WO2023166226A1 - Utilisations thérapeutiques d'inhibiteurs de la pcyox1 - Google Patents

Utilisations thérapeutiques d'inhibiteurs de la pcyox1 Download PDF

Info

Publication number
WO2023166226A1
WO2023166226A1 PCT/EP2023/055604 EP2023055604W WO2023166226A1 WO 2023166226 A1 WO2023166226 A1 WO 2023166226A1 EP 2023055604 W EP2023055604 W EP 2023055604W WO 2023166226 A1 WO2023166226 A1 WO 2023166226A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
polynucleotide
pcy0x1
cells
sequence
Prior art date
Application number
PCT/EP2023/055604
Other languages
English (en)
Inventor
Cristina BANFI
Saverio Minucci
Isabella Pallavicini
Original Assignee
Istituto Europeo Di Oncologia S.R.L.
Centro Cardiologico Monzino S.p.A.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Istituto Europeo Di Oncologia S.R.L., Centro Cardiologico Monzino S.p.A. filed Critical Istituto Europeo Di Oncologia S.R.L.
Publication of WO2023166226A1 publication Critical patent/WO2023166226A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0051—Oxidoreductases (1.) acting on a sulfur group of donors (1.8)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y108/00—Oxidoreductases acting on sulfur groups as donors (1.8)
    • C12Y108/03—Oxidoreductases acting on sulfur groups as donors (1.8) with oxygen as acceptor (1.8.3)
    • C12Y108/03005—Prenylcysteine oxidase (1.8.3.5)
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5011—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing antineoplastic activity
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/502—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
    • G01N33/5038—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects involving detection of metabolites per se
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/52—Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis

