WO2023165618A1 - Methods for treating cancer - Google Patents

Methods for treating cancer Download PDF

Info

Publication number
WO2023165618A1
WO2023165618A1 PCT/CN2023/079650 CN2023079650W WO2023165618A1 WO 2023165618 A1 WO2023165618 A1 WO 2023165618A1 CN 2023079650 W CN2023079650 W CN 2023079650W WO 2023165618 A1 WO2023165618 A1 WO 2023165618A1
Authority
WO
WIPO (PCT)
Prior art keywords
kras
mutation
cancer
cells
seq
Prior art date
Application number
PCT/CN2023/079650
Other languages
French (fr)
Inventor
Xi Chen
Chao Yan
Huanhuan HU
Original Assignee
Nanjing University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nanjing University filed Critical Nanjing University
Publication of WO2023165618A1 publication Critical patent/WO2023165618A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding

Definitions

  • This application relates to methods for treating cancer in an individual, wherein the cancer comprises one or more cells that comprise a mutation that activates the KRAS signaling pathway.
  • KRAS Mutations in the KRAS gene are the most common drivers of tumor development across a spectrum of human cancers, such as cancers of the lung, colon, and pancreas.
  • NSCLC non-small cell lung cancer
  • the KRAS G12C mutation accounts for approximately 30%of all cases and correlates with poor prognosis.
  • KRAS proteins with activating mutations abrogate the GTPase activity and are locked in the GTP-bound hyperactive state, leading to constitutive activation of downstream pro-proliferative and pro-survival pathways such as RAF-MEK-ERK and PI3K-AKT5.
  • AMG 510 the first covalent inhibitor of the KRAS G12C mutation has just been approve by the FDA in May 2021; and targeting other KRAS mutations is still considered “mission impossible. ” Understanding how mutations that activate the KRAS signaling pathway drive cancer pathogenesis and developing new intervention strategies are the major priorities for conquering KRAS-driven cancers.
  • provided is a method of treating cancer in an individual comprising administering an effective amount of an agent that blocks the interaction between CD47 and SIRP ⁇ , wherein the cancer has been determined to comprise one or more cells that comprise a mutation that activates the KRAS signaling pathway.
  • a method of treating cancer in an individual comprising (a) determining whether the cancer in the individual comprises one or more cells that comprise a mutation that activates the KRAS signaling pathway, and (b) administering an effective amount of an agent that blocks the interaction between CD47 and SIRP ⁇ to the individual who has been determined to have the cancer that comprises one or more cells that comprise a mutation that activates the KRAS signaling pathway.
  • a method of predicting whether an individual with cancer is likely to respond to treatment with an agent that blocks the interaction between CD47 and SIRP ⁇ comprising determining whether the cancer in the individual comprises one or more cells that comprise a mutation that activates the KRAS signaling pathway, wherein the presence of a mutation that activates the KRAS signaling pathway in one or more cells of the cancer indicates that the individual is likely to respond to the treatment.
  • the mutation that activates the KRAS signaling pathway is a mutation in an amino acid sequence of a wild type KRAS.
  • the mutation in the amino acid sequence of the wild type KRAS is an amino acid substitution at position 12 relative to a wild type KRAS set forth in SEQ ID NO: 37 or SEQ ID NO: 38.
  • the amino acid substitution at position 12 relative to the wild type KRAS set forth in SEQ ID NO: 37 or SEQ ID NO: 38 is selected from the group consisting of: G12C, G12D, G12V, G12W, G12R, and G12A.
  • the mutation that activates the KRAS signaling pathway is a mutation in an amino acid sequence of a wild type PIK3CA.
  • the mutation in the amino acid sequence of the wild type PIK3CA is an amino acid substitution at position 345, 542, 545, or 1047 relative to a wild type PIK3CA set forth in SEQ ID NO: 41.
  • the amino acid substitution at position 345, 542, 545, or 1047 relative to a wild type PIK3CA set forth in SEQ ID NO: 41 is selected from the group consisting of: N345K, E542K, E545K, H1047L, and H1047R.
  • the mutation that activates the KRAS signaling pathway is a mutation in an amino acid sequence of a wild type STAT3.
  • the mutation in the amino acid sequence of the wild type STAT3 is an amino acid substitution at position 174, 392, 427, 646, 658, 705, or 716 relative to a wild type STAT3 set forth in SEQ ID NO: 42.
  • the amino acid substitution at position 174, 392, 427, 646, 658, 705, or 716 relative to a wild type STAT3 set forth in SEQ ID NO: 42 is selected from the group consisting of: F174A, K392K, D427H, K392R, N646K, K658N, T705F, and T716M.
  • the mutation that activates the KRAS signaling pathway is a germline mutation.
  • the germline mutation is identified in one or more cells in a blood sample or buccal sample from the individual.
  • the mutation that activates the KRAS signaling pathway is a somatic mutation.
  • the somatic mutation is identified in sample containing the one or more cells of the cancer from the individual.
  • the presence of the mutation that activates the KRAS signaling pathway in the one or more cells of the cancer is determined via nucleic acid sequencing or polymerase chain reaction (PCR) , fluorescence in situ hybridization (FISH) , or denaturing high performance liquid chromatography (DHPLC) .
  • the mutation that activates the KRAS signaling pathway results in overexpression of MEK protein (pMEK) in the one or more cancer cells.
  • the one or more cancer cells are considered to overexpress pMEK when an expression level of the pMEK in a sample comprising the cancer cells from the individual is higher than an expression level of the pMEK in a reference sample from a healthy individual.
  • the mutation that activates the KRAS signaling pathway results in overexpression of AKT protein (pAKT) in the one or more cancer cells.
  • the one or more cancer cells are considered to overexpress pMEK when an expression level of the pAKT in a sample comprising the cancer cells from the individual is higher than an expression level of the pAKT in a reference sample from a healthy individual.
  • the mutation that activates the KRAS signaling pathway results in overexpression of STAT3 protein (pSTAT3) in the one or more cancer cells in the individual.
  • the one or more cancer cells are considered to overexpress pSTAT3 when an expression level of the pSTAT3 in a sample comprising the cancer cells from the individual is higher than an expression level of the pSTAT3 in a reference sample from a healthy individual.
  • the presence of the mutation that activates the KRAS signaling pathway in the one or more cells of the cancer is determined via assessed via Western blot, ELISA, or immunofluorescence.
  • the mutation that activates the KRAS signaling pathway results in low level of microRNA-34a (miR-34a) in the one or more cancer cells.
  • the one or more cancer cells are considered to have the low level of miR-34a when an expression level of the miR-34a in a sample comprising the one or more cancer cells from the individual is lower than an expression level of the miR-34a in a reference sample from a healthy individual.
  • the presence of the mutation that activates the KRAS signaling pathway in the one or more cells of the cancer is determined via quantitative reverse transcription-polymerase chain reaction (RT-PCR) , Northern blot, in situ hybridization, and/or nuclease protection assay.
  • RT-PCR quantitative reverse transcription-polymerase chain reaction
  • the agent that blocks the interaction between CD47 and SIRP ⁇ is anti-CD47 antibody or immunologically active fragment thereof.
  • the anti-CD47 antibody is CC-90002, 5F9, LQ001, HLX24, TI-061, AO-176, SRF-231, IBI-188, IMC-002, SHR-1603, STI-6643, ZL-1201, or an immunologically active fragment thereof.
  • the anti-CD47 antibody or immunologically active fragment thereof comprises three complementarity determining regions (CDRs) of a heavy chain variable domain (VH) set forth in SEQ ID NO: 1 and three CDRs of a light chain variable domain (VL) set forth in SEQ ID NO: 2.
  • the anti-CD47 antibody or immunologically active fragment thereof comprises: (a) a VH that comprises (1) a CDR-H1 comprising RAWMN (SEQ ID NO: 5) ; (2) a CDR-H2 comprising RIKRKTDGETTDYAAPVKG (SEQ ID NO: 6) ; and (3) a CDR-H3 comprising SNRAFDI (SEQ ID NO: 7) and (b) a VL that comprises (1) a CDR-L1 comprising KSSQSVLYAGNNRNYLA (SEQ ID NO: 8) ; (2) a CDR-L2 comprising QASTRAS (SEQ ID NO: 9) ; and (3) a CDR-L3 comprising QQYYTPPLA (SEQ ID NO: 10) , wherein the CDR sequences are defined according to the Kabat numbering system.
  • the VH domain of the anti-CD47 antibody or immunologically active fragment thereof comprises an amino acid sequence that has at least 95%identity to SEQ ID NO: 1
  • the VL of the anti-CD47 antibody or immunologically active fragment thereof comprises an amino acid sequence that has at least 95%identity to SEQ ID NO: 2.
  • the anti-CD47 antibody comprises a heavy chain that comprises SEQ ID NO: 3 or SEQ ID NO: 35 and a light chain that comprises SEQ ID NO: 4.
  • kits comprising an anti-CD47 antibody, wherein the kit is for use according to a method of treatment provided herein.
  • the kit is for use in the treatment of a cancer comprising one or more cells that comprise a mutation that activates the KRAS signaling pathway in an individual who has been identified as having a cancer that comprises one or more cells that comprise a mutation that activates the KRAS signaling pathway.
  • the kit further comprises a label or package insert stating that the agent that blocks the interaction between CD47 (e.g., hCD47) and SIRP ⁇ (e.g., hSIRP ⁇ ) is to be used in treating cancer in an individual, wherein the cancer comprises one or more cells that comprise a mutation that activates the KRAS signaling pathway.
  • CD47 e.g., hCD47
  • SIRP ⁇ e.g., hSIRP ⁇
  • KRAS-CD47 signaling axis suggesting that KRAS mutation status can serve as a biomarker for agents that block the interaction between CD47 and SIRP ⁇ , such as a CD47 antibody, and provides novel strategies for KRAS mutant cancers.
  • a method of treating malignant tumor in a subject in need thereof comprising administering to the subject an effective amount of an agent that blocks the interaction between CD47 and SIRP ⁇ , wherein the tumor comprises a cell with a KRAS mutation.
  • the KRAS mutation occurs at residue 12 of KRAS protein as set forth in SEQ ID NO. 37 or SEQ ID NO. 38.
  • the KRAS mutation is selected from the group consisting of G12C, G12D, G12V, G12W, G12R, and G12A mutation.
  • the agent that blocks the interaction between CD47 and SIRP ⁇ is anti-CD47 antibody or immunologically active fragment thereof.
  • the anti-CD47 antibody or immunologically active fragment thereof is CC-90002, 5F9, LQ001, HLX24, TI-061, AO-176, SRF-231, IBI-188, IMC-002, SHR-1603, STI-6643, ZL-1201, or an immunologically active fragment thereof.
  • the anti-CD47 antibody or immunologically active fragment thereof comprises three complementarity determining regions (CDRs) of a heavy chain variable domain (VH) set forth in SEQ ID NO: 1 and three CDRs of a light chain variable domain (VL) set forth in SEQ ID NO: 2.
  • CDRs complementarity determining regions
  • the anti-CD47 antibody or immunologically active fragment thereof comprises: (a) a VH that comprises (1) a CDR-H1 comprising RAWMN (SEQ ID NO: 5) ; (2) a CDR-H2 comprising RIKRKTDGETTDYAAPVKG (SEQ ID NO: 6) ; and (3) a CDR-H3 comprising SNRAFDI (SEQ ID NO: 7) and (b) a VL that comprises (1) a CDR-L1 comprising KSSQSVLYAGNNRNYLA (SEQ ID NO: 8) ; (2) a CDR-L2 comprising QASTRAS (SEQ ID NO: 9) ; and (3) a CDR-L3 comprising QQYYTPPLA (SEQ ID NO: 10) , wherein the CDR sequences are defined according to the Kabat numbering system.
  • the VH domain of the anti-CD47 antibody or immunologically active fragment thereof comprises an amino acid sequence that has at least 95%identity to SEQ ID NO: 1
  • the VL of the anti-CD47 antibody or immunologically active fragment thereof comprises an amino acid sequence that has at least 95%identity to SEQ ID NO: 2.
  • the anti-CD47 antibody comprises a heavy chain that comprises SEQ ID NO: 3 or SEQ ID NO: 35 and a light chain that comprises SEQ ID NO: 4.
  • the malignant tumor is solid tumor.
  • the malignant tumor is selected from the group consisting of NSCLC, pancreas cancer, colorectal cancer, gall bladder cancer, bile duct cancer, thyroid cancer, head and neck cancer, SCLC, colon cancer, small intestine cancer, appendiceal cancer, gastric cancer, esophageal cancer, bladder cancer, kidney cancer, liver cancer, breast cancer, ovarian cancer, teratocarcinoma, endometrial cancer, cervical cancer, prostate cancer, lymphoma, myeloma, leukemia, brain cancer, MPNST, neurofibromatosis, neuroblastoma, glioma, schwannomas seminoma astrocytoma, squamous cell carcinoma, fibrosarcoma, rhabdomyosarcoma, osteosarcoma, Kaposi’s sarcoma and keratoacanthoma.
  • a method for determining whether a subject in need thereof is suitable for cancer treatment by an agent that blocks the interaction between CD47 and SIRP ⁇ comprising determining presence or absence of a KRAS mutation in the subject, wherein the presence of the KRAS mutation indicates the subject is suitable for cancer treatment by the agent.
  • the KRAS mutation is selected from the group consisting of G12C, G12D, G12V, G12W, G12R, and G12A mutation.
  • determining likelihood of a subject in need thereof to respond to an agent that blocks the interaction between CD47 and SIRP ⁇ in cancer treatment comprising determining presence or absence of a KRAS mutation in the subject, wherein the presence of the KRAS mutation indicates the subject has a higher likelihood to respond to the agent.
  • the KRAS mutation is selected from the group consisting of G12C, G12D, G12V, G12W, G12R, and G12A mutation.
  • the present application provides use of an agent in the preparation of a medicament for treating malignant tumor in a subject in need thereof, wherein the agent blocks the interaction between CD47 and SIRP ⁇ A, and the tumor comprises a cell with a KRAS mutation.
  • the KRAS mutation occurs at residue 12 of KRAS protein as set forth in SEQ ID NO. 37 or SEQ ID NO. 38. In some embodiments, the KRAS mutation is selected from the group consisting of G12C, G12D, G12V, G12W, G12R, and G12A mutation.
  • the agent that blocks the interaction between CD47 and SIRP ⁇ is anti-CD47 antibody or immunologically active fragment thereof.
  • the anti-CD47 antibody or immunologically active fragment thereof is CC-90002, 5F9, LQ001, HLX24, TI-061, AO-176, SRF-231, IBI-188, IMC-002, SHR-1603, STI-6643, ZL-1201, or an immunologically active fragment thereof.
  • the anti-CD47 antibody or immunologically active fragment thereof comprises three complementarity determining regions (CDRs) of a heavy chain variable domain (VH) set forth in SEQ ID NO: 1 and three CDRs of a light chain variable domain (VL) set forth in SEQ ID NO: 2.
  • CDRs complementarity determining regions
  • the anti-CD47 antibody or immunologically active fragment thereof comprises: (a) a VH that comprises (1) a CDR-H1 comprising RAWMN (SEQ ID NO: 5) ; (2) a CDR-H2 comprising RIKRKTDGETTDYAAPVKG (SEQ ID NO: 6) ; and (3) a CDR-H3 comprising SNRAFDI (SEQ ID NO: 7) and (b) a VL that comprises (1) a CDR-L1 comprising KSSQSVLYAGNNRNYLA (SEQ ID NO: 8) ; (2) a CDR-L2 comprising QASTRAS (SEQ ID NO: 9) ; and (3) a CDR-L3 comprising QQYYTPPLA (SEQ ID NO: 10) , wherein the CDR sequences are defined according to the Kabat numbering system.
  • the VH domain of the anti-CD47 antibody or immunologically active fragment thereof comprises an amino acid sequence that has at least 95%identity to SEQ ID NO: 1
  • the VL of the anti-CD47 antibody or immunologically active fragment thereof comprises an amino acid sequence that has at least 95%identity to SEQ ID NO: 2.
  • the anti-CD47 antibody comprises a heavy chain that comprises SEQ ID NO: 3 or SEQ ID NO: 35 and a light chain that comprises SEQ ID NO: 4.
  • the medicament comprises a second agent for treating a tumor comprising a cell with a KRAS mutation.
  • the medicament is used in combination with a second agent for treating a tumor comprising a cell with a KRAS mutation.
  • the second agent is a KRAS G12D inhibitor, or a miR-34a mimic.
  • the KRAS G12D inhibitor is selected from the group consisting of MRTX1133 (Mirati) , iExosomes (MD Anderson) and mRNA-5671 (Moderna) .
  • the KRAS G12D inhibitor comprises a structure of:
  • the malignant tumor is solid tumor.
  • the malignant tumor is selected from the group consisting of NSCLC, pancreas cancer, colorectal cancer, gall bladder cancer, bile duct cancer, thyroid cancer, head and neck cancer, SCLC, colon cancer, small intestine cancer, appendiceal cancer, gastric cancer, esophageal cancer, bladder cancer, kidney cancer, liver cancer, breast cancer, ovarian cancer, teratocarcinoma, endometrial cancer, cervical cancer, prostate cancer, lymphoma, myeloma, leukemia, brain cancer, MPNST, neurofibromatosis, neuroblastoma, glioma, schwannomas seminoma astrocytoma, squamous cell carcinoma, fibrosarcoma, rhabdomyosarcoma, osteosarcoma, Kaposi’s sarcoma and keratoacanthoma.
  • Figures 1A-1F show that oncogenic KRAS mutations render lung cancer cells insensitive to macrophage phagocytosis.
  • Figure 1A shows that tumor cells from KRAS mut NSCLC patients were more resistant to macrophage phagocytosis than that from KRAS WT patients.
  • cancer cells were isolated from 12 KRAS WT and 6 KRAS mut patients, labelled with the fluorescent dye CFSE, incubated with human peripheral blood monocyte-derived macrophages for 2 h, stained with F4/80 and analyzed by flow cytometry. Phagocytosis rate was calculated as the percentage of CFSE+ F4/80+ cells among the CFSE+ cells. Representative FACS results and quantification of all patients are shown.
  • Figure 1B show the effect of KRAS manipulation on macrophage phagocytosis of KRAS G12C H358 cells.
  • Figures 1C and 1D show macrophage phagocytosis of H358 cells gradually decreased with tumor progression in vivo.
  • An orthotopical model of lung cancer was established by tail vein injection of EGFP-labelled H358 cells into BALB/c nude mice.
  • Figures 2A-2N show that CD47 is required for KRAS-driven antiphagocytic effect in lung cancer.
  • Figure 2A shows that tumor cells from KRAS mut NSCLC patients showed more CD47 expression than that from KRAS WT patients. Cancer cells were isolated from 12 KRAS WT and 6 KRAS mut patients, labelled with the CD47 antibody and analyzed by flow cytometry. Representative FACS results and quantification of all patients are shown.
  • Figures 2B and 2X show that KRAS LSL-g12d/+ ; p53 fl/fl mice showed a gradual increase in CD47 expression in the lung tumor tissue over time.
  • KRAS LSL-g12d/+ ; p53 fl/fl were sacrificed at 0, 1, 2 and 3 months, respectively, and analyzed for CD47 expression by IHC staining (see Figure 2B;scale bars, 20 ⁇ m) and immunoblotting (see Figure 2C) .
  • Figures 2D and 2E show that KRAS mut NSCLC cell lines showed higher CD47 expression than KRAS WT cell lines.
  • the KRAS WT NSCLC cell lines h292 and calu-3 and KRAS mut lines a549, h23, SK-LU-1and H358 were analyzed for surface and total CD47 protein levels by flow cytometry (see Figure 2D) and immunoblotting (see Figure 2E) , respectively.
  • Figure 2F shows western blot analysis of CD47 expression in the MEFs overexpressing various KRAS mutations (WT, G12C or g12d) .
  • Figures 2G and 2H show the effect of KRAS manipulation on CD47 expression in H358 and SK-LU-1cells. H358 and SK-LU-1cells were transfected with plasmids expressing KRAS WT or KRAS G12C or with three KRAS siRNAs. After 48 h, CD47 expression was determined by immunoblotting. Representative immunoblots of three independent experiments are shown.
  • Figures 2I-2N show the effect of CD47 knockdown on KRAS-driven tumorigenesis and macrophage phagocytosis in vivo.
  • FIG. 1 Kaplan-Meier survival analysis.
  • Figure 2J representative micro-CT visualization of tumors 3 months’ post-administration.
  • Figure 2K shows representative H&E staining of lung sections. scale bars, 2 mm.
  • Figure 2L shows representative IHC staining of CD47 in lung tumor sections. scale bars, 20 ⁇ m.
  • Figure 2M shows representative immunoblotting result of CD47 expression in lung tumors.
  • Figures 3A-3M show that MiR-34A restricts CD47 activity and restores the phagocytic function of macrophages in vitro and in vivo.
  • Figure 3A shows a scatter plot comparison illustrating miRNAs that were differentially expressed between the malignant and normal lung tissues of the KRAS LSL-G12D/+ mice. Small RNA deep sequencing was performed to determine the miRNA profiles in the lung adenocarcinomas and normal lung tissues. Analysis of differentially expressed miRNAs used a stringent threshold and a significance criterion of log2 (fold-change) > 1 and P ⁇ 0.05.
  • Figure 3B shows cluster analysis of the miRNAs differentially expressed between the malignant and normal lungs of the KRAS LSL-G12D/+ mice.
  • Figures 3D and 3E show the effect of the miR-34A mimic (see Figure 3D) or miR-34A antisense (see Figure 3E) on CD47 expression in H358 cells.
  • Figure 3F shows the effects of miR-34A mimic on macrophage phagocytosis of H358 cells.
  • Figures 3G-3M show the effect of miR-34A on KRAS-driven tumorigenesis and tumor macrophage infiltration in vivo.
  • the KRAS LSL-G12D/+ ; p53 fl/fl mice were intratracheally administered Adeno-CRE along with different combinations of AAV-scrRNA (scrambled RNA sequence as the negative control for AAV-miR-34A) , AAV-miR-34A, AAV-control (negative control of AAV-CD47) or AAV-CD47 (CD47 coding sequence) .
  • Figure 3G shows Kaplan-Meier survival analysis.
  • Figure 3H shows representative micro-CT visualization of the tumors 3 months’ post-administration.
  • Figure 3I shows representative H&E staining of lung sections. Scale bars, 2 mm.
  • Figure 3J shows representative IHC staining of CD47 in lung tumor sections.
  • Figure 3K shows representative immunoblotting result of CD47 expression in lung tumors.
  • Figures 4A-4O show that KRAS modulates CD47 expression through the PI3K- STAT3-miR-34A signaling axis.
  • Figure 4H shows the effect of MEK and PI3K inhibition on the expression of miR-34A.
  • MEFs and H358 cells were treated with DMSO, MEK inhibitor, PI3K inhibitor or a combination, the pharmaceutical composition, or the manufacture of product of both inhibitors.
  • Figure 4I shows the effect of MEK and PI3K inhibition on the expression of CD47, p-STAT3 and total STAT3 in MEFs and H358 cells.
  • Figures 4J-4N Western blot analysis of the expression levels of KRAS, p-STAT3 and total STAT3 in the MEFs (see Figure 4J) ; H358 cells overexpressing KRAS WT or KRAS G12C (see Figure 4K) ; SK-LU-1cells overexpressing KRAS WT or KRAS G12D (see Figure 4L) ; H358 cells transfected with three KRAS siRNAs (see Figure 4M) ; or SK-LU-1cells transfected with three KRAS siRNAs (see Figure 4N) .
  • Western blots shown are representative of three independent experiments.
  • Figure 4O Schematic of the signaling pathways involved in the regulation of CD47 expression and macrophage phagocytic function by KRAS mutation.
  • Figures 5A-5G show clinical relevance of KRAS mutation status and CD47 expression in NSCLC patients.
  • Figures 5A shows correlation analysis of KRAS activity and CD47 expression in the first patient cohort containing 157 lung adenocarcinoma samples. IHC staining was performed to analyze CD47 and p-STAT3 in the tissue microarray chips stratified by high or low KRAS activity (measured by p-AKT levels due to the lack of KRAS mutation information) .
  • Left panel representative IHC images.
  • CD47 and p-STAT3 expression statuses were stratified based on IHC scores.
  • Figures 5B shows IHC analysis of CD47 and p-STAT3 in a homemade tissue microarray containing 40 NSCLC samples (28 KRAS WT and 12 KRAS MUT ) .
  • Left panel representative IHC images.
  • the CD47 and p-STAT3 expression statuses were stratified based on IHC scores.
  • Figures 5C-5E show correlation analysis of KRAS mutation status and the expression of CD47, p-STAT3 and miR-34A in the third NSCLC patient cohort with KRAS mutation status determined by deep sequencing.
  • Figure 5C shows Western blot analysis of CD47 protein expression in the KRAS WT , KRAS G12C , KRAS G12D or KRASG12V patients.
  • Left panel representative blots (N: normal; T: tumor) .
  • Figure 5D shows Western blot analysis of p-STAT3 protein expression in the KRAS WT and KRAS MUT patients.
  • Figure 5E shows quantitative RT-PCR analysis of the miR-34A levels in the KRAS WT and KRAS MUT patients.
  • Figures 5F and 5G show Pearson’s correlation coefficient analysis of the correlations among p-STAT3, miR-34A and CD47 in the KRAS MUT (see Figure 5F) and KRAS WT (see Figure 5G) NSCLC samples.
  • FC fold change.
  • Figures 6A-6L show that the KRAS G12C inhibitor AMG 510 inhibits CD47 signaling and promotes macrophage phagocytosis of tumor cells in vitro and in vivo.
  • Figures 6A-6C show that AMG 510 treatment renders H358 cells sensitive to phagocytosis by macrophages.
  • Figures 6A and 6B show the effect of AMG 510 on the expression levels of p-STAT3, total STAT3, CD47 and miR-34A in H358 cells. Cells were treated with AMG 510 for 24 h. Representative blots of three independent experiments are shown.
  • Figure 6C shows that KRAS G12C inhibition increased phagocytosis of H358 cells by macrophages.
  • FIGS. 6A-6F show that AMG 510 treatment renders LLC cells sensitive to phagocytosis by macrophages. Experiments identical to that of a-c were carried out for LLC cells.
  • Figures 6D and 6E show the effect of AMG 510 on the expression levels of p-STAT3, total STAT3, CD47 and miR-34A in LLC cells. Representative blots of three independent experiments are shown.
  • Figures 6G-6L show the effect of AMG 510 treatment on CD47 expression and macrophage phagocytosis in vivo.
  • EGFP-labelled LLC mouse lung cancer cells were injected via tail vein into C57BL/6 immunocompetent mice to establish an orthotopic model of lung cancer. After tumor formation, the mice were administered vehicle control or AMG 510 via oral gavage for 8 days.
  • Figure 6G shows representative H&E-stained lung sections. Scale bars, 2 mm.
  • Figure 6H shows representative Ki-67 staining of lung sections. Scale bars, 20 ⁇ m.
  • Figure 6I shows representative IHC staining of CD47 expression in lung sections. Scale bars, 20 ⁇ m.
  • Figure 6J shows representative western blots of CD47, p-STAT3 and total STAT3 in lung tumors.
  • Figures 7A-7F show that oncogenic KRAS mutations render lung cancer cells insensitive to macrophage phagocytosis.
  • Figure 7A shows that tumor cells from KRAS MUT NSCLC patients were more resistant to macrophage phagocytosis than that from KRAS WT patients.
  • Cancer cells were isolated from 12 KRAS WT and 6 KRAS MUT patients, labelled with the fluorescent dye CFSE, incubated with human peripheral blood monocyte-derived macrophages, stained with F4/80, and analyzed by flow cytometry. Phagocytosis rate was calculated as the percentage of CFSE+F4/80+ cells among the CFSE+ cells. FACS results for all 18 patients are shown.
  • Figures 7B and 7C show the effect of KRAS manipulation on macrophage phagocytosis of KRAS G12C H358 cells.
  • H358 cells were transfected with plasmids expressing KRAS WT or KRAS G12C or with three KRAS siRNAs. After 48 h, the cells were labelled with CFSE and subjected to the in vitro phagocytosis assay. Representative FACS result for each group is shown.
  • Figures 7D-7F show the effect of KRAS manipulation on macrophage phagocytosis of KRAS G12C H358 cells.
  • Figures 8A-8E show that macrophage phagocytosis of tumor cells is inhibited in KRAS LSL-G12D/+ mice.
  • Figure 8A shows IHC staining of the M1 macrophage markers iNOS and TNF- ⁇ in the lung sections derived from the H358 orthotopic mice model at different time points. Scale bars, 20 ⁇ m.
  • Figures 8B-8E show monitoring of tumor growth and macrophage infiltration in KRAS LSL-G12D/+ mice. KRAS LSL-G12D/+ mice were intratracheally administered Adeno-CRE to trigger pulmonary adenocarcinoma formation.
  • tumor growth was monitored by non-invasive micro-CT scans at different time points post-administration.
  • Figures 9A-9C show that macrophage phagocytosis of tumor cells is inhibited in KRAS LSL-G12D/+ ; p53 fl/fl mice.
  • KRAS LSL-G12D/+ ; p53 fl/fl mice were intratracheally administered Adeno-CRE to trigger pulmonary adenocarcinoma formation.
  • Figure 9B tumor growth was also evaluated by H&E-staining of lung sections. Left panel: representative H&E images. Scale bars, 2 mm.
  • Figures 10A-10E show that KRAS mutations drive CD47 expression in NSCLC patients and mouse models of lung cancer.
  • Figure 10A shows FACS analysis of surface expression of CD47 on tumor cells isolated from 12 KRAS WT and 6 KRAS MUT NSCLC patients.
  • Figures 11A-11F show that KRAS mutations drive CD47 protein expression in vitro.
  • Figures 12A-12E show that silencing of CD47 expression by shRNA induces tumor regression in the KRAS LSL-G12D/+ ; p53 fl/fl mice.
  • the KRAS LSL-G12D/+ ; p53 fl/fl mice were intratracheally administered Adeno-CRE along with AAV-control shRNA or AAV-CD47 shRNA. The mice were then monitored to evaluate tumor growth and CD47 expression.
  • Figure 12E shows IHC staining of the M1 macrophage markers iNOS and TNF- ⁇ in the lung sections derived from the KRAS LSL-G12D/+ ; p53 fl/fl mice treated with AAV-CD47 shRNA. Scale bars, 20 ⁇ m.
  • Figures 13A-13D show effect of KRAS mutation status and expression on CD47 mRNA levels in vitro and in vivo.
  • Figures 14A-14M show post-transcriptional regulation of CD47 by miR-34A.
  • Figure 14A shows a schematic description of the predicted duplexes formed by miR-34A and the 3’-UTR of CD47 mRNA. The predicted free energy values of the hybrids are indicated, which were well within the range of genuine miRNA-target pairs.
  • the nucleic acid sequences shown in Figure 14A are UGGCAGUGUCUUAGCUGGUUGU (SEQ ID NO: 39) , GAUAACUACUUAGCACUGCCC (SEQ ID NO: 43) ; UGCUGCCUGCCUUUUGAGGCAUUCACUGCCC (SEQ ID NO: 44) ; and AAAUUACUAACUGCCA (SEQ ID NO: 45) .
  • Figure 14J shows firefly luciferase reporters containing wild-type or mutant miR-34A binding sites in the CD47 3’-UTR were co-transfected into HEK293T cells together with the control mimic or miR-34A mimic.
  • FIG. 14K shows TargetScan prediction of miRNAs’ possibilities of binding to CD47.
  • Figure 14L shows dual-luciferase assay showed the four miRNAs had no interaction with the CD47 3’UTR.
  • Figure 14M shows Western blot assay showed the expression level of CD47 was not regulated by the 4 miRNAs.
  • Figures 15A-15G show that miR-34A restores the phagocytic function of macrophages by negatively regulating CD47 activity in vitro and in vivo.
  • Figure 15A shows efficient induction of CD47 protein expression in H358 lung cancer cells by a plasmid expressing the CD47 coding sequence (CD47 plasmid) .
  • Left panel representative blots.
  • Figure 15B shows fluorescence microscopy of the macrophage phagocytosis of the EGFP-labelled H358 cells that were co-transfected with the control mimic plus the control plasmid, the miR-34A mimic plus the control plasmid or the miR-34A mimic plus the CD47 plasmid for 48 h before coculture with human peripheral blood monocyte-derived macrophages.
  • Left panel representative fluorescence images. Scale bars, 50 ⁇ m.
  • Figures 15C-15G shows that MiR-34A restricts CD47 activity and induces tumor regression in the KRAS LSL-G12D/+ ; p53 fl/fl mouse model of lung cancer.
  • Figure 15G shows IHC staining of the M1 macrophage markers iNOS and TNF- ⁇ in the lung sections derived from the KRAS LSL-G12D/+ ; p53 fl/fl mice treated with AAV-miR-34A alone or together with AAV-CD47. Scale bars, 20 ⁇ m.
  • Figures 16A-16Q show that KRAS mutations lead to the phosphorylation of STAT3, suppression of miR-34A expression and activation of CD47 expression in lung cancer cells.
  • Figures 16J-16L show Western blot analysis of the expression levels of KRAS, p-STAT3 and total STAT3 in the H358 cells transfected with three KRAS siRNAs.
  • Figures 17A-17B show effect of the STAT3 inhibitor on CD47 and miR-34A expression in lung cancer cells.
  • Figures 18A-18I show characterization of the expression patterns of CD47, p-STAT3 and miR-34A in NSCLC patients.
  • Figures 18A-18E show IHC analysis of CD47 protein in the first patient cohort containing 157 lung adenocarcinoma samples.
  • Figure 18A shows IHC staining of CD47 protein in paired NSCLC and normal adjacent tissue samples.
  • Left panel representative IHC images. Scale bars, 20 ⁇ m.
  • Figure 18C shows IHC staining of CD47 protein in the NSCLC samples with different grades.
  • Left panel representative IHC images. Scale bars, 20 ⁇ m.
  • the CD47 expression levels were stratified based on IHC scores (low: 1–4; medium: 5–6; high: 7–10) .
  • Figures 19A-19C show that the KRAS G12C inhibitor AMG 510 renders H358 and LLC cells sensitive to phagocytosis by macrophages.
  • Figure 19B shows fluorescence microscopy of the macrophage phagocytosis of the EGFP-labelled H358 cells treated with AMG 510 for 24 h before coculture with human peripheral blood monocyte-derived macrophages. Left panel: representative fluorescence images.
  • Figures 20A-20F show that the KRAS G12C inhibitor AMG 510 restores innate immune surveillance in an orthotopic xenograft mouse model.
  • C57BL/6 immunocompetent mice were tail vein injected with LLC cells (KRAS G12C ) mouse lung cancer cells to establish an orthotopic xenograft mouse model. After tumor formation, the mice were administered vehicle control or AMG 510 via oral gavage for 8 days. The mice were then monitored to evaluate tumor growth, CD47 expression and macrophage phagocytosis and infiltration.
  • Figure 20F shows representative IHC staining of the M1 macrophage markers iNOS and TNF- ⁇ in the xenograft tumor sections. Scale bars, 20 ⁇ m.
  • Figure 21 shows that compared with that of LLC cell line, the p-AKT, p-ERK, p-STAT3 and CD47 protein expression levels were significantly decreased in LLC-KI cell line.
  • Figure 22A shows the results of FACS experiments that were performed to investigate a correlation between KRAS mutation status with CD47 expression in colon cancer cell lines.
  • Figure 22B shows the results of Western Blots that were performed to investigate a correlation between KRAS mutation status with CD47 expression in colon cancer cell lines
  • Figure 23 shows the results of KRAS siRNA knock down experiments that were performed to investigate a correlation between KRAS mutation status with CD47 expression in colon cancer cell lines.
  • Figure 24 shows the results experiments that were performed to determine whether overexpression of wild type KRAS or mutant KRAS could up-regulate the expression of CD47 in colon cancer cells.
  • Figure 25 shows the results experiments that were performed to determine the IC50 value of KRASG12D inhibitor MRTX1133 on LS180 cells.
  • Figure 26 shows the results experiments that were performed to determine effects of KRASG12D inhibitor MRTX1133 on the expression levels of pERK, ERK, pAKT, AKT, and CD47 in LS180 cells.
  • aspects and embodiments of the present disclosure include “comprising, ” “consisting, ” and “consisting essentially of” aspects and embodiments.
  • CD47 (which is also known as Integrin Associated Protein (IAP) , Antigenic Surface Determinant Protein OA3, OA3, CD47 Antigen, Rh-Related Antigen, Integrin-Associated Signal Transducer, Antigen Identified By Monoclonal Antibody 1D8, CD47 glycoprotein) preferably refers to human CD47 and, in particular, to a protein comprising the amino acid sequence
  • CD47 also refers to any post translationally modified variants and conformation variants.
  • an antibody is used in the broadest sense and specifically covers intact antibodies (e.g., full length antibodies) , antibody fragments (including without limitation Fab, F (ab’) 2, scFv, scFv-Fc, single domain antibodies) , monoclonal antibodies, and polyclonal antibodies, so long as they exhibit the desired biological activity (e.g., epitope binding) .
  • An “immunologically active fragment” of an antibody is a fragment of an antibody that binds to the antigen of the antibody or an epitope of the antigen, comprising any one of the fragments selected from the group consisting of CDR, VL, VH, Fab, F (ab’) 2 and scFv.
  • an isolated antibody may refer to an antibody that is substantially free of other cellular material. In one embodiment, an isolated antibody is substantially free of other proteins from the same species. In another embodiment, an isolated antibody is expressed by a cell from a different species and is substantially free of other proteins from the different species. In some embodiments, an “isolated” antibody is one which has been identified and separated and/or recovered from a component of its natural environment. Contaminant components of its natural environment are materials which would interfere with diagnostic or therapeutic uses for the antibody, and may include enzymes, hormones, and other proteinaceous or nonproteinaceous solutes.
  • an antibody may be rendered substantially free of naturally associated components (or components associated with the cellular expression system used to produce the antibody) by isolation, using protein purification techniques well known in the art.
  • the antibody will be purified (1) to greater than 75%by weight of antibody as determined by the Lowry method, and most preferably more than 80%, 90%, 95%or 99%by weight, or (2) to homogeneity by SDS-PAGE under reducing or nonreducing conditions using Coomassie blue or, preferably, silver stain.
  • Isolated antibody includes the antibody in situ within recombinant cells since at least one component of the antibody’s natural environment will not be present. Ordinarily, however, isolated antibody will be prepared by at least one purification step.
  • epitopic determinants means any antigenic determinant on an antigen to which the paratope of an antibody binds.
  • Epitopic determinants usually consist of chemically active surface groupings of molecules such as amino acids or sugar side chains and usually have specific three-dimensional structural characteristics, as well as specific charge characteristics.
  • the term “native antibodies and immunoglobulins” are usually heterotetrameric glycoproteins of about 150,000 daltons, composed of two identical light (L) chains and two identical heavy (H) chains. Each light chain is linked to a heavy chain by one covalent disulfide bond (also termed a “VH/VL pair” ) , while the number of disulfide linkages varies between the heavy chains of different immunoglobulin isotypes. Each heavy and light chain also has regularly spaced intrachain disulfide bridges. Each heavy chain has at one end a variable domain (VH) followed by a number of constant domains.
  • VH variable domain
  • Each light chain has a variable domain at one end (VL) and a constant domain at its other end; the constant domain of the light chain is aligned with the first constant domain of the heavy chain, and the light chain variable domain is aligned with the variable domain of the heavy chain.
  • Particular amino acid residues are believed to form an interface between the light-and heavy-chain variable domains. See, e.g., Chothia et al., J. Mol. Biol., 186: 651 (1985) ; Novotny and Haber, Proc. Natl. Acad. Sci. U.S.A., 82: 4592 (1985) .
  • variable refers to the fact that certain portions of the variable domains differ extensively in sequence among antibodies and are used in the binding and specificity of each particular antibody for its particular antigen. However, the variability is not evenly distributed throughout the variable domains of antibodies. It is concentrated in three segments called complementarity-determining regions (CDRs) or hypervariable regions both in the light-chain and the heavy-chain variable domains. The more highly conserved portions of variable domains are called the framework (FR) .
  • CDRs complementarity-determining regions
  • FR framework
  • the variable domains of native heavy and light chains each comprise four FR regions, largely adopting a ⁇ -sheet configuration, connected by three CDRs, which form loops connecting, and in some cases forming part of, the ⁇ -sheet structure.
  • the CDRs in each chain are held together in close proximity by the FR regions and, with the CDRs from the other chain, contribute to the formation of the antigen-binding site of antibodies. See, e.g., Kabat et al., Sequences of Proteins of Immunological Interest, Fifth Edition, National Institute of Health, Bethesda, Md. (1991) .
  • the constant domains are not involved directly in binding an antibody to an antigen, but exhibit various effector functions, such as participation of the antibody in antibody-dependent cellular toxicity.
  • Variable region sequences of interest include the humanized variable region sequences for CD47 antibodies described in detail elsewhere herein.
  • hypervariable region or “complementarity determining region (CDR) ” may refer to the subregions of the VH and VL domains characterized by enhanced sequence variability and/or formation of defined loops. These include three CDRs in the VH domain (H1, H2, and H3) and three CDRs in the VL domain (L1, L2, and L3) . H3 is believed to be critical in imparting fine binding specificity, with L3 and H3 showing the highest level of diversity. See Johnson and Wu, in Methods in Molecular Biology 248: 1-25 (Lo, ed., Human Press, Totowa, N. J., 2003) .
  • CDR/HVR delineations A number of CDR/HVR delineations are known.
  • the Kabat Complementarity Determining Regions are based on sequence variability and are the most commonly used (Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. (1991) ) . Chothia refers instead to the location of the structural loops (Chothia and Lesk J. Mol. Biol. 196: 901-917 (1987) ) .
  • the AbM HVRs represent a compromise between the Kabat HVRs and Chothia structural loops, and are used by Oxford Molecular’s AbM antibody modeling software.
  • the “contact” HVRs are based on an analysis of the available complex crystal structures. The residues from each of these HVRs/CDRs are noted below. “Framework” or “FR” residues are those variable domain residues other than the HVR/CDR residues.
  • Extended HVRs are also known: 24-36 or 24-34 (L1) , 46-56 or 50-56 (L2) and 89-97 or 89-96 (L3) in the VL and 26-35 (H1) , 50-65 or 49-65 (H2) and 93-102, 94-102, or 95-102 (H3) in the VH (Kabat numbering) .
  • “Numbering according to Kabat” may refer to the numbering system used for heavy chain variable domains or light chain variable domains of the compilation of antibodies in Kabat et al., supra.
  • the actual linear amino acid sequence may contain fewer or additional amino acids corresponding to a shortening of, or insertion into, a FR or HVR of the variable domain.
  • the Kabat numbering of residues may be determined for a given antibody by alignment at regions of homology of the sequence of the antibody with a “standard” Kabat numbered sequence.
  • the Kabat numbering is used when referring to a residue in the variable domains (approximately residues 1-107 of the light chain and residues 1-113 of the heavy chain)
  • the EU numbering system or index e.g., the EU index as in Kabat, numbering according to EU IgG1
  • EU index is generally used when referring to a residue in the heavy chain constant region.
  • a “monoclonal” antibody refers to an antibody obtained from a population of substantially homogeneous antibodies, e.g., substantially identical but allowing for minor levels of background mutations and/or modifications. “Monoclonal” denotes the substantially homogeneous character of antibodies, and does not require production of the antibody by any particular method.
  • a monoclonal antibody is selected by its HVR, VH, and/or VL sequences and/or binding properties, e.g., selected from a pool of clones (e.g., recombinant, hybridoma, or phage-derived) .
  • a monoclonal antibody may be engineered to include one or more mutations, e.g., to affect binding affinity or other properties of the antibody, create a humanized or chimeric antibody, improve antibody production and/or homogeneity, engineer a multispecific antibody, resultant antibodies of which are still considered to be monoclonal in nature.
  • a population of monoclonal antibodies may be distinguished from polyclonal antibodies as the individual monoclonal antibodies of the population recognize the same antigenic site.
  • phage-display technologies see, e.g., Clackson et al., Nature, 352: 624-628 (1991) ; Marks et al., J. Mol. Biol. 222: 581-597 (1992) ; Sidhu et al., J. Mol. Biol. 338 (2) : 299-310 (2004) ; Lee et al., J. Mol. Biol. 340 (5) : 1073-1093 (2004) ; Fellouse, Proc. Natl. Acad. Sci. USA 101 (34) : 12467-12472 (2004) ; and Lee et al., J. Immunol.
  • Methods 284 (1-2) 119-132 (2004) , and technologies for producing human or human-like antibodies in animals that have parts or all of the human immunoglobulin loci or genes encoding human immunoglobulin sequences (see, e.g., WO 1998/24893; WO 1996/34096; WO 1996/33735; WO 1991/10741; Jakobovits et al., Proc. Natl. Acad. Sci. USA 90: 2551 (1993) ; Jakobovits et al., Nature 362: 255-258 (1993) ; Bruggemann et al., Year in Immunol. 7: 33 (1993) ; U.S. Pat. Nos.
  • Chimeric antibodies may refer to an antibody with one portion of the heavy and/or light chain from a particular isotype, class, or organism and another portion from another isotype, class, or organism.
  • the variable region will be from one source or organism, and the constant region will be from another.
  • Humanized antibodies may refer to antibodies with predominantly human sequence and a minimal amount of non-human (e.g., mouse or chicken) sequence.
  • a humanized antibody has one or more HVR sequences (bearing a binding specificity of interest) from an antibody derived from a non-human (e.g., mouse or chicken) organism grafted onto a human recipient antibody framework (FR) .
  • non-human residues are further grafted onto the human framework (not present in either source or recipient antibodies) , e.g., to improve antibody properties.
  • a humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the hypervariable loops correspond to those of a non-human immunoglobulin, and all or substantially all of the FRs are those of a human immunoglobulin sequence.
  • the humanized antibody optionally will also comprise at least a portion of an immunoglobulin constant region (Fc) , typically that of a human immunoglobulin. See Jones et al., Nature 321: 522-525 (1986) ; Riechmann et al., Nature 332: 323-329 (1988) ; and Presta, Curr. Op. Struct. Biol. 2: 593-596 (1992) .
  • a “human” antibody may refer to an antibody having an amino acid sequence which corresponds to that of an antibody produced by a human and/or has been made using any of the techniques for making human antibodies as disclosed herein.
  • Human antibodies can be produced using various techniques known in the art, including phage-display libraries. Hoogenboom and Winter, J. Mol. Biol., 227: 381 (1991) ; Marks et al., J. Mol. Biol., 222: 581 (1991) ; preparation of human monoclonal antibodies as described in Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985) ; Boerner et al., J.
  • immunized xenomice see, e.g., U.S. Pat. Nos. 6,075,181 and 6,150,584 regarding XENOMOUSE TM technology
  • chickens with human immunoglobulin sequence (s) see, e.g., WO2012162422, WO2011019844, and WO2013059159
  • immunoglobulins There are five major classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, and several of these can be further divided into subclasses (isotypes) , e.g., IgG1, IgG2, IgG3, IgG4, IgA1, IgA2.
  • the heavy-chain constant domains that correspond to the different classes of immunoglobulins are called ⁇ , ⁇ , ⁇ , ⁇ , and ⁇ , respectively.
  • the subunit structures and three-dimensional configurations of different classes of immunoglobulins are well known.
  • antibody fragment and all grammatical variants thereof, are defined as a portion of an intact antibody comprising the antigen binding site or variable region of the intact antibody which, in certain instances, is free of the constant heavy chain domains (i.e. CH2, CH3, and/or CH4, depending on antibody isotype) of the Fc region of the intact antibody.
