WO2023164696A2 - Rnai agents of prion expression - Google Patents

Rnai agents of prion expression Download PDF

Info

Publication number
WO2023164696A2
WO2023164696A2 PCT/US2023/063353 US2023063353W WO2023164696A2 WO 2023164696 A2 WO2023164696 A2 WO 2023164696A2 US 2023063353 W US2023063353 W US 2023063353W WO 2023164696 A2 WO2023164696 A2 WO 2023164696A2
Authority
WO
WIPO (PCT)
Prior art keywords
oligomeric
modified
modified oligonucleotide
certain embodiments
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2023/063353
Other languages
English (en)
French (fr)
Other versions
WO2023164696A3 (en
Inventor
Hien Thuy ZHAO
Susan M. Freier
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ionis Pharmaceuticals Inc
Original Assignee
Ionis Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ionis Pharmaceuticals Inc filed Critical Ionis Pharmaceuticals Inc
Priority to JP2024550753A priority Critical patent/JP2025507749A/ja
Priority to US18/841,971 priority patent/US20260028623A1/en
Priority to EP23761016.7A priority patent/EP4486892A2/en
Publication of WO2023164696A2 publication Critical patent/WO2023164696A2/en
Publication of WO2023164696A3 publication Critical patent/WO2023164696A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7115Nucleic acids or oligonucleotides having modified bases, i.e. other than adenine, guanine, cytosine, uracil or thymine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/712Nucleic acids or oligonucleotides having modified sugars, i.e. other than ribose or 2'-deoxyribose
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7125Nucleic acids or oligonucleotides having modified internucleoside linkage, i.e. other than 3'-5' phosphodiesters
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/02Inorganic compounds
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/46Ingredients of undetermined constitution or reaction products thereof, e.g. skin, bone, milk, cotton fibre, eggshell, oxgall or plant extracts
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3222'-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • C12N2310/334Modified C
    • C12N2310/33415-Methylcytosine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/341Gapmers, i.e. of the type ===---===
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/351Conjugate
    • C12N2310/3519Fusion with another nucleic acid

Definitions

  • RNAi agents, methods, and pharmaceutical compositions for reducing the amount or activity of PRNP RNA in a cell or a subject, and in certain instances reducing the amount of prion protein (PrP) in a cell or a subject.
  • Such agents, methods, and pharmaceutical compositions are useful to ameliorate at least one symptom or hallmark of a neurodegenerative disease associated with PrP.
  • Such symptoms and hallmarks include rapidly progressing dementia, personality changes, ataxia, hallucinations, myoclonus (muscle jerks), chorea, autonomic disturbances, impaired vision, insomnia, blindness, loss of speech, coma, death, spongiform changes in the brain, development of abnormal protein aggregates, neuronal loss, gliosis, and the presence of markers of neuronal loss.
  • Such neurodegenerative diseases include prion diseases, such as Creutzfeldt-Jakob disease (CJD) (e.g., variant Creutzfeldt-Jakob Disease (vCJD), classic Creutzfeldt-Jakob Disease (cCJD), familial Creutzfeldt-Jakob Disease (fCJD), and sporadic Creutzfeldt-Jakob Disease (sCJD)), Gerstmann-Straussler-Scheinker syndrome, fatal familial insomnia, and kuru; synucleinopathies such as Alzheimer’s disease, Parkinson’s disease, and dementia with Lewy bodies; and tauopathies such as frontal temporal dementia associated with a Tau mutation, Pick’s disease, progressive supranuclear palsy, corticobasal neurodegeneration, and chronic traumatic encephalopathy (CTE).
  • CJD Creutzfeldt-Jakob disease
  • vCJD variant Creutzfeldt-Jakob Disease
  • cCJD classic
  • Prion diseases also known as transmissible spongiform encephalopathies or TSEs
  • TSEs transmissible spongiform encephalopathies
  • Prion diseases are a family of rare, progressive, neurodegenerative disorders that affect both humans and non-human animals. Such diseases are caused by the misfolding of the normal prion protein (“PrP c ”) and are distinguished by long incubation periods and characteristic spongiform changes associated with neuronal loss (Senesi, et al., “In vivo prion models and the disconnection between transmissibility and neurotoxicity”, Ageing Research Reviews 2017, 36: 156-164; Erana, et al., Biochem. And Biophys. Res.
  • PrP c normal prion protein
  • Hallmarks of prion diseases include, but are not limited to, spongiform changes in the brain, development of abnormal protein aggregates, neuronal loss, gliosis, and the presence of markers of neuronal loss (Sigurdson, et al., “Cellular and Molecular Mechanisms of Prion Disease,” Annu. Rev. Pathol. Meeh. Dis. 2019, 14: 497-516).
  • Symptoms of prion diseases include, but are not limited to, rapidly progressing dementia, personality changes, ataxia, hallucinations, myoclonus (muscle jerks), chorea, autonomic disturbances, impaired vision, insomnia, blindness, loss of speech, coma, and death.
  • CJD Creutzfeldt-Jakob disease
  • vCJD variant Creutzfeldt-Jakob Disease
  • cCJD classic CJD
  • fCJD familial CJD
  • sCJD sporadic CJD
  • GSS Gerstmann-Straussler-Scheinker syndrome
  • FI fatal familial insomnia
  • Prion protein can occur in several distinct conformational states: a normal cellular form, PrP c , and the protease-resistant scrapie, disease-causing form, hypothesized to represent an ensemble of misfolded conformers, collectively referred to as scrapie or disease-causing prion protein, “PrP Sc ” (Senesi, 2017).
  • the scrapie form of the prion protein, PrP Sc is the causative agent of transmissible spongiform encephalopathies. Both forms of the protein have the same amino acid sequence, encoded by PRNP gene, and differ only in how they are folded in three-dimensional space.
  • PrP Sc forms aggregates and is resistant to proteolytic degradation by proteinase K.
  • the infectious PrP Sc can cause misfolding of normal cellular PrP c , converting it to the proteinase K-resistant PrP Sc .
  • This causes an increase in cellular levels of PrP Sc , leading to increased protein aggregation as well as spread of the misfolded form throughout the CNS.
  • the patient rapidly develops the characteristic signs and symptoms of prion disease, which is always fatal.
  • PrP c has also been implicated as a molecular target in synucleinopathies, such as Parkinson’s disease and dementia with Lewy bodies (Ferreira, et. al., “a- synuclein interacts with PrPC to induce cognitive impairment through mGluR5 and NMDAR2B”, Nature Neuroscience, 2017, 20: 1569-157) and Alzheimer’s disease (Purro, et al., “Alzheimer’s”, Biological Psychiatry, 2018, 83(4):358-368).
  • synucleinopathies such as Parkinson’s disease and dementia with Lewy bodies (Ferreira, et. al., “a- synuclein interacts with PrPC to induce cognitive impairment through mGluR5 and NMDAR2B”, Nature Neuroscience, 2017, 20: 1569-157) and Alzheimer’s disease (Purro, et al., “Alzheimer’s”, Biological Psychiatry, 2018, 83(4):358-368).
  • PrP c has further been implicated as a molecular target in tauopathies (Corbett et al., “PrP is a central player in toxicity mediated by soluble aggregates of neurodegeneration-causing proteins,” Actta Neuropathologica (2020, 139:503-526).
  • tauopathies include, but are not limited to, frontal temporal dementia associated with a Tau mutation, Pick’s disease, progressive supranuclear palsy, corticobasal neurodegeneration, and chronic traumatic encephalopathy (CTE).
  • PrP c and PrP Sc can be detected in cerebrospinal fluid (CSF).
  • PrP c can be detected in CSF by standard methods such as western blot and enzyme linked immunoabsorbant assay (ELISA).
  • the infectious PrP Sc can be detected in the CSF of prion-infected patients via a RT-QuIC test (real-time quaking induced conversion), as described by Orru, et. al., mBio, “Rapid and sensitive RT-QuIC detection of human Creutzfeldt-Jakob disease using cerebrospinal fluid,” 2015, 6(1): e02451-14.
  • RNAi agents RNA silencing complex
  • RISC RNA silencing complex
  • RNAi agents for reducing the amount or activity of PRNP RNA, and in certain embodiments reducing the amount of prion protein in a cell or a subject.
  • the subject has a neurodegenerative disease associated with PrP.
  • the neurodegenerative disease is a prion disease.
  • the neurodegenerative disease is a synucleinopathy.
  • the neurodegenerative disease is a tauopathy.
  • the neurodegenerative disease is Creutzfeldt- Jakob disease (CJD) (e.g., variant Creutzfeldt-Jakob Disease (vCJD), classic Creutzfeldt-Jakob Disease (cCJD), familial Creutzfeldt- Jakob Disease (fCJD), or sporadic Creutzfeldt-Jakob Disease (sCJD)), Gerstmann- Straussler-Scheinker syndrome (GSS), fatal familial insomnia (FFI), kuru, Alzheimer’s disease, Parkinson’s disease, dementia with Lewy bodies, frontal temporal dementia associated with a Tau mutation, Pick’s disease, progressive supranuclear palsy, corticobasal neurodegeneration, or chronic traumatic encephalopathy (CTE).
  • CJD Creutzfeldt- Jakob disease
  • vCJD variant Creutzfeldt-Jakob Disease
  • cCJD classic Creutzfeldt-Jakob Disease
  • fCJD
  • RNAi agents useful for reducing expression of PRNP RNA are oligomeric duplexes. In certain embodiments, RNAi agents useful for reducing expression of PRNP RNA are antisense agents. In certain embodiments, the oligomeric duplexes comprise modified oligonucleotides. In certain embodiments, the oligomeric duplexes comprise antisense RNAi oligonucleotides.
  • the neurodegenerative disease is a prion disease.
  • the neurodegenerative disease is a synucleinopathy.
  • the neurodegenerative disease is a tauopathy.
  • the neurodegenerative disease is Creutzfeldt-Jakob disease (CJD) (e.g., variant Creutzfeldt-Jakob Disease (vCJD), classic Creutzfeldt-Jakob Disease (cCJD), familial Creutzfeldt-Jakob Disease (fCJD), or sporadic Creutzfeldt-Jakob Disease (sCJD)), Gerstmann-Straussler-Scheinker syndrome (GSS), fatal familial insomnia (FFI), kuru, Alzheimer’s disease, Parkinson’s disease, dementia with Lewy’s Bodies, frontal temporal dementia associated with a Tau mutation, Pick’s disease, progressive supranuclear palsy, corticobasal neurodegeneration, or chronic traumatic encephalopathy (CTE).
  • CJD Creutzfeldt-Jakob disease
  • vCJD variant Creutzfeldt-Jakob Disease
  • cCJD classic Creutzfeldt-Jakob Disease
  • the symptom or hallmark includes rapidly progressing dementia, personality changes, ataxia, hallucinations, myoclonus (muscle jerks), chorea, autonomic disturbances, impaired vision, insomnia, blindness, loss of speech, coma, death, spongiform changes in the brain, development of abnormal protein aggregates, neuronal loss, gliosis, and the presence of markers of neuronal loss.
  • 2 ’-deoxynucleoside means a nucleoside comprising a 2’-H(H) deoxyribosyl sugar moiety.
  • a 2 ’-deoxynucleoside is a 2’-P-D-deoxynucleoside and comprises a 2’-P-D-deoxyribosyl sugar moiety, which has the P-D ribosyl configuration as found in naturally occurring deoxyribonucleic acids (DNA).
  • a 2 ’-deoxynucleoside or a nucleoside comprising an unmodified 2 ’-deoxyribosyl sugar moiety may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil).
  • 2 ’-MOE means a 2’-OCH2CH2OCH3 group in place of the 2 ’-OH group of a ribosyl sugar moiety.
  • a “2’-M0E sugar moiety” means a sugar moiety with a 2’-OCH2CH2OCH3 group in place of the 2’-OH group of a ribosyl sugar moiety. Unless otherwise indicated, a 2’-M0E sugar moiety is in the P-D-ribosyl configuration.
  • MOE means O-methoxyethyl.
  • 2’-M0E nucleoside or “2’- O(CH2)2OCH3 nucleoside” or “2’-OCH2CH2OCH3 nucleoside” means a nucleoside comprising a 2 ’-MOE sugar moiety (or 2’-O(CH2)2OCH3 ribosyl sugar moiety).
  • “2’-0Me” means a 2’-OCH3 group in place of the 2’-OH group of a ribosyl sugar moiety.
  • A“2’-0-methyl sugar moiety” or “2’-0Me sugar moiety” or “2’-O-methylribosyl sugar moiety” means a sugar moiety with a 2’-OCH3 group in place of the 2’-OH group of a ribosyl sugar moiety. Unless otherwise indicated, a 2’-0Me sugar moiety is in the P-D-ribosyl configuration.
  • “2’-0Me nucleoside” or “2’-0Me modified nucleoside” means a nucleoside comprising a 2’-0Me sugar moiety.
  • 2’-F means a 2’-fluoro group in place of the 2’-OH group of a furanosyl sugar moiety.
  • a “2’-F sugar moiety” means a sugar moiety with a 2’-F group in place of the 2’-OH group of a furanosyl sugar moiety. Unless otherwise indicated, a 2’-F sugar moiety is in the P-D-ribosyl configuration.
  • 2’-F nucleoside or “2’-F modified nucleoside” means a nucleoside comprising a 2’-F modified sugar moiety.
  • xylo 2’-F means a 2’-F sugar moiety in the -D-xylosyl configuration.
  • 2 ’-substituted nucleoside means a nucleoside comprising a 2 ’-substituted furanosyl sugar moiety.
  • 2’ -substituted in reference to a sugar moiety means a sugar moiety comprising at least one 2'-substituent group other than H or OH.
  • 3’ target site refers to the 3 ’-most nucleotide of a target nucleic acid which is complementary to an antisense oligonucleotide, when the antisense oligonucleotide is hybridized to the target nucleic acid.
  • 5’ target site refers to the 5 ’-most nucleotide of a target nucleic acid which is complementary to an antisense oligonucleotide, when the antisense oligonucleotide is hybridized to the target nucleic acid.
  • 5-methylcytosine means a cytosine modified with a methyl group attached to the 5 position.
  • a 5-methylcytosine is a modified nucleobase.
  • abasic sugar moiety means a sugar moiety of a nucleoside that is not attached to a nucleobase. Such abasic sugar moieties are sometimes referred to in the art as “abasic nucleosides.”
  • administering means providing a pharmaceutical agent or composition to a subject.
  • “ameliorate” in reference to a treatment means improvement in at least one symptom or hallmark relative to the same symptom or hallmark in the absence of the treatment.
  • amelioration is the reduction in the severity or frequency of a symptom or hallmark or the delayed onset or slowing of progression in the severity or frequency of a symptom or hallmark.
  • the symptom or hallmark is rapidly progressing dementia, personality changes, ataxia, hallucinations, myoclonus (muscle jerks), chorea, autonomic disturbances, impaired vision, insomnia, blindness, loss of speech, coma, death, spongiform changes in the brain, a development of abnormal protein aggregates, neuronal loss, gliosis, or the presence of markers of neuronal loss.
  • the progression or severity of indicators may be determined by subjective or objective measures, which are known to those skilled in the art.
  • antisense activity means any detectable and/or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid.
  • antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound.
  • antisense agent means an antisense compound and optionally one or more additional features, such as a sense compound.
  • antisense compound means an antisense oligonucleotide and optionally one or more additional features, such as a conjugate group.
  • antisense oligonucleotide means an oligonucleotide, including the oligonucleotide portion of an antisense compound, that is capable of hybridizing to a target nucleic acid and is capable of at least one antisense activity.
  • Antisense oligonucleotides include, but are not limited to, antisense RNAi oligonucleotides and antisense RNase H oligonucleotides.
  • sense compound means a sense oligonucleotide and optionally one or more additional features, such as a conjugate group.
  • sense oligonucleotide means an oligonucleotide, including the oligonucleotide portion of an oligomeric compound, that is capable of hybridizing to an antisense oligonucleotide.
  • Sense oligonucleotides include, but are not limited to, sense RNAi oligonucleotides.
  • bicyclic nucleoside or “BNA” means a nucleoside comprising a bicyclic sugar moiety.
  • bicyclic sugar or “bicyclic sugar moiety” means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure.
  • the first ring of the bicyclic sugar moiety is a furanosyl sugar moiety.
  • the furanosyl sugar moiety is a ribosyl sugar moiety.
  • the bicyclic sugar moiety does not comprise a furanosyl sugar moiety.
  • oligomeric duplex As used herein, “blunt” or “blunt ended” in reference to an oligomeric duplex means that there are no terminal unpaired nucleotides (i.e. no overhanging nucleotides). One or both ends of an oligomeric duplex can be blunt.
  • cell-targeting moiety means a conjugate group or portion of a conjugate group that is capable of binding to a particular cell type or particular cell types.
  • Cerebrospinal fluid or “CSF” means the fluid filling the space around the brain and spinal cord.
  • Artificial cerebrospinal fluid” or “aCSF” means a prepared or manufactured fluid that has certain properties (e.g., osmolarity, pH, and/or electrolytes) similar to cerebrospinal fluid and is biocompatible with CSF.
  • cleavable moiety means a bond or group of atoms that is cleaved under physiological conditions, for example, inside a cell, an animal, or a human.
  • complementary in reference to an oligonucleotide means that at least 70% of the nucleobases of the oligonucleotide or one or more portions thereof and the nucleobases of another nucleic acid or one or more portions thereof are capable of hydrogen bonding with one another when the nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions.
  • complementary nucleobases means nucleobases that are capable of forming hydrogen bonds with one another.
  • Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5 -methylcytosine ( m C) and guanine (G).
  • Certain modified nucleobases that pair with natural nucleobases or with other modified nucleobases are known in the art.
  • inosine can pair with adenosine, cytosine, or uracil.
  • Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated.
  • oligonucleotide or a portion thereof, means that the oligonucleotide, or portion thereof, is complementary to another oligonucleotide or nucleic acid at each nucleobase of the shorter of the two oligonucleotides, or at each nucleoside if the oligonucleotides are the same length.
  • complementary region in reference to an oligonucleotide is the range of nucleobases of the oligonucleotide that is complementary with a second oligonucleotide or target nucleic acid.
  • conjugate group means a group of atoms that is directly attached to an oligonucleotide.
  • Conjugate groups include a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.
  • conjugate linker means a single bond or a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.
  • conjugate moiety means a group of atoms that is attached to an oligonucleotide via a conjugate linker.
  • oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or intemucleoside linkages that are immediately adjacent to each other.
  • contiguous nucleobases means nucleobases that are immediately adjacent to each other in a sequence.
  • constraining ethyl or “cEt” or “cEt sugar moiety” means a P-D ribosyl bicyclic sugar moiety wherein the second ring of the bicyclic sugar is formed via a bridge connecting the d’carbon and the 2 ’-carbon of the -D ribosyl sugar moiety, wherein the bridge has the formula 4'- CH(CH3)-O-2', and wherein the methyl group of the bridge is in the S configuration.
  • cEt nucleoside means a nucleoside comprising a cEt sugar moiety.
  • chirally enriched population or “chirally enriched” in reference to a population means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom as defined herein. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers.
  • the molecules are modified oligonucleotides.
  • the molecules are oligomeric compounds comprising modified oligonucleotides.
  • the chiral center is at the phosphorous atom of a phosphorothioate intemucleoside linkage.
  • “diluent” means an ingredient in a composition that lacks pharmacological activity, but is pharmaceutically necessary or desirable.
  • the diluent in an injected composition can be a liquid, e.g., aCSF, PBS, or saline solution.
  • double-stranded in reference to a region or an oligonucleotide means a duplex formed by complementary strands of nucleic acids (including, but not limited to oligonucleotides) hybridized to one another.
  • the two strands of a double-stranded region are separate molecules.
  • the two strands are regions of the same molecule that has folded onto itself (e.g., a hairpin structure).
  • duplex or “duplex region” means the structure formed by two oligonucleotides or portions thereof that are hybridized to one another.
  • hotspot region is a range of nucleobases on a target nucleic acid that is amenable to RNAi agent-mediated reduction of the amount or activity of the target nucleic acid.
  • hybridization means the annealing of oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.
  • complementary nucleic acid molecules include, but are not limited to, an antisense compound and a nucleic acid target. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense oligonucleotide and a nucleic acid target.
  • intemucleoside linkage is the covalent linkage between adjacent nucleosides in an oligonucleotide.
  • modified intemucleoside linkage means any intemucleoside linkage other than a phosphodiester intemucleoside linkage.
  • Phosphorothioate intemucleoside linkage is a modified intemucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester intemucleoside linkage is replaced with a sulfur atom.
  • inverted nucleoside means a nucleotide having a 3’ to 3’ and/or 5’ to 5’ intemucleoside linkage, as shown herein.
  • inverted sugar moiety means the sugar moiety of an inverted nucleoside or an abasic sugar moiety having a 3’ to 3’ and/or 5’ to 5’ intemucleoside linkage.
  • lipid nanoparticle is a vesicle comprising a lipid layer encapsulating a pharmaceutically active molecule, such as a nucleic acid molecule, e.g., an RNAi agent or a plasmid from which an RNAi agent is transcribed.
  • a pharmaceutically active molecule such as a nucleic acid molecule, e.g., an RNAi agent or a plasmid from which an RNAi agent is transcribed.
  • LNPs are described in, for example, U.S. Patent Nos. 6,858,225, 6,815,432, 8,158,601, and 8,058,069, the entire contents of which are hereby incorporated herein by reference.
  • linked nucleosides are nucleosides that are connected in a contiguous sequence (i.e., no additional nucleosides are presented between those that are linked).
  • linker-nucleoside means a nucleoside that links, either directly or indirectly, an oligonucleotide to a conjugate moiety. Linker-nucleosides are located within the conjugate linker of an oligomeric compound. Linker-nucleosides are not considered part of the oligonucleotide portion of an oligomeric compound even if they are contiguous with the oligonucleotide.
  • mismatch or “non-complementary” means a nucleobase of a first nucleic acid sequence that is not complementary with the corresponding nucleobase of a second nucleic acid sequence when the first and second nucleic acid sequences are aligned in opposing directions.
  • modified nucleoside means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety.
  • motif means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or intemucleoside linkages, in an oligonucleotide.
  • neurodegenerative disease or “neurodegenerative disease associated with PrP” means a condition marked by progressive loss of function or structure, including loss of neuronal function and death of neurons.
  • the neurodegenerative disease is a prion disease.
  • the neurodegenerative disease is a synucleinopathy or a tauopathy in which the respective alpha-synuclein or tau induced toxicity is mediated by a PrP-depedent mechanism.
  • the neurodegenerative disease is Creutzfeldt-Jakob disease (CJD) (e.g., variant Creutzfeldt-Jakob Disease (vCJD), classic Creutzfeldt-Jakob Disease (cCJD), familial Creutzfeldt-Jakob Disease (fCJD), or sporadic Creutzfeldt-Jakob Disease (sCJD)), Gerstmann-Straussler-Scheinker syndrome, fatal familial insomnia, kuru, Alzheimer’s disease, Parkinson’s disease, dementia with Lewy bodies, frontal temporal dementia associated with a Tau mutation, Pick’s disease, progressive supranuclear palsy, corticobasal neurodegeneration, or chronic traumatic encephalopathy (CTE).
  • CJD Creutzfeldt-Jakob disease
  • vCJD variant Creutzfeldt-Jakob Disease
  • cCJD classic Creutzfeldt-Jakob Disease
  • fCJD familial Creutzfeldt
  • non-bicyclic modified sugar moiety means a modified sugar moiety that comprises a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring.
  • nucleobase means an unmodified nucleobase or a modified nucleobase.
  • an “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G).
  • a “modified nucleobase” is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one unmodified nucleobase.
  • a “5 -methylcytosine” is a modified nucleobase.
  • a universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases.
  • nucleobase sequence means the order of contiguous nucleobases in a target nucleic acid or oligonucleotide, including such nucleobases that are each optionally independently modified or unmodified, and independent of any sugar or intemucleoside linkage modification.
  • nucleobase sequence of’ a reference SEQ ID NO refers only to the nucleobase sequence provided in such SEQ ID NO and therefore, unless otherwise indicated, includes compounds wherein each nucleobase, each sugar moiety, and each intemucleoside linkage, independently, may be modified or unmodified, irrespective of the presence or absence of modifications, indicated in the referenced SEQ ID NO.
  • nucleoside means a compound, or a fragment of a compound, comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each, independently, unmodified or modified.
  • nucleoside overhang refers to unpaired nucleosides at either or both ends of an oligomeric duplex formed by hybridization of two oligonucleotides.
  • oligomeric agent means an oligomeric compound and optionally one or more additional features, such as a second oligomeric compound.
  • An oligomeric agent may be a singlestranded oligomeric compound or may be an oligomeric duplex formed by two complementary oligomeric compounds.
  • oligomeric compound means an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group.
  • An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound or may be unpaired.
  • a “singled-stranded oligomeric compound” is an unpaired oligomeric compound.
  • oligomeric duplex means a duplex formed by two oligomeric compounds having complementary nucleobase sequences.