Definitions

  • the present invention concerns molecules capable of inhibiting or blocking the expression and/or function of prenylcysteine oxidase 1 (PCY0X1) for use in the treatment and/or in the prevention of cancer and/or metastases.
  • PCY0X1 prenylcysteine oxidase 1
  • PCY0X1 Prenylcysteine oxidase 1
  • PCYOX1 represents a new member in the panel of oxidizing enzymes involved in the pathogenesis of atherosclerosis (Banfi C, 2021).
  • Gene ablation of Pcyoxl in a murine model is associated with delayed progression of atherosclerotic injury, reduced plaque vulnerability, reduced body weight and improved lipid profile, lower levels of systemic and vascular lipid peroxidation, and finally a reduction in the inflammatory response in macrophages (Banfi C, 2021).
  • PCYOX1 is a FAD-dependent thioether oxidase that produces free cysteine, an isoprenoid aldehyde and a stoichiometric amount of H2O2 (Digits JA, 2002).
  • the role of PCYOX1 as a regulator of the oxidizing system is reinforced by proteomic analysis in silenced cells for Pcyoxl, in which the most relevant modulated processes were represented by the oxidative stress response and by the response to ROS.
  • PCYOX1 is a multifunctional protein potentially involved in a plethora of systems, including regulation of peptide activity, platelet degranulation, regulation of signal transduction, stress response, regulation of stimulus response, damage response (Banfi C., 2021).
  • Patent pplication WO2016107874 refers to PCYOX1 inhibitors for the prevention and/or treatment of degenerative diseases related to oxidative stress. There is still a need to provide molecules that can treat tumors, particularly highly aggressive tumors for which the treatment options are limited.
  • the present inventors found that deletion of PCY0X1 reduces the metastatic properties of the MD- MB-231 triple-negative tumor cell by reversing the mesenchymal phenotype of triple-negative, thereby inducing an epithelial tract.
  • the triple-negative subtype of breast cancer (BC) is a highly aggressive cancer for which treatment options are limited.
  • One of the mechanisms that gives metastatic properties to the cell is based on epithelial to mesenchymal transition (EMT).
  • EMT epithelial to mesenchymal transition
  • the epithelial to mesenchymal transition (EMT) contributes to the progression of metastatic cancer as it allows cancer cells to become migratory and invasive.
  • the reversal of the epithelial to mesenchymal transition (EMT) through the re-differentiation of the cancer cells represents a potential therapeutic challenge in order to improve the prognosis of patients.
  • PCY0X1 ablation/inhibition represents a promising pharmacological approach to reduce cell invasiveness, reverse EMT in BC, thus overcoming resistance to standard treatments.
  • the present invention refers to a molecule capable of inhibiting or blocking the expression and/or the function of prenylcysteine oxidase 1 (PCY0X1) for use in the treatment and/or in the prevention of cancer and/or metastases.
  • the molecule is selected from the group consisting of: a) polynucleotide capable of inhibiting the expression of the PCY0X1 gene or a polynucleotide coding for said polynucleotide; b) a polypeptide, preferably an antibody or a synthetic or recombinant derivative thereof; c) a polynucleotide coding for said polypeptide or a functional derivative thereof; d) a small molecule; e) a component of the CRISPR/Cas9 system, for example a sgRNA (single strand guide RNA, (“single guide RNA”)), a gRNA (guide RNA) or a guide sequence; and f) a component of the protein degradation system, for example by proteolysis, of the cell, for example of proteolysis targeting chimeras (for example, “proteolysis targeting chimera” (“PROTAC”)).
  • a component of the CRISPR/Cas9 system for example
  • the molecule is an antibody or a synthetic or recombinant derivative thereof.
  • Said antibody is preferably a monoclonal or polyclonal antibody, or synthetic or recombinant derivatives thereof, more preferably said antibody being a humanized monoclonal antibody.
  • said polynucleotide is an RNA or DNA.
  • the molecule is a polynucleotide capable of inhibiting the expression of the PCY0X1 gene, preferably an antisense construct, an RNA inhibitor, more preferably a siRNA, a shRNA, a microRNA, a sgRNA, a gRNA, a guide sequence or an antisense oligonucleotide, or a polynucleotide encoding it.
  • an RNA inhibitor more preferably a siRNA, a shRNA, a microRNA, a sgRNA, a gRNA, a guide sequence or an antisense oligonucleotide, or a polynucleotide encoding it.
  • the shRNA comprises SEQ ID NO: 6 or 9 or 12 or a derivative, variant or functional fragment thereof
  • the siRNA comprises at least one of the sequences selected from the group consisting of SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 13 and SEQ ID NO: 14, or a derivative, variant or functional fragment thereof.
  • the molecule is a shRNA consisting essentially of SEQ ID NO: 6, SEQ ID NO: 9 or SEQ ID NO: 12, a derivative, variant and functional fragment thereof or a siRNA consisting essentially of SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 13 or SEQ ID NO: 14, or a derivative, variant or functional fragment thereof.
  • the molecule is a sgRNA comprising or consisting essentially of SEQ ID NO: 15, 16 or 17 or a derivative, variant or functional fragment thereof.
  • the molecule is a sgRNA comprising a guide sequence comprising or consisting essentially of SEQ ID NO: 15, 16 or 17 or a derivative, variant or functional fragment thereof.
  • the molecule is a gRNA comprising or consisting essentially of SEQ ID NO: 15, 16 or 17 or a derivative, variant or functional fragment thereof.
  • a further object of the invention is a vector comprising or expressing the polynucleotide as defined herein for use in the treatment and/or prevention of tumor and/or metastases.
  • Another object of the invention is a genetically modified host cell capable of expressing in suitable conditions the polypeptide as defined herein or comprising the polynucleotide as defined herein or at least a component of e) or f) as defined herein or comprising the vector as defined herein for use in the treatment and/or prevention of tumor and/or of metastases.
  • a further object of the invention is a pharmaceutical composition
  • a pharmaceutical composition comprising the molecule or the vector or the cell as defined herein or a cell as defined herein and at least one pharmaceutically acceptable vehicle for use in the treatment and/or prevention of tumor and/or of metastases.
  • the tumor is preferably selected from the group consisting of: breast cancer, hepatocellular carcinoma, thyroid cancer, liver cancer, and any other PCYOX1- expressing tumor or with alterations in PCYOX1 levels.
  • a further object is a method for measuring the total activity of the PCYOX1 protein and/or for measuring the alteration of the activity of the PYCOX1 protein comprising the steps of: - incubation of the cell fraction, preferably a cell lysate, with a substrate of PCY0X1, preferably farnesylcysteine;
  • Another object of the invention is an in vitro method for evaluating the risk and/or for diagnosis and/or for prognosis and/or for monitoring the progression and/or for monitoring the efficacy of a therapeutic treatment and/or for screening a therapeutic treatment of a tumor and/or metastases, in a subject comprising the steps of: a) detecting or measuring the amount or activity of the PCY0X1 protein or of its fragments or of the polynucleotide encoding said protein or its fragments in an isolated biological sample obtained from the subject; and b) comparing with a proper control; wherein preferably step a) is carried out with the method described herein.
  • Another object of the invention is a kit for carrying out the method described herein, comprising:
  • a further object is the use of the kit of the invention for carrying out a method of the invention.
  • step a) comprises measuring the amount of the PCY0X1 protein or fragments thereof or of the polynucleotide coding for said protein or fragments thereof in said isolated biological sample obtained from the subject and step b) comprises comparing the measured amount of step a) with a proper control amount.
  • step a) of the methods defined above is carried out by means of the method for measuring the total activity of the PCY0X1 protein and/or for measuring the alteration of the activity of the PYC0X1 protein or by means of the method for detecting and/or for measuring the amount and/or measuring the alteration of the amount of PYC0X1 protein or fragments thereof as defined above.
  • the biological sample is a fluid, a cell or a tissue sample.
  • PCY0X1 is a protein and preferably has essentially the amino acid sequence described as NCBI Accession GI: 166795301, NP 057381.3 or SEQ ID NO:5 or 18.
  • PCY0X1 is a gene and preferably has essentially the nucleotide sequence described as NCBI Accession No. gi
  • PCYOX1 is an mRNA and preferably has essentially the nucleotide sequence described as NCBI Accession No.: NM_016297.3, NM_016297.4 or SEQ ID NO:3 or 4.
  • the molecules of the present invention e.g. gRNAs or sgRNAs, may further comprise or consist of a sequence substantially complementary to the sequences described herein or to portions thereof at least 15 nucleotides long, or to functional fragments of the sequences described herein, wherein such fragments are preferably at least 15 nucleotides long, preferably 17-18 nucleotides long, or to a variant thereof with at least 70%, preferably 85%, homology or identity to any of the sequences described herein.
  • the present invention also comprises the sequences mentioned herein in the reverse orientation, from 3’ to 5’.
  • the object of the invention is also at least one isolated ribonucleic acid guide (gRNA) or a sgRNA comprising or consisting of or being substantially complementary to or capable of perfectly pairing with the sequences described herein, or to portions thereof at least 15 nucleotides long.
  • Another obj ect of the invention is a nucleic acid encoding the gRNA or sgRNA or the fragments as defined above, preferably wherein said nucleic acid is functionally linked to a promoter sequence that is recognized by a phage RNA polymerase for RNA synthesis in vitro, preferably wherein said nucleic acid is part of a vector.
  • the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)- CRISPR 9-associated protein preferably comprises: a. a Cas9 protein or a nucleic acid encoding a Cas9 protein, and b. at least one gRNA or a sgRNA or at least one nucleic acid as defined herein, preferably wherein the system and a. or b.
  • the Cas9 protein is a Streptococcus pyogenes Cas9 (SpCas9) protein or a variant thereof, such as Cas9-VQRHF1, VQR, EQR, eSpcas9, xCas9, evoCas9, SpCas9HFl, HyPaCas9 or KamiCas9 or a Staphylococcus aureus Cas9 (SaCas9) or a homologue thereof, a recombination thereof of the naturally occurring molecule, a version in which the codons are optimized, or modified versions thereof, and the relative combinations.
  • AAV adeno-associated virus
  • Another object of the invention is a vector comprising at least one sgRNA or a gRNA or at least one nucleic acid or which comprises a CRISPR-Cas system as defined herein.
  • a further object is a pharmaceutical composition comprising at least one guide RNA or a sgRNA, at least one nucleic acid, a CRISPR/Cas9 system or at least one vector as defined above, and at least one pharmaceutically acceptable vehicle and/or excipient.
  • the cell of the invention may comprise the nucleic acid or a CRISPR/Cas9 system, or a vector as defined above.
  • the kit of the invention may comprise at least one gRNA or sgRNA as defined above or a nucleic acid as defined above and further optionally it may comprise a CRISPR/Cas9 protein or a nucleic acid encoding the CRISPR/Cas9 protein, preferably the kit comprises the CRISPR/Cas9 system as defined above.
  • the target DNA sequence comprises nucleotides complementary to the guide RNA and a motif adjacent to the trinucleotide protospacer (PAM).
  • PAM trinucleotide protospacer
  • molecule capable of inhibiting or blocking it is meant a molecule that makes a change in the expression and/or in the function of the target and includes the term “inhibitor”.
  • the change in expression and/or function is evaluated relatively to the normal or basal level of the target in the absence of the molecule, but in any case under similar conditions, and represents a decrease (even up to a zero or total depletion) in the normal/basal expression and/or function.
  • the inhibitors described herein may be compounds that are capable of interfering with the enzymatic activity of PCY0X1.
  • an "inhibitor” may refer to an agent that blocks, delays, or otherwise causes the inhibition of a physiological, chemical, or enzymatic action or function.