  • antibody fragments include Fab, Fab’, Fab’-SH, F (ab’) 2 , and Fv fragments; diabodies; any antibody fragment that is a polypeptide having a primary structure consisting of one uninterrupted sequence of contiguous amino acid residues (referred to herein as a “single-chain antibody fragment” or “single chain polypeptide” ) , including without limitation (1) single-chain Fv (scFv) molecules, (2) single chain polypeptides containing only one light chain variable domain, or a fragment thereof that contains the three CDRs of the light chain variable domain, without an associated heavy chain moiety, and (3) single chain polypeptides containing only one heavy chain variable region, or a fragment thereof containing the three CDRs of the heavy chain variable region, without an associated light chain moiety; and multi-specific or multivalent structures formed from antibody fragments.
  • the heavy chain (s) can contain any constant domain sequence (e.g. CH1 in the IgG isotype) found in a non-Fc region of an intact antibody, and/or can contain any hinge region sequence found in an intact antibody, and/or can contain a leucine zipper sequence fused to or situated in the hinge region sequence or the constant domain sequence of the heavy chain (s) .
  • any constant domain sequence e.g. CH1 in the IgG isotype
  • Papain digestion of antibodies produces two identical antigen-binding fragments, called “Fab” fragments, each with a single antigen-binding site, and a residual “Fc” fragment, whose name reflects its ability to crystallize readily.
  • Pepsin treatment yields an F (ab’) 2 fragment that has two antigen-combining sites and is still capable of cross-linking antigen.
  • Fv is the minimum antibody fragment which contains a complete antigen-recognition and -binding site. In a two-chain Fv species, this region consists of a dimer of one heavy-and one light-chain variable domain in tight, non-covalent association.
  • one heavy-and one light-chain variable domain can be covalently linked by a flexible peptide linker such that the light and heavy chains can associate in a “dimeric” structure analogous to that in a two-chain Fv species. It is in this configuration that the three CDRs of each variable domain interact to define an antigen-binding site on the surface of the VH-VL dimer. Collectively, the six CDRs confer antigen-binding specificity to the antibody. However, even a single variable domain (or half of an Fv comprising only three CDRs specific for an antigen) has the ability to recognize and bind antigen, although at a lower affinity than the entire binding site.
  • the Fab fragment also contains the constant domain of the light chain and the first constant domain (CH 1 ) of the heavy chain.
  • Fab’ fragments differ from Fab fragments by the addition of a few residues at the carboxy terminus of the heavy chain CH 1 domain including one or more cysteines from the antibody hinge region.
  • Fab’-SH is the designation herein for Fab’ in which the cysteine residue (s) of the constant domains bear a free thiol group.
  • F (ab’) 2 antibody fragments originally were produced as pairs of Fab’ fragments which have hinge cysteines between them. Other chemical couplings of antibody fragments are also known.
  • the term “monoclonal antibody” refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigenic site. Each mAb is directed against a single determinant on the antigen. In addition to their specificity, the monoclonal antibodies are advantageous in that they can be synthesized by hybridoma culture, uncontaminated by other immunoglobulins.
  • the modifier “monoclonal” indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method.
  • the monoclonal antibodies to be used in accordance with the present invention may be made in an immortalized B cell or hybridoma thereof, or may be made by recombinant DNA methods.
  • the monoclonal antibodies herein include hybrid and recombinant antibodies produced by splicing a variable (including hypervariable) domain of an CD47 antibody with a constant domain (e.g. “humanized” antibodies) , or a light chain with a heavy chain, or a chain from one species with a chain from another species, or fusions with heterologous proteins, regardless of species of origin or immunoglobulin class or subclass designation, as well as antibody fragments (e.g., Fab, F (ab’) 2 , and Fv) , so long as they exhibit the desired biological activity.
  • Fab fragment antigen binding
  • the monoclonal antibodies herein specifically include chimeric antibodies (immunoglobulins) in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain (s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity.
  • chimeric antibodies immunoglobulins in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain (s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity.
  • treatment refers to clinical intervention designed to alter the natural course of the individual or cell being treated during the course of clinical pathology. Desirable effects of treatment include decreasing the rate of disease progression, ameliorating, or palliating the disease state, and remission or improved prognosis.
  • an individual is successfully “treated” if one or more symptoms associated with cancer are mitigated or eliminated, including, but are not limited to, reducing the proliferation of (or destroying) cancerous cells, decreasing symptoms resulting from the disease, increasing the quality of life of those suffering from the disease, decreasing the dose of other medications required to treat the disease, and/or prolonging survival of individuals.
  • “treating” a disease such as cancer refers to delaying progression of the disease, i.e., deferring, hindering, slowing, retarding, stabilizing, and/or postponing development of the disease (such as cancer) .
  • This delay can be of varying lengths of time, depending on the history of the disease and/or individual being treated.
  • a sufficient or significant delay can, in effect, encompass prevention, in that the individual does not develop the disease.
  • a late stage cancer such as development of metastasis, may be delayed.
  • an “effective amount” is at least the minimum amount required to effect a measurable improvement or prevention of a particular disease (e.g., cancer) .
  • An effective amount herein may vary according to factors such as the disease state, age, sex, and weight of the patient, and the ability of a therapeutic agent (or combination of therapeutic agents) to elicit a desired response in the individual.
  • An effective amount is also one in which any toxic or detrimental effects of the treatment are outweighed by the therapeutically beneficial effects.
  • beneficial or desired results include clinical results such as decreasing one or more symptoms resulting from the disease, increasing the quality of life of those suffering from the disease, decreasing the dose of other medications required to treat the disease, enhancing effect of another medication such as via targeting, delaying the progression of the disease, and/or prolonging survival.
  • an effective amount of the drug may have the effect in reducing the number of cancer cells; reducing the tumor size; inhibiting (i.e., slow to some extent or desirably stop) cancer cell infiltration into peripheral organs; inhibit (i.e., slow to some extent and desirably stop) tumor metastasis; inhibiting to some extent tumor growth; and/or relieving to some extent one or more of the symptoms associated with the disorder.
  • An effective amount can be administered in one or more administrations.
  • an effective amount of drug, compound, or pharmaceutical composition is an amount sufficient to accomplish therapeutic treatment either directly or indirectly.
  • an effective amount of a drug, compound, or pharmaceutical composition may or may not be achieved in conjunction with another drug, compound, or pharmaceutical composition.
  • an “effective amount” may be considered in the context of administering one or more therapeutic agents, and a single agent may be considered to be given in an effective amount if, in conjunction with one or more other agents, a desirable result may be or is achieved.
  • the term “subject” for purposes of treatment refers to any animal classified as a mammal, including humans, domestic and farm animals, and zoo, sports, or pet animals, such as dogs, horses, cats, cows, etc.
  • the mammal is human.
  • the present application is based on the Applicant’s unexpected finding of a direct mechanistic link between activation of the KRAS signaling pathway, the PI3K signaling pathway, and/or the STAT signaling pathway and to cancer/tumor evasion of phagocytosis by macrophages.
  • Applicant found mutations that activate the KRAS signaling pathway lead to the high expression of CD47 via the PI3K and STAT3 signaling pathways.
  • a mutation that activates the KRAS signaling pathway is a substitution in the amino acid KRAS, PI3K, and/or STAT3.
  • a mutation that activates the KRAS signaling pathway results in overexpression of pMEK, pAKT, and/or pSTAT3. In some embodiments, a mutation that activates the KRAS pathway results in in low level of miR-34a.
  • a method of treating cancer in an individual comprises administering an effective amount of an agent (e.g., a therapeutic agent) that blocks the interaction between CD47 (e.g., hCD47) and SIRP ⁇ (e.g., hSIRP ⁇ ) , wherein the cancer has been determined to comprise one or more cells that comprise a mutation that activates the KRAS signaling pathway.
  • an agent e.g., a therapeutic agent
  • SIRP ⁇ e.g., hSIRP ⁇
  • the individual is a human.
  • a method of treating cancer in an individual comprises (a) determining whether the cancer in the individual comprises one or more cells that comprise a mutation that activates the KRAS signaling pathway, and (b) administering an effective amount of an agent that blocks the interaction between CD47 and SIRP ⁇ to the individual who has been determined to have the cancer that comprises one or more cells that comprise a mutation that activates the KRAS signaling pathway.
  • a method predicting whether an individual with cancer is likely respond to treatment with an agent that blocks the interaction between CD47 and SIRP ⁇ comprising determining whether the cancer in the individual comprises one or more cells that comprise a mutation that activates the KRAS signaling pathway, wherein the presence of a mutation that activates the KRAS signaling pathway in one or more cells of the cancer indicates that the individual is likely to respond to the treatment.
  • the individual is human.
  • Also provided is a method of stimulating phagocytosis of a population of cancer cells comprising contacting the population with an effective amount of an agent (e.g., a therapeutic agent) that blocks the interaction between CD47 (e.g., hCD47) and SIRP ⁇ (e.g., hSIRP ⁇ ) , wherein the population comprises one or more cells that comprise a mutation that activates the KRAS signaling pathway.
  • an agent e.g., a therapeutic agent
  • SIRP ⁇ e.g., hSIRP ⁇
  • a cancer (or a population of cancer cells) that one or more cells that comprise a mutation that activates the KRAS signaling pathway is alternatively referred to herein as “a KRAS associated cancer” or “a KRAS mutant cancer. ”
  • the KRAS mutant cancer is solid tumor.
  • the KRAS mutant cancer is selected from the group consisting of lung cancer (such as NSCLC) , pancreas cancer, colorectal cancer, gall bladder cancer, bile duct cancer, thyroid cancer, SCLC, colon cancer, small intestine cancer, appendiceal cancer, gastric cancer, esophageal cancer, bladder cancer, kidney cancer, liver cancer, breast cancer, ovarian cancer, teratocarcinoma, endometrial cancer, cervical cancer, prostate cancer, lymphoma, myeloma, leukemia, brain cancer, MPNST, neurofibromatosis, neuroblastoma, glioma, schwannomas seminoma astrocytoma, squamous cell carcinoma, fibrosarcoma, rhabdomyosarcoma, osteosarcoma, Kaposi’s sarcoma and keratoacanthoma.
  • lung cancer such as NSCLC
  • pancreas cancer colorectal cancer
  • gall bladder cancer gall
  • a “mutation that activates the KRAS signaling pathway” refers to any mutation that results in the activation of the KRAS signaling pathway or a signaling pathway upstream or downstream of KRAS. Such mutations include, but are not limited to, mutations in the amino acid sequence of the KRAS protein.
  • the mutation that activates the KRAS signaling pathway is a substitution in the amino acid sequence of a KRAS protein (e.g., a human KRAS protein, such as set forth in SEQ ID NO: 37 or 38) that ‘locks’ KRAS in a constitutively active state, which therefore results in ligand-independent activation of KRAS signaling.
  • the mutation that activates the KRAS signaling pathway is an amino acid substitution at position 12 relative to a wild type KRAS set forth in SEQ ID NO: 37 or SEQ ID NO: 38.
  • the substitution is selected from the group consisting of: G12C, G12D, G12V, G12W, G12R, and G12A.
  • the wild type KRAS is a wild type human KRAS comprising SEQ ID NO: 37 or SEQ ID NO: 38.
  • the mutation that activates the KRAS signaling pathway is a mutation that activates a signaling pathway downstream of the KRAS signaling pathway. In some embodiments, the mutation that activates the KRAS signaling pathway is a mutation activates the PI3K signaling pathway. In some embodiments, the mutation is a substitution in the amino acid sequence of a p110 ⁇ subunit of PI3K (or “PIK3CA, ” e.g., a human PIK3CA protein, such as set forth in SEQ ID NO: 41) . In some embodiments, the mutation is an amino acid substitution at position 345, 542, 545, or 1047 relative to a wild type PIK3CA set forth in SEQ ID NO: 41.
  • the mutation is selected from the group consisting of: N345K, E542K, E545K, H1047L, and H1047R relative to a wild type PIK3CA set forth in SEQ ID NO: 41.
  • the wild type PIK3CA is a wild type human PIK3CA comprising SEQ ID NO: 41.
  • the mutation that activates the PI3K signaling pathway is a PTEN loss of function mutation.
  • the mutation that activates the KRAS signaling pathway is a mutation that activates a signaling pathway downstream of the KRAS signaling pathway.
  • the mutation that activates the KRAS signaling pathway is a mutation activates the STAT signaling pathway.
  • the mutation is a substitution in the amino acid sequence of a STAT3 protein (e.g., a human STAT3 protein, such as set forth in SEQ ID NO: 42) .
  • the mutation is an amino acid substitution at position 174, 392, 427, 646, 658, 705, or 716 relative to a wild type STAT3 set forth in SEQ ID NO: 42.
  • the mutation is selected from the group consisting of: F174A, K392K, D427H, K392R, N646K, K658N, T705F, and T716M relative to a wild type STAT3 set forth in SEQ ID NO: 42.
  • the wild type STAT3 is a wild type human PIK3CA comprising SEQ ID NO: 42.
  • the mutation that activates the KRAS signaling pathway is a germline mutation.
  • the germline mutation is detected in one or more cells from a blood sample or buccal sample from the individual.
  • the mutation that activates the KRAS signaling pathway is a somatic mutation.
  • the somatic mutation is detected in one or more cells from a sample of cancer cells from the individual.
  • the presence of the mutation that activates the KRAS signaling pathway is determined via, e.g., nucleic acid sequencing, polymerase chain reaction (PCR) , fluorescence in situ hybridization (FISH) , or denaturing high performance liquid chromatography (DHPLC) . Details regarding these techniques are provided in e.g., Wu et al. (2015) Chem. Soc. Rev. 44, 2963-2997.
  • the mutation that activates the KRAS signaling pathway results in altered expression levels of one or more proteins in the KRAS signaling pathway and/or of one or more proteins in a pathway downstream of the KRAS signaling pathway. In some embodiments, the mutation that activates the KRAS signaling pathway results in the overexpression of the MEK protein (pMEK) .
  • the individual (such as the one or more cancer cells in a sample from the individual) is considered to overexpress pMEK when the expression level of pMEK in a sample comprising the cancer cells from the individual is higher than the expression level of pMEK in a reference sample from a healthy individual (e.g., an individual who does not have cancer) .
  • the mutation that activates the KRAS signaling pathway results in overexpression of the AKT protein (pAKT)
  • the individual (such as the one or more cancer cells in a sample from the individual) is considered to overexpress pAKT when the expression level of pAKT in a sample comprising the cancer cells from the individual is higher than the expression level of pAKT in a reference sample from a healthy individual (e.g., an individual who does not have cancer) .
  • the mutation that activates the KRAS signaling pathway results in overexpression of a STAT3 protein (pSTAT3) .
  • the individual (such as the one or more cancer cells in a sample from the individual) is considered to overexpress pSTAT3 when the expression level of pSTAT3 in a sample comprising the cancer cells from the individual is higher than the expression level of pSTAT3 in a reference sample from a healthy individual (e.g., an individual who does not have cancer) .
  • the presence of the mutation that activates the KRAS signaling pathway is determined via, e.g., Western blot, ELISA, or immunofluorescence.
  • the mutation that activates the KRAS signaling pathway results in altered expression levels of one or more microRNAs in the KRAS signaling pathway and/or of one or more microRNAs in a pathway downstream of the KRAS signaling pathway. In some embodiments, the mutation that activates the KRAS signaling pathway results in low level of microRNA-34a (miR-34a) .
  • the individual (such as the one or more cancer cells in a sample from the individual) is considered to have low level of miR-34a when the expression level of the miR-34a in a sample comprising the cancer cells from the individual is lower than the expression level of the miR-34a in a reference sample from a healthy individual (e.g., an individual who does not have cancer) .
  • the presence of the mutation that activates the KRAS signaling pathway is determined via quantitative reverse transcription-polymerase chain reaction (RT-PCR) , Northern blot, in situ hybridization, and/or nuclease protection assay.
  • sample refers to a composition that is obtained or derived from the individual that contains a cellular and/or other molecular entity that is to be characterized and/or identified, for example based on physical, biochemical, chemical and/or physiological characteristics.
  • sample comprising cancer cells and variations thereof refers to any sample obtained from a subject of interest that would be expected or is known to contain the cellular and/or molecular entity that is to be characterized.
  • a sample can be a biological sample (such as an ex vivo biological sample) of biological tissue or fluid that contains cancer cells and/or tumor cells from the subject from which nucleic acids (such as polynucleotides, e.g., genomic DNA and/or transcripts) and/or polypeptides can be isolated.
  • samples are typically from a human subject, but include tissues isolated from other subjects (such any animal classified as a mammal, as described elsewhere herein.
  • a sample may also include sections of tissues such as biopsy and autopsy samples, frozen sections taken for histologic purposes, etc. Samples may include fresh samples from the individual or preserved tissue samples, such as a formalin-fixed paraffin-embedded (FFPE) samples.
  • FFPE formalin-fixed paraffin-embedded
  • Samples also include explants and primary and/or transformed cell cultures derived from the individual’s tissues.
  • sample refers to a collection of similar cells obtained from a tissue of an individual.
  • the source of the tissue or cell sample may be solid tissue as from a fresh, frozen and/or preserved organ or tissue sample or biopsy or aspirate; blood or any blood constituents; bodily fluids such as cerebral spinal fluid, amniotic fluid, peritoneal fluid, or interstitial fluid; cells from any time in gestation or development of the subject.
  • the tissue sample may also be primary or cultured cells or cell lines.
  • the sample is obtained from a disease tissue/organ (e.g., a cancerous tissue or organ) .
  • sample contains compounds which are not naturally intermixed with the tissue in nature such as preservatives, anticoagulants, buffers, fixatives, nutrients, antibiotics, or the like.
  • the agent that blocks the interaction between CD47 (e.g., hCD47) and SIRP ⁇ (e.g., hSIRP ⁇ ) is a polypeptide.
  • the agent that blocks the interaction between CD47 (e.g., hCD47) and SIRP ⁇ (e.g., hSIRP ⁇ ) is a polypeptide that binds CD47 (e.g., hCD47) .
  • the polypeptide is or comprises an anti-CD47 antibody, an immunologically active fragment thereof, or an antibody-based construct (such as a multispecific construct, e.g., a bispecific antibody) . Exemplary anti-CD47 antibodies that find use with the methods are described in further detail below.
  • an anti-CD47 antibody (or an immunologically active fragment thereof) is an antibody that binds to CD47 (e.g., human CD47 or “hCD47” ) with sufficient affinity and specificity.
  • an “immunologically active fragment” of an antibody refers to an antigen-binding fragment of said antibody.
  • the terms “immunologically active fragment” and “antigen-binding fragment” are used interchangeably herein.
  • the anti-CD47 antibody (or immunologically active fragment thereof) is a chimeric (such as humanized) monoclonal antibody (or immunologically active fragment thereof) .
  • the anti-CD47 antibody is 5F9 (also known as Hu5F9-G4 and magrolimab) , which is under development by Gilead Sciences/Forty Seven, Inc.; CC-90002 (also known as INBRX103) , which is under development by Celgene; LQ001, which is under development by Novamab; HLX24, which is under development by Henlius; TI-061, which is under development by Arch Oncology (formerly Tioma Therapeutics) ; AO-176, which is under development by Arch Oncology; SRF-231, which is under development by Surface Oncology; IBI-188, which is under development by Innovent Bio; AK117, which is under development by Akesobio; IMC-002, which is under development by ImmuneOncia Therapeutics 3D Medicines; SHR-1603, which is under development by Jiangsu HengRui Medicine; STI-6643, which is under development by Sorrento Therapeutics Inc.; or ZL
  • the immunologically active fragment of the anti-CD47 antibody is an immunologically active fragment thereof anti-CD47 antibodies. Additional details about these exemplary anti-CD47 antibodies can be found in, e.g., Jiang et al. (2021) J Hematol Oncol 14: 180 doi (dot) org/10 (dot) 1186/s13045-021-01197-w; WO 2011/143624A2, USP 9, 382, 320 B2.
  • the anti-CD47 antibody (or immunologically active fragment thereof) comprises a heavy chain variable domain (V H ) , and/or a light chain variable domain (V L ) of described herein below.
  • the anti-CD47 antibody (or immunologically active fragment thereof) comprises a (a) VH domain that comprises (1) a CDR-H1 comprising RAWMN (SEQ ID NO: 5) ; (2) a CDR-H2 comprising RIKRKTDGETTDYAAPVKG (SEQ ID NO: 6) ; (3) a CDR-H3 comprising SNRAFDI (SEQ ID NO: 7) and (b) a VL domain that comprises (1) a CDR-L1 comprising KSSQSVLYAGNNRNYLA (SEQ ID NO: 8) ; (2) a CDR-L2 comprising QASTRAS (SEQ ID NO: 9) ; and (3) a CDR-L3 comprising QQYYTPPLA (SEQ ID NO: 10) .
  • VH domain that comprises (1) a CDR-H1 comprising RAWMN (SEQ ID NO: 5) ; (2) a CDR-H2 comprising RIKRKTDGETTDYAAPVKG (SEQ
  • the CDR sequences are defined according to Kabat (see, e.g., (Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. (1991) ) .
  • the anti-CD47 antibody (or immunologically active fragment thereof) comprises a (a) VH domain that comprises (1) a CDR-H1 comprising GLTFERA (SEQ ID NO: 11) ; (2) a CDR-H2 comprising KRKTDGET (SEQ ID NO: 12) ; (3) a CDR-H3 comprising SNRAFDI (SEQ ID NO: 7) and (b) a VL domain that comprises (1) a CDR-L1 comprising KSSQSVLYAGNNRNYLA (SEQ ID NO: 14) ; (2) a CDR-L2 comprising QASTRAS (SEQ ID NO: 15) ; and (3) a CDR-L3 comprising QQYYTPPLA (SEQ ID NO: 16) .
  • VH domain that comprises (1) a CDR-H1 comprising GLTFERA (SEQ ID NO: 11) ; (2) a CDR-H2 comprising KRKTDGET (SEQ ID NO: 12) ; (3) a CDR-H
  • the CDR sequences are defined according to the Chothia numbering system (see, e.g., Chothia and Lesk (1986) EMBO J. 5 (4) : 823-6 and Al-Lazikani et al., (1997) JMB 273: 927-948) .
  • the anti-CD47 antibody (or immunologically active fragment thereof) comprises a (a) VH domain that comprises (1) a CDR-H1 comprising GLTFERAW (SEQ ID NO: 17) ; (2) a CDR-H2 comprising IKRKTDGETT (SEQ ID NO: 18) ; (3) a CDR-H3 comprising AGSNRAFDI (SEQ ID NO: 19) and (b) a VL domain that comprises (1) a CDR-L1 comprising QSVLYAGNNRNY (SEQ ID NO: 20) ; (2) a CDR-L2 comprising QAS (SEQ ID NO: 21) ; and (3) a CDR-L3 comprising QQYYTPPLA (SEQ ID NO: 22) .
  • the CDR sequences are defined according to the IMGT numbering system (see, e.g., Lefranc MP. (2013) IMGT Unique Numbering. In: Dubitzky W., Wolkenhauer O., Cho KH., Yokota H. (eds) Encyclopedia of Systems Biology. Springer, New York, NY; https: //doi. org/10.1007/978-1-4419-9863-7_127) .
  • the anti-CD47 antibody (or immunologically active fragment thereof) comprises a (a) VH domain that comprises (1) a CDR-H1 comprising GLTFERAWMN (SEQ ID NO: 23) ; (2) a CDR-H2 comprising RIKRKTDGETTD (SEQ ID NO: 24) ; (3) a CDR-H3 comprising SNRAFDI (SEQ ID NO: 25) and (b) a VL domain that comprises (1) a CDR-L1 comprising KSSQSVLYAGNNRNYLA (SEQ ID NO: 26) ; (2) a CDR-L2 comprising QASTRAS (SEQ ID NO: 27) ; and (3) a CDR-L3 comprising QQYYTPPLA (SEQ ID NO: 28) .
  • VH domain that comprises (1) a CDR-H1 comprising GLTFERAWMN (SEQ ID NO: 23) ; (2) a CDR-H2 comprising RIKRKTDGETTD (SEQ ID NO: 24
  • the CDR sequences are defined according to the AbM numbering system (see, e.g., Abhinandan R.K., Martin A.C. Analysis and improvements to Kabat and structurally correct numbering of antibody variable domains. Mol. Immunol. 2008; 45: 3832–3839. doi: 10.1016/j. molimm. 2008.05.022) .
  • the anti-CD47 antibody (or immunologically active fragment thereof) comprises (a) VH domain that comprises (1) a CDR-H1 comprising ERAWMN (SEQ ID NO: 29) ; (2) a CDR-H2 comprising WVGRIKRKTDGETTD (SEQ ID NO: 30) ; (3) a CDR-H3 comprising AGSNRAFD (SEQ ID NO: 31) and (b) a VL domain that comprises (1) a CDR-L1 comprising LYAGNNRNYLAWY (SEQ ID NO: 32) ; (2) a CDR-L2 comprising LLINQASTRA (SEQ ID NO: 33) ; and (3) a CDR-L3 comprising QQYYTPPL (SEQ ID NO: 34) .
  • the CDR sequences are defined according to the Contact numbering system (see, e.g., McCallum et al. (1996) J Mol Biol. 262 (5) : 732-45; doi: 10.1006/jmbi. 1996.0548) .
  • the anti-CD47 antibody (or immunologically active fragment thereof) comprises 3 CDRs of a VH domain comprising SEQ ID NO: 1. Additionally or alternatively, in some embodiments, the anti-CD47 antibody (or immunologically active fragment thereof) comprises 3 CDRs of a VL domain comprising SEQ ID NO: 2. In some embodiments, the 3 CDRs of the VH domain are CDRs according to Kabat, Chothia, AbM or Contact numbering system. Additionally or alternatively, in some embodiments, the 3 CDRs of the VL domain are CDRs according to Kabat, Chothia, AbM or Contact numbering system.
  • the N-terminal amino acid of the VH domain of the anti-CD47 antibody (or immunologically active fragment thereof) is E, and, optionally, in some embodiments, the C-terminal amino acid of the VH domain of the anti-CD47 antibody (or immunologically active fragment thereof) is S.
  • the anti-CD47 antibody (or immunologically active fragment thereof) comprises a heavy chain variable domain (VH) comprising an amino acid sequence that has at least about 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to an amino acid sequence set forth in SEQ ID NO: 1.
  • VH heavy chain variable domain
  • the N-terminal amino acid of the VH domain that has at least about 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to an amino acid sequence set forth in SEQ ID NO: 1 is E.
  • the C-terminal amino acid of the VH domain that has at least about 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to an amino acid sequence set forth in SEQ ID NO: 1 is S.
  • the N-terminal amino acid of the V H domain of the anti-CD47 antibody (or immunologically active fragment thereof) corresponds to position H1 according to the Kabat numbering system
  • the C-terminal amino acid of the V H domain of the anti-CD47 antibody (or immunologically active fragment thereof) corresponds to position H113 according to the Kabat numbering system.
  • the N-terminal amino acid of the V H domain of the anti-CD47 antibody corresponds to position H1 according to the Chothia numbering system
  • the C-terminal amino acid of the V H domain of the anti-CD47 antibody corresponds to position H113 according to the Chothia numbering system
  • the N-terminal amino acid of the V H domain of the anti-CD47 antibody corresponds to position H1 according to the IMGT numbering system
  • the C-terminal amino acid of the V H domain of the anti-CD47 antibody (or immunologically active fragment thereof) corresponds to position H128 according to the IMGT numbering system.
  • the N-terminal amino acid of the V H domain of the anti-CD47 antibody corresponds to amino acid 1 of SEQ ID NO: 1
  • the C-terminal amino acid of the V H domain the anti-CD47 antibody corresponds to amino acid 118 of SEQ ID NO: 1.
  • the anti-CD47 antibody comprises (such as further comprises) a light chain variable domain (VL) comprising an amino acid sequence that has at least about 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to an amino acid sequence set forth in SEQ ID NO: 2.
  • VL light chain variable domain
  • the anti-CD47 antibody comprises a VH comprising SEQ ID NO: 1 and a VL comprising SEQ ID NO: 2. The amino acid sequences of SEQ ID NOs: 1 and 2 are provided below:
  • the anti-CD47 antibody is a full length antibody.
  • the full length antibody comprises a human Fc region.
  • the human Fc region is an IgG1, IgG2, or IgG4 Fc region.
  • the full length anti-CD47 antibody comprises a human IgG4 Fc region or a variant thereof that comprises an S228P substitution, wherein amino acid numbering is according to the EU index.
  • the full length anti-CD47 antibody comprises a heavy chain comprising the amino acid SEQ ID NO: 3 and a light chain comprising the amino acid sequence of SEQ ID NO: 4.
  • the full length anti-CD47 antibody is a full length antibody that comprises a heavy chain comprising the amino acid SEQ ID NO: 35 and a light chain comprising the amino acid sequence of SEQ ID NO: 4.
  • the anti-CD47 antibody is lemzoparlimab (also known as TJ011133) .
  • the anti-CD47 antibody that binds specifically to hCD47 can be of any of the various types of antibodies as defined above, but is, in certain embodiments, a human, humanized, or chimeric antibody. In some embodiments, the anti-CD47 antibody is a human antibody.
  • the anti-CD47 is a humanized antibody that comprises a human antibody constant domain (e.g., a human Fc domain, such as a human IgG Fc domain, e.g., a human IgG1, a human IgG2, a human IgG3, or a human IgG4 Fc domain, or a variant of a human IgG4 Fc domain that comprises an S228P substitution, wherein amino acid numbering is according to the EU index. ) .
  • the anti-CD47 antibody is a chimeric antibody. See, e.g., U.S. Patent No. 4,816,567 and Morrison et al., Proc. Natl. Acad. Sci.
  • the chimeric anti-CD47 antibody comprises a non-human variable region (e.g., a variable region derived from a chicken, mouse, rat, hamster, rabbit, or non-human primate, such as a monkey) and a human constant region.
  • a chimeric antibody is a “class switched” antibody in which the class or subclass has been changed from that of the parent antibody. Chimeric antibodies include antigen-binding fragments thereof.
  • a chimeric antibody is a humanized antibody.
  • a non-human antibody can be humanized to reduce immunogenicity to humans, while retaining the specificity and affinity of the parental non-human antibody.
  • a humanized antibody comprises one or more variable domains in which HVRs, e.g., CDRs, (or portions thereof) are derived from a non-human antibody (e.g., a chicken antibody) , and FRs (or portions thereof) are derived from human antibody sequences.
  • HVRs e.g., CDRs
  • FRs or portions thereof
  • a humanized antibody optionally will also comprise at least a portion of a human constant region.
  • some FR residues in a humanized antibody are substituted with corresponding residues from a non-human antibody (e.g., the antibody from which the HVR or CDR residues are derived) , e.g., to restore or improve antibody specificity or affinity.
  • a non-human antibody e.g., the antibody from which the HVR or CDR residues are derived
  • Humanized antibodies and methods of making them are reviewed, e.g., in Almagro and Fransson, Front. Biosci. 13: 1619-1633 (2008) .
  • Human framework regions useful for humanization include but are not limited to: framework regions selected using the “best-fit” method; framework regions derived from the consensus sequence of human antibodies of a particular subgroup of light or heavy chain variable regions; human somatically mutated framework regions or human germline framework regions; and framework regions derived from screening FR libraries. See, e.g., Sims et al. J. Immunol. 151 : 2296 (1993) ; Carter et al. Proc. Natl. Acad. Sci. USA, 89: 4285 (1992) ; Presta et al. J. Immunol., 151: 2623 (1993) ; Almagro and Fransson, Front. Biosci. 13: 1619-1633 (2008) ; and Baca et al., J. Biol. Chem. 272: 10678-10684 (1997) .
  • an anti-CD47 antibody of the present disclosure is a human antibody.
  • Human antibodies can be produced using various techniques known in the art.
  • the human antibody is produced by a non-human animal, such as the genetically engineered chickens (see, e.g., US Pat. Nos. 8,592,644; and 9,380,769) and/or mice described herein. Human antibodies are described generally in Lonberg, Curr. Opin. Immunol. 20: 450-459 (2008) .
  • an anti-CD47 antibody of the present disclosure is an antibody fragment (e.g., an immunologically active fragment) , including without limitation a Fab, F (ab’) 2, Fab’-SH, Fv, or scFv fragment, or a single domain, single heavy chain, or single light chain antibody.
  • an “immunologically active fragment” of an antibody refers to an antigen-binding fragment of said antibody.
  • the terms “immunologically active fragment” and “antigen-binding fragment” are used interchangeably herein.
  • Antibody fragments can be generated, e.g., by enzymatic digestion or by recombinant techniques.
  • an antibody fragment is produced by a recombinant host cell.
  • Fab, Fv and ScFv antibody fragments are expressed by and secreted from E. coli.
  • Antibody fragments can alternatively be isolated from an antibody phage library. Other methods of generating immunologically active fragments of an antibody are well-known in the art.
  • the anti-CD47 antibody (or immunologically active fragment thereof) specifically recognizes (such as binds) to hCD47 expressed on the surface of a cell.
  • the anti-CD47 antibody specifically recognizes hCD47 expressed on the surface of a cancer cell, e.g., a KRAS mutant cancer cell (such as a non-small cell lung cancer (NSCLC) cell, pancreas cancer cell, colorectal cancer cell, gall bladder cancer cell, bile duct cancer cell, thyroid cancer cell, head and neck cancer cell, SCLC cell, colon cancer cell, small intestine cancer cell, appendiceal cancer cell, gastric cancer cell, esophageal cancer cell, bladder cancer cell, kidney cancer cell, liver cancer cell, breast cancer cell, ovarian cancer cell, teratocarcinoma cell, endometrial cancer cell, cervical cancer cell, prostate cancer cell, lymphoma cell, myeloma cell, leukemia cell, brain cancer cell, MPNST cell, neurofibromat
  • NSCLC non-
  • the binding of an anti-CD47 antibody (or immunologically active fragment thereof) described herein to hCD47 prevents the interaction of hCD47 with signal regulatory protein alpha (SIRP ⁇ ) , such as human SIRP ⁇ ( “hSIRP ⁇ ” ) .
  • SIRP ⁇ signal regulatory protein alpha
  • the binding of an anti-CD47 antibody (or immunologically active fragment thereof) described herein to hCD47 expressed on the surface of a cancer cell promotes macrophage mediated phagocytosis of the cancer cell.
  • exemplary anti-CD47 antibodies that may be used with the methods of treating a KRAS mutant cancer cell, including pharmaceutical formulations comprising same, exemplary dosages, and exemplary administration schedules, are provided in PCT/CN2021/123892. Further details about methods of producing/manufacturing anti-CD47 antibodies described herein are provided in PCT/CN2021/123892.
  • KRAS a member of the RAS family, is a key regulator of signaling pathways responsible for cell proliferation, differentiation, and survival. See, e.g., Cox et al. (2003) Nat Rev Drug Discov. 13 (11) : 828-851 and Downward J. (2003) Nat Rev Cancer. 3 (1) : 11-22. KRAS mutations are present in approximately 25%of tumors, making them one of the most common gene mutations linked to cancer. They are frequent drivers in lung, colorectal and pancreatic cancers. KRAS drives 32%of lung cancers, 40%of colorectal cancers, and 85%to 90%of pancreatic cancer cases.
  • G12C, G12D and G12R are some of the most common KRAS mutations, based on the specific mutations that are present.
  • KRAS proteins with activating mutations abrogate the GTPase activity and are locked in the GTP-bound hyperactive state, leading to constitutive activation of downstream pro-proliferative and pro-survival pathways such as RAF-MEK-ERK and PI3K-AKT.
  • An emerging and exciting new direction may come from recent advances in our understanding of the relationship between KRAS mutations and tumor immune evasion.
  • the present application reveals a direct mechanistic link between active KRAS and innate immune evasion and identify CD47 as a major effector underlying KRAS-mediated immunosuppressive tumor microenvironment, thereby provides novel methods for treating KRAS mutant cancer.
  • KRAS mutation refers to a mutation in the KRAS protein, especially a KRAS oncogenic mutation.
  • KRAS oncogenic mutation refers to a KRAS mutation causing a cancer or promoting cancer development, such as a KRAS mutation that results in a reduced ability of KRAS protein to catalyze the hydrolysis of guanosine triphosphate (GTP) to guanosine diphosphate (GDP) .
  • GTP guanosine triphosphate
  • GDP guanosine diphosphate
  • Reduced ability of KRAS protein to catalyze the hydrolysis of guanosine triphosphate (GTP) to guanosine diphosphate (GDP) includes hindering the binding of KRAS to GTPase activating proteins (GAPs) and/or promoting the binding of KRAS to guanine nucleotide exchange factors (GEFs) .
  • GAPs GTPase activating proteins
  • GEFs guanine nucleotide exchange factors
  • KRAS oncogenic mutations include, but are not limited to G12D, G12C, G12V, G12R, G12A, and G12W.
  • KRAS G12D inhibitor refers to any agent, e.g., polypeptide, fusion polypeptide, antibody, peptide, antisense oligonucleotide, or small molecule drug that inhibits the activity of the KRAS G12D mutant protein.
  • the KRAS G12D inhibitor interacts directly with the KRAS G12Dmutant protein to inhibit the protein’s activity.
  • the KRAS G12D inhibitor is a small molecule drug.
  • Exemplary small molecule KRAS G12D inhibitors that find use with the methods provided herein include, without limitation, e.g., MRTX1133 (Mirati) , iExosomes (MD Anderson) and mRNA-5671 (Moderna) .
  • Other exemplary small molecule KRAS G12D inhibitors are described in, e.g., WO2021041671A1, WO2022015375A1, the contents of which are incorporated herein by reference in their entireties.
  • the KRAS G12D inhibitor is MRTX1133, which is currently under development by Mirati.
  • MRTX1133 is a noncovalent, potent, and selective KRAS G12D inhibitor.
  • MRTX1133 fills the switch II pocket and extends three substituents to favorably interact with the protein, resulting in an estimated K D against KRAS G12D of 0.2 pM. It prevents SOS1-catalyzed nucleotide exchange and/or formation of the KRAS G12D/GTP/RAF1 complex, thereby inhibiting mutant KRAS-dependent signal transduction.
  • MRTX1133 has nanomolar activity in tumor models harboring KRAS G12D mutations.
  • MRTX1133 is described chemically as 2-Naphthalenol, 4- [4- (3, 8-diazabicyclo [3.2.1] oct-3-yl) -8-fluoro-2- [ [ (2R, 7aS) -2-fluorotetrahydro-1H-pyrrolizin-7a (5H) -yl] methoxy] pyrido [4, 3-d] pyrimidin-7-yl] -5-ethynyl-6-fluoro-and has the following chemical structure:
  • miR-34a mimic is a molecule capable of mimicking the activity of endogenous miR-34a.
  • MiR-34a mimic can be double-stranded, single-stranded, or hairpin.
  • An miRNA mimic can be modified (e.g. chemically) to have more or less activity than their endogenous equivalent (e.g. through greater resistance to degradation) .
  • a miR-34a mimic comprises a sequence of a mature miR-34a.
  • the sequence of a mature miR-34a comprises SEQ ID NO: 39, from 5’ to 3’.
  • miR-34a mimics comprise vectors or polynucleotides which encode a miR-34a.
  • an miR-34a mimics also comprise pri-miR-34a, pre-miR-34a, double-stranded nucleotide comprising mature-miR-34a, artificial mature-miR-34a, single-strand mature-miR-34a expressed from the 5′-end of a pre-miRNA, or a single-strand mature-miRNA expressed from the 3′-end of a pre-miRNA.
  • Exemplary miR-34a mimics are RNA4TNBC created by Protheragen Inc, MRX-34 created by Mirna Therapeutics Inc, and those described in WO-2006137941, WO-2011088309, WO-2008104974, WO-2014203189. In this application, unless otherwise specified, the miR-34a is miR-34a-5p.
  • provided herein is a method of treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of an agent that blocks the interaction between CD47 and SIRP ⁇ , wherein the tumor is mediated by a KRAS mutation in the subject.
  • the KRAS mutation occurs at residue 12 of the amino acid sequence of KRAS protein, as set forth in SEQ ID NO. 37 or SEQ ID NO. 38.
  • the KRAS mutation is selected from the group consisting of G12C, G12D, G12V, G12W, G12R, and G12A mutation.
  • the KRAS mutation is G12D mutation.
  • the KRAS mutation is G12V mutation.
  • the agent that blocks the interaction between CD47 and SIRP ⁇ is anti-CD47 antibody or immunologically active fragment thereof.
  • the anti-CD47 antibody or immunologically active fragment thereof is CC-90002, 5F9, LQ001, HLX24, TI-061, AO-176, SRF-231, IBI-188, IMC-002, SHR-1603, STI-6643, ZL-1201, or an immunologically active fragment thereof.
  • the anti-CD47 antibody or immunologically active fragment thereof comprises three complementarity determining regions (CDRs) of a heavy chain variable domain (VH) set forth in SEQ ID NO: 1 and three CDRs of a light chain variable domain (VL) set forth in SEQ ID NO: 2.
  • CDRs complementarity determining regions
  • the anti-CD47 antibody or immunologically active fragment thereof comprises: (a) a VH that comprises (1) a CDR-H1 comprising RAWMN (SEQ ID NO: 5) ; (2) a CDR-H2 comprising RIKRKTDGETTDYAAPVKG (SEQ ID NO: 6) ; and (3) a CDR-H3 comprising SNRAFDI (SEQ ID NO: 7) and (b) a VL that comprises (1) a CDR-L1 comprising KSSQSVLYAGNNRNYLA (SEQ ID NO: 8) ; (2) a CDR-L2 comprising QASTRAS (SEQ ID NO: 9) ; and (3) a CDR-L3 comprising QQYYTPPLA (SEQ ID NO: 10) , wherein the CDR sequences are defined according to the Kabat numbering system.
  • the anti-CD47 antibody or immunologically active fragment thereof comprises a VH domain and a VL domain
  • the VH domain of the anti-CD47 antibody or immunologically active fragment thereof comprises an amino acid sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identity to SEQ ID NO: 1
  • the VL of the anti-CD47 antibody or immunologically active fragment thereof comprises an amino acid sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%identity to SEQ ID NO: 2.
  • the VH domain of the anti-CD47 antibody or immunologically active fragment thereof comprises an amino acid sequence of SEQ ID NO: 1
  • the VL of the anti-CD47 antibody or immunologically active fragment thereof comprises an amino acid sequence of SEQ ID NO: 2.
  • the anti-CD47 antibody is a full length antibody.
  • the full length anti-CD47 antibody comprises a heavy chain that comprises an amino acid sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identity to SEQ ID NO: 3 or SEQ ID NO: 35; and a light chain that comprises an amino acid sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identity to SEQ ID NO: 4.
  • provided herein is a method of treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of anti-CD47 antibody or immunologically active fragment thereof of the present application, wherein the tumor is mediated by a KRAS G12D mutation in the subject.
  • a method of treating cancer in a subject in need thereof comprising administering to the subject an effective amount of anti-CD47 antibody or immunologically active fragment thereof of the present application, wherein the tumor is mediated by a KRAS G12V mutation in the subject.
  • provided herein is a method of treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of anti-CD47 antibody or immunologically active fragment thereof of the present application, wherein the tumor is mediated by a KRAS G12W mutation in the subject.
  • a method of treating cancer in a subject in need thereof comprising administering to the subject an effective amount of anti-CD47 antibody or immunologically active fragment thereof of the present application, wherein the tumor is mediated by a KRAS G12R mutation in the subject.
  • provided herein is a method of treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of anti-CD47 antibody or immunologically active fragment thereof of the present application, wherein the tumor is mediated by a KRAS G12A mutation in the subject.
  • the method further comprises administrating the subject an effective amount of a second agent for treating a tumor comprising a cell with a KRAS mutation.
  • the second agent is a KRAS G12D inhibitor, or a miR-34a mimic.
  • the KRAS G12D inhibitor is selected from the group consisting of MRTX1133 (Mirati) , iExosomes (MD Anderson) and mRNA-5671 (Moderna) .
  • the KRAS G12D inhibitor is MRTX1133.
  • the KRAS G12D inhibitor comprises a structure of:
  • provided herein is a method of treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of anti-CD47 antibody or immunologically active fragment thereof of the present application and a KRAS G12D inhibitor, wherein the tumor is mediated by a KRAS G12D mutation in the subject.
  • a method of treating cancer in a subject in need thereof comprising administering to the subject an effective amount of anti-CD47 antibody or immunologically active fragment thereof of the present application and a KRAS G12D inhibitor comprising the structure below:
  • the tumor is mediated by a KRAS G12D mutation in the subject.
  • the agent that blocks the interaction between CD47 and SIRP ⁇ such as anti-CD47 antibody or immunologically active fragment thereof of the present application and the second agent such as the KRAS G12D inhibitor are administered simultaneously. In some embodiments of the methods of treatment, the agent that blocks the interaction between CD47 and SIRP ⁇ such as anti-CD47 antibody or immunologically active fragment thereof of the present application and the second agent such as the KRAS G12D inhibitor are administered sequentially. In some embodiments of the methods of treatment, the agent that blocks the interaction between CD47 and SIRP ⁇ such as anti-CD47 antibody or immunologically active fragment thereof of the present application is administered prior to the second agent such as the KRAS G12D inhibitor. In some embodiments of the methods of treatment, the second agent such as the KRAS G12D inhibitor is administered prior to the agent that blocks the interaction between CD47 and SIRP ⁇ such as anti-CD47 antibody or immunologically active fragment thereof of the present application.
  • the cancer comprises one or more cells that comprise a mutation that activates the KRAS signaling pathway.
  • Exemplary mutations that activate the KRAS pathway are described in detail elsewhere herein.
  • the cancer i.e., the cancer that comprises one or more cells that comprise a mutation that activates the KRAS signaling pathway