  • oligonucleotide means a polymer of linked nucleosides connected via intemucleoside linkages, wherein each nucleoside and intemucleoside linkage may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8-50 linked nucleosides.
  • modified oligonucleotide means an oligonucleotide, wherein at least one nucleoside or intemucleoside linkage is modified.
  • unmodified oligonucleotide means an oligonucleotide that does not comprise any nucleoside modifications or intemucleoside modifications.
  • pharmaceutically acceptable carrier or diluent means any substance suitable for use in administering to an animal. Certain such carriers enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, symps, slurries, suspension and lozenges for the oral ingestion by a subject.
  • a pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution or sterile artificial cerebrospinal fluid.
  • pharmaceutically acceptable salts means physiologically and pharmaceutically acceptable salts of compounds. Pharmaceutically acceptable salts retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.
  • a pharmaceutical composition means a mixture of substances suitable for administering to to a subject.
  • a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution.
  • a pharmaceutical composition shows activity in free uptake assay in certain cell lines.
  • prodrug means a therapeutic agent in a first form outside the body that is converted to a second form within a subject or cells thereof. Typically, conversion of a prodrug within the subject is facilitated by the action of an enzymes (e.g., endogenous or viral enzyme) or chemicals present in cells or tissues and/or by physiologic conditions.
  • a prodrug is an inactive or less active form of a compound which, when administered to a subject, is metabolized to form the active, or more active, compound.
  • a prodrug comprises a cell-targeting moiety and at least one active compound.
  • PrP c means the normal cellular form of prion protein (PrP).
  • PrP Sc means the protease-resistant, disease-causing form of prion protein.
  • RNA means an RNA transcript and includes pre-mRNA and mature mRNA unless otherwise specified.
  • RNAi agent means an antisense compound or an antisense agent that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and/or protein encoded by a target nucleic acid.
  • RNAi agents include, but are not limited to double-stranded siRNA, single -stranded RNA (ssRNAi), and microRNA, including microRNA mimics.
  • RNAi agents may comprise conjugate groups and/or terminal groups.
  • an RNAi agent modulates the amount, activity, and/or splicing of a target nucleic acid.
  • the term RNAi agent excludes antisense agents that act through RNase H.
  • RNAi oligonucleotide means an oligonucleotide comprising a region that is complementary to a target sequence, and which includes at least one chemical modification suitable for RNAi-mediated nucleic acid reduction.
  • standard in vitro assay means the assay described in Example 2 and reasonable variations thereof.
  • the number of molecules having the (.S') configuration of the stereorandom chiral center may be but is not necessarily the same as the number of molecules having the (R) configuration of the stereorandom chiral center (racemic).
  • the stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method that is not designed to control the stereochemical configuration.
  • a stereorandom chiral center is a stereorandom phosphorothioate intemucleoside linkage.
  • stabilized phosphate group means a 5 ’-phosphate analog that is metabolically more stable than a 5 ’-phosphate as naturally occurs on DNA or RNA.
  • subject means a human or non-human animal. In certain embodiments, the subject is a human.
  • subject and animal are used interchangeable herein.
  • sugar moiety means an unmodified sugar moiety or a modified sugar moiety.
  • unmodified sugar moiety means a 2’-0H(H) P-D-ribosyl sugar moiety, as found in RNA (an “unmodified RNA sugar moiety”), or a 2’-H(H) -D-deoxyribosyl sugar moiety, as found in DNA (an “unmodified DNA sugar moiety”).
  • Unmodified sugar moieties have one hydrogen at each of the 1’, 3’, and 4’ positions, an oxygen at the 3’ position, and two hydrogens at the 5’ position.
  • modified sugar moiety or “modified sugar” means a modified furanosyl sugar moiety or a sugar surrogate.
  • sugar surrogate means a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an intemucleoside linkage, conjugate group, or terminal group in an oligonucleotide.
  • Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or target nucleic acids.
  • symptom or “hallmark” means any physical feature or test result that indicates the existence or extent of a disease or disorder.
  • a symptom is apparent to a subject or to a medical professional examining or testing the subject.
  • a hallmark is apparent upon invasive diagnostic testing, including, but not limited to, post-mortem tests.
  • a hallmark is apparent on a brain MRI scan.
  • symptoms and hallmarks include rapidly progressing dementia, personality changes, ataxia, hallucinations, myoclonus (muscle jerks), chorea, autonomic disturbances, impaired vision, insomnia, blindness, loss of speech, coma, death, spongiform changes in the brain, development of abnormal protein aggregates, neuronal loss, gliosis, and the presence of markers of neuronal loss.
  • target nucleic acid and “target RNA” mean a nucleic acid that an antisense compound is designed to affect.
  • Target RNA means an mRNA transcript and includes pre-mRNA and mRNA unless otherwise specified.
  • target region means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.
  • terminal group means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.
  • treating means improving a subject’s disease or condition by administering an oligomeric agent, an oligomeric compound, an oligomeric duplex, or an antisense agent described herein.
  • treating a subject improves a symptom relative to the same symptom in the absence of the treatment.
  • treatment reduces in the severity or frequency of a symptom, or delays the onset of a symptom, slows the progression of a symptom, or slows the severity or frequency of a symptom.
  • terapéuticaally effective amount means an amount of a pharmaceutical agent or composition that provides a therapeutic benefit to an animal. For example, a therapeutically effective amount improves a symptom of a disease.
  • Embodiment 1 An oligomeric compound, wherein the oligomeric compound comprises a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 20-175 and wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified intemucleoside linkage.
  • the nucleobase sequence of the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 20-175 and wherein the modified
  • Embodiment 2 The oligomeric compound of embodiment 1, wherein the nucleobase sequence of the modified oligonucleotide comprises the nucleobase sequence of any of SEQ ID NOs: 20-175.
  • Embodiment 3 The oligomeric compound of embodiment 1, wherein the nucleobase sequence of the modified oligonucleotide consists of the nucleobase sequence of any of SEQ ID NOs: 20-175.
  • Embodiment 4 The oligomeric compound of any of embodiments 1-3, wherein the nucleobase sequence of the modified oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleobase sequence of an equal length portion of any of SEQ ID NOs: 1-9.
  • Embodiment 5 The oligomeric compound of any of embodiments 1-4, wherein the modified oligonucleotide consists of 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18, 16 to 20, 16 to 25, 16 to
  • Embodiment 6 The oligomeric compound of any of embodiments 1-5, wherein the nucleobase sequence of the modified oligonucleotide is complementary to at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 contiguous nucleobases of an equal length portion of nucleobases 839-895 of SEQ ID NO: 1; an equal length portion of nucleobases 1179-1235 of SEQ ID NO: 1; an equal length portion of nucleobases 1332-1371 of SEQ ID NO: 1; an equal length portion of nucleobases 1383-1507 of SEQ ID NO: 1; an equal length portion of nucleobases 1553-1660 of SEQ ID NO: 1; an equal length portion of nucleobases 1672-1711 of SEQ ID NO: 1; an equal length portion of nucleobases 1808-1915 of SEQ ID NO: 1; an equal length
  • Embodiment 7 The oligomeric compound of any of embodiments 1-6, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 contiguous nucleobases of a nucleobase sequence selected from:
  • Embodiment 8 The oligomeric compound of any of embodiments 1-6, wherein the nucleobase sequence of the modified oligonucleotide comprises or consists of the nucleobase sequence selected from:
  • Embodiment 9 The oligomeric compound of any of embodiments 1-8, wherein at least one nucleoside of the modified oligonucleotide comprises a modified sugar moiety.
  • Embodiment 10 The oligomeric compound of embodiment 9, wherein the modified sugar moiety comprises a bicyclic sugar moiety.
  • Embodiment 11 The oligomeric compound of embodiment 10, wherein the bicyclic sugar moiety comprises a 2’-4’ bridge, wherein the 2’-4’ bridge is selected from -O-CH2-; and -0-04(043)-.
  • Embodiment 12 The oligomeric compound of embodiment 9, wherein the modified sugar moiety is a non-bicyclic modified sugar moiety.
  • Embodiment 13 The oligomeric compound of embodiment 12, wherein the non-bicyclic modified sugar moiety is a 2’-M0E sugar moiety, a 2’-0Me sugar moiety, or a 2’-F sugar moiety.
  • Embodiment 14 The oligomeric compound of embodiment 9, wherein the modified sugar moiety is a sugar surrogate.
  • Embodiment 15 The oligomeric compound of embodiment 14, wherein the sugar surrogate is selected from morpholino, modified morpholino, glycol nucleic acid (GNA), six-membered tetrahydropyran (TEIP), and F-hexitol nucleic acid (F-HNA).
  • the sugar surrogate is selected from morpholino, modified morpholino, glycol nucleic acid (GNA), six-membered tetrahydropyran (TEIP), and F-hexitol nucleic acid (F-HNA).
  • Embodiment 16 The oligomeric compound of any of embodiments 1-15, wherein the modified oligonucleotide comprises at least one modified intemucleoside linkage.
  • Embodiment 17 The oligomeric compound of embodiment 16, wherein the at least one modified intemucleoside linkage is a phosphorothioate intemucleoside linkage.
  • Embodiment 18 The oligomeric compound of embodiment 16, wherein the at least one modified intemucleoside linkage is a mesyl phosphoramidate intemucleoside linkage.
  • Embodiment 19 The oligomeric compound of any of embodiments 1-18, wherein each intemucleoside linkage of the modified oligonucleotide is independently selected from a phosphorothioate intemucleoside linkage, a phosphodiester intemucleoside linkage, and a mesyl phosphoramidate intemucleoside linkage.
  • Embodiment 20 The oligomeric compound of any of embodiments 1-19, wherein each intemucleoside linkage of the modified oligonucleotide is independently selected from a phosphodiester intemucleoside linkage and a phosphorothioate intemucleoside linkage.
  • Embodiment 21 The oligomeric compound of any of embodiments 1-19, wherein each intemucleoside linkage of the modified oligonucleotide is independently selected from a phosphodiester intemucleoside linkage and a mesyl phosphoramidate intemucleoside linkage.
  • Embodiment 22 The oligomeric compound of any of embodiments 1-21, wherein the modified oligonucleotide has a backbone motif of 5’- ssooooooooooooooooooss -3’, wherein each “s” is a phosphorothioate intemucleoside linkage and each “o” is a phosphodiester intemucleoside linkage.
  • Embodiment 23 The oligomeric compound of any of embodiments 1-22, wherein the modified oligonucleotide comprises at least one modified nucleobase.
  • Embodiment 24 The oligomeric compound of embodiment 23, wherein the modified nucleobase is 5 -methylcytosine.
  • Embodiment 25 The oligomeric compound of embodiment 23 or embodiment 24, wherein each cytosine is a 5 -methylcytosine.
  • Embodiment 26 The oligomeric compound of embodiment 23 or embodiment 24, wherein one or more cytosine nucleobases are unmodified.
  • Embodiment 27 The oligomeric compound of any of embodiments 1-26, wherein the modified oligonucleotide has a sugar motif of: 5’- yfyfyfyfyfyfyfyfyfyfyfyyyyy -3’, wherein each “y” represents a 2'- OMe sugar moiety, and each “f ’ represents a 2'-F sugar moiety.
  • Embodiment 28 The oligomeric compound of any of embodiments 1-27, wherein the oligomeric compound comprises a conjugate group.
  • Embodiment 29 The oligomeric compound of embodiment 28, wherein the conjugate group comprises a conjugate moiety and a conjugate linker.
  • Embodiment 30 The oligomeric compound of embodiment 29, wherein the conjugate moiety is a lipophilic group.
  • Embodiment 31 The oligomeric compound of embodiment 29 or embodiment 30, wherein the conjugate moiety is selected from a C22 alkyl, C20 alkyl, C16 alkyl, CIO alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, Cl l alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, CIO alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, Cl l alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 al
  • Embodiment 32 The oligomeric compound of any of embodiments 29-31, wherein the conjugate linker consists of a single bond.
  • Embodiment 33 The oligomeric compound of any of embodiments 29-32, wherein the conjugate linker is cleavable.
  • Embodiment 34 The oligomeric compound of any of embodiments 1-33, comprising a terminal group.
  • Embodiment 35 The oligomeric compound of embodiment 34, wherein the terminal group is a 5 ’-stabilized phosphate group.
  • Embodiment 36 The oligomeric compound of embodiment 35, wherein the 5 ’-stabilized phosphate group is selected from cyclopropylphosphonate and vinylphosphonate.
  • Embodiment 37 The oligomeric compound of any of embodiments 1-36, wherein the modified oligonucleotide is an antisense oligonucleotide.
  • Embodiment 38 The oligomeric compound of any of embodiments 1-37, wherein the modified oligonucleotide is an antisense RNAi oligonucleotide.
  • Embodiment 39 An oligomeric duplex, comprising a first oligomeric compound and a second oligomeric compound comprising a second modified oligonucleotide, wherein the first oligomeric compound is an oligomeric compound of any of embodiments 1-38.
  • Embodiment 40 The oligomeric duplex of embodiment 39, wherein the second oligomeric compound comprises a second modified oligonucleotide consisting of 12 to 50 linked nucleosides, and wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to the nucleobase sequence of an equal length portion of the first modified oligonucleotide.
  • Embodiment 41 The oligomeric duplex of embodiment 39, wherein the second oligomeric compound comprises a second modified oligonucleotide consisting of 12 to 50 linked nucleosides, and wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or 21 nucleobases that is at least 95% complementary to an equal length portion of the first modified oligonucleotide.
  • Embodiment 42 The oligomeric duplex of embodiment 39, wherein the second oligomeric compound comprises a second modified oligonucleotide consisting of 12 to 50 linked nucleosides, and wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or 21 nucleobases that is 100% complementary to an equal length portion of the first modified oligonucleotide.
  • Embodiment 43 The oligomeric duplex of any of embodiments 39-42, wherein at least one nucleoside of the second modified oligonucleotide comprises a modified sugar moiety.
  • Embodiment 44 The oligomeric duplex of embodiment 43, wherein the modified sugar moiety comprises a bicyclic sugar moiety.
  • Embodiment 45 The oligomeric duplex of embodiment 44, wherein the bicyclic sugar moiety comprises a 2’-4’ bridge, wherein the 2’-4’ bridge is selected from -O-CH2-; and -O-CE ⁇ CEfi)-.
  • Embodiment 46 The oligomeric duplex of embodiment 43, wherein the modified sugar moiety is a non-bicyclic modified sugar moiety.
  • Embodiment 47 The oligomeric duplex of embodiment 46, wherein the non-bicyclic modified sugar moiety is a 2’-MOE sugar moiety, a 2’-OMe sugar moiety, or a 2’-F sugar moiety.
  • Embodiment 48 The oligomeric duplex of embodiment 43, wherein the modified sugar moiety is a sugar surrogate.
  • Embodiment 49 The oligomeric duplex of embodiment 48, wherein the sugar surrogate is selected from morpholino, modified morpholino, glycol nucleic acid (GNA), six-membered tetrahydropyran (TEIP), and F-hexitol nucleic acid (F-HNA).
  • the sugar surrogate is selected from morpholino, modified morpholino, glycol nucleic acid (GNA), six-membered tetrahydropyran (TEIP), and F-hexitol nucleic acid (F-HNA).
  • Embodiment 50 The oligomeric duplex of any of embodiments 39-49, wherein the second modified oligonucleotide comprises at least one modified intemucleoside linkage.
  • Embodiment 51 The oligomeric duplex of embodiment 50, wherein the at least one modified intemucleoside linkage is a phosphorothioate intemucleoside linkage.
  • Embodiment 52 The oligomeric duplex of embodiment 50, wherein the at least one modified intemucleoside linkage is a mesyl phosphoramidate intemucleoside linkage.
  • Embodiment 53 The oligomeric duplex of any of embodiments 39-52, wherein each intemucleoside linkage of the second modified oligonucleotide is independently selected from a phosphorothioate intemucleoside linkage, a phosphodiester intemucleoside linkage, and a mesyl phosphoramidate intemucleoside linkage.
  • Embodiment 54 The oligomeric duplex of any of embodiments 39-53, wherein each intemucleoside linkage of the second modified oligonucleotide is independently selected from a phosphodiester intemucleoside linkage and a phosphorothioate intemucleoside linkage.
  • Embodiment 55 The oligomeric duplex of any of embodiments 39-53, wherein each intemucleoside linkage of the second modified oligonucleotide is independently selected from a phosphodiester intemucleoside linkage and a mesyl phosphoramidate intemucleoside linkage.
  • Embodiment 56 The oligomeric duplex of any of embodiments 39-55, wherein the second modified oligonucleotide has a backbone motif of 5’ - ssooooooooooooooooss -3’, wherein each “s” is a phosphorothioate intemucleoside linkage and each “o” is a phosphodiester intemucleoside linkage.
  • Embodiment 57 The oligomeric duplex of any of embodiments 39-56, wherein the second modified oligonucleotide comprises at least one modified nucleobase.
  • Embodiment 58 The oligomeric duplex of embodiment 57, wherein the modified nucleobase is 5 -methylcytosine .
  • Embodiment 59 The oligomeric duplex of embodiment 57 or embodiment 58, wherein each cytosine is a 5 -methylcytosine.
  • Embodiment 60 The oligomeric duplex of embodiment 57 or embodiment 58, wherein one or more cytosine nucleobases are unmodified.
  • Embodiment 61 The oligomeric duplex of any of embodiments 39-59, wherein the second modified oligonucleotide has a sugar motif of: 5’- fyfyfyfyfyfyfyfyfyfyfyfyfyfyf -3’, wherein each “y” represents a 2'-OMe sugar moiety, and each “f ’ represents a 2'-F sugar moiety.
  • Embodiment 62 An oligomeric duplex comprising: a first oligomeric compound comprising a first modified oligonucleotide consisting of 18 to 30 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 20-175; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 29 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to the nucleobase sequence of an equal length portion of the first modified oligonucleotide.
  • Embodiment 63 An oligomeric duplex comprising: a first oligomeric compound comprising a first modified oligonucleotide consisting of 18 to 30 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 20-175; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 29 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or 21 contiguous nucleobases of
  • Embodiment 64 An oligomeric duplex comprising: a first oligomeric compound comprising a first modified oligonucleotide consisting of 23 linked nucleosides and has a nucleobase sequence of consisting of the nucleobase sequence of any of SEQ ID NOs: 20-175; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 21 linked nucleosides, wherein the second modified oligonucleotide has a nucleobase sequence consisting of the nucleobase sequence of any of SEQ ID NOs: 176-331, and wherein the nucleobase sequence of the second modified oligonucleotide is at least 90% complementary to the nucleobase sequence of an equal length portion of the first modified oligonucleotide.
  • Embodiment 65 The oligomeric duplex of any of embodiments 62-64, wherein the nucleobase sequence of the second modified oligonucleotide is at least 95% of 100% complementary to the nucleobase sequence of an equal length portion of the first modified oligonucleotide.
  • Embodiment 66 The oligomeric duplex of any of embodiments 62-65, wherein the first modified oligonucleotide comprises a 5 ’-stabilized phosphate group.
  • Embodiment 67 The oligomeric duplex of embodiment 66, wherein the 5 ’-stabilized phosphate group comprises a cyclopropylphosphonate or a vinylphosphonate.
  • Embodiment 68 The oligomeric duplex of any of embodiments 62-67, wherein at least one nucleoside of the first modified oligonucleotide and at least one nucleoside of the second modified oligonucleotide each independently comprises a modified sugar moiety.
  • Embodiment 69 The oligomeric duplex of embodiment 68, wherein the modified sugar moiety comprises a bicyclic sugar moiety.
  • Embodiment 70 The oligomeric duplex of embodiment 69, wherein the bicyclic sugar moiety comprises a 2’-4’ bridge, wherein the 2’-4’ bridge is selected from -O-CH2-; and -O-CH(CH3)-.
  • Embodiment 71 The oligomeric duplex of any of embodiments 62-70, wherein at least one nucleoside of the first modified oligonucleotide and at least one nucleoside of the second modified oligonucleotide each independently comprises a non-bicyclic modified sugar moiety.
  • Embodiment 72 The oligomeric duplex of embodiment 71, wherein the non-bicyclic modified sugar moiety is a 2’-M0E sugar moiety, a 2’-OMe sugar moiety, or a 2’-F sugar moiety.
  • Embodiment 73 The oligomeric duplex of any of embodiments 62-72, wherein at least one nucleoside of the first modified oligonucleotide or the second modified oligonucleotide each independently comprises a sugar surrogate.
  • Embodiment 74 The oligomeric duplex of embodiment 73, wherein the sugar surrogate is selected from morpholino, modified morpholino, glycol nucleic acid (GNA), six-membered tetrahydropyran (TEIP), and F-hexitol nucleic acid (F-HNA).
  • the sugar surrogate is selected from morpholino, modified morpholino, glycol nucleic acid (GNA), six-membered tetrahydropyran (TEIP), and F-hexitol nucleic acid (F-HNA).
  • Embodiment 75 The oligomeric duplex of any of embodiments 62-74, wherein the first modified oligonucleotide comprises at least one modified intemucleoside linkage.
  • Embodiment 76 The oligomeric duplex of any of embodiments 62-75, wherein the second modified oligonucleotide comprises at least one modified intemucleoside linkage
  • Embodiment 77 The oligomeric duplex of embodiment 75 or embodiment 76, wherein the at least one modified intemucleoside linkage is a phosphorothioate intemucleoside linkage.
  • Embodiment 78 The oligomeric duplex of embodiment 75 or embodiment 76, wherein the at least one modified intemucleoside linkage is a mesyl phosphoramidate intemucleoside linkage.
  • Embodiment 79 The oligomeric duplex of embodiment 75 or embodiment 77, wherein each intemucleoside linkage of the first modified oligonucleotide is independently selected from a phosphodiester intemucleoside linkage and a phosphorothioate intemucleoside linkage.
  • Embodiment 80 The oligomeric duplex of embodiment 75 or embodiment 78, wherein each intemucleoside linkage of the first modified oligonucleotide is independently selected from a phosphodiester intemucleoside linkage and a mesyl phosphoramidate intemucleoside linkage.
  • Embodiment 81 The oligomeric duplex of any of embodiments 75, 76, 77, 79, or 80, wherein each intemucleoside linkage of the second modified oligonucleotide is independently selected from a phosphodiester intemucleoside linkage and a phosphorothioate intemucleoside linkage.
  • Embodiment 82 The oligomeric duplex of any of embodiments 75, 76, 78, 79, or 80, wherein each intemucleoside linkage of the second modified oligonucleotide is independently selected from a phosphodiester intemucleoside linkage and a mesyl phosphoramidate intemucleoside linkage.
  • Embodiment 83 The oligomeric duplex of any of embodiments 62-82, wherein the first modified oligonucleotide has a backbone motif of 5’- ssooooooooooooooooooss -3’, wherein each “s” is a phosphorothioate intemucleoside linkage and each “o” is a phosphodiester intemucleoside linkage.
  • Embodiment 84 The oligomeric duplex of any of embodiments 62-83, wherein the second modified oligonucleotide has a backbone motif of 5’ - ssooooooooooooooooss -3’, wherein each “s” is a phosphorothioate intemucleoside linkage and each “o” is a phosphodiester intemucleoside linkage.
  • Embodiment 85 The oligomeric duplex of any of embodiments 62-84, wherein the first modified oligonucleotide and the second modified oligonucleotide each independently comprises at least one modified nucleobase.
  • Embodiment 86 The oligomeric duplex of embodiment 85, wherein the at least one modified nucleobase is 5 -methylcytosine.
  • Embodiment 87 The oligomeric duplex of embodiment 85 or embodiment 86, wherein each cytosine is a 5 -methylcytosine.
  • Embodiment 88 The oligomeric duplex of embodiment 85 or embodiment 86, wherein the first modified oligonucleotide and the second modified oligonucleotide each independently comprises one or more cytosine nucleobases that are unmodified.
  • Embodiment 89 The oligomeric duplex of any of embodiments 62-88, wherein at least one nucleoside of the first modified oligonucleotide comprises a 2’-F sugar moiety and the at least one nucleoside is at: position 2 or 14 from the 5’ end; position 2, 6, or 14 from the 5’ end; position 2, 14, or 16 from the 5’ end; position 2, 6, 14, or 16 from the 5’ end; or position 2, 6, 8, 9, 14, or 16 from the 5’ end.
  • Embodiment 90 The oligomeric duplex of any of embodiments 62-88, wherein the nucleosides of the first modified oligonucleotide each comprises a 2’-F sugar moiety and the nucleosides are at: positions 2 and 14 from the 5’ end; positions 2, 6, and 14 from the 5’ end; positions 2, 14, and 16 from the 5’ end; positions 2, 6, 14, and 16 from the 5’ end; or positions 2, 6, 8, 9, 14, and 16 from the 5’ end.
  • Embodiment 91 The oligomeric duplex of any of embodiments 62-88, wherein at least one nucleoside of the second modified oligonucleotide comprises a 2’-F sugar moiety and the at least one nucleoside is at: position 9, 10, or 11 from the 5’ end; position 7, 9, 10, or 11 from the 5’ end; position 11, 12, or 15 from the 5’ end; or position 7, 9, 10, 11, 12, or 15 from the 5’ end.