  • An inhibitor may cause at least a 5% decrease in the enzyme activity.
  • An inhibitor may also or alternatively refer to a drug, compound or agent that prevents or reduces the expression, the transcription or the translation of a gene or of a protein.
  • An inhibitor may reduce or impede the function of a protein, for example by binding to or activating/inactivating another protein or receptor.
  • PROTACs are small heterobifunctional molecules that selectively degrade PCY0X1 ("PROteolysis TARgeting Chimeras" or "PROTAC").
  • PROTACs including, but not limited to, molecular glue, Lysosome-Targeting Chimaera (LYTAC), and Antibody-based PROTAC (AbTAC), may comprise a PCY0X1 ligand (or a targeting moiety) conjugated to a degradation tag.
  • the linkage of the ligand to the degradation tag can be direct or indirect via a linker.
  • the degradation tags of the present disclosure include, e.g., thalidomide, pomalidomide, lenalidomide, VHL-1, adamantane, l-((4,4, 5,5,5-pentafluoropentyl)sulmyl)nonane, nutlin-3a, RG7112, RG7338, AMG232, AA-115, bestatin, MV-1, LCL161, and/or analogues thereof.
  • the terms "function” and "activity” are interchangeable here.
  • the inhibition or the blocking of the target expression and/or function may be assessed by any means known to the person skilled in the art.
  • the assessment of the expression level or of the presence of the target is preferably carried out with molecular biology techniques such as, "real time Polymerase Chain Reaction", qPCR, "microarray”, “bead arrays”, RNAse protection assay or Northern blot or cloning and sequencing.
  • the assessment of the function (or activity) of the target is e.g. carried out by assessing the generation of an oxidant in the presence of farnesylcysteine (FC).
  • FC farnesylcysteine
  • H202 hydrogen peroxide produced in the PCY0X1 reaction can be measured as previously described (Tschantz, Digits et al 2001), or with methods described herein.
  • the target is the gene, mRNA, cDNA, or its encoded protein.
  • the polynucleotides as described above, such as siRNAs, may further comprise dTdT or UU 3’- protrusions, and/or nucleotide and/or polynucleotide modifications as described herein.
  • the molecule of the invention or the siRNA according to the invention may comprise or consist of nucleotides 1-19 of SEQ ID NO: 7, 8, 10, 11, 13 or 14 or a functional derivative thereof capable of inhibiting PCYOX1 gene expression.
  • the molecule of the invention or the shRNA comprises or consists of SEQ ID NO: 6, 9 or 12, or a functional derivative thereof capable of inhibiting PCYOX1 gene expression.
  • the molecule of the invention or the siRNA comprises or consists of at least one of the sequences selected from the group consisting of: SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 13 and SEQ ID NO: 14 or a functional derivative thereof capable of inhibiting PCYOX1 gene expression.
  • the molecule of the invention or the sgRNA or guide sequence of the sgRNA comprises or consists of at least one of the sequences selected from the group consisting of: SEQ ID NO: 15-17 or a functional derivative thereof capable of inhibiting PCYOX1 gene expression.
  • Another object of the invention is an in vitro method for evaluating the risk and/or the diagnosis and/or the prognosis of a tumor and/or of metastases as described herein comprising the steps of: a) measuring the amount or activity of the PCYOX1 protein or of its fragments or of the polynucleotide encoding said protein or of its fragments in said isolated biological sample obtained from the subject; and b) comparing the measured amount or activity of step a) with a proper control amount or activity, wherein an amount or activity of said PCYOX1 protein or of its fragments or of said polynucleotide or of its fragments in the isolated biological sample obtained from the subject greater than the control amount or activity indicates that the subject is at increased risk of developing or is suffering from a tumor and/or from metastases.
  • Another object of the invention is a method in vitro for monitoring the progression and/or for monitoring the efficacy of a therapeutic treatment of a tumor and/or of metastases as defined herein, comprising the steps of: a) measuring the alteration of the amount or the alteration of the activity of the PCY0X1 protein or of its fragments or of the polynucleotide encoding said protein or of its fragments in said isolated biological sample obtained from the subject; and b) comparing the measured alteration of step a) with a proper control alteration.
  • the biological sample is a fluid, a cell or a tissue sample.
  • the control means may be used to compare the amount or the increase of the amount of the compound as defined above with an appropriate control. Proper control can be obtained, for example, with reference to known standards, from both a normal subject and from a normal population.
  • the means for measuring the amount of at least one compound as defined above are preferably at least one antibody, a functional analogue or its derivatives. Said antibody, functional analogue or its derivatives are specific for said compound.
  • the kit of the invention comprises:
  • the means capable of measuring PCY0X1 activity may be e.g. FC and means for measuring the amount of H2O2, labelled peptides (such as for examples the peptides as defined above) for measuring the amount of PCY0X1 by MRM.
  • kits according to the invention may further comprise customary auxiliaries, such as swabs, vehicles, markers, etc. and/or instructions for use.
  • the proper control may be a sample taken from a healthy patient or from a patient suffering from another disorder or pathology, and the proper control amount or activity may be the amount or the activity of the same protein or polynucleotide measured in a sample taken from a healthy patient or from a patient suffering from another disorder or pathology.
  • the disease course is monitored and the proper control may be a sample taken from the same subject at different times or from another patient, and the proper control amount or activity may be measured based on the amount or activity of the same protein or polynucleotide in a sample taken from the same subject at different times or from another patient.
  • the proper control may be a sample taken from the same subject before the start of the therapy or taken at several times during the course of therapy and the proper control amount or activity can be the amount or the activity of the same protein or polynucleotide measured in a sample taken from the same subject before the start of the therapy or taken at various times during the course of the therapy.
  • the proper control may be a sample taken from untreated subjects and from subjects treated with a substance to be tested or from subjects treated with a reference treatment and the proper control amount or activity may be the average of the amounts or of activity of the same protein or polynucleotide measured in samples taken from untreated subjects and from subjects treated with a substance to be tested or from subjects treated with a reference treatment.
  • the amount or the activity of said PCY0X1 protein or of said polynucleotide in the isolated biological sample obtained from the subject is less than or equal to the control amount or activity, it may indicate that the screened substance is effective for the treatment of the tumor or metastasis.
  • the expression "measure the amount” may be understood as measuring the amount (or the activity) or the concentration or the level of the respective protein and/or its mRNA and/or its DNA, preferably semi-quantitative or quantitative.
  • the measurement of a protein can be performed directly or indirectly.
  • the direct measurement refers to the measurement of the quantity or concentration of the biomarker, based on a signal obtained directly from the protein, and which is directly related to the number of protein molecules present in the sample.
  • This signal - which can also be referred to as an intensity signal - can be obtained, for example, by measuring an intensity value of a chemical or physical property of the biomarker.
  • the indirect measurements include the measurement obtained from a secondary component (e.g., a component other than the gene expression product) and a biological measurement system (e.g. the measurement of cellular responses, ligands, "tags” or enzymatic reaction products).
  • amount refers to but is not limited to the absolute or relative amount of proteins and/or mRNAs thereof and/or their DNA, and any other value or parameter associated therewith or which might result therefrom.
  • values or parameters comprise signal intensity values obtained from physical or chemical properties of the protein, obtained by direct measurement, e.g. intensity values in an immunological assay, mass spectroscopy or nuclear magnetic resonance.
  • values or parameters include those obtained by indirect measurement, for example any of the measurement systems described herein. The methods for measuring mRNA and DNA in samples are known in the art.
  • the cells in a test sample can be lysed and the mRNA levels in the lysates or in RNA purified or semi-purified from the lysates can be measured with any variety of methods familiar to the experts in the art. Such methods include hybridization assays using detectably labelled DNA or RNA probes (i.e., Northern blotting) or quantitative or semi -quantitative RT-PCR methodologies using appropriate oligonucleotide primers. Alternatively, quantitative or semi-quantitative in situ hybridization assays can be performed using, for example, non-lysed tissue sections or cell suspensions and detectably labelled (e.g., fluorescent or enzyme-labelled) DNA or RNA probes.
  • detectably labelled DNA or RNA probes e.g., fluorescent or enzyme-labelled
  • Rnase Protection Assay testing, cDNA and oligonucleotide microarrays, Difference of Representation (RD A) analysis, differential visualization, EST sequence analysis, and Serial Gene Expression Analysis (SAGE).
  • the subject may present the disease or be moving towards an aggravation of said disease.
  • the subject may not be affected by the disease or be moving towards an improvement of the disease, respectively.
  • the expression “detection” or “measurement of quantity” it is meant to measure the alteration of the molecule. Such alteration may reflect an increase or a decrease in the amount or in the activity of the molecules as defined above.
  • An increase in the protein or in the activity of PCY0X1 or of the polynucleotide coding for said protein may be related to an aggravation of the disease.
  • a decrease in the protein or in the activity of PCY0X1 or in the polynucleotide coding for said protein may be related to an improvement of the disease or to healing of the subject.
  • PCY0X1 protein or "PCY0X1” is intended to include also the corresponding protein encoded by a PCY0X1 orthologous or homologous gene, functional mutants, functional derivatives, functional fragments or analogues, isoforms thereof.
  • PCY0X1 gene or “PCY0X1” refer also to the corresponding orthologous or homologous genes, functional mutants, functional derivatives, functional fragments or analogues, isoforms thereof.
  • mutants of the protein are mutants which can be generated by mutating one or more amino acids in their sequences and which maintain their activity e.g. of degradation of prenyl cysteines with generation of H2O2.
  • the protein of the invention if required, may be modified in vitro and/or in vivo, for example by glycosylation, myristoylation, amidation, carboxylation or phosphorylation, and may be obtained, for example, by synthetic or recombinant techniques known in the art.
  • “functional” means for example “maintaining its activity” e.g. of degradation of prenylcysteines with generation of H2O2.
  • analogue as used herein referring to a protein means a modified peptide wherein one or more amino acid residues of the peptide have been substituted by other amino acid residues and/or wherein one or more amino acid residues have been removed from the peptide and/or wherein one or more amino acid residues have been removed from the peptide and/or wherein one or more amino acid residues have been added to the peptide. Such addition or removal of amino acid residues may occur at the N-terminus of the peptide and/or at the C-terminus of the peptide.
  • derivative as used herein in relation to a protein means a chemically modified peptide or an analogue thereof, wherein at least one substituent is not present in the unmodified peptide or an analogue thereof, i.e. a peptide which has been covalently modified. Typical modifications are amides, carbohydrates, alkyl groups, acyl groups, esters and the like. As used herein, the term “derivatives” also refers to longer or shorter polypeptides having e.g.