  • the cancer is selected from the group consisting of lung cancer (such as lung adenocarcinoma or NSCLC) , pancreas cancer, colorectal cancer, gall bladder cancer, bile duct cancer, thyroid cancer, head and neck cancer, SCLC, colon cancer, small intestine cancer, appendiceal cancer, gastric cancer, esophageal cancer, bladder cancer, kidney cancer, liver cancer, breast cancer, ovarian cancer, teratocarcinoma, endometrial cancer, cervical cancer, prostate cancer, lymphoma, myeloma, leukemia, brain cancer, MPNST, neurofibromatosis, neuroblastoma, glioma, schwannomas seminoma astrocytoma, squamous cell carcinoma, fibrosarcoma, rhabdomyosarcoma, osteosarcoma, Kaposi’s sarcoma and keratoacanthoma.
  • lung cancer such as lung adenocarcinoma or
  • a method of stimulating the phagocytosis of a population of cancer cells that comprises one or more cancer cells that express a KRAS mutant protein comprising contacting the population with an effective amount of an agent (e.g., therapeutic agent) that blocks the interaction between CD47 (e.g., hCD47) and SIRP ⁇ (e.g., hSIRP ⁇ ) .
  • the KRAS mutation occurs at residue 12 of the amino acid sequence of KRAS protein, as set forth in SEQ ID NO. 37 or SEQ ID NO. 38.
  • the KRAS mutation is selected from the group consisting of G12C, G12D, G12V, G12W, G12R, and G12A mutation.
  • the KRAS mutation is G12D mutation.
  • the KRAS mutation is G12V mutation.
  • the agent that blocks the interaction between CD47 and SIRP ⁇ is anti-CD47 antibody or immunologically active fragment thereof.
  • the anti-CD47 antibody or immunologically active fragment thereof is CC-90002, 5F9, LQ001, HLX24, TI-061, AO-176, SRF-231, IBI-188, IMC-002, SHR-1603, STI-6643, ZL-1201, or an immunologically active fragment thereof.
  • the anti-CD47 antibody or immunologically active fragment thereof comprises three complementarity determining regions (CDRs) of a heavy chain variable domain (VH) set forth in SEQ ID NO: 1 and three CDRs of a light chain variable domain (VL) set forth in SEQ ID NO: 2.
  • CDRs complementarity determining regions
  • a method of stimulating the phagocytosis of a population of cancer cells that comprises one or more cancer cells that express a KRAS G12D mutant protein comprising contacting the population with an effective amount of an agent (e.g., therapeutic agent) that blocks the interaction between CD47 (e.g., hCD47) and SIRP ⁇ (e.g., hSIRP ⁇ ) and an effective amount of a KRAS G12D inhibitor.
  • the KRAS G12D inhibitor is selected from the group consisting of MRTX1133 (Mirati) , iExosomes (MD Anderson) and mRNA-5671 (Moderna) .
  • the KRAS G12D inhibitor is MRTX1133.
  • the KRAS G12D inhibitor comprises a structure of:
  • the KRAS G12D containing cancer cell (or the one or more cancer cells that expresses KRAS G12D mutant protein) is a solid tumor cell.
  • the cancer cell is selected from the group consisting of NSCLC cell, pancreas cancer cell, colorectal cancer cell, gall bladder cancer cell, bile duct cancer cell, thyroid cancer cell, head and neck cancer cell, SCLC cell, colon cancer cell, small intestine cancer cell, appendiceal cancer cell, gastric cancer cell, esophageal cancer cell, bladder cancer cell, kidney cancer cell, liver cancer cell, breast cancer cell, ovarian cancer cell, teratocarcinoma cell, endometrial cancer cell, cervical cancer cell, prostate cancer cell, lymphoma cell, myeloma cell, leukemia cell, brain cancer cell, MPNST cell, neurofibromatosis cell, neuroblastoma cell, glioma cell, schwannomas seminoma astrocytoma cell, squamous
  • a method for determining whether a subject in need thereof is suitable for cancer treatment by an agent that blocks the interaction between CD47 and SIRP ⁇ comprising determining presence or absence of a KRAS mutation in the subject.
  • the presence of the KRAS mutation indicates the subject is suitable for cancer treatment by the agent.
  • the KRAS mutation is selected from the group consisting of G12C, G12D, G12V, G12W, G12R, and G12A mutation.
  • the method further comprises determining expression level of CD47 in the subject. In some embodiments, the expression level of CD47 in the subject is higher than that in a reference subject.
  • the reference subject does not comprise any KRAS mutant, for example, KRAS mutant at residue 12 of the amino acid of KRAS protein as set forth in SEQ ID NO. 37 or SEQ ID NO. 38.
  • the reference subject does not have cancer.
  • the reference subject is a healthy human being.
  • a method for determining likelihood of a subject in need thereof to respond to an agent that blocks the interaction between CD47 and SIRP ⁇ in cancer treatment comprising determining presence or absence of a KRAS mutation in the subject.
  • the KRAS mutation is selected from the group consisting of G12C, G12D, G12V, G12W, G12R, and G12A mutation, and the presence of the KRAS mutation indicates the subject has a higher likelihood to respond to the agent.
  • the method further comprises determining the expression level of CD47 in the subject. In some embodiments, the expression level of CD47 in the subject is higher than that in a reference subject.
  • the reference subject does not comprise any KRAS mutant, for example, KRAS mutant at residue 12 of the amino acid of KRAS protein as set forth in SEQ ID NO. 37 or SEQ ID NO.38.
  • the reference subject does not have cancer.
  • the reference subject is a healthy human being.
  • an agent e.g., therapeutic agent
  • CD47 e.g., hCD47
  • SIRP ⁇ e.g., hSIRP ⁇
  • the medicament is administrated in combination with a second agent such as a KRAS G12D inhibitor.
  • an agent e.g., therapeutic agent
  • CD47 e.g., hCD47
  • SIRP ⁇ e.g., hSIRP ⁇
  • the medicament is administrated in combination with a second agent such as a KRAS G12D inhibitor.
  • the agent that blocks the interaction between CD47 and SIRP ⁇ is a polypeptide. In some embodiments, the agent that blocks the interaction between CD47 and SIRP ⁇ is an antibody, antibody construct, or an immunologically active fragment of the antibody of the antibody construct. In some embodiments, the agent that blocks the interaction between CD47 and SIRP ⁇ is an anti-CD47 antibody (or immunologically active fragment thereof) .
  • the anti-CD47 antibody is CC-90002 (also known as INBRX103) , 5F9 (also known as Hu5F9-G4 and magrolimab) , LQ001, HLX24, TI-061, AO-176, SRF-231, IBI-188, IMC-002, SHR-1603, STI-6643, ZL-1201, or an immunologically active fragment thereof.
  • the anti-CD47 antibody (or immunologically active fragment thereof) is any anti-CD47 antibody (or immunologically active fragment thereof) described herein.
  • composition comprising an agent that blocks the interaction between CD47 and SIRP ⁇ , and a KRAS G12D inhibitor.
  • the agent that blocks the interaction between CD47 and SIRP ⁇ is anti-CD47 antibody or immunologically active fragment thereof.
  • the anti-CD47 antibody or immunologically active fragment thereof is CC-90002, 5F9, LQ001, HLX24, TI-061, AO-176, SRF-231, IBI-188, IMC-002, SHR-1603, STI-6643, ZL-1201, or an immunologically active fragment thereof.
  • the anti-CD47 antibody or immunologically active fragment thereof comprises three complementarity determining regions (CDRs) of a heavy chain variable domain (VH) set forth in SEQ ID NO: 1 and three CDRs of a light chain variable domain (VL) set forth in SEQ ID NO: 2.
  • CDRs complementarity determining regions
  • the anti-CD47 antibody or immunologically active fragment thereof comprises: (a) a VH that comprises (1) a CDR-H1 comprising RAWMN (SEQ ID NO: 5) ; (2) a CDR-H2 comprising RIKRKTDGETTDYAAPVKG (SEQ ID NO: 6) ; and (3) a CDR-H3 comprising SNRAFDI (SEQ ID NO: 7) and (b) a VL that comprises (1) a CDR-L1 comprising KSSQSVLYAGNNRNYLA (SEQ ID NO: 8) ; (2) a CDR-L2 comprising QASTRAS (SEQ ID NO: 9) ; and (3) a CDR-L3 comprising QQYYTPPLA (SEQ ID NO: 10) , wherein the CDR sequences are defined according to the Kabat numbering system.
  • the anti-CD47 antibody or immunologically active fragment thereof comprises a VH domain and a VL domain, wherein the VH domain of the anti-CD47 antibody or immunologically active fragment thereof comprises an amino acid sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identity to SEQ ID NO: 1, and the VL of the anti-CD47 antibody or immunologically active fragment thereof comprises an amino acid sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%identity to SEQ ID NO: 2.
  • the VH domain of the anti-CD47 antibody or immunologically active fragment thereof comprises an amino acid sequence of SEQ ID NO: 1
  • the VL of the anti-CD47 antibody or immunologically active fragment thereof comprises an amino acid sequence of SEQ ID NO: 2.
  • the anti-CD47 antibody is a full length antibody.
  • the full length anti-CD47 antibody comprises a heavy chain that comprises an amino acid sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identity to SEQ ID NO: 3 or SEQ ID NO: 35; and a light chain that comprises an amino acid sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identity to SEQ ID NO: 4.
  • the KRAS G12D inhibitor is selected from the group consisting of MRTX1133 (Mirati) , iExosomes (MD Anderson) and mRNA-5671 (Moderna) .
  • the KRAS G12D inhibitor is MRTX1133.
  • the KRAS G12D inhibitor comprises a structure of:
  • the cancer comprises one or more cells that comprise a mutation that activates the KRAS signaling pathway (e.g., mutations described herein) .
  • the cancer e.g., the cancer that comprises one or more cells that comprise a mutation that activates the KRAS signaling pathway
  • the cancer is solid tumor.
  • cancers include, but are not limited to, e.g., cancer is lung cancer (such as NSCLC, pancreas cancer, colorectal cancer, gall bladder cancer, bile duct cancer, thyroid cancer, head and neck cancer, SCLC, colon cancer, small intestine cancer, appendiceal cancer, gastric cancer, esophageal cancer, bladder cancer, kidney cancer, liver cancer, breast cancer, ovarian cancer, teratocarcinoma, endometrial cancer, cervical cancer, prostate cancer, lymphoma, myeloma, leukemia, brain cancer, MPNST, neurofibromatosis, neuroblastoma, glioma, schwannomas seminoma astrocytoma, squamous cell carcinoma, fibrosarcoma, rhabdomyosarcoma, osteosarcoma, Kaposi’s sarcoma and keratoacanthoma) .
  • lung cancer such as NSCLC, pancreas cancer, colore
  • the article of manufacture or kit comprises an agent that blocks the interaction between CD47 (e.g., hCD47) and SIRP ⁇ (e.g., hSIRP ⁇ ) .
  • the agent that blocks the interaction between CD47 and SIRP ⁇ is an antibody, antibody construct, or an immunologically active fragment of the antibody or antibody construct.
  • the agent that blocks the interaction between CD47 and SIRP ⁇ is an anti-CD47 antibody or immunologically active fragment thereof (e.g., an anti-CD47 antibody or immunologically active fragment thereof described herein) .
  • the anti-CD47 antibody (or immunologically active fragment thereof) is CC-90002 (also known as INBRX103) , 5F9 (also known as Hu5F9-G4 and magrolimab) , LQ001, HLX24, TI-061, AO-176, SRF-231, IBI-188, IMC-002, SHR-1603, STI-6643, or ZL-1201.
  • the anti-CD47 antibody or immunologically active fragment thereof is an anti-CD47 antibody (or fragment thereof) described herein or a pharmaceutical composition comprising such an anti-CD47 antibody or antibody fragment.
  • the article of manufacture or kit comprises a container containing nucleic acid (s) encoding an anti-CD47 antibody (or an immunologically active fragment thereof) , e.g., an anti-CD47 antibody (or fragment) described herein.
  • Suitable containers include, for example, bottles, vials, syringes, IV solution bags, test tubes, etc.
  • the containers may be formed from a variety of materials such as glass or plastic.
  • the article of manufacture may further comprise an additional container comprising a pharmaceutically acceptable buffer, such as bacteriostatic water for injection (BWFI) , phosphate-buffered saline, Ringer’s solution, and dextrose solution. It may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, and syringes.
  • BWFI bacteriostatic water for injection
  • the article of manufacture or kit further comprises a label or package insert.
  • the label or package insert instructs the agent that blocks the interaction between CD47 (e.g., hCD47) and SIRP ⁇ (e.g., hSIRP ⁇ ) to be used in in treating cancer in an individual, wherein the cancer comprises one or more cells that comprise a mutation that activates the KRAS signaling pathway (e.g., a mutation described in detail elsewhere herein) .
  • Example 1 KRAS mutations render lung cancer cells insensitive to phagocytosis by macrophages
  • Non Small Cell Lung Cancer (NSCLC) patients (12 were KRAS wild-type (KRAS WT ) and 6 harbored the KRAS G12C mutation) .
  • Primary tumor cells freshly isolated from surgically-removed tumor tissues were fluorescently labelled with carboxyfluorescein succinimidyl ester (CFSE) and cocultured with human peripheral blood monocyte-derived macrophages and analyzed by fluorescence-activated cell sorting (FACS) to quantify cancer cells that were phagocytosed by macrophages.
  • CFSE carboxyfluorescein succinimidyl ester
  • FACS fluorescence-activated cell sorting
  • Fig. 1A and Fig. 7A A similar phagocytosis assay was carried out using the human NSCLC cell line H358 harboring KRAS G12C mutation.
  • CFSE-labelled H358 cells were cocultured with human peripheral blood monocyte-derived macrophages and analyzed by FACS or fluorescence microscopy; overexpression of KRAS G12C , but not KRAS WT , led to decreased phagocytosis of H358 cells by macrophages, whereas siRNA knockdown of KRAS increased phagocytosis (Fig. 1B and Fig. 7B-7F) .
  • the inventors also established an orthotopic lung cancer model by tail vein injection of eGFP-labelled H358 cells into nude mice (Fig.
  • the inventors further confirmed this observation in two KRAS-driven genetically engineered mouse models of lung cancer, the Lox-Stop-Lox-KRAS G12D (KRAS LSL-G12D/+ ) mouse strain and the KRAS LSL-G12D/+ ; p53 fl/fl mouse strain.
  • the KRAS LSL-G12D/+ mice developed spontaneous, sporadic pulmonary adenocarcinomas following intratracheal administration of the Cre-expressing adenovirus (Adeno-Cre) to remove the Stop element from the KRAS G12D allele; while the KRAS LSL-G12D/+ ; p53 fl/fl mice exhibited accelerated pulmonary adenocarcinoma formation by the concomitant deletion of the p53 tumor suppressor gene.
  • Adeno-Cre Cre-expressing adenovirus
  • pulmonary adenocarcinomas were present in the KRAS LSL-G12D/+ ; p53 fl/fl mice at 1 month and substantially increased at 3 months (Fig. 1E and Fig. 9A-9B) .
  • the inventors then analyzed the status of macrophage infiltration and tumor phagocytosis in the lung tumors from both the KRAS LSL-G12D/+ and KRAS LSL-G12D/+ ; p53 fl/fl mice. Similar to the H358 model, a gradual decrease in macrophage phagocytosis of tumor cells over time was observed (Fig. 1F and Fig.
  • CD47 protein levels were also found to be higher in KRAS-mutant (KRAS MUT ) human NSCLC cell lines than in KRAS WT lines (Fig. 2D, E and Fig. 11A) , indicating a positive correlation between oncogenic KRAS signaling and CD47 expression.
  • KRAS MUT KRAS-mutant
  • KRAS WT lines Fig. 2D, E and Fig. 11A
  • the inventors then used the RAS-less mouse embryonic fibroblast (MEF) model to investigate the role of KRAS mutations in regulating CD47 expression.
  • CD47 protein levels were significantly elevated in the RAS-less MEFs stably overexpressing KRAS G12C or KRAS G12D compared with KRAS WT (Fig. 2F and Fig. 11B) .
  • H358 KRAS G12C
  • SK-LU-1 KRAS G12D
  • Overexpression of the respective KRAS MUT , but not KRAS WT led to significant induction of CD47 expression in H358 and SK-LU-1 cells (Fig. 2G and Fig. 11C-11D) .
  • siRNA knockdown of KRAS significantly decreased CD47 expression in both cell lines (Fig. 2H and Fig. 11E-11F) .
  • KRAS mutations could drive CD47 expression both in vitro and in vivo, while the use of KRAS inhibitors such as siRNA against KRAS can inhibit the expression of CD47, thereby restoring the phagocytosis of tumors by macrophages.
  • CD47 knockdown substantially increased the infiltration of M1 macrophages in tumor tissues and the phagocytosis of tumor cells by M1 macrophages in vivo (Fig. 2N and Fig. 12E) .
  • knockdown of CD47 significantly decreased tumor formation in the lungs of the mice and prolonged overall survival (Fig. 2I-M and Fig. 12A-12D) .
  • the inventors detected the EGFR expression of 18 pairs of NSCLC patient samples (as shown in Example 1) , and compared them with the KRAS expression levels of the samples.
  • the results are shown in Table B.
  • WT KRAS wild-type tumor samples
  • MUT KRAS-mutant tumor samples
  • KRAS mutation hardly co-exist with EGFR mutation, which explains why patients with KRAS mutation are prone to resistance to EGFR inhibitors from another perspective.
  • CD47 inhibitors such as CD47 antibodies
  • MiR-34a is a negative regulator of CD47-mediated antiphagocytic activity
  • a stringent threshold of log2 (fold-change) > 1 and significance criterion of p ⁇ 0.05 By applying a stringent threshold of log2 (fold-change) > 1 and significance criterion of p ⁇ 0.05, a total of 10 miRNAs were significantly increased in the lung tumors, while 40 miRNAs exhibited a decreasing trend (Fig. 3A) .
  • Hierarchical clustering also revealed the separation of the tumorous from normal tissues based on miRNA profiling (Fig. 3B) .
  • the expression of some top ranked dysregulated miRNAs (mean reads > 500, log2 (fold-change) >1 and p ⁇ 0.01) (Table C) was confirmed by quantitative RT-PCR; 7 of the 9 miRNAs were differentially expressed in the lung tumors compared with the normal tissues (Fig. 3C) .
  • miRNAs usually suppress the expression of their target genes, the inventors focused on the 5 miRNAs that were decreased during tumorigenesis.
  • the inventors identified miR-34a-5p (miR-34a) , one of the most downregulated miRNAs in the lung tumors of the KRAS LSL-G12D/+ mice, as a potential regulator of CD47 expression.
  • a total of three specific miR-34a binding sites were identified in the 3’-untranslated region (3’-UTR) of CD47 (Fig. 14A) .
  • the inventors assessed the CD47 protein levels in H358 and SK-LU-1 cells after transfection with miR-34a mimic (synthetic double-stranded RNA oligonucleotide that mimics the precursor of miR-34a) or with miR-34a antisense (single-stranded, chemically modified oligonucleotide designed to specifically bind to and inhibit mature miR-34a) (Fig. 14B-14C) .
  • the CD47 protein levels were significantly suppressed by the miR-34a mimic and increased by the miR-34a antisense in both H358 and SK-LU-1 cells (Fig. 3D, E and Fig.
  • the inventors evaluated the effect of miR-34a on the antiphagocytic activity of CD47 in lung cancer.
  • Introduction of the miR-34a mimic into H358 cells significantly promoted macrophage-mediated phagocytosis, which was reversed by co-transfection with the CD47 overexpression plasmid (Fig. 3F and Fig. 15A-15B) .
  • AAV-mediated delivery of miR-34a at the time of intratracheal Adeno-Cre administration in the KRAS LSL-G12D/+ ; p53 fl/fl mice significantly decreased lung tumor formation and prolonged overall survival, which could be completely rescued by coadministration of AAV-mediated CD47 overexpression plasmid (Fig. 3G-I and Fig.
  • the inventors first determined the relationship between KRAS mutation/expression and miR-34a expression.
  • overexpression of KRAS G12C or KRAS G12D decreased the miR-34a levels compared with overexpression of KRAS WT (Fig. 4A) .
  • overexpression of KRAS G12C or KRAS G12D but not KRAS WT decreased the miR-34a levels in H358 and SK-LU-1 cells, respectively (Fig. 4B, D) .
  • KRAS knockdown resulted in an increase in miR-34a expression in both cell lines (Fig. 4C, E) .
  • the inventors blocked the RAF-MEK-ERK pathway with a MEK inhibitor (GSK1120212, trametinib) and the PI3K-AKT pathway with a PI3K inhibitor (GDC-0941, pictilisib) , respectively, in the MEFs (with G12C or G12D mutation in KRAS) and H358 cells. While the MEK inhibitor had no effect on the expression of miR-34a and CD47; the PI3K inhibitor, either alone or in combination with the MEK inhibitor, substantially induced miR-34a expression (Fig. 4H) and decreased CD47 levels (Fig. 4I and Fig.
  • the inventors first measured STAT3 phosphorylation levels in the MEF cells; the p-STAT3 levels were higher in the MEF G12C and MEF G12D cells than in the MEF WT cells (Fig. 4J and Supplementary Fig. 16B, C) .
  • Overexpression of KRAS G12C or KRAS G12D but not KRAS WT increased the p-STAT3 levels in H358 or SK-LU-1 cells, respectively (Fig. 4K, L and Supplementary Fig. 16D-I) .
  • KRAS knockdown decreased p-STAT3 in both cell lines (Fig. 4M, N and Supplementary Fig. 16J-O) .
  • the inventors then determined the impact of MEK and PI3K inhibitors on STAT3 phosphorylation. Similar to the effect on miR-34a, the PI3K inhibitor but not the MEK inhibitor suppressed KRAS-driven STAT3 phosphorylation in both the MEFs and H358 cells (Fig. 4I and Supplementary Fig. 16P, Q) . Likewise, treatment with a STAT3 inhibitor (stattic) also caused sustained inhibition of STAT3 activation (Tyr705 phosphorylation) and CD47 expression as well as elevation of miR-34a in H358 cells (Supplementary Fig. 17) .
  • PI3K inhibitors such as Pictilisib or STAT3 inhibitors such as Stattic can increase the expression of miR-34a and inhibit the expression of CD47 in tumors with KRAS oncogene activation or high CD47 expression, thereby ultimately inhibiting tumor progression.
  • the inventors assessed the correlation of KRAS mutation status with CD47 expression in three independent NSCLC cohorts.
  • the first cohort was a commercial tissue microarray containing 157 pairs of NSCLC and normal adjacent tissue samples, which lacked KRAS mutation information.
  • the inventors performed immunohistochemistry (IHC) analysis of CD47, p-STAT3 and p-AKT and found that the CD47 levels were consistently higher in the tumor tissues than in the normal controls (Supplementary Fig. 18A) .
  • High CD47 expression was also positively correlated with advanced tumor grade and poor survival (Supplementary Fig. 18B, C) .
  • the inventors used the p-AKT levels (downstream effector of PI3K) as the readout for KRAS activity and segregated all patient samples into high and low p-AKT groups.
  • both CD47 and p-STAT3 levels were higher in the high p-AKT group than in the low p-AKT group (Fig. 5A) .
  • high p-AKT expression was positively correlated with poor overall survival in NSCLC patients, coordinated activation of KRAS (p-AKT high ) and CD47 further increased the probability of a poor prognosis (Fig. 18D-18E; hazard ratio 1.81 vs. 1.46) .
  • the inventors performed IHC analysis of CD47 and p-STAT3 in a homemade tissue microarray containing paired tumor samples and adjacent normal tissue samples from 12 KRAS MUT NSCLC patients and 28 KRAS WT NSCLC patients. KRAS mutation status was determined by deep sequencing. In both KRAS MUT and KRAS WT patients, CD47 was highly expressed in the tumor samples compared with their normal counterparts (Supplementary Fig. 18F) . Compared with the KRAS WT tumors, the tumor samples with KRAS mutations displayed higher expression of CD47 and p-STAT3 (Fig. 5B) .
  • the inventors determined the KRAS mutation status and the CD47, p-STAT3 and miR-34a expression levels in 100 pairs of NSCLC and normal tissue samples. Thirty NSCLC samples were confirmed to be KRAS-mutant and seventy were wild-type. The CD47 and p-STAT3 protein levels were consistently upregulated, and miR-34a was downregulated in the NSCLC samples compared with the paired normal controls, regardless of KRAS mutation status (Fig. 18G-18I) . In the tumor samples, the CD47 and p-STAT3 expression levels were much higher in the KRAS MUT patients than in the KRAS WT patients (Fig. 5C-5D) . The opposite trend was observed for miR-34a (Fig.
  • miR-34a or miR-34a mimics are therapeutic products with functional components, which can be used to treat tumor patients with activated KRAS oncogene.
  • Example 6 Reverse mutation further confirms that KRAS mutation affects CD47 expression through the KRAS-CD47 axis
  • KRAS G12C The G12C mutation in LLC cells (KRAS G12C ) was reverted by Knock In technology to obtain LLC-KI, an LLC homologous cell line with wild-type KRAS.
  • KRAS-CD47 axis the protein expression levels of p-AKT, p-ERK, p-STAT3 and CD47 downstream of KRAS in the original LLC cell line and LLC-KI cell line were determined using Western blot assay and compared. The results showed that compared with LLC cells, the expression levels of p-AKT, p-ERK, p-STAT3 and CD47 protein in LLC-KI were significantly down-regulated (Figure 21) . It was further confirmed that KRAS mutation leads to the high expression of CD47 by up-regulating the expressions of p-AKT, p-ERK and p-STAT3.
  • Example 7 The KRAS G12C inhibitor AMG 510 inhibits CD47 signaling and restores innate immune surveillance in animal models of NSCLC
  • AMG 510 tested the effect of AMG 510 on the tumor immune microenvironment in an orthotopic model of lung cancer.
  • the LLC mouse lung cancer cells were injected via tail vein into immunocompetent C57BL/6 mice to establish the model.
  • AMG 510 treatment for 8 days significantly suppressed tumor growth, inhibited KRAS activity, STAT3 phosphorylation and CD47 expression and stimulated miR-34a expression in tumor tissues (Fig. 6G-K and Supplementary Fig. 20A-20E) .
  • AMG 510 treatment significantly increased the infiltration of M1 macrophages in the tumor tissue as well as tumor phagocytosis by the M1 macrophages (Fig. 6L and Fig. 20F) .
  • KRAS inhibitors such as AMG 510, can be used to suppress the progress of tumors with activated oncogenic KRAS gene.
  • LS180 KRASG12D
  • SW480 KRASG12V
  • HCT116 KRASG13D
  • LS180, SW480, and HCT116 cells were plated in 12-well plates one day in advance.
  • three kinds of KRAS siRNA (20 ⁇ M) were transfected with lipo2000.
  • the total protein was collected and detected by Western Blot for KRAS expression levels and CD47 expression levels. The results showed that knockdown of KRAS expression by KRAS siRNA significantly reduced the expression of CD47 in the three types of cells. See Figure 23) , demonstrating that KRAS can directly regulate the expression level of CD47 in colon cancer cells.
  • Caco2 and HT29 cell lines were used to further study the potential regulatory effect of KRAS upregulation on CD47.
  • Caco2 and HT29 cells were plated in 12-well plates one day in advance, and after the cell density reached 80%, the cells were transfected with plasmids (3 ⁇ g/well) overexpressing KRAS protein using lipo2000, which were OE-KRASWT (Plasmid overexpressing wild-type KRAS) , OE-KRASG12D (plasmid overexpressing KRASG12D mutation) , OE-KRASG12V (plasmid overexpressing KRASG12V mutation) , OE-KRASG12C (plasmid overexpressing KRASG12C mutation) , OE-KRASG13D (plasmid overexpressing KRASG12C mutation) .
  • OE-KRASWT Plasmid overexpressing wild-type KRAS
  • OE-KRASG12D Plasmid overexpressing wild-type KRAS
  • the IC50 value of KRASG12D inhibitor MRTX1133 on LS180 cells, which harbor the KRASG12D mutation was determined as follows. LS180 cells were plated in 96-well plates at 2000 cells/well, and MRTX1133 was administered 12 hours after adherence, at doses of 0, 4, 8, 15, 30, 60, 120, 400, 800, 1500, 3000 nM, 4 pairs of wells were made for each dose, and detected by Cell Counting Kit-8 ( “CCK8” ) . after 72 hours. The IC50 value of MRTX1133 against LS180 was 80.55 nM. See Figure 25.
  • KRAS LSL-G12D/+ and KRAS LSL- G12D/+ ; p53 fl/fl transgenic mice were intratracheally administered Adeno-Cre to induce pulmonary adenocarcinoma formation. Tumor growth, CD47 expression, and macrophage infiltration were assessed at different time points or were evaluated when disrupting the KRAS-CD47 signaling axis.
  • C57BL/6 mice were injected via tail vein with LLC cells (KRAS G12C ) and administered the KRAS G12C inhibitor AMG 510 via oral gavage after tumor formation; then, tumor regression, CD47 expression and macrophage infiltration were assessed.
  • a RAS-less MEF model stably overexpressing KRAS G12C , KRAS G12D or KRAS WT and lung cancer H358 (KRAS G12C ) and SK-LU-1 (KRAS G12D ) cell lines were cultured and assessed.
  • KRAS G12C KRAS G12D or KRAS WT and lung cancer H358
  • KRAS G12D SK-LU-1
  • FACS and fluorescence microscopy were performed to analyze the phagocytosis of primary lung tumor cells or NSCLC cell lines by human peripheral blood monocyte-derived macrophages.
  • the correlation of KRAS mutation status with CD47 expression was assessed in three independent NSCLC cohorts.
  • the human lung cancer cell lines H358 and SK-LU-1 were obtained from the ATCC.
  • the human embryonic kidney cell line HEK293T and mouse lung cancer cell line LLC were obtained from the Shanghai Institute of Cell Biology, Chinese Academy of Sciences (Shanghai, China) . Cells were certified by STR analysis and regularly checked for mycoplasma contamination.
  • RAS-less MEF cell lines overexpressing different KRAS mutations were obtained from the NIH RAS Initiative and cultured as indicated in https: //www. cancer. gov/research/key-initiatives/ras/ras-central/blog/2017/rasless-mefs-drug-screens.
  • H358 cells were maintained in RPMI 1640 medium (C11875500BT, Gibco, California, USA) supplemented with 10%FBS (10099-141, Gibco, Australia) ; SK-LU-1, LLC, and HEK293T cells were maintained in high-glucose (4.5 g/L) DMEM (C11995500BT, Gibco) supplemented with 10%FBS (Gibco) . All cells were incubated in 5%CO2 at 37°C in a humidified atmosphere.
  • Tissues were then dissociated into single cells using the gentleMACS program at 37°C for 40 min, according to the manufacturer’s instructions. Cells were then passed through a 70 mm mesh and centrifuged at 350 g for 5 min. Cell pellets were re-suspended and one aliquot of the cells (1 x 106) were incubated with 1 mg of fluorescently conjugated mAbs against human CD47 (BD Biosciences) or the isotype control. Another aliquot of the cells was subjected to the in vitro phagocytosis assay. Samples were fixed in 4%paraformaldehyde, washed, re-suspended in FACS buffer, and analyzed by flow cytometry (FACScalibur, BD Biosciences) .
  • the first cohort was a commercial tissue microarray containing 157 pairs of NSCLC and normal adjacent tissue samples purchased from Shanghai Outdo Biotech (Shanghai, China) .
  • the second cohort was a homemade tissue microarray containing 12 pairs of KRAS MUT NSCLC and adjacent normal tissue samples and 28 pairs of KRAS WT NSCLC and adjacent normal tissue samples; these samples were obtained from Jiangsu Biobank of Clinical Resources (located at Jiangsu Cancer Hospital, Nanjing, China) .
  • the third cohort containing 100 pairs of NSCLC and normal adjacent tissue samples were obtained from the Jiangsu Biobank of Clinical Resources (located at Jiangsu Cancer Hospital, Nanjing, China.
  • mice The KRAS LSL-G12D/+ and KRAS LSL-G12D/+ ; p53 fl/fl transgenic mice were originally generously provided by Professor Hongbin Ji (Shanghai Institutes for Biological Sciences) . The mice were maintained on a 12 h light/dark cycle (lights on at 7 am) with free access to food and water. All animal care and handling procedures were performed in accordance with the National Institutes of Health’s Guide for the Care and Use of Laboratory Animals and were approved by the Ethical Committee of Nanjing University (Nanjing, China) .
  • KRAS G12D activation in mouse lungs six-week-old KRAS LSL-G12D/+ and KRAS LSL-G12D/+ ; p53 fl/fl mice were first anaesthetized with ketamine (100 mg/kg) and xylazine (10 mg/kg) , and then, 5 ⁇ 10 6 plaque-forming units of Adeno-Cre were diluted with PBS to obtain a final volume of 50 ⁇ L and given through intratracheal administration14, 15.
  • mice were anaesthetized to evaluate tumor growth by microcomputed tomography (micro-CT) scanning or euthanized to confirm lung adenocarcinoma formation by histological analysis. Histological analysis was performed by hematoxylin and eosin (H&E) staining. Excised lung adenocarcinomas were also processed to determine CD47 expression, macrophage infiltration by western blotting, immunofluorescence staining or IHC analyses.
  • micro-CT microcomputed tomography
  • H&E hematoxylin and eosin
  • RNA of CD47 was cloned into the AAV vector AAV9-CAG-EGFP (Sunbio, Shanghai, China) (AAV-CD47 shRNA) .
  • AAV-CD47 shRNA An AAV encoding scrambled shRNA (AAV-control shRNA) served as the negative control.
  • KRAS LSL-G12D/+ ; p53 fl/fl mice were intratracheally co-administered with Adeno-Cre along with the AAV-control shRNA or AAV-CD47 shRNA. Then, the mice were divided into 2 groups and monitored to determine either survival time or tumor regression. For survival analysis, the mice were monitored for 150 days without any further treatment.
  • mice were anaesthetized to evaluate tumor growth by micro-CT scanning or euthanized to confirm lung adenocarcinoma formation by histological analysis at 90 days.
  • Excised lung adenocarcinomas were also processed to determine CD47 expression and macrophage infiltration by western blotting, immunofluorescence staining or IHC analyses.
  • an AAV9-CAG-EGFP (Sunbio) encoding miR-34a (AAV-miR-34a) was used, with or without simultaneous administration of an AAV9-CAG-EGFP (Sunbio) expressing the CD47 open reading frame (AAV-CD47) .
  • An AAV encoding scrambled RNA (AAV-scrRNA) served as the negative control of AAV-miR-34a, and an AAV that does not express a transgene (AAV-control) served as the negative control of AAV-CD47.
  • mice were intratracheally co-administered Adeno-Cre along with the combination of AAV-scrRNA plus AAV-control, AAV-miR-34a plus AAV-control or AAV-miR-34a plus AAV-CD47. The mice were assessed as described above.
  • Micro-CT analysis was performed to assess lung tumor growth because the micro-CT images clearly distinguished the lung tumors from the surrounding tissue even without any contrast agent, and the reconstructed 3-D pulmonary images can easily differentiate the tumors from the blood vessels26.
  • micro-CT scans were performed using a SkyScan 1176 micro-CT analyzer, which scanned a360° area at a resolution of 50umwith a rotation step of0.5.
  • the system comprised two metallochromic tubes equipped with a fixed 0.5 mm Al filter and two 1280 ⁇ 1024 pixel digital X-ray cameras. Images were acquired at 60 kV and 134 ⁇ A. The mice were scanned while in a supine position.
  • micro-CT data were batch-sorted, processed, and reconstructed as 3-D pulmonary images using the N-Recon program according to the manufacturer’s instructions (SkyScan) .
  • the reconstructed data were subsequently imaged using DataViewer, and the tumor numbers and volumes were calculated using the CTAn program according to the manufacturer’s instructions (SkyScan, Nanjing, China) .
  • Excised lung adenocarcinomas were postfixed for 4 h in 4%PFA and cryoprotected in 20%and 30%sucrose in 1 ⁇ PBS at 4°C.
  • the sections were postfixed for 10 min in 4%PFA and then washed with 1 ⁇ PBS prior to blocking with 5%normal horse serum/0.25%Triton X-100 in PBS (1 h) .
  • the sections were then incubated with CD11b, iNOS, TNF- ⁇ or KRAS G12D primary antibodies diluted 1: 100 in blocking solution overnight.
  • Table E Detailed information on the primary antibodies used can be found in Table E.
  • the sections were washed with 1 ⁇ PBS and subsequently incubated in blocking solution containing secondary antibody for 1 h. Then, the sections were washed with 1 ⁇ PBS and placed in DAPI staining solution for 10 min. After the sections were washed with 1 ⁇ PBS, they were examined with a TCS SP8 inverted laser scanning confocal microscope (Leica) . Digital images from the microscope were recorded with LAS X Viewer Software (Leica) . Cell counts were performed using Image-Pro Plus 6.0 software (Media Cybernetics, Inc., Rockville, MD) in combination with manual scoring to ensure accuracy.
  • IHC was performed according to standard protocols. Prior to staining, sections from the lung tumors of the KRAS LSL-G12D/+ and KRAS LSL-G12D/+ ; p53 fl/fl mice were baked at 60°C for 1 h, deparaffinized in xylene and rehydrated through graded ethanol. Antigen retrieval was performed by heating the sections under high pressure in citrate antigen retrieval solution for approximately 5 min. The sections were incubated with monoclonal antibodies against CD47, iNOS, TNF- ⁇ , p-AKT or p-STAT3 for 60 min at room temperature. Detailed information on the primary antibodies used can be found in Table E.
  • the immunoreaction was detected by treatment with diaminobenzidine chromogen for 3 min.
  • the immunoreaction images were viewed and captured using the NDP. view. 2 software program. Protein expression was assessed by two experienced pathologists blinded to the clinical data who performed the first reading independently and then debated any discrepancies until reaching a consensus.
  • RNA deep sequencing was performed to examine the miRNA profiles in the lung tumors of the KRAS LSL-G12D/+ mice. All sRNA library construction and deep sequencing were performed by Novogene (Beijing, China) . Briefly, sRNA libraries were constructed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina (NEB, USA) . After library quality validation, raw data for each sRNA library were generated on the Illumina HiSeq 2500 platform. The clean reads were obtained after data filtration. Precursor and mature miRNA sequences were obtained from miRBase v21.
  • KRAS WT wild-type KRAS
  • mutant KRAS G12C or mutant KRAS G12D were synthetized by GenScript (Nanjing, China) and inserted into a CMV-EGFP plasmid.
  • a plasmid that does not express a transgene served as the negative control.
  • KRAS siRNAs were purchased from GenePharma (Shanghai, China) .
  • a siRNA with a scrambled sequence served as the negative control.
  • MiR-34a mimic and antisense were purchased from GenePharma. Control mimic and antisense designed to express double-stranded or single-stranded scrambled RNAs served as negative controls.
  • H358 and SK-LU-1 cells were seeded in 12-well plates, and each well was transfected with 5 ⁇ g of the KRAS WT , KRAS G12C or KRAS G12D plasmids or 50 pmol of miR-34a mimic, miR-34a antisense or the corresponding negative controls by Lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions.
  • Total RNA and protein were isolated 24 or 48 h after transfection. Sequences of synthetic siRNAs, miRNA mimics and antisense strands are listed in Table F.
  • RNA extraction, reverse transcription and TaqMan-based real-time PCR were performed as described previously. Briefly, total RNA was extracted from cultured cells and mouse tumors with TRIzol Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions.
  • RNA was reverse transcribed to cDNA using AMV reverse transcriptase (TaKaRa, Dalian, China) and stem-loop RT primers (Applied Biosystems, Foster City, CA) .
  • AMV reverse transcriptase TaKaRa, Dalian, China
  • stem-loop RT primers Applied Biosystems, Foster City, CA
  • the following reaction conditions were used: 16°Cfor 30 min, 42°C for 30 min, and 85°C for 5 min.
  • Real-time RT-PCR was performed using TaqMan miRNA probes (Applied Biosystems) on an Applied Biosystems 7300 Sequence Detection System (Applied Biosystems) .
  • the reactions were incubated in a 96-well optical plate at 95°C for 10 min followed by 40 cycles at 95°C for 15 s and 60°C for 1 min.
  • RNA analysis 1 ⁇ g of total RNA was reverse transcribed to cDNA using AMV reverse transcriptase (TaKaRa) and oligo dT primer (TaKaRa) .
  • the following reaction conditions were used: 16°C for 30 min, 42°C for 30 min, and 85°C for 5 min.
  • Real-time RT-PCR was performed using SYBRTM Green PCR Master Mix (Invitrogen, Carlsbad, CA, USA) on an Applied Biosystems 7300 Sequence Detection System. The reactions were incubated in a 96-well optical plate at 95°C for 10 min followed by 40 cycles at 95°C for 15 s and 60°C for 1 min. All reactions were run in triplicate.
  • Cells were rinsed with cold PBS (pH 7.4) and then lysed in RIPA buffer (0.5%NP-40, 0.1%sodium deoxycholate, 150 mM NaCl and 50 mM Tris-HCl, pH 7.5) supplemented with a protease and phosphatase inhibitor cocktail (Thermo Scientific, Rockford, IL) on ice for 30 min.
  • the tissue samples were flash frozen in liquid nitrogen, ground into powder and then lysed in RIPA buffer.
  • the cell lysates and tissue homogenates were centrifuged for 10 min (12,000 ⁇ g at 4°C) , the supernatant was collected, and the protein concentration was determined using a Pierce BCA Protein Assay Kit (Thermo Scientific) .
  • Equal amounts of protein (30-60 ⁇ g) were resolved via 10%–12.5%SDS-PAGE and then transferred to a PVDF membrane (Millipore, Bedford, MA) .
  • the membrane was blocked in Tris-buffered saline Tween-20 (TBST) containing 5%bovine serum albumin and then incubated with the corresponding primary antibodies overnight at 4°C. After a 1 h incubation with HRP-conjugated secondary antibody, the protein level was detected using a luminal reagent.
  • the data were quantified using ImageJ software (NIH, Bethesda, MD) , and relative protein expression was normalized to the value of GAPDH. Information on primary antibodies is listed in Table E.
  • the upper PVDF membrane (> 70 kD) were then treated with antibody removal solution (Beyotime Biotechnology) to remove both primary and secondary antibodies and blotted with a STAT3 ( ⁇ 88 kD) antibody.
  • antibody removal solution Beyotime Biotechnology
  • STAT3 ⁇ 88 kD
  • the PVDF membrane was cut at 35 kD and 70 kD into three parts ( ⁇ 35 kD, 35 ⁇ 70 kD and > 70 kD) .
  • the three parts were then first blotted with KRAS (21 kD) , p-STAT3 ( ⁇ 88 kD) and GAPDH (37 kD) ; the upper PVDF membrane (> 70 kD) were then stripped and blotted with STAT3 ( ⁇ 88 kD) antibody.
  • the same experiment was repeated three times, and in each biological replicate, the sliced membranes were stripped only once (blotted twice) .
  • the 3’-UTR of CD47 was inserted into a firefly luciferase reporter plasmid (GenScript, Nanjing, China) .
  • sequences that interacted with the miR-34a seed sequence were mutated from ACTGCC, CACTGCC and ACTGCC to TGACGG, GTGACGG and TGACGG, respectively, and the mutant CD47 3’-UTR fragment was inserted into the same reporter plasmid.
  • the ⁇ -galactosidase ( ⁇ -gal) plasmid was included as a transfection control.
  • HEK293T cells were cultured in DMEM containing 10%FBS and seeded in 24-well plates.
  • 0.2 ⁇ g of wild-type or mutant luciferase reporter plasmid, 0.1 ⁇ g of ⁇ -gal plasmid and equal amounts (20 pmol) of miR-34a mimic or control mimic (GenePharma) were co-transfected into cells with Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions.
  • the cells were analyzed using a luciferase assay kit (Cat#E4550, Promega, Madison, WI) to determine the fluorescence intensity. All experiments were performed in triplicate wells for each condition and repeated three times independently.
  • PBMCs Peripheral blood mononuclear cells
  • CD14+ monocytes were isolated by magnetic column purification based on positive selection with anti-CD14 microbeads (Miltenyi Biotec) with a purity of 96%.
  • 1 ⁇ 10 6 CD14+ cells were cultured in RPMI 1640 medium supplemented with 2 mmol/mL glutamine, 100 ⁇ g/mL ticarpen and 10%FBS (complete RPMI) and stimulated with granulocyte-macrophage colony stimulating factor (GM-CSF) at 25 ng/mL for 7 days to generate macrophages.
  • GM-CSF granulocyte-macrophage colony stimulating factor
  • the phagocytosis assay was conducted as previously described27, 28. Briefly, macrophages were plated at a density of 5 ⁇ 10 4 cells per well in a 24-well tissue-culture plate in complete DMEM supplemented with GM-CSF overnight before the experiment. H358 cells were pre-transfected with KRAS G12C plasmid, miR-34a mimic or CD47 plasmid and their corresponding negative controls for 48 h and then stained with 2.5 ⁇ M carboxyfluorescein succinimidyl ester (CFSE) at 37°C for 10 min. Macrophages were incubated in serum-free medium for 2 h before addition of 2 ⁇ 10 5 CFSE-labelled H358 cells.
  • CFSE carboxyfluorescein succinimidyl ester
  • a phagocytosis assay was performed by fluorescence microscopy29. Briefly, a GFP-encoding lentivirus was prepared from the pCDH-CMV construct using standard techniques and transfected into H358 cells to generate GFP+ cells. Macrophages were plated at a density of 5 ⁇ 10 4 cells per well in a 24-well tissue culture plate. GFP+ H358 cells were pre-transfected with KRAS G12C plasmid, miR-34a mimic or CD47 plasmid and their corresponding negative controls for 48 h. Macrophages were incubated in serum-free medium for 2 h.
  • tissue microarray chips containing 157 pairs of lung adenocarcinoma samples and normal adjacent tissue (NAT) samples were purchased from Shanghai Outdo Biotech (Shanghai, China) . Each sample dot with a diameter of 1.5 mm and a thickness of 4 ⁇ m was prepared according to a standard method. All patients had been pathologically diagnosed with adenocarcinoma after operation, and follow-up data (range 0–120 months) were available. Informed consent was obtained for all patients. The IHC analysis was performed as described previously30.
  • tissue sections were blocked with goat serum and then incubated with anti-CD47 (1: 100, Abcam, ab175388) , anti-p-STAT3 (1: 100, 9145S, Cell Signaling Technology, MA, USA) or anti-p-AKT (1: 100, 4066S, Cell Signaling Technology) antibodies overnight at 4°C.
  • the sections were stained with 3, 3-diaminobenzidine and counterstained with hematoxylin after being incubated with secondary antibody. All IHC sample dots were assessed by two independent pathologists blinded to both the sample origins and the subject outcomes.
  • the IHC staining score was scored according to the extent of cell staining ( ⁇ 10%positive cells for 0; 11%–50%positive cells for 2; 51%–80%positive cells for 3; > 80%positive cells for 4) and the staining intensity (no staining for 0; slight staining for 1; moderate staining for 2; strong staining for 3) . Scores for the percentage of positive cells and the staining intensity were added.
  • the CD47, p-STAT3 and p-AKT expression levels in the NSCLC tissues were considered medium expression when the score of each protein was in the range of average score ⁇ 20%in all samples; high expression was considered higher than medium expression; low expression was considered lower than medium expression.
  • Patient information related to the tissue microarray is shown in Table D.
  • tissue microarray containing 12 pairs of KRAS MUT NSCLC and normal adjacent tissue samples and 28 pairs of KRAS WT NSCLC and normal adjacent tissue samples was obtained from the Jiangsu Biobank of Clinical Resources. All patients had been pathologically diagnosed with adenocarcinoma after operation, and informed consent was obtained for all patients. IHC analysis in the tissue microarray was performed with anti-CD47 and anti-p-STAT3 antibodies as described above. Patient information related to the tissue microarray is shown in Table D.
  • H358 cells stably transfected with eGFP were intravenously injected into BALB/c nude mice via the tail vein. After 3 weeks, one mouse was euthanatized every week to ensure successful lung tumor formation by immunofluorescence. Then, the tumor-bearing mice were divided into three groups and monitored to determine macrophage infiltration by immunofluorescence at different times.
  • mice were intravenously injected into C57BL/6 mice via the tail vein. After 15 days, the mice were monitored using non-invasive micro-CT scanning to ensure successful tumor formation in the lungs. Then, the tumor-bearing mice were randomly divided into two groups and were orally administered with 100 mg/kg AMG 510 or vehicle control. After 8 days, the mice were euthanized to evaluate lung tumor burden by histopathological staining. Excised lung tumors were also processed to determine CD47 expression and macrophage infiltration by western blotting, immunofluorescence staining or IHC analyses. Moreover, single cell suspensions of tumors were prepared for flow cytometry as described previously.
  • tumors were placed in 1.0 mL RPMI 1640 with Liberase TL (0.2 mg/ml; Roche) and DNase I (20 ⁇ g/ml; Ambion) , and minced with scissors to sub-millimeter pieces. Tissues were homogenized in the MACS tissue homogenizer using the gentleMACS program according to the manufacturer’s instructions and then incubated at 37°C for 40 min. Specimens were passed through a 70 mm mesh and centrifuged at 350 g for 5 min. Cell pellets were resuspended and cell labelling was performed by incubating 1 ⁇ 10 6 cells with 0.5 ⁇ g of fluorescently conjugated antibodies directed against mouse F4/80 (BD Biosciences) .
  • Intracellular iNOS antibody (BD Biosciences) staining was performed following the intracellular staining protocol. Samples were fixed in 4%paraformaldehyde, washed, resuspended in FACS buffer, and analyzed by flow cytometry (FACScalibur, BD Biosciences) .

