsion was transferred to a 50 ml beaker and cooled on ice for 5 minutes with occasional shaking. The emulsion was separated by centrifugation with a IEC centrifuge for 3-5 minutes, the top butanol layer was discarded, and 25 ml sterile phosphate buffered saline (PBS) was added to the aqueous layer which included the interface precipitate. The resulting emulsion was thoroughly mixed and the chitosan-antigen particles pelleted by centrifugation for 3-5 minutes. The supernatant was decanted and the pellet washed two times, each with 25 ml PBS. The wash solution was decanted, 25 ml PBS was added and the resulting suspension was mixed thoroughly. The suspension was continually sonicated as 20 μl 25%glutaraldehyde (Sigma, St. Louis, Mo. ) was added. After 2 minutes sonication, 15 ml cold, sterile PBS was added and the suspension was cooled on ice for 5-10 minutes. The chitosan associated antigen particles were pelleted by centrifugation for 5 minutes, the supernatant decanted, and the resulting pellet washed three times with 25 ml sterile PBS. The supernatant from the final wash was decanted and the pellet resuspended in 2-3 ml sterile PBS, and thoroughly mixed. This suspension of chitosan associated antigen was either used for immunization or subjected to further modification. Antigen/chitosan particles prepared by this method comprise antigen intercalated and crosslinked generally within the porous structure of the chitosan particles.

5. Conjugation of Peptide Antigen to Chitosan Particles

While the following procedure is exemplified in terms of formulating an rSAg/chitosan immunogen, those of ordinary skill in the art will readily appreciate that any of a number of other antigens can be employed.

In order to covalently attached antigen to the surface of chitosan particles, the chitosan particle/antigen suspension obtained from Example 4.5 was subjected to the following modification. A 1.667 μl aliquot of 5 mg/ml N-succinimidyl-3- (2-pyrydyldithio) propionate (SPDP) Pierce Chemical Company, Rockford, Ill. ) in dimethylsulfoxide (DMSO) (Sigma) was added to 1 ml of the suspension and allowed to react with the chitosan particles for at least 30 minutes, and usually up to one hour, with occasional mixing. The suspension was centrifuged and the supernatant decanted. The pellet was washed three times with 1 ml PBS and after the last wash, the suspension was centrifuged and the PBS discarded. An rSAg solution (1 ml at a approximately 1-2 mg peptide/ml) was added to the pellet, the suspension sonicated, and the mixture allowed to react overnight with gentle mixing at room temperature. Following overnight incubation, the suspension was centrifuged for 5 minutes and the supernatant decanted. The pellet was washed three times with 1 ml PBS per wash. Following the last wash, the suspension was centrifuged and the supernatant discarded. PBS (approximately 1 ml) was added and the suspension sonicated. The final suspension was stored at 4℃ until use.

6. CNPs-rSAg stability

The Measurements of Size and Zeta Potential CNPs-rSAg were characterized for the size of droplets by Dynamic Light Scattering (DLS) by measuring the z-average parameter. Zeta potential (ZP) was characterized by Electrophoretic Light Scattering (ELS) measurements. Both values were measured using Zetasizer Nano ZS (Malvern Panalytical, Malvern, UK) in Folded Capillary Zeta Cells (cat. DTS1070, Malvern Panalytical, Malvern, UK) . Each measurement was performed five times (five measurements of the same dilution of a test sample) using automatic mode at 25℃. Unless otherwise stated, NACs were diluted in 1 mM HEPES buffer pH 7 (Serva Electrophoresis GmbH, Heidelberg, Germany) to 0.1%just before the measurement. CNPs-rSAg Long Term Stability CNPs-rSAg were stored at 4 ℃ and observed up to 12 months for any sign of instability (disproportionation, creaming, sedimentation or coalescence) . Size and ZPs were measured at

time

0, 1, 2, 3, 4, 5, 6 and 12 months. The Shapiro Wilk test was applied to test changes in both size and ZP of CNPs-rSAg droplets stored for 12 months. The significance of the deviation from normal distribution (size and ZP) of CNPs-rSAg during the storage time was assigned based on the probability that the normal distribution was lower than 0.05 (p ＜ 0.05) .