  • Embodiment 92 The oligomeric duplex of any of embodiments 62-88, wherein the nucleosides of the second modified oligonucleotide each comprises a 2’-F sugar moiety and the nucleosides are at: positions 9, 10, and 11 from the 5’ end; or positions 7, 9, 10, and 11 from the 5’ end.
  • Embodiment 93 The oligomeric duplex of embodiment 89 or embodiment 90, wherein the nucleosides at the remaining positions of the first modified oligonucleotide each comprises a 2’-OMe sugar moiety.
  • Embodiment 94 The oligomeric duplex of any of embodiments 89-93, wherein the nucleosides at the remaining positions of the second modified oligonucleotide each comprises a 2’-OMe sugar moiety.
  • Embodiment 95 The oligomeric duplex of any of embodiments 62-88, wherein the first modified oligonucleotide has a sugar motif of: 5’- yfyfyfyfyfyfyfyfyfyfyfyyyyyyyyyy -3’, wherein each “y” represents a 2'- OMe sugar moiety, and each “f ’ represents a 2'-F sugar moiety.
  • Embodiment 96 The oligomeric duplex of any of embodiments 62-88 or 95, wherein the second modified oligonucleotide has a sugar motif of: 5’- fyfyfyfyfyfyfyfyfyfyfyfyfyfyf -3’, wherein each “y” represents a 2'-0Me sugar moiety, and each “f ’ represents a 2'-F sugar moiety.
  • Embodiment 97 The oligomeric duplex of any of embodiments 62-96, wherein the second modified oligonucleotide comprises a conjugate group.
  • Embodiment 98 The oligomeric duplex of embodiment 97, wherein the conjugate group comprises a conjugate linker and a conjugate moiety.
  • Embodiment 99 The oligomeric duplex of embodiment 97 or embodiment 98, wherein the conjugate group is attached to the second modified oligonucleotide at the 5 ’-end of the second modified oligonucleotide.
  • Embodiment 100 The oligomeric duplex of embodiment 97 or embodiment 98, wherein the conjugate group is attached to the second modified oligonucleotide at the 3 ’-end of the second modified oligonucleotide.
  • Embodiment 101 The oligomeric duplex of embodiment 97 or embodiment 98, wherein the conjugate group is attached to the second modified oligonucleotide at the 2’-position of a furanosyl sugar moiety.
  • Embodiment 102 The oligomeric duplex of embodiment 97 or embodiment 98, wherein the conjugate group is attached to the second modified oligonucleotide through a modified intemucleoside linkage.
  • Embodiment 103 The oligomeric duplex of any of embodiments 97-102, wherein the conjugate group comprises a C22 alkyl, C20 alkyl, C16 alkyl, CIO alkyl, C21 alkyl, C19 alkyl, Cl 8 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, Cl l alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, CIO alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, Cl l alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl,
  • Embodiment 104 The oligomeric duplex of any of embodiments 39-103, wherein the second modified oligonucleotide comprises a terminal group.
  • Embodiment 105 The oligomeric duplex of embodiment 104, wherein the terminal group is an abasic sugar moiety.
  • Embodiment 106 The oligomeric duplex of any of embodiments 39-105, wherein the second modified oligonucleotide consists of 10 to 25, 10 to 30, 10 to 50, 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18,16 to 20, 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 25, 17 to 30, 17 to 50, 18 to 20, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, 20 to 50, 21 to 25, 21 to 30, 21 to 50, 22 to 25, 22 to 30, 22 to 50, 23 to 25, 23 to 30, or 23 to 50 linked nucleosides.
  • the second modified oligonucleotide consists of 10 to 25, 10 to 30, 10 to 50, 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50,
  • Embodiment 107 The oligomeric duplex of any of embodiments 39-106, wherein the first modified oligonucleotide consists of 23 linked nucleosides and the second modified oligonucleotide consists of 21 linked nucleosides.
  • Embodiment 108 An antisense agent, wherein the antisense agent is the oligomeric duplex of any of embodiments 39-107.
  • Embodiment 109 The antisense agent of embodiment 108, wherein the antisense agent is an RNAi agent capable of reducing the amount of PRNP RNA through the activation of RISC/Ago2.
  • Embodiment 110 A population of oligomeric duplexes of embodiments 39-107, wherein the population is chirally enriched for modified oligonucleotides comprising at least one particular phosphorothioate intemucleoside linkage having a particular stereochemical configuration.
  • Embodiment 111 The population of embodiment 110, wherein the population is chirally enriched for modified oligonucleotides having a particular, independently selected stereochemical configuration at each phosphorothioate intemucleoside linkage.
  • Embodiment 112. The population of embodiment 110, wherein the population is chirally enriched for modified oligonucleotides having the (Rp) configuration at one particular phosphorothioate intemucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate intemucleoside linkages, or the population is chirally enriched for modified oligonucleotides having the (Sp) configuration at each phosphorothioate intemucleoside linkage or for modified oligonucleotides having the (/?p) configuration at each phosphorothioate intemucleoside linkage.
  • Embodiment 113 A population of oligomeric compounds comprising modified oligonucleotides of any of embodiments 1-38, wherein all of the phosphorothioate intemucleoside linkages of the modified oligonucleotides are stereorandom.
  • Embodiment 114 A population of oligomeric duplexes of any of embodiments 39-107, wherein all of the phosphorothioate intemucleoside linkages of the modified oligonucleotide of the first oligomeric compound are stereorandom.
  • Embodiment 115 The population of oligomeric duplexes of embodiment 114, wherein all of the phosphorothioate intemucleoside linkages of the second modified oligonucleotide of the second oligomeric compound are stereorandom.
  • Embodiment 116 A pharmaceutical composition comprising the oligomeric compound of any of embodiments 1-38, the oligomeric duplex of any of embodiments 39-107, the antisense agent of any of embodiments 108-109, or the population of any of embodiments 110-115, and a pharmaceutically acceptable diluent or carrier.
  • Embodiment 117 The pharmaceutical composition of embodiment 116, wherein the pharmaceutically acceptable diluent is phosphate buffered saline (PBS) or artificial cerebrospinal fluid (aCSF).
  • PBS phosphate buffered saline
  • ACSF artificial cerebrospinal fluid
  • Embodiment 118 The pharmaceutical composition of embodiment 117, wherein the pharmaceutical composition consists essentially of the oligomeric compound of any of embodiments 1- 38, the oligomeric duplex of any of embodiments 39-107, the antisense agent of any of embodiments 108-109, or the population of any of embodiments 110-115, and aCSF.
  • Embodiment 119 The pharmaceutical composition of embodiment 117, wherein the pharmaceutical composition consists essentially of the oligomeric compound of any of embodiments 1- 38, the oligomeric duplex of any of embodiments 39-107, the antisense agent of any of embodiments 108-109, or the population of any of embodiments 110-115, and PBS.
  • Embodiment 120 A method comprising administering to a subject the oligomeric compound of any of embodiments 1-38, the oligomeric duplex of any of embodiments 39-107, the antisense agent of any of embodiments 108-109, the population of any of embodiments 110-115, or the pharmaceutical composition of any of embodiments 116-119.
  • Embodiment 121 The method of embodiment 120, wherein the subject has a prion disease.
  • Embodiment 122 The method of embodiment 120, wherein the subject has a synucleinopathy.
  • Embodiment 123 The method of embodiment 120, wherein the subject has atauopathy.
  • Embodiment 124 The method of embodiment 120, wherein the subject has Creutzfeldt-Jakob disease (CJD), Gerstmann-Straussler-Scheinker syndrome, fatal familial insomnia, kuru, Alzheimer’s disease, Parkinson’s disease, dementia with Lewy bodies, frontal temporal dementia associated with a Tau mutation, Pick’s disease, progressive supranuclear palsy, corticobasal neurodegeneration, or chronic traumatic encephalopathy (CTE).
  • CJD Creutzfeldt-Jakob disease
  • Gerstmann-Straussler-Scheinker syndrome fatal familial insomnia
  • kuru Alzheimer’s disease
  • Parkinson’s disease dementia with Lewy bodies
  • Pick’s disease progressive supranuclear palsy
  • corticobasal neurodegeneration or chronic traumatic encephalopathy (CTE).
  • CTE chronic traumatic encephalopathy
  • Embodiment 125 A method of treating a neurodegenerative disease associated with PrP comprising administering to a subject having or at risk of developing a neurodegenerative disease associated with PrP a therapeutically effective amount of the oligomeric compound of any of embodiments 1-38, the oligomeric duplex of any of embodiments 39-107, the antisense agent of any of embodiments 108-109, the population of any of embodiments 110-115, or the pharmaceutical composition of any of embodiments 116-119, thereby treating the neurodegenerative disease associated with PrP.
  • Embodiment 126 The method of embodiment 125, wherein the neurodegenerative disease associated with PrP is a prion disease.
  • Embodiment 127 The method of embodiment 125, wherein the neurodegenerative disease associated with PrP is a synucleinopathy.
  • Embodiment 128 The method of embodiment 125, wherein the neurodegenerative disease associated with PrP is a tauopathy.
  • Embodiment 129 The method of embodiment 125, wherein the neurodegenerative disease associated with PrP is Creutzfeldt-Jakob disease (CJD), Gerstmann-Straussler-Scheinker syndrome, fatal familial insomnia, kuru, Alzheimer’s disease, Parkinson’s disease, dementia with Lewy bodies, frontal temporal dementia associated with a Tau mutation, Pick’s disease, progressive supranuclear palsy, corticobasal neurodegeneration, or chronic traumatic encephalopathy (CTE).
  • CJD Creutzfeldt-Jakob disease
  • Gerstmann-Straussler-Scheinker syndrome fatal familial insomnia
  • kuru Alzheimer’s disease
  • Parkinson’s disease dementia with Lewy bodies
  • Pick’s disease progressive supranuclear palsy
  • corticobasal neurodegeneration or chronic traumatic encephalopathy (CTE).
  • CTE chronic traumatic encephalopathy
  • CJD Creutzfeldt- Jakob Disease
  • cCJD classic Creutzfeldt-Jakob Disease
  • fCJD familial Creutzfeldt-Jakob Disease
  • sCJD sporadic Creutzfeldt-Jakob Disease
  • Embodiment 131 The method of embodiment 125, wherein at least one symptom or hallmark of the neurodegenerative disease associated with PrP is ameliorated.
  • Embodiment 132 The method of embodiment 131, wherein the at least one symptom or hallmark is rapidly progressing dementia, personality changes, ataxia, hallucinations, myoclonus (muscle jerks), chorea, autonomic disturbances, impaired vision, insomnia, blindness, loss of speech, coma, death, spongiform changes in the brain, development of abnormal protein aggregates, neuronal loss, gliosis, or the presence of markers of neuronal loss.
  • the at least one symptom or hallmark is rapidly progressing dementia, personality changes, ataxia, hallucinations, myoclonus (muscle jerks), chorea, autonomic disturbances, impaired vision, insomnia, blindness, loss of speech, coma, death, spongiform changes in the brain, development of abnormal protein aggregates, neuronal loss, gliosis, or the presence of markers of neuronal loss.
  • Embodiment 133 The method of any of embodiments 125-132, wherein administering the oligomeric compound of any of embodiments 1-38, the oligomeric duplex of any of embodiments 39- 107, the antisense agent of any of embodiments 108-109, the population of any of embodiments 110-115, or the pharmaceutical composition of any of embodiments 116-119 reduces or delays the onset or progression of rapidly progressing dementia, personality changes, ataxia, hallucinations, myoclonus (muscle jerks), chorea, autonomic disturbances, impaired vision, insomnia, blindness, loss of speech, coma, spongiform changes in the brain, a development of abnormal protein aggregates, neuronal loss, or gliosis, or delays death, or reduces the presence of markers of neuronal loss.
  • Embodiment 134 The method of any of embodiments 120-133, wherein the oligomeric compound of any of embodiments 1-38, the oligomeric duplex of any of embodiments 39-107, the antisense agent of any of embodiments 108-109, the population of any of embodiments 110-115, or the pharmaceutical composition of any of embodiments 116-119 is administered to the central nervous system or systemically.
  • Embodiment 135. The method of any of embodiments 120-134, wherein the oligomeric compound of any of embodiments 1-38, the oligomeric duplex of any of embodiments 39-107, the antisense agent of any of embodiments 108-109, the population of any of embodiments 110-115, or the pharmaceutical composition of any of embodiments 116-119 is administered intrathecally.
  • Embodiment 136 The method of any of embodiments 120-135, wherein the subject is a human.
  • Embodiment 137 A method of reducing PRNP RNA in a cell comprising contacting the cell with the oligomeric compound of any of embodiments 1-38, the oligomeric duplex of any of embodiments 39-107, the antisense agent of any of embodiments 108-109, the population of any of embodiments 110-115, or the pharmaceutical composition of any of embodiments 116-119.
  • Embodiment 138 A method of reducing prion protein in a cell comprising contacting the cell with the oligomeric compound of any of embodiments 1-38, the oligomeric duplex of any of embodiments 39-107, the antisense agent of any of embodiments 108-109, the population of any of embodiments 110-115, or the pharmaceutical composition of any of embodiments 116-119.
  • Embodiment 139 The method of embodiment 137 or 138, wherein the cell is a neuron or a glial cell.
  • Embodiment 140 The method of embodiment 139, wherein the glial cell is an astrocyte.
  • Embodiment 141 The method of any of embodiments 137-140, wherein the cell is a human cell.
  • Embodiment 142 Use of the oligomeric compound of any of embodiments 1-38, the oligomeric duplex of any of embodiments 39-107, the antisense agent of any of embodiments 108-109, the population of any of embodiments 110-115, or the pharmaceutical composition of any of embodiments 116-119 for treating a neurodegenerative disease associated with PrP.
  • Embodiment 143 Use of the oligomeric compound of any of embodiments 1-38, the oligomeric duplex of any of embodiments 39-107, the antisense agent of any of embodiments 108-109, the population of any of embodiments 110-115, or the pharmaceutical composition of any of embodiments 116-119 in the manufacture of a medicament for treating a neurodegenerative disease associated with PrP.
  • Embodiment 144 The use of embodiment 142 or embodiment 143, wherein the neurodegenerative disease associated with PrP is a prion disease.
  • Embodiment 145 The use of embodiment 142 or embodiment 143, wherein the neurodegenerative disease associated with PrP is a synucleinopathy.
  • Embodiment 146 The use of embodiment 142 or embodiment 143, wherein the neurodegenerative disease associated with PrP is a tauopathy.
  • Embodiment 147 The use of embodiment 142 or embodiment 143, wherein the neurodegenerative disease associated with PrP is Creutzfeldt-Jakob disease (CJD), Gerstmann-Straussler- Scheinker syndrome, fatal familial insomnia, kuru, Alzheimer’s disease, Parkinson’s disease, dementia with Lewy bodies, frontal temporal dementia associated with a Tau mutation, Pick’s disease, progressive supranuclear palsy, corticobasal neurodegeneration, or chronic traumatic encephalopathy (CTE).
  • CJD Creutzfeldt-Jakob disease
  • Gerstmann-Straussler- Scheinker syndrome fatal familial insomnia, kuru, Alzheimer’s disease, Parkinson’s disease, dementia with Lewy bodies, frontal temporal dementia associated with a Tau mutation
  • Pick’s disease progressive supranuclear palsy
  • corticobasal neurodegeneration or chronic traumatic encephalopathy (CTE).
  • CTE chronic traumatic encephalopathy
  • oligomeric compounds comprising antisense oligonucleotides complementary to PRNP RNA and optionally, sense oligonucleotides complementary to the antisense oligonucleotides.
  • Antisense oligonucleotides and sense oligonucleotides typically comprise at least one modified nucleoside and/or at least one modified intemucleoside linkage. Certain modified nucleosides and modified intemucleoside linkages suitable for use in antisense oligonucleotides and/or sense oligonucleotides are described below.
  • Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modifed sugar moiety and a modified nucleobase. Modified nucleosides comprising the following modifed sugar moieties and/or the following modifed nucleobases may be incorporated into antisense oligonucleotides and/or sense oligonucleotides.
  • sugar moieties are non-bicyclic modified sugar moieties.
  • modified sugar moieties are bicyclic or tricyclic sugar moieties.
  • modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.
  • modified sugar moieties are non-bicyclic modified fiiranosyl sugar moieties comprising one or more acyclic substituent, including, but not limited, to substituents at the 2’, 3’, 4’, and/or 5’ positions.
  • the fiiranosyl sugar moiety is a ribosyl sugar moiety.
  • one or more acyclic substituent of non-bicyclic modified sugar moieties is branched.
  • non-bicyclic modifed sugar moieties comprise a substituent group at the 2’-position.
  • substituent groups suitable for the 2’-position of modified sugar moieties include but are not limited to: -F, -OCH3 (“OMe” or “O-methyl”), and -( CFE OCFE (“MOE”).
  • these 2'-substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl.
  • a non-bridging 2 ’-substituent group selected from: F, NH2, N3, OCF3, OCH3, O(CH 2 ) 3
  • a 2 ’-substituted sugar moiety of a modified nucleoside comprises 2’- substituent group selected from: F, OCH3, and OCH2CH2OCH3.
  • modified fiiranosyl sugar moieties and nucleosides incorporating such modified fiiranosyl sugar moieties are further defined by isomeric configuration.
  • a 2’- deoxyfiiranosyl sugar moiety may be in seven isomeric configurations other than the naturally occurring P-D-deoxyribosyl configuration.
  • modified sugar moieties are described in, e.g., WO 2019/157531, incorporated by reference herein.
  • a 2 ’-modified sugar moiety has an additional stereocenter at the 2’- position relative to a 2’-deoxyfuranosyl sugar moiety; therefore, such sugar moieties have a total of sixteen possible isomeric configurations.
  • Modified fiiranosyl sugar moieties described herein are in the - D-ribosyl isomeric configuration unless otherwise specified.
  • non-bicyclic modifed sugar moieties comprise a substituent group at the 4’-position.
  • substituent groups suitable for the 4’-position of modified sugar moieties include but are not limited to alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015/106128.
  • non-bicyclic modifed sugar moieties comprise a substituent group at the 3’-position.
  • substituent groups suitable for the 3’-position of modified sugar moieties include but are not limited to alkoxy (e.g., methoxy), alkyl (e.g., methyl, ethyl).
  • non-bicyclic modifed sugar moieties comprise a substituent group at the 5’-position.
  • substituent groups suitable for the 5’-position of modified sugar moieties include but are not limited to vinyl, alkoxy (e.g., methoxy), alkyl (e.g., methyl (R or .S). ethyl).
  • non-bicyclic modified sugar moieties comprise more than one nonbridging sugar substituent, for example, 2'-F-5 '-methyl sugar moieties and the modified sugar moieties and modified nucleosides described in Migawa et al., WO 2008/101157 and Rajeev et al., US2013/0203836).
  • oligonucleotides include one or more nucleoside or sugar moiety linked at an alternative position, for example at the 2’ position or inverted 5’ to 3’.
  • the linkage is at the 2’ position
  • the 2 ’-substituent groups may instead be at the 3 ’-position.
  • modified sugar moieties comprise a substituent that bridges two atoms of the fiiranosyl ring to form a second ring, resulting in a bicyclic sugar moiety.
  • the bicyclic sugar moiety comprises a bridge between the 4' and the 2' furanose ring atoms.
  • Examples of such 4’ to 2’ bridging sugar substituents include, but are not limited to: 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O- 2' (“LNA”), 4'-CH 2 -S-2', 4'-(CH 2 )2-O-2' (“ENA”), 4'-CH(CH 3 )-O-2' (referred to as “constrained ethyl” or “cEt” when in the S configuration), 4’-CH 2 -O-CH 2 -2’, 4’-CH 2 -N(R)-2’, 4'-CH(CH 2 OCH3)-O-2' (“constrained MOE” or “cMOE”) and analogs thereof (see, e.g., Seth et al., U.S.
  • each R, Ra, and Rj is, independently, H, a protecting group, or C1-C12 alkyl (see, e.g. Imanishi et al., U.S. 7,427,672).
  • bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration.
  • an ENA nucleoside (described herein) may be in the a-L configuration or in the -D configuration.
  • bicyclic nucleosides include both isomeric configurations.
  • positions of specific bicyclic nucleosides e.g., LNA or cEt
  • they are in the -D configuration, unless otherwise specified.
  • modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5 ’-substituted and 4 ’-2’ bridged sugars).
  • modified sugar moieties are sugar surrogates.
  • the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom.
  • such modified sugar moieties also comprise bridging and/or nonbridging substituents as described herein.
  • certain sugar surrogates comprise a 4’-sulfur atom and a substitution at the 2'-position (see, e.g., Bhat et al., U.S. 7,875,733 and Bhat et al., U.S. 7,939,677) and/or the 5’ position.
  • sugar surrogates comprise rings having other than 5 atoms.
  • a sugar surrogate comprises a six-membered tetrahydropyran (“THP”).
  • TTP tetrahydropyrans
  • Such tetrahydropyrans may be further modified or substituted.
  • Nucleosides comprising such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acid (“HNA”), anitol nucleic acid (“ANA”), manitol nucleic acid (“MNA”) (see e.g., Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841- 854), fluoro HNA:
  • F-HNA see e.g., Swayze et al., U.S. 8,088,904; Swayze et al., U.S. 8,440,803; and Swayze et al., U.S. 9,005,906
  • F-HNA can also be referred to as a F-THP or 3'-fluoro tetrahydropyran, and nucleosides comprising additional modified THP compounds having the formula: wherein, independently, for each of said modified THP nucleoside:
  • Bx is a nucleobase moiety
  • T3 and T4 are each, independently, an intemucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide or one of T3 and T4 is an intemucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5' or 3'-terminal group; qi, q2, q3, qi. qs, qg and q?
  • modified THP nucleosides are provided wherein qi, q2, q3, qi. qs, g and q? are each H. In certain embodiments, at least one of qi, q2, q3, q4, qs, qg and q? is other than H. In certain embodiments, at least one of qi, q2, q3, qi. qs, qg and q? is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of Ri and R2 is F. In certain embodiments, Ri is F and R2 is H, in certain embodiments, Ri is methoxy and R2 is H, and in certain embodiments, Ri is methoxyethoxy and R 2 is H.
  • sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom.
  • nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., U.S. 5,698,685; Summerton et al., U.S. 5,166,315; Summerton et al., U.S. 5,185,444; and Summerton et al., U.S. 5,034,506).
  • morpholino means a sugar surrogate having the following structure:
  • morpholines may be modified, for example, by adding or altering various substituent groups from the above morpholino structure.
  • sugar surrogates are refered to herein as “modifed morpholines. ”
  • sugar surrogates comprise acyclic moietes.
  • nucleosides and oligonucleotides comprising such acyclic sugar surrogates include, but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853- 5865), and nucleosides and oligonucleotides described in Manoharan et al., US2013/130378.
  • sugar surrogates are the “unlocked” sugar structure of UNA (unlocked nucleic acid) nucleosides.
  • UNA is a nucleoside wherein any of the bonds of the sugar moiety has been removed, forming an unlocked sugar surrogate.
  • Representative U.S. publications that teach the preparation of UNA include, but are not limited to, US Patent No. 8,314,227; and US Patent Publication Nos. 2013/0096289; 2013/0011922; and 2011/0313020, the entire contents of each of which are hereby incorporated herein by reference.
  • sugar surrogates are the glycerol as found in GNA (glycol nucleic acid) nucleosides as depicted below:
  • modified sugar moieties and sugar surrogates are known in the art that can be used in modified nucleosides.
  • oligonucleotides comprise one or more nucleoside comprising a modified nucleobase. In certain embodiments, oligonucleotides comprise one or more inosine nucleosides (i.e., nucleosides comprising a hypoxantine nucleobase).
  • modified nucleobases are selected from: 5-substituted pyrimidines, 6- azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and O-6 substituted purines.
  • modified nucleobases are selected from: 2- aminopropyladenine, 5 -hydroxymethyl cytosine, 5-methylcytosine, xanthine, hypoxanthine, 2- aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine , 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (CAC -CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6- azothymine, 5 -ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8- hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly, 5-bromo, 5 -trifluoromethyl, 5- halouracil, and 5-halocytosine, 7
  • nucleobases include tricyclic pyrimidines, such as 1,3- diazaphenoxazine-2-one, l,3-diazaphenothiazine-2-one, and 9-(2-aminoethoxy)-l,3-diazaphenoxazine-2- one (G-clamp).
  • Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example, 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.
  • Further nucleobases include those disclosed in Merigan et al., U.S.
  • nucleosides of oligonucleotides may be linked together using one or more modified intemucleoside linkages.
  • the two main classes of intemucleoside linking groups are defined by the presence or absence of a phosphoms atom.
  • Modified intemucleoside linkages compared to naturally occurring phosphodiester intemucleoside linkages, can alter, typically increase, nuclease resistance of the oligonucleotide.
  • intemucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Methods of preparation of phosphorous-containing and non-phosphorous-containing intemucleoside linkages are well known to those skilled in the art.
  • a modified intemucleoside linkage is any of those described in WO/2021/030778, incorporated by reference herein.