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biochemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Provided herein are methods of treating a cancer in a subject, comprising administering to the subject an effective amount of an agent that blocks the interaction between CD47 and SIRPα.

Description

METHODS FOR TREATING CANCER
CROSS REFERENCE TO RELATED APPLICATIONS
This application claims the priority benefit of International Application No. PCT/CN2022/079305, filed March 4, 2022, the contents of which are incorporated herein by reference in their entirety.
REFERENCE TO AN ELECTRONIC SEQUENCE LISTING
The contents of the electronic sequence listing (233002001740seqlist. xml; Size: 80,720 bytes; and Date of Creation: March 2, 2023) are herein incorporated by reference in their entirety.
FIELD OF THE INVENTION
This application relates to methods for treating cancer in an individual, wherein the cancer comprises one or more cells that comprise a mutation that activates the KRAS signaling pathway.
BACKGROUND OF THE INVENTION
Mutations in the KRAS gene are the most common drivers of tumor development across a spectrum of human cancers, such as cancers of the lung, colon, and pancreas. For example, in non-small cell lung cancer (NSCLC) , the KRAS G12C mutation accounts for approximately 30%of all cases and correlates with poor prognosis. At the molecular level, KRAS proteins with activating mutations abrogate the GTPase activity and are locked in the GTP-bound hyperactive state, leading to constitutive activation of downstream pro-proliferative and pro-survival pathways such as RAF-MEK-ERK and PI3K-AKT5. Despite more than three decades of intensive efforts to develop targeted therapy for the KRAS oncoprotein, AMG 510, the first covalent inhibitor of the KRAS G12C mutation has just been approve by the FDA in May 2021; and targeting other KRAS mutations is still considered “mission impossible. ” Understanding how mutations that activate the KRAS signaling pathway drive cancer pathogenesis and developing new intervention strategies are the major priorities for conquering KRAS-driven cancers.
SUMMARY OF THE INVENTION
In some embodiments, provided is a method of treating cancer in an individual, comprising administering an effective amount of an agent that blocks the interaction between CD47 and SIRPα, wherein the cancer has been determined to comprise one or more cells that  comprise a mutation that activates the KRAS signaling pathway. In some embodiments, provided is a method of treating cancer in an individual, comprising (a) determining whether the cancer in the individual comprises one or more cells that comprise a mutation that activates the KRAS signaling pathway, and (b) administering an effective amount of an agent that blocks the interaction between CD47 and SIRPα to the individual who has been determined to have the cancer that comprises one or more cells that comprise a mutation that activates the KRAS signaling pathway. In some embodiments, provided is a method of predicting whether an individual with cancer is likely to respond to treatment with an agent that blocks the interaction between CD47 and SIRPα comprising determining whether the cancer in the individual comprises one or more cells that comprise a mutation that activates the KRAS signaling pathway, wherein the presence of a mutation that activates the KRAS signaling pathway in one or more cells of the cancer indicates that the individual is likely to respond to the treatment.
In some embodiments, the mutation that activates the KRAS signaling pathway is a mutation in an amino acid sequence of a wild type KRAS. In some embodiments, the mutation in the amino acid sequence of the wild type KRAS is an amino acid substitution at position 12 relative to a wild type KRAS set forth in SEQ ID NO: 37 or SEQ ID NO: 38. In some embodiments, the amino acid substitution at position 12 relative to the wild type KRAS set forth in SEQ ID NO: 37 or SEQ ID NO: 38 is selected from the group consisting of: G12C, G12D, G12V, G12W, G12R, and G12A. In some embodiments, the mutation that activates the KRAS signaling pathway is a mutation in an amino acid sequence of a wild type PIK3CA. In some embodiments, the mutation in the amino acid sequence of the wild type PIK3CA is an amino acid substitution at position 345, 542, 545, or 1047 relative to a wild type PIK3CA set forth in SEQ ID NO: 41. In some embodiments, the amino acid substitution at position 345, 542, 545, or 1047 relative to a wild type PIK3CA set forth in SEQ ID NO: 41is selected from the group consisting of: N345K, E542K, E545K, H1047L, and H1047R. In some embodiments, the mutation that activates the KRAS signaling pathway is a mutation in an amino acid sequence of a wild type STAT3. In some embodiments, the mutation in the amino acid sequence of the wild type STAT3 is an amino acid substitution at position 174, 392, 427, 646, 658, 705, or 716 relative to a wild type STAT3 set forth in SEQ ID NO: 42. In some embodiments, the amino acid substitution at position 174, 392, 427, 646, 658, 705, or 716 relative to a wild type STAT3 set forth in SEQ ID NO: 42is selected from the group consisting of: F174A, K392K, D427H, K392R, N646K, K658N, T705F, and T716M. In  some embodiments, the mutation that activates the KRAS signaling pathway is a germline mutation. In some embodiments, the germline mutation is identified in one or more cells in a blood sample or buccal sample from the individual. In some embodiments, the mutation that activates the KRAS signaling pathway is a somatic mutation. In some embodiments, the somatic mutation is identified in sample containing the one or more cells of the cancer from the individual. In some embodiments, the presence of the mutation that activates the KRAS signaling pathway in the one or more cells of the cancer is determined via nucleic acid sequencing or polymerase chain reaction (PCR) , fluorescence in situ hybridization (FISH) , or denaturing high performance liquid chromatography (DHPLC) .
In some embodiments, the mutation that activates the KRAS signaling pathway results in overexpression of MEK protein (pMEK) in the one or more cancer cells. In some embodiments, the one or more cancer cells are considered to overexpress pMEK when an expression level of the pMEK in a sample comprising the cancer cells from the individual is higher than an expression level of the pMEK in a reference sample from a healthy individual. In some embodiments, the mutation that activates the KRAS signaling pathway results in overexpression of AKT protein (pAKT) in the one or more cancer cells. In some embodiments, the one or more cancer cells are considered to overexpress pMEK when an expression level of the pAKT in a sample comprising the cancer cells from the individual is higher than an expression level of the pAKT in a reference sample from a healthy individual. In some embodiments, the mutation that activates the KRAS signaling pathway results in overexpression of STAT3 protein (pSTAT3) in the one or more cancer cells in the individual. In some embodiments, the one or more cancer cells are considered to overexpress pSTAT3 when an expression level of the pSTAT3 in a sample comprising the cancer cells from the individual is higher than an expression level of the pSTAT3 in a reference sample from a healthy individual. In some embodiments, the presence of the mutation that activates the KRAS signaling pathway in the one or more cells of the cancer is determined via assessed via Western blot, ELISA, or immunofluorescence.
In some embodiments, the mutation that activates the KRAS signaling pathway results in low level of microRNA-34a (miR-34a) in the one or more cancer cells. In some embodiments, the one or more cancer cells are considered to have the low level of miR-34a when an expression level of the miR-34a in a sample comprising the one or more cancer cells from the individual is lower than an expression level of the miR-34a in a reference sample from a healthy individual. In some embodiments, the presence of the mutation that activates  the KRAS signaling pathway in the one or more cells of the cancer is determined via quantitative reverse transcription-polymerase chain reaction (RT-PCR) , Northern blot, in situ hybridization, and/or nuclease protection assay.
In some embodiments, the agent that blocks the interaction between CD47 and SIRPα is anti-CD47 antibody or immunologically active fragment thereof. In some embodiments, the anti-CD47 antibody is CC-90002, 5F9, LQ001, HLX24, TI-061, AO-176, SRF-231, IBI-188, IMC-002, SHR-1603, STI-6643, ZL-1201, or an immunologically active fragment thereof. In some embodiments, the anti-CD47 antibody or immunologically active fragment thereof comprises three complementarity determining regions (CDRs) of a heavy chain variable domain (VH) set forth in SEQ ID NO: 1 and three CDRs of a light chain variable domain (VL) set forth in SEQ ID NO: 2. In some embodiments, the anti-CD47 antibody or immunologically active fragment thereof comprises: (a) a VH that comprises (1) a CDR-H1 comprising RAWMN (SEQ ID NO: 5) ; (2) a CDR-H2 comprising RIKRKTDGETTDYAAPVKG (SEQ ID NO: 6) ; and (3) a CDR-H3 comprising SNRAFDI (SEQ ID NO: 7) and (b) a VL that comprises (1) a CDR-L1 comprising KSSQSVLYAGNNRNYLA (SEQ ID NO: 8) ; (2) a CDR-L2 comprising QASTRAS (SEQ ID NO: 9) ; and (3) a CDR-L3 comprising QQYYTPPLA (SEQ ID NO: 10) , wherein the CDR sequences are defined according to the Kabat numbering system. In some embodiments, the VH domain of the anti-CD47 antibody or immunologically active fragment thereof comprises an amino acid sequence that has at least 95%identity to SEQ ID NO: 1, and the VL of the anti-CD47 antibody or immunologically active fragment thereof comprises an amino acid sequence that has at least 95%identity to SEQ ID NO: 2. In some embodiments, the anti-CD47 antibody comprises a heavy chain that comprises SEQ ID NO: 3 or SEQ ID NO: 35 and a light chain that comprises SEQ ID NO: 4.
In some embodiments, provided is a kit comprising an anti-CD47 antibody, wherein the kit is for use according to a method of treatment provided herein. In some embodiments, the kit is for use in the treatment of a cancer comprising one or more cells that comprise a mutation that activates the KRAS signaling pathway in an individual who has been identified as having a cancer that comprises one or more cells that comprise a mutation that activates the KRAS signaling pathway. In some embodiments, the kit further comprises a label or package insert stating that the agent that blocks the interaction between CD47 (e.g., hCD47) and SIRPα (e.g., hSIRPα) is to be used in treating cancer in an individual, wherein the cancer comprises one or more cells that comprise a mutation that activates the KRAS  signaling pathway.
In this application, the inventors proved KRAS-CD47 signaling axis, suggesting that KRAS mutation status can serve as a biomarker for agents that block the interaction between CD47 and SIRPα, such as a CD47 antibody, and provides novel strategies for KRAS mutant cancers.
In one aspect, provided is a method of treating malignant tumor in a subject in need thereof, comprising administering to the subject an effective amount of an agent that blocks the interaction between CD47 and SIRPα, wherein the tumor comprises a cell with a KRAS mutation.
In some embodiments of the method of the present application, the KRAS mutation occurs at residue 12 of KRAS protein as set forth in SEQ ID NO. 37 or SEQ ID NO. 38. In some embodiment, the KRAS mutation is selected from the group consisting of G12C, G12D, G12V, G12W, G12R, and G12A mutation.
In some embodiments of the method of the present application, the agent that blocks the interaction between CD47 and SIRPα is anti-CD47 antibody or immunologically active fragment thereof. In some embodiments, the anti-CD47 antibody or immunologically active fragment thereof is CC-90002, 5F9, LQ001, HLX24, TI-061, AO-176, SRF-231, IBI-188, IMC-002, SHR-1603, STI-6643, ZL-1201, or an immunologically active fragment thereof.
In some embodiments, the anti-CD47 antibody or immunologically active fragment thereof comprises three complementarity determining regions (CDRs) of a heavy chain variable domain (VH) set forth in SEQ ID NO: 1 and three CDRs of a light chain variable domain (VL) set forth in SEQ ID NO: 2. In some embodiments, the anti-CD47 antibody or immunologically active fragment thereof comprises: (a) a VH that comprises (1) a CDR-H1 comprising RAWMN (SEQ ID NO: 5) ; (2) a CDR-H2 comprising RIKRKTDGETTDYAAPVKG (SEQ ID NO: 6) ; and (3) a CDR-H3 comprising SNRAFDI (SEQ ID NO: 7) and (b) a VL that comprises (1) a CDR-L1 comprising KSSQSVLYAGNNRNYLA (SEQ ID NO: 8) ; (2) a CDR-L2 comprising QASTRAS (SEQ ID NO: 9) ; and (3) a CDR-L3 comprising QQYYTPPLA (SEQ ID NO: 10) , wherein the CDR sequences are defined according to the Kabat numbering system. In some embodiments, the VH domain of the anti-CD47 antibody or immunologically active fragment thereof comprises an amino acid sequence that has at least 95%identity to SEQ ID NO: 1, and the VL of the anti-CD47 antibody or immunologically active fragment thereof comprises an amino acid sequence that has at least 95%identity to SEQ ID NO: 2. In some embodiments, the anti-CD47 antibody comprises a heavy chain that comprises SEQ ID NO: 3 or SEQ ID NO: 35 and a light chain that comprises SEQ ID NO: 4.
In some embodiments of the method of the present application, the malignant tumor is solid tumor. In some embodiments, the malignant tumor is selected from the group consisting of NSCLC, pancreas cancer, colorectal cancer, gall bladder cancer, bile duct cancer, thyroid cancer,  head and neck cancer, SCLC, colon cancer, small intestine cancer, appendiceal cancer, gastric cancer, esophageal cancer, bladder cancer, kidney cancer, liver cancer, breast cancer, ovarian cancer, teratocarcinoma, endometrial cancer, cervical cancer, prostate cancer, lymphoma, myeloma, leukemia, brain cancer, MPNST, neurofibromatosis, neuroblastoma, glioma, schwannomas seminoma astrocytoma, squamous cell carcinoma, fibrosarcoma, rhabdomyosarcoma, osteosarcoma, Kaposi’s sarcoma and keratoacanthoma.
In another aspect, provided is a method for determining whether a subject in need thereof is suitable for cancer treatment by an agent that blocks the interaction between CD47 and SIRPα, comprising determining presence or absence of a KRAS mutation in the subject, wherein the presence of the KRAS mutation indicates the subject is suitable for cancer treatment by the agent. In some embodiments, the KRAS mutation is selected from the group consisting of G12C, G12D, G12V, G12W, G12R, and G12A mutation.
In another aspect, provided is method for determining likelihood of a subject in need thereof to respond to an agent that blocks the interaction between CD47 and SIRPα in cancer treatment, comprising determining presence or absence of a KRAS mutation in the subject, wherein the presence of the KRAS mutation indicates the subject has a higher likelihood to respond to the agent. In some embodiments, the KRAS mutation is selected from the group consisting of G12C, G12D, G12V, G12W, G12R, and G12A mutation.
In another aspect, the present application provides use of an agent in the preparation of a medicament for treating malignant tumor in a subject in need thereof, wherein the agent blocks the interaction between CD47 and SIRPαA, and the tumor comprises a cell with a KRAS mutation.
In some embodiments of the use of the present application, the KRAS mutation occurs at residue 12 of KRAS protein as set forth in SEQ ID NO. 37 or SEQ ID NO. 38. In some embodiments, the KRAS mutation is selected from the group consisting of G12C, G12D, G12V, G12W, G12R, and G12A mutation.
In some embodiments of the use of the present application, the agent that blocks the interaction between CD47 and SIRPα is anti-CD47 antibody or immunologically active fragment thereof. In some embodiments, the anti-CD47 antibody or immunologically active fragment thereof is CC-90002, 5F9, LQ001, HLX24, TI-061, AO-176, SRF-231, IBI-188, IMC-002, SHR-1603, STI-6643, ZL-1201, or an immunologically active fragment thereof. In some embodiments, the anti-CD47 antibody or immunologically active fragment thereof comprises three complementarity determining regions (CDRs) of a heavy chain variable domain (VH) set forth in SEQ ID NO: 1 and three CDRs of a light chain variable domain (VL) set forth in SEQ ID NO: 2. In some embodiments, the anti-CD47 antibody or immunologically active fragment thereof  comprises: (a) a VH that comprises (1) a CDR-H1 comprising RAWMN (SEQ ID NO: 5) ; (2) a CDR-H2 comprising RIKRKTDGETTDYAAPVKG (SEQ ID NO: 6) ; and (3) a CDR-H3 comprising SNRAFDI (SEQ ID NO: 7) and (b) a VL that comprises (1) a CDR-L1 comprising KSSQSVLYAGNNRNYLA (SEQ ID NO: 8) ; (2) a CDR-L2 comprising QASTRAS (SEQ ID NO: 9) ; and (3) a CDR-L3 comprising QQYYTPPLA (SEQ ID NO: 10) , wherein the CDR sequences are defined according to the Kabat numbering system. In some embodiments, the VH domain of the anti-CD47 antibody or immunologically active fragment thereof comprises an amino acid sequence that has at least 95%identity to SEQ ID NO: 1, and the VL of the anti-CD47 antibody or immunologically active fragment thereof comprises an amino acid sequence that has at least 95%identity to SEQ ID NO: 2. In some embodiments, the anti-CD47 antibody comprises a heavy chain that comprises SEQ ID NO: 3 or SEQ ID NO: 35 and a light chain that comprises SEQ ID NO: 4.
In some embodiments of the use of the present application, the medicament comprises a second agent for treating a tumor comprising a cell with a KRAS mutation. In some embodiments, the medicament is used in combination with a second agent for treating a tumor comprising a cell with a KRAS mutation. In some embodiments, the second agent is a KRAS G12D inhibitor, or a miR-34a mimic. In some embodiments, the KRAS G12D inhibitor is selected from the group consisting of MRTX1133 (Mirati) , iExosomes (MD Anderson) and mRNA-5671 (Moderna) . In some embodiments, the KRAS G12D inhibitor comprises a structure of:
In some embodiments of the use of the present application, the malignant tumor is solid tumor. In some embodiments, the malignant tumor is selected from the group consisting of NSCLC, pancreas cancer, colorectal cancer, gall bladder cancer, bile duct cancer, thyroid cancer, head and neck cancer, SCLC, colon cancer, small intestine cancer, appendiceal cancer, gastric cancer, esophageal cancer, bladder cancer, kidney cancer, liver cancer, breast cancer, ovarian cancer, teratocarcinoma, endometrial cancer, cervical cancer, prostate cancer, lymphoma, myeloma, leukemia, brain cancer, MPNST, neurofibromatosis, neuroblastoma, glioma,  schwannomas seminoma astrocytoma, squamous cell carcinoma, fibrosarcoma, rhabdomyosarcoma, osteosarcoma, Kaposi’s sarcoma and keratoacanthoma.
It is to be understood that one, some, or all of the properties of the various embodiments described herein may be combined to form other embodiments of the present invention. These and other aspects of the invention will become apparent to one of skill in the art. These and other embodiments of the invention are further described by the detailed description that follows.
BRIEF DESCRIPTIONS OF THE DRAWINGS
Figures 1A-1F show that oncogenic KRAS mutations render lung cancer cells insensitive to macrophage phagocytosis. Figure 1A shows that tumor cells from KRASmut NSCLC patients were more resistant to macrophage phagocytosis than that from KRASWT patients. cancer cells were isolated from 12 KRASWT and 6 KRASmut patients, labelled with the fluorescent dye CFSE, incubated with human peripheral blood monocyte-derived macrophages for 2 h, stained with F4/80 and analyzed by flow cytometry. Phagocytosis rate was calculated as the percentage of CFSE+ F4/80+ cells among the CFSE+ cells. Representative FACS results and quantification of all patients are shown. Figure 1B show the effect of KRAS manipulation on macrophage phagocytosis of KRASG12C H358 cells. H358 cells were transfected with plasmids expressing KRASWT or KRASG12C or with three KRAS siRNAs. After 48 h, the cells were subjected to phagocytosis assay similar to that in a. quantitative analysis (n = 5) is shown. Figures 1C and 1D show macrophage phagocytosis of H358 cells gradually decreased with tumor progression in vivo. An orthotopical model of lung cancer was established by tail vein injection of EGFP-labelled H358 cells into BALB/c nude mice. Representative images of H&E-stained lung sections at different time points are shown in Figure 1C. Scale bars, 2 mm. Macrophage infiltration in the mouse lung tumor tissue was assessed by immunofluorescence staining of CD11b (red) , iNOS (purple) and DAPI (blue) . Representative images (scale bars, 50 μm) and quantification results (n = 5 mice per group) are shown Figure 1D. Figures 1E and 1F show that macrophage phagocytosis of tumor cells gradually decreased with tumor progression in genetic models of lung cancer. KRASLSL-g12d/+; p53fl/fl mice were intratracheally administered adeno-CRE to trigger pulmonary adenocarcinoma formation. Tumor growth was monitored by non-invasive micro-CT scans at different time points. Representative 3-d reconstructions of mouse lungs are shown in e. tumors are shown in maroon. Macrophage infiltration in the mouse lung tumor tissue was assessed by immunofluorescence staining of CD11b (red) , iNOS (purple) , KRASg12d (green) and DAPI (blue) . representative images (scale bars, 50 μm) and  quantification results (n = 5 mice per group) are shown Figure 1F.
Figures 2A-2N show that CD47 is required for KRAS-driven antiphagocytic effect in lung cancer. Figure 2A shows that tumor cells from KRASmut NSCLC patients showed more CD47 expression than that from KRASWT patients. Cancer cells were isolated from 12 KRASWT and 6 KRASmut patients, labelled with the CD47 antibody and analyzed by flow cytometry. Representative FACS results and quantification of all patients are shown. Figures 2B and 2X show that KRASLSL-g12d/+; p53fl/fl mice showed a gradual increase in CD47 expression in the lung tumor tissue over time. KRASLSL-g12d/+; p53fl/fl were sacrificed at 0, 1, 2 and 3 months, respectively, and analyzed for CD47 expression by IHC staining (see Figure 2B;scale bars, 20 μm) and immunoblotting (see Figure 2C) . Figures 2D and 2E show that KRASmut NSCLC cell lines showed higher CD47 expression than KRASWT cell lines. The KRASWT NSCLC cell lines h292 and calu-3 and KRASmut lines a549, h23, SK-LU-1and H358 were analyzed for surface and total CD47 protein levels by flow cytometry (see Figure 2D) and immunoblotting (see Figure 2E) , respectively. Figure 2F shows western blot analysis of CD47 expression in the MEFs overexpressing various KRAS mutations (WT, G12C or g12d) . Figures 2G and 2H show the effect of KRAS manipulation on CD47 expression in H358 and SK-LU-1cells. H358 and SK-LU-1cells were transfected with plasmids expressing KRASWT or KRASG12C or with three KRAS siRNAs. After 48 h, CD47 expression was determined by immunoblotting. Representative immunoblots of three independent experiments are shown. Figures 2I-2N show the effect of CD47 knockdown on KRAS-driven tumorigenesis and macrophage phagocytosis in vivo. the KRASLSL-g12d/+; p53fl/fl mice were intratracheally administered adeno-CRE along with an AAV encoding short hairpin RNA of CD47 (AAV-CD47 shRNA) or scrambled negative control shRNA (AAV-control shRNA) . Figure 2I Kaplan-Meier survival analysis. Figure 2J representative micro-CT visualization of tumors 3 months’ post-administration. Figure 2K shows representative H&E staining of lung sections. scale bars, 2 mm. Figure 2L shows representative IHC staining of CD47 in lung tumor sections. scale bars, 20 μm. Figure 2M shows representative immunoblotting result of CD47 expression in lung tumors. Figure 2N shows immunofluorescence staining of CD11b (red) , iNOS (purple) , KRASg12d (green) and DAPI (blue) in lung tumors showing an increase in macrophage phagocytosis of tumor cells with CD47 shRNA. Representative images (scale bars, 50 μm) and quantification results (n = 5 mice per group) are shown.
Figures 3A-3M show that MiR-34A restricts CD47 activity and restores the phagocytic function of macrophages in vitro and in vivo. Figure 3A shows a scatter plot  comparison illustrating miRNAs that were differentially expressed between the malignant and normal lung tissues of the KRASLSL-G12D/+ mice. Small RNA deep sequencing was performed to determine the miRNA profiles in the lung adenocarcinomas and normal lung tissues. Analysis of differentially expressed miRNAs used a stringent threshold and a significance criterion of log2 (fold-change) > 1 and P < 0.05. Figure 3B shows cluster analysis of the miRNAs differentially expressed between the malignant and normal lungs of the KRASLSL-G12D/+ mice. Dendrogram generated by unsupervised hierarchical cluster analysis showed the separation of the tumors from the normal tissues based on miRNA profiling (10 upregulated vs. 40 downregulated) . Figure 3C shows quantitative RT-PCR analysis of the expression levels of 9 representative miRNAs in the malignant and normal lung tissues of the KRASLSL-G12D/+ mice. Among the 9 miRNAs, 2 and 5 were significantly up-and downregulated in lung adenocarcinomas, respectively (n = 5 mice per group) . Figures 3D and 3E show the effect of the miR-34A mimic (see Figure 3D) or miR-34A antisense (see Figure 3E) on CD47 expression in H358 cells. Figure 3F shows the effects of miR-34A mimic on macrophage phagocytosis of H358 cells. Cells were co-transfected with control mimic plus control plasmid, miR-34A mimic plus control plasmid or miR-34A mimic plus CD47 plasmid. After 48 h, cells were subjected to macrophage phagocytosis assay by flow cytometry. Representative FACS images and quantification results (n = 5 per group) are shown. Figures 3G-3M show the effect of miR-34A on KRAS-driven tumorigenesis and tumor macrophage infiltration in vivo. The KRASLSL-G12D/+; p53fl/fl mice were intratracheally administered Adeno-CRE along with different combinations of AAV-scrRNA (scrambled RNA sequence as the negative control for AAV-miR-34A) , AAV-miR-34A, AAV-control (negative control of AAV-CD47) or AAV-CD47 (CD47 coding sequence) . Figure 3G shows Kaplan-Meier survival analysis. Figure 3H shows representative micro-CT visualization of the tumors 3 months’ post-administration. Figure 3I shows representative H&E staining of lung sections. Scale bars, 2 mm. Figure 3J shows representative IHC staining of CD47 in lung tumor sections. Scale bars, 20 μm. Figure 3K shows representative immunoblotting result of CD47 expression in lung tumors. Figure 3L shows levels of miR-34A in lung tumors. Quantitative analysis (n = 5 per group) is shown. Figure 3M shows immunofluorescence staining of CD11b (red) , iNOS (purple) , KRASG12D (green) and DAPI (blue) in lung tumors showing an increase in macrophage phagocytosis of tumor cells with AAV-miR-34A which was rescued by AAV-CD47. Representative images (Scale bars, 50 μm) and quantification results (n = 5 mice per group) were shown.
Figures 4A-4O show that KRAS modulates CD47 expression through the PI3K- STAT3-miR-34A signaling axis. Figures 4A-4E show quantitative RT-PCR analysis of the effect of KRAS mutation status on the miR-34A levels in MEFs (see Figure 4A) ; H358 cells overexpressing KRASWT or KRASG12C (see Figure 4B) ; H358 cells transfected with three KRAS siRNAs (see Figure 4C) ; SK-LU-1cells overexpressing KRASWT or KRASG12D (see Figure 4D) ; or SK-LU-1cells transfected with three KRAS siRNAs (see Figure 4E) (n = 3 per group) . Figures 4F and 4G show quantitative RT-PCR analysis of the relative expression levels of miR-34A in the whole lung extracts from the KRASLSL-G12D/+ or KRASLSL-G12D/+; p53fl/fl mice at different time points (n = 3 mice per group) . Figure 4H shows the effect of MEK and PI3K inhibition on the expression of miR-34A. MEFs and H358 cells were treated with DMSO, MEK inhibitor, PI3K inhibitor or a combination, the pharmaceutical composition, or the manufacture of product of both inhibitors. The relative miR-34A expression levels were determined by quantitative RT-PCR (n = 3 per group) . Figure 4I shows the effect of MEK and PI3K inhibition on the expression of CD47, p-STAT3 and total STAT3 in MEFs and H358 cells. Figures 4J-4N Western blot analysis of the expression levels of KRAS, p-STAT3 and total STAT3 in the MEFs (see Figure 4J) ; H358 cells overexpressing KRASWT or KRASG12C (see Figure 4K) ; SK-LU-1cells overexpressing KRASWT or KRASG12D (see Figure 4L) ; H358 cells transfected with three KRAS siRNAs (see Figure 4M) ; or SK-LU-1cells transfected with three KRAS siRNAs (see Figure 4N) . Western blots shown are representative of three independent experiments. Figure 4O Schematic of the signaling pathways involved in the regulation of CD47 expression and macrophage phagocytic function by KRAS mutation.
Figures 5A-5G show clinical relevance of KRAS mutation status and CD47 expression in NSCLC patients. Figures 5A shows correlation analysis of KRAS activity and CD47 expression in the first patient cohort containing 157 lung adenocarcinoma samples. IHC staining was performed to analyze CD47 and p-STAT3 in the tissue microarray chips stratified by high or low KRAS activity (measured by p-AKT levels due to the lack of KRAS mutation information) . Left panel: representative IHC images. Right panel: bar graph showing the expression of CD47 and p-STAT3 in the low and high p-AKT patients (n = 98 and 59, respectively) . CD47 and p-STAT3 expression statuses were stratified based on IHC scores. Figures 5B shows IHC analysis of CD47 and p-STAT3 in a homemade tissue microarray containing 40 NSCLC samples (28 KRASWT and 12 KRASMUT) . Left panel: representative IHC images. Right panel: bar graph showing the expression of CD47 and p-STAT3 in the KRASWT and KRASMUT tumors (n = 28 and 12, respectively) . The CD47 and p-STAT3 expression statuses were stratified based on IHC scores. Figures 5C-5E show  correlation analysis of KRAS mutation status and the expression of CD47, p-STAT3 and miR-34A in the third NSCLC patient cohort with KRAS mutation status determined by deep sequencing. Figure 5C shows Western blot analysis of CD47 protein expression in the KRASWT, KRASG12C, KRASG12D or KRASG12V patients. Left panel: representative blots (N: normal; T: tumor) . Right panel: quantitative analysis (n = 70 KRASWT and 30 KRASMUT, respectively) . Figure 5D shows Western blot analysis of p-STAT3 protein expression in the KRASWT and KRASMUT patients. Figure 5E shows quantitative RT-PCR analysis of the miR-34A levels in the KRASWT and KRASMUT patients. Figures 5F and 5G show Pearson’s correlation coefficient analysis of the correlations among p-STAT3, miR-34A and CD47 in the KRASMUT (see Figure 5F) and KRASWT (see Figure 5G) NSCLC samples. FC, fold change.
Figures 6A-6L show that the KRASG12C inhibitor AMG 510 inhibits CD47 signaling and promotes macrophage phagocytosis of tumor cells in vitro and in vivo. Figures 6A-6C show that AMG 510 treatment renders H358 cells sensitive to phagocytosis by macrophages. Figures 6A and 6B show the effect of AMG 510 on the expression levels of p-STAT3, total STAT3, CD47 and miR-34A in H358 cells. Cells were treated with AMG 510 for 24 h. Representative blots of three independent experiments are shown. Figure 6C shows that KRASG12C inhibition increased phagocytosis of H358 cells by macrophages. Cells were treated with AMG 510 for 24 h before coculture with human peripheral blood monocyte-derived macrophages. Phagocytosis of H358 cells by macrophages was analyzed by flow cytometry. Representative FACS plots and quantification (n = 5 per group) are shown. Figures 6A-6F show that AMG 510 treatment renders LLC cells sensitive to phagocytosis by macrophages. Experiments identical to that of a-c were carried out for LLC cells. Figures 6D and 6E show the effect of AMG 510 on the expression levels of p-STAT3, total STAT3, CD47 and miR-34A in LLC cells. Representative blots of three independent experiments are shown. Figure 6F shows KRASG12C inhibition increased phagocytosis of LLC cells by macrophages. Representative FACS plots and quantification (n = 5 per group) are shown. Figures 6G-6L show the effect of AMG 510 treatment on CD47 expression and macrophage phagocytosis in vivo. EGFP-labelled LLC mouse lung cancer cells were injected via tail vein into C57BL/6 immunocompetent mice to establish an orthotopic model of lung cancer. After tumor formation, the mice were administered vehicle control or AMG 510 via oral gavage for 8 days. Figure 6G shows representative H&E-stained lung sections. Scale bars, 2 mm. Figure 6H shows representative Ki-67 staining of lung sections. Scale bars, 20 μm. Figure 6I shows representative IHC staining of CD47 expression in lung sections. Scale bars, 20 μm.  Figure 6J shows representative western blots of CD47, p-STAT3 and total STAT3 in lung tumors. Figure 6K shows quantitative RT-PCR analysis of the relative expression levels of miR-34A in the xenografted tumors (n = 3 per group) . Figure 6L shows immunofluorescence staining of CD11b (red) , iNOS (purple) and DAPI (blue) in lung tumors showing an increase in macrophage phagocytosis of tumor cells with AMG 510 treatment. Representative images (Scale bars, 50 μm) and quantification results (n = 5 mice per group) are shown.
Figures 7A-7F show that oncogenic KRAS mutations render lung cancer cells insensitive to macrophage phagocytosis. Figure 7A shows that tumor cells from KRASMUT NSCLC patients were more resistant to macrophage phagocytosis than that from KRASWT patients. Cancer cells were isolated from 12 KRASWT and 6 KRASMUT patients, labelled with the fluorescent dye CFSE, incubated with human peripheral blood monocyte-derived macrophages, stained with F4/80, and analyzed by flow cytometry. Phagocytosis rate was calculated as the percentage of CFSE+F4/80+ cells among the CFSE+ cells. FACS results for all 18 patients are shown. Figures 7B and 7C show the effect of KRAS manipulation on macrophage phagocytosis of KRASG12C H358 cells. H358 cells were transfected with plasmids expressing KRASWT or KRASG12C or with three KRAS siRNAs. After 48 h, the cells were labelled with CFSE and subjected to the in vitro phagocytosis assay. Representative FACS result for each group is shown. Figures 7D-7F show the effect of KRAS manipulation on macrophage phagocytosis of KRASG12C H358 cells. Fluorescence microscopy of the macrophage phagocytosis of the EGFP-labelled H358 cells transfected with plasmids expressing KRASWT or KRASG12C or with three KRAS siRNA for 48 h before coculture with human peripheral blood monocyte-derived macrophages. Representative fluorescence images are provided by Figures 7D and 7E (scale bars, 50 μm) and phagocytic index (Figure 7F; n = 5 per group) are shown.
Figures 8A-8E show that macrophage phagocytosis of tumor cells is inhibited in KRASLSL-G12D/+mice. Figure 8A shows IHC staining of the M1 macrophage markers iNOS and TNF-α in the lung sections derived from the H358 orthotopic mice model at different time points. Scale bars, 20 μm. Figures 8B-8E show monitoring of tumor growth and macrophage infiltration in KRASLSL-G12D/+ mice. KRASLSL-G12D/+ mice were intratracheally administered Adeno-CRE to trigger pulmonary adenocarcinoma formation. In Figure 8B, tumor growth was monitored by non-invasive micro-CT scans at different time points post-administration. Left panel: representative 3-D reconstructions of the mouse lungs. Right panel: quantitative analysis of the tumor numbers and volumes (n = 5 per group) . In Figure 8C, tumor growth was also evaluated by H&E-staining of lung sections. Left panel:  representative H&E images. Scale bars, 2 mm. Right panel: quantification of tumor burden (n = 5 per group) . In Figure 8D, macrophage infiltration was assessed by immunofluorescence staining of CD11b (red) , iNOS (purple) , KRASG12D (green) and DAPI (blue) in the mouse lung tumor tissue. Left panel: representative images. Scale bars, 50 μm. Right panel: quantification results (n = 5 mice per group) . In Figure 8E, the presence of M1 macrophages in lung tumor tissue was assessed by IHC staining of the M1 macrophage markers iNOS and TNF-α in the lung sections from KRASLSL-G12D/+ mice. Scale bars, 20 μm.
Figures 9A-9C show that macrophage phagocytosis of tumor cells is inhibited in KRASLSL-G12D/+; p53fl/fl mice. KRASLSL-G12D/+; p53fl/fl mice were intratracheally administered Adeno-CRE to trigger pulmonary adenocarcinoma formation. In Figure 9A, tumor growth was monitored by non-invasive micro-CT scans at different time points post-administration. Quantitative analysis of the tumor numbers and volumes (n = 5 per group) is shown. In Figure 9B, tumor growth was also evaluated by H&E-staining of lung sections. Left panel: representative H&E images. Scale bars, 2 mm. Right panel: quantification of tumor burden (n = 5 per group) . In Figure 9C, the presence of M1 macrophages in lung tumor tissue was assessed by IHC staining of the M1 macrophage markers iNOS and TNF-α in the lung sections from KRASLSL-G12D/+; p53fl/fl mice. Scale bars, 20 μm.
Figures 10A-10E show that KRAS mutations drive CD47 expression in NSCLC patients and mouse models of lung cancer. Figure 10A shows FACS analysis of surface expression of CD47 on tumor cells isolated from 12 KRASWT and 6 KRASMUT NSCLC patients. Figure 10B shows IHC analysis of the CD47 protein levels in the lung tumors of KRASLSL-G12D/+ mice. Representative images (Scale bars, 20 μm) and quantification results (n = 5 per group) are shown. Figure 10C shows Western blot analysis of CD47 protein levels in the lung tumors of KRASLSL-G12D/+ mice. Representative images and quantification results (n = 3 per group) are shown. Figure 10D shows IHC analysis of the CD47 protein levels in the lung tumors from KRASLSL-G12D/+; p53fl/fl mice. Quantification results (n = 5 per group) are shown. Figure 10E shows Western blot analysis of CD47 protein levels in the lung tumors from KRASLSL-G12D/+; p53fl/fl mice. Quantification results (n = 3 per group) are shown.
Figures 11A-11F show that KRAS mutations drive CD47 protein expression in vitro. Figure 11A shows Western blot analysis of the CD47 protein levels in the KRASWT NSCLC cell lines H292 and Calu-3 and KRASMUT lines A549, H23, SK-LU-1and H358. Quantification results (n = 3 per group) are shown. Figure 11B shows Western blot analysis of the CD47 protein levels in the MEFs overexpressing KRASWT, KRASG12C or KRASG12D. Quantification results (n = 3 per group) are shown. Figures 11C and 11D show Western blot  analysis of the KRAS and CD47 protein levels in the H358 (see Figure 11C) and SK-LU-1 (see Figure 11D) cells transfected with the plasmids expressing KRASWT or KRASG12C. Quantification results (n = 3 per group) are shown. Figures 11E and 11F show Western blot analysis of the KRAS and CD47 protein levels in the H358 (see Figure 11E) and SK-LU-1 (see Figure 11F) cells transfected with three KRAS siRNAs. Quantification results (n = 3 per group) are shown.
Figures 12A-12E show that silencing of CD47 expression by shRNA induces tumor regression in the KRASLSL-G12D/+; p53fl/fl mice. The KRASLSL-G12D/+; p53fl/fl mice were intratracheally administered Adeno-CRE along with AAV-control shRNA or AAV-CD47 shRNA. The mice were then monitored to evaluate tumor growth and CD47 expression. Figure 12A shows quantification of the tumor numbers and volumes at 3 months post-administration from the micro-CT images (n = 5 per group) . Figure 12B shows quantification of the tumor area from H&E-stained lung sections (n = 5 per group) . Figure 12C shows IHC analysis of the CD47 protein levels in the lung tumors. Quantitative results of the IHC scores are shown (n = 5 mice per group) . Figure 12D shows Western blot analysis of the CD47 protein levels in the lung tumors. Quantitative results are shown (n = 5 mice per group) . Figure 12E shows IHC staining of the M1 macrophage markers iNOS and TNF-α in the lung sections derived from the KRASLSL-G12D/+; p53fl/fl mice treated with AAV-CD47 shRNA. Scale bars, 20 μm.
Figures 13A-13D show effect of KRAS mutation status and expression on CD47 mRNA levels in vitro and in vivo. Figures 13A and 13B show quantitative RT-PCR analysis of the relative CD47 mRNA levels in the whole lung extracts from the KRASLSL-G12D/+ and KRASLSL-G12D/+; p53fl/fl mice at different time points (n = 3 per group) . Figures 13C and 13D show quantitative RT-PCR analysis of the relative CD47 mRNA levels in the H358 (see Figure 13C) and SK-LU-1 (see Figure 13D) cells that were transfected with the plasmids expressing KRASWT or KRASG12C or with three KRAS siRNAs (n = 3 per group) .
Figures 14A-14M show post-transcriptional regulation of CD47 by miR-34A. Figure 14A shows a schematic description of the predicted duplexes formed by miR-34A and the 3’-UTR of CD47 mRNA. The predicted free energy values of the hybrids are indicated, which were well within the range of genuine miRNA-target pairs. The nucleic acid sequences shown in Figure 14A are UGGCAGUGUCUUAGCUGGUUGU (SEQ ID NO: 39) , GAUAACUACUUAGCACUGCCC (SEQ ID NO: 43) ; UGCUGCCUGCCUUUUGAGGCAUUCACUGCCC (SEQ ID NO: 44) ; and AAAUUACUAACUGCCA (SEQ ID NO: 45) . Figure 14B shows quantitative RT-PCR  analysis of the relative expression levels of miR-34A in the H358 and SK-LU-1cells transfected with the control mimic or miR-34A mimic (n = 3 per group) . Figure 14C shows quantitative RT-PCR analysis of the relative expression levels of miR-34A in the H358 and SK-LU-1cells transfected with the control antisense or miR-34A antisense (n = 3 per group) . Figure 14D shows Western blot analysis of the CD47 protein levels in the H358 cells transfected with the control mimic or miR-34A mimic. Quantification results (n = 3 per group) are shown. Figure 14E shows Western blot analysis of the CD47 protein levels in the H358 cells transfected with the control antisense or miR-34A antisense. Quantification results (n = 3 per group) are shown. Figure 14F shows Western blot analysis of the CD47 protein levels in SK-LU-1cells transfected with the control mimic or miR-34A mimic. Left panel: representative blots. Right panel: quantification results (n = 3 per group) . Figure 14G shows Western blot analysis of the CD47 protein levels in SK-LU-1cells transfected with the control antisense or miR-34A antisense. Left panel: representative blots. Right panel: quantification results (n = 3 per group) . Figure 14H shows quantitative RT-PCR analysis of the relative CD47 mRNA levels in the H358 and SK-LU-1cells transfected with the control mimic or miR-34A mimic (n = 3 per group) . Figure 14I shows quantitative RT-PCR analysis of the relative CD47 mRNA levels in the H358 and SK-LU-1cells transfected with the control antisense or miR-34A antisense (n = 3 per group) . Figure 14J shows firefly luciferase reporters containing wild-type or mutant miR-34A binding sites in the CD47 3’-UTR were co-transfected into HEK293T cells together with the control mimic or miR-34A mimic. The reduction in luciferase activity only in the wild-type reporters indicates direct binding of miR-34A to the presumed sites in the 3’-UTR of CD47 (n = 3 per group) . Figure 14K shows TargetScan prediction of miRNAs’ possibilities of binding to CD47. Figure 14L shows dual-luciferase assay showed the four miRNAs had no interaction with the CD47 3’UTR. Figure 14M shows Western blot assay showed the expression level of CD47 was not regulated by the 4 miRNAs.
Figures 15A-15G show that miR-34A restores the phagocytic function of macrophages by negatively regulating CD47 activity in vitro and in vivo. Figure 15A shows efficient induction of CD47 protein expression in H358 lung cancer cells by a plasmid expressing the CD47 coding sequence (CD47 plasmid) . Left panel: representative blots. Right panel: quantification results (n = 3 per group) . Figure 15B shows fluorescence microscopy of the macrophage phagocytosis of the EGFP-labelled H358 cells that were co-transfected with the control mimic plus the control plasmid, the miR-34A mimic plus the control plasmid or the miR-34A mimic plus the CD47 plasmid for 48 h before coculture with  human peripheral blood monocyte-derived macrophages. Left panel: representative fluorescence images. Scale bars, 50 μm. Right panel: phagocytic index (n = 5 per group) . Figures 15C-15G shows that MiR-34A restricts CD47 activity and induces tumor regression in the KRASLSL-G12D/+; p53fl/fl mouse model of lung cancer. The KRASLSL-G12D/+; p53fl/fl mice were intratracheally administered Adeno-CRE along with various combinations of AAV-scrRNA, AAV-control, AAV-miR-34A or AAV-CD47. The mice were then monitored to evaluate tumor growth, CD47 expression and macrophage phagocytosis. Figure 15C shows quantification of the tumor numbers and volumes from micro-CT images (n = 5 per group) . Figure 15D shows quantification of the tumor burden from H&E staining (n = 5 per group) . Figure 15E shows IHC staining of CD47 in the lung adenocarcinoma sections. The quantification of IHC scores is shown (n = 5 per group) . Figure 15F shows Western blot analysis of the CD47 protein levels in the lung adenocarcinomas. The quantitative analysis is shown (n = 5 per group) . Figure 15G shows IHC staining of the M1 macrophage markers iNOS and TNF-α in the lung sections derived from the KRASLSL-G12D/+; p53fl/fl mice treated with AAV-miR-34A alone or together with AAV-CD47. Scale bars, 20 μm.
Figures 16A-16Q show that KRAS mutations lead to the phosphorylation of STAT3, suppression of miR-34A expression and activation of CD47 expression in lung cancer cells. Figure 16A shows Western blot analysis of the expression levels of CD47 in the MEFs and H358 cells treated with the MEK inhibitor, the PI3K inhibitor or both. Quantification results (n = 3 per group) are shown Figure 16B and 16C show Western blot analysis of the expression levels of p-STAT3 and total STAT3 in the MEFs. Quantification results (n = 3 per group) are shown. Figures 16D-16F show Western blot analysis of the expression levels of KRAS, p-STAT3 and total STAT3 in the H358 cells overexpressing KRASWT or KRASG12C. Quantification results (n = 3 per group) are shown. Figures 16G-16I show Western blot analysis of the expression levels of KRAS, p-STAT3 and total STAT3 in the SK-LU-1cells overexpressing KRASWT or KRASG12D. Quantification results (n = 3 per group) are shown. Figures 16J-16L show Western blot analysis of the expression levels of KRAS, p-STAT3 and total STAT3 in the H358 cells transfected with three KRAS siRNAs. Quantification results (n = 3 per group) are shown. Figures 16M-16O show Western blot analysis of the expression levels of KRAS, p-STAT3 and total STAT3 in the SK-LU-1cells transfected with three KRAS siRNAs. Quantification results (n = 3 per group) are shown. Figures 16P-16Q show Western blot analysis of the expression levels of p-STAT3 and total STAT3 in the MEFs and H358 cells treated with the MEK inhibitor, the PI3K inhibitor or both. Quantification results (n = 3 per group) are shown.
Figures 17A-17B show effect of the STAT3 inhibitor on CD47 and miR-34A expression in lung cancer cells. Figure 17A shows Western blot analysis of the expression levels of p-STAT3, total STAT3 and CD47 in the H358 cells treated with DMSO or STAT3 inhibitor. Top panel: representative blots. Bottom panel: quantification results (n = 3 per group) . Figure 17B shows quantitative RT-PCR analysis of the relative miR-34A levels in the H358 cells treated with DMSO or STAT3 inhibitor (n = 3 per group) .