  • a “derivative” may be a nucleic acid molecule, such as DNA molecule, encoding the polynucleotide as defined above, or a nucleic acid molecule comprising the polynucleotide as defined above, or a complementary sequence polynucleotide.
  • the term “derivatives” also refers to longer or shorter polynucleotides and/or polynucleotides having e.g. a percent of identity of at least 41%, 50%, 60%, 65%, 70% or 75%, more preferably of at least 85%, e.g.
  • the term “derivatives” and the term “polynucleotide” also include modified synthetic oligonucleotides.
  • the modified synthetic oligonucleotides are preferably LNA (Locked Nucleic Acid), phosphorothiolated oligo or methylated oligo, 2’-O-methyl, 2’-O-methoxyethyl oligonucleotides and cholesterol-conjugated modified 2’-O-methyl oligonucleotides (antagomirs).
  • the term "derivative" may also include nucleotide analogues, i.e. a naturally occurring ribonucleotide or deoxyribonucleotide substituted by a non-naturally occurring nucleotide.
  • the modified nucleotide analogue can be positioned e.g. at the 5’ end and/or at the 3’ end of the nucleic acid molecule.
  • the nucleotide analogues may be selected from sugar or backbone modified ribonucleotides or nucleobase modified ribonucleotides, i.e. ribonucleotides, containing a non -naturally occurring nucleobase instead of a naturally occurring nucleobase.
  • derivatives also comprises nucleic acids that can be generated by mutating one or more nucleotides in their sequences, equivalents or precursor sequences.
  • derivatives also comprises at least one functional fragment of the polynucleotide.
  • fragments refers to polynucleotides preferably having a length of at least 1000 nucleotides, 1100 nucleotides, 1200 nucleotides, 1300 nucleotides, 1400 nucleotides, 1500 nucleotides.
  • the length is preferably 10, 11, 12, 13, 14, 15, 16, 17, 18,19, 20, 21 nucleotides.
  • fragment refers to polypeptides preferably having a length of at least 10 amino acids, more preferably at least 15, at least 17 amino acids or at least 20 amino acids, still more preferably at least 25 amino acids or at least 37 or 40 amino acids, and most preferably at least 50, or 100, or 150 or 200 or 250 or 300 or 350 or 400 or 450 or 500 amino acids.
  • the RNAi inhibitors as defined above are preferably capable of hybridizing in whole or in part with a specific PCYOX1 target sequence. Thus, RNAi inhibitors may be completely or partially complementary to all or part of the target sequence.
  • RNAi inhibitors can hybridize to the specified target sequence under medium-high stringency conditions.
  • RNAi inhibitor may be defined with reference to a specific sequence identity with respect to the reverse complement of the sequence to which it is targeted.
  • the antisense sequences or the molecules of the invention will typically have at least about 75%, preferably at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99% sequence identity to the reverse complements of their target sequences.
  • polynucleotide also refers to modified polynucleotides.
  • an "effective amount" of a composition is that sufficient to achieve a desired biological effect, in this case an improvement or the treatment of a tumor or metastasis.
  • the effective dosage will depend on the age, on sex, on health and on the weight of the recipient, on the type of concomitant treatment, if any, on the frequency of the treatment and on the nature of the effect desired.
  • the provided ranges of effective doses of the inhibitor or of the molecule of the invention e.g. from 1 mg/kg to 100 mg/kg, in particular administered systemically
  • the preferred dosage can be tailored to the individual subject, as is understood and can be determined by a person skilled in the art, without undue experimentation.
  • the administration of oligonucleotides of the present invention can be carried out with known methods, wherein a nucleic acid is introduced into a desired target cell in vitro or in vivo.
  • An aspect of the present invention comprises a nucleic acid construct comprised within a delivery vehicle.
  • a delivery vehicle is an entity by which a nucleotide sequence can be transported from at least one means to another.
  • the release vehicles can generally be used for the expression of the encoded sequences within the nucleic acid construct and/or for intracellular release of the construct. It is within the scope of the present invention that the delivery vehicle may be a vehicle selected from the group of RNA-based vehicles, DNA-based vehicles/vectors, lipid-based vehicles, viral-based vehicles and cell-based vehicles.
  • delivery vehicles include: biodegradable polymeric microspheres, lipid-based formulations such as liposome vectors, structure coating on colloidal gold particles, lipopolysaccharides, polypeptides, polysaccharides, pegylation of viral vehicles.
  • An embodiment of the present invention may comprise a virus as a delivery vehicle, wherein the virus may be selected from: adenoviruses, retroviruses, lentiviruses, adeno-associated viruses, herpesviruses, virus vaccines, foamy viruses, cytomegaloviruses, Semliki forest viruses, poxviruses, RNA virus vector and DNA virus vector.
  • viruses are well known in the art.
  • the commonly used gene transfer techniques include calcium phosphate, DEAE-dextran, transfection, electroporation and microinjection and viral methods.
  • Another technique for introducing DNA into cells is the use of cationic liposomes.
  • the commercially available cationic lipid formulations are e.g. Tfx 50 (Promega) or Lipofectamin 2000 (Life Technologies).
  • compositions are preferably for systemic, oral, local, preferably rectal or topical administration.
  • compositions of the present invention may be in the form of a solution, e.g., an injectable solution, a cream, an ointment, a tablet, a suspension, or the like.
  • the composition may be administered in any suitable manner, e.g. by injection, in particular by intraocular injection, by oral, topical, nasal, rectal application etc.
  • the vehicle may be any suitable pharmaceutical vehicle.
  • a vector is used, which is capable of increasing the efficiency of RNA molecules to enter target cells. Suitable examples of such vehicles are liposomes, in particular cationic liposomes.
  • the recombinant expression vector of the invention may be any suitable recombinant expression vector and may be used to transform or transfect any suitable host. Suitable vectors include those designed for propagation and expansion or for expression or both, such as plasmids and viruses.
  • the recombinant expression vectors of the invention can be prepared using standard recombinant DNA techniques. Constructs of expression vectors, which are circular or linear, can be prepared to contain a functional replication system in a prokaryotic or eukaryotic host cell.
  • the replication systems can be derived, for example, from CoIEI, 2 ⁇ plasmid, ⁇ , SV40, bovine papilloma virus, and the like.
  • the recombinant expression vector comprises regulatory sequences, such as transcription and translation start and stop codons, which are specific to the type of host (e.g., bacterium, fungus, plant or animal) into which the vector is to be introduced, as appropriate and taking into account whether the vector is DNA or RNA based.
  • the recombinant expression vector may include one or more marker genes, which allow the selection of transformed or transfected hosts.
  • the marker genes include the resistance to biocides, e.g., the resistance to antibiotics, to heavy metals, etc., the complementation in an auxotrophic host to provide prototrophy, and the like.
  • Marker genes suitable for the expression vectors of the invention include, for example, neomycin/G418 resistance genes, hygromycin resistance genes, histidinol resistance genes, tetracycline resistance genes, and ampicillin resistance genes.
  • the recombinant expression vector may comprise a native or regulatory promoter operably linked to the nucleotide sequence coding for the PCY0X1 inhibitor (including functional portions and functional variants thereof), or to the nucleotide sequence that is complementary to or hybridizes to the nucleotide sequence encoding the RNA.
  • the selection of the promoters e.g. strong, weak, inducible, tissue-specific and developmental specific, falls within the ordinary skill of the person skilled in the art.
  • the promoter may be a non-viral promoter or a viral promoter, for example a cytomegalovirus (CMV) promoter, a SV40 promoter, a RSV promoter and a promoter found in the long terminal repeat of murine stem cell virus.
  • CMV cytomegalovirus
  • the recombinant expression vectors of the invention may be designed for transient expression, for stable expression, or for both.
  • the recombinant expression vectors can be made for constitutive expression or for inducible expression.
  • compositions further materials as well as processing techniques and the like may be illustrated in Part 5 of Remington's Pharmaceutical Sciences, 20th Edition, 2000, Marek Publishing Company, Easton, Pennsylvania, which is incorporated herein by reference.
  • the molecules of the present invention may also be administered in sustained release forms or by sustained release drug delivery systems.
  • sustained release materials can also be found in the materials incorporated into Remington's Pharmaceutical Sciences.
  • pharmaceutical formulations may be prepared using a method generally known in the pharmaceutical art.
  • biological sample comprises a clinical sample and also comprises tissue obtained by surgical resection, tissue obtained by biopsy, cultured cells, cell supernatants, cell lysates, tissue samples, organs, bone marrow, blood, plasma, serum and the like.
  • sample in the context of the present teachings refers to any biological sample isolated from a subject.
  • a sample may include, without limitation, an aliquot of body fluid, whole blood, serum, plasma, solid tissue samples such as tissue biopsies or tissue cultures or cells derived therefrom and their progeny, synovial fluid, lymphatic fluid, ascites fluid, and interstitial or extracellular fluid.
  • sample comprises also the fluid in the spaces between the cells, including gingival crevicular fluid, bone marrow, cerebrospinal fluid (CSF), saliva, mucous membranes, sputum, semen, sweat, urine or any other body fluid.
  • Bood sample may refer to whole blood or any fraction thereof, including serum and plasma.
  • the samples may be obtained from a subject by means including but not limited to venous sampling, excretion, ejaculation, massage, biopsy, aspirated needle, washing, scraping, surgical incision or surgery or other means known in the art.
  • the term "genetically modified host cell” concerns host cells that have been transduced, transformed or transfected with the polynucleotide or with the vector described above.
  • suitable host cells include bacterial cells such as E coli, Streptomyces, Salmonella typhimurium, fungal cells such as yeast, insect cells such as Sf9, animal cells such as CHO or COS, plant cells, etc.
  • said host cell is an animal cell, and more preferably a human cell.
  • Further evaluation methods include whole transcriptome analysis, mass spectrometry analysis to identify proteins interacting with the target.
  • the present invention further provides two methods for reducing the amount of PCY0X1 protein, wherein a PCY0X1 inhibitor is used, for example a short hairpin RNA (shRNA) or CRISPR/Cas9 technology.
  • a PCY0X1 inhibitor for example a short hairpin RNA (shRNA) or CRISPR/Cas9 technology.
  • CRISPR system refers collectively to transcripts and other elements involved in the expression or in the direction of the CRISPR-associated gene (“Cas") activity, including the sequences encoding a Cas gene, a guide sequence (also called a “spacer” in the context of an endogenous CRISPR system), or other sequences and transcribed from a CRISPR locus.
  • a guide sequence also called a "spacer” in the context of an endogenous CRISPR system
  • one or more elements of a CRISPR system are derived from a particular organism comprising an endogenous CRISPR system, such as Streptococcus pyogenes.
  • a CRISPR system is characterized by elements that promote the formation of a CRISPR complex at the site of a target sequence (also called a protospacer in the context of an endogenous CRISPR system).
  • target sequence it is meant a sequence on which a guide sequence is designed to have complementarity, where hybridization between a target sequence and a guide sequence promotes the formation of a CRISPR complex. Full complementarity is not necessarily required, provided that there is sufficient complementarity to cause hybridisation and to promote the formation of a CRISPR complex.