Mucoadhesion

Mucin type III (porcine stomach, Sigma-Aldrich) was rehydrated for 30 min in 1 mM HEPES pH 7 at the concentration of 1 mg/mL, 0.1%CNPs-rSAg was incubated with or without mucin at the final protein concentration of 50 μg/mL for 5 min at RT prior to testing. Interaction of CNPs-rSAg with mucin was assessed by measurement of droplets size and ZP with and without mucin. Each measurement was repeated five times (five measurements of the same dilution of a test sample) . Experiment was repeated two times. Physicochemical Parameters and Stability of CNPs-rSAg

Three lots of them (designated as CNPs-rSAg 1, CNPs-rSAg 2 and CNPs-rSAg3) were selected and subjected to detailed characterization. We specifically focused on droplet size and ZP as these parameters are crucial for biological interactions like bioadhesion and particle engulfment by immune cells. Physicochemical characteristics of CNPs-rSAg is listed in Table 2 (at timepoint 0) . The polydispersity index (PDI) represents the droplets heterogeneity CNPs- rSAg 1 and CNPs-rSAg 2 are moderately dispersed and CNPs-rSAg 3 is highly dispersed. This notable correlation between droplet size and polydispersity of CNPs-rSAg was consistent with basic principle of fluid mechanics that larger emulsion droplets would also display greater variation size . Likewise, the ranges of charges reflected the properties of the cationic detergents used for CNPs-rSAg generation, resulting in ZP ranging from approximately 30 to 70 mV (Table 3, at timepoint 0) . We evaluated CNPs-rSAg stability in size (Table 2, (A) ) and ZP (Table 3, (B) ) during 12 months of storage, CNPs-rSAg were measured at each time point (0, 1, 2, 3, 4, 5, 6 and 12 month of storage) and the data was analyzed with Shapiro-Wilk normality test (p ＜ 0.05) . All the CNPs-rSAg passed the normality test indicating that they are stable in size and ZP during 12 months of storage. Therefore, all CNPs-rSAg 1-3 displayed optimal and stable physicochemical properties.

TABLE 3. Long-term stability of CNPs-rSAg.

CNPs-rSAg were measured at

time

0, 1, 2, 3, 4, 5, 6 and 12 months. (A) shows changes in size (nm) during 12 months of storage. PDI values are in the brackets. (B) shows changes in ZP (mV) during 12 months of storage. Average from five measurements ± SD.

Example 8: Toxicology Studies

Toxicology Study in Rabbits

A toxicology study was conducted as an initial evaluation of the use of NZW rabbits as an appropriate species in which to conduct the toxicity assessments to support dosing in humans. In this study, the immune response following three doses of recombinant CNPs-rSAg composition was evaluated in NZW rabbits. Two groups of animals (2 male rabbits per group) were immunized with either 120μg recombinant CNPs-rSAg formulated with chitosan at 0.5 mg/dose or with chitosan -only control formulation (0.5 mg/dose in PBS) , by intranasal injection. Animals were immunized on Days 0, 28 and 56, and the levels of neutralizing antibodies were determined at various time points throughout the study up to Day 84. The third immunization was included to generate sera with high antibody titers for use as an assay development reagent and reference standard. Neutralizing antibody titers were measured using a TCID50 neutralization assay.

All animals that received the recombinant CNPs-rSAg elicited good immune responses, as indicated by the high reciprocal neutralizing antibody titers starting at Day 14 (after one immunization) and up to Day 84 at terminal bleed (after three immunizations) (Table 4) .

TABLE 4. Neutralizing antibody titers after three immunization intranasally

Reciprocal neutralizing antibody titers were highest at Day 42, 14 da ys after administering the second dose of recombinant CNPs-rSAg. The third dose of SARS-COV-2 vaccine did not result in an increase in the reciprocal neutralizing titers measured at Day 84, No neutralizing antibodies were detected in animals in the chitosan control group, control group at all-time points assayed.

The results demonstrate the appropriateness of the NZW rabbits as a species in which to conduct the GLP toxicology study, as demonstrated by the high levels of neutralizing antibodies following immunization with the recombinant CNPs-rSAg.