Figures 18A-18I show characterization of the expression patterns of CD47, p-STAT3 and miR-34A in NSCLC patients. Figures 18A-18E show IHC analysis of CD47 protein in the first patient cohort containing 157 lung adenocarcinoma samples. Figure 18A shows IHC staining of CD47 protein in paired NSCLC and normal adjacent tissue samples. Left panel: representative IHC images. Scale bars, 20 μm. Right panel: IHC scores (n = 157) . Figure 18B shows Kaplan–Meier curves were generated to analyze the association of CD47 protein expression with the overall survival of the NSCLC patients. Patients were stratified into high or low CD47 expression groups by the median value (n = 99 and 58, respectively) . Figure 18C shows IHC staining of CD47 protein in the NSCLC samples with different grades. Left panel: representative IHC images. Scale bars, 20 μm. Right panel: bar graph showing the percentages of patients in the grade I, II and III groups (n = 7, 93 and 57, respectively) . The CD47 expression levels were stratified based on IHC scores (low: 1–4; medium: 5–6; high: 7–10) . Figure 18D shows Kaplan–Meier curves were generated to analyze the association of p-AKT protein expression with the overall survival of the NSCLC patients. The patients were stratified into high or low p-AKT expression groups by the median value (n = 59 and 98, respectively) . Figure 18E shows Kaplan–Meier analysis of the association between p-AKT and CD47 co-expression and overall survival of NSCLC patients. Patients were grouped according to a positive CD47 and p-AKT co-expression pattern (both > median value) or negative (both < median value) co-expression pattern (n =51 and 30, respectively) . Figure 18F shows IHC staining of CD47 protein in paired NSCLC and normal adjacent tissue samples derived from the second patient cohort containing 40 NSCLC samples (28 KRASWT and 12 KRASMUT) . Left panel: representative IHC images. Scale bars, 20 μm. Right panel: IHC scores (n = 40) . Figures 18G and 18H show Western blot analyses of the expression levels of CD47 and p-STAT3 proteins in the paired NSCLC and normal adjacent tissue samples derived from the third patient cohort containing 100 NSCLC samples (70 KRASWT and 30 KRASMUT) . The quantification results are shown (n =100 per group) . Figure 18I shows quantitative RT-PCR analysis of the miR-34A levels in the  paired NSCLC and normal adjacent tissue samples derived from the third patient cohort (n =100 per group) .
Figures 19A-19C show that the KRASG12C inhibitor AMG 510 renders H358 and LLC cells sensitive to phagocytosis by macrophages. Figure 19A shows the effect of the KRASG12C inhibitor AMG 510 on the expression levels of p-STAT3, total STAT3 and CD47 in the H358 cells. Cells were treated with AMG 510 for 24 h and subjected to immunoblotting. Quantification results (n = 3 per group) are shown. Figure 19B shows fluorescence microscopy of the macrophage phagocytosis of the EGFP-labelled H358 cells treated with AMG 510 for 24 h before coculture with human peripheral blood monocyte-derived macrophages. Left panel: representative fluorescence images. Scale bars, 50 μm. Right panel: phagocytic index (n = 5 per group) . Figure 19C shows the effect of the KRASG12C inhibitor AMG 510 on the expression levels of p-STAT3, total STAT3 and CD47 in the LLC cells. Cells were treated with AMG 510 for 24 h and subjected to immunoblotting. Quantification results (n = 3 per group) are shown.
Figures 20A-20F show that the KRASG12C inhibitor AMG 510 restores innate immune surveillance in an orthotopic xenograft mouse model. C57BL/6 immunocompetent mice were tail vein injected with LLC cells (KRASG12C) mouse lung cancer cells to establish an orthotopic xenograft mouse model. After tumor formation, the mice were administered vehicle control or AMG 510 via oral gavage for 8 days. The mice were then monitored to evaluate tumor growth, CD47 expression and macrophage phagocytosis and infiltration. Figure 20A shows quantification of tumor burden from H&E staining of the lung tumor sections (n = 3 per group) . Figure 20B shows quantification of Ki67 levels from IHC staining of the lung tumor sections (n = 3 per group) . Figure 20C shows Western blot analysis of the expression levels of p-ERK and total ERK in the xenograft tumors as a marker for KRAS target engagement. Top panel: representative blots. Bottom panel: quantification results (n = 3 per group) . Figure 20D shows IHC staining of CD47 in the xenograft tumor sections. Quantitative analysis of the IHC scores is shown (n = 3 per group) . Figure 20E shows Western blot analysis of the expression levels of CD47, p-STAT3 and total STAT3 in the xenograft tumors. Quantification results (n = 3 per group) are shown. Figure 20F shows representative IHC staining of the M1 macrophage markers iNOS and TNF-α in the xenograft tumor sections. Scale bars, 20 μm.
Figure 21 shows that compared with that of LLC cell line, the p-AKT, p-ERK, p-STAT3 and CD47 protein expression levels were significantly decreased in LLC-KI cell line.
Figure 22A shows the results of FACS experiments that were performed to  investigate a correlation between KRAS mutation status with CD47 expression in colon cancer cell lines. Figure 22B shows the results of Western Blots that were performed to investigate a correlation between KRAS mutation status with CD47 expression in colon cancer cell lines
Figure 23 shows the results of KRAS siRNA knock down experiments that were performed to investigate a correlation between KRAS mutation status with CD47 expression in colon cancer cell lines.
Figure 24 shows the results experiments that were performed to determine whether overexpression of wild type KRAS or mutant KRAS could up-regulate the expression of CD47 in colon cancer cells.
Figure 25 shows the results experiments that were performed to determine the IC50 value of KRASG12D inhibitor MRTX1133 on LS180 cells.
Figure 26 shows the results experiments that were performed to determine effects of KRASG12D inhibitor MRTX1133 on the expression levels of pERK, ERK, pAKT, AKT, and CD47 in LS180 cells.
DETAILED DESCRIPTION OF THE INVENTION
Definitions
Before describing the embodiments in detail, it is to be understood that the present disclosure is not limited to particular compositions or biological systems, which can, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.
As used in this specification and the appended claims, the singular forms “a, ” “an” and “the” include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to “a molecule” optionally includes a combination of two or more such molecules, and the like.
The term “about” as used herein refers to the usual error range for the respective value readily known to the skilled person in this technical field. Reference to “about” a value or parameter herein includes (and describes) embodiments that are directed to that value or parameter per se.
It is understood that aspects and embodiments of the present disclosure include “comprising, ” “consisting, ” and “consisting essentially of” aspects and embodiments.
The term “CD47” (which is also known as Integrin Associated Protein (IAP) , Antigenic Surface Determinant Protein OA3, OA3, CD47 Antigen, Rh-Related Antigen, Integrin-Associated Signal Transducer, Antigen Identified By Monoclonal Antibody 1D8, CD47  glycoprotein) preferably refers to human CD47 and, in particular, to a protein comprising the amino acid sequence
or a variant of said amino acid sequence. The term “CD47” also refers to any post translationally modified variants and conformation variants.
As used herein, the term “antibody” is used in the broadest sense and specifically covers intact antibodies (e.g., full length antibodies) , antibody fragments (including without limitation Fab, F (ab’) 2, scFv, scFv-Fc, single domain antibodies) , monoclonal antibodies, and polyclonal antibodies, so long as they exhibit the desired biological activity (e.g., epitope binding) . An “immunologically active fragment” of an antibody is a fragment of an antibody that binds to the antigen of the antibody or an epitope of the antigen, comprising any one of the fragments selected from the group consisting of CDR, VL, VH, Fab, F (ab’) 2 and scFv.
As used herein, the term “isolated” antibody may refer to an antibody that is substantially free of other cellular material. In one embodiment, an isolated antibody is substantially free of other proteins from the same species. In another embodiment, an isolated antibody is expressed by a cell from a different species and is substantially free of other proteins from the different species. In some embodiments, an “isolated” antibody is one which has been identified and separated and/or recovered from a component of its natural environment. Contaminant components of its natural environment are materials which would interfere with diagnostic or therapeutic uses for the antibody, and may include enzymes, hormones, and other proteinaceous or nonproteinaceous solutes. An antibody may be rendered substantially free of naturally associated components (or components associated with the cellular expression system used to produce the antibody) by isolation, using protein purification techniques well known in the art. In some embodiments, the antibody will be purified (1) to greater than 75%by weight of antibody as determined by the Lowry method, and most preferably more than 80%, 90%, 95%or 99%by weight, or (2) to homogeneity by SDS-PAGE under reducing or nonreducing conditions using Coomassie blue or, preferably, silver stain. Isolated antibody includes the antibody in situ within recombinant cells since at least one component of the antibody’s natural environment will not be present. Ordinarily, however, isolated antibody will be prepared by at least one purification step.
As used herein, the term “epitope” means any antigenic determinant on an antigen to  which the paratope of an antibody binds. Epitopic determinants usually consist of chemically active surface groupings of molecules such as amino acids or sugar side chains and usually have specific three-dimensional structural characteristics, as well as specific charge characteristics.
As used herein, the term “native antibodies and immunoglobulins” are usually heterotetrameric glycoproteins of about 150,000 daltons, composed of two identical light (L) chains and two identical heavy (H) chains. Each light chain is linked to a heavy chain by one covalent disulfide bond (also termed a “VH/VL pair” ) , while the number of disulfide linkages varies between the heavy chains of different immunoglobulin isotypes. Each heavy and light chain also has regularly spaced intrachain disulfide bridges. Each heavy chain has at one end a variable domain (VH) followed by a number of constant domains. Each light chain has a variable domain at one end (VL) and a constant domain at its other end; the constant domain of the light chain is aligned with the first constant domain of the heavy chain, and the light chain variable domain is aligned with the variable domain of the heavy chain. Particular amino acid residues are believed to form an interface between the light-and heavy-chain variable domains. See, e.g., Chothia et al., J. Mol. Biol., 186: 651 (1985) ; Novotny and Haber, Proc. Natl. Acad. Sci. U.S.A., 82: 4592 (1985) .
As used herein, the term “variable” refers to the fact that certain portions of the variable domains differ extensively in sequence among antibodies and are used in the binding and specificity of each particular antibody for its particular antigen. However, the variability is not evenly distributed throughout the variable domains of antibodies. It is concentrated in three segments called complementarity-determining regions (CDRs) or hypervariable regions both in the light-chain and the heavy-chain variable domains. The more highly conserved portions of variable domains are called the framework (FR) . The variable domains of native heavy and light chains each comprise four FR regions, largely adopting a β-sheet configuration, connected by three CDRs, which form loops connecting, and in some cases forming part of, the β-sheet structure. The CDRs in each chain are held together in close proximity by the FR regions and, with the CDRs from the other chain, contribute to the formation of the antigen-binding site of antibodies. See, e.g., Kabat et al., Sequences of Proteins of Immunological Interest, Fifth Edition, National Institute of Health, Bethesda, Md. (1991) . The constant domains are not involved directly in binding an antibody to an antigen, but exhibit various effector functions, such as participation of the antibody in antibody-dependent cellular toxicity. Variable region sequences of interest include the humanized variable region sequences for CD47 antibodies described in detail elsewhere herein.
The term “hypervariable region (HVR) ” or “complementarity determining region (CDR) ” may refer to the subregions of the VH and VL domains characterized by enhanced  sequence variability and/or formation of defined loops. These include three CDRs in the VH domain (H1, H2, and H3) and three CDRs in the VL domain (L1, L2, and L3) . H3 is believed to be critical in imparting fine binding specificity, with L3 and H3 showing the highest level of diversity. See Johnson and Wu, in Methods in Molecular Biology 248: 1-25 (Lo, ed., Human Press, Totowa, N. J., 2003) .
A number of CDR/HVR delineations are known. The Kabat Complementarity Determining Regions (CDRs) are based on sequence variability and are the most commonly used (Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. (1991) ) . Chothia refers instead to the location of the structural loops (Chothia and Lesk J. Mol. Biol. 196: 901-917 (1987) ) . The AbM HVRs represent a compromise between the Kabat HVRs and Chothia structural loops, and are used by Oxford Molecular’s AbM antibody modeling software. The “contact” HVRs are based on an analysis of the available complex crystal structures. The residues from each of these HVRs/CDRs are noted below. “Framework” or “FR” residues are those variable domain residues other than the HVR/CDR residues.
“Extended” HVRs are also known: 24-36 or 24-34 (L1) , 46-56 or 50-56 (L2) and 89-97 or 89-96 (L3) in the VL and 26-35 (H1) , 50-65 or 49-65 (H2) and 93-102, 94-102, or 95-102 (H3) in the VH (Kabat numbering) .
“Numbering according to Kabat” may refer to the numbering system used for heavy chain variable domains or light chain variable domains of the compilation of antibodies in Kabat et al., supra. The actual linear amino acid sequence may contain fewer or additional amino acids corresponding to a shortening of, or insertion into, a FR or HVR of the variable domain. The Kabat numbering of residues may be determined for a given antibody by alignment at regions of homology of the sequence of the antibody with a “standard” Kabat numbered sequence. Typically, the Kabat numbering is used when referring to a residue in the variable domains (approximately residues 1-107 of the light chain and residues 1-113 of the heavy chain) , whereas the EU numbering system or index (e.g., the EU index as in Kabat, numbering according to EU IgG1) is generally used when referring to a residue in the heavy chain constant region.
As used herein, a “monoclonal” antibody refers to an antibody obtained from a population of substantially homogeneous antibodies, e.g., substantially identical but allowing for minor levels of background mutations and/or modifications. “Monoclonal” denotes the substantially homogeneous character of antibodies, and does not require production of the antibody by any particular method. In some embodiments, a monoclonal antibody is selected by its HVR, VH, and/or VL sequences and/or binding properties, e.g., selected from a pool of clones (e.g., recombinant, hybridoma, or phage-derived) . A monoclonal antibody may be engineered to include one or more mutations, e.g., to affect binding affinity or other properties of the antibody, create a humanized or chimeric antibody, improve antibody production and/or homogeneity, engineer a multispecific antibody, resultant antibodies of which are still considered to be monoclonal in nature. A population of monoclonal antibodies may be distinguished from polyclonal antibodies as the individual monoclonal antibodies of the population recognize the same antigenic site. A variety of techniques for production of monoclonal antibodies are known; see, e.g., the hybridoma method (e.g., Kohler and Milstein, Nature, 256: 495-97 (1975) ; Hongo et al., Hybridoma, 14 (3) : 253-260 (1995) , Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988) ; Hammerling et al., in: Monoclonal Antibodies and T-Cell Hybridomas 563-681 (Elsevier, N. Y., 1981) ) , recombinant DNA methods (see, e.g., U.S. Pat. No. 4,816,567) , phage-display technologies (see, e.g., Clackson et al., Nature, 352: 624-628 (1991) ; Marks et al., J. Mol. Biol. 222: 581-597 (1992) ; Sidhu et al., J. Mol. Biol. 338 (2) : 299-310 (2004) ; Lee et al., J. Mol. Biol. 340 (5) : 1073-1093 (2004) ; Fellouse, Proc. Natl. Acad. Sci. USA 101 (34) : 12467-12472 (2004) ; and Lee et al., J. Immunol. Methods 284 (1-2) : 119-132 (2004) , and technologies for producing human or human-like antibodies in animals that have parts or all of the human immunoglobulin loci or genes encoding human immunoglobulin sequences (see, e.g., WO 1998/24893; WO 1996/34096; WO 1996/33735; WO 1991/10741; Jakobovits et al., Proc. Natl. Acad. Sci. USA 90: 2551 (1993) ; Jakobovits et al., Nature 362: 255-258 (1993) ; Bruggemann et al., Year in Immunol. 7: 33 (1993) ; U.S. Pat. Nos. 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; and 5,661,016; Marks et al., Bio/Technology 10: 779-783 (1992) ; Lonberg et al., Nature 368: 856-859 (1994) ; Morrison, Nature 368: 812-813 (1994) ; Fishwild et al., Nature Biotechnol. 14: 845-851 (1996) ; Neuberger, Nature Biotechnol. 14: 826 (1996) ; and Lonberg and Huszar, Intern. Rev. Immunol. 13: 65-93 (1995) .
“Chimeric” antibodies may refer to an antibody with one portion of the heavy and/or light chain from a particular isotype, class, or organism and another portion from another isotype, class, or organism. In some embodiments, the variable region will be from one source or organism, and the constant region will be from another.
“Humanized antibodies” may refer to antibodies with predominantly human sequence  and a minimal amount of non-human (e.g., mouse or chicken) sequence. In some embodiments, a humanized antibody has one or more HVR sequences (bearing a binding specificity of interest) from an antibody derived from a non-human (e.g., mouse or chicken) organism grafted onto a human recipient antibody framework (FR) . In some embodiments, non-human residues are further grafted onto the human framework (not present in either source or recipient antibodies) , e.g., to improve antibody properties. In general, a humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the hypervariable loops correspond to those of a non-human immunoglobulin, and all or substantially all of the FRs are those of a human immunoglobulin sequence. The humanized antibody optionally will also comprise at least a portion of an immunoglobulin constant region (Fc) , typically that of a human immunoglobulin. See Jones et al., Nature 321: 522-525 (1986) ; Riechmann et al., Nature 332: 323-329 (1988) ; and Presta, Curr. Op. Struct. Biol. 2: 593-596 (1992) .
A “human” antibody may refer to an antibody having an amino acid sequence which corresponds to that of an antibody produced by a human and/or has been made using any of the techniques for making human antibodies as disclosed herein. Human antibodies can be produced using various techniques known in the art, including phage-display libraries. Hoogenboom and Winter, J. Mol. Biol., 227: 381 (1991) ; Marks et al., J. Mol. Biol., 222: 581 (1991) ; preparation of human monoclonal antibodies as described in Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985) ; Boerner et al., J. Immunol., 147 (1) : 86-95 (1991) ; and by administering the antigen to a transgenic animal that has been modified to produce such antibodies in response to antigenic challenge, but whose endogenous loci have been disabled, e.g., immunized xenomice (see, e.g., U.S. Pat. Nos. 6,075,181 and 6,150,584 regarding XENOMOUSETM technology) or chickens with human immunoglobulin sequence (s) (see, e.g., WO2012162422, WO2011019844, and WO2013059159) .
There are five major classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, and several of these can be further divided into subclasses (isotypes) , e.g., IgG1, IgG2, IgG3, IgG4, IgA1, IgA2. The heavy-chain constant domains that correspond to the different classes of immunoglobulins are called α, δ, ε, γ, and μ, respectively. The subunit structures and three-dimensional configurations of different classes of immunoglobulins are well known.
As used herein, the term “antibody fragment, ” and all grammatical variants thereof, are defined as a portion of an intact antibody comprising the antigen binding site or variable region of the intact antibody which, in certain instances, is free of the constant heavy chain domains (i.e. CH2, CH3, and/or CH4, depending on antibody isotype) of the Fc region of the intact antibody. Examples of antibody fragments include Fab, Fab’, Fab’-SH, F (ab’) 2, and Fv  fragments; diabodies; any antibody fragment that is a polypeptide having a primary structure consisting of one uninterrupted sequence of contiguous amino acid residues (referred to herein as a “single-chain antibody fragment” or “single chain polypeptide” ) , including without limitation (1) single-chain Fv (scFv) molecules, (2) single chain polypeptides containing only one light chain variable domain, or a fragment thereof that contains the three CDRs of the light chain variable domain, without an associated heavy chain moiety, and (3) single chain polypeptides containing only one heavy chain variable region, or a fragment thereof containing the three CDRs of the heavy chain variable region, without an associated light chain moiety; and multi-specific or multivalent structures formed from antibody fragments. In an antibody fragment comprising one or more heavy chains, the heavy chain (s) can contain any constant domain sequence (e.g. CH1 in the IgG isotype) found in a non-Fc region of an intact antibody, and/or can contain any hinge region sequence found in an intact antibody, and/or can contain a leucine zipper sequence fused to or situated in the hinge region sequence or the constant domain sequence of the heavy chain (s) .
Papain digestion of antibodies produces two identical antigen-binding fragments, called “Fab” fragments, each with a single antigen-binding site, and a residual “Fc” fragment, whose name reflects its ability to crystallize readily. Pepsin treatment yields an F (ab’) 2 fragment that has two antigen-combining sites and is still capable of cross-linking antigen. “Fv” is the minimum antibody fragment which contains a complete antigen-recognition and -binding site. In a two-chain Fv species, this region consists of a dimer of one heavy-and one light-chain variable domain in tight, non-covalent association. In a single-chain Fv species (scFv) , one heavy-and one light-chain variable domain can be covalently linked by a flexible peptide linker such that the light and heavy chains can associate in a “dimeric” structure analogous to that in a two-chain Fv species. It is in this configuration that the three CDRs of each variable domain interact to define an antigen-binding site on the surface of the VH-VL dimer. Collectively, the six CDRs confer antigen-binding specificity to the antibody. However, even a single variable domain (or half of an Fv comprising only three CDRs specific for an antigen) has the ability to recognize and bind antigen, although at a lower affinity than the entire binding site. See, e.g., Pluckthün, in The Pharmacology of Monoclonal Antibodies, Vol. 113, Rosenburg and Moore eds., Springer-Verlag, New York, pp. 269-315 (1994) .
The Fab fragment also contains the constant domain of the light chain and the first constant domain (CH1) of the heavy chain. Fab’ fragments differ from Fab fragments by the addition of a few residues at the carboxy terminus of the heavy chain CH1 domain including one or more cysteines from the antibody hinge region. Fab’-SH is the designation herein for Fab’ in which the cysteine residue (s) of the constant domains bear a free thiol group. F (ab’) 2 antibody fragments originally were produced as pairs of Fab’ fragments which have hinge cysteines  between them. Other chemical couplings of antibody fragments are also known.
As used herein, the term “monoclonal antibody” (mAb) refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigenic site. Each mAb is directed against a single determinant on the antigen. In addition to their specificity, the monoclonal antibodies are advantageous in that they can be synthesized by hybridoma culture, uncontaminated by other immunoglobulins. The modifier “monoclonal” indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method. For example, the monoclonal antibodies to be used in accordance with the present invention may be made in an immortalized B cell or hybridoma thereof, or may be made by recombinant DNA methods.
The monoclonal antibodies herein include hybrid and recombinant antibodies produced by splicing a variable (including hypervariable) domain of an CD47 antibody with a constant domain (e.g. “humanized” antibodies) , or a light chain with a heavy chain, or a chain from one species with a chain from another species, or fusions with heterologous proteins, regardless of species of origin or immunoglobulin class or subclass designation, as well as antibody fragments (e.g., Fab, F (ab’) 2, and Fv) , so long as they exhibit the desired biological activity.
The monoclonal antibodies herein specifically include chimeric antibodies (immunoglobulins) in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain (s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity.
As used herein, the term “treatment” refers to clinical intervention designed to alter the natural course of the individual or cell being treated during the course of clinical pathology. Desirable effects of treatment include decreasing the rate of disease progression, ameliorating, or palliating the disease state, and remission or improved prognosis. For example, an individual is successfully “treated” if one or more symptoms associated with cancer are mitigated or eliminated, including, but are not limited to, reducing the proliferation of (or destroying) cancerous cells, decreasing symptoms resulting from the disease, increasing the quality of life of those suffering from the disease, decreasing the dose of other medications required to treat the  disease, and/or prolonging survival of individuals. In some embodiments, “treating” a disease such as cancer refers to delaying progression of the disease, i.e., deferring, hindering, slowing, retarding, stabilizing, and/or postponing development of the disease (such as cancer) . This delay can be of varying lengths of time, depending on the history of the disease and/or individual being treated. As is evident to one skilled in the art, a sufficient or significant delay can, in effect, encompass prevention, in that the individual does not develop the disease. For example, a late stage cancer, such as development of metastasis, may be delayed.
An “effective amount” is at least the minimum amount required to effect a measurable improvement or prevention of a particular disease (e.g., cancer) . An effective amount herein may vary according to factors such as the disease state, age, sex, and weight of the patient, and the ability of a therapeutic agent (or combination of therapeutic agents) to elicit a desired response in the individual. An effective amount is also one in which any toxic or detrimental effects of the treatment are outweighed by the therapeutically beneficial effects. For therapeutic use, beneficial or desired results include clinical results such as decreasing one or more symptoms resulting from the disease, increasing the quality of life of those suffering from the disease, decreasing the dose of other medications required to treat the disease, enhancing effect of another medication such as via targeting, delaying the progression of the disease, and/or prolonging survival. In the case of cancer or tumor, an effective amount of the drug may have the effect in reducing the number of cancer cells; reducing the tumor size; inhibiting (i.e., slow to some extent or desirably stop) cancer cell infiltration into peripheral organs; inhibit (i.e., slow to some extent and desirably stop) tumor metastasis; inhibiting to some extent tumor growth; and/or relieving to some extent one or more of the symptoms associated with the disorder. An effective amount can be administered in one or more administrations. For purposes of this disclosure, an effective amount of drug, compound, or pharmaceutical composition is an amount sufficient to accomplish therapeutic treatment either directly or indirectly. As is understood in the clinical context, an effective amount of a drug, compound, or pharmaceutical composition may or may not be achieved in conjunction with another drug, compound, or pharmaceutical composition. Thus, an “effective amount” may be considered in the context of administering one or more therapeutic agents, and a single agent may be considered to be given in an effective amount if, in conjunction with one or more other agents, a desirable result may be or is achieved.
As used herein, the term “subject” for purposes of treatment refers to any animal classified as a mammal, including humans, domestic and farm animals, and zoo, sports, or pet animals, such as dogs, horses, cats, cows, etc. Preferably, the mammal is human.
All references cited herein, including patent applications and publications, are hereby incorporated by reference in their entirety.
Overview
The present application is based on the Applicant’s unexpected finding of a direct mechanistic link between activation of the KRAS signaling pathway, the PI3K signaling pathway, and/or the STAT signaling pathway and to cancer/tumor evasion of phagocytosis by macrophages. Applicant found mutations that activate the KRAS signaling pathway lead to the high expression of CD47 via the PI3K and STAT3 signaling pathways. In some embodiments, a mutation that activates the KRAS signaling pathway is a substitution in the amino acid KRAS, PI3K, and/or STAT3. In some embodiments, a mutation that activates the KRAS signaling pathway results in overexpression of pMEK, pAKT, and/or pSTAT3. In some embodiments, a mutation that activates the KRAS pathway results in in low level of miR-34a.
Methods of Treating Cancer
In some embodiments, provided herein is a method of treating cancer in an individual that comprises administering an effective amount of an agent (e.g., a therapeutic agent) that blocks the interaction between CD47 (e.g., hCD47) and SIRPα (e.g., hSIRPα) , wherein the cancer has been determined to comprise one or more cells that comprise a mutation that activates the KRAS signaling pathway. In some embodiments, the individual is a human. In some embodiments, provided herein, is a method of treating cancer in an individual that comprises (a) determining whether the cancer in the individual comprises one or more cells that comprise a mutation that activates the KRAS signaling pathway, and (b) administering an effective amount of an agent that blocks the interaction between CD47 and SIRPα to the individual who has been determined to have the cancer that comprises one or more cells that comprise a mutation that activates the KRAS signaling pathway. In some embodiments, provided is a method predicting whether an individual with cancer is likely respond to treatment with an agent that blocks the interaction between CD47 and SIRPα, the method comprising determining whether the cancer in the individual comprises one or more cells that comprise a mutation that activates the KRAS signaling pathway, wherein the presence of a mutation that activates the KRAS signaling pathway in one or more cells of the cancer indicates that the individual is likely to respond to the treatment. In some embodiments the individual is human. Also provided is a method of stimulating phagocytosis of a population of cancer cells comprising contacting the population with an effective amount of an agent (e.g., a therapeutic agent) that blocks the interaction between CD47 (e.g., hCD47) and SIRPα (e.g., hSIRPα) , wherein the population comprises one or more cells that comprise a mutation that activates the KRAS signaling pathway.
A cancer (or a population of cancer cells) that one or more cells that comprise a  mutation that activates the KRAS signaling pathway is alternatively referred to herein as “a KRAS associated cancer” or “a KRAS mutant cancer. ” In some embodiments, the KRAS mutant cancer is solid tumor. In some embodiments, the KRAS mutant cancer is selected from the group consisting of lung cancer (such as NSCLC) , pancreas cancer, colorectal cancer, gall bladder cancer, bile duct cancer, thyroid cancer, SCLC, colon cancer, small intestine cancer, appendiceal cancer, gastric cancer, esophageal cancer, bladder cancer, kidney cancer, liver cancer, breast cancer, ovarian cancer, teratocarcinoma, endometrial cancer, cervical cancer, prostate cancer, lymphoma, myeloma, leukemia, brain cancer, MPNST, neurofibromatosis, neuroblastoma, glioma, schwannomas seminoma astrocytoma, squamous cell carcinoma, fibrosarcoma, rhabdomyosarcoma, osteosarcoma, Kaposi’s sarcoma and keratoacanthoma.
As used herein, a “mutation that activates the KRAS signaling pathway” refers to any mutation that results in the activation of the KRAS signaling pathway or a signaling pathway upstream or downstream of KRAS. Such mutations include, but are not limited to, mutations in the amino acid sequence of the KRAS protein.
In some embodiments, the mutation that activates the KRAS signaling pathway is a substitution in the amino acid sequence of a KRAS protein (e.g., a human KRAS protein, such as set forth in SEQ ID NO: 37 or 38) that ‘locks’ KRAS in a constitutively active state, which therefore results in ligand-independent activation of KRAS signaling. In some embodiments, the mutation that activates the KRAS signaling pathway is an amino acid substitution at position 12 relative to a wild type KRAS set forth in SEQ ID NO: 37 or SEQ ID NO: 38. In some embodiments, the substitution is selected from the group consisting of: G12C, G12D, G12V, G12W, G12R, and G12A. In some embodiments, the wild type KRAS is a wild type human KRAS comprising SEQ ID NO: 37 or SEQ ID NO: 38.
In some embodiments, the mutation that activates the KRAS signaling pathway is a mutation that activates a signaling pathway downstream of the KRAS signaling pathway. In some embodiments, the mutation that activates the KRAS signaling pathway is a mutation activates the PI3K signaling pathway. In some embodiments, the mutation is a substitution in the amino acid sequence of a p110α subunit of PI3K (or “PIK3CA, ” e.g., a human PIK3CA protein, such as set forth in SEQ ID NO: 41) . In some embodiments, the mutation is an amino acid substitution at position 345, 542, 545, or 1047 relative to a wild type PIK3CA set forth in SEQ ID NO: 41. In some embodiments, the mutation is selected from the group consisting of: N345K, E542K, E545K, H1047L, and H1047R relative to a wild type PIK3CA set forth in SEQ ID NO: 41. In some embodiments, the wild type PIK3CA is a wild type human PIK3CA comprising SEQ ID NO: 41. In some embodiments, the mutation that activates the PI3K signaling pathway is a PTEN loss of function mutation.
As noted above, in some embodiments, the mutation that activates the KRAS signaling pathway is a mutation that activates a signaling pathway downstream of the KRAS signaling pathway. In some embodiments, the mutation that activates the KRAS signaling pathway is a mutation activates the STAT signaling pathway. In some embodiments, the mutation is a substitution in the amino acid sequence of a STAT3 protein (e.g., a human STAT3 protein, such as set forth in SEQ ID NO: 42) . In some embodiments, the mutation is an amino acid substitution at position 174, 392, 427, 646, 658, 705, or 716 relative to a wild type STAT3 set forth in SEQ ID NO: 42. In some embodiments, the mutation is selected from the group consisting of: F174A, K392K, D427H, K392R, N646K, K658N, T705F, and T716M relative to a wild type STAT3 set forth in SEQ ID NO: 42. In some embodiments, the wild type STAT3 is a wild type human PIK3CA comprising SEQ ID NO: 42.
In some embodiments, the mutation that activates the KRAS signaling pathway (e.g., an amino acid substitution mutation in a KRAS protein, am amino acid substitution mutation in a PIK3CA protein, and/or an amino acid substitution in a STAT3 protein) is a germline mutation. In some embodiments, the germline mutation is detected in one or more cells from a blood sample or buccal sample from the individual. In some embodiments, the mutation that activates the KRAS signaling pathway (e.g., an amino acid substitution mutation in a KRAS protein, an amino acid substitution mutation in a PIK3CA protein, and/or an amino acid substitution in a STAT3 protein) is a somatic mutation. In some embodiments, the somatic mutation is detected in one or more cells from a sample of cancer cells from the individual.
In some embodiments, the presence of the mutation that activates the KRAS signaling pathway (e.g., the presence of an amino acid substitution mutation in the amino acid sequence of KRAS, PI3K, and/or STAT3) is determined via, e.g., nucleic acid sequencing, polymerase chain reaction (PCR) , fluorescence in situ hybridization (FISH) , or denaturing high performance liquid chromatography (DHPLC) . Details regarding these techniques are provided in e.g., Wu et al. (2015) Chem. Soc. Rev. 44, 2963-2997.
In some embodiments, the mutation that activates the KRAS signaling pathway results in altered expression levels of one or more proteins in the KRAS signaling pathway and/or of one or more proteins in a pathway downstream of the KRAS signaling pathway. In some embodiments, the mutation that activates the KRAS signaling pathway results in the overexpression of the MEK protein (pMEK) . In some embodiments, the individual (such as the one or more cancer cells in a sample from the individual) is considered to overexpress pMEK when the expression level of pMEK in a sample comprising the cancer cells from the individual is higher than the expression level of pMEK in a reference sample from a healthy individual (e.g., an individual who does not have cancer) . In some embodiments, the mutation that activates the  KRAS signaling pathway results in overexpression of the AKT protein (pAKT) In some embodiments, the individual (such as the one or more cancer cells in a sample from the individual) is considered to overexpress pAKT when the expression level of pAKT in a sample comprising the cancer cells from the individual is higher than the expression level of pAKT in a reference sample from a healthy individual (e.g., an individual who does not have cancer) . In some embodiments, the mutation that activates the KRAS signaling pathway results in overexpression of a STAT3 protein (pSTAT3) . In some embodiments, the individual (such as the one or more cancer cells in a sample from the individual) is considered to overexpress pSTAT3 when the expression level of pSTAT3 in a sample comprising the cancer cells from the individual is higher than the expression level of pSTAT3 in a reference sample from a healthy individual (e.g., an individual who does not have cancer) . In some embodiments, the presence of the mutation that activates the KRAS signaling pathway (e.g., a mutation that results in the overexpression of pMEK, pAKT, and/or pSTAT3) is determined via, e.g., Western blot, ELISA, or immunofluorescence.
In some embodiments, the mutation that activates the KRAS signaling pathway results in altered expression levels of one or more microRNAs in the KRAS signaling pathway and/or of one or more microRNAs in a pathway downstream of the KRAS signaling pathway. In some embodiments, the mutation that activates the KRAS signaling pathway results in low level of microRNA-34a (miR-34a) . In some embodiments, the individual (such as the one or more cancer cells in a sample from the individual) is considered to have low level of miR-34a when the expression level of the miR-34a in a sample comprising the cancer cells from the individual is lower than the expression level of the miR-34a in a reference sample from a healthy individual (e.g., an individual who does not have cancer) . In some embodiments, the presence of the mutation that activates the KRAS signaling pathway (e.g., a mutation that results in the low level of miR-34a) is determined via quantitative reverse transcription-polymerase chain reaction (RT-PCR) , Northern blot, in situ hybridization, and/or nuclease protection assay.
In some embodiment, “sample” refers to a composition that is obtained or derived from the individual that contains a cellular and/or other molecular entity that is to be characterized and/or identified, for example based on physical, biochemical, chemical and/or physiological characteristics. For example, the phrase “sample comprising cancer cells” and variations thereof refers to any sample obtained from a subject of interest that would be expected or is known to contain the cellular and/or molecular entity that is to be characterized. A sample can be a biological sample (such as an ex vivo biological sample) of biological tissue or fluid that contains cancer cells and/or tumor cells from the subject from which nucleic acids (such as polynucleotides, e.g., genomic DNA and/or transcripts) and/or polypeptides can be isolated.  Such samples are typically from a human subject, but include tissues isolated from other subjects (such any animal classified as a mammal, as described elsewhere herein. A sample may also include sections of tissues such as biopsy and autopsy samples, frozen sections taken for histologic purposes, etc. Samples may include fresh samples from the individual or preserved tissue samples, such as a formalin-fixed paraffin-embedded (FFPE) samples. Samples also include explants and primary and/or transformed cell cultures derived from the individual’s tissues. In some embodiments, “sample” refers to a collection of similar cells obtained from a tissue of an individual. The source of the tissue or cell sample may be solid tissue as from a fresh, frozen and/or preserved organ or tissue sample or biopsy or aspirate; blood or any blood constituents; bodily fluids such as cerebral spinal fluid, amniotic fluid, peritoneal fluid, or interstitial fluid; cells from any time in gestation or development of the subject. The tissue sample may also be primary or cultured cells or cell lines. In some embodiments, the sample is obtained from a disease tissue/organ (e.g., a cancerous tissue or organ) . In some embodiments, sample contains compounds which are not naturally intermixed with the tissue in nature such as preservatives, anticoagulants, buffers, fixatives, nutrients, antibiotics, or the like.
In some embodiments, the agent that blocks the interaction between CD47 (e.g., hCD47) and SIRPα (e.g., hSIRPα) is a polypeptide. In some embodiments, the agent that blocks the interaction between CD47 (e.g., hCD47) and SIRPα (e.g., hSIRPα) is a polypeptide that binds CD47 (e.g., hCD47) . In some embodiments, the polypeptide is or comprises an anti-CD47 antibody, an immunologically active fragment thereof, or an antibody-based construct (such as a multispecific construct, e.g., a bispecific antibody) . Exemplary anti-CD47 antibodies that find use with the methods are described in further detail below.
Exemplary Anti-CD47 Antibodies
An anti-CD47 antibody (or an immunologically active fragment thereof) is an antibody that binds to CD47 (e.g., human CD47 or “hCD47” ) with sufficient affinity and specificity. As used herein, an “immunologically active fragment” of an antibody refers to an antigen-binding fragment of said antibody. The terms “immunologically active fragment” and “antigen-binding fragment” are used interchangeably herein. In some embodiments, the anti-CD47 antibody (or immunologically active fragment thereof) is a chimeric (such as humanized) monoclonal antibody (or immunologically active fragment thereof) . In some embodiments, the anti-CD47 antibody is 5F9 (also known as Hu5F9-G4 and magrolimab) , which is under development by Gilead Sciences/Forty Seven, Inc.; CC-90002 (also known as INBRX103) , which is under development by Celgene; LQ001, which is under development by Novamab; HLX24, which is under development by Henlius; TI-061, which is under development by Arch  Oncology (formerly Tioma Therapeutics) ; AO-176, which is under development by Arch Oncology; SRF-231, which is under development by Surface Oncology; IBI-188, which is under development by Innovent Bio; AK117, which is under development by Akesobio; IMC-002, which is under development by ImmuneOncia Therapeutics 3D Medicines; SHR-1603, which is under development by Jiangsu HengRui Medicine; STI-6643, which is under development by Sorrento Therapeutics Inc.; or ZL-1201, which is under development by Zai Lab. In some embodiments, the immunologically active fragment of the anti-CD47 antibody is an immunologically active fragment thereof anti-CD47 antibodies. Additional details about these exemplary anti-CD47 antibodies can be found in, e.g., Jiang et al. (2021) J Hematol Oncol 14: 180 doi (dot) org/10 (dot) 1186/s13045-021-01197-w; WO 2011/143624A2, USP 9, 382, 320 B2.
In some embodiments, the anti-CD47 antibody (or immunologically active fragment thereof) comprises a heavy chain variable domain (VH) , and/or a light chain variable domain (VL) of described herein below.
In some embodiments, the anti-CD47 antibody (or immunologically active fragment thereof) comprises a (a) VH domain that comprises (1) a CDR-H1 comprising RAWMN (SEQ ID NO: 5) ; (2) a CDR-H2 comprising RIKRKTDGETTDYAAPVKG (SEQ ID NO: 6) ; (3) a CDR-H3 comprising SNRAFDI (SEQ ID NO: 7) and (b) a VL domain that comprises (1) a CDR-L1 comprising KSSQSVLYAGNNRNYLA (SEQ ID NO: 8) ; (2) a CDR-L2 comprising QASTRAS (SEQ ID NO: 9) ; and (3) a CDR-L3 comprising QQYYTPPLA (SEQ ID NO: 10) . In some embodiments, the CDR sequences are defined according to Kabat (see, e.g., (Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. (1991) ) . In some embodiments, the anti-CD47 antibody (or immunologically active fragment thereof) comprises a (a) VH domain that comprises (1) a CDR-H1 comprising GLTFERA (SEQ ID NO: 11) ; (2) a CDR-H2 comprising KRKTDGET (SEQ ID NO: 12) ; (3) a CDR-H3 comprising SNRAFDI (SEQ ID NO: 7) and (b) a VL domain that comprises (1) a CDR-L1 comprising KSSQSVLYAGNNRNYLA (SEQ ID NO: 14) ; (2) a CDR-L2 comprising QASTRAS (SEQ ID NO: 15) ; and (3) a CDR-L3 comprising QQYYTPPLA (SEQ ID NO: 16) . In some embodiments, the CDR sequences are defined according to the Chothia numbering system (see, e.g., Chothia and Lesk (1986) EMBO J. 5 (4) : 823-6 and Al-Lazikani et al., (1997) JMB 273: 927-948) . In some embodiments, the anti-CD47 antibody (or immunologically active fragment thereof) comprises a (a) VH domain that comprises (1) a CDR-H1 comprising GLTFERAW (SEQ ID NO: 17) ; (2) a CDR-H2 comprising IKRKTDGETT (SEQ ID NO: 18) ; (3) a CDR-H3 comprising AGSNRAFDI (SEQ ID NO: 19) and (b) a VL domain that comprises (1) a CDR-L1 comprising QSVLYAGNNRNY (SEQ ID NO: 20) ; (2) a CDR-L2 comprising QAS (SEQ ID NO: 21) ; and (3) a CDR-L3 comprising QQYYTPPLA (SEQ ID NO:  22) . In some embodiments, the CDR sequences are defined according to the IMGT numbering system (see, e.g., Lefranc MP. (2013) IMGT Unique Numbering. In: Dubitzky W., Wolkenhauer O., Cho KH., Yokota H. (eds) Encyclopedia of Systems Biology. Springer, New York, NY; https: //doi. org/10.1007/978-1-4419-9863-7_127) . In some embodiments, the anti-CD47 antibody (or immunologically active fragment thereof) comprises a (a) VH domain that comprises (1) a CDR-H1 comprising GLTFERAWMN (SEQ ID NO: 23) ; (2) a CDR-H2 comprising RIKRKTDGETTD (SEQ ID NO: 24) ; (3) a CDR-H3 comprising SNRAFDI (SEQ ID NO: 25) and (b) a VL domain that comprises (1) a CDR-L1 comprising KSSQSVLYAGNNRNYLA (SEQ ID NO: 26) ; (2) a CDR-L2 comprising QASTRAS (SEQ ID NO: 27) ; and (3) a CDR-L3 comprising QQYYTPPLA (SEQ ID NO: 28) . In some embodiments, the CDR sequences are defined according to the AbM numbering system (see, e.g., Abhinandan R.K., Martin A.C. Analysis and improvements to Kabat and structurally correct numbering of antibody variable domains. Mol. Immunol. 2008; 45: 3832–3839. doi: 10.1016/j. molimm. 2008.05.022) . In some embodiments, the anti-CD47 antibody (or immunologically active fragment thereof) comprises (a) VH domain that comprises (1) a CDR-H1 comprising ERAWMN (SEQ ID NO: 29) ; (2) a CDR-H2 comprising WVGRIKRKTDGETTD (SEQ ID NO: 30) ; (3) a CDR-H3 comprising AGSNRAFD (SEQ ID NO: 31) and (b) a VL domain that comprises (1) a CDR-L1 comprising LYAGNNRNYLAWY (SEQ ID NO: 32) ; (2) a CDR-L2 comprising LLINQASTRA (SEQ ID NO: 33) ; and (3) a CDR-L3 comprising QQYYTPPL (SEQ ID NO: 34) . In some embodiments, the CDR sequences are defined according to the Contact numbering system (see, e.g., McCallum et al. (1996) J Mol Biol. 262 (5) : 732-45; doi: 10.1006/jmbi. 1996.0548) .
For ease of reference, the amino acid sequences of SEQ ID NOs: 5-34 and are provided in Table A below.
Table A