  • a target sequence may comprise any polynucleotide, such as DNA or RNA polynucleotides.
  • a target sequence is located in the nucleus or in the cytoplasm of a cell.
  • the target sequence may be within an organelle of a eukaryotic cell, e.g., mitochondria or chloroplast.
  • a sequence or a pattern that can be used for recombination in the target locus that comprises the target sequences is referred to as an "editing pattern” or “editing polynucleotide” or “editing sequence.”
  • an exogenous pattern polynucleotide may be referred to as an "editing pattern.”
  • the recombination is a homologous recombination.
  • a vector comprises one or more insertion sites, such as a recognition sequence of the restriction endonuclease (also referred to as a "cloning site").
  • one or more insertion sites e.g., about or more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more insertion sites
  • a single expression construct can be used to target the CRISPR activity to more different and corresponding target sequences within a cell.
  • a single vector may comprise about or more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or more guide sequences.
  • about or more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more of such vectors containing guide sequences may be provided, and possibly introduced into a cell.
  • a guide sequence is any polynucleotide sequence that has sufficient complementarity to a target polynucleotide sequence to hybridize with the target sequence and to directly link a specific sequence of a CRISPR complex to the target sequence.
  • the degree of complementarity between a guide sequence and its corresponding target sequence when optimally aligned using a suitable alignment algorithm, is about or more than about 50%, 60%, 75%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, or more.
  • the optimal alignment can be determined using any suitable algorithm for sequence alignment, including, for example, the Smith -Waterman algorithm, the Needleman-Wunsch algorithm, algorithms based on the Burrows- Wheel er Transformation (e.g.
  • a guide sequence is about or more than 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 23, 24, 25, 26, 27, 28, 29, 30, 35, 35, 40, 45, 50, 75, or more nucleotides in length. In some embodiments, a guide sequence is less than about 75, 50, 45, 40, 35, 30, 25, 20, 15, 12, or fewer nucleotides in length.
  • the target sequence can be 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% homologous to the nucleotide sequences set forth herein.
  • the term “homologous” refers to "% homology" and is used herein interchangeably with the term “% identity”, and refers to the level of identity of the nucleic acid sequence when aligned with a sequence alignment software. For example, as used herein, 80% homology means the same thing as 80% sequence identity determined by a defined algorithm, and consequently a homologue of a given sequence may have a sequence identity greater than 80% over a given sequence length.
  • sequence identity examples include, but are not limited to, about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or more sequence identities to the sequences set forth in SEQ ID NOs: 1-18.
  • polynucleotide refers to a polymeric form of nucleotides of any length, whether deoxyribonucleotides or ribonucleotides, or analogues thereof.
  • chimeric RNA chimeric guide RNA
  • guide RNA single guide RNA
  • synthetic guide RNA synthetic guide RNA
  • guide sequence refers to the polynucleotide sequence comprising the guide sequence.
  • guide sequence preferably refers to the approximately 20 bp sequence within the guide RNA that specifies the target site and may be used interchangeably with the terms “guide” or “spacer” or “crRNA” ("spacer").
  • sgRNA single guide RNA
  • gRNA single guide RNA
  • gRNA single guide RNA
  • gRNA single guide RNA
  • variable should be understood as a set of qualities that have a pattern that deviates from what happens in nature.
  • “Complementarity” means the ability of a nucleic acid to form a hydrogen bond with another nucleic acid sequence by both the traditional Watson-Crick type and other non-traditional types.
  • a percentage complementarity indicates the percentage of residues in a molecule of nucleic acid that can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 70%, 80%, 90% and 100% complementary).
  • Perfectly complementary means that all contiguous residues of a nucleic acid sequence will bind hydrogen with the same number of contiguous residues in a second nucleic acid sequence.
  • substantially complementary refers to a degree of complementarity that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%. 97%, 98%, 99%, or 100% over a region of 8, 9, 10, 11, 12,
  • the shRNA used in the present invention is preferably a pool of 3 different shRNA plasmids: sc-76093-SHA:
  • the Crispr/Cas9 component used in the present invention is preferably one of the following sequences: crRNA sequence (Hs.Cas9.PCYOXl.l.AA) Position 70261341
  • CTACCCACATGTGCATACGG SEQ ID NO: 15
  • crRNA sequence Hs.Cas9.PCYOXl.l.AB
  • the vector of the invention also includes an RNAi-inducing vector whose presence within a cell results in the production of a siRNA or shRNA or miRNA.
  • siRNAs or shRNAs in any combination or systems based on CRISPR/Cas9 technology targeting PCYOX1 may be used.
  • Such polynucleotides may be single- or double-stranded.
  • a strand of a double-stranded polynucleotide comprises at least one partial sequence complementary to a target mRNA.
  • the nucleotides of the inhibitory nucleic acid may be chemically modified, natural or artificial.
  • the sequence homology between the polynucleotide (e.g., a RNAi-inducing agent) and the targeted PCYOX1 mRNA may be 100% or less, but is ideally greater than about 50% and typically 90% or greater and even more preferably at least 98% and 99%.
  • RNAi-inducing agent e.g. siRNA
  • target mRNA preferably under cytoplasmic conditions.
  • the transport and the release of an effective amount of the polynucleotide according to the invention may be made with any suitable known method, such as cationic polymers, modified cationic polymers, peptide molecular vehicles, lipids, liposomes and/or non-cationic polymers.
  • Viral vectors may also be used.
  • an alternative route of administration comprises the direct delivery of the polynucleotide (including siRNA, shRNA and miRNA) and also antisense RNA (asRNA) into gene constructs followed by the transformation of cells with the resulting recombinant DNA molecules.
  • Such an alternative route of administration may involve the use of a lentiviral vector comprising a nucleotide sequence encoding a siRNA (or shRNA) that targets PCYOX1.
  • a lentiviral vector may be comprised within a viral particle.
  • Adeno- associated viruses may also be used.
  • the molecules described herein may be used in combination with one or more additional therapeutic regimens including, but not limited to, surgery, chemotherapy, radiation therapy, hormone therapy, targeted therapy, and immunotherapy.
  • the targeted therapeutic regimens include the use of agents such as MEK inhibitors, ERK inhibitors, hormone therapy, and RAS(G12C) inhibitors.
  • MEK inhibitors include, but are not limited to, trametinib, cobimetinib, binimetinib, selumetinib, PD-325901, CI-1040, PD035901, and TAK-733.
  • ERK inhibitors include, but are not limited to, ulixertinib, BVD-523, CC-90003, GDC-0994, and MK-8533.
  • RAS(G12C) inhibitors include, but are not limited to, AMG 510 and MRTX849.
  • a "variant" of an oligonucleotide (such as an oligonucleotide probe or primer) has a length similar to a particular oligonucleotide (within 5 nucleotides) and hybridizes to substantially the same region of the particular oligonucleotide.
  • the variant oligonucleotide hybridizes under stringent conditions to a particular oligonucleotide.
  • RNA molecules identical to said polynucleotides except that the RNA sequence contains uracil instead of thymine and the backbone of the RNA molecule contains ribose instead of deoxyribose, RNA sequences complementary to the sequences described therein, functional fragments, mutants and their derivatives, proteins encoded by them, functional fragments, mutants and their derivatives are also included in the invention.
  • complementary sequence refers to a polynucleotide that is not identical to the sequence but has a base sequence complementary to the first sequence or encodes the same amino acid sequence as the first sequence.
  • a complementary sequence may include DNA and RNA polynucleotides.
  • derivatives as used herein also refers to more or less long polynucleotides/proteins and/or having e.g. a percent identity of at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, more preferably of at least 99% with the sequences described herein.
  • identity of at least 70% means that the sequence identity may be at least 70%, or 75%, or 80%, or 85% or 90% or 95% or 100% with respect to the reference sequences. This applies to all identity % mentioned. Preferably, the identity % refers to the entire length of the indicated sequence.
  • polynucleotides having the same nucleotide sequence as a polynucleotide exemplified herein except for nucleotide substitutions, additions or deletions within the polynucleotide sequence, so long as these variant polynucleotides maintain substantially the same relevant functional activity as the polynucleotides specifically exemplified herein (e.g., encode for a protein having the same amino acid sequence or the same functional activity encoded by the exemplified polynucleotide).
  • polynucleotides described herein should be understood as including mutants, derivatives, variants and fragments, as discussed above, of the specifically exemplified sequences.
  • the present invention also contemplates those polynucleotide molecules having sequences sufficiently homologous to the polynucleotide sequences of the invention such as to allow the hybridization with that sequence under standard stringent conditions and standard methods (Maniatis, T. et al, 1982).
  • the polynucleotides described herein may also be defined in terms of more particular identity and/or similarity ranges with the polynucleotides exemplified herein.
  • sequence identity will typically be greater than 60%, preferably greater than 75%, more preferably greater than 80%, and even more preferably greater than 90%, and may be greater than 95%.
  • the identity and/or the similarity of a sequence may be 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% or greater with respect to a sequence exemplified herein.
  • the term "subject" refers to a mammal, such as a human, but may also be another animal such as a pet (e.g., a dog, a cat, or the like), a farm animal (e.g., a cow, a sheep, a pig, a horse, or the like), or a laboratory animal (e.g., a monkey, a mouse, a rabbit, a guinea pig, or the like).
  • a pet e.g., a dog, a cat, or the like
  • a farm animal e.g., a cow, a sheep, a pig, a horse, or the like
  • a laboratory animal e.g., a monkey, a mouse, a rabbit, a guinea pig, or the like.
  • PCYOX1 is preferably characterized by a sequence selected from the group consisting of SEQ ID NO: 1-5 or 18.
  • molecules of the invention or inhibitors preferably comprise, are comprised or consist of a sequence selected from the group consisting of SEQ ID NO: 6-17 or of a corresponding RNA or DNA sequence
  • the term comprising includes also the term consisting of or characterized by or consisting essentially of.
  • 1-5339 Homo sapiens prenylcysteine oxidase 1 (PCYOX1), mRNA
  • Figure 1 Growth of PCYOX1 KO (IB 10 and 4B9) and PCYOX1 WT (N7 and N10) cells.
  • Figure 2 Invasiveness of PCYOX1 KO (1B10) and WT cells (N7) in 24-hour matrigel (white bar) and 48-hour matrigel (black bar).
  • Figure 3 Morphology of MDA-MB-231 cells in which the PCYOX1 gene was eliminated thanks to the CRISPR/Cas9 system (PCYOX1 KO). 10x and 20x magnification. Negative, negative control cells, in which the scrambled gRNA sequence does not bind to the genomic DNA target and the Cas9/gRNA complex will not bind to the target of interest.
  • Figure 4 Representative image of immunofluorescence staining with Phalloidin showing the organization into actin stress fibers in control cells and PCY0X1 KO cells. The positivity of the cells with stress fibers with respect to the total number of cells is expressed in graph.
  • Figure 7 effect of PCY0X1 gene deletion on adhesion to different substrates.
  • Intermediate panels show surface expression levels of integrin alpha and beta in control cells (neg) and PC Y0X1 -deleted cells (CRISP).
  • CRISP PC Y0X1 -deleted cells