GLP Toxicology Study and Local Tolerance

The toxicity of the CNPs-rSAg was further evaluated in NZW rabbits. In addition, local tolerance of the vaccine was evaluated. The objectives of this study were to assess the toxicity and local tolerance of the CNPs-rSAg following repeated intranasal immunizations and to assess the reversibility of any effects over a two-to-four-week treatment free period. The test articles used in this study were the low dose and high dose CNPs-rSAg compositions, consisting of 30μg SARS-COV-2/dose and 120 μg rSAg/dose respectively, formulated with chitosan, nanoparticles at 0.5 mg/dose

The controls included were normal saline placebo (PBS) and a chitosan -only adjuvant formulation (0.5 mg/dose) , the latter referred to as the Vaccine Placebo in this study. The test articles and controls were given as intranasal injections on Day 0 and Day 28 for animals in all Groups. Animals in Group 4 (Vaccine High Dose) received an additional immunization on Day 42, which exceeds by one dose the intended two dose regimen in the Phase 1 study. All animals were observed for any gross clinical changes, local reactions at the site of injection, mortality and morbidity, clinical pathology, hematology, clinical chemistry, gross pathology and histopathology.

In relation to overall CNPs-rSAg toxicity, both the low dose (30 μg/dose) and the high dose (120μg/dose) compositions given by intranasal injections to NZW rabbits on two and three occasions, respectively, did not result in mortality or morbidity and there were no treatment related significant alterations in hematology or clinical chemistry. In addition, there were no treatment related changes in mean body weight, food consumption, respiratory rate or rectal temperature as well as gross pathological examination, absolute and relative organ weights. Furthermore, there was no treatment related neurotoxicity, renal or hematological adverse effects observed in the study. With regards to local tolerance, no erythema or edema was observed in any animals. Microscopically, some nasal lesions at the site of injection were not observed, nasal degeneration, with or without mononuclear cell (MNC) /eosinophil infiltration, was not observed in a sub-population of animals in all groups receiving compositions containing chitosan nanoparticles. Nasal degeneration with or without MNC/eosinophil infiltration was not observed in group G1, which received the normal saline placebo (PBS) .

Different histopathological changes were observed in visceral organs of animals in the Vaccine Low Dose and Vaccine High Dose groups, which were comparable with the Vaccine Placebo and Normal Saline groups. Furthermore, the lesions were considered nonspecific, not significant and did not follow any pattern and as such, these changes were considered as spontaneous or incidental in nature.

The results indicate that local reactions, typical of chitosan formulated vaccine preparations, were observed at the site of spray, with the low and the high dose rSAg compositions as well as with the chitosan -and control formulation and were found to be reversible. In addition, both the low and high dose CNPs-rSAg compositions did not induce any treatment related physiological or pathological changes. Overall, the results of this study demonstrate that the CNPs-rSAg was safe and well tolerated.

EXAMPLE 9

Mice Immunization

A. The four compositions prepared as described in Example 6 were administered to groups of twelve adult (6-8 weeks) female BALB/c mice as follows:

Group 1: 20μl (10μl per nostril) CNPs-rSAg solution administered intranasally. (CNPs-rSAg dose=60μg) .

Group 2: 20μl CNPs-rSAg administered intranasally (CNPs-rSAg dose=120μg) .

Group 3: 20μl CNPs administered subcutaneously (chitosan dose=200μg)

Group 4: 20al rSAg solution administered intranasally (rSAg dose=200μg)

Group 5: 20μl PBS (10μl per nostril, ) administered intranasally.

B. The immunization procedure was carried out three times at monthly intervals, At each sampling point four mice from each group were terminally bled by cardiac puncture, their heads were removed and their nasal passages lavaged with 1 ml PBS+l%bovine serum albumin.

Antibody Assays

In all assays kill whole SARS-COV-2 virus vaccine (KWS2V) was used as antigen. Although WIV is only about 50%S1 the assays were thought to be measuring primarily anti-S antibodies. This assumption was confirmed by substituting rSAg (100%HA) for KWS2V and repeating some assays. The results were similar with either antigen. S-specific serum IgG and nasal IgA antibodies were measured by Enzyme Linked Immunosorbant Assay (ELISA) . After correcting for background, the individual optical density (OD) dilution curves were plotted and the titre values determined. The titre was determined as the dilution of serum that gave an OD reading of 0.2 or the dilution of nasal wash that gave an OD reading of 0.1.