In some embodiments, the anti-CD47 antibody (or immunologically active fragment thereof) comprises 3 CDRs of a VH domain comprising SEQ ID NO: 1. Additionally or alternatively, in some embodiments, the anti-CD47 antibody (or immunologically active fragment thereof) comprises 3 CDRs of a VL domain comprising SEQ ID NO: 2. In some embodiments, the 3 CDRs of the VH domain are CDRs according to Kabat, Chothia, AbM or Contact numbering system. Additionally or alternatively, in some embodiments, the 3 CDRs of the VL domain are CDRs according to Kabat, Chothia, AbM or Contact numbering system. In some embodiments, the N-terminal amino acid of the VH domain of the anti-CD47 antibody (or immunologically active fragment thereof) is E, and, optionally, in some embodiments, the C-terminal amino acid of the VH domain of the anti-CD47 antibody (or immunologically active fragment thereof) is S.
In some embodiments, the anti-CD47 antibody (or immunologically active fragment thereof) comprises a heavy chain variable domain (VH) comprising an amino acid sequence that has at least about 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to an amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the N-terminal amino acid of the VH domain that has at least about 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to an amino acid sequence set forth in SEQ ID NO: 1 is E. Additionally or alternatively, in some embodiments, the C-terminal amino acid of the VH domain that has at least about 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to an amino acid sequence set forth in SEQ ID NO: 1 is S. In some embodiments, the N-terminal amino acid of the VH domain of the anti-CD47 antibody (or immunologically active fragment thereof) corresponds to position H1 according to the Kabat numbering system, and the C-terminal amino acid of the VH domain of the anti-CD47 antibody (or immunologically active fragment thereof) corresponds to position H113 according to the Kabat numbering system. In some embodiments, the N-terminal amino acid of the VH domain of the anti-CD47 antibody (or immunologically active fragment thereof) corresponds to position H1 according to the Chothia numbering system, and the C-terminal amino acid of the VH domain of the anti-CD47 antibody (or immunologically active fragment thereof) corresponds to position H113 according to the Chothia numbering system. In some embodiments, the N-terminal amino acid of the VH domain of the anti-CD47 antibody (or immunologically active fragment thereof) corresponds to position H1 according to the IMGT numbering system, and the C-terminal amino acid of the VH domain of the anti-CD47 antibody (or immunologically active  fragment thereof) corresponds to position H128 according to the IMGT numbering system. In some embodiments, the N-terminal amino acid of the VH domain of the anti-CD47 antibody (or immunologically active fragment thereof) corresponds to amino acid 1 of SEQ ID NO: 1, and the C-terminal amino acid of the VH domain the anti-CD47 antibody (or immunologically active fragment thereof) corresponds to amino acid 118 of SEQ ID NO: 1. In some embodiments, the anti-CD47 antibody comprises (such as further comprises) a light chain variable domain (VL) comprising an amino acid sequence that has at least about 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to an amino acid sequence set forth in SEQ ID NO: 2. In some embodiments, the anti-CD47 antibody comprises a VH comprising SEQ ID NO: 1 and a VL comprising SEQ ID NO: 2. The amino acid sequences of SEQ ID NOs: 1 and 2 are provided below:
In some embodiments, the anti-CD47 antibody is a full length antibody. In some embodiments, the full length antibody comprises a human Fc region. In some embodiments, the human Fc region is an IgG1, IgG2, or IgG4 Fc region. In some embodiments, the full length anti-CD47 antibody comprises a human IgG4 Fc region or a variant thereof that comprises an S228P substitution, wherein amino acid numbering is according to the EU index. In some embodiments, the full length anti-CD47 antibody comprises a heavy chain comprising the amino acid SEQ ID NO: 3 and a light chain comprising the amino acid sequence of SEQ ID NO: 4. In some embodiments, the full length anti-CD47 antibody is a full length antibody that comprises a heavy chain comprising the amino acid SEQ ID NO: 35 and a light chain comprising the amino acid sequence of SEQ ID NO: 4. In some embodiments, the anti-CD47 antibody is lemzoparlimab (also known as TJ011133) .