  • a modified intemucleoside linkage comprises the formula: wherein independently for each intemucleoside linking group of the modified oligonucleotide:
  • X is selected from O or S
  • Ri is selected from H, Ci-Ce alkyl, and substituted Ci-Ce alkyl;
  • R2 is selected from an aryl, a substituted aryl, a heterocycle, a substituted heterocycle, an aromatic heterocycle, a substituted aromatic heterocycle, a diazole, a substituted diazole, a Ci-Cg alkoxy, Ci-Cg alkyl, Ci-Cg alkenyl, Ci-Cg alkynyl, substituted Ci-Cg alkyl, substituted Ci-Cg alkenyl substituted Ci-Cg alkynyl, and a conjugate group;
  • R3 is selected from an aryl, a substituted aryl, CH3, N(CH3)2, OCH3 and a conjugate group;
  • R4 is selected from OCH3, OH, Ci-Ce alkyl, substituted Ci-Ce alkyl and a conjugate group;
  • Rs is selected from OCH3, OH, Ci-Ce alkyl, and substituted Ci-Ce alkyl.
  • a modified intemucleoside linkage comprises a mesyl phosphoramidate linking group having a formula:
  • a mesyl phosphoramidate intemucleoside linkage may comprise a chiral center.
  • modified oligonucleotides comprising (Rp) and/or (.S'p) mesyl phosphoramidates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase:
  • Representative intemucleoside linkages having a chiral center include but are not limited to alkylphosphonates, mesyl phosphoramidates, and phosphorothioates.
  • Modified oligonucleotides comprising intemucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom intemucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate or other linkages containing chiral centers in particular stereochemical configurations.
  • populations of modified oligonucleotides comprise phosphorothioate intemucleoside linkages wherein all of the phosphorothioate intemucleoside linkages are stereorandom.
  • populations of modified oligonucleotides comprise mesyl phosphoramidate intemucleoside linkages wherein all of the mesyl phosphoramidate intemucleoside linkages are stereorandom.
  • Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate or mesyl phosphoramidate linkage.
  • each individual phosphorothioate or mesyl phosphoramidate of each individual oligonucleotide molecule has a defined stereoconfiguration.
  • populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate or mesyl phosphoramidate intemucleoside linkages in a particular, independently selected stereochemical configuration.
  • the particular configuration of the particular phosphorothioate or mesyl phosphoramidate linkage is present in at least 65% of the molecules in the population.
  • the particular configuration of the particular phosphorothioate or mesyl phosphoramidate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate or mesyl phosphoramidate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate or mesyl phosphoramidate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate or mesyl phosphoramidate linkage is present in at least 99% of the molecules in the population.
  • Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO 2017/015555.
  • a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate or mesyl phosphoramidate in the (.S'p) configuration.
  • a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate or mesyl phosphoramidate in the (Rp) configuration.
  • modified oligonucleotides comprising (Rp) and/or (.S'p) phosphorothioates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase:
  • chiral intemucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.
  • Further neutral intemucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See, for example: Carbohydrate Modifications in Antisense Research; Y.S. Sanghvi and P.D. Cook, Eds., ACS Symposium Series 580;
  • Further neutral intemucleoside linkages include nonionic linkages comprising mixed N, O, S and CH 2 component parts.
  • oligonucleotides (such as antisense oligonucleotides and/or sense oligonucleotides) comprise one or more inverted nucleoside, as shown below:
  • each Bx independently represents any nucleobase.
  • an inverted nucleoside is terminal (i.e., the last nucleoside on one end of an oligonucleotide) and so only one intemucleoside linkage depicted above will be present.
  • additional features such as a conjugate group may be attached to the inverted nucleoside.
  • Such terminal inverted nucleosides can be attached to either or both ends of an oligonucleotide.
  • such groups lack a nucleobase and are referred to herein as inverted sugar moieties.
  • an inverted sugar moiety is terminal (i.e., attached to the last nucleoside on one end of an oligonucleotide) and so only one intemucleoside linkage above will be present.
  • additional features such as a conjugate group may be attached to the inverted sugar moiety.
  • Such terminal inverted sugar moieties can be attached to either or both ends of an oligonucleotide.
  • nucleic acids can be linked 2’ to 5’ rather than the standard 3’ to 5’ linkage. Such a linkage is illustrated below. wherein each Bx represents any nucleobase.
  • antisense oligonucleotides comprise a number of linked nucleosides, wherein certain nucleosides and/or linkages are modified.
  • antisense oligonucleotides consist of 12-30 linked nucleosides. In certain embodiments, antisense oligonucleotides consist of 17-25 linked nucleosides. In certain embodiments, antisense oligonucleotides consist of 17-23 linked nucleosides. In certain embodiments, antisense oligonucleotides consist of 17-21 linked nucleosides. In certain embodiments, antisense oligonucleotides consist of 18-30 linked nucleosides. In certain embodiments, antisense oligonucleotides consist of 20-30 linked nucleosides. In certain embodiments, antisense oligonucleotides consist of 21-30 linked nucleosides.
  • antisense oligonucleotides consist of 23-30 linked nucleosides. In certain embodiments, antisense oligonucleotides consist of 18-25 linked nucleosides. In certain embodiments, antisense oligonucleotides consist of 20-22 linked nucleosides. In certain embodiments, antisense oligonucleotides consist of 21-23 linked nucleosides. In certain embodiments, antisense oligonucleotides consist of 23-24 linked nucleosides. In certain embodiments, antisense oligonucleotides consist of 20 linked nucleosides. In certain embodiments, antisense oligonucleotides consist of 21 linked nucleosides. In certain embodiments, antisense oligonucleotides consist of 22 linked nucleosides. In certain embodiments, antisense oligonucleotides consist of 23 linked nucleosides.
  • the sugar moiety of at least one nucleoside of an antisense oligonucleotide is a modified sugar moiety.
  • At least one nucleoside comprises a 2’-OMe sugar moiety. In certain embodiments, at least 2 nucleosides comprise 2’-OMe sugar moieties. In certain embodiments, at least 5 nucleosides comprise 2’-OMe sugar moieties. In certain embodiments, at least 8 nucleosides comprise 2’-OMe sugar moieties. In certain embodiments, at least 10 nucleosides comprise 2’-OMe sugar moieties. In certain embodiments, at least 12 nucleosides comprise 2’-OMe sugar moieties. In certain embodiments, at least 14 nucleosides comprise 2’-OMe sugar moieties. In certain embodiments, at least 15 nucleosides comprise 2’-OMe sugar moieties.
  • At least 17 nucleosides comprise 2’-OMe sugar moieties. In certain such embodiments, at least 18 nucleosides comprise 2’-OMe sugar moieties. In certain such embodiments, at least 20 nucleosides comprise 2’-OMe sugar moieties. In certain such embodiments, at least 21 nucleosides comprise 2’-OMe sugar moieties.
  • At least one nucleoside comprises a 2’-F sugar moiety. In certain embodiments, at least 2 nucleosides comprise 2’-F sugar moieties. In certain embodiments, at least 3 nucleosides comprise 2’-F sugar moieties. In certain embodiments, at least 4 nucleosides comprise 2’-F sugar moieties. In certain embodiments, at least 6 nucleosides comprise 2’-F sugar moieties. In certain embodiments, at least 8 nucleosides comprise 2’-F sugar moieties. In certain embodiments, at least 10 nucleosides comprise 2’-F sugar moieties. In certain embodiments, at least 11 nucleosides comprise 2’-F sugar moieties.
  • nucleosides comprise 2’-F sugar moieties.
  • one, but not more than one nucleoside comprises a 2’-F sugar moiety.
  • 1 or 2 nucleosides comprise 2’-F sugar moieties.
  • 1-3 nucleosides comprise 2’-F sugar moieties.
  • at least 1-4 nucleosides comprise 2’-F sugar moieties.
  • antisense oligonucleotides have a block of 2-4 contiguous 2’-F modified nucleosides.
  • nucleosides of an antisense oligonucleotide are 2’-F modified nucleosides and 3 of those 2’-F modified nucleosides are contiguous. In certain such embodiments the remainder of the nucleosides are 2’0Me modified.
  • one nucleoside of an antisense oligonucleotide is a UNA.
  • one nucleoside of an antisense oligonucleotide is a GNA.
  • 1-4 nucleosides of an antisense oligonucleotide is/are DNA.
  • the 1-4 DNA nucleosides are at one or both ends of the antisense oligonucleotide.
  • At least one linkage of the antisense oligonucleotide is a modified linkage.
  • the 5 ’-most linkage i.e., linking the first nucleoside from the 5 ’-end to the second nucleoside from the 5 ’-end
  • the two 5 ’-most linkages are modified.
  • the first one or 2 linkages from the 3 ’-end are modified.
  • the modified linkage is a phosphorothioate linkage.
  • the modified linkage is a mesyl phosphoramidate linkage.
  • the remaining linkages are all unmodified phosphodiester linkages.
  • At least one linkage of the antisense oligonucleotide is an inverted linkage.
  • sense oligonucleotides comprise a number of linked nucleosides, wherein certain nucleosides and/or linkages are modified.
  • sense oligonucleotides consist of 12-30 linked nucleosides. In certain embodiments, sense oligonucleotides consist of 17-25 linked nucleosides. In certain embodiments, sense oligonucleotides consist of 17-23 linked nucleosides. In certain embodiments, sense oligonucleotides consist of 17-21 linked nucleosides. In certain embodiments, sense oligonucleotides consist of 18-30 linked nucleosides. In certain embodiments, sense oligonucleotides consist of 20-30 linked nucleosides. In certain embodiments, sense oligonucleotides consist of 21-30 linked nucleosides.
  • sense oligonucleotides consist of 23-30 linked nucleosides. In certain embodiments, sense oligonucleotides consist of 18-25 linked nucleosides. In certain embodiments, sense oligonucleotides consist of 20-22 linked nucleosides. In certain embodiments, sense oligonucleotides consist of 21-23 linked nucleosides. In certain embodiments, sense oligonucleotides consist of 23-24 linked nucleosides. In certain embodiments, sense oligonucleotides consist of 19 linked nucleosides. In certain embodiments, sense oligonucleotides consist of 20 linked nucleosides.
  • sense oligonucleotides consist of 21 linked nucleosides. In certain embodiments, sense oligonucleotides consist of 22 linked nucleosides. In certain embodiments, sense oligonucleotides consist of 23 linked nucleosides. In certain embodiments, sense oligonucleotides consist of 25 linked nucleosides.
  • the sugar moiety of at least one nucleoside of a sense oligonucleotides is a modified sugar moiety.
  • At least one nucleoside comprises a 2’-0Me sugar moiety. In certain embodiments, at least 2 nucleosides comprise 2’-0Me sugar moieties. In certain embodiments, at least 5 nucleosides comprise 2’-0Me sugar moieties. In certain embodiments, at least 8 nucleosides comprise 2’-0Me sugar moieties. In certain embodiments, at least 10 nucleosides comprise 2’-OMe sugar moieties. In certain embodiments, at least 12 nucleosides comprise 2’-OMe sugar moieties. In certain embodiments, at least 14 nucleosides comprise 2’-OMe sugar moieties.
  • nucleosides comprise 2’-OMe sugar moieties. In certain embodiments, at least 17 nucleosides comprise 2’-OMe sugar moieties. In certain such embodiments, at least 18 nucleosides comprise 2’-OMe sugar moieties. In certain such embodiments, at least 20 nucleosides comprise 2’-OMe sugar moieties. In certain such embodiments, at least 21 nucleosides comprise 2’-OMe sugar moieties.
  • At least one nucleoside comprises a 2’-F sugar moiety. In certain embodiments, at least 2 nucleosides comprise 2’-F sugar moieties. In certain embodiments, at least 3 nucleosides comprise 2’-F sugar moieties. In certain embodiments, at least 4 nucleosides comprise 2’-F sugar moieties. In certain embodiments, at least 6 nucleosides comprise 2’-F sugar moieties. In certain embodiments, at least 8 nucleosides comprise 2’-F sugar moieties. In certain embodiments, at least 10 nucleosides comprise 2’-F sugar moieties. In certain embodiments, at least 11 nucleosides comprise 2’-F sugar moieties.
  • nucleosides comprise 2’-F sugar moieties.
  • one, but not more than one nucleoside comprises a 2’-F sugar moiety.
  • 1 or 2 nucleosides comprise 2’-F sugar moieties.
  • 1-3 nucleosides comprise 2’-F sugar moieties.
  • at least 1-4 nucleosides comprise 2’-F sugar moieties.
  • sense oligonucleotides have a block of 2-4 contiguous 2’-F modified nucleosides.
  • nucleosides of an sense oligonucleotide are 2’-F modified nucleosides and 3 of those 2’-F modified nucleosides are contiguous. In certain such embodiments the remainder of the nucleosides are 2’OMe modified.
  • one nucleoside of an sense oligonucleotide is a UNA.
  • one nucleoside of an sense oligonucleotide is a GNA.
  • 1-4 nucleosides of an sense oligonucleotide is/are DNA.
  • the 1-4 DNA nucleosides are at one or both ends of the sense oligonucleotide.
  • At least one linkage of the sense oligonucleotides is a modified linkage.
  • the 5 ’-most linkage i.e., linking the first nucleoside from the 5 ’-end to the second nucleoside from the 5 ’-end
  • the two 5 ’-most linkages are modified.
  • the first one or 2 linkages from the 3 ’-end are modified.
  • the modified linkage is a phosphorothioate linkage.
  • the modified linkage is a mesyl phosphoramidate linkage.
  • the remaining linkages are all unmodified phosphodiester linkages.
  • At least one linkage of the sense oligonucleotides is an inverted linkage.
  • an oligomeric compound described herein comprises an oligonucleotide, having a nucleobase sequence complementary to that of a target nucleic acid, is paired with a second oligomeric compound to form an oligomeric duplex.
  • oligomeric duplexes comprise a first oligomeric compound having a portion complementary to a target nucleic acid and a second oligomeric compound having a portion complementary to the first oligomeric compound.
  • the first oligomeric compound of an oligomeric duplex comprises or consists of (1) a first modified or unmodified oligonucleotide and optionally a conjugate group and (2) a second modified or unmodified oligonucleotide and optionally a conjugate group.
  • Either or both oligomeric compounds of an oligomeric duplex may comprise a conjugate group.
  • the oligonucleotides of each oligomeric compound of an oligomeric duplex may include non-complementary overhanging nucleosides.
  • the two oligonucleotides have at least one mismatch relative to one another.
  • the oligomeric duplex is an antisense agent.
  • an oligomeric duplex comprises: a first oligomeric compound comprising a first modified oligonucleotide consisting of 15 to 30 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 20-175; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 29 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 contiguous nucleobases
  • the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide. In certain embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide. In certain embodiments, the second modified oligonucleotide is a sense RNAi oligonucleotide.
  • the nucleobase sequence of the second modified oligonucleotide is at least 95% or 100% complementary to the nucleobase sequence of an equal length portion of the first modified oligonucleotide.
  • the oligomeric duplex is an antisense agent.
  • an oligomeric duplex comprises: a first oligomeric compound comprising a first modified oligonucleotide consisting of 18 to 30 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 20-175; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 29 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to the nucleobase sequence of an equal length portion of the first modified oligonucleotide.
  • the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide. In certain embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide. In certain embodiments, the second modified oligonucleotide is a sense RNAi oligonucleotide.
  • the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or 21 nucleobases that is at least 90% complementary to the nucleobase sequence of an equal portion of the first modified oligonucleotide.
  • the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or 21 nucleobases that is at least 95% complementary to the nucleobase sequence of an equal portion of the first modified oligonucleotide.
  • the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or 21 nucleobases that is 100% complementary to the nucleobase sequence of an equal portion of the first modified oligonucleotide.
  • the oligomeric duplex is an antisense agent.
  • an oligomeric duplex comprises: a first oligomeric compound comprising a first modified oligonucleotide consisting of 18 to 30 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 20-175; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 29 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 contiguous nucleobases
  • the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide. In certain embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide. In certain embodiments, the second modified oligonucleotide is a sense RNAi oligonucleotide.
  • the nucleobase sequence of the second modified oligonucleotide is at least 95% or 100% complementary to the nucleobase sequence of an equal length portion of the first modified oligonucleotide.
  • the oligomeric duplex is an antisense agent.
  • an oligomeric duplex comprises: a first oligomeric compound comprising a first modified oligonucleotide consisting of 23 linked nucleosides and has a nucleobase sequence of consisting of the nucleobase sequence of any of SEQ ID NOs: 20-175; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 21 linked nucleosides, wherein the second modified oligonucleotide has a nucleobase sequence consisting of the nucleobase sequence of any of SEQ ID NOs: 176-331, and wherein the nucleobase sequence of the second modified oligonucleotide is at least 90% complementary to the nucleobase sequence of an equal length portion of the first modified oligonucleotide.
  • the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide. In certain embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide. In certain embodiments, the second modified oligonucleotide is a sense RNAi oligonucleotide.
  • the nucleobase sequence of the second modified oligonucleotide is at least 95% or 100% complementary to the nucleobase sequence of an equal length portion of the first modified oligonucleotide.
  • the oligomeric duplex is an antisense agent.
  • an oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 15 to 30 linked nucleosides and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 29 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 20-175 and the nucleobase sequence of the second modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 contiguous nucleobases of the nucle
  • the nucleobase sequence of the second modified oligonucleotide is at least 95% or 100% complementary to the nucleobase sequence of an equal length portion of the first modified oligonucleotide.
  • the first oligomeric compound is an antisense compound.
  • the first modified oligonucleotide is an antisense oligonucleotide.
  • the second oligomeric compound is a sense compound.
  • the second modified oligonucleotide is a sense oligonucleotide.
  • the first modified oligonucleotide is an antisense RNAi oligonucleotide.
  • the second modified oligonucleotide is a sense RNAi oligonucleotide.
  • the oligomeric duplex is an antisense agent.
  • an oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 18 to 30 linked nucleosides and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 29 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 20-175 and the nucleobase sequence of the second modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 contiguous nucleobases of the nucle
  • the nucleobase sequence of the second modified oligonucleotide is at least 95% or 100% complementary to the nucleobase sequence of an equal length portion of the first modified oligonucleotide.
  • the first oligomeric compound is an antisense compound.
  • the first modified oligonucleotide is an antisense oligonucleotide.
  • the second oligomeric compound is a sense compound.
  • the second modified oligonucleotide is a sense oligonucleotide.
  • the first modified oligonucleotide is an antisense RNAi oligonucleotide.
  • the second modified oligonucleotide is a sense RNAi oligonucleotide.
  • the oligomeric duplex is an antisense agent.
  • an oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 18 to 30 linked nucleosides and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 29 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of any of SEQ ID NOs: 20-175 and the nucleobase sequence of the second modified oligonucleotide comprises the nucleobase sequence of any of SEQ ID NOs: 176-331, wherein the nucleobase sequence of the second modified oligonucleotide is at least 90% complementary to the nucleobase sequence of an equal length portion of the first modified oligonucleotide.
  • the nucleobase sequence of the second modified oligonucleotide is at least 95% or 100% complementary to the nucleobase sequence of an equal length portion of the first modified oligonucleotide.
  • the first oligomeric compound is an antisense compound.
  • the first modified oligonucleotide is an antisense oligonucleotide.
  • the second oligomeric compound is a sense compound.
  • the second modified oligonucleotide is a sense oligonucleotide.
  • the first modified oligonucleotide is an antisense RNAi oligonucleotide.
  • the second modified oligonucleotide is a sense RNAi oligonucleotide.
  • the oligomeric duplex is an antisense agent.
  • an oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 23 linked nucleosides and a second oligomeric compound comprising a second modified oligonucleotide consisting of 21 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of any of SEQ ID NOs: 20-175 and the nucleobase sequence of the second modified oligonucleotide comprises the nucleobase sequence of any of SEQ ID NOs: 176-331, wherein the nucleobase sequence of the second modified oligonucleotide is at least 90% complementary to the nucleobase sequence of an equal length portion of the first modified oligonucleotide.
  • the nucleobase sequence of the second modified oligonucleotide is at least 95% or 100% complementary to the nucleobase sequence of an equal length portion of the first modified oligonucleotide.
  • the first oligomeric compound is an antisense compound.
  • the first modified oligonucleotide is an antisense oligonucleotide.
  • the second oligomeric compound is a sense compound.
  • the second modified oligonucleotide is a sense oligonucleotide.
  • the first modified oligonucleotide is an antisense RNAi oligonucleotide.
  • the second modified oligonucleotide is a sense RNAi oligonucleotide.
  • the oligomeric duplex is an antisense agent.
  • an oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 19 to 29 linked nucleosides and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 29 linked nucleosides, wherein the nucleobase sequences of the first modified oligonucleotide and second modified oligonucleotide comprise any of the following pairs of nucleobase sequences recited in SEQ ID NOs: 20/176, 21/177, 22/178, 23/179, 24/180, 25/181, 26/182, 27/183, 28/184, 29/185, 30/186, 31/187, 32/188, 33/189, 34/190, 35/191, 36/192, 37/193, 38/194, 39/195, 40/196, 41/197, 42/198, 43/199, 44/200, 45/201, 46/202, 47/203, 48/204, 49/205, 50/206,
  • the nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of the first SEQ ID NO recited in the pair and the nucleobase sequence of the second modified oligonucleotide comprises the nucleobase sequence of the second SEQ ID NO recited in the pair.
  • the first oligomeric compound is an antisense compound.
  • the first modified oligonucleotide is an antisense oligonucleotide.
  • the second oligomeric compound is a sense compound.
  • the second modified oligonucleotide is a sense oligonucleotide.
  • the first modified oligonucleotide is an antisense RNAi oligonucleotide.
  • the second oligomeric compound is a sense compound.
  • the second modified oligonucleotide is a sense RNAi oligonucleotide.
  • the oligomeric duplex is an antisense agent.
  • an oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 23 linked nucleosides and a second oligomeric compound comprising a second modified oligonucleotide consisting of 21 linked nucleosides, wherein the nucleobase sequences of the first modified oligonucleotide and second modified oligonucleotide consist of any of the following pairs of nucleobase sequences recited in SEQ ID NOs: 20/176, 21/177, 22/178, 23/179, 24/180, 25/181, 26/182, 27/183, 28/184, 29/185, 30/186, 31/187, 32/188, 33/189,
  • nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of the first SEQ ID NO recited in the pair and the nucleobase sequence of the second modified oligonucleotide comprises the nucleobase sequence of the second SEQ ID NO
  • the first modified oligonucleotide is an antisense oligonucleotide.
  • the second oligomeric compound is a sense compound.
  • the second modified oligonucleotide is a sense oligonucleotide.
  • the first modified oligonucleotide is an antisense RNAi oligonucleotide.
  • the second oligomeric compound is a sense compound.
  • the second modified oligonucleotide is a sense RNAi oligonucleotide.
  • the oligomeric duplex is an antisense agent.
  • At least one nucleoside of the first modified oligonucleotide and/or the second modified oligonucleotide can comprise a modified sugar moiety.
  • suitable modified sugar moieties include, but are not limited to, a bicyclic sugar moiety, such as a 2 ’-4’ bridge selected from -O-CH2-; and -O-CH(CH3)-, and a non-bicyclic sugar moiety, such as a 2 ’-MOE sugar moiety, a 2’-F sugar moiety, a 2’-OMe sugar moiety, or a 2’-NMA sugar moiety.
  • At least one nucleoside of the first modified oligonucleotide and/or the second modified oligonucleotide can comprise an unmodified 2 ’-deoxyribosyl sugar moiety.
  • at least 80%, at least 90%, or 100% of the nucleosides of the first modified oligonucleotide and/or the second modified oligonucleotide comprises a modified sugar moiety selected from 2’-F and 2’-OMe.
  • one or more 2’-F sugar moieties have a confirmation other than 2’-P- D-ribosyl.
  • one or more 2’-F sugar moieties is in the 2’-P-D-xylosyl conformation.
  • At least one nucleoside of the first modified oligonucleotide and/or the second modified oligonucleotide can comprise a sugar surrogate.
  • suitable sugar surrogates include, but are not limited to, morpholino, hexitol nucleic acid (HNA), fluro- hexitol nucleic acid (F-HNA), the sugar surrogates of glycol nucleic acid (GNA), and unlocked nucleic acid (UNA).
  • at least one nucleoside of the first modified oligonucleotide comprises a sugar surrogate, which can be a GNA.
  • an oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 19 to 29 linked nucleosides and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 29 linked nucleosides, wherein at least one nucleoside of the first modified oligonucleotide and/or the second modified oligonucleotide comprises a modified sugar moiety.
  • the modified sugar moiety is a non-bicyclic sugar moiety.
  • the non-bicyclic sugar moiety is selected from a 2’-F sugar moiety and a 2’-OMe sugar moiety.
  • the first modified oligonucleotide comprises two, three, four, five, six, or more nucleosides comprising non-bicyclic sugar moieties selected from a 2’-F sugar moiety and a 2’-0Me sugar moiety.
  • the second modified oligonucleotide comprises two, three, four, or more nucleosides comprising non- bicyclic sugar moieties selected from a 2’-F sugar moiety and a 2’-0Me sugar moiety.