  • the last panel shows the level of ITGA5 gene expression in control MDA-MB-231 cells (N7) and PCY0X1 gene-deleted cells (1B10 and 1E6).
  • FIG. 8 MDA-MB-231 cells treated with vehicle (A) or doxorubicin (A).
  • vehicle A
  • doxorubicin A
  • cells with PCY0X1 gene silencing show cytotoxicity following treatment with doxorubicin (B).
  • FIG. 9 Levels of MMP1 gene expression in MDA-MB-231 cells (clones N8, N10, N7, Ni l) and in PCYOXl gene-deleted cells (clones 2c9, 4b9, IblO, le6, 5b 11)
  • FIG. 10 Transcriptomic analysis performed on MDA-MB-231 cells demonstrates that the epithelial mesenchymal transition pathway is significantly downregulated in cells with PCYOX1 gene deletion. Similarly, the migration and adhesion processes were both downregulated with respect to control cells.
  • Figure 11 the graphs show tumor growth and the survival of the mice in which PC YOX1 -expressing control cells (NEGs) and two different PCYOX1 KO cell clones (1E6 and 1B10) were inoculated
  • Figure 12 Levels of Dkkl gene expression in control HepG2 cells (NEG) and in several PCYOX1 gene-deleted clones (le9, 2c 12, 2C11, lh4)
  • the human hepatome cell line, HepG2 was cultured as previously described (Banfi, C. 1999).
  • the Flp-InTM-CHO cell line containing a single integrated FRT site and stably expressing the lacZ- ZeocinTM fusion gene from the pFRT/lacZeo2 plasmid, was cultured according to the supplier's instructions (Flp-InTM-CHO R758-07, Technologies for Life, ThermoFisher Scientific).
  • the MDA- MB-231 cell line was cultured in high glucose DMEM medium containing glutamine, supplemented with penicillin/streptomycin and 10% fetal bovine serum. Stable transfection of PCYOX1 shRNA into HepG2 and MDA-MB-231 cells.
  • the stable gene silencing of PCY0X1 was obtained in HepG2 and MDA-MB-231 cells using shRNA plasmids (Santa Cruz Biotechnology), a pool of 3 target specific lentiviral vector plasmids, each encoding 19-25 nt shRNA (plus hairpin) (corresponding to SEQ ID NO: 6, 9 and 12 or to SEQ ID NOs:7, 8, 10, 11, 13 and 14) designed to decrease PCYOX1 gene expression.
  • a shRNA plasmid encoding for an encoded shRNA sequence that does not lead to specific degradation of any cellular message was used as a negative control (control cells). The cells were then cultured in complete medium containing puromycin to obtain selection.
  • gRNAs 3 different guide RNAs, gRNAs, (corresponding to SEQ ID NO: 15, 16 and 17) specifically targeted to PCYOX1, designed by IDT, complexed with ATTO550-labelled tracRNAs and using HiFi Cas9 Nuclease V3 (IDT). Transfection was performed according to the supplier's instructions using CrisprMAX lipofectamin (Thermo scientific). A construct not specific to any human sequence was used as a negative control. After transfection the cells were subjected to clonal selection to identify clones completely lacking PCYOX1.
  • PCYOX1 An empty pcDNA5/FRT vector and a custom pcDNA5/FRT: PCYOX1 (Invitrogen, Life Technologies) were transfected in Flp-In-CHO cells (R758-07, Invitrogen, Life technologies) with an expression vector pOG44 (V6005-20, Invitrogen, Life technologies) and clones expressing PCYOX1 were selected according to the Flip-In System protocol (K6010-01, Invitrogen, Life technologies). All experiments were performed using cells within 20 passages from transfection and selection, comparing PCYOX1 overexpressing cells with CHO cells transfected with empty vector, called control cells.
  • Cell proliferation was assessed using the cell proliferation ELISA, BrdU (Roche Diagnostics), according to the manufacturer's instructions.
  • the MTT test was based on the protocol described for the first time by Mosmann (Mosmann, T. 1983).
  • Hydrogen peroxide (H2O2) produced in the PCY0X1 reaction was measured as previously described (Banfi, C. 2009) using the Amplex Red kit (Life technologies) with variation of reaction temperature.
  • the cells were lysed in a hypotonic buffer (10 mmol/L Tris pH 7.3, 10 mmol/L KC1, 1.5 mmol/L MgC12), sonicated and centrifuged at 9000 g for 1 minute.
  • the cell lysates (50 pg) were incubated at 37°C in the reaction buffer, in the presence of the substrate PCYOX1 farnesylcysteine (125 ⁇ mol/L).
  • the conversion of Amplex Red from H2O2 to the resorufin oxidation product was measured following fluorescence on an Infinite 200 microplate reader (TECAN), equipped for excitation in the range of 530 ⁇ 12.5 nm and the detection of fluorescence emission at 590 ⁇ 17.5 nm.
  • TECAN Infinite 200 microplate reader
  • primer sequences used as normalizer were: 18S human sense: 5'-CGG CTA CCA CAT CCA AGG AA-3' (SEQ ID NO: 19); human 18s antisense: 5'-CCT GTA TTG TTA TTT TTC GTC ACT ACC T-3' (SEQ ID NO: 20); while the primers for the genes of interest were validated and provided by QIAGEN
  • the lysosome-enriched cell fraction was obtained according to the procedure described in the Lysosome Enrichment Kit for Tissue and Cultured (Thermo Scientific). The lysosome pellet was resuspended in 25 mmol/L ammonium bicarbonate buffer containing 0.1% Rapigest and then it was continued with protein digestion.
  • Proteomic analysis of the secretome samples was performed after dialysis, concentration and digestion as previously described (Brioschi, M. 2013) with slight variations. Briefly, the cell culture media of each condition were collected and the cell debris was removed by centrifugation. Then, the samples were dialyzed at 4°C using a 3500 Da molecular weight cut-off dialysis tube (Spectrum Laboratories) against 5 mmol/L NH4HCO3 containing 0.01% EDTA, followed by dialysis against water. After lyophilization, the secreted protein pellets were dissolved in 25 mmol/L NH4HCO3 containing 0.1% RapiGest (Waters Corporation), sonicated and centrifuged at 13000 x g for 10 minutes.
  • the samples (50 pg protein) were then incubated for 15 minutes at 80 °C and reduced with 5 mmol/L of DTT at 60 °C for 15 minutes, followed by carbamidom ethylation with 10 mmol/L of iodoacetamide for 30 minutes at room temperature in the dark. Then, 1 pg of sequencing grade trypsin (Promega) was added to each sample and incubated overnight at 37°C. After digestion, 2% of TFA was added to hydrolyze RapiGest and inactivate trypsin.
  • the tryptic peptides were used for mass spectrometry analysis, LC-MS E , performed on a hybrid quadrupole time-of-flight mass spectrometer (SYNAPT-XS, Waters corporation) coupled with a UPLC Mclass system and equipped with a nanoflow source.
  • SYNAPT-XS Hybrid quadrupole time-of-flight mass spectrometer
  • the samples were injected into a Symmetry Cl 8 nanoACQUITY Trap Column, 100 A, 5 ⁇ m, 180 ⁇ m x 2 cm (Waters Corporation, Milford, MA, USA) and subsequently routed to the HSS T3 C18 Analytical Column, 100 A, 1.7 ⁇ m, 75 ⁇ m x 150 mm (Waters Corporation, Milford, MA, USA) and analysed in "data independent" mode alternating high and low collision energy acquisitions, as previously detailed (Brioschi 2013; Roverso 2016). The statistical analysis was performed using Progenesis QIP v 4.1 (Nonlinear Dynamics). The targeted proteomic analysis was carried out using Proximity Extension Assay technology (PEA, Olink, Sweden).
  • the concentration of the analytes in the conditioned medium was performed by specific immunoenzymatic assays (e.g., Dkkl supplied by R&D System).
  • alpha alpha2, alpha3, alpha4, alpha5, alphaV, and alphavbeta3
  • beta beta2, beta3, beta4, beta6, alpha Vbeta5, and alpha5betal subunits
  • ECM554 kit (Merck) which is based on the Boyden chamber principle and allows to evaluate the amount of cells migrating through a porous insert with 8 um pores coated with ECMatrixTM, a mixture of proteins derived from the tumor of the Engelbreth Holm- Swarm mouse.
  • Cellular senescence was assessed by measuring beta-galactosidase activity using the Cellular senescence activity assay kit manufactured by Enzo Life Sciences following the manufacturer's instructions.
  • the cancer cells Prior to injection, the cancer cells were detached by trypsin, washed and resuspended in PBS up to a final concentration of 250,000 cells/10 ⁇ L. The cell suspension was then mixed with 10 ⁇ L of reduced growth factor Matrigel and kept on ice until injection.
  • DEGs Differentially expressed genes
  • PCYOX1 KO cells The invasiveness of PCYOX1 KO cells is significantly reduced after 24 and 48 hours after plating the cells in a matrigel plate ( Figure 2). Furthermore, in PCYOX1 KO cells the expression and the secretion of MMP1 is almost completely abolished (-90%), which suggests that metalloproteinases could contribute to the invasiveness of MDA-MB-231. In a similar way also the secretion of other metalloproteinase (e.g. MMP7 and MMP12) is reduced in PCY0X1 KO cells.
  • MMP7 and MMP12 other metalloproteinase
  • the morphology of the negative cells is typical of cells that grow in a disorganized manner and in continuous proliferation.
  • the deletion of PCY0X1 shows a monolayer of cells with epithelial celllike morphology, in single monolayer, with contact inhibition phenomenon ( Figure 3) and restoration of the senescence process (114 ⁇ 9 and 157 ⁇ 16 AU/mg protein in WT and PCY0X1 KO cells).
  • the analysis with a fluorescent dye capable of binding F-actin, Phalloidin allows to evaluate the presence of stress fibers, a phenomenon due to a remodelling of the actin cytoskeleton associated with an increase in cell movement during the transition from epithelial to mesenchymal (EMT).
  • EMT epithelial to mesenchymal
  • the actin is assembled into contractile stress fibers, which are organized structures consisting of parallel actin fibers in the control cells while in PCY0X1 gene-silenced cells this organization into stress fibers decreases (Figure 4).
  • the cancer cells use glycolysis as a metabolic pathway, even when a sufficient amount of oxygen is available. This dependence on aerobic glycolysis is called the Warburg effect and promotes tumorigenesis and progression of malignancy.
  • the gene deletion of PCY0X1 results in a significant reduction in the expression of hexokinase 2, one of the key glycolysis enzymes (Figure 5).
  • ROS reactive oxygen species
  • ITGA5 alpha5 integrin
  • PCY0X1 ablation in MDA-MB-231 cells results in a significant reduction in ITGA5 mRNA levels in two different clones, while ITGB1 expression is not affected ( Figure 7).
  • Doxorubicin is widely used as a chemotherapic agent as it kills rapidly proliferating cancer cells by inhibiting topoisomerase II.
  • vehicle and doxorubicin treated negative cells (concentration 1-4 micromolar)
  • panel B and C two different cell clones in which the PCYOX1 expression was decreased by CRISPR/Cas9, exposed to vehicle or doxorubicin (1-4 micromolar) ( Figure 8).
  • Doxorubicin treatment induces cytotoxicity in PCYOX1 gene-deleted cells.
  • Proteomic analysis of sub-cellular compartments show how PCY0X1 gene deletion inhibits the biosynthesis of important tumor mediators such as ENNP1 and SPANXB1.
  • Ontological analysis of PCYOXl-modulated protein classes indicates that PCYOXl is also involved in the immune response.
  • Hepatocellular carcinoma is a common form of liver cancer.
  • the Wnt DKK1 signalling protein is abundant in HCC and is associated with metastatic progression and poor prognosis in patients.
  • Gene silencing of PCYOX1 both by sh and by CRISPR/Cas9 in human hepatocarcinoma (HepG2) cells, results in a significant reduction in DKK1 protein and mRNA levels.
  • PCYOX1 gene deletion inhibits the release of downstream Dkkl targets such as MMP7 and cytokines implicated in tumorigenesis.
  • Dkkl targets such as MMP7 and cytokines implicated in tumorigenesis.
  • HUMAN PROTEIN ATLAS and Cancer Genome Atlas database most human cancers show weak to moderate PCY0X1 expression (e.g. thyroid and liver cancer) with some low- expression cancers (e.g. gliomas and lymphomas) https://www.proteinatlas.org/ENSG00000116005-PCYOXl/pathology.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Hematology (AREA)
  • General Engineering & Computer Science (AREA)
  • Urology & Nephrology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Toxicology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Pathology (AREA)
  • General Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Food Science & Technology (AREA)
  • Cell Biology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Virology (AREA)
  • Epidemiology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Un objet de l'invention concerne une molécule capable d'inhiber ou de bloquer l'expression et/ou la fonction de la prénylcystéine oxydase 1 (PCYOX1) destinée à être utilisée dans le traitement et/ou dans la prévention du cancer et/ou de métastases.
PCT/EP2023/055604 2022-03-04 2023-03-06 Utilisations thérapeutiques d'inhibiteurs de la pcyox1 WO2023166226A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
IT102022000004193 2022-03-04
IT202200004193 2022-03-04