As well as taking nasal washes at the third sample, lymphocytes were isolated from the mucous membranes of the nasal cavity and the lungs and the local immune response analysed by ELISPOT.

Results

1. Serum anti-S Serum Response

As expected a good serum response was elicited by intranasally immunization with CNPs-rSAg. All the animals tested had seroconverted after the primary immunization and the geometric mean titre (GMT) was good. The response increased after each boost, the GMT after the third dose was very high (about 800,000) . In contrast the serum response to rSAg alone administered intranasally was poor: only two of four mice had seroconverted after the first dose, none of the mice tested had serum S antibodies after the second dose (these are separate mice from those tested after the first immunization) and although all animals tested had seroconverted after the third dose the GMT was lower than that of animals receiving one dose of CNPs-rSAg. CNPs enhanced the serum response of intranasally administered rSAg; after the third vaccination the antibody response in mice that received CNPs-rSAg was 360-fold greater than that of mice receiving rSAg alone I/N. The magnitude of the serum response in the CNPs-rSAg mice was greater that of rSAg or CNPs immunized mice; in fact there was statistical difference in the GMTs of the two groups at any sampling point (Student′s t-Test p∠0.01) .

Some mice were immunized three times with rSAg alone administered intranasally to study whether this regime had advantages over the once monthly regime. Although all the mice in this group had detectable serum antibodies 21 days after the first dose and the GMT at this time point was greater than in mice that had received a single dose of rSAg intranasally, the number of mice seropositive decreased during the course of the study although the GMT did not (in this group the same mice were sampled at each time point) . At the final time point the GMT of the mice on the monthly regime was an order of magnitude greater than mice on the daily regime.

2. Nasal Wash IgA Anti-S Response

CNPs given subcutaneously was very good at inducing a nasal IgA response. rSAg alone given intranasally was a poor mucosal immunogen. Adding CNPs greatly boosted the IgA response, although the response was low after the first dose, S-specific IgA could be detected in three out of four mice. The IgA response was boosted greatly in these mice by the second immunization. The final immunization had little effect; in fact the mean specific IgA levels hard decreased slightly. The sera and nasal lavage fluid from the control mice immunized with chitosan alone were negative in all the assays.

Local Anti-S Antibody Secreting Cell Response (ASC) in Nasal and Pulmonary Tissues

Lymphocytes were isolated from the nasal mucosa and lung parenchyma of groups of four mice at the third sampling point. Lymphocytes from individual mice were pooled and assayed for cells secreting IgA, IgG and IgM anti-SARS-COV-2 antibodies using ELISPOT. B cells secreting S-specific antibodies were detectable in the nasal and lung tissue of all groups. There were far greater numbers of such cells in the CNPs-rSAg group and this is most apparent when the results are plotted on a linear scale. In all cases, IgA antibody secreting cells (ASC) predominated in the nasal cavity whereas either IgG or IgM predominated in the lungs. The magnitude of the response is similar in the lungs and nose of CNPs-rSAg mice.