  • at least one nucleoside at position 2, 6, 8, 9, 14, or 16 from the 5’ end of the first modified oligonucleotide comprises a 2’-F sugar moiety.
  • At least one nucleoside at position 2, 6, 14, or 16 from the 5’ end of the first modified oligonucleotide comprises a 2’-F sugar moiety. In certain embodiments, at least one nucleoside at position 2, 6, or 14 from the 5’ end of the first modified oligonucleotide comprises a 2’-F sugar moiety. In certain embodiments, at least one nucleoside at position 2, 14, or 16 from the 5’ end of the first modified oligonucleotide comprises a 2’-F sugar moiety. In certain embodiments, the nucleoside at position 2 or 14 from the 5’ end of the first modified oligonucleotide comprises a 2’-F sugar moiety.
  • the nucleosides at positions 2, 6, 8, 9, 14, and 16 from the 5’ end of the first modified oligonucleotide each comprises a 2’-F sugar moiety. In certain embodiments, the nucleosides at positions 2, 6, 14, and 16 from the 5’ end of the first modified oligonucleotide each comprises a 2’-F sugar moiety. In certain embodiments, the nucleosides at positions 2, 6, and 14 from the 5’ end of the first modified oligonucleotide each comprises a 2’-F sugar moiety. In certain embodiments, the nucleosides at positions 2, 14, and 16 from the 5’ end of the first modified oligonucleotide each comprises a 2’-F sugar moiety.
  • the nucleosides at positions 2 and 14 from the 5’ end of the first modified oligonucleotide each comprises a 2’-F sugar moiety. In certain embodiments, at least one nucleoside from the remaining positions of the first modified oligonucleotide comprises a 2’-0Me sugar moiety. In certain embodiments, the nucleosides at the remaining positions of the first modified oligonucleotide each comprises a 2’-0Me sugar moiety. In certain embodiments, at least one nucleoside at position 7, 9, 10, 11, 12, or 15 from the 5’ end of the second modified oligonucleotide comprises a 2’-F sugar moiety.
  • At least one nucleoside at position 7, 9, 10, or 11 from the 5’ end of the second modified oligonucleotide comprises a 2’-F sugar moiety. In certain embodiments, at least one nucleoside at position 9, 10, or 11 from the 5’ end of the second modified oligonucleotide comprises a 2’-F sugar moiety. In certain embodiments, at least one nucleoside at position 11, 12, or 15 from the 5’ end of the second modified oligonucleotide comprises a 2’-F sugar moiety. In certain embodiments, the nucleosides at positions 7, 9, 10, and 11 from the 5’ end of the second modified oligonucleotide each comprises a 2’-F sugar moiety.
  • the nucleosides at positions 9, 10, and 11 from the 5’ end of the second modified oligonucleotide each comprises a 2’-F sugar moiety. In certain embodiments, at least one nucleoside from the remaining positions of the second modified oligonucleotide comprises a 2’-OMe sugar moiety. In certain embodiments, the nucleosides at the remaining positions of the second modified oligonucleotide each comprises a 2’-OMe sugar moiety.
  • the nucleobase sequences of the first modified oligonucleotide and second modified oligonucleotide consist of any of the following pairs of nucleobase sequences recited in SEQ ID NOs: 20/176, 21/177, 22/178, 23/179, 24/180, 25/181, 26/182, 27/183, 28/184, 29/185, 30/186, 31/187, 32/188, 33/189, 34/190, 35/191, 36/192, 37/193, 38/194, 39/195, 40/196, 41/197, 42/198, 43/199, 44/200, 45/201, 46/202, 47/203, 48/204, 49/205, 50/206, 51/207, 52/208, 53/209, 54/210, 55/211, 56/212, 57/213, 58/214, 59/215,
  • the nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of the first SEQ ID NO recited in the pair and the nucleobase sequence of the second modified oligonucleotide comprises the nucleobase sequence of the second SEQ ID NO recited in the pair.
  • the first modified oligonucleotide is an antisense oligonucleotide.
  • the second oligomeric compound is a sense compound.
  • the second modified oligonucleotide is a sense oligonucleotide.
  • the first modified oligonucleotide is an antisense RNAi oligonucleotide.
  • the second oligomeric compound is a sense compound.
  • the second modified oligonucleotide is a sense RNAi oligonucleotide.
  • the oligomeric duplex is an antisense agent.
  • an oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 23 linked nucleosides and a second oligomeric compound comprising a second modified oligonucleotide consisting of 21 linked nucleosides, wherein at least one nucleoside of the first modified oligonucleotide and/or the second modified oligonucleotide comprises a modified sugar moiety.
  • the modified sugar moiety is a non-bicyclic sugar moiety.
  • the non-bicyclic sugar moiety is selected from a 2’-F sugar moiety and a 2’-OMe sugar moiety.
  • the first modified oligonucleotide comprises two, three, four, five, six, or more nucleosides comprising non-bicyclic sugar moieties selected from a 2’-F sugar moiety and a 2’-OMe sugar moiety.
  • the second modified oligonucleotide comprises two, three, four, or more nucleosides comprising non-bicyclic sugar moieties selected from a 2’-F sugar moiety and a 2’-OMe sugar moiety.
  • at least one nucleoside at position 2, 6, 8, 9, 14, or 16 from the 5’ end of the first modified oligonucleotide comprises a 2’-F sugar moiety.
  • At least one nucleoside at position 2, 6, 14, or 16 from the 5’ end of the first modified oligonucleotide comprises a 2’-F sugar moiety. In certain embodiments, at least one nucleoside at position 2, 6, or 14 from the 5’ end of the first modified oligonucleotide comprises a 2’-F sugar moiety. In certain embodiments, at least one nucleoside at position 2, 14, or 16 from the 5’ end of the first modified oligonucleotide comprises a 2’-F sugar moiety. In certain embodiments, the nucleoside at position 2 or 14 from the 5’ end of the first modified oligonucleotide comprises a 2’-F sugar moiety.
  • the nucleosides at positions 2, 6, 8, 9, 14, and 16 from the 5’ end of the first modified oligonucleotide each comprises a 2’-F sugar moiety. In certain embodiments, the nucleosides at positions 2, 6, 14, and 16 from the 5’ end of the first modified oligonucleotide each comprises a 2’-F sugar moiety. In certain embodiments, the nucleosides at positions 2, 6, and 14 from the 5’ end of the first modified oligonucleotide each comprises a 2’-F sugar moiety. In certain embodiments, the nucleosides at positions 2, 14, and 16 from the 5’ end of the first modified oligonucleotide each comprises a 2’-F sugar moiety.
  • the nucleosides at positions 2 and 14 from the 5’ end of the first modified oligonucleotide each comprises a 2’-F sugar moiety. In certain embodiments, at least one nucleoside from the remaining positions of the first modified oligonucleotide comprises a 2’- OMe sugar moiety. In certain embodiments, the nucleosides at the remaining positions of the first modified oligonucleotide each comprises a 2’-0Me sugar moiety. In certain embodiments, at least one nucleoside at position 7, 9, 10, 11, 12, or 15 from the 5’ end of the second modified oligonucleotide comprises a 2’-F sugar moiety.
  • At least one nucleoside at position 7, 9, 10, or 11 from the 5’ end of the second modified oligonucleotide comprises a 2’-F sugar moiety. In certain embodiments, at least one nucleoside at position 9, 10, or 11 from the 5’ end of the second modified oligonucleotide comprises a 2’-F sugar moiety. In certain embodiments, at least one nucleoside at position 11, 12, or 15 from the 5’ end of the second modified oligonucleotide comprises a 2’-F sugar moiety. In certain embodiments, the nucleosides at positions 7, 9, 10, and 11 from the 5’ end of the second modified oligonucleotide each comprises a 2’-F sugar moiety.
  • the nucleosides at positions 9, 10, and 11 from the 5’ end of the second modified oligonucleotide each comprises a 2’-F sugar moiety. In certain embodiments, at least one nucleoside from the remaining positions of the second modified oligonucleotide comprises a 2’-OMe sugar moiety. In certain embodiments, the nucleosides at the remaining positions of the second modified oligonucleotide each comprises a 2’-OMe sugar moiety.
  • the nucleobase sequences of the first modified oligonucleotide and second modified oligonucleotide consist of any of the following pairs of nucleobase sequences recited in SEQ ID NOs: 20/176, 21/177, 22/178, 23/179, 24/180, 25/181, 26/182, 27/183, 28/184, 29/185, 30/186, 31/187, 32/188, 33/189, 34/190, 35/191, 36/192, 37/193, 38/194,
  • nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of the first SEQ ID NO recited in the pair and the nucleobase sequence of the second modified oligonucleotide comprises the nucleobase sequence of the second SEQ ID NO recited in the pair.
  • the first modified oligonucleotide is an antisense oligonucleotide.
  • the second oligomeric compound is a sense compound.
  • the second modified oligonucleotide is a sense oligonucleotide.
  • the first modified oligonucleotide is an antisense RNAi oligonucleotide.
  • the second oligomeric compound is a sense compound.
  • the second modified oligonucleotide is a sense RNAi oligonucleotide.
  • the oligomeric duplex is an antisense agent.
  • an oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 19 to 29 linked nucleosides and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 29 linked nucleosides, wherein at least one nucleoside of the first modified oligonucleotide and/or the second modified oligonucleotide comprises a modified sugar moiety selected from a 2’-F sugar moiety and a 2’- OMe sugar moiety.
  • each nucleoside of the first modified oligonucleotide comprises a modified sugar moiety selected from a 2’-F sugar moiety and a 2’-OMe sugar moiety.
  • the nucleosides of the first modified oligonucleotide have an alternating 2’-F/2’- OMe sugar motif with the nucleoside at position 1 from the 5’ end comprising a 2’-OMe sugar moiety.
  • each nucleoside of the second modified oligonucleotide comprises a modified sugar moiety selected from a 2’-F sugar moiety and a 2’-OMe sugar moiety.
  • the nucleosides of the second modified oligonucleotide have an alternating 2’-F/2’-OMe sugar motif with the nucleoside at position 1 from the 5’ end comprising a 2’-F sugar moiety.
  • the nucleobase sequences of the first modified oligonucleotide and second modified oligonucleotide consist of any of the following pairs of nucleobase sequences recited in SEQ ID NOs: 20/176, 21/177, 22/178, 23/179, 24/180, 25/181, 26/182, 27/183, 28/184, 29/185, 30/186, 31/187, 32/188, 33/189, 34/190,
  • nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of the first SEQ ID NO recited in the pair and the nucleobase sequence of the second modified oligonucleotide comprises the nucleobase sequence of the second SEQ ID NO recited in the pair.
  • the first modified oligonucleotide is an antisense oligonucleotide.
  • the second oligomeric compound is a sense compound.
  • the second modified oligonucleotide is a sense oligonucleotide.
  • the first modified oligonucleotide is an antisense RNAi oligonucleotide.
  • the second oligomeric compound is a sense compound.
  • the second modified oligonucleotide is a sense RNAi oligonucleotide.
  • the oligomeric duplex is an antisense agent.
  • an oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 23 linked nucleosides and a second oligomeric compound comprising a second modified oligonucleotide consisting of 21 linked nucleosides, wherein at least one nucleoside of the first modified oligonucleotide and/or the second modified oligonucleotide comprises a modified sugar moiety selected from a 2’-F sugar moiety and a 2’-OMe sugar moiety.
  • each nucleoside of the first modified oligonucleotide comprises a modified sugar moiety selected from a 2’-F sugar moiety and a 2’-OMe sugar moiety.
  • the nucleosides of the first modified oligonucleotide have an alternating 2’-F/2’-OMe sugar motif with the nucleoside at position 1 from the 5’ end comprising a 2’-OMe sugar moiety.
  • each nucleoside of the second modified oligonucleotide comprises a modified sugar moiety selected from a 2’-F sugar moiety and a 2’-OMe sugar moiety.
  • the nucleosides of the second modified oligonucleotide have an alternating 2’-F/2’-OMe sugar motif with the nucleoside at position 1 from the 5’ end comprising a 2’-F sugar moiety.
  • the nucleobase sequences of the first modified oligonucleotide and second modified oligonucleotide consist of any of the following pairs of nucleobase sequences recited in SEQ ID NOs: 20/176, 21/177, 22/178, 23/179, 24/180, 25/181, 26/182, 27/183, 28/184, 29/185, 30/186, 31/187, 32/188, 33/189, 34/190, 35/191, 36/192, 37/193,
  • nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of the first SEQ ID NO recited in the pair and the nucleobase sequence of the second modified oligonucleotide comprises the nucleobase sequence of the second SEQ ID NO recited in the pair.
  • the first modified oligonucleotide is an antisense oligonucleotide.
  • the second oligomeric compound is a sense compound.
  • the second modified oligonucleotide is a sense oligonucleotide.
  • the first modified oligonucleotide is an antisense RNAi oligonucleotide.
  • the second oligomeric compound is a sense compound.
  • the second modified oligonucleotide is a sense RNAi oligonucleotide.
  • the oligomeric duplex is an antisense agent.
  • an oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 19 to 29 linked nucleosides and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 29 linked nucleosides, wherein at least one nucleoside of the first modified oligonucleotide and/or the second modified oligonucleotide comprises a modified sugar moiety selected from a 2’-F sugar moiety and a 2’- OMe sugar moiety.
  • each nucleoside of the first modified oligonucleotide comprises a modified sugar moiety selected from a 2’-F sugar moiety and a 2’-OMe sugar moiety.
  • the nucleosides of the first modified oligonucleotide have an alternating 2’-F/2’- OMe sugar motif with the nucleoside at position 1 from the 5’ end comprising a 2’-OMe sugar moiety.
  • each nucleoside of the second modified oligonucleotide comprises a modified sugar moiety selected from a 2’-F sugar moiety and a 2’-OMe sugar moiety.
  • At least one nucleoside at position of 9, 10, or 11 from the 5’ end of the second modified oligonucleotide comprises a 2’-F sugar moiety.
  • the nucleosides at positions of 9, 10, and 11 from the 5’ end of the second modified oligonucleotide each comprises a 2’-F sugar moiety.
  • the nucleobase sequences of the first modified oligonucleotide and second modified oligonucleotide consist of any of the following pairs of nucleobase sequences recited in SEQ ID NOs: 20/176, 21/177, 22/178, 23/179, 24/180, 25/181, 26/182, 27/183, 28/184, 29/185, 30/186, 31/187,
  • nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of the first SEQ ID NO recited in the pair and the nucleobase sequence of the second modified oligonucleotide comprises the nucleobase sequence of the second SEQ ID NO recited in the pair.
  • the first modified oligonucleotide is an antisense oligonucleotide.
  • the second oligomeric compound is a sense compound.
  • the second modified oligonucleotide is a sense oligonucleotide.
  • the first modified oligonucleotide is an antisense RNAi oligonucleotide.
  • the second oligomeric compound is a sense compound.
  • the second modified oligonucleotide is a sense RNAi oligonucleotide.
  • the oligomeric duplex is an antisense agent.
  • an oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 23 linked nucleosides and a second oligomeric compound comprising a second modified oligonucleotide consisting of 21 linked nucleosides, wherein at least one nucleoside of the first modified oligonucleotide and/or the second modified oligonucleotide comprises a modified sugar moiety selected from a 2’-F sugar moiety and a 2’-OMe sugar moiety.
  • each nucleoside of the first modified oligonucleotide comprises a modified sugar moiety selected from a 2’-F sugar moiety and a 2’-OMe sugar moiety.
  • the nucleosides of the first modified oligonucleotide have an alternating 2’-F/2’-OMe sugar motif with the nucleoside at position 1 from the 5’ end comprising a 2’-OMe sugar moiety.
  • each nucleoside of the second modified oligonucleotide comprises a modified sugar moiety selected from a 2’-F sugar moiety and a 2’-OMe sugar moiety.
  • At least one nucleoside at position of 9, 10, or 11 from the 5’ end of the second modified oligonucleotide comprises a 2’-F sugar moiety.
  • the nucleosides at positions of 9, 10, and 11 from the 5’ end of the second modified oligonucleotide each comprises a 2’-F sugar moiety.
  • the nucleobase sequences of the first modified oligonucleotide and second modified oligonucleotide consist of any of the following pairs of nucleobase sequences recited in SEQ ID NOs: 20/176, 21/177, 22/178, 23/179, 24/180, 25/181, 26/182, 27/183, 28/184, 29/185, 30/186, 31/187, 32/188, 33/189, 34/190,
  • nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of the first SEQ ID NO recited in the pair and the nucleobase sequence of the second modified oligonucleotide comprises the nucleobase sequence of the second SEQ ID NO
  • the first modified oligonucleotide is an antisense oligonucleotide.
  • the second oligomeric compound is a sense compound.
  • the second modified oligonucleotide is a sense oligonucleotide.
  • the first modified oligonucleotide is an antisense RNAi oligonucleotide.
  • the second oligomeric compound is a sense compound.
  • the second modified oligonucleotide is a sense RNAi oligonucleotide.
  • the oligomeric duplex is an antisense agent.
  • At least one intemucleoside linkage of the first modified oligonucleotide and/or the second modified oligonucleotide can comprise a modified intemucleoside linkage.
  • the modified intemucleoside linkage is a phosphorothioate intemucleoside linkage.
  • at least one of the first, second, or third intemucleoside linkages from the 5’ end and/or the 3’ end of the first modified oligonucleotide comprises a phosphorothioate linkage.
  • At least one of the first, second, or third intemucleoside linkages from the 5 ’ end and/or the 3 ’ end of the second modified oligonucleotide comprises a phosphorothioate linkage.
  • the modified intemucleoside linkage is a mesyl phosphoramidate intemucleoside linkage.
  • at least one of the first or second intemucleoside linkages from the 5 ’ end and/or the 3 ’ end of the first modified oligonucleotide comprises a mesyl phosphoramidate intemucleoside linkage.
  • At least one of the first or second intemucleoside linkages from the 5 ’ end and/or the 3 ’ end of the second modified oligonucleotide comprises a mesyl phosphoramidate intemucleoside linkage.
  • At least one intemucleoside linkage of the first modified oligonucleotide and/or the second modified oligonucleotide can comprise a phosphodiester intemucleoside linkage.
  • each intemucleoside linkage of the first modified oligonucleotide and/or the second modified oligonucleotide can be independently selected from a phosphodiester, a phosphorothioate, or a mesyl phosphoramidate intemucleoside linkage.
  • each intemucleoside linkage of the first modified oligonucleotide and/or the second modified oligonucleotide can be independently selected from a phosphodiester or a phosphorothioate intemucleoside linkage.
  • the intemucleoside linkage motif of the first modified oligonucleotide can be 5’- ssooooooooooooooss -3’, wherein each “s” is a phosphorothioate intemucleoside linkage and each “o” is a phosphodiester intemucleoside linkage.
  • the intemucleoside linkage motif of the second modified oligonucleotide can be 5’- ssooooooooooooss -3’, wherein each “s” is a phosphorothioate intemucleoside linkage and each “o” is a phosphodiester intemucleoside linkage.
  • At least one nucleobase of the first modified oligonucleotide and/or the second modified oligonucleotide can be modified nucleobase.
  • the modified nucleobase is 5 -methylcytosine.
  • one or more nucleobases of the first modified oligonucleotide and/or the second modified oligonucleotide can be unmodified nucleobases. In certain embodiments, one or more cytosine nuclebases of the first modified oligonucleotide are unmodified. In certain embodiments, one or more cytosine nuclebases of the second modified oligonucleotide are unmodified.
  • the first modified oligonucleotide can comprise a stabilized phosphate group attached to the 5’ position of the 5 ’-most nucleoside.
  • the stabilized phosphate group comprises a cyclopropyl phosphonate or an /// inyl phosphonate.
  • the first modified oligonucleotide can comprise a conjugate group.
  • the conjugate group comprises a conjugate linker and a conjugate moiety.
  • the conjugate group is attached to the first modified oligonucleotide at the 5’-end of the first modified oligonucleotide.
  • the conjugate group is attached to the first modified oligonucleotide at the 3 ’-end of the modified oligonucleotide.
  • the conjugate group is attached to the first modified oligonucleotide at an internal position.
  • the conjugate group is attached to the first modified oligonucleotide through a 2 ’-modification of a furanosyl sugar moiety. In certain embodiments, the conjugate group is attached to the first modified oligonucleotide through a modified intemucleoside linkage. In certain embodiments, the conjugate group comprises N-acetyl galactosamine. In certain embodiments, the conjugate group comprises a cell-targeting moiety having an affinity for transferrin receptor (TfR), also known as TfRl and CD71. In certain embodiments, the conjugate group comprises an anti-TfRl antibody or fragment thereof. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding TfRl.
  • TfR transferrin receptor
  • the conjugate group comprises an aptamer capable of binding TfRl.
  • conjugate groups may be selected from any of a C22 alkyl, C20 alkyl, C16 alkyl, CIO alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, Cl 1 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, CIO alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, Cl 1 alkenyl, C9 alkenyl, C8 alkenyl, C7 al
  • conjugate groups may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, CIO alkyl, C21 alkyl, C19 alkyl, Cl 8 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, Cl l alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, where the alkyl chain has one or more unsaturated bonds.
  • the second modified oligonucleotide can comprise a conjugate group.
  • the conjugate group comprises a conjugate linker and a conjugate moiety.
  • the conjugate group is attached to the second modified oligonucleotide at the 5 ’-end of the second modified oligonucleotide.
  • the conjugate group is attached to the second modified oligonucleotide at the 3 ’-end of the modified oligonucleotide.
  • the conjugate group is attached to the second modified oligonucleotide at an internal position.
  • the conjugate group is attached to the second modified oligonucleotide through a 2 ’-modification of a fiiranosyl sugar moiety.
  • the conjugate group is attached to the second modified oligonucleotide through a modified intemucleoside linkage.
  • the conjugate group comprises N-acetyl galactosamine.
  • the conjugate group comprises a cell-targeting moiety having an affinity for transferrin receptor (TfR), also known as TfR.1 and CD71.
  • TfR transferrin receptor
  • the conjugate group comprises an anti-TfRl antibody or fragment thereof.
  • the conjugate group comprises a protein or peptide capable of binding TfR.1.
  • the conjugate group comprises an aptamer capable of binding TfR.1.
  • conjugate groups may be selected from any of a C22 alkyl, C20 alkyl, C16 alkyl, CIO alkyl, C21 alkyl, C19 alkyl, Cl 8 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, Cl l alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, CIO alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, Cl l alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.
  • conjugate groups may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, CIO alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, Cl l alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, where the alkyl chain has one or more unsaturated bonds.
  • an antisense agent comprises an antisense compound, which comprises an oligomeric compound or an oligomeric duplex described herein.
  • an antisense agent which can comprise an oligomeric compound or an oligomeric duplex described herein, is an RNAi agent capable of reducing the amount of PRNP RNA through the activation of RISC/Ago2.
  • an oligomeric agent comprising two or more oligomeric duplexes.
  • an oligomeric agent comprises two or more of any of the oligomeric duplexes described herein.
  • an oligomeric agent comprises two or more of the same oligomeric duplex, which can be any of the oligomeric duplexes described herein.
  • the two or more oligomeric duplexes are linked together.
  • the two or more oligomeric duplexes are covalently linked together.
  • the second modified oligonucleotides of two or more oligomeric duplexes are covalently linked together.
  • the second modified oligonucleotides of two or more oligomeric duplexes are covalently linked together at their 3’ ends.
  • the two or more oligomeric duplexes are covalently linked together by a glycol linker, such as a tetraethylene glycol linker.
  • a glycol linker such as a tetraethylene glycol linker.
  • oligomeric compounds comprise a terminal group.
  • oligomeric compounds comprise a phosphorus-containing group at the 5 ’-end of the antisense oligonucleotide and/or the sense oligonucleotide.
  • the terminal group is a phosphate stabilized phosphate group.
  • the 5 ’-end phosphorus-containing group can be 5 ’-end phosphate (5’-P), 5’-end phosphorothioate (5’-PS), 5’-end phosphorodithioate (5’-PS2), 5’-end vinylphosphonate (5 ’-VP), 5 ’-end methylphosphonate (MePhos) or 5’-deoxy-5’-C-malonyl.
  • the 5 ’VP can be either 5’-E-VP isomer (i.e., trans-vinylphosphonate), 5’-Z-VP isomer (i.e., cis-vinylphosphonate), or mixtures thereof.
  • 5’-E-VP isomer i.e., trans-vinylphosphonate
  • 5’-Z-VP isomer i.e., cis-vinylphosphonate
  • such phosphate group can be attached to either the antisense oligonucleotide or the sense oligonucleotide, it will typically be attached to the antisense oligonucleotide as that has been shown to improve activity of certain RNAi agents.
  • the phosphate stabilizing group is 5 ’-cyclopropyl phosphonate. See e.g., WO/2018/027106.
  • the oligomeric compounds comprise one or more conjugate groups.
  • Conjugate groups consist of one or more conjugate moiety and a conjugate linker which links the conjugate moiety to an oligonucleotide of an oligomeric compound. Conjugate groups may be attached to either or both ends and/or at any internal position of an oligonucleotide.