Publications (1)

Publication Number Publication Date
WO2023166226A1 true WO2023166226A1 (fr) 2023-09-07

Family

ID=82019603

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2023/055604 WO2023166226A1 (fr) 2022-03-04 2023-03-06 Utilisations thérapeutiques d'inhibiteurs de la pcyox1

Country Status (1)

Country Link
WO (1) WO2023166226A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016107874A2 (fr) 2014-12-29 2016-07-07 Centro Cardiologico Monzino S.P.A. - Irccs Inhibiteurs de prénylcystéine oxydase 1 pour la prévention et/ou le traitement de maladies dégénératives liées au stress oxydatif et prénylcystéine oxydase 1 utilisée comme marqueur de diagnostic
CN112553332A (zh) * 2020-12-08 2021-03-26 青岛泱深生物医药有限公司 多个基因在肝癌诊断中的联合应用

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016107874A2 (fr) 2014-12-29 2016-07-07 Centro Cardiologico Monzino S.P.A. - Irccs Inhibiteurs de prénylcystéine oxydase 1 pour la prévention et/ou le traitement de maladies dégénératives liées au stress oxydatif et prénylcystéine oxydase 1 utilisée comme marqueur de diagnostic
CN112553332A (zh) * 2020-12-08 2021-03-26 青岛泱深生物医药有限公司 多个基因在肝癌诊断中的联合应用

Non-Patent Citations (20)