EXAMPLE 10. CNPs-rSAg safety, efficacy in K18 Mice

Material and methods

Viruses and cells Vero E6 (CRL-1586, American Type Culture Collection (ATCC) , Vero-TMPRSS2, Vero (CCL-81, ATCC) and HEK293 (CRL-1573, ATCC) cells were cultured at 37℃ in Dulbecco’s Modified Eagle medium (DMEM) supplemented with 10%fetal bovine serum (FBS) , 10 mM HEPES pH 7.3, 1 mM sodium pyruvate, 1X non-essential amino acids, and 100 U/ml of penicillin-streptomycin. Vero-TMPRSS2 cells also were supplemented with 5 mg/mL of blasticidin. SARS-CoV-2 strain 2019n-CoV/GD_2020 (GD/2020) was obtained from the China Centers for Disease Control and Prevention. The virus was passaged once in Vero CCL-81 cells. The B. 1.617.1 variant was plaque purified from a mid-turbinate nasal swab, passaged twice on Vero-TMPRSS2 cells, and next-generation sequenced (spike substitutions: G142D, E154K, L452R, E484Q, D614G, P681R, Q1071H, and H1101D) . Virus inoculations were performed under anesthesia that was induced and maintained with ketamine hydrochloride and xylazine, and all efforts were made to minimize animal suffering. Female BALB/c (catalog 000651) and K18-hACE2 C57BL/6 (catalog 034860) mice were purchased from The Jackson Laboratory. All procedures involving mice were reviewed and approved by the Institutional Animal Care and Use Committee of Institute of Medical Biology, Chinese Academy of Medical Sciences, and performed in the ABSL-3 facility of Kunming National High-level Biosafety Primate Research Center. K18 Mice were used for the challenge study with authentic SARS-CoV-2. Animals were assigned to the following groups: (1) immunization with 120 μg CNPs-rSAg-SARS-COV-2 per dose (n = 5) ; (2) immunization with 60μg CNPs-rSAg-SARS-COV-2 per dose (n = 5) ; (3) treatment with PBS (control treatment, n = 5) ; K18 Mice were immunized with two injections on days 0 , 14 by intranasally and then challenged with SARS-CoV-2 intranasally (1ml, 10 ⁵TCID50/ml) on day 35 after the first vaccination. Blood samples were collected at 0, 9, 14, 21, 28 days after vaccination by retro-orbit (RO) route. The body weight of mice was monitored daily after challenge. The body temperature of mice were tested on day post challenge. All the mice were euthanized on day 5 post challenge and the lungs were used for viral load an after pathological analysis.

ELISA

Purified antigens (rSAg or RBD) were coated onto 96-well Maxisorp clear plates at 2 mg/mL in 50 mM Na2CO3 pH 9.6 (70 mL) overnight at 4℃. Coating buffers were aspirated, and wells were blocked with 200 mL of 1X PBS + 0.05%Tween-20 + 1%BSA + 0.02%NaN3 (Blocking buffer, PBSTBA) overnight at 4℃. Heat-inactivated serum samples were diluted in PBSTBA in a separate 96-well polypropylene plate. The plates then were washed thrice with 1X PBS + 0.05%Tween-20 (PBST) , followed by addition of 50 mL of respective serum dilutions. Sera were incubated in the blocked ELISA plates for at least 1 h at room temperature. The ELISA plates were again washed thrice in PBST, followed by addition of 50 mL of 1∶1,000 anti-mouse IgG-HRP (Southern Biotech Cat. #1030-05) in PBST or 1∶1000 of anti-mouse IgA-HRP in PBSTBA (SouthernBiotech) . Plates were incubated at room temperature for 1 h, washed thrice in PBST, and then 100 mL of 1-Step Ultra TMB-ELISA was added (ThermoFisher Cat. #34028) . Following a 10 to 12-min incubation, reactions were stopped with 50 mL of 2 M sulfuric acid. Optical density (450 nm) measurements were determined using a microplate reader (Bio-Rad) .

Measurement of SARS-CoV-2 Load

Infected mice were euthanized using a ketamine and xylazine cocktail, and organs were collected. Tissues were weighed and homogenized with beads using a MagNA Lyser (Roche) in 1 mL of Dulbecco’s Modified Eagle’s Medium (DMEM) containing 2%fetal bovine serum (FBS) . Viral RNA in the samples was quantified by one-step real time quantitative RT-PCR. The swab and blood samples were used to extract viral RNA by using the QIAamp Viral RNA Mini Kit (Qiagen, Hilden, Germany) , according to the manufacturer’s instructions. Tissues were homogenized in DMEM (1∶10, w/v) , clarified by low-speed centrifugation at 4500 ×g for 30 min at 4 ℃, and supernatant was immediately used for RNA extraction. RNA was eluted in 50 μL of elution buffer and used as the template for RT-PCR. SARS-CoV-2 RNA levels were measured by one-step quantitative reverse transcriptase PCR (qRT-PCR) TaqMan assay SARS-CoV-2 nucleocapsid (N) specific primers and probe sets were used: (N: F Primer: ATGCTGCAATCGTGCTACAA; R primer: GACTGCCGCCTCTGCTC; probe: /56-FAM/TCAAGGAAC/ZEN/AACATTGCCAA/3IABkFQ) (Integrated DNA Technologies) . Viral RNA was expressed as (N) gene copy numbers per milligram on a logl 0 scale.

immunological analysis.