  • conjugate groups modify one or more properties of oligomeric compound, including, but not limited to, pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance.
  • Conjugation of one or more carbohydrate moieties to an oligomeric compound can optimize one or more properties of the oligomeric compound.
  • the carbohydrate moiety is attached to a modified subunit of the oligomeric compound.
  • the ribose sugar of one or more ribonucleotide subunits of an oligomeric compound can be replaced with another moiety, e.g. a noncarbohydrate (preferably cyclic) carrier to which is attached a carbohydrate ligand.
  • a ribonucleotide subunit in which the ribose sugar of the subunit has been so replaced is referred to herein as a ribose replacement modification subunit (RRMS), which is a modified sugar moiety.
  • RRMS ribose replacement modification subunit
  • a cyclic carrier may be a carbocyclic ring system, i.e., one or more ring atoms may be a heteroatom, e.g., nitrogen, oxygen, sulphur.
  • the cyclic carrier may be a monocyclic ring system, or may contain two or more rings, e.g. fused rings.
  • the cyclic carrier may be a fully saturated ring system, or it may contain one or more double bonds.
  • conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Me d. Chem. Lett., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem.
  • Acids Res., 1990, 18, 3777-3783 a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic, a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), an octadecylamine or hexylamino-carbonyl- oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp.
  • a tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids , 2015, 4, e220; doi: 10.1038/mtna.2014.72 and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or a GalNAc cluster (e.g., WO2014/179620).
  • Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), antibodies, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.
  • intercalators include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), antibodies, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospho
  • a conjugate moiety comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (.S')-(+)-pranoprofcn.
  • active drug substance for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (.S')-(+)-pranoprofcn.
  • carprofen dansylsarcosine, 2, 3, 5 -triiodobenzoic acid, fmgolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial, or an antibiotic.
  • Conjugate moieties are attached to an oligomeric compound through conjugate linkers.
  • a conjugate group is a single chemical bond (i.e. conjugate moiety is attached to an oligonucleotide via a conjugate linker through a single bond).
  • the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units, such as ethylene glycol, nucleosides, or amino acid units.
  • a conjugate linker comprises a pyrrolidine.
  • a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group.
  • conjugate linkers are bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate groups to parent compounds, such as the oligonucleotides provided herein.
  • a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a particular site on a compound and the other is selected to bind to a conjugate group. Examples of functional groups used in a bifunctional linking moiety include, but are not limited to, electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups.
  • bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.
  • conjugate linkers include, but are not limited to, pyrrolidine, 8-amino-3,6- dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane- 1 -carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA).
  • ADO 8-amino-3,6- dioxaoctanoic acid
  • SMCC succinimidyl 4-(N-maleimidomethyl) cyclohexane- 1 -carboxylate
  • AHEX or AHA 6-aminohexanoic acid
  • conjugate linkers include, but are not limited to, substituted or unsubstituted C1-C10 alkyl, substituted or unsubstituted C2-C10 alkenyl, or substituted or unsubstituted C2-C10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.
  • conjugate linkers comprise 1-5 linker-nucleosides.
  • such linker-nucleosides are modified nucleosides.
  • such linker- nucleosides comprise a modified sugar moiety.
  • linker-nucleosides are unmodified.
  • linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine.
  • a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N- benzoylcytosine, 5 -methylcytosine, 4-N-benzoyl-5 -methylcytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine. It is typically desirable for linker-nucleosides to be cleaved from the compound after it reaches a target tissue. Accordingly, linker-nucleosides are typically linked to one another and to the remainder of the compound through cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.
  • linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which an oligomeric compound comprises two oligonucleotides each consisting of a specified number or range of linked nucleosides and the antisense oligonucleotide having a specified percent complementarity to a reference nucleic acid, and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker-nucleosides are not counted toward the length of the oligonucleotides of an oligomeric compound and are not used in determining the percent complementarity of the antisense oligonucleotide with the reference nucleic acid.
  • conjugate linkers comprise no more than 10 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 5 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 2 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 1 linker-nucleoside.
  • a conjugate group it is desirable for a conjugate group to be cleaved from the oligomeric compound.
  • oligomeric compounds comprising a particular conjugate moiety are better taken up by a particular cell type, but once the oligomeric compound has been taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligomeric compound.
  • certain conjugates may comprise one or more cleavable moieties, typically within the conjugate linker.
  • a cleavable moiety is a cleavable bond.
  • a cleavable moiety is a group of atoms comprising at least one cleavable bond.
  • a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds.
  • a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome.
  • a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.
  • a cleavable bond is selected from among: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate linkage between an oligonucleotide and a conjugate moiety or conjugate group.
  • a cleavable moiety comprises or consists of one or more linker- nucleosides.
  • one or more linker-nucleosides are linked to one another and/or to the remainder of the compound through cleavable bonds.
  • such cleavable bonds are unmodified phosphodiester bonds.
  • a cleavable moiety is 2'- deoxy nucleoside that is attached to either the 3' or 5 '-terminal nucleoside of an oligonucleotide by a phosphate intemucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate linkage.
  • the cleavable moiety is 2'-deoxyadenosine.
  • each ligand of a cell-targeting moiety has an affinity for at least one type of receptor on a target cell. In certain embodiments, each ligand has an affinity for at least one type of receptor on the surface of a mammalian liver cell. In certain embodiments, each ligand has an affinity for the hepatic asialoglycoprotein receptor (ASGP-R). In certain embodiments, each ligand is a carbohydrate.
  • the cell-targeting moiety targets neurons. In certain embodiments, the cell-targeting moiety targets a neurotransmitter receptor. In certain embodiments, the cell targeting moiety targets a neurotransmitter transporter. In certain embodiments, the cell targeting moiety targets a GABA transporter. See e.g., WO 2011/131693, WO 2014/064257. Certain motifs
  • Oligomeric duplexes can be described by motif or by specific features.
  • an oligomeric duplex having a motif or specific feature described herein is an antisense agent.
  • the oligomeric duplexes described herein comprise:
  • the oligomeric duplexes described herein comprise:
  • the oligomeric duplexes described herein comprise:
  • oligomeric duplex includes a two nucleoside overhang at the 3 ’end of the antisense oligonucleotide, and a blunt end at the 5 ’-end of the antisense oligonucleotide.
  • the oligomeric duplexes described herein comprise:
  • the oligomeric duplexes described herein comprise:
  • oligomeric duplex has a two nucleotide overhang at the 3 ’end of the antisense oligonucleotide, and a blunt end at the 5 ’-end of the antisense oligonucleotide.
  • the oligomeric duplexes described herein comprise:
  • the oligomeric duplexes described herein comprise:
  • oligomeric duplex has a two nucleoside overhang at the 3 ’end of the antisense oligonucleotide, and a blunt end at the 5 ’-end of the antisense oligonucleotide.
  • the conjugate at the 3 ’-end of the sense oligonucleotide may comprise a targeting moiety.
  • the targeting moiety targets a neurotransmitter receptor.
  • the cell targeting moiety targets a neurotransmitter transporter.
  • the cell targeting moiety targets a GABA transporter.
  • the oligomeric duplex comprises a sense oligonucleotide consisting of 21 nucleosides and an antisense oligonucleotide consisting of 23 nucleosides, wherein the sense oligonucleotide contains at least one motif of three contiguous 2’-F modified nucleosides at positions 9, 10, 11 from the 5 ’-end; the antisense oligonucleotide contains at least one motif of three 2’-O-methyl modifications on three consecutive nucleosides at positions 11, 12, 13 from the 5’ end, wherein one end of the oligomeric duplex is blunt, while the other end comprises a 2 nucleotide overhang.
  • the 2 nucleotide overhang is at the 3 ’-end of the antisense oligonucleotide.
  • the 2 nucleotide overhang is at the 3 ’-end of the antisense oligonucleotide, there may be two phosphorothioate intemucleoside linkages between the terminal three nucleotides, wherein two of the three nucleotides are the overhang nucleotides, and the third nucleotide is a paired nucleotide next to the overhang nucleotide.
  • the oligomeric duplex additionally has two phosphorothioate intemucleoside linkages between the terminal three nucleotides at both the 5 ’-end of the sense oligonucleotide and at the 5 ’-end of the antisense oligonucleotide.
  • every nucleoside in the sense oligonucleotide and the antisense oligonucleotide of the oligomeric duplex is a modified nucleoside.
  • each nucleoside is independently modified with a 2’-O-methyl or 3 ’-fluoro, e.g. in an alternating motif.
  • the oligomeric duplex comprises a conjugate.
  • every nucleotide in the sense oligonucleotide and antisense oligonucleotide of the oligomeric duplex, including the nucleotides that are part of the motifs, may be modified.
  • Each nucleotide may be modified with the same or different modification, which can include one or more alteration of one or both of the non-linking phosphate oxygens; alteration of a constituent of the ribose sugar, e.g., of the 2’ hydroxyl on the ribose sugar; wholesale replacement of the phosphate moiety with “dephospho” linkers; modification or replacement of a naturally occurring base; and replacement or modification of the ribose-phosphate backbone.
  • each nucleoside of the sense oligonucleotide and antisense oligonucleotide is independently modified with LNA, cEt, UNA, UNA, CeNA, 2 ’-MOE, 2’-0Me, 2’-O- allyl, 2’-C-allyl, 2 ’-deoxy, 2 ’-hydroxyl, or 2 ’-fluoro.
  • the oligomeric duplex can contain more than one modification.
  • each nucleoside of the sense oligonucleotide and antisense oligonucleotide is independently modified with 2’-O-methyl or 2’-F. In certain embodiments, the modification is a 2’- NMA modification.
  • alternating motif refers to a motif having one or more modifications, each modification occurring on alternating nucleosides of one oligonucleotide .
  • the alternating nucleoside may refer to one per every other nucleoside or one per every three nucleosides, or a similar pattern.
  • A, B and C each represent one type of modification to the nucleoside, the alternating motif can be "ABABABABABAB ... ,” “AABBAABBAABB ... ,” “AABAABAABAAB ... ,” “AAABAAABAAAB ... ,” “AAABBBAAABBB ... ,” or “ABCABCABCABC ... ,” etc.
  • the type of modifications contained in the alternating motif may be the same or different.
  • the alternating pattern i.e., modifications on every other nucleoside, may be the same, but each of the sense oligonucleotide or antisense oligonucleotide can be selected from several possibilities of modifications within the alternating motif such as "ABABAB ... ", "ACACAC ... " "BDBDBD ... " or "CDCDCD ... ,” etc.
  • the modification pattern for the alternating motif on the sense oligonucleotide relative to the modification pattern for the alternating motif on the antisense oligonucleotide is shifted.
  • the shift may be such that the group of modified nucleotide of the sense oligonucleotide corresponds to a group of differently modified nucleotides of the antisense oligonucleotide and vice versa.
  • the sense oligonucleotide when paired with the antisense oligonucleotide in the oligomeric duplex the alternating motif in the sense oligonucleotide may start with "ABABAB” from 5' -3' of the oligonucleotide and the alternating motif in the antisense oligonucleotide may start with "BABABA” from 5' -3 'of the oligonucleotide within the duplex region.
  • the alternating motif in the sense oligonucleotide may start with "AABBAABB” from 5’-3* of the oligonucleotide and the alternating motif in the antisense oligonucleotide may start with "BBAABBAA” from 5' -3' of the oligonucleotide within the duplex region, so that there is a complete or partial shift of the modification 10 patterns between the sense oligonucleotide and the antisense oligonucleotide .
  • the oligomeric duplex comprising the pattern of the alternating motif of 2’-O-methyl modification and 2’-F modification on the sense oligonucleotide initially has a shift relative to the pattern of the alternating motif of 2’-O-methyl modification and 2’-F modification on the antisense oligonucleotide initially, i.e., the 2’-O-methyl modified nucleotide on the sense oligonucleotide base pairs with a 2’-F modified nucleotides on the antisense oligonucleotide and vice versa.
  • the 1 position of the sense oligonucleotide may start with the 2’-F modification
  • the 1 position of the antisense oligonucleotide may start with a 2’-O-methyl modification.
  • the introduction of one or more motifs of three identical modifications on three consecutive nucleotides to the sense oligonucleotide and/or antisense oligonucleotide interrupts the initial modification pattern present in the sense oligonucleotide and/or antisense oligonucleotide.
  • This interruption of the modification pattern of the sense and/or antisense oligonucleotide by introducing one or more motifs of three identical modifications on three consecutive nucleotides to the sense and/or antisense oligonucleotide surprisingly enhances the gene silencing activity to the target gene.
  • the modification of the nucleotide next to the motif is a different modification than the modification of the motif.
  • the portion of the sequence containing the motif is " ... NaYYYNb - • •,” where "Y” represents the modification of the motif of three identical modifications on three consecutive nucleotide, and "Na” and “Nb” represent a modification to the nucleotide next to the motif "YYY” that is different than the modification of Y, and where Na and Nb can be the same or different modifications.
  • Na and/or Nb may be present or absent when there is a wing modification present.
  • the sense oligonucleotide may be represented by formula (I):
  • each Y comprises a 2’-F modification.
  • the N a and Nb comprise modifications of alternating patterns.
  • the YYY motif occurs at or near the cleavage site of the target nucleic acid.
  • the YYY motif can occur at or near the vicinity of the cleavage site (e.g., can occur at positions 6, 7, 8; 7, 8, 9; 8, 9, 10; 9, 10, 11; 10, 11, 12; or 11, 12, 13) of the sense oligonucleotide , the count starting from the 1 st nucleotide from the 5 ’-end; or optionally, the count starting at the 1 st paired nucleotide within the duplex region, from the 5 ’-end.
  • the antisense oligonucleotide of the oligomeric duplex may be represented by the formula:
  • each X’X’X’, Y’Y’Y’ and Z’Z’Z’ each independently represent modified nucleosides where each X’ nucleoside has the same modification; each Y’ nucleoside has the same modification; and each Z’ nucleoside has the same modification.
  • each Y’ comprises a 2’-F modification.
  • each Y’ comprises a 2’-OMe modification.
  • the N a ’ and/or N b ’ comprise modifications of alternating patterns.
  • the Y’Y’Y’ motif occurs at or near the cleavage site of the target nucleic acid.
  • the Y’Y’Y’ motif can occur at positions 9, 10, 11; 10, 11, 12; 11, 12, 13; 12, 13, 14; or 13, 14, 15 of the antisense oligonucleotide , with the count starting from the 1 st nucleotide from the 5 ’-end; or, optionally, the count starting at the 1 st paired nucleotide within the duplex region, from the 5 ’-end.
  • the Y’Y’Y’ motif occurs at positions 11, 12, 13.
  • k is 1 and 1 is 0, or k is 0 and 1 is 1, or both k and 1 are 1.
  • the antisense oligonucleotide can therefore be represented by the following formulas:
  • Nb’ represents 0-10, 0-7, 0-5, 0-4, 0-2, or 0 linked nucleosides.
  • Each N a ’ independently represents 2-20, 2-15, or 2-10 linked nucleosides.
  • Nb represents 0-10, 0-7, 0-5, 0-4, 0-2, or 0 linked nucleosides.
  • Each N a ’ independently represents 2-20, 2-15, or 2-10 linked nucleosides.
  • Nb’ represents 0-10, 0-7, 0-5, 0-4, 0-2, or 0 linked nucleosides.
  • Each N a ’ independently represents 2-20, 2-15, or 2-10 linked nucleosides.
  • Nb’ is 0, 1, 2, 3, 4, 5, or 6.
  • k is 0 and 1 is 0 and the antisense oligonucleotide may be represented by the formula:
  • each N a independently represents 2-20, 2-15, or 2-10 linked nucleosides.
  • Each X’, Y’, and Z’ may be the same or different from each other.
  • Each nucleoside of the sense oligonucleotide and antisense oligonucleotide may be independently modified with LNA, UNA, cEt, UNA, CeNA, 2 ’-methoxy ethyl, 2’-O-methyl, 2’-O-allyl, 2’-C-allyl, 2’-hydroxyl, or 2’-fluoro.
  • each nucleoside of the sense oligonucleotide and antisense oligonucleotide is independently modified with , 2’-O-methyl or 2’-fluoro.
  • Each X, Y, Z, X’, Y’, and Z’ in particular, may represent a 2’-O-methyl modification or 2’-fluoro modification.
  • the modification is a 2’- NMA modification.
  • the sense oligonucleotide of the oligomeric duplex may contain YYY motif occurring at 9, 10, and 11 positions of the oligonucleotide when the duplex region is 21 nucleotides, the count starting from the 1 st nucleotide from the 5 ’-end, or optionally, the count starting at the 1 st paired nucleotide within the duplex region, from the 5’-end; and Y represents 2’-F modification.
  • the sense oligonucleotide may additionally contain XXX motif or ZZZ motifs as wing modifications at the opposite end of the duplex region; and XXX and ZZZ each independently represents a 2’-O-methyl modification or 2 ’-fluoro modification.
  • the antisense oligonucleotide may contain Y’Y’Y’ motif occurring at positions 11, 12, 13 of the oligonucleotide , the count starting from the 1 st nucleotide from the 5’-end, or optionally, the count starting at the 1 st paired nucleotide within the duplex region, from the 5 ’-end; and Y’ represents 2’-O-methyl modification.
  • the antisense oligonucleotide may additionally contain X’X’X’ motif or Z’Z’Z’ motif as wing modifications at the opposite end of the duplex region; and X’X’X’ or Z’Z’Z’ each independently represents a 2’-O-methyl modification or 2’-fluoro modification.
  • the sense oligonucleotide represented by any one of the above formulas la, lb, Ic, and Id forms a duplex with an antisense oligonucleotide being represented by any one of the formulas Ila, lib, lie, and lid, respectively.
  • the oligomeric duplexes described herein may comprise a sense oligonucleotide and an antisense oligonucleotide, each oligonucleotide having 14 to 30 nucleotides, the oligomeric duplex represented by formula (III):
  • XXX, YYY, X’X’X’, Y’Y’Y’, and Z’Z’Z’ each independently represent one motif of three identical modifications on three consecutive nucleotides.
  • i is 0 and j is 0; or i is 1 and j is 0; or i is 0 and j is 1; or both i and j are 0; or both i and j are 1.
  • k is 0 and 1 is 0; or k is 1 and 1 is 0, or k is 0 and 1 is 1; or both k and 1 are 0; or both k and 1 are 1.
  • Exemplary combinations of the sense oligonucleotide and antisense oligonucleotide forming a oligomeric duplex include the formulas below:
  • each N a independently represents 2-20, 2-15, or 2-10 linked nucleosides.
  • each Nb independently represents 1-10, 1-7, 1-5, or 1-4 linked nucleosides.
  • Each N a independently represents 2-20, 2-15, or 2-10 linked nucleosides.
  • each Nb, Nb’ independently represents 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2, or 0 linked nucleosides.
  • Each N a independently represents 2-20, 2-15, or 2-10 linked nucleosides.
  • each Nb, Nb’ independently represents 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2, or 0 linked nucleosides.
  • Each N a , N a ’ independently 2-20, 2- 15, or 2-10 linked nucleosides.
  • Each N a , N a ’, Nb, Nb’ independently comprises modifications of alternating pattern.
  • Each of X, Y, and Z in formulas III, Illa, Illb, IIIc, and Illd may be the same or different from each other.
  • At least one of the Y nucleotides may form a base pair with one of the Y’ nucleotides.
  • at least two of the Y nucleotides may form base pairs with the corresponding Y’ nucleotides; or all three of the Y nucleotides may form base pairs with the corresponding Y’ nucleotides.
  • the oligomeric duplex is represented by formula Illb or Illd
  • at least one of the Z nucleotides may form a base pair with one of the Z’ nucleotides.
  • at least two of the Z nucleotides may form base pairs with the corresponding Z’ nucleotides; or all three of the Z nucleotides may form base pairs with the corresponding Z’ nucleotides.
  • At least one of the X nucleotides may form a base pair with one of the X’ nucleotides.
  • at least two of the X nucleotides may form base pairs with the corresponding X’ nucleotides; or all three of the X nucleotides may form base pairs with the corresponding X’ nucleotides.
  • the modification of the Y nucleotide is different than the modification on the Y’ nucleotide
  • the modification on the Z nucleotide is different than the modification on the Z’ nucleotide
  • the modification on the X nucleotide is different than the modification on the X’ nucleotide.
  • the N a modifications are 2’-O-methyl or 2’-fluoro modifications.
  • the N a modifications are 2’-O-methyl or 2 ’-fluoro modifications and n p ’>0 and at least one n p ’ is linked to a neighboring nucleotide via phosphorothioate linkage.
  • the N a modifications are 2’-O- methyl or 2’ -fluoro modifications, n p ’>0 and at least one n p ’ is linked to a neighboring nucleotide via phosphorothioate linkage, and the sense oligonucleotide is conjugated to one or more cell targeting group attached through a bivalent or trivalent branched linker.
  • the N a modifications are 2’-O-methyl or 2 ’-fluoro modifications, n p ’>0 and at least one n p ’ is linked to a neighboring nucleotide via phosphorothioate linkage, the sense oligonucleotide comprises at least one phosphorothioate linkage and the sense oligonucleotide is conjugated to one or more cell targeting group attached through a bivalent or trivalent branched linker.
  • the N a modifications are 2’-O-methyl or 2’-fluoro modifications and n p ’>0 and at least one n p ’ is linked to a neighboring nucleotide via phosphorothioate linkage
  • the sense oligonucleotide comprises at least one phosphorothioate linkage and the sense oligonucleotide is conjugated to one or more cell targeting group attached through a bivalent or trivalent branched linker.
  • the modification is a 2’- NMA modification.
  • oligomeric compounds and oligomeric duplexes are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity; such oligomeric compounds and oligomeric duplexes are antisense agents.
  • an antisense agent or a portion of an antisense agent is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid.
  • RISC RNA-induced silencing complex
  • antisense agents having antisense oligonucleotides that are loaded into RISC are RNAi agents.
  • RNAi agents may be double-stranded (siRNA or dsRNAi) or single -stranded (ssRNA).
  • RNAi agents are capable of RISC-mediated modulation of a target nucleic acid in a cell. In certain embodiments, such compounds reduce or inhibit the amount or activity of a target nucleic acid by 25% or more in the standard in vitro assay as described in Example 2. In certain embodiments, RNAi agents selectively affect more than one target nucleic acid. Such RNAi agents comprise a nucleobase sequence that hybridizes to more than one target nucleic acid, resulting in more than one desired antisense activity. In certain embodiments, an RNAi agent does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in significant undesired antisense activity.
  • Antisense activities may be observed directly or indirectly.
  • observation or detection of an RNAi activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein and/or a phenotypic change in a cell or subject.
  • antisense agents comprise an antisense oligonucleotide comprising a region that is complementary to a target nucleic acid.
  • oligomeric compounds or oligomeric duplexes comprise an antisense oligonucleotide comprising a region that is complementary to a target nucleic acid.
  • the target nucleic acid is an endogenous RNA molecule.
  • the target nucleic acid encodes a protein.
  • the oligomeric compound or oligomeric duplex is an RNAi agent.
  • an antisense agent comprises an antisense oligonucleotide comprising a region that is complementary to a target nucleic acid.
  • an oligomeric compound or an oligomeric duplex comprises an antisense oligonucleotide comprising a region that is complementary to a target nucleic acid.
  • antisense oligonucleotides are 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid.
  • antisense oligonucleotides are at least 80% complementary to the target nucleic acid over the entire length of the antisense oligonucleotides and comprise a region that is 100% or fully complementary to a target nucleic acid. In certain embodiments, the region of full complementarity is from 6 to 20, 10 to 18, or 18 to 20 nucleobases in length.
  • antisense oligonucleotides comprise one or more mismatched nucleobases relative to the target nucleic acid. In certain embodiments, antisense activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount. Thus, in certain embodiments selectivity of the antisense oligonucleotides is improved.
  • antisense oligonucleotides comprise a region complementary to the target nucleic acid.
  • the complementary region comprises or consists of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 contiguous nucleosides.
  • the complementary region comprises or consists of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 contiguous nucleosides.
  • the complementary region constitutes 70%, 80%, 85%, 90%, 95% of the nucleosides of the antisense oligonucleotide. In certain embodiments, the complementary region constitutes all of the nucleosides of the antisense oligonucleotide. In certain embodiments, the complementary region of the antisense oligonucleotide is at least 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, the complementary region of the antisense oligonucleotide is 100% complementary to the target nucleic acid.
  • an oligomeric duplex comprises a sense oligonucleotide.
  • an antisense agent comprises a sense oligonucleotide.
  • the sense oligonucleotide comprises a region complementary to the antisense oligonucleotide.
  • the complementary region comprises or consists of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 contiguous nucleosides.
  • the complementary region comprises or consists of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or 21 contiguous nucleosides. In certain embodiments, the complementary region constitutes 70%, 80%, 85%, 90%, 95% of the nucleosides of the sense oligonucleotide. In certain embodiments, the complementary region constitutes all of the nucleosides of the sense oligonucleotide. In certain embodiments, the complementary region of the sense oligonucleotide is at least 99%, 95%, 90%, 85%, or 80% complementary to the antisense oligonucleotide. In certain embodiments, the complementary region of the sense oligonucleotide is 100% complementary to the antisense oligonucleotide.