The anti-CD47 antibody that binds specifically to hCD47 can be of any of the various types of antibodies as defined above, but is, in certain embodiments, a human, humanized, or chimeric antibody. In some embodiments, the anti-CD47 antibody is a human antibody. In some embodiments, the anti-CD47 is a humanized antibody that comprises a human antibody constant domain (e.g., a human Fc domain, such as a human IgG Fc domain, e.g., a human IgG1, a human IgG2, a human IgG3, or a human IgG4 Fc domain, or a variant of a human IgG4 Fc domain that comprises an S228P substitution, wherein amino acid numbering is according to the EU index. ) . In some embodiments, the anti-CD47 antibody is a chimeric antibody. See, e.g., U.S. Patent No. 4,816,567 and Morrison et al., Proc. Natl. Acad. Sci. USA, 81: 6851-6855 (1984) . In some embodiments, the chimeric anti-CD47 antibody comprises a non-human variable region (e.g., a variable region derived from a chicken, mouse, rat, hamster, rabbit, or non-human primate, such as a monkey) and a human constant region. In some embodiments, a chimeric antibody is a “class switched” antibody in which the class or subclass has been changed from that of the parent antibody. Chimeric antibodies include antigen-binding fragments thereof.
In some embodiments, a chimeric antibody is a humanized antibody. A non-human antibody can be humanized to reduce immunogenicity to humans, while retaining the specificity and affinity of the parental non-human antibody. Generally, a humanized antibody comprises one or more variable domains in which HVRs, e.g., CDRs, (or portions thereof) are derived from a non-human antibody (e.g., a chicken antibody) , and FRs (or portions thereof) are derived from human antibody sequences. A humanized antibody optionally will also comprise at least a portion of a human constant region. In some embodiments, some FR residues in a humanized antibody are substituted with corresponding residues from a non-human antibody (e.g., the antibody from which the HVR or CDR residues are derived) , e.g., to restore or improve antibody specificity or affinity. Humanized antibodies and methods of making them are reviewed, e.g., in Almagro and Fransson, Front. Biosci. 13: 1619-1633 (2008) .
Human framework regions useful for humanization include but are not limited to: framework regions selected using the “best-fit” method; framework regions derived from the consensus sequence of human antibodies of a particular subgroup of light or heavy chain variable  regions; human somatically mutated framework regions or human germline framework regions; and framework regions derived from screening FR libraries. See, e.g., Sims et al. J. Immunol. 151 : 2296 (1993) ; Carter et al. Proc. Natl. Acad. Sci. USA, 89: 4285 (1992) ; Presta et al. J. Immunol., 151: 2623 (1993) ; Almagro and Fransson, Front. Biosci. 13: 1619-1633 (2008) ; and Baca et al., J. Biol. Chem. 272: 10678-10684 (1997) .
In some embodiments, an anti-CD47 antibody of the present disclosure is a human antibody. Human antibodies can be produced using various techniques known in the art. In some embodiments, the human antibody is produced by a non-human animal, such as the genetically engineered chickens (see, e.g., US Pat. Nos. 8,592,644; and 9,380,769) and/or mice described herein. Human antibodies are described generally in Lonberg, Curr. Opin. Immunol. 20: 450-459 (2008) .
In some embodiments, an anti-CD47 antibody of the present disclosure is an antibody fragment (e.g., an immunologically active fragment) , including without limitation a Fab, F (ab’) 2, Fab’-SH, Fv, or scFv fragment, or a single domain, single heavy chain, or single light chain antibody. As used herein, an “immunologically active fragment” of an antibody refers to an antigen-binding fragment of said antibody. The terms “immunologically active fragment” and “antigen-binding fragment” are used interchangeably herein. Antibody fragments can be generated, e.g., by enzymatic digestion or by recombinant techniques. In some embodiments, Proteolytic digestion of an intact antibody is used to generate an antibody fragment, e.g., as described in Morimoto et al., Journal of Biochemical and Biophysical Methods 24: 107-117 (1992) and Brennan et al., Science, 229: 81 (1985) . In some embodiments, an antibody fragment is produced by a recombinant host cell. For example, Fab, Fv and ScFv antibody fragments are expressed by and secreted from E. coli. Antibody fragments can alternatively be isolated from an antibody phage library. Other methods of generating immunologically active fragments of an antibody are well-known in the art.
In some embodiments, the anti-CD47 antibody (or immunologically active fragment thereof) specifically recognizes (such as binds) to hCD47 expressed on the surface of a cell. In some embodiments, the anti-CD47 antibody specifically recognizes hCD47 expressed on the surface of a cancer cell, e.g., a KRAS mutant cancer cell (such as a non-small cell lung cancer (NSCLC) cell, pancreas cancer cell, colorectal cancer cell, gall bladder cancer cell, bile duct cancer cell, thyroid cancer cell, head and neck cancer cell, SCLC cell, colon cancer cell, small intestine cancer cell, appendiceal cancer cell, gastric cancer cell, esophageal cancer cell, bladder cancer cell, kidney cancer cell, liver cancer cell, breast cancer cell, ovarian cancer cell, teratocarcinoma cell, endometrial cancer cell, cervical cancer cell, prostate cancer cell, lymphoma cell, myeloma cell, leukemia cell, brain cancer cell, MPNST cell, neurofibromatosis cell,  neuroblastoma cell, glioma cell, schwannomas seminoma astrocytoma cell, squamous cell carcinoma cell, fibrosarcoma cell, rhabdomyosarcoma cell, osteosarcoma cell, Kaposi’s sarcoma cell and keratoacanthoma cell.
In some embodiments, the binding of an anti-CD47 antibody (or immunologically active fragment thereof) described herein to hCD47 (e.g., hCD47 expressed on the surface of a cell) prevents the interaction of hCD47 with signal regulatory protein alpha (SIRPα) , such as human SIRPα ( “hSIRPα” ) . In some embodiments, the binding of an anti-CD47 antibody (or immunologically active fragment thereof) described herein to hCD47 expressed on the surface of a cancer cell (e.g., a KRAS mutant cancer cell) promotes macrophage mediated phagocytosis of the cancer cell.
Further details about exemplary anti-CD47 antibodies that may be used with the methods of treating a KRAS mutant cancer cell, including pharmaceutical formulations comprising same, exemplary dosages, and exemplary administration schedules, are provided in PCT/CN2021/123892. Further details about methods of producing/manufacturing anti-CD47 antibodies described herein are provided in PCT/CN2021/123892.
KRAS and Exemplary KRAS mutant Inhibitors
KRAS, a member of the RAS family, is a key regulator of signaling pathways responsible for cell proliferation, differentiation, and survival. See, e.g., Cox et al. (2003) Nat Rev Drug Discov. 13 (11) : 828-851 and Downward J. (2003) Nat Rev Cancer. 3 (1) : 11-22. KRAS mutations are present in approximately 25%of tumors, making them one of the most common gene mutations linked to cancer. They are frequent drivers in lung, colorectal and pancreatic cancers. KRAS drives 32%of lung cancers, 40%of colorectal cancers, and 85%to 90%of pancreatic cancer cases. G12C, G12D and G12R are some of the most common KRAS mutations, based on the specific mutations that are present. At the molecular level, KRAS proteins with activating mutations abrogate the GTPase activity and are locked in the GTP-bound hyperactive state, leading to constitutive activation of downstream pro-proliferative and pro-survival pathways such as RAF-MEK-ERK and PI3K-AKT. An emerging and exciting new direction may come from recent advances in our understanding of the relationship between KRAS mutations and tumor immune evasion. The present application reveals a direct mechanistic link between active KRAS and innate immune evasion and identify CD47 as a major effector underlying KRAS-mediated immunosuppressive tumor microenvironment, thereby provides novel methods for treating KRAS mutant cancer.
The term “KRAS mutation” refers to a mutation in the KRAS protein, especially a KRAS oncogenic mutation. “KRAS oncogenic mutation” refers to a KRAS mutation causing a  cancer or promoting cancer development, such as a KRAS mutation that results in a reduced ability of KRAS protein to catalyze the hydrolysis of guanosine triphosphate (GTP) to guanosine diphosphate (GDP) . “Reduced ability of KRAS protein to catalyze the hydrolysis of guanosine triphosphate (GTP) to guanosine diphosphate (GDP) ” includes hindering the binding of KRAS to GTPase activating proteins (GAPs) and/or promoting the binding of KRAS to guanine nucleotide exchange factors (GEFs) . Such KRAS oncogenic mutations include, but are not limited to G12D, G12C, G12V, G12R, G12A, and G12W.
The term “KRAS G12D inhibitor” as used herein refers to any agent, e.g., polypeptide, fusion polypeptide, antibody, peptide, antisense oligonucleotide, or small molecule drug that inhibits the activity of the KRAS G12D mutant protein. In some embodiments, the KRAS G12D inhibitor interacts directly with the KRAS G12Dmutant protein to inhibit the protein’s activity. In some embodiments, the KRAS G12D inhibitor is a small molecule drug. Exemplary small molecule KRAS G12D inhibitors that find use with the methods provided herein include, without limitation, e.g., MRTX1133 (Mirati) , iExosomes (MD Anderson) and mRNA-5671 (Moderna) . Other exemplary small molecule KRAS G12D inhibitors are described in, e.g., WO2021041671A1, WO2022015375A1, the contents of which are incorporated herein by reference in their entireties.
In some embodiments, the KRAS G12D inhibitor is MRTX1133, which is currently under development by Mirati. MRTX1133 is a noncovalent, potent, and selective KRAS G12D inhibitor. MRTX1133 fills the switch II pocket and extends three substituents to favorably interact with the protein, resulting in an estimated KD against KRAS G12D of 0.2 pM. It prevents SOS1-catalyzed nucleotide exchange and/or formation of the KRAS G12D/GTP/RAF1 complex, thereby inhibiting mutant KRAS-dependent signal transduction. In vitro and in vivo studies show that MRTX1133 has nanomolar activity in tumor models harboring KRAS G12D mutations.
The CAS Registry Number for MRTX1133 is 2621928-55-8. MRTX1133 is described chemically as 2-Naphthalenol, 4- [4- (3, 8-diazabicyclo [3.2.1] oct-3-yl) -8-fluoro-2- [ [ (2R, 7aS) -2-fluorotetrahydro-1H-pyrrolizin-7a (5H) -yl] methoxy] pyrido [4, 3-d] pyrimidin-7-yl] -5-ethynyl-6-fluoro-and has the following chemical structure:
The term “miR-34a mimic” is a molecule capable of mimicking the activity of endogenous miR-34a. MiR-34a mimic can be double-stranded, single-stranded, or hairpin. An miRNA mimic can be modified (e.g. chemically) to have more or less activity than their endogenous equivalent (e.g. through greater resistance to degradation) . In some embodiments, a miR-34a mimic comprises a sequence of a mature miR-34a. In some embodiments, the sequence of a mature miR-34a comprises SEQ ID NO: 39, from 5’ to 3’. In some embodiments, miR-34a mimics comprise vectors or polynucleotides which encode a miR-34a. In some embodiments, an miR-34a mimics also comprise pri-miR-34a, pre-miR-34a, double-stranded nucleotide comprising mature-miR-34a, artificial mature-miR-34a, single-strand mature-miR-34a expressed from the 5′-end of a pre-miRNA, or a single-strand mature-miRNA expressed from the 3′-end of a pre-miRNA. Exemplary miR-34a mimics are RNA4TNBC created by Protheragen Inc, MRX-34 created by Mirna Therapeutics Inc, and those described in WO-2006137941, WO-2011088309, WO-2008104974, WO-2014203189. In this application, unless otherwise specified, the miR-34a is miR-34a-5p.
Exemplary Methods
In one aspect, provided herein is a method of treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of an agent that blocks the interaction between CD47 and SIRPα, wherein the tumor is mediated by a KRAS mutation in the subject.
In some embodiments of the methods of treatment, the KRAS mutation occurs at residue 12 of the amino acid sequence of KRAS protein, as set forth in SEQ ID NO. 37 or SEQ ID NO. 38. In some embodiments, the KRAS mutation is selected from the group consisting of G12C, G12D, G12V, G12W, G12R, and G12A mutation. In some embodiments, the KRAS mutation is G12D mutation. In some embodiments, the KRAS mutation is G12V mutation.
In some embodiments of the method of treatment, the agent that blocks the interaction between CD47 and SIRPα is anti-CD47 antibody or immunologically active fragment thereof. In  some embodiments, the anti-CD47 antibody or immunologically active fragment thereof is CC-90002, 5F9, LQ001, HLX24, TI-061, AO-176, SRF-231, IBI-188, IMC-002, SHR-1603, STI-6643, ZL-1201, or an immunologically active fragment thereof. In some embodiments, the anti-CD47 antibody or immunologically active fragment thereof comprises three complementarity determining regions (CDRs) of a heavy chain variable domain (VH) set forth in SEQ ID NO: 1 and three CDRs of a light chain variable domain (VL) set forth in SEQ ID NO: 2.
In some embodiments, the anti-CD47 antibody or immunologically active fragment thereof comprises: (a) a VH that comprises (1) a CDR-H1 comprising RAWMN (SEQ ID NO: 5) ; (2) a CDR-H2 comprising RIKRKTDGETTDYAAPVKG (SEQ ID NO: 6) ; and (3) a CDR-H3 comprising SNRAFDI (SEQ ID NO: 7) and (b) a VL that comprises (1) a CDR-L1 comprising KSSQSVLYAGNNRNYLA (SEQ ID NO: 8) ; (2) a CDR-L2 comprising QASTRAS (SEQ ID NO: 9) ; and (3) a CDR-L3 comprising QQYYTPPLA (SEQ ID NO: 10) , wherein the CDR sequences are defined according to the Kabat numbering system.
In some embodiments, the anti-CD47 antibody or immunologically active fragment thereof comprises a VH domain and a VL domain, wherein the VH domain of the anti-CD47 antibody or immunologically active fragment thereof comprises an amino acid sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identity to SEQ ID NO: 1, and the VL of the anti-CD47 antibody or immunologically active fragment thereof comprises an amino acid sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%identity to SEQ ID NO: 2. In some embodiments, the VH domain of the anti-CD47 antibody or immunologically active fragment thereof comprises an amino acid sequence of SEQ ID NO: 1, and the VL of the anti-CD47 antibody or immunologically active fragment thereof comprises an amino acid sequence of SEQ ID NO: 2.
In some embodiments, the anti-CD47 antibody is a full length antibody. In some embodiments, the full length anti-CD47 antibody comprises a heavy chain that comprises an amino acid sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identity to SEQ ID NO: 3 or SEQ ID NO: 35; and a light chain that comprises an amino acid sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identity to SEQ ID NO: 4.
In some embodiments, provided herein is a method of treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of anti-CD47 antibody or immunologically active fragment thereof of the present application, wherein the tumor is mediated by a KRAS G12D mutation in the subject. In some embodiments, provided herein is a method of treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of anti-CD47 antibody or immunologically active fragment thereof of the present application, wherein the tumor is mediated by a KRAS G12V mutation in the subject. In  some embodiments, provided herein is a method of treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of anti-CD47 antibody or immunologically active fragment thereof of the present application, wherein the tumor is mediated by a KRAS G12W mutation in the subject. In some embodiments, provided herein is a method of treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of anti-CD47 antibody or immunologically active fragment thereof of the present application, wherein the tumor is mediated by a KRAS G12R mutation in the subject. In some embodiments, provided herein is a method of treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of anti-CD47 antibody or immunologically active fragment thereof of the present application, wherein the tumor is mediated by a KRAS G12A mutation in the subject.
In some embodiments of the methods of treatment, the method further comprises administrating the subject an effective amount of a second agent for treating a tumor comprising a cell with a KRAS mutation. In some embodiments, the second agent is a KRAS G12D inhibitor, or a miR-34a mimic. In some embodiments, the KRAS G12D inhibitor is selected from the group consisting of MRTX1133 (Mirati) , iExosomes (MD Anderson) and mRNA-5671 (Moderna) . In some embodiments, the KRAS G12D inhibitor is MRTX1133. In some embodiments, the KRAS G12D inhibitor comprises a structure of:
In some embodiments, provided herein is a method of treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of anti-CD47 antibody or immunologically active fragment thereof of the present application and a KRAS G12D inhibitor, wherein the tumor is mediated by a KRAS G12D mutation in the subject. In some embodiments, provided herein is a method of treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of anti-CD47 antibody or immunologically active fragment thereof of the present application and a KRAS G12D inhibitor comprising the structure below:
wherein the tumor is mediated by a KRAS G12D mutation in the subject.
In some embodiments of the methods of treatment, the agent that blocks the interaction between CD47 and SIRPα such as anti-CD47 antibody or immunologically active fragment thereof of the present application and the second agent such as the KRAS G12D inhibitor are administered simultaneously. In some embodiments of the methods of treatment, the agent that blocks the interaction between CD47 and SIRPα such as anti-CD47 antibody or immunologically active fragment thereof of the present application and the second agent such as the KRAS G12D inhibitor are administered sequentially. In some embodiments of the methods of treatment, the agent that blocks the interaction between CD47 and SIRPα such as anti-CD47 antibody or immunologically active fragment thereof of the present application is administered prior to the second agent such as the KRAS G12D inhibitor. In some embodiments of the methods of treatment, the second agent such as the KRAS G12D inhibitor is administered prior to the agent that blocks the interaction between CD47 and SIRPα such as anti-CD47 antibody or immunologically active fragment thereof of the present application.
Exemplary Cancers
Provided herein are methods of treating cancer in an individual, wherein the cancer comprises one or more cells that comprise a mutation that activates the KRAS signaling pathway. Exemplary mutations that activate the KRAS pathway are described in detail elsewhere herein. In some embodiments, the cancer (i.e., the cancer that comprises one or more cells that comprise a mutation that activates the KRAS signaling pathway) is solid tumor. In some embodiments, the cancer is selected from the group consisting of lung cancer (such as lung adenocarcinoma or NSCLC) , pancreas cancer, colorectal cancer, gall bladder cancer, bile duct cancer, thyroid cancer, head and neck cancer, SCLC, colon cancer, small intestine cancer, appendiceal cancer, gastric cancer, esophageal cancer, bladder cancer, kidney cancer, liver cancer, breast cancer, ovarian cancer, teratocarcinoma, endometrial cancer, cervical cancer, prostate cancer, lymphoma, myeloma, leukemia, brain cancer, MPNST, neurofibromatosis, neuroblastoma, glioma,  schwannomas seminoma astrocytoma, squamous cell carcinoma, fibrosarcoma, rhabdomyosarcoma, osteosarcoma, Kaposi’s sarcoma and keratoacanthoma.
In another aspect, provided herein is a method of stimulating the phagocytosis of a population of cancer cells that comprises one or more cancer cells that express a KRAS mutant protein, comprising contacting the population with an effective amount of an agent (e.g., therapeutic agent) that blocks the interaction between CD47 (e.g., hCD47) and SIRPα (e.g., hSIRPα) . In some embodiments, the KRAS mutation occurs at residue 12 of the amino acid sequence of KRAS protein, as set forth in SEQ ID NO. 37 or SEQ ID NO. 38. In some embodiments, the KRAS mutation is selected from the group consisting of G12C, G12D, G12V, G12W, G12R, and G12A mutation. In some embodiments, the KRAS mutation is G12D mutation. In some embodiments, the KRAS mutation is G12V mutation.
In some embodiments of the method of stimulating the phagocytosis of the population of cancer cells, the agent that blocks the interaction between CD47 and SIRPα is anti-CD47 antibody or immunologically active fragment thereof. In some embodiments, the anti-CD47 antibody or immunologically active fragment thereof is CC-90002, 5F9, LQ001, HLX24, TI-061, AO-176, SRF-231, IBI-188, IMC-002, SHR-1603, STI-6643, ZL-1201, or an immunologically active fragment thereof. In some embodiments, the anti-CD47 antibody or immunologically active fragment thereof comprises three complementarity determining regions (CDRs) of a heavy chain variable domain (VH) set forth in SEQ ID NO: 1 and three CDRs of a light chain variable domain (VL) set forth in SEQ ID NO: 2.
In some embodiments, provided is a method of stimulating the phagocytosis of a population of cancer cells that comprises one or more cancer cells that express a KRAS G12D mutant protein, comprising contacting the population with an effective amount of an agent (e.g., therapeutic agent) that blocks the interaction between CD47 (e.g., hCD47) and SIRPα (e.g., hSIRPα) and an effective amount of a KRAS G12D inhibitor. In some embodiments, the KRAS G12D inhibitor is selected from the group consisting of MRTX1133 (Mirati) , iExosomes (MD Anderson) and mRNA-5671 (Moderna) . In some embodiments, the KRAS G12D inhibitor is MRTX1133. In some embodiments, the KRAS G12D inhibitor comprises a structure of:
In some embodiments, the KRAS G12D containing cancer cell (or the one or more cancer cells that expresses KRAS G12D mutant protein) is a solid tumor cell. In some embodiments, the cancer cell is selected from the group consisting of NSCLC cell, pancreas cancer cell, colorectal cancer cell, gall bladder cancer cell, bile duct cancer cell, thyroid cancer cell, head and neck cancer cell, SCLC cell, colon cancer cell, small intestine cancer cell, appendiceal cancer cell, gastric cancer cell, esophageal cancer cell, bladder cancer cell, kidney cancer cell, liver cancer cell, breast cancer cell, ovarian cancer cell, teratocarcinoma cell, endometrial cancer cell, cervical cancer cell, prostate cancer cell, lymphoma cell, myeloma cell, leukemia cell, brain cancer cell, MPNST cell, neurofibromatosis cell, neuroblastoma cell, glioma cell, schwannomas seminoma astrocytoma cell, squamous cell carcinoma cell, fibrosarcoma cell, rhabdomyosarcoma cell, osteosarcoma cell, Kaposi’s sarcoma cell and keratoacanthoma cell. In some embodiments, the KRAS G12D containing cancer cell is pancreatic cancer cell.
In another aspect, provided herein is a method for determining whether a subject in need thereof is suitable for cancer treatment by an agent that blocks the interaction between CD47 and SIRPα, comprising determining presence or absence of a KRAS mutation in the subject. In some embodiments, the presence of the KRAS mutation indicates the subject is suitable for cancer treatment by the agent. In some embodiments, the KRAS mutation is selected from the group consisting of G12C, G12D, G12V, G12W, G12R, and G12A mutation. In some embodiments, the method further comprises determining expression level of CD47 in the subject. In some embodiments, the expression level of CD47 in the subject is higher than that in a reference subject. In some embodiments, the reference subject does not comprise any KRAS mutant, for example, KRAS mutant at residue 12 of the amino acid of KRAS protein as set forth in SEQ ID NO. 37 or SEQ ID NO. 38. In some embodiments, the reference subject does not have cancer. In some embodiments, the reference subject is a healthy human being.
In another aspect, provided herein is a method for determining likelihood of a subject in need thereof to respond to an agent that blocks the interaction between CD47 and SIRPα in cancer treatment, comprising determining presence or absence of a KRAS mutation in the subject.  In some embodiments, the KRAS mutation is selected from the group consisting of G12C, G12D, G12V, G12W, G12R, and G12A mutation, and the presence of the KRAS mutation indicates the subject has a higher likelihood to respond to the agent. In some embodiments, the method further comprises determining the expression level of CD47 in the subject. In some embodiments, the expression level of CD47 in the subject is higher than that in a reference subject. In some embodiments, the reference subject does not comprise any KRAS mutant, for example, KRAS mutant at residue 12 of the amino acid of KRAS protein as set forth in SEQ ID NO. 37 or SEQ ID NO.38. In some embodiments, the reference subject does not have cancer. In some embodiments, the reference subject is a healthy human being.
In some embodiments, provided is use of an agent (e.g., therapeutic agent) that blocks the interaction between CD47 (e.g., hCD47) and SIRPα (e.g., hSIRPα) in the manufacture of a medicament for treating a KRAS mutant cancer (i.e., a cancer comprising one or more cancer cells that express a KRAS mutant protein such as KRAS G12D mutant protein) in a subject (e.g., a human subject) . In some embodiments, the medicament is administrated in combination with a second agent such as a KRAS G12D inhibitor.
In some embodiments, provided is the use of an agent (e.g., therapeutic agent) that blocks the interaction between CD47 (e.g., hCD47) and SIRPα (e.g., hSIRPα) in the manufacture of a medicament for stimulating the phagocytosis of a population of cancer cells that comprises one or more cancer cells that express a KRAS mutant such as KRAS G12D mutant protein in a subject (e.g., a human subject) . In some embodiments, the medicament is administrated in combination with a second agent such as a KRAS G12D inhibitor.
In some embodiments, the agent that blocks the interaction between CD47 and SIRPαis a polypeptide. In some embodiments, the agent that blocks the interaction between CD47 and SIRPα is an antibody, antibody construct, or an immunologically active fragment of the antibody of the antibody construct. In some embodiments, the agent that blocks the interaction between CD47 and SIRPα is an anti-CD47 antibody (or immunologically active fragment thereof) . In some embodiments, the anti-CD47 antibody is CC-90002 (also known as INBRX103) , 5F9 (also known as Hu5F9-G4 and magrolimab) , LQ001, HLX24, TI-061, AO-176, SRF-231, IBI-188, IMC-002, SHR-1603, STI-6643, ZL-1201, or an immunologically active fragment thereof. In some embodiments, the anti-CD47 antibody (or immunologically active fragment thereof) is any anti-CD47 antibody (or immunologically active fragment thereof) described herein.
Pharmaceutical Compositions
In another aspect, provided is a pharmaceutical composition comprising an agent that blocks the interaction between CD47 and SIRPα, and a KRAS G12D inhibitor.
In some embodiments of the pharmaceutical composition, the agent that blocks the interaction between CD47 and SIRPα is anti-CD47 antibody or immunologically active fragment thereof. In some embodiments, the anti-CD47 antibody or immunologically active fragment thereof is CC-90002, 5F9, LQ001, HLX24, TI-061, AO-176, SRF-231, IBI-188, IMC-002, SHR-1603, STI-6643, ZL-1201, or an immunologically active fragment thereof. In some embodiments, the anti-CD47 antibody or immunologically active fragment thereof comprises three complementarity determining regions (CDRs) of a heavy chain variable domain (VH) set forth in SEQ ID NO: 1 and three CDRs of a light chain variable domain (VL) set forth in SEQ ID NO: 2.
In some embodiments of the pharmaceutical composition, the anti-CD47 antibody or immunologically active fragment thereof comprises: (a) a VH that comprises (1) a CDR-H1 comprising RAWMN (SEQ ID NO: 5) ; (2) a CDR-H2 comprising RIKRKTDGETTDYAAPVKG (SEQ ID NO: 6) ; and (3) a CDR-H3 comprising SNRAFDI (SEQ ID NO: 7) and (b) a VL that comprises (1) a CDR-L1 comprising KSSQSVLYAGNNRNYLA (SEQ ID NO: 8) ; (2) a CDR-L2 comprising QASTRAS (SEQ ID NO: 9) ; and (3) a CDR-L3 comprising QQYYTPPLA (SEQ ID NO: 10) , wherein the CDR sequences are defined according to the Kabat numbering system.
In some embodiments of the pharmaceutical composition, the anti-CD47 antibody or immunologically active fragment thereof comprises a VH domain and a VL domain, wherein the VH domain of the anti-CD47 antibody or immunologically active fragment thereof comprises an amino acid sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identity to SEQ ID NO: 1, and the VL of the anti-CD47 antibody or immunologically active fragment thereof comprises an amino acid sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%identity to SEQ ID NO: 2. In some embodiments of the pharmaceutical composition, the VH domain of the anti-CD47 antibody or immunologically active fragment thereof comprises an amino acid sequence of SEQ ID NO: 1, and the VL of the anti-CD47 antibody or immunologically active fragment thereof comprises an amino acid sequence of SEQ ID NO: 2.
In some embodiments of the pharmaceutical composition, the anti-CD47 antibody is a full length antibody. In some embodiments, the full length anti-CD47 antibody comprises a heavy chain that comprises an amino acid sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identity to SEQ ID NO: 3 or SEQ ID NO: 35; and a light chain that comprises an amino acid sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identity to SEQ ID NO: 4.
In some embodiments of the pharmaceutical composition, the KRAS G12D inhibitor is selected from the group consisting of MRTX1133 (Mirati) , iExosomes (MD Anderson) and mRNA-5671 (Moderna) . In some embodiments, the KRAS G12D inhibitor is MRTX1133. In some embodiments, the KRAS G12D inhibitor comprises a structure of:
Articles of Manufacture and Kits
Provided are articles of manufacture and kits for treating cancer in an individual, wherein the cancer comprises one or more cells that comprise a mutation that activates the KRAS signaling pathway (e.g., mutations described herein) . In some embodiments, the cancer (e.g., the cancer that comprises one or more cells that comprise a mutation that activates the KRAS signaling pathway) is solid tumor. Exemplary cancers include, but are not limited to, e.g., cancer is lung cancer (such as NSCLC, pancreas cancer, colorectal cancer, gall bladder cancer, bile duct cancer, thyroid cancer, head and neck cancer, SCLC, colon cancer, small intestine cancer, appendiceal cancer, gastric cancer, esophageal cancer, bladder cancer, kidney cancer, liver cancer, breast cancer, ovarian cancer, teratocarcinoma, endometrial cancer, cervical cancer, prostate cancer, lymphoma, myeloma, leukemia, brain cancer, MPNST, neurofibromatosis, neuroblastoma, glioma, schwannomas seminoma astrocytoma, squamous cell carcinoma, fibrosarcoma, rhabdomyosarcoma, osteosarcoma, Kaposi’s sarcoma and keratoacanthoma) . In some embodiments, the article of manufacture or kit comprises an agent that blocks the interaction between CD47 (e.g., hCD47) and SIRPα (e.g., hSIRPα) . In some embodiments, the agent that blocks the interaction between CD47 and SIRPα is an antibody, antibody construct, or an immunologically active fragment of the antibody or antibody construct. In some embodiments, the agent that blocks the interaction between CD47 and SIRPα is an anti-CD47 antibody or immunologically active fragment thereof (e.g., an anti-CD47 antibody or immunologically active fragment thereof described herein) . In some embodiments, the anti-CD47 antibody (or immunologically active fragment thereof) is CC-90002 (also known as INBRX103) , 5F9 (also known as Hu5F9-G4 and magrolimab) , LQ001, HLX24, TI-061, AO-176, SRF-231, IBI-188, IMC-002, SHR-1603, STI-6643, or ZL-1201. In some embodiments, the anti-CD47 antibody or immunologically active fragment thereof is an anti-CD47 antibody (or fragment thereof) described herein or a pharmaceutical composition comprising such an anti-CD47 antibody or antibody fragment. In certain embodiments, the article of manufacture or kit  comprises a container containing nucleic acid (s) encoding an anti-CD47 antibody (or an immunologically active fragment thereof) , e.g., an anti-CD47 antibody (or fragment) described herein.
Suitable containers include, for example, bottles, vials, syringes, IV solution bags, test tubes, etc. The containers may be formed from a variety of materials such as glass or plastic. Additionally, the article of manufacture may further comprise an additional container comprising a pharmaceutically acceptable buffer, such as bacteriostatic water for injection (BWFI) , phosphate-buffered saline, Ringer’s solution, and dextrose solution. It may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, and syringes.
In certain embodiments, the article of manufacture or kit further comprises a label or package insert. In some embodiments, the label or package insert instructs the agent that blocks the interaction between CD47 (e.g., hCD47) and SIRPα (e.g., hSIRPα) to be used in in treating cancer in an individual, wherein the cancer comprises one or more cells that comprise a mutation that activates the KRAS signaling pathway (e.g., a mutation described in detail elsewhere herein) .
All publications and patent applications cited in this specification are herein incorporated by reference as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference.
EXAMPLES
The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention nor are they intended to represent that the experiments below are all or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (e.g. amounts, temperature, etc. ) but some experimental errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Centigrade, and pressure is at or near atmospheric.
Example 1. KRAS mutations render lung cancer cells insensitive to phagocytosis by macrophages
The inventors set out to investigate whether KRAS mutations could lead to impaired innate immune response against tumors in 18 Non Small Cell Lung Cancer (NSCLC) patients (12 were KRAS wild-type (KRASWT) and 6 harbored the KRASG12C mutation) . Primary tumor cells freshly isolated from surgically-removed tumor tissues were fluorescently labelled with carboxyfluorescein succinimidyl ester (CFSE) and cocultured with human peripheral blood  monocyte-derived macrophages and analyzed by fluorescence-activated cell sorting (FACS) to quantify cancer cells that were phagocytosed by macrophages. Tumors cells derived from patients with KRAS mutation showed significantly less phagocytosis by macrophages (Fig. 1A and Fig. 7A) . A similar phagocytosis assay was carried out using the human NSCLC cell line H358 harboring KRASG12C mutation. CFSE-labelled H358 cells were cocultured with human peripheral blood monocyte-derived macrophages and analyzed by FACS or fluorescence microscopy; overexpression of KRASG12C, but not KRASWT, led to decreased phagocytosis of H358 cells by macrophages, whereas siRNA knockdown of KRAS increased phagocytosis (Fig. 1B and Fig. 7B-7F) . The inventors also established an orthotopic lung cancer model by tail vein injection of eGFP-labelled H358 cells into nude mice (Fig. 1C) . The infiltration of macrophages in mouse lung tumors was analyzed by immunofluorescence staining with antibodies against the typical myeloid marker CD11b and the tumoricidal M1 macrophage marker iNOS. Although the M1 macrophage population (CD11b+iNOS+ or iNOS+ TNF-α+ by immunohistochemistry) was continuously present in the tumor tissue over the 3-month experiment period (Fig. 1D and Fig. 8A) , the co-localization of the CD11b/iNOS signal and the eGFP signal displayed a gradual decrease over time (Fig. 1D) , indicating impaired macrophage phagocytosis of H358 tumor cells in vivo.
The inventors further confirmed this observation in two KRAS-driven genetically engineered mouse models of lung cancer, the Lox-Stop-Lox-KRASG12D (KRASLSL-G12D/+ ) mouse strain and the KRASLSL-G12D/+ ; p53fl/fl mouse strain. The KRASLSL-G12D/+ mice developed spontaneous, sporadic pulmonary adenocarcinomas following intratracheal administration of the Cre-expressing adenovirus (Adeno-Cre) to remove the Stop element from the KRASG12D allele; while the KRASLSL-G12D/+ ; p53fl/fl mice exhibited accelerated pulmonary adenocarcinoma formation by the concomitant deletion of the p53 tumor suppressor gene. As expected, spontaneous formation of small adenocarcinomas was observed in the lungs of the KRASLSL-G12D/+ mice 5 months after Adeno-Cre administration (Fig. 8B-8C) , whereas pulmonary adenocarcinomas were present in the KRASLSL-G12D/+ ; p53fl/fl mice at 1 month and substantially increased at 3 months (Fig. 1E and Fig. 9A-9B) . The inventors then analyzed the status of macrophage infiltration and tumor phagocytosis in the lung tumors from both the KRASLSL-G12D/+ and KRASLSL-G12D/+ ; p53fl/fl mice. Similar to the H358 model, a gradual decrease in macrophage phagocytosis of tumor cells over time was observed (Fig. 1F and Fig. 8D) despite the continuous presence of M1 macrophages, which was confirmed by immunohistochemistry (IHC) with the M1 macrophage markers iNOS and TNF-α (Fig. 8E and Fig. 9C) . Together, these results suggested that KRAS mutations endowed lung cancer cells with antiphagocytic capacity during tumor progression.
Example 2. CD47 inhibition decrease KRAS-driven antiphagocytic effect in lung cancer
Since cell-surface expression of CD47 is a major mechanism used by cancer cells to evade macrophage phagocytosis, the inventors investigated whether KRAS mutation status could affect CD47 expression in lung tumors. The inventors first analyzed CD47 expression on the surface of tumor cells isolated from the 18 paired NSCLC patient samples by flow cytometry. Patients with KRAS mutations displayed a significantly higher level of CD47 expression on tumor cell surface (Fig. 2A and Fig. 10A) . Next, in both the KRASLSL-G12D/+ and KRASLSL-G12D/+ ; p53fl/fl mice, the CD47 protein expression in the lung also gradually increased over time (Fig. 2B-2C and Fig. 10B-10E) . In addition, CD47 protein levels were also found to be higher in KRAS-mutant (KRASMUT) human NSCLC cell lines than in KRASWT lines (Fig. 2D, E and Fig. 11A) , indicating a positive correlation between oncogenic KRAS signaling and CD47 expression. The inventors then used the RAS-less mouse embryonic fibroblast (MEF) model to investigate the role of KRAS mutations in regulating CD47 expression. CD47 protein levels were significantly elevated in the RAS-less MEFs stably overexpressing KRASG12C or KRASG12D compared with KRASWT (Fig. 2F and Fig. 11B) . Moreover, the inventors used two human NSCLC cell lines, H358 (KRASG12C) and SK-LU-1 (KRASG12D) , to further illustrate the potential regulation of CD47 by KRAS. Overexpression of the respective KRASMUT, but not KRASWT, led to significant induction of CD47 expression in H358 and SK-LU-1 cells (Fig. 2G and Fig. 11C-11D) . In contrast, siRNA knockdown of KRAS significantly decreased CD47 expression in both cell lines (Fig. 2H and Fig. 11E-11F) . These data indicated that KRAS mutations could drive CD47 expression both in vitro and in vivo, while the use of KRAS inhibitors such as siRNA against KRAS can inhibit the expression of CD47, thereby restoring the phagocytosis of tumors by macrophages.
To verify the effect of CD47 inhibitors on macrophage phagocytosis in KRAS-driven tumors, the inventors treated the KRASLSL-G12D/+ ; p53fl/fl mice with CD47 shRNA (comprising sequence shown in SEQ ID NO. 40) delivered by adeno-associated virus (AAV) along with intratracheal administration of Adeno-Cre. CD47 knockdown substantially increased the infiltration of M1 macrophages in tumor tissues and the phagocytosis of tumor cells by M1 macrophages in vivo (Fig. 2N and Fig. 12E) . At the same time, knockdown of CD47 significantly decreased tumor formation in the lungs of the mice and prolonged overall survival (Fig. 2I-M and Fig. 12A-12D) .
Taken together, these data suggested that, in KRAS-driven tumors, CD47 promotes tumor progression through the inhibition of macrophages. Administration of an siRNA knocking down KRAS or CD47, or an inhibitor targeting KRAS, CD47, or their activation cascades to subjects with oncogenic KRAS mutations can restored phagocytosis of tumor cells by macrophages, thereby inhibiting tumor development and prolonging the overall survival time of the subjects.
In addition, the inventors detected the EGFR expression of 18 pairs of NSCLC patient  samples (as shown in Example 1) , and compared them with the KRAS expression levels of the samples. The results are shown in Table B. For the KRAS wild-type tumor samples (WT) , the main mutation type was EGFR mutation, while no EGFR mutation was found in KRAS-mutant tumor samples (MUT) . It suggests that KRAS mutation hardly co-exist with EGFR mutation, which explains why patients with KRAS mutation are prone to resistance to EGFR inhibitors from another perspective. In addition to the previous results that KRAS mutation and CD47 expression are positively correlated, patients with EGFR mutation may not be suitable for the treatment of CD47 inhibitors (such as CD47 antibodies) .
Table B.
Example 3. MiR-34a is a negative regulator of CD47-mediated antiphagocytic activity
While our data showed a positive correlation between KRAS mutation status and CD47 protein levels in both mice and human tumors, CD47 mRNA levels were unaffected by KRAS (Fig. 13) , suggesting the involvement of post-transcriptional regulatory mechanisms. The inventors hypothesized that KRAS may regulate CD47 expression through miRNAs. The inventors therefore employed small RNA deep sequencing to determine the alteration of miRNA profiles in the lung tumors from the KRASLSL-G12D/+ mice compared with the normal lung tissues from the mice without Adeno-Cre treatment. By applying a stringent threshold of log2 (fold-change) > 1 and significance  criterion of p < 0.05, a total of 10 miRNAs were significantly increased in the lung tumors, while 40 miRNAs exhibited a decreasing trend (Fig. 3A) . Hierarchical clustering also revealed the separation of the tumorous from normal tissues based on miRNA profiling (Fig. 3B) . Subsequently, the expression of some top ranked dysregulated miRNAs (mean reads > 500, log2 (fold-change) >1 and p < 0.01) (Table C) was confirmed by quantitative RT-PCR; 7 of the 9 miRNAs were differentially expressed in the lung tumors compared with the normal tissues (Fig. 3C) . Because miRNAs usually suppress the expression of their target genes, the inventors focused on the 5 miRNAs that were decreased during tumorigenesis. Using three different computational software programmers (TargetScan, miRanda and PicTar) , the inventors identified miR-34a-5p (miR-34a) , one of the most downregulated miRNAs in the lung tumors of the KRASLSL-G12D/+ mice, as a potential regulator of CD47 expression. A total of three specific miR-34a binding sites were identified in the 3’-untranslated region (3’-UTR) of CD47 (Fig. 14A) . For the other 4 miRNAs that are reduced during tumorigenesis (miR-128-3p, miR-146b-5p, miR-181d-5p and miR-340-3p) , possible binding sites for CD47 mRNA 3’UTR were not detected (Figure 14K) .
Table C. Significantly changed miRNAs between lung tumors and normal lung tissues  of KRASLSL-G12D/+mice
Stringent threshold and significance criterion: mean reads > 500, log2 (fold-change) > 1 and P <0.01.
To further validate the correlation between miR-34a and CD47, the inventors assessed the CD47 protein levels in H358 and SK-LU-1 cells after transfection with miR-34a mimic (synthetic double-stranded RNA oligonucleotide that mimics the precursor of miR-34a) or with miR-34a antisense (single-stranded, chemically modified oligonucleotide designed to specifically bind to and inhibit mature miR-34a) (Fig. 14B-14C) . The CD47 protein levels were significantly  suppressed by the miR-34a mimic and increased by the miR-34a antisense in both H358 and SK-LU-1 cells (Fig. 3D, E and Fig. 14D-14G) , whereas the CD47 mRNA levels were not affected (Fig. 14H-14I) . Furthermore, direct binding of miR-34a to the 3’-UTR of CD47 was also confirmed in a luciferase reporter assay (Fig. 14J) . However, other decreased miR-128-3p, miR-146b-5p, miR-181d-5p and miR-340-3p screened by miRNA chip did not bind to CD47 mRNA 3’UTR (Fig. 14L) , and also failed to reduce the expression level of CD47 protein (Fig. 14M) . These results demonstrated that miR-34a could directly bind to the 3’-UTR of CD47 and inhibit CD47 translation.
Next, the inventors evaluated the effect of miR-34a on the antiphagocytic activity of CD47 in lung cancer. Introduction of the miR-34a mimic into H358 cells significantly promoted macrophage-mediated phagocytosis, which was reversed by co-transfection with the CD47 overexpression plasmid (Fig. 3F and Fig. 15A-15B) . In vivo, AAV-mediated delivery of miR-34a at the time of intratracheal Adeno-Cre administration in the KRASLSL-G12D/+ ; p53fl/fl mice significantly decreased lung tumor formation and prolonged overall survival, which could be completely rescued by coadministration of AAV-mediated CD47 overexpression plasmid (Fig. 3G-I and Fig. 15C-15D) . Similar to CD47 knockdown (Fig. 2I-N) , miR-34a overexpression strongly inhibited CD47 protein levels and promoted tumor phagocytosis by the M1 macrophages; cotreatment with AAV-CD47 in mice completely reversed the effect of miR-34a (Fig. 3J-M and Supplementary Fig. 15E-G) . These results indicated that the escape from innate immune surveillance induced by CD47 was controlled, at least in part, by miR-34a. It is suggested that the administration of therapeutic products with miR-34a mimics or miR-34a as the main functional component to tumor patients with high expression of CD47, especially those with activated KRAS oncogene, will inhibit the expression of CD47, inhibit tumor growth, and prolong the overall survival of patients.
Example 4. PI3K-STAT3 axis-related inhibitor prevents KRAS-driven miR-34a repression and CD47 activation
To illustrate how miR-34a connects oncogenic KRAS signaling to CD47 expression, the inventors first determined the relationship between KRAS mutation/expression and miR-34a expression. In RAS-less MEFs, overexpression of KRASG12C or KRASG12D decreased the miR-34a levels compared with overexpression of KRASWT (Fig. 4A) . Similarly, overexpression of KRASG12C or KRASG12D but not KRASWT decreased the miR-34a levels in H358 and SK-LU-1 cells, respectively (Fig. 4B, D) . In contrast, KRAS knockdown resulted in an increase in miR-34a expression in both cell lines (Fig. 4C, E) . A gradual decrease in the miR-34a levels was also observed in both the KRASLSL-G12D/+ and KRASLSL-G12D/+ ; p53fl/fl mice upon activation of the oncogenic activity of KRASG12D (Fig. 4F, G) . These data indicated that oncogenic KRAS mutations  functioned as a negative regulator of miR-34a expression during KRAS-driven lung tumorigenesis.
To determine which signaling pathway downstream of KRAS is responsible for regulating miR-34a expression, the inventors blocked the RAF-MEK-ERK pathway with a MEK inhibitor (GSK1120212, trametinib) and the PI3K-AKT pathway with a PI3K inhibitor (GDC-0941, pictilisib) , respectively, in the MEFs (with G12C or G12D mutation in KRAS) and H358 cells. While the MEK inhibitor had no effect on the expression of miR-34a and CD47; the PI3K inhibitor, either alone or in combination with the MEK inhibitor, substantially induced miR-34a expression (Fig. 4H) and decreased CD47 levels (Fig. 4I and Fig. 16A) in both MEFs and H358 cells. These results revealed a direct mechanistic link between the PI3K pathway and miR-34a expression in lung cancer cells. It also demonstrated the role of PI3K inhibitors such as Pictilisib in the treatment of tumors with high CD47 expression, especially KRAS oncogene activation.
Recent studies have uncovered an interdependence of PI3K and STAT3 signaling in cancer cells; in particular, STAT3 was phosphorylated at Tyr705 and activated in a PI3K-dependent manner. Because STAT3 is a well-known transcriptional repressor of miR-34a that negatively controls the expression of miR-34a via a conserved STAT3-binding site in the first intron of the MIR-34A gene, the inventors speculated that KRAS might regulate miR-34a expression through PI3K-STAT3 signaling. To prove this hypothesis, the inventors first measured STAT3 phosphorylation levels in the MEF cells; the p-STAT3 levels were higher in the MEFG12C and MEFG12D cells than in the MEFWT cells (Fig. 4J and Supplementary Fig. 16B, C) . Overexpression of KRASG12C or KRASG12D but not KRASWT increased the p-STAT3 levels in H358 or SK-LU-1 cells, respectively (Fig. 4K, L and Supplementary Fig. 16D-I) . In contrast, KRAS knockdown decreased p-STAT3 in both cell lines (Fig. 4M, N and Supplementary Fig. 16J-O) . The inventors then determined the impact of MEK and PI3K inhibitors on STAT3 phosphorylation. Similar to the effect on miR-34a, the PI3K inhibitor but not the MEK inhibitor suppressed KRAS-driven STAT3 phosphorylation in both the MEFs and H358 cells (Fig. 4I and Supplementary Fig. 16P, Q) . Likewise, treatment with a STAT3 inhibitor (stattic) also caused sustained inhibition of STAT3 activation (Tyr705 phosphorylation) and CD47 expression as well as elevation of miR-34a in H358 cells (Supplementary Fig. 17) . Taken together, these data suggested that KRAS signaling could suppress miR-34a expression via the PI3K-STAT3 axis, which in turn relieves miR-34a-dependent repression of CD47, leading to escape from innate immune surveillance and tumor progression (Fig. 4O) . Thus, PI3K inhibitors such as Pictilisib or STAT3 inhibitors such as Stattic can increase the expression of miR-34a and inhibit the expression of CD47 in tumors with KRAS oncogene activation or high CD47 expression, thereby ultimately inhibiting tumor progression.
Example 5. KRAS mutation status is positively correlated with CD47 expression in NSCLC cohorts
To further explore the clinical relevance of our findings, the inventors assessed the correlation of KRAS mutation status with CD47 expression in three independent NSCLC cohorts. The first cohort was a commercial tissue microarray containing 157 pairs of NSCLC and normal adjacent tissue samples, which lacked KRAS mutation information. The inventors performed immunohistochemistry (IHC) analysis of CD47, p-STAT3 and p-AKT and found that the CD47 levels were consistently higher in the tumor tissues than in the normal controls (Supplementary Fig. 18A) . High CD47 expression was also positively correlated with advanced tumor grade and poor survival (Supplementary Fig. 18B, C) . To evaluate the correlation of CD47 expression with KRAS signaling, the inventors used the p-AKT levels (downstream effector of PI3K) as the readout for KRAS activity and segregated all patient samples into high and low p-AKT groups. As expected, both CD47 and p-STAT3 levels were higher in the high p-AKT group than in the low p-AKT group (Fig. 5A) . Moreover, while high p-AKT expression was positively correlated with poor overall survival in NSCLC patients, coordinated activation of KRAS (p-AKThigh) and CD47 further increased the probability of a poor prognosis (Fig. 18D-18E; hazard ratio 1.81 vs. 1.46) .
In the second cohort, the inventors performed IHC analysis of CD47 and p-STAT3 in a homemade tissue microarray containing paired tumor samples and adjacent normal tissue samples from 12 KRASMUT NSCLC patients and 28 KRASWT NSCLC patients. KRAS mutation status was determined by deep sequencing. In both KRASMUT and KRASWT patients, CD47 was highly expressed in the tumor samples compared with their normal counterparts (Supplementary Fig. 18F) . Compared with the KRASWT tumors, the tumor samples with KRAS mutations displayed higher expression of CD47 and p-STAT3 (Fig. 5B) .
In the third cohort, the inventors determined the KRAS mutation status and the CD47, p-STAT3 and miR-34a expression levels in 100 pairs of NSCLC and normal tissue samples. Thirty NSCLC samples were confirmed to be KRAS-mutant and seventy were wild-type. The CD47 and p-STAT3 protein levels were consistently upregulated, and miR-34a was downregulated in the NSCLC samples compared with the paired normal controls, regardless of KRAS mutation status (Fig. 18G-18I) . In the tumor samples, the CD47 and p-STAT3 expression levels were much higher in the KRASMUT patients than in the KRASWT patients (Fig. 5C-5D) . The opposite trend was observed for miR-34a (Fig. 5E) . The tight correlation between KRAS mutation status and CD47, p-STAT3 and miR-34a expression was further demonstrated by Pearson’s correlation coefficient analysis, in which a significant reciprocal expression pattern between p-STAT3 and miR-34a and between CD47 and miR-34a, as well as a significant coincident pattern between p-STAT3 and CD47, were observed in the KRASMUT patients, compared with that in the KRASWT patients (Fig. 5F-5G) . In summary, the results from three independent NSCLC cohorts were consistent with each other and confirmed clinically that KRAS mutation status is positively correlated with CD47  expression in NSCLC patients. Therefore, there are solid evidences to infer that miR-34a or miR-34a mimics, p-AKT inhibitors, p-STAT3 inhibitors, CD47 inhibitors, or miR-34a or miR-34a, p-AKT inhibitors, p-AKT inhibitors, -STAT3 inhibitor and CD47 inhibitor are therapeutic products with functional components, which can be used to treat tumor patients with activated KRAS oncogene.
Example 6. Reverse mutation further confirms that KRAS mutation affects CD47 expression through the KRAS-CD47 axis
The G12C mutation in LLC cells (KRASG12C) was reverted by Knock In technology to obtain LLC-KI, an LLC homologous cell line with wild-type KRAS. For the KRAS-CD47 axis, the protein expression levels of p-AKT, p-ERK, p-STAT3 and CD47 downstream of KRAS in the original LLC cell line and LLC-KI cell line were determined using Western blot assay and compared. The results showed that compared with LLC cells, the expression levels of p-AKT, p-ERK, p-STAT3 and CD47 protein in LLC-KI were significantly down-regulated (Figure 21) . It was further confirmed that KRAS mutation leads to the high expression of CD47 by up-regulating the expressions of p-AKT, p-ERK and p-STAT3.
Example 7. The KRASG12C inhibitor AMG 510 inhibits CD47 signaling and restores innate immune surveillance in animal models of NSCLC
From a translational perspective, the link between KRAS mutations and innate immune evasion suggests that targeting the KRAS-CD47 axis might compromise the ability of cancer cells to evade innate immune surveillance and increase their susceptibility to macrophage phagocytosis. Consistently, treatment of the H358 human lung cancer cell line or the Lewis Lung Carcinoma (LLC, KRASG12C) mouse lung cancer cell line with the KRASG12C covalent inhibitor AMG 51021 attenuated p-STAT3 and CD47 expression, enhanced miR-34a expression and stimulated the phagocytosis of the H358 or LLC cells by macrophages (Fig. 6A-F and Fig. 19) . Moreover, the inventors tested the effect of AMG 510 on the tumor immune microenvironment in an orthotopic model of lung cancer. The LLC mouse lung cancer cells were injected via tail vein into immunocompetent C57BL/6 mice to establish the model. AMG 510 treatment for 8 days significantly suppressed tumor growth, inhibited KRAS activity, STAT3 phosphorylation and CD47 expression and stimulated miR-34a expression in tumor tissues (Fig. 6G-K and Supplementary Fig. 20A-20E) . Most importantly, AMG 510 treatment significantly increased the infiltration of M1 macrophages in the tumor tissue as well as tumor phagocytosis by the M1 macrophages (Fig. 6L and Fig. 20F) . Taken together, these data proved that the in vivo antitumor effect of KRASG12C inhibitors might, at least in part, be due to the reactivation of the innate immune response to cancer cells. KRAS inhibitors, such as AMG 510, can be used to suppress the progress  of tumors with activated oncogenic KRAS gene.
Example 8. Correlation of KRAS mutation status with CD47 expression in colon cancer cell lines.
Different human colon cancer cell lines were collected. Both the Caco2 and HT29 cell line harbor wild type KRAS, whereas the COLO678, HCT116, SW480, and LS180 cell lines harbor a mutant KRAS allele having an activating mutation. After the collected cells were stained with FITC-labeled anti-CD47 antibody, the expression level of CD47 protein on the surfaces of cells from each cell line was detected by flow cytometry. See Figure 22A. After the total protein was extracted from the collected cells, the expression level of CD47 protein in the cells was detected by Western Blot. See Figure 22B. It was found that the expression level of CD47 protein in KRAS mutant cell lines was much higher than that of KRAS wild-type cells. These results suggest that KRAS mutation status is positively correlated with CD47 expression in colon cancer cells, i.e., cells harboring KRAS activating mutations demonstrate higher levels of CD47 expression levels than cells harboring wild type KRAS.
Next, three human colon cancer cell lines harboring KRAS mutations, i.e., LS180 (KRASG12D) , SW480 (KRASG12V) , HCT116 (KRASG13D) were used to further study the potential regulatory effect of KRAS n on CD47 expression. LS180, SW480, and HCT116 cells were plated in 12-well plates one day in advance. After the cell density reached 80%, three kinds of KRAS siRNA (20 μM) were transfected with lipo2000. After 48 hours, the total protein was collected and detected by Western Blot for KRAS expression levels and CD47 expression levels. The results showed that knockdown of KRAS expression by KRAS siRNA significantly reduced the expression of CD47 in the three types of cells. See Figure 23) , demonstrating that KRAS can directly regulate the expression level of CD47 in colon cancer cells.
The Caco2 and HT29 cell lines, each of which harbors wild type KRAS, were used to further study the potential regulatory effect of KRAS upregulation on CD47. Caco2 and HT29 cells were plated in 12-well plates one day in advance, and after the cell density reached 80%, the cells were transfected with plasmids (3 μg/well) overexpressing KRAS protein using lipo2000, which were OE-KRASWT (Plasmid overexpressing wild-type KRAS) , OE-KRASG12D (plasmid overexpressing KRASG12D mutation) , OE-KRASG12V (plasmid overexpressing KRASG12V mutation) , OE-KRASG12C (plasmid overexpressing KRASG12C mutation) , OE-KRASG13D (plasmid overexpressing KRASG12C mutation) . 48 hours later, the total protein was collected, and the expression levels of KRAS and CD47 were  detected by western blot. The results showed that overexpression of mutant KRAS could up-regulate the expression of CD47 in colon cancer cells, but the change of CD47 was small after overexpression of wild-type KRAS. See Figure 24. Such results further indicate that KRAS mutation can directly regulate the expression level of CD47 in colon cancer cells.
Example 9. Effect of KRAS inhibition on CD47 signaling
The IC50 value of KRASG12D inhibitor MRTX1133 on LS180 cells, which harbor the KRASG12D mutation was determined as follows. LS180 cells were plated in 96-well plates at 2000 cells/well, and MRTX1133 was administered 12 hours after adherence, at doses of 0, 4, 8, 15, 30, 60, 120, 400, 800, 1500, 3000 nM, 4 pairs of wells were made for each dose, and detected by Cell Counting Kit-8 ( “CCK8” ) . after 72 hours. The IC50 value of MRTX1133 against LS180 was 80.55 nM. See Figure 25.
Next, experiments were performed to determine the effects of KRASG12D inhibitor MRTX1133 on the expression levels of pERK, ERK, pAKT, AKT, and CD47 in LS180 cells. Briefly, LS180 cells were treated with MRTX1133 (200 nM) for 24 hours, the total protein was collected, and KRAS downstream pathway proteins pERK and pAKT were detected by western blot. As shown in FIG. 26, in addition to inhibiting CD47 expression, MRTX1133 reduced expression of pERK and pAKT in vitro, indicating that the KRASG12D inhibitor can inhibit CD47 signaling in addition to regulating to CD47 expression. Such result indicates that KRAS can directly regulate the expression level of CD47 in colon cancer cells, and that the KRASG12D inhibitor MRTX1133 has a more significant effect on CD47.
Methods and Materials
The methods and materials used in the above examples are described below. Those without specific conditions in the above examples usually follow the conventional conditions as described in J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Third Edition, Science Press, 2002, or follow the conditions suggested by the manufacturers.
Study design
For the KRAS-driven spontaneous lung cancer model, KRASLSL-G12D/+ and KRASLSL- G12D/+ ; p53fl/fl transgenic mice were intratracheally administered Adeno-Cre to induce pulmonary adenocarcinoma formation. Tumor growth, CD47 expression, and macrophage infiltration were assessed at different time points or were evaluated when disrupting the KRAS-CD47 signaling axis. For the orthotopic xenograft mouse model, C57BL/6 mice were injected via tail vein with LLC cells (KRASG12C) and administered the KRASG12C inhibitor AMG 510 via oral gavage after tumor formation; then, tumor regression, CD47 expression and macrophage infiltration were assessed.  For determination of the molecular mechanism underlying KRAS-mediated CD47 activation, a RAS-less MEF model stably overexpressing KRASG12C, KRASG12D or KRASWT and lung cancer H358 (KRASG12C) and SK-LU-1 (KRASG12D) cell lines were cultured and assessed. For the in vitro phagocytosis assay, FACS and fluorescence microscopy were performed to analyze the phagocytosis of primary lung tumor cells or NSCLC cell lines by human peripheral blood monocyte-derived macrophages. For analysis of NSCLC patient samples, the correlation of KRAS mutation status with CD47 expression was assessed in three independent NSCLC cohorts.
Cell culture
The human lung cancer cell lines H358 and SK-LU-1 were obtained from the ATCC. The human embryonic kidney cell line HEK293T and mouse lung cancer cell line LLC were obtained from the Shanghai Institute of Cell Biology, Chinese Academy of Sciences (Shanghai, China) . Cells were certified by STR analysis and regularly checked for mycoplasma contamination. RAS-less MEF cell lines overexpressing different KRAS mutations were obtained from the NIH RAS Initiative and cultured as indicated in https: //www. cancer. gov/research/key-initiatives/ras/ras-central/blog/2017/rasless-mefs-drug-screens. H358 cells were maintained in RPMI 1640 medium (C11875500BT, Gibco, California, USA) supplemented with 10%FBS (10099-141, Gibco, Australia) ; SK-LU-1, LLC, and HEK293T cells were maintained in high-glucose (4.5 g/L) DMEM (C11995500BT, Gibco) supplemented with 10%FBS (Gibco) . All cells were incubated in 5%CO2 at 37℃ in a humidified atmosphere.
Patient tissue samples
A total of four separate patient cohorts were used in this study. For the assessment of macrophage phagocytosis and CD47 expression in fresh human NSCLC tumor tissues, 18 pairs of tumor and normal adjacent tissue samples were collected from NSCLC patients receiving surgery at the Jiangsu Cancer Hospital, China. Informed consent was obtained from each patient, and the collection of tissue specimens was approved by the Internal Review and Ethics Boards at Jiangsu Cancer Hospital. Briefly, tissues were placed in 1.0 mL RPMI 1640 with Liberase TL (0.2 mg/ml; Roche) and DNase I (20 μg/ml; Ambion) , and minced with scissors to sub-millimeter pieces. Tissues were then dissociated into single cells using the gentleMACS program at 37℃ for 40 min, according to the manufacturer’s instructions. Cells were then passed through a 70 mm mesh and centrifuged at 350 g for 5 min. Cell pellets were re-suspended and one aliquot of the cells (1 x 106) were incubated with 1 mg of fluorescently conjugated mAbs against human CD47 (BD Biosciences) or the isotype control. Another aliquot of the cells was subjected to the in vitro phagocytosis assay. Samples were fixed in 4%paraformaldehyde, washed, re-suspended in FACS buffer, and analyzed by flow cytometry (FACScalibur, BD Biosciences) .
Three patient cohorts were used for the correlation analysis of KRAS mutation and  CD47 levels. The first cohort was a commercial tissue microarray containing 157 pairs of NSCLC and normal adjacent tissue samples purchased from Shanghai Outdo Biotech (Shanghai, China) . The second cohort was a homemade tissue microarray containing 12 pairs of KRASMUT NSCLC and adjacent normal tissue samples and 28 pairs of KRASWT NSCLC and adjacent normal tissue samples; these samples were obtained from Jiangsu Biobank of Clinical Resources (located at Jiangsu Cancer Hospital, Nanjing, China) . The third cohort containing 100 pairs of NSCLC and normal adjacent tissue samples were obtained from the Jiangsu Biobank of Clinical Resources (located at Jiangsu Cancer Hospital, Nanjing, China. Informed consent was obtained from each patient, and the collection of tissue specimens was approved by the Internal Review and Ethics Boards at Jiangsu Cancer Hospital. These cases were selected based on a clear pathological diagnosis. Approximately 5 g segments of NSCLC and normal tissues were promptly transferred to containers with liquid nitrogen and frozen at -80℃. The KRAS mutation status in these samples was determined by TA cloning and sequencing of RT-PCR products. Patient information is shown in Table D.
Table D. Demographic and clinical information of the NSCLC samples.
Table D-1. Detailed information of NSCLC samples in the first cohort (commercial tissue microarray)
Table D-2. Detailed information of NSCLC samples in the second cohort (homemade tissue microarray)
Table D-3. Detailed information of NSCLC samples in the third cohort (100 individual NSCLC samples)
Genetic models of lung cancer
The KRASLSL-G12D/+ and KRASLSL-G12D/+ ; p53fl/fl transgenic mice were originally generously provided by Professor Hongbin Ji (Shanghai Institutes for Biological Sciences) . The mice were maintained on a 12 h light/dark cycle (lights on at 7 am) with free access to food and water. All animal care and handling procedures were performed in accordance with the National Institutes of Health’s Guide for the Care and Use of Laboratory Animals and were approved by the Ethical Committee of Nanjing University (Nanjing, China) . For KRASG12D activation in mouse lungs, six-week-old KRASLSL-G12D/+ and KRASLSL-G12D/+ ; p53fl/fl mice were first anaesthetized with ketamine (100 mg/kg) and xylazine (10 mg/kg) , and then, 5 × 106 plaque-forming units of Adeno-Cre were diluted with PBS to obtain a final volume of 50 μL and given through intratracheal administration14, 15. At different time points after Adeno-Cre administration (0 and 5 months for KRASLSL-G12D/+ mice and 0, 1 and 3 months for KRASLSL-G12D/+ ; p53fl/fl mice) , the mice were anaesthetized to evaluate tumor growth by microcomputed tomography (micro-CT) scanning or  euthanized to confirm lung adenocarcinoma formation by histological analysis. Histological analysis was performed by hematoxylin and eosin (H&E) staining. Excised lung adenocarcinomas were also processed to determine CD47 expression, macrophage infiltration by western blotting, immunofluorescence staining or IHC analyses.
For AAV-mediated silencing of CD47, a short hairpin RNA of CD47 was cloned into the AAV vector AAV9-CAG-EGFP (Sunbio, Shanghai, China) (AAV-CD47 shRNA) . An AAV encoding scrambled shRNA (AAV-control shRNA) served as the negative control. KRASLSL-G12D/+ ; p53fl/fl mice were intratracheally co-administered with Adeno-Cre along with the AAV-control shRNA or AAV-CD47 shRNA. Then, the mice were divided into 2 groups and monitored to determine either survival time or tumor regression. For survival analysis, the mice were monitored for 150 days without any further treatment. For tumor size, the mice were anaesthetized to evaluate tumor growth by micro-CT scanning or euthanized to confirm lung adenocarcinoma formation by histological analysis at 90 days. Excised lung adenocarcinomas were also processed to determine CD47 expression and macrophage infiltration by western blotting, immunofluorescence staining or IHC analyses.
For the overexpression of miR-34a in mice, an AAV9-CAG-EGFP (Sunbio) encoding miR-34a (AAV-miR-34a) was used, with or without simultaneous administration of an AAV9-CAG-EGFP (Sunbio) expressing the CD47 open reading frame (AAV-CD47) . An AAV encoding scrambled RNA (AAV-scrRNA) served as the negative control of AAV-miR-34a, and an AAV that does not express a transgene (AAV-control) served as the negative control of AAV-CD47. The KRASLSL-G12D/+ ; p53fl/fl mice were intratracheally co-administered Adeno-Cre along with the combination of AAV-scrRNA plus AAV-control, AAV-miR-34a plus AAV-control or AAV-miR-34a plus AAV-CD47. The mice were assessed as described above.
Micro-CT scanning
Micro-CT analysis was performed to assess lung tumor growth because the micro-CT images clearly distinguished the lung tumors from the surrounding tissue even without any contrast agent, and the reconstructed 3-D pulmonary images can easily differentiate the tumors from the blood vessels26. Briefly, micro-CT scans were performed using a SkyScan 1176 micro-CT analyzer, which scanned a360° area at a resolution of 50umwith a rotation step of0.5. The system comprised two metallochromic tubes equipped with a fixed 0.5 mm Al filter and two 1280×1024 pixel digital X-ray cameras. Images were acquired at 60 kV and 134 μA. The mice were scanned while in a supine position. The micro-CT data were batch-sorted, processed, and reconstructed as 3-D pulmonary images using the N-Recon program according to the manufacturer’s instructions (SkyScan) . The reconstructed data were subsequently imaged using DataViewer, and the tumor numbers and volumes were calculated using the CTAn program according to the manufacturer’s  instructions (SkyScan, Nanjing, China) .
Histopathology
For histopathological examination of the KRASLSL-G12D/+ and KRASLSL-G12D/+ ; p53fl/fl mice, whole lung lobes were fixed in 4%paraformaldehyde overnight and embedded in paraffin. H&E staining was performed with a standard method. Digitally scanned images of H&E slides were created with the Aperio ScanScope AT2 at 20 × magnification and analyzed with Aperio’s WebScope software. For quantification of the tumor burden, tumor regions were outlined, and the percentage of the tumor area relative to the total lung area was calculated for each mouse. All tumor burdens were assessed in a blinded fashion, and at least five mice per group were included in the analyses.
Immunofluorescence staining
Excised lung adenocarcinomas were postfixed for 4 h in 4%PFA and cryoprotected in 20%and 30%sucrose in 1 × PBS at 4℃. For immunofluorescence analysis, the sections were postfixed for 10 min in 4%PFA and then washed with 1× PBS prior to blocking with 5%normal horse serum/0.25%Triton X-100 in PBS (1 h) . The sections were then incubated with CD11b, iNOS, TNF-α or KRASG12D primary antibodies diluted 1: 100 in blocking solution overnight. Detailed information on the primary antibodies used can be found in Table E. The following day, the sections were washed with 1 × PBS and subsequently incubated in blocking solution containing secondary antibody for 1 h. Then, the sections were washed with 1 × PBS and placed in DAPI staining solution for 10 min. After the sections were washed with 1× PBS, they were examined with a TCS SP8 inverted laser scanning confocal microscope (Leica) . Digital images from the microscope were recorded with LAS X Viewer Software (Leica) . Cell counts were performed using Image-Pro Plus 6.0 software (Media Cybernetics, Inc., Rockville, MD) in combination with manual scoring to ensure accuracy.
Table E. Antibody list
Immunohistochemistry
IHC was performed according to standard protocols. Prior to staining, sections from the lung tumors of the KRASLSL-G12D/+ and KRASLSL-G12D/+ ; p53fl/fl mice were baked at 60℃ for 1 h, deparaffinized in xylene and rehydrated through graded ethanol. Antigen retrieval was performed by heating the sections under high pressure in citrate antigen retrieval solution for approximately 5 min. The sections were incubated with monoclonal antibodies against CD47, iNOS, TNF-α, p-AKT or p-STAT3 for 60 min at room temperature. Detailed information on the primary antibodies used can be found in Table E. The immunoreaction was detected by treatment with diaminobenzidine chromogen for 3 min. The immunoreaction images were viewed and captured using the NDP. view. 2 software program. Protein expression was assessed by two experienced pathologists blinded to the clinical data who performed the first reading independently and then debated any  discrepancies until reaching a consensus.
Small RNA sequencing
Small RNA deep sequencing was performed to examine the miRNA profiles in the lung tumors of the KRASLSL-G12D/+ mice. All sRNA library construction and deep sequencing were performed by Novogene (Beijing, China) . Briefly, sRNA libraries were constructed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina (NEB, USA) . After library quality validation, raw data for each sRNA library were generated on the Illumina HiSeq 2500 platform. The clean reads were obtained after data filtration. Precursor and mature miRNA sequences were obtained from miRBase v21. To annotate miRNA, clean reads were mapped to known mouse miRNA precursor sequences by using bowtie and only candidates with no more than 1 mismatch and 2 shifts were counted as miRNA matches. Differential analysis was performed using DESeq2. Significance was set at uncorrected P < 0.05 for broad pattern identification. A fold-change threshold was set at > 2. Volcano plot was generated using the ggplot2 R package and heatmap were generated using the pheatmap R package.
Cell transfection
Sequences of the open reading frames of wild-type KRAS (KRASWT) or mutant KRASG12C or mutant KRASG12D were synthetized by GenScript (Nanjing, China) and inserted into a CMV-EGFP plasmid. A plasmid that does not express a transgene served as the negative control. KRAS siRNAs were purchased from GenePharma (Shanghai, China) . A siRNA with a scrambled sequence served as the negative control. MiR-34a mimic and antisense were purchased from GenePharma. Control mimic and antisense designed to express double-stranded or single-stranded scrambled RNAs served as negative controls. H358 and SK-LU-1 cells were seeded in 12-well plates, and each well was transfected with 5 μg of the KRASWT, KRASG12C or KRASG12D plasmids or 50 pmol of miR-34a mimic, miR-34a antisense or the corresponding negative controls by Lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions. Total RNA and protein were isolated 24 or 48 h after transfection. Sequences of synthetic siRNAs, miRNA mimics and antisense strands are listed in Table F.
Table F. Sequences of synthetic siRNAs, miRNA mimics and antisense strands