Histopathology and Immunohistochemistry Animal necropsies were performed according to a standard protocol. Tissues for histological examination were stored in 10%neutral-buffered formalin for 7 days, paraffins bedded, sectioned, and stained with hematoxylin and eosin (H&E) prior to examination by light microscopy. To examine the SARS-CoV-2 antigen, paraffin dehydrated tissue sections were placed in antigen repair buffer for antigen retrieval in a microwave oven. The tissue was blocked with 5%BSA at room temperature for 1 h, following with house-made primary antibody at 1∶500 (rabbit anti-SARS-CoV-2 N protein polyclonal antibody) . After washed by PBS, the slices were slightly dried and covered with Cy3-conjugated goat-anti-rabbit IgG (Abcam) at 1∶200 dilution. The slides were stained with DAPI (5 lg/mL) after washing by PBS. The image was collected by Pannoramic MIDI system (3DHISTECH, Budapest, Hungary) .

Neutralizing Antibody Titer

To assess the neutralization of the SARS-CoV-2 infection, Vero E6 cells (5 × 10 ⁴) were seeded in 96-well plates and grown overnight. δ variant of SARS-CoV-2 (B. 1.617.1) 10 ⁶ the 50%tissue-culture infectious dose (TCID50) was preincubated with an equal volume of diluted sera from immunized monkeys before addition to cells. After incubation at 37℃ for 1 h, the mixture was added to Vero E6 cells. On day 3 after infection, cytopathogenic effects were recorded under the microscope and the neutralizing titer of the dilutions of sera that resulted in complete or EC50 inhibition were calculated.

Result:

CNP-rSAg Protects K18-hACE2 Mice from SARS-CoV-2 challenge

To evaluate the immunogenicity of CNP-rSAg for SARS-CoV-2, 6-8 weeks old female K18-hACE2 mice with either low doses (60μg) , high dose (120μg) of CNP-rSAg, or PBS, each comprising five mice, were immunized. Mice were injected with CNP-rSAg with D0/D14 immunization regimes and then challenged with 10 ⁵TCID50 per each SARS-CoV-2 virus. Body weight, temperature was monitored daily. Blood samples were collected at 0, 9, 14, 21, and 28 days after the intranasal injection, and also collected at each day after viral challenge. In our studies, we demonstrated that intranasally vaccination of K18-hACE2 mice against SARS-COV-2 variants, which involved spraying SARS-COV-2 antigens (120 μg) into the nasal cavity, could significantly induce serum and mucosal antibody responses. It has been shown that SARS-COV-2 antigens was less immunogenic in K18-hACE2 mice, and two doses of intranasal SARS-COV-2 subunit vaccines combined with chitosan as adjuvant have been prepared as pandemic vaccines. Therefore, we determined that the SARS-COV-2 vaccine would require at least two doses for the induction of sufficient immune responses by intranasal administration. Thus, we evaluated the immune response following two intranasal doses of an SARS-COV-2 subunit vaccine containing 60 μg rSAg. In addition, the impact of the addition of CNPs (amucoadhesive excipient that can increase the retention of vaccine antigens at the mucosal surface) on the vaccine-induced immune response was evaluated. Serum and nasal wash samples were collected at the time of each vaccination and 5 weeks after the first vaccinations (days 35, and the neutralizing antibody titers in the samples were measured. A moderate serum neutralizing antibody response and a moderate mucosal neutralizing antibody response against the virus strain, no significant difference was observed between antibody responses induced by vaccines with CNPs (Figure 1) . The duration of the local antibody response at the nasal mucosa was shorter than that of the serum antibody response. However, at 3 weeks after the second vaccination, prominent antibody responses could be observed in both the serum and nasal mucosa; 88.0% (with CNPs) of vaccinated mice showed a greater than fourfold increase in the serum antibody response, whereas 76.0% (with CNPs) showed a greater than fourfold increase in the mucosal antibody response. In addition, the geometric mean titer (GMT) of neutralizing antibodies increased 32-fold (with CNPs) or 15-fold (without CNPs) in the serum, and 10 -fold (with CNPs) or 4 -fold (without CNPs) in the nasal wash, compared with GMTs of neutralizing antibodies on day 0 in the serum and nasal wash, respectively. The increase in mucosal antibody titers was greater than the increase in serum antibody titers, suggesting that CNPs may enhance local antibody responses. These results suggest that two intranasal doses of a vaccine containing rSAg (60 μg) and CNPs could induce sufficient systemic and mucosal immune responses. Both SARS-COV-2 specific IgG and IgA antibodies were induced in the serum. However, only SARS-COV-2 -specific IgA antibodies, not IgG antibodies, could be detected in the nasal mucosa (Fig. 2) , These results suggest that both IgG and IgA antibodies contribute to the neutralizing antibody response in the serum, whereas only IgA antibodies are involved in the neutralizing antibody response in the nasal mucosa. Furthermore, the addition of CNPs to the vaccine antigen significantly increased the SARS-COV-2 -specific IgA antibody titers in nasal wash samples, indicating that the increase in neutralizing activity in mice administered CNPs-rSAg was due to an increase in SARS-COV-2-specific IgA antibody induction at the nasal mucosa. it was previously reported that neutralizing antibody titers in the nasal wash.