  • a sense oligonucleotide hybridizes with the antisense oligonucleotide to form a duplex region.
  • duplex region consists of 7 hybridized pairs of nucleosides (one of each pair being on the antisense oligonucleotide and the other of each pair being on the sense oligonucleotide).
  • a duplex region comprises least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 hybridized pairs.
  • a duplex region comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or 21 hybridized pairs.
  • each nucleoside of antisense oligonucleotide is paired in the duplex region (i.e., the antisense oligonucleotide has no overhanging nucleosides).
  • the antisense oligonucleotide includes unpaired nucleosides at the 3 ’-end and/or the 5 ’end (overhanging nucleosides).
  • each nucleoside of sense oligonucleotide is paired in the duplex region (i.e., the sense oligonucleotide has no overhanging nucleosides).
  • the sense oligonucleotide includes unpaired nucleosides at the 3 ’-end and/or the 5 ’end (overhanging nucleosides).
  • duplexes formed by the antisense oligonucleotide and the sense oligonucleotide do not include any overhangs at one or both ends. Such ends without overhangs are referred to as blunt.
  • the antisense oligonucleotide has overhanging nucleosides
  • one or more of those overhanging nucleosides are complementary to the target nucleic acid.
  • one or more of those overhanging nucleosides are not complementary to the target nucleic acid.
  • oligomeric compounds, oligomeric duplexes, antisense agents, or RNAi agents disclosed herein comprise or consist of an antisense oligonucleotide comprising a region that is complementary to a target nucleic acid, wherein the target nucleic acid is PRNP RNA.
  • the RNAi agent, antisense agents, oligomeric compound, or oligomeric duplex disclosed herein may target PRNP RNA.
  • the RNAi agent is an an oligomeric duplex.
  • PRNP RNA has the sequence of any one of the sequences set forth in SEQ ID NO: 1 (GENBANK Accession No.
  • contacting a cell with an oligomeric duplex comprising an oligomeric compound in which the oligomeric compound comprises or consists of an antisense oligonucleotide complementary to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 or SEQ ID NO: 9 reduces the amount of PRNP RNA, and in certain embodiments reduces the amount of prion protein.
  • contacting a cell with an oligomeric duplex comprising an oligomeric compound complementary to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, or SEQ ID NO: 9 results in reduced aggregation of prion protein.
  • the oligomeric compound consists of an antisense oligonucleotide.
  • the oligomeric compound, the oligomeric duplex, or the antisense agent comprises a conjugate group.
  • the oligomeric compounds, the oligomeric duplex, or the antisense agent comprises more than one conjugate group.
  • contacting a cell in a subject with an RNAi agent disclosed herein comprising or consisting of an antisense oligonucleotide complementary to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, or SEQ ID NO: 9 ameliorates one or more symptoms or hallmarks of a neurodegenerative disease associated with PrP.
  • the neurodegenerative disease associated with PrP is a prion disease.
  • the neurodegenerative disease associated with PrP is Creutzfeldt-Jakob disease (CJD), Gerstmann-Straussler-Scheinker syndrome, fatal familial insomnia, or kuru.
  • the CJD is variant Creutzfeldt-Jakob Disease (vCJD), classic Creutzfeldt- Jakob Disease (cCJD), familial Creutzfeldt-Jakob Disease (fCJD), or sporadic Creutzfeldt-Jakob Disease (sCJD)).
  • the neurodegenerative disease associated with PrP is a synucleinopathy.
  • the synucleinopathy is Alzheimer’s disease, Parkinson’s disease, or dementia with Lewy bodies.
  • the neurodegenerative disease associated with PrP is a tauopathy.
  • the tauopathy is frontal temporal dementia associated with a Tau mutation, Pick’s disease, progressive supranuclear palsy, corticobasal neurodegeneration, or chronic traumatic encephalopathy (CTE).
  • the one or more symptoms or hallmarks is rapidly progressing dementia, personality changes, ataxia, hallucinations, myoclonus (muscle jerks), chorea, autonomic disturbances, impaired vision, insomnia, blindness, loss of speech, coma, death, spongiform changes in the brain, development of abnormal protein aggregates, neuronal loss, gliosis, and the presence of markers of neuronal loss. .
  • contacting a cell in a subject with an RNAi agent disclosed herein comprising or consisting of an antisense oligonucleotide complementary to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, or SEQ ID NO: 9 reduces or delays the onset or progression of rapidly progressing dementia, personality changes, ataxia, hallucinations, myoclonus (muscle jerks), chorea, autonomic disturbances, impaired vision, insomnia, blindness, loss of speech, coma, spongiform changes in the brain, a development of abnormal protein aggregates, neuronal loss, or gliosis, or delays death, or reduces the presence of markers of neuronal loss.
  • an RNAi agent disclosed herein comprising or consisting of an antisense oligonucleotide complementary to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3,
  • contacting a cell in a subject with an antisense agent disclosed herein comprising or consisting of an antisense oligonucleotide complementary to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, or SEQ ID NO: 9 ameliorates one or more symptoms or hallmarks of a neurodegenerative disease associated with PrP.
  • the one or more symptoms or hallmarks is rapidly progressing dementia, personality changes, ataxia, hallucinations, myoclonus (muscle jerks), chorea, autonomic disturbances, impaired vision, insomnia, blindness, loss of speech, coma, death, spongiform changes in the brain, development of abnormal protein aggregates, neuronal loss, gliosis, and the presence of markers of neuronal loss.
  • contacting a cell in a subject with an antisense agent disclosed herein comprising or consisting of an antisense oligonucleotide complementary to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, or SEQ ID NO: 9 reduces or delays the onset or progression of rapidly progressing dementia, personality changes, ataxia, hallucinations, myoclonus (muscle jerks), chorea, autonomic disturbances, impaired vision, insomnia, blindness, loss of speech, coma, spongiform changes in the brain, a development of abnormal protein aggregates, neuronal loss, or gliosis, or delays death, or reduces the presence of markers of neuronal loss.
  • contacting a cell in a subject with an oligomeric compound disclosed herein comprising or consisting of an antisense oligonucleotide complementary to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, or SEQ ID NO: 9 ameliorates one or more symptoms or hallmarks of a neurodegenerative disease associated with PrP.
  • the one or more symptoms or hallmarks is rapidly progressing dementia, personality changes, ataxia, hallucinations, myoclonus (muscle jerks), chorea, autonomic disturbances, impaired vision, insomnia, blindness, loss of speech, coma, death, spongiform changes in the brain, development of abnormal protein aggregates, neuronal loss, gliosis, and the presence of markers of neuronal loss.
  • contacting a cell in a subject with an oligomeric compound disclosed herein comprising or consisting of an antisense oligonucleotide complementary to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, or SEQ ID NO: 9 reduces or delays the onset or progression of rapidly progressing dementia, personality changes, ataxia, hallucinations, myoclonus (muscle jerks), chorea, autonomic disturbances, impaired vision, insomnia, blindness, loss of speech, coma, spongiform changes in the brain, a development of abnormal protein aggregates, neuronal loss, or gliosis, or delays death, or reduces the presence of markers of neuronal loss.
  • contacting a cell in a subject with an oligomeric duplex disclosed herein comprising an antisense oligonucleotide complementary to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, or SEQ ID NO: 9 ameliorates one or more symptoms or hallmarks of a neurodegenerative disease associated with PrP.
  • the one or more symptoms or hallmarks is rapidly progressing dementia, personality changes, ataxia, hallucinations, myoclonus (muscle jerks), chorea, autonomic disturbances, impaired vision, insomnia, blindness, loss of speech, coma, death, spongiform changes in the brain, development of abnormal protein aggregates, neuronal loss, gliosis, and the presence of markers of neuronal loss.
  • contacting a cell in a subject with an oligomeric duplex disclosed herein comprising an antisense oligonucleotide complementary to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, or SEQ ID NO: 9 reduces or delays the onset or progression of rapidly progressing dementia, personality changes, ataxia, hallucinations, myoclonus (muscle jerks), chorea, autonomic disturbances, impaired vision, insomnia, blindness, loss of speech, coma, spongiform changes in the brain, a development of abnormal protein aggregates, neuronal loss, or gliosis, or delays death, or reduces the presence of markers of neuronal loss.
  • oligomeric compounds comprise or consist of an antisense oligonucleotide comprising a region that is complementary to a target nucleic acid, wherein the target nucleic acid is expressed in a pharmacologically relevant tissue.
  • oligomeric duplexes comprise an antisense oligonucleotide comprising a region that is complementary to a target nucleic acid, wherein the target nucleic acid is expressed in a pharmacologically relevant tissue.
  • the pharmacologically relevant tissues are the cells and tissues that comprise the central nervous system.
  • the tissues include the cortex, spinal cord, the hippocampus, thalamus, cerebellum, and the brain stem.
  • the tissues include the cortex and the spinal cord.
  • the cells are brain cells.
  • the cells include neurons and glial cells.
  • the glial cells include astrocytes.
  • Certain embodiments provided herein relate to methods of reducing PRNP RNA or inhibiting PRNP RNA expression or activity, which can be useful for treating or ameliorating a neurodegenerative disease associated with PrP.
  • the neurodegenerative disease associated with PrP is a prion disease.
  • the neurodegenerative disease associated with PrP is a synucleinopathy.
  • the neurodegenerative disease associated with PrP is a tauopathy.
  • the neurodegenerative disease associated with PrP is Creutzfeldt- Jakob disease (CJD), variant Creutzfeldt-Jakob Disease (vCJD), familial Creutzfeldt- Jakob Disease (fCJD), Gerstmann-Straussler-Scheinker syndrome (GSS), fatal familial insomnia (FFI), kuru, Alzheimer’s disease, Parkinson’s disease, dementia with Lewy bodies, frontal temporal dementia associated with a Tau mutation, Pick’s disease, progressive supranuclear palsy, corticobasal neurodegeneration, or chronic traumatic encephalopathy (CTE).
  • CJD Creutzfeldt- Jakob disease
  • vCJD variant Creutzfeldt-Jakob Disease
  • fCJD familial Creutzfeldt- Jakob Disease
  • GSS Gerstmann-Straussler-Scheinker syndrome
  • FFI fatal familial insomnia
  • kuru Alzheimer’s disease
  • Parkinson’s disease dementia with Lewy bodies
  • Creutzfeldt- Jakob disease isvariant Creutzfeldt-Jakob Disease (vCJD), classic Creutzfeldt- Jakob Disease (cCJD), familial Creutzfeldt-Jakob Disease (fCJD), or sporadic Creutzfeldt-Jakob Disease (sCJD).
  • the neurodegenerative disease associated with PrP is CJD.
  • the neurodegenerative disease associated with PrP is Gerstmann-Straussler-Scheinker syndrome.
  • the neurodegenerative disease associated with PrP is fatal familial insomnia.
  • the neurodegenerative disease associated with PrP is kuru.
  • the neurodegenerative disease associated with PrP is Alzheimer’s disease. In certain embodiments, the neurodegenerative disease associated with PrP is Parkinson’s disease. In certain embodiments, the neurodegenerative disease associated with PrP is dementia with Lewy bodies. In certain embodiments, the neurodegenerative disease associated with PrP is frontal temporal dementia associated with a Tan mutation. In certain embodiments, the neurodegenerative disease associated with PrP is Pick’s disease. In certain embodiments, the neurodegenerative disease associated with PrP is progressive supranuclear palsy. In certain embodiments, the neurodegenerative disease associated with PrP is corticobasal neurodegeneration. In certain embodiments, the neurodegenerative disease associated with PrP is chronic traumatic encephalopathy (CTE).
  • CTE chronic traumatic encephalopathy
  • a method comprises administering to a subject an oligomeric compound, an oligomeric duplex, or an antisense agent, any of which having a nucleobase sequence complementary to PRNP.
  • the subject has or is at risk for developing a neurodegenerative disease associated with PrP.
  • the subject has a prion disease.
  • the subject has a synucleinopathy.
  • the subject has atauopathy.
  • the subject has Creutzfeldt- Jakob disease (CJD) (e.g., variant Creutzfeldt- Jakob Disease (vCJD), classic Creutzfeldt-Jakob Disease (cCJD), familial Creutzfeldt-Jakob Disease (fCJD), or sporadic Creutzfeldt-Jakob Disease (sCJD)), Gerstmann-Straussler-Scheinker syndrome, fatal familial insomnia, kuru, Alzheimer’s disease, Parkinson’s disease, dementia with Lewy bodies, frontal temporal dementia associated with a Tau mutation, Pick’s disease, progressive supranuclear palsy, corticobasal neurodegeneration, or chronic traumatic encephalopathy (CTE).
  • CJD Creutzfeldt- Jakob disease
  • vCJD variant Creutzfeldt- Jakob Disease
  • cCJD classic Creutzfeldt-Jakob Disease
  • fCJD familial Creutzfeldt-Jak
  • the subject has Creutzfeldt-Jakob disease (CJD) (e.g., variant Creutzfeldt-Jakob Disease (vCJD), classic Creutzfeldt- Jakob Disease (cCJD), familial Creutzfeldt-Jakob Disease (fCJD), or sporadic Creutzfeldt-Jakob Disease (sCJD)).
  • CJD Creutzfeldt-Jakob disease
  • vCJD variant Creutzfeldt-Jakob Disease
  • cCJD classic Creutzfeldt- Jakob Disease
  • fCJD familial Creutzfeldt-Jakob Disease
  • sCJD sporadic Creutzfeldt-Jakob Disease
  • the subject has Gerstmann-Straussler-Scheinker syndrome, fatal familial insomnia, kuru, Alzheimer’s disease, Parkinson’s disease, or dementia with Lewy bodies.
  • the subject has frontal temporal dementia associated with a Tau mutation, Pick’s disease, progressive supranuclear palsy, corticobasal neurodegeneration, or chronic traumatic encephalopathy (CTE).
  • the oligomeric compound is an antisense agent.
  • a method of treating a neurodegenerative disease associated with PrP comprises administering to a subject an oligomeric compound, an oligomeric duplex, or an antisense agent, any of which having a nucleobase sequence complementary to PRNP.
  • the subject has or is at risk for developing a neurodegenerative disease.
  • the subject has or is at risk for developing a prion disease.
  • the subject has prion disease.
  • the subject has a synucleinopathy.
  • the subject has a tauopathy.
  • the subject has Creutzfeldt-Jakob disease (CJD) (e.g., variant Creutzfeldt-Jakob Disease (vCJD), classic Creutzfeldt-Jakob Disease (cCJD), familial Creutzfeldt-Jakob Disease (fCJD), or sporadic Creutzfeldt-Jakob Disease (sCJD)), Gerstmann-Straussler-Scheinker syndrome, fatal familial insomnia, kuru, Alzheimer’s disease, Parkinson’s disease, dementia with Lewy bodies, frontal temporal dementia associated with a Tau mutation, Pick’s disease, progressive supranuclear palsy, corticobasal neurodegeneration, or chronic traumatic encephalopathy (CTE).
  • CJD Creutzfeldt-Jakob disease
  • vCJD variant Creutzfeldt-Jakob Disease
  • cCJD classic Creutzfeldt-Jakob Disease
  • fCJD familial Creutzfeldt-Jak
  • the subject has Creutzfeldt- Jakob disease (CJD) (e.g., variant Creutzfeldt-Jakob Disease (vCJD), classic Creutzfeldt-Jakob Disease (cCJD), familial Creutzfeldt-Jakob Disease (fCJD), or sporadic Creutzfeldt-Jakob Disease (sCJD)).
  • CJD Creutzfeldt- Jakob disease
  • vCJD variant Creutzfeldt-Jakob Disease
  • cCJD classic Creutzfeldt-Jakob Disease
  • fCJD familial Creutzfeldt-Jakob Disease
  • sCJD sporadic Creutzfeldt-Jakob Disease
  • the subject has Gerstmann- Straussler-Scheinker syndrome, fatal familial insomnia, kuru, Alzheimer’s disease, Parkinson’s disease, or dementia with Lewy bodies.
  • the subject has frontal temporal dementia associated with a Tau mutation, Pick’s disease, progressive supranuclear palsy, corticobasal neurodegeneration, or chronic traumatic encephalopathy (CTE).
  • CTE chronic traumatic encephalopathy
  • at least one symptom or hallmark of the neurodegenerative disease associated with PrP is ameliorated.
  • the at least one symptom or hallmark is rapidly progressing dementia, personality changes, ataxia, hallucinations, myoclonus (muscle jerks), chorea, autonomic disturbances, impaired vision, insomnia, blindness, loss of speech, coma, death, spongiform changes in the brain, a development of abnormal protein aggregates, neuronal loss, gliosis, or the presence of markers of neuronal loss.
  • administration of the oligomeric compound, the oligomeric duplex, or the antisense agent to the subject reduces or delays the onset or progression of rapidly progressing dementia, personality changes, ataxia, hallucinations, myoclonus (muscle jerks), chorea, autonomic disturbances, impaired vision, insomnia, blindness, loss of speech, coma, spongiform changes in the brain, a development of abnormal protein aggregates, neuronal loss, or gliosis, or delays death, or reduces the presence of markers of neuronal loss.
  • a method of reducing expression of PRNP or reducing prion protein in a cell comprises contacting the cell with an oligomeric compound, an oligomeric duplex, or an antisense agent, any of which having a nucleobase sequence complementary to PRNP.
  • the cell is a neuron or a glial cell.
  • the glial cell is an astrocyte.
  • the cell is a human cell.
  • Certain embodiments are drawn to an oligomeric compound, an oligomeric duplex, or an antisense agent, any of which having a nucleobase sequence complementary to PRNP, for use in treating a neurodegenerative disease associated with PrP or for use in the manufacture of a medicament for treating a neurodegenerative disease associated with PrP.
  • the neurodegenerative disease associated with PrP is a prion disease.
  • the neurodegenerative disease associated with PrP is a synucleinopathy.
  • the neurodegenerative disease associated with PrP is a tauopathy.
  • the neurodegenerative disease associated with PrP is Creutzfeldt-Jakob disease (CJD) (e.g., variant Creutzfeldt-Jakob Disease (vCJD), classic Creutzfeldt-Jakob Disease (cCJD), familial Creutzfeldt- Jakob Disease (fCJD), or sporadic Creutzfeldt- Jakob Disease (sCJD)), Gerstmann-Straussler-Scheinker syndrome, fatal familial insomnia, kuru, Alzheimer’s disease, Parkinson’s disease, dementia with Lewy bodies, frontal temporal dementia associated with a Tau mutation, Pick’s disease, progressive supranuclear palsy, corticobasal neurodegeneration, or chronic traumatic encephalopathy (CTE).
  • CJD Creutzfeldt-Jakob disease
  • vCJD variant Creutzfeldt-Jakob Disease
  • cCJD classic Creutzfeldt-Jakob Disease
  • fCJD familial
  • the neurodegenerative disease associated with PrP is Creutzfeldt-Jakob disease (CJD) (e.g., variant Creutzfeldt-Jakob Disease (vCJD), classic Creutzfeldt-Jakob Disease (cCJD), familial Creutzfeldt-Jakob Disease (fCJD), or sporadic Creutzfeldt-Jakob Disease (sCJD)).
  • CJD Creutzfeldt-Jakob disease
  • vCJD variant Creutzfeldt-Jakob Disease
  • cCJD classic Creutzfeldt-Jakob Disease
  • fCJD familial Creutzfeldt-Jakob Disease
  • sCJD sporadic Creutzfeldt-Jakob Disease
  • the neurodegenerative disease associated with PrP is Gerstmann-Straussler-Scheinker syndrome, fatal familial insomnia, kum, Alzheimer’s disease, Parkinson’s disease, or dementia with Lewy bodies.
  • the oligomeric compound, the oligomeric duplex, or the antisense agent can be any described herein.
  • Oligomeric compounds, oligomeric duplexes, antisense agents, or RNAi agents described herein may be admixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations.
  • Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
  • the RNAi agent is an oligomeric duplex.
  • compositions comprising one or more oligomeric compounds, oligomeric duplexes, or antisense agents, or a salt thereof.
  • the pharmaceutical composition comprises a suitable pharmaceutically acceptable diluent or carrier.
  • a pharmaceutical composition comprises a sterile saline solution and one or more oligomeric compounds, oligomeric duplexes, or antisense agents.
  • such pharmaceutical composition consists of a sterile saline solution and one or more oligomeric compounds, oligomeric duplexes, or antisense agents.
  • the sterile saline is pharmaceutical grade saline.
  • a pharmaceutical composition comprises one or more oligomeric compounds, oligomeric duplexes, or antisense agents, and sterile water.
  • a pharmaceutical composition consists of one or more oligomeric compounds, oligomeric duplexes, or antisense agents, and sterile water.
  • the sterile water is pharmaceutical grade water.
  • a pharmaceutical composition comprises one or more oligomeric compounds, oligomeric duplexes, or antisense agents, and phosphate-buffered saline (PBS).
  • PBS phosphate-buffered saline
  • a pharmaceutical composition consists of one or more oligomeric compounds, oligomeric duplexes, or antisense agents, and sterile PBS.
  • the sterile PBS is pharmaceutical grade PBS.
  • a pharmaceutical composition consists of cerebrospinal fluid (CSF) and one or more oligomeric compounds, oligomeric duplexes, or antisense agents, .
  • the oligomeric compound, oligomeric duplexe, or antisense agent comprises a sense oligonucleotide and an antisense oligonucleotide.
  • the CSF is artificial CSF (aCSF).
  • Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
  • a pharmaceutical composition comprises one or more oligomeric compounds, oligomeric duplexes, or antisense agents and artificial cerebrospinal fluid (aCSF).
  • a pharmaceutical composition consists of one or more oligomeric compounds, oligomeric duplexes, or antisense agents and artificial cerebrospinal fluid.
  • a pharmaceutical composition consists essentially of one or more oligomeric compounds, oligomeric duplexes, or antisense agents and artificial cerebrospinal fluid.
  • the artificial cerebrospinal fluid is pharmaceutical grade.
  • aCSF comprises sodium chloride, potassium chloride, sodium dihydrogen phosphate dihydrate, sodium phosphate dibasic anhydrous, calcium chloride dihydrate, and magnesium chloride hexahydrate.
  • the pH of an aCSF solution is modulated with a suitable pH-adjusting agent, for example, with acids such as hydrochloric acid and alkalis such as sodium hydroxide, to a range of from about 7.1-7.3, or to about 7.2.
  • compositions comprise one or more oligomeric compounds, oligomeric duplexes, or antisense agents and one or more excipients.
  • excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone .
  • oligomeric compounds, oligomeric duplexes, or antisense agents may be admixed with pharmaceutically acceptable active and/or inert substances for the preparation of pharmaceutical compositions or formulations.
  • Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
  • compositions comprising oligomeric compounds, oligomeric duplexes, or antisense agents provided herein encompass any pharmaceutically acceptable salts, esters, or salts of such esters, which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof.
  • the disclosure is also drawn to pharmaceutically acceptable salts of compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.
  • pharmaceutically acceptable salts comprise inorganic salts, such as monovalent or divalent inorganic salts. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium, potassium, calcium, and magnesium salts.
  • a prodrug can include the incorporation of additional nucleosides at one or both ends of an oligomeric compound, oligomeric duplexe, or antisense agent, which are cleaved by endogenous nucleases within the body, to form the active compound.
  • compositions comprise a delivery system.
  • delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds.
  • certain organic solvents such as dimethylsulfoxide are used.
  • pharmaceutical compositions comprise one or more tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents comprising an oligomeric duplex provided herein to specific tissues or cell types.
  • pharmaceutical compositions include liposomes coated with a tissue-specific antibody.
  • compositions comprise a co-solvent system.
  • co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase.
  • co-solvent systems are used for hydrophobic compounds.
  • a non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant Polysorbate 80TM and 65% w/v polyethylene glycol 300.
  • the proportions of such cosolvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics.
  • co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80TM; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.
  • compositions are prepared for oral administration.
  • pharmaceutical compositions are prepared for buccal administration.
  • a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.).
  • a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer.
  • other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives).
  • injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like.
  • compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers.
  • Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.
  • oligomeric compounds, oligomeric duplexes, or antisense agents are in aqueous solution with sodium. In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents are in aqueous solution with potassium. In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents, are in PBS. In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents are in water. In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents are in aCSF. In certain such embodiments, the pH of the solution is adjusted with NaOH and/or HC1 to achieve a desired pH. VII. Certain Hotspot Regions
  • nucleobases 839-895 of SEQ ID NO: 1 comprise a hotspot region.
  • oligomeric compounds, oligomeric duplexes, or antisense agents comprise antisense oligonucleotides complementary to a portion of nucleobases 839-895 of SEQ ID NO: 1.
  • the antisense oligonucleotides are 15 to 30 nucleobases in length.
  • the antisense oligonucleotides are 17 to 30, 18 to 30, 18 to 25, or 20 to 23 nucleobases in length.
  • the antisense oligonucleotides are 23 nucleobases in length.
  • nucleobase sequences of SEQ ID NOs: 45, 46, and 50 are complementary to nucleobases 839-895 of SEQ ID NO: 1.