RNA isolation and quantitative RT-PCR assay
Total RNA extraction, reverse transcription and TaqMan-based real-time PCR were performed as described previously. Briefly, total RNA was extracted from cultured cells and mouse tumors with TRIzol Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions.
For quantitative RT-PCR analysis of miRNAs, 100 ng of total RNA was reverse transcribed to cDNA using AMV reverse transcriptase (TaKaRa, Dalian, China) and stem-loop RT primers (Applied Biosystems, Foster City, CA) . The following reaction conditions were used: 16℃for 30 min, 42℃ for 30 min, and 85℃ for 5 min. Real-time RT-PCR was performed using TaqMan miRNA probes (Applied Biosystems) on an Applied Biosystems 7300 Sequence Detection System (Applied Biosystems) . The reactions were incubated in a 96-well optical plate at 95℃ for 10 min followed by 40 cycles at 95℃ for 15 s and 60℃ for 1 min. All reactions were run in triplicate. After the reactions were complete, the cycle threshold (CT) values were determined using fixed threshold settings, and the mean CT was determined from triplicate PCRs. The relative expression of miRNAs was determined using the 2-△△CT method, and U6 snRNA served as the internal control.
For mRNA analysis, 1 μg of total RNA was reverse transcribed to cDNA using AMV reverse transcriptase (TaKaRa) and oligo dT primer (TaKaRa) . The following reaction conditions were used: 16℃ for 30 min, 42℃ for 30 min, and 85℃ for 5 min. Real-time RT-PCR was performed using SYBRTM Green PCR Master Mix (Invitrogen, Carlsbad, CA, USA) on an Applied Biosystems 7300 Sequence Detection System. The reactions were incubated in a 96-well optical plate at 95℃ for 10 min followed by 40 cycles at 95℃ for 15 s and 60℃ for 1 min. All reactions were run in triplicate. After the reactions were complete, the CT values were determined using fixed threshold settings, and the mean CT was determined from the triplicate PCRs. The relative expression of mRNAs was determined using the 2-△△CT method, and β-actin mRNA served as the internal control. The primer sequences are listed in Table G.
Table G. Primer list

Protein extraction and western blotting
Cells were rinsed with cold PBS (pH 7.4) and then lysed in RIPA buffer (0.5%NP-40, 0.1%sodium deoxycholate, 150 mM NaCl and 50 mM Tris-HCl, pH 7.5) supplemented with a protease and phosphatase inhibitor cocktail (Thermo Scientific, Rockford, IL) on ice for 30 min. The tissue samples were flash frozen in liquid nitrogen, ground into powder and then lysed in RIPA buffer. The cell lysates and tissue homogenates were centrifuged for 10 min (12,000 × g at 4℃) , the supernatant was collected, and the protein concentration was determined using a Pierce BCA Protein Assay Kit (Thermo Scientific) . Equal amounts of protein (30-60 μg) were resolved via  10%–12.5%SDS-PAGE and then transferred to a PVDF membrane (Millipore, Bedford, MA) . The membrane was blocked in Tris-buffered saline Tween-20 (TBST) containing 5%bovine serum albumin and then incubated with the corresponding primary antibodies overnight at 4℃. After a 1 h incubation with HRP-conjugated secondary antibody, the protein level was detected using a luminal reagent. The data were quantified using ImageJ software (NIH, Bethesda, MD) , and relative protein expression was normalized to the value of GAPDH. Information on primary antibodies is listed in Table E.
For analyses of 3 different proteins (CD47, p-STAT3 and STAT3) and 1 internal control (GAPDH) in the same samples, sliced bands from the same blot were used. Based on the apparent molecular weights of CD47, p-STAT3, STAT3 and GAPDH (40～70, ～88, ～88 and 37 kD) , the PVDF membrane was cut at 40 kD and 70 kD into three parts (< 40 kD, 40～70 kD and >70 kD) . The three parts were then first blotted with CD47 (40～70 kD) , p-STAT3 (～88 kD) and GAPDH (37 kD) primary antibodies and detected with a secondary antibody. The upper PVDF membrane (> 70 kD) were then treated with antibody removal solution (Beyotime Biotechnology) to remove both primary and secondary antibodies and blotted with a STAT3 (～88 kD) antibody. For analysis of KRAS (21 kD) , p-STAT3 and STAT3 in the same samples, the PVDF membrane was cut at 35 kD and 70 kD into three parts (< 35 kD, 35～70 kD and > 70 kD) . The three parts were then first blotted with KRAS (21 kD) , p-STAT3 (～88 kD) and GAPDH (37 kD) ; the upper PVDF membrane (> 70 kD) were then stripped and blotted with STAT3 (～88 kD) antibody. The same experiment was repeated three times, and in each biological replicate, the sliced membranes were stripped only once (blotted twice) .
Luciferase reporter assay
For analysis of the direct binding of miR-34a to CD47, the 3’-UTR of CD47 was inserted into a firefly luciferase reporter plasmid (GenScript, Nanjing, China) . For determination of the binding specificity, sequences that interacted with the miR-34a seed sequence were mutated from ACTGCC, CACTGCC and ACTGCC to TGACGG, GTGACGG and TGACGG, respectively, and the mutant CD47 3’-UTR fragment was inserted into the same reporter plasmid. The β-galactosidase (β-gal) plasmid was included as a transfection control. In the luciferase assay, HEK293T cells were cultured in DMEM containing 10%FBS and seeded in 24-well plates. At 24 h after plating, 0.2 μg of wild-type or mutant luciferase reporter plasmid, 0.1 μg of β-gal plasmid and equal amounts (20 pmol) of miR-34a mimic or control mimic (GenePharma) were co-transfected into cells with Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. At 24 h post-transfection, the cells were analyzed using a luciferase assay kit (Cat#E4550, Promega, Madison, WI) to determine the fluorescence intensity. All experiments were performed in triplicate wells for each condition and repeated three times independently.
In vitro phagocytosis assay
Peripheral blood mononuclear cells (PBMCs) were isolated via density gradient centrifugation using Ficoll-Hypaque (GE Healthcare) from healthy donors. CD14+ monocytes were isolated by magnetic column purification based on positive selection with anti-CD14 microbeads (Miltenyi Biotec) with a purity of 96%. Then, 1 × 106 CD14+ cells were cultured in RPMI 1640 medium supplemented with 2 mmol/mL glutamine, 100 μg/mL ticarpen and 10%FBS (complete RPMI) and stimulated with granulocyte-macrophage colony stimulating factor (GM-CSF) at 25 ng/mL for 7 days to generate macrophages.
The phagocytosis assay was conducted as previously described27, 28. Briefly, macrophages were plated at a density of 5 × 104 cells per well in a 24-well tissue-culture plate in complete DMEM supplemented with GM-CSF overnight before the experiment. H358 cells were pre-transfected with KRASG12C plasmid, miR-34a mimic or CD47 plasmid and their corresponding negative controls for 48 h and then stained with 2.5 μM carboxyfluorescein succinimidyl ester (CFSE) at 37℃ for 10 min. Macrophages were incubated in serum-free medium for 2 h before addition of 2 × 105 CFSE-labelled H358 cells. After coculture for 2 h at 37℃, the cells were harvested, the macrophages were stained with APC-labelled anti-F4/80 antibody (BD Biosciences) , and flow cytometry (FACScalibur, BD Biosciences) was performed to detect CFSE+F4/80+ cells. A total of 10,000 cells in each sample were analyzed. Phagocytosis was calculated as the percentage of CFSE+F4/80+ cells (Q2) among CFSE+ cells (Q1+Q2) : phagocytosis (%) = [Q2/ (Q1+Q2) ] ×100%.
For direct visualization of the phagocytosed H358 cells by macrophages, a phagocytosis assay was performed by fluorescence microscopy29. Briefly, a GFP-encoding lentivirus was prepared from the pCDH-CMV construct using standard techniques and transfected into H358 cells to generate GFP+ cells. Macrophages were plated at a density of 5 × 104 cells per well in a 24-well tissue culture plate. GFP+ H358 cells were pre-transfected with KRASG12C plasmid, miR-34a mimic or CD47 plasmid and their corresponding negative controls for 48 h. Macrophages were incubated in serum-free medium for 2 h. Then, 2 × 104 GFP+ H358 cells were added to the macrophage-containing wells and incubated for 2 h at 37℃. Macrophages were repeatedly washed and subsequently examined by fluorescence microscopy (Leica DMI6000B) . Macrophages that were GFP+ represent macrophages containing phagocytosed H358 cells. The phagocytic index was calculated as the number of phagocytosed GFP+ cells per 100 macrophages.
IHC analysis in tissue microarray
Commercial tissue microarray chips containing 157 pairs of lung adenocarcinoma samples and normal adjacent tissue (NAT) samples were purchased from Shanghai Outdo Biotech (Shanghai, China) . Each sample dot with a diameter of 1.5 mm and a thickness of 4 μm was  prepared according to a standard method. All patients had been pathologically diagnosed with adenocarcinoma after operation, and follow-up data (range 0–120 months) were available. Informed consent was obtained for all patients. The IHC analysis was performed as described previously30. Briefly, the tissue sections were blocked with goat serum and then incubated with anti-CD47 (1: 100, Abcam, ab175388) , anti-p-STAT3 (1: 100, 9145S, Cell Signaling Technology, MA, USA) or anti-p-AKT (1: 100, 4066S, Cell Signaling Technology) antibodies overnight at 4℃. The sections were stained with 3, 3-diaminobenzidine and counterstained with hematoxylin after being incubated with secondary antibody. All IHC sample dots were assessed by two independent pathologists blinded to both the sample origins and the subject outcomes. Both staining intensity and positive percentage were used to examine the expression of CD47, p-STAT3 and p-AKT in the lung cancer tissues: the IHC staining score was scored according to the extent of cell staining (≤ 10%positive cells for 0; 11%–50%positive cells for 2; 51%–80%positive cells for 3; > 80%positive cells for 4) and the staining intensity (no staining for 0; slight staining for 1; moderate staining for 2; strong staining for 3) . Scores for the percentage of positive cells and the staining intensity were added. The CD47, p-STAT3 and p-AKT expression levels in the NSCLC tissues were considered medium expression when the score of each protein was in the range of average score ± 20%in all samples; high expression was considered higher than medium expression; low expression was considered lower than medium expression. Patient information related to the tissue microarray is shown in Table D.
In addition, a tissue microarray containing 12 pairs of KRASMUT NSCLC and normal adjacent tissue samples and 28 pairs of KRASWT NSCLC and normal adjacent tissue samples was obtained from the Jiangsu Biobank of Clinical Resources. All patients had been pathologically diagnosed with adenocarcinoma after operation, and informed consent was obtained for all patients. IHC analysis in the tissue microarray was performed with anti-CD47 and anti-p-STAT3 antibodies as described above. Patient information related to the tissue microarray is shown in Table D.
Orthotopic models of NSCLC
To generate an orthotopic model of human lung cancer, 5 × 106 H358 cells stably transfected with eGFP were intravenously injected into BALB/c nude mice via the tail vein. After 3 weeks, one mouse was euthanatized every week to ensure successful lung tumor formation by immunofluorescence. Then, the tumor-bearing mice were divided into three groups and monitored to determine macrophage infiltration by immunofluorescence at different times.
To generate an orthotopic model of lung cancer in immune competent mice, 5 × 106 LLC cells were intravenously injected into C57BL/6 mice via the tail vein. After 15 days, the mice were monitored using non-invasive micro-CT scanning to ensure successful tumor formation in the lungs. Then, the tumor-bearing mice were randomly divided into two groups and were orally  administered with 100 mg/kg AMG 510 or vehicle control. After 8 days, the mice were euthanized to evaluate lung tumor burden by histopathological staining. Excised lung tumors were also processed to determine CD47 expression and macrophage infiltration by western blotting, immunofluorescence staining or IHC analyses. Moreover, single cell suspensions of tumors were prepared for flow cytometry as described previously. Briefly, tumors were placed in 1.0 mL RPMI 1640 with Liberase TL (0.2 mg/ml; Roche) and DNase I (20 μg/ml; Ambion) , and minced with scissors to sub-millimeter pieces. Tissues were homogenized in the MACS tissue homogenizer using the gentleMACS program according to the manufacturer’s instructions and then incubated at 37℃ for 40 min. Specimens were passed through a 70 mm mesh and centrifuged at 350 g for 5 min. Cell pellets were resuspended and cell labelling was performed by incubating 1 × 106 cells with 0.5μg of fluorescently conjugated antibodies directed against mouse F4/80 (BD Biosciences) . Intracellular iNOS antibody (BD Biosciences) staining was performed following the intracellular staining protocol. Samples were fixed in 4%paraformaldehyde, washed, resuspended in FACS buffer, and analyzed by flow cytometry (FACScalibur, BD Biosciences) .
Statistical analysis
All statistical tests were performed using the open-source statistics package R or using GraphPad Prism software 8 (San Diego, CA) . Data are presented as the mean ± SEM. Differences were considered statistically significant at p < 0.05. Normality and equal variances between group samples were assessed using the Shapiro-Wilk test and Brown–Forsythe tests, respectively. When normality and equal variance were achieved between sample groups, one-way ANOVA (followed by Bonferroni’s multiple comparisons test) , two-way ANOVA (followed by Bonferroni’s multiple comparisons test) or t-tests were used. Where normality or equal variance of samples failed, Kruskal–Wallis one-way ANOVA (followed by Dunn’s correction) or Mann–Whitney U tests were performed.
Study approval
All patient samples were obtained from Jiangsu Biobank of Clinical Resources (located at Jiangsu Cancer Hospital, Nanjing, China) . These samples were collected from NSCLC patients receiving surgery at the Jiangsu Cancer Hospital, China. Informed consent was obtained from each patient, and the collection of tissue specimens was approved by the Internal Review and Ethics Boards at Jiangsu Cancer Hospital. All animal care and handling procedures were performed in accordance with the National Institutes of Health’s Guide for the Care and Use of Laboratory Animals and were approved by the Ethical Committee of Nanjing University (Nanjing, China) .
The present invention has been described in terms of particular embodiments found or proposed by the present inventor to comprise preferred modes for the practice of the invention. It will be appreciated by those of skill in the art that, in light of the present disclosure, numerous  modifications and changes can be made in the particular embodiments exemplified without departing from the intended scope of the invention. For example, due to codon redundancy, changes can be made in the underlying DNA sequence without affecting the protein sequence. Moreover, due to biological functional equivalency considerations, changes can be made in protein structure without affecting the biological action in kind or amount. All such modifications are intended to be included within the scope of the appended claims.

Claims (35)

  1. A method of treating cancer in an individual, comprising administering an effective amount of an agent that blocks the interaction between CD47 and SIRPα, wherein the cancer has been determined to comprise one or more cells that comprise a mutation that activates the KRAS signaling pathway.
  2. A method of treating cancer in an individual, comprising
    (a) determining whether the cancer in the individual comprises one or more cells that comprise a mutation that activates the KRAS signaling pathway, and
    (b) administering an effective amount of an agent that blocks the interaction between CD47 and SIRPα to the individual who has been determined to have the cancer that comprises one or more cells that comprise a mutation that activates the KRAS signaling pathway.
  3. A method of predicting whether an individual with cancer is likely to respond to treatment with an agent that blocks the interaction between CD47 and SIRPα comprising determining whether the cancer in the individual comprises one or more cells that comprise a mutation that activates the KRAS signaling pathway, wherein the presence of a mutation that activates the KRAS signaling pathway in one or more cells of the cancer indicates that the individual is likely to respond to the treatment.
  4. The method of any one of claims 1-3, wherein the mutation that activates the KRAS signaling pathway is a mutation in an amino acid sequence of a wild type KRAS.
  5. The method of any one of claims 4, wherein the mutation in the amino acid sequence of the wild type KRAS is an amino acid substitution at position 12 relative to a wild type KRAS set forth in SEQ ID NO: 37 or SEQ ID NO: 38.
  6. The method of claim 4, wherein the amino acid substitution at position 12 relative to the wild type KRAS set forth in SEQ ID NO: 37 or SEQ ID NO: 38 is selected from the group consisting of: G12C, G12D, G12V, G12W, G12R, and G12A.
  7. The method of any one of claims 1-6, wherein the mutation that activates the KRAS signaling pathway is a mutation in an amino acid sequence of a wild type PIK3CA.
  8. The method of claim 7, wherein the mutation in the amino acid sequence of the wild type PIK3CA is an amino acid substitution at position 345, 542, 545, or 1047 relative to a wild type PIK3CA set forth in SEQ ID NO: 41.
  9. The method of claim 8, wherein the amino acid substitution at position 345, 542, 545, or 1047 relative to a wild type PIK3CA set forth in SEQ ID NO: 41is selected from the group consisting of: N345K, E542K, E545K, H1047L, and H1047R.
  10. The method of any one of claims 1-9, wherein the mutation that activates the KRAS signaling pathway is a mutation in an amino acid sequence of a wild type STAT3.
  11. The method of any one of claims 110, wherein the mutation in the amino acid sequence of the wild type STAT3 is an amino acid substitution at position 174, 392, 427, 646, 658, 705, or 716 relative to a wild type STAT3 set forth in SEQ ID NO: 42.
  12. The method of any one of claim 11, wherein the amino acid substitution at position 174, 392, 427, 646, 658, 705, or 716 relative to a wild type STAT3 set forth in SEQ ID NO: 42is selected from the group consisting of: F174A, K392K, D427H, K392R, N646K, K658N, T705F, and T716M.
  13. The method of any one of claims 1-12, wherein the mutation that activates the KRAS signaling pathway is a germline mutation.
  14. The method of claim 13, wherein the germline mutation is identified in one or more cells in a blood sample or buccal sample from the individual.
  15. The method of any one of claims 1-12, wherein the mutation that activates the KRAS signaling pathway is a somatic mutation.
  16. The method of claim 15, wherein the somatic mutation is identified in sample containing the one or more cells of the cancer from the individual.
  17. The method of any one of claims 1-16, wherein the presence of the mutation that activates the KRAS signaling pathway in the one or more cells of the cancer is determined via  nucleic acid sequencing or polymerase chain reaction (PCR) , fluorescence in situ hybridization (FISH) , or denaturing high performance liquid chromatography (DHPLC) .
  18. The method of any one of claims 1-3, wherein the mutation that activates the KRAS signaling pathway results in overexpression of MEK protein (pMEK) in the one or more cancer cells.
  19. The method of claim 18, wherein the one or more cancer cells are considered to overexpress pMEK when an expression level of the pMEK in a sample comprising the cancer cells from the individual is higher than an expression level of the pMEK in a reference sample from a healthy individual.
  20. The method of any one of claims 1-3 and 18-19, wherein the mutation that activates the KRAS signaling pathway results in overexpression of AKT protein (pAKT) in the one or more cancer cells.
  21. The method of claim 20, wherein the one or more cancer cells are considered to overexpress pMEK when an expression level of the pAKT in a sample comprising the cancer cells from the individual is higher than an expression level of the pAKT in a reference sample from a healthy individual.
  22. The method of any one of claims 1-3 and 18-21, wherein the mutation that activates the KRAS signaling pathway results in overexpression of STAT3 protein (pSTAT3) in the one or more cancer cells in the individual.
  23. The method of claim 22, wherein the one or more cancer cells are considered to overexpress pSTAT3 when an expression level of the pSTAT3 in a sample comprising the cancer cells from the individual is higher than an expression level of the pSTAT3 in a reference sample from a healthy individual.
  24. The method of any one of claims 1-3 an 15-23, wherein the presence of the mutation that activates the KRAS signaling pathway in the one or more cells of the cancer is determined via assessed via Western blot, ELISA, or immunofluorescence.
  25. The method of any one of claims 1-3, wherein the mutation that activates the KRAS signaling pathway results in low level of microRNA-34a (miR-34a) in the one or more cancer cells.
  26. The method claim 25, wherein the one or more cancer cells are considered to have the low level of miR-34a when an expression level of the miR-34a in a sample comprising the one or more cancer cells from the individual is lower than an expression level of the miR-34a in a reference sample from a healthy individual.
  27. The method of any one of claims 1-3 and 25-26, wherein the presence of the mutation that activates the KRAS signaling pathway in the one or more cells of the cancer is determined via quantitative reverse transcription-polymerase chain reaction (RT-PCR) , Northern blot, in situ hybridization, and/or nuclease protection assay.
  28. The method of any one of claims 1-27, wherein the agent that blocks the interaction between CD47 and SIRPα is anti-CD47 antibody or immunologically active fragment thereof.
  29. The method of claim 28, wherein the anti-CD47 antibody is CC-90002, 5F9, LQ001, HLX24, TI-061, AO-176, SRF-231, IBI-188, IMC-002, SHR-1603, STI-6643, ZL-1201, or an immunologically active fragment thereof.
  30. The method of any one of claim 28, wherein the anti-CD47 antibody or immunologically active fragment thereof comprises three complementarity determining regions (CDRs) of a heavy chain variable domain (VH) set forth in SEQ ID NO: 1 and three CDRs of a light chain variable domain (VL) set forth in SEQ ID NO: 2.
  31. The method of claim 28, wherein the anti-CD47 antibody or immunologically active fragment thereof comprises:
    (a) a VH that comprises (1) a CDR-H1 comprising RAWMN (SEQ ID NO: 5) ; (2) a CDR-H2 comprising RIKRKTDGETTDYAAPVKG (SEQ ID NO: 6) ; and (3) a CDR-H3 comprising SNRAFDI (SEQ ID NO: 7) and
    (b) a VL that comprises (1) a CDR-L1 comprising KSSQSVLYAGNNRNYLA (SEQ ID NO: 8) ; (2) a CDR-L2 comprising QASTRAS (SEQ ID NO: 9) ; and (3) a CDR-L3 comprising QQYYTPPLA (SEQ ID NO: 10) , wherein the CDR sequences are defined according to the Kabat numbering system.
  32. The method of claim 28 or 31, wherein the VH domain of the anti-CD47 antibody or immunologically active fragment thereof comprises an amino acid sequence that has at least 95%identity to SEQ ID NO: 1, and the VL of the anti-CD47 antibody or immunologically active fragment thereof comprises an amino acid sequence that has at least 95%identity to SEQ ID NO: 2.
  33. The method of any one of claims 28, 31, and 32, wherein the anti-CD47 antibody comprises a heavy chain that comprises SEQ ID NO: 3 or SEQ ID NO: 35 and a light chain that comprises SEQ ID NO: 4.
  34. A kit comprising an anti-CD47 antibody, wherein the kit is for use according to the method of any one of claims 1-33.
  35. The kit of claim 33, wherein the kit further comprises a label or package insert stating that the agent that blocks the interaction between CD47 (e.g., hCD47) and SIRPα (e.g., hSIRPα) is to be used in in treating cancer in an individual, wherein the cancer comprises one or more cells that comprise a mutation that activates the KRAS signaling pathway.
PCT/CN2023/079650 2022-03-04 2023-03-03 Methods for treating cancer WO2023165618A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN2022079305 2022-03-04
CNPCT/CN2022/079305 2022-03-04

Publications (1)

Publication Number Publication Date
WO2023165618A1 true WO2023165618A1 (en) 2023-09-07

Family

ID=87883100

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2023/079650 WO2023165618A1 (en) 2022-03-04 2023-03-03 Methods for treating cancer

Country Status (1)

Country Link
WO (1) WO2023165618A1 (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120282174A1 (en) * 2009-09-15 2012-11-08 Weissman Irving L Synergistic Anti-CD47 Therapy for Hematologic Cancers
US20200102387A1 (en) * 2018-09-27 2020-04-02 Celgene Corporation SIRP-Alpha BINDING PROTEINS AND METHODS OF USE THEREOF
US20220033506A1 (en) * 2015-12-11 2022-02-03 The Board Of Trustees Of The Leland Stanford Junior University Treatment of cancer with dual targeting of cd47 and egfr

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120282174A1 (en) * 2009-09-15 2012-11-08 Weissman Irving L Synergistic Anti-CD47 Therapy for Hematologic Cancers
US20220033506A1 (en) * 2015-12-11 2022-02-03 The Board Of Trustees Of The Leland Stanford Junior University Treatment of cancer with dual targeting of cd47 and egfr
US20200102387A1 (en) * 2018-09-27 2020-04-02 Celgene Corporation SIRP-Alpha BINDING PROTEINS AND METHODS OF USE THEREOF

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
HU HUANHUAN, CHENG RONGJIE, WANG YANBO, WANG XIAOJUN, WU JIANZHUANG, KONG YAN, ZHAN SHOUBIN, ZHOU ZHEN, ZHU HONGYU, YU RANRAN, LIA: "Oncogenic KRAS signaling drives evasion of innate immune surveillance in lung adenocarcinoma by activating CD47", JOURNAL OF CLINICAL INVESTIGATION, vol. 133, no. 2, 17 January 2023 (2023-01-17), pages 1 - 18, XP093088510, DOI: 10.1172/JCI153470 *
MAUTE R., XU J., WEISSMAN I.L.: "CD47–SIRPα-targeted therapeutics: status and prospects", vol. 13, 1 March 2022 (2022-03-01), pages 100070, XP093028949, DOI: 10.1016/j.iotech.2022.100070 *

Similar Documents

Publication Publication Date Title
JP6894952B2 (en) Combination of PD-1 antagonist and VEGFR inhibitor for cancer treatment
CN111213059B (en) Diagnostic and therapeutic methods for cancer
JP7212902B2 (en) Compositions and methods for controlling renalase in the treatment of diseases and disorders
KR20190134631A (en) How to diagnose and treat cancer
JP2018534927A (en) Gene signature that determines ICOS expression
JP6890546B2 (en) TNFRSF14 / HVEM protein and method of its use
JP7289420B6 (en) AMHRII-binding compounds for preventing or treating lung cancer
US20230088070A1 (en) Use of il-1beta binding antibodies
JP6372930B2 (en) Malignant tumor treatment
KR20210106531A (en) Compositions and methods for treating cancer
EP3822284A1 (en) Epitope specific to smo protein, antibody recognizing same, and composition comprising same
WO2023165618A1 (en) Methods for treating cancer
JP2022500378A (en) Treatment of cancer by inhibiting the ubiquitin-conjugating enzyme E2K (UBE2K)
TW202300527A (en) Method of treating diseases using gremlin1 antagonists
JP7481255B2 (en) Antibody-drug conjugate sensitivity markers
TWI730450B (en) Antibody, kit comprising the same, and uses thereof
JP7148151B2 (en) Compositions and methods for treating cancer using anti-renalase and anti-PD-1 antibodies
EP2917347B1 (en) Methods and pharmaceutical compositions for the treatment of bone metastases
WO2021202959A1 (en) Therapeutic and diagnostic methods for cancer
RU2797506C2 (en) Amhrii binding compounds for the prevention or treatment of lung cancers
WO2022241293A2 (en) Cd274 mutations for cancer treatment
WO2023077104A2 (en) Novel kinase fusions detected by liquid biopsy
JP2022521541A (en) Cells, compositions, and methods for enhancing immune function

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23763016

Country of ref document: EP

Kind code of ref document: A1