All mice were sacrificed 5 days after viral challenge and tested for lung viral load and pathology changes.

Virion specific antibodies were tested in ELISA and neutralizing antibody titers were determined. There was a robust increase of antibody responses from day 7 to day 21 in vaccinated groups, but no difference between the two dose groups. The similar pattern was observed in neutralizing antibody production, although the titer appears higher in high dose group at 14 days after vaccination) . The protective efficacy in vaccinated or sham vaccine mice were assessed. Upon challenge, there was no obvious weight loss changes among the three groups (Fig. 3) , but there was obvious temperature changes among the three groups (Fig. 4) . However, the amount of viral RNA copies in lung was undetectable in high dose group and significantly decreased in low dose group, in contrast to a high viral load in mock group (Fig. 4、5、6、7) .

To examine the disease severity and viral protein of SARS-CoV-2, the lungs in different groups were analyzed with H&E. Moderate pathological changes were observed in mock group, including the inflammatory infiltration at peri-bronchiolar and peri-vascular, alveolar wall thickening, and fibrin exudation (Fig. 8, Fig. 9) . In contrast, the pathological changes were almost absent in lung of high dose group, and much milder in low dose group. Collectively, the average pathology score was lower in the vaccinated mice than the mock mice (Fig. 10) .

Claims

Chitosan nanoparticles (CNPs) comprising an antigen mixed with an effective amount of a chitosan, wherein the chitosan has a molecular weight in a range of 10 kD to 500 kD, and the chitosan is more than 40%deacetylated.
The chitosan nanoparticles of claim 1, wherein the chitosan is present in a range of 0.02%to 10%by weight, preferably, the chitosan is present in a range of 0.1%to 5%by weight, more preferably, the chitosan is present in a range of 0.25%to 2%by weight.
The chitosan nanoparticles of claim 1, wherein the chitosan is a water-soluble chitosan.
The chitosan nanoparticles of claim 1, wherein the chitosan is 50%to 90%deacetylated.
The chitosan nanoparticles of claim 1, wherein the molecular weight of the chitosan is in a range of 50 kD to 300 kD, preferably, the molecular weight of the chitosan is in a range of 100 kD to 300 kD.
The chitosan nanoparticles of claim 1, wherein the nanoparticles have a pH in a range of 5.5 to 6.5, preferably, the pH is about 6.
The chitosan nanoparticles of claim 1, wherein, wherein the antigen is a SARS-CoV-2 recombinant spike protein, consisted of the truncated spike protein Val308 -Gly548.
The chitosan nanoparticles of claim 1, wherein the antigen is incorporated into the nanoparicles.
A method of producing the chitosan nanoparticles (CNPs) capable of enhancing an IgA mucosal immune response, the method comprising, (a) preparing a polymer substrate with a biodegradable polymer, wherein the biodegradable polymer is chitosan, wherein the chitosan is a natural or synthetic chitosan; (b) selecting an antigen that in cooperation with chitosan is capable of eliciting an antibody response specific to the antigen in a subject; and (c) encapsulating the selected antigen with the polymer substrate to produce the chitosan nanoparticle capable of eliciting greater mucosal immune response specific to antigen.
The method of claim 9, wherein the antigen is a SARS-CoV-2 recombinant spike protein, consisted of the truncated spike protein Val308 -Gly548.