* Cited by examiner, † Cited by third party
Title
"NCBI", Database accession no. NC_000002.12:70258137-70281185
"Remington's Pharmaceutical Sciences", 2000, MARCK PUBLISHING COMPANY
BANFI CBAETTA RBARBIERI SSBRIOSCHI MGUARINO AGHILARDI SSANDRINI LELIGINI SPOLVANI GBERGMAN O: "Prenylcysteine oxidase 1, an emerging player in atherosclerosis", COMMUN BIOL, vol. 4, no. 1, 21 September 2021 (2021-09-21), pages 1109
BANFI, C.L. MUSSONIP. RISEM. G. CATTANEOL. VICENTINIF. BATTAINIC. GALLIE. TREMOLI: "Very low density lipoprotein-mediated signal transduction and plasminogen activator inhibitor type 1 in cultured HepG2 cells", CIRC RES, vol. 85, no. 2, 1999, pages 208 - 217
BANFI, C.M. BRIOSCHIS. BARCELLAA. PIGNIERIA. PAROLARIP. BIGLIOLIE. TREMOLIL. MUSSONI: "Tissue factor induction by protease-activated receptor 1 requires intact caveolin-enriched membrane microdomains in human endothelial cells", J THROMB HAEMOST, vol. 5, no. 12, 2007, pages 2437 - 2444
BANFI, C.M. BRIOSCHIS. BARCELLAR. WAITS. BEGUMS. GALLIA. RIZZIE. TREMOLI: "Proteomic analysis of human low-density lipoprotein reveals the presence of prenylcysteine lyase, a hydrogen peroxide-generating enzyme", PROTEOMICS, vol. 9, no. 5, 2009, pages 1344 - 1352, XP055261140, DOI: 10.1002/pmic.200800566
BRIOSCHI, M.S. LENTOE. TREMOLIC. BANFI: "Proteomic analysis of endothelial cell secretome: a means of studying the pleiotropic effects of Hmg-CoA reductase inhibitors", J PROTEOMICS, vol. 78, 2013, pages 346 - 361
CRISTINA BANFI ET AL: "Proteomic analysis of human low-density lipoprotein reveals the presence of prenylcysteine lyase, a hydrogen peroxide-generating enzyme", PROTEOMICS, vol. 9, no. 5, 27 February 2009 (2009-02-27), DE, pages 1344 - 1352, XP055261140, ISSN: 1615-9853, DOI: 10.1002/pmic.200800566 *
DIGITS JAPYUN HJCOATES RMCASEY PJ: "Stereospecificity and kinetic mechanism of human prenylcysteine lyase, an unusual thioether oxidase", J. BIOL. CHEM., vol. 277, 2002, pages 41086 - 41093, XP055261144, DOI: 10.1074/jbc.M208069200
DUNCAN R E ET AL: "Farnesol induces thyroid hormone receptor (THR) @b1 but inhibits THR-mediated signaling in MCF-7 human breast cancer cells", BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, ELSEVIER, AMSTERDAM NL, vol. 343, no. 1, 28 April 2006 (2006-04-28), pages 239 - 243, XP024923561, ISSN: 0006-291X, [retrieved on 20060428], DOI: 10.1016/J.BBRC.2006.02.145 *
HERRERA-MARCOS LUIS V. ET AL: "Prenylcysteine oxidase 1, a pro-oxidant enzyme of low density lipoproteins", vol. 23, no. 6, 1 January 2018 (2018-01-01), pages 1020 - 1037, XP055975108, Retrieved from the Internet <URL:https://pubmed.ncbi.nlm.nih.gov/28930587/> *
HERRERA-MARCOS LV ET AL.: "Prenylcysteine oxidase 1, a pro-oxidant enzyme of low density lipoproteins", FRONT BIOSCI, vol. 23, 2018, pages 1020 - 1037, XP055975088, DOI: 10.2741/4631
J. A. DIGITS ET AL: "Stereospecificity and Kinetic Mechanism of Human Prenylcysteine Lyase, an Unusual Thioether Oxidase", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 277, no. 43, 25 October 2002 (2002-10-25), US, pages 41086 - 41093, XP055261144, ISSN: 0021-9258, DOI: 10.1074/jbc.M208069200 *
KUSTATSCHER G, WILLS KL, FURLAN C, RAPPSILBER J.: "Chromatin enrichment for proteomics", NAT PROTOC, vol. 9, no. 9, 2014, pages 2090 - 9
LIANG SHUANG ET AL: "NADPH Oxidase 1 in Liver Macrophages Promotes Inflammation and Tumor Development in Mice", GASTROENTEROLOGY, vol. 156, no. 4, 10 April 2019 (2019-04-10), US, pages 1156 - 1172.e6, XP055972123, ISSN: 0016-5085, DOI: 10.1053/j.gastro.2018.11.019 *
MANCONE C ET AL.: "Proteomic analysis of human very low-density lipoprotein by two-dimensional gel electrophoresis and MALDI-TOF/TOF", PROTEOMICS, vol. 7, 2007, pages 143 - 154
MOSMANN, T: "Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays", J IMMUNOL METHODS, vol. 65, no. 1-2, 1983, pages 55 - 63, XP023973702, DOI: 10.1016/0022-1759(83)90303-4
PARK JIN SOO ET AL: "Farnesol induces apoptosis of DU145 prostate cancer cells through the PI3K/Akt and MAPK pathways", INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE, vol. 33, no. 5, 27 February 2014 (2014-02-27), GR, pages 1169 - 1176, XP055974501, ISSN: 1107-3756, DOI: 10.3892/ijmm.2014.1679 *
ROVERSO, M.M. BRIOSCHIC. BANFIS. VISENTINS. BURLINAR. SERAGLIAP. TRALDIA. LAPOLLA: "A preliminary study on human placental tissue impaired by gestational diabetes: a comparison of gel-based versus gel-free proteomics approaches", EUR J MASS SPECTROM (CHICHESTER, vol. 22, no. 2, 2016, pages 71 - 82
ZHANG LTSCHANTZ WRCASEY PJ: "Isolation and characterization of a prenylcysteine lyase from bovine brain", J. BIOL. CHEM., vol. 272, 1997, pages 23354 - 23359, XP055261145, DOI: 10.1074/jbc.272.37.23354

Similar Documents

Publication Publication Date Title
Guarnerio et al. Intragenic antagonistic roles of protein and circRNA in tumorigenesis
Peng et al. Antiproliferative effects by Let-7 repression of high-mobility group A2 in uterine leiomyoma
Kong et al. MicroRNA-140-3p inhibits proliferation, migration and invasion of lung cancer cells by targeting ATP6AP2
Ishiwata et al. State of heat shock factor 1 expression as a putative diagnostic marker for oral squamous cell carcinoma
Liu et al. miR-192 prevents renal tubulointerstitial fibrosis in diabetic nephropathy by targeting Egr1.
US8211635B2 (en) P53 modulator and cancer target
Qian et al. MicroRNA-134-5p promotes high glucose-induced podocyte apoptosis by targeting bcl-2
Li et al. Study on the effect of IRE1α on cell growth and apoptosis via modulation PLK1 in ER stress response
Dmitriev et al. The Krüppel-like factor 15 as a molecular link between myogenic factors and a chromosome 4q transcriptional enhancer implicated in facioscapulohumeral dystrophy
Carpentier et al. The signaling adaptor BCAP inhibits NLRP3 and NLRC4 inflammasome activation in macrophages through interactions with Flightless-1
D’Agostino et al. The receptor protein tyrosine phosphatase PTPRJ negatively modulates the CD98hc oncoprotein in lung cancer cells
Wang et al. Secreted protease PRSS35 suppresses hepatocellular carcinoma by disabling CXCL2-mediated neutrophil extracellular traps
WO2016152352A1 (fr) Biomarqueur spécifique du mélanome et son utilisation
Jiang et al. Methylation of miR‐19b‐3p promoter exacerbates inflammatory responses in sepsis‐induced ALI via targeting KLF7
Xiong et al. MicroRNA miR-215-5p regulates doxorubicin-induced cardiomyocyte injury by targeting ZEB2
Sharma et al. Quorum sensing by gelsolin regulates programmed cell death 4 expression and a density-dependent phenotype in macrophages
US8841269B2 (en) Polynucleotides for use in treating and diagnosing cancers
Liu et al. Screening and identification of lung cancer metastasis‐related genes by suppression subtractive hybridization
Yuan et al. [Retracted] Circ‐GTF2I/miR‐590‐5p Axis Aggravates Myocardial Ischemia‐Reperfusion Injury by Regulating Kelch Repeat and BTB Domain‐Containing Protein 7
WO2023166226A1 (fr) Utilisations thérapeutiques d&#39;inhibiteurs de la pcyox1
US20220251569A1 (en) Treatment and prevention of disease mediated by wwp2
Lento et al. Proteomics of tissue factor silencing in cardiomyocytic cells reveals a new role for this coagulation factor in splicing machinery control
US20240192217A1 (en) Systems and methods for barrett&#39;s esophagus pathogenesis and esophageal adenocarcinoma progression revealing markers
WO2006066826A1 (fr) Procede de diagnostic d’un cancer
Cámara-Quílez HMGB1 and HMGB2 Interactomes in Ovarian and Prostate Tumours

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23708802

Country of ref document: EP

Kind code of ref document: A1