  • nucleobase sequences of the antisense oligonucleotides of compound NOs: 1547376, 1547377, and 1547393 are complementary to nucleobases 839-895 of SEQ ID NO: 1.
  • oligomeric compounds, oligomeric duplexes, or antisense agents comprising antisense oligonucleotides complementary to a portion of nucleobases 839-895 of SEQ ID NO: 1 achieve at least 69% reduction of PRNP RNA in a standard in vitro assay. In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents comprising antisense oligonucleotides complementary to a portion of nucleobases 839-895 of SEQ ID NO: 1 achieve an average of 84% reduction of PRNP RNA in a standard in vitro assay.
  • nucleobases 1179-1235 of SEQ ID NO: 1 comprise a hotspot region.
  • oligomeric compounds, oligomeric duplexes, or antisense agents comprise antisense oligonucleotides complementary to a portion of nucleobases 1179-1235 of SEQ ID NO: 1.
  • the antisense oligonucleotides are 15 to 30 nucleobases in length.
  • the antisense oligonucleotides are 17 to 30, 18 to 30, 18 to 25, or 20 to 23 nucleobases in length.
  • the antisense oligonucleotides are 23 nucleobases in length.
  • nucleobase sequences of SEQ ID NOs: 68, 70, and 72 are complementary to nucleobases 1179-1235 of SEQ ID NO: 1.
  • nucleobase sequences of the antisense oligonucleotides of compound NOs: 1547447, 1547449, and 1547451 are complementary to nucleobases 1179-1235 of SEQ ID NO: 1.
  • oligomeric compounds, oligomeric duplexes, or antisense agents comprising antisense oligonucleotides complementary to a portion of nucleobases 1179-1235 of SEQ ID NO: 1 achieve at least 81% reduction of PRNP RNA in a standard in vitro assay. In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents comprising antisense oligonucleotides complementary to a portion of nucleobases 1179-1235 of SEQ ID NO: 1 achieve an average of 86% reduction of PRNP RNA in a standard in vitro assay.
  • nucleobases 1332-1371 of SEQ ID NO: 1 comprise a hotspot region.
  • oligomeric compounds, oligomeric duplexes, or antisense agents comprise antisense oligonucleotides complementary to a portion of nucleobases 1332-1371 of SEQ ID NO: l.
  • the antisense oligonucleotides are 15 to 30 nucleobases in length.
  • the antisense oligonucleotides are 17 to 30, 18 to 30, 18 to 25, or 20 to 23 nucleobases in length.
  • the antisense oligonucleotides are 23 nucleobases in length.
  • nucleobase sequences of SEQ ID NOs: 75 and 76 are complementary to nucleobases 1332- 1371 of SEQ ID NO: 1.
  • nucleobase sequences of the antisense oligonucleotides of compound NOs: 1547466 and 1547467 are complementary to nucleobases 1332-1371 of SEQ ID NO: 1.
  • oligomeric compounds, oligomeric duplexes, or antisense agents comprising antisense oligonucleotides complementary to a portion of nucleobases 1332-1371 of SEQ ID NO: 1 achieve at least 81% reduction of PRNP RNA in a standard in vitro assay. In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents comprising antisense oligonucleotides complementary to a portion of nucleobases 1332-1371 of SEQ ID NO: 1 achieve an average of 85% reduction of PRNP RNA in a standard in vitro assay.
  • nucleobases 1383-1507 of SEQ ID NO: 1 comprise a hotspot region.
  • oligomeric compounds, oligomeric duplexes, or antisense agents comprise antisense oligonucleotides complementary to a portion of nucleobases 1383-1507 of SEQ ID NO: 1.
  • the antisense oligonucleotides are 15 to 30 nucleobases in length.
  • the antisense oligonucleotides are 17 to 30, 18 to 30, 18 to 25, or 20 to 23 nucleobases in length.
  • the antisense oligonucleotides are 23 nucleobases in length.
  • nucleobase sequences of SEQ ID NOs: 80, 81, 82, 83, 84, 85, and 86 are complementary to nucleobases 1383-1507 of SEQ ID NO: 1.
  • the nucleobase sequences of the antisense oligonucleotides of compound NOs: 1547483, 1547484, 1547485, 1547486, 1547487, 1547488, and 1547501 are complementary to nucleobases 1383-1507 of SEQ ID NO: 1.
  • oligomeric compounds, oligomeric duplexes, or antisense agents comprising antisense oligonucleotides complementary to a portion of nucleobases 1383-1507 of SEQ ID NO: 1 achieve at least 64% reduction of PRNP RNA in a standard in vitro assay. In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents comprising antisense oligonucleotides complementary to a portion of nucleobases 1383-1507 of SEQ ID NO: 1 achieve an average of 84% reduction of PRNP RNA in a standard in vitro assay.
  • nucleobases 1553-1660 of SEQ ID NO: 1 comprise a hotspot region.
  • oligomeric compounds, oligomeric duplexes, or antisense agents comprise antisense oligonucleotides complementary to a portion of nucleobases 1553-1660 of SEQ ID NO: 1.
  • the antisense oligonucleotides are 15 to 30 nucleobases in length.
  • the antisense oligonucleotides are 17 to 30, 18 to 30, 18 to 25, or 20 to 23 nucleobases in length.
  • the antisense oligonucleotides are 23 nucleobases in length.
  • nucleobase sequences of SEQ ID NOs: 89, 90, 91, 92, 96, and 97 are complementary to nucleobases 1553-1660 of SEQ ID NO: 1.
  • nucleobase sequences of the antisense oligonucleotides of compound NOs: 1547510, 1547511, 1547512, 1547519, 1547523, and 1547524 are complementary to nucleobases 1553-1660 of SEQ ID NO: 1.
  • oligomeric compounds, oligomeric duplexes, or antisense agents comprising antisense oligonucleotides complementary to a portion of nucleobases 1553-1660 of SEQ ID NO: 1 achieve at least 79% reduction of PRNP RNA in a standard in vitro assay. In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents comprising antisense oligonucleotides complementary to a portion of nucleobases 1553-1660 of SEQ ID NO: 1 achieve an average of 88% reduction of PRNP RNA in a standard in vitro assay.
  • nucleobases 1672-1711 of SEQ ID NO: 1 comprise a hotspot region.
  • oligomeric compounds, oligomeric duplexes, or antisense agents comprise antisense oligonucleotides complementary to a portion of nucleobases 1672-1711 of SEQ ID NO: I.
  • the antisense oligonucleotides are 15 to 30 nucleobases in length.
  • the antisense oligonucleotides are 17 to 30, 18 to 30, 18 to 25, or 20 to 23 nucleobases in length.
  • the antisense oligonucleotides are 23 nucleobases in length.
  • nucleobase sequences of SEQ ID NOs: 93 and 98 are complementary to nucleobases 1672- 1711 of SEQ ID NO: 1.
  • nucleobase sequences of the antisense oligonucleotides of compound NOs: 1547520 and 1547537 are complementary to nucleobases 1672-1711 of SEQ ID NO: 1.
  • oligomeric compounds, oligomeric duplexes, or antisense agents comprising antisense oligonucleotides complementary to a portion of nucleobases 1672-1711 of SEQ ID NO: 1 achieve at least 85% reduction of PRNP RNA in a standard in vitro assay. In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents comprising antisense oligonucleotides complementary to a portion of nucleobases 1672-1711 of SEQ ID NO: 1 achieve an average of 90% reduction of PRNP RNA in a standard in vitro assay.
  • nucleobases 1808-1915 of SEQ ID NO: 1 comprise a hotspot region.
  • oligomeric compounds, oligomeric duplexes, or antisense agents comprise antisense oligonucleotides complementary to a portion of nucleobases 1808-1915 of SEQ ID NO: 1.
  • the antisense oligonucleotides are 15 to 30 nucleobases in length.
  • the antisense oligonucleotides are 17 to 30, 18 to 30, 18 to 25, or 20 to 23 nucleobases in length.
  • the antisense oligonucleotides are 23 nucleobases in length.
  • nucleobase sequences of SEQ ID NOs: 105, 106, 107, 108, 109, and 110 are complementary to nucleobases 1808-1915 of SEQ ID NO: 1.
  • the nucleobase sequences of the antisense oligonucleotides of compound NOs: 1547556, 1547557, 1547558, 1547559, 1547560, and 1547573 are complementary to nucleobases 1808-1915 of SEQ ID NO: 1.
  • oligomeric compounds, oligomeric duplexes, or antisense agents comprising antisense oligonucleotides complementary to a portion of nucleobases 1808-1915 of SEQ ID NO: 1 achieve at least 66% reduction of PRNP RNA in a standard in vitro assay. In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents comprising antisense oligonucleotides complementary to a portion of nucleobases 1808-1915 of SEQ ID NO: 1 achieve an average of 85% reduction of PRNP RNA in a standard in vitro assay.
  • nucleobases 1978-2034 of SEQ ID NO: 1 comprise a hotspot region.
  • oligomeric compounds, oligomeric duplexes, or antisense agents comprise antisense oligonucleotides complementary to a portion of nucleobases 1978-2034 of SEQ ID NO: 1.
  • the antisense oligonucleotides are 15 to 30 nucleobases in length.
  • the antisense oligonucleotides are 17 to 30, 18 to 30, 18 to 25, or 20 to 23 nucleobases in length.
  • the antisense oligonucleotides are 23 nucleobases in length.
  • nucleobase sequences of SEQ ID NOs: 111, 116, and 117 are complementary to nucleobases 1978-2034 of SEQ ID NO: 1.
  • nucleobase sequences of the antisense oligonucleotides of compound NOs: 1547574, 1547591, and 1547592 are complementary to nucleobases 1978-2034 of SEQ ID NO: 1.
  • oligomeric compounds, oligomeric duplexes, or antisense agents comprising antisense oligonucleotides complementary to a portion of nucleobases 1978-2034 of SEQ ID NO: 1 achieve at least 89% reduction of PRNP RNA in a standard in vitro assay. In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents comprising antisense oligonucleotides complementary to a portion of nucleobases 1978-2034 of SEQ ID NO: 1 achieve an average of 91% reduction of PRNP RNA in a standard in vitro assay.
  • nucleobases 2131-2238 of SEQ ID NO: 1 comprise a hotspot region.
  • oligomeric compounds, oligomeric duplexes, or antisense agents comprise antisense oligonucleotides complementary to a portion of nucleobases 2131-2238 of SEQ ID NO: 1.
  • the antisense oligonucleotides are 15 to 30 nucleobases in length.
  • the antisense oligonucleotides are 17 to 30, 18 to 30, 18 to 25, or 20 to 23 nucleobases in length.
  • the antisense oligonucleotides are 23 nucleobases in length.
  • nucleobase sequences of SEQ ID NOs: 123, 124, 125, 127, 128, and 133 are complementary to nucleobases 2131-2238 of SEQ ID NO: 1.
  • the nucleobase sequences of the antisense oligonucleotides of compound NOs: 1547610, 1547611, 1547612, 1547614, 1547627, and 1547632 are complementary to nucleobase s 2131-2238 of SEQ ID NO: 1.
  • oligomeric compounds, oligomeric duplexes, or antisense agents comprising antisense oligonucleotides complementary to a portion of nucleobases 2131-2238 of SEQ ID NO: 1 achieve at least 82% reduction of PRNP RNA in a standard in vitro assay. In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents comprising antisense oligonucleotides complementary to a portion of nucleobases 2131-2238 of SEQ ID NO: 1 achieve an average of 89% reduction of PRNP RNA in a standard in vitro assay.
  • nucleobases 2284-2476 of SEQ ID NO: 1 comprise a hotspot region.
  • oligomeric compounds, oligomeric duplexes, or antisense agents comprise antisense oligonucleotides complementary to a portion of nucleobases 2284-2476 of SEQ ID NO: 1.
  • the antisense oligonucleotides are 15 to 30 nucleobases in length.
  • the antisense oligonucleotides are 17 to 30, 18 to 30, 18 to 25, or 20 to 23 nucleobases in length.
  • the antisense oligonucleotides are 23 nucleobases in length.
  • nucleobase sequences of SEQ ID NOs: 129, 130, 134, 135, 136, 137, 139, 140, 143, 144, and 145 are complementary to nucleobases 2284-2476 of SEQ ID NO: 1.
  • the nucleobase sequences of the antisense oligonucleotides of compound NOs: 1547628, 1547629, 1547645, 1547646, 1547647, 1547648, 1547650, 1547663, 1547666, 1547667, and 1547668 are complementary to nucleobases 2284- 2476 of SEQ ID NO: 1.
  • oligomeric compounds, oligomeric duplexes, or antisense agents comprising antisense oligonucleotides complementary to a portion of nucleobases 2284-2476 of SEQ ID NO: 1 achieve at least 71% reduction of PRNP RNA in a standard in vitro assay. In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents comprising antisense oligonucleotides complementary to a portion of nucleobases 2284-2476 of SEQ ID NO: 1 achieve an average of 89% reduction of PRNP RNA in a standard in vitro assay.
  • nucleobases 2488-2586 of SEQ ID NO: 1 comprise a hotspot region.
  • oligomeric compounds, oligomeric duplexes, or antisense agents comprise antisense oligonucleotides complementary to a portion of nucleobases 2488-2586 of SEQ ID NO: 1.
  • the antisense oligonucleotides are 15 to 30 nucleobases in length.
  • the antisense oligonucleotides are 17 to 30, 18 to 30, 18 to 25, or 20 to 23 nucleobases in length.
  • the antisense oligonucleotides are 23 nucleobases in length.
  • nucleobase sequences of SEQ ID NOs: 141, 146, 149, 150, 151, 162, and 164 are complementary to nucleobases 2488-2586 of SEQ ID NO: 1.
  • the nucleobase sequences of the antisense oligonucleotides of compound NOs: 1547664, 1547681, 1547684, 1547685, 1547686, 1547721, and 1547735 are complementary to nucleobases 2488-2586 of SEQ ID NO: 1.
  • oligomeric compounds, oligomeric duplexes, or antisense agents comprising antisense oligonucleotides complementary to a portion of nucleobases 2488-2586 of SEQ ID NO: 1 achieve at least 81% reduction of PRNP RNA in a standard in vitro assay. In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents comprising antisense oligonucleotides complementary to a portion of nucleobases 2488-2586 of SEQ ID NO: 1 achieve an average of 92% reduction of PRNP RNA in a standard in vitro assay.
  • nucleobases 2505-2586 of SEQ ID NO: 1 comprise a hotspot region.
  • oligomeric compounds, oligomeric duplexes, or antisense agents comprise antisense oligonucleotides complementary to a portion of nucleobases 2505-2586 of SEQ ID NO: 1.
  • the antisense oligonucleotides are 15 to 30 nucleobases in length.
  • the antisense oligonucleotides are 17 to 30, 18 to 30, 18 to 25, or 20 to 23 nucleobases in length.
  • the antisense oligonucleotides are 23 nucleobases in length.
  • nucleobase sequences of SEQ ID NOs: 146, 149, 150, 151, 162, and 164 are complementary to nucleobases 2505-2586 of SEQ ID NO: 1.
  • the nucleobase sequences of the antisense oligonucleotides of compound NOs: 1547681, 1547684, 1547685, 1547686, 1547721, and 1547735 are complementary to nucleobases 2505-2586 of SEQ ID NO: 1.
  • oligomeric compounds, oligomeric duplexes, or antisense agents comprising antisense oligonucleotides complementary to a portion of nucleobases 2505-2586 of SEQ ID NO: 1 achieve at least 92% reduction of PRNP RNA in a standard in vitro assay. In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents comprising antisense oligonucleotides complementary to a portion of nucleobases 2505-2586 of SEQ ID NO: 1 achieve an average of 93% reduction of PRNP RNA in a standard in vitro assay.
  • nucleobases 2590-2790 of SEQ ID NO: 1 comprise a hotspot region.
  • oligomeric compounds, oligomeric duplexes, or antisense agents comprise antisense oligonucleotides complementary to a portion of nucleobases 2590-2790 of SEQ ID NO: 1.
  • the antisense oligonucleotides are 15 to 30 nucleobases in length.
  • the antisense oligonucleotides are 17 to 30, 18 to 30, 18 to 25, or 20 to 23 nucleobases in length.
  • the antisense oligonucleotides are 23 nucleobases in length.
  • nucleobase sequences of SEQ ID NOs: 147, 169, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 166, 167, 168, and 175 are complementary to nucleobases 2590-2790 of SEQ ID NO: l.
  • nucleobase sequences of the antisense oligonucleotides of compound NOs: 1547682, 1547740, 1547699, 1547700, 1547701, 1547702, 1547703, 1547704, 1547717, 1547718, 1547719, 1547720, 1547737, 1547738, 1547739, and 1547759 are complementary to nucleobases 2590-2790 of SEQ ID NO: 1.
  • oligomeric compounds, oligomeric duplexes, or antisense agents comprising antisense oligonucleotides complementary to a portion of nucleobases 2590-2790 of SEQ ID NO: 1 achieve at least 60% reduction of PRNP RNA in a standard in vitro assay. In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents comprising antisense oligonucleotides complementary to a portion of nucleobases 2590-2790 of SEQ ID NO: 1 achieve an average of 85% reduction of PRNP RNA in a standard in vitro assay.
  • nucleobases 2624-2790 of SEQ ID NO: 1 comprise a hotspot region.
  • oligomeric compounds, oligomeric duplexes, or antisense agents comprise antisense oligonucleotides complementary to a portion of nucleobases 2624-2790 of SEQ ID NO: 1.
  • the antisense oligonucleotides are 15 to 30 nucleobases in length.
  • the antisense oligonucleotides are 17 to 30, 18 to 30, 18 to 25, or 20 to 23 nucleobases in length.
  • the antisense oligonucleotides are 23 nucleobases in length.
  • nucleobase sequences of SEQ ID NOs: 153, 154, 155, 156, 157, 158, 159, 160, 161, 166, 167, 168, and 175 are complementary to nucleobases 2624-2790 of SEQ ID NO: 1.
  • the nucleobase sequences of the antisense oligonucleotides of compound NOs: 1547700, 1547701, 1547702, 1547703, 1547704, 1547717, 1547718, 1547719, 1547720, 1547737, 1547738, 1547739, and 1547759 are complementary to nucleobases 2624-2790 of SEQ ID NO: 1.
  • oligomeric compounds, oligomeric duplexes, or antisense agents comprising antisense oligonucleotides complementary to a portion of nucleobases 2624-2790 of SEQ ID NO: 1 achieve at least 60% reduction of PRNP RNA in a standard in vitro assay. In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents comprising antisense oligonucleotides complementary to a portion of nucleobases 2624-2790 of SEQ ID NO: 1 achieve an average of 86% reduction of PRNP RNA in a standard in vitro assay
  • RNA nucleoside comprising a 2 ’-OH sugar moiety and a thymine base
  • nucleic acid sequences provided herein are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, unless otherwise stated, including, but not limited to such nucleic acids having modified nucleobases.
  • an oligomeric compound having the nucleobase sequence “ATCGATCG” encompasses any oligomeric compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence “AUCGAUCG” and those having some DNA bases and some RNA bases such as “AUCGATCG” and oligomeric compounds having other modified nucleobases, such as “AT m CGAUCG,” wherein m C indicates a cytosine base comprising a methyl group at the 5-position.
  • nucleobase sequence of SEQ ID NO: X refers only to the sequence of nucleobases in that SEQ ID NO: X, independent of any sugar or intemucleoside linkage modifications also described in such SEQ ID. While effort has been made to accurately describe compounds in the accompanying sequence listing, should there be any discrepancies between a description in this specification and in the accompanying sequence listing, the description in the specification and not in the sequence listing is the accurate description.
  • Certain compounds described herein e.g., modified oligonucleotides have one or more asymmetric center and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (.S'), as a or p such as for sugar anomers, or as (D) or (L), such as for amino acids, etc.
  • Compounds provided herein that are drawn or described as having certain stereoisomeric configurations include only the indicated compounds.
  • Compounds provided herein that are drawn or described with undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms, unless specified otherwise.
  • tautomeric forms of the compounds herein are also included unless otherwise indicated. Unless otherwise indicated, compounds described herein are intended to include corresponding salt forms.
  • the compounds described herein include variations in which one or more atoms are replaced with a non-radioactive isotope or radioactive isotope of the indicated element.
  • compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the 4 H hydrogen atoms.
  • Isotopic substitutions encompassed by the compounds herein include but are not limited to: 2 H or 3 H in place of 1 H, 13 C or 14 C in place of 12 C, 15 N in place of 14 N, 17 O or 18 O in place of 16 O, and 33 S, 34 S, 35 S, or 36 S in place of 32 S.
  • non-radioactive isotopic substitutions may impart new properties on the oligomeric compound that are beneficial for use as a therapeutic or research tool.
  • radioactive isotopic substitutions may make the compound suitable for research or diagnostic purposes such as imaging.
  • Example 1 Design of oligomeric duplexes with oligomeric compounds complementary to a human PRNP nucleic acid
  • Oligomeric duplexes comprising antisense oligonucleotides complementary to a human PRNP nucleic acid and sense oligonucleotides complementary to the antisense oligonucleotides were designed as follows.
  • the oligomeric duplexes in the table below comprise an antisense oligonucleotide and a sense oligonucleotide.
  • the antisense oligonucleotide consists of 23 nucleosides; has a sugar motif (from 5' to 3') of: yfyfyfyfyfyfyfyfyfyfyyyy, wherein each “y” represents a 2'-0Me sugar moiety, and each “f” represents a 2'-F sugar moiety; and has an intemucleoside linkage motif (from 5' to 3') of: ssooooooooooooooooooss, wherein each “o” represents a phosphodiester intemucleoside linkage, and each “s” represents a phosphorothioate intemucleoside linkage.
  • the sense oligonucleotide in each case consists of 21 nucleosides; has a sugar motif (from 5' to 3') of: fyfyfyfyfyfyfyfyfyfyfyf, wherein each “y” represents a 2'-0Me sugar moiety, and each “f ’ represents a 2'-F sugar moiety; and has an intemucleoside linkage motif (from 5' to 3') of: ssooooooooooooooooss, wherein each “o” represents a phosphodiester intemucleoside linkage, and each “s” represents a phosphorothioate intemucleoside linkage.
  • Each antisense oligonucleotide is complementary to the target nucleic acid (PRNP, encoding prion protein), and each sense oligonucleotide is complementary to the first of the 21 nucleosides of the antisense oligonucleotide (from 5' to 3') wherein the last two 3 '-nucleosides of the antisense oligonucleotides are not paired with the sense oligonucleotide (are overhanging nucleosides). “Start site” indicates the 5 '-most nucleoside to which the antisense oligonucleotide is complementary in the human gene sequence.
  • “Stop site” indicates the 3 '-most nucleoside to which the antisense oligonucleotide is complementary in the human gene sequence.
  • Each antisense oligonucleoside listed in the tables below is 100% complementary to SEQ ID NO: 1 (GENBANK Accession No. NM_000311.4).
  • Example 2 Effect of oligomeric duplexes on human PRNP RNA in vitro, single dose
  • Oligomeric duplexes described above were tested in a series of experiments under the same culture conditions. The results for each experiment are presented in separate tables below. Cultured A431 cells at a density of 20,000 cells per well were transfected using Lipofectamine
  • Human primer probe set RTS42354 forward sequence CCTCTCCTCACGACCGA, designated herein as SEQ ID NO: 10; reverse sequence CCCAGTGTTCCATCCTCCA, designated herein as SEQ ID NO: 11; probe sequence CCACAAAGAGAACCAGCATCCAGCA, designated herein as SEQ ID NO: 12
  • RTS42354 forward sequence CCTCTCCTCACGACCGA, designated herein as SEQ ID NO: 10
  • reverse sequence CCCAGTGTTCCATCCTCCA designated herein as SEQ ID NO: 11
  • probe sequence CCACAAAGAGAACCAGCATCCAGCA designated herein as SEQ ID NO: 12
  • PRNP RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented as percent PRNP RNA relative to the amount in untreated control cells (% UTC).
  • human primer probe set RTS42359 forward sequence AGTGGAACAAGCCGAGTAAG, designated herein as SEQ ID NO: 13; reverse sequence CCTCATAGTCACTGCCGAAAT, designated herein as SEQ ID NO: 14; probe sequence AACCAACATGAAGCACATGGCTGG, designated herein as SEQ ID NO: 15 was used to further assess the activity of the oligomeric duplexes.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Epidemiology (AREA)
  • Biochemistry (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Inorganic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Hospice & Palliative Care (AREA)
  • Psychiatry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Botany (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Saccharide Compounds (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicinal Preparation (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/US2023/063353 2022-02-28 2023-02-27 Rnai agents of prion expression Ceased WO2023164696A2 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
JP2024550753A JP2025507749A (ja) 2022-02-28 2023-02-27 プリオン発現のRNAi剤
US18/841,971 US20260028623A1 (en) 2022-02-28 2023-02-27 RNAi AGENTS OF PRION EXPRESSION
EP23761016.7A EP4486892A2 (en) 2022-02-28 2023-02-27 Rnai agents of prion expression

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202263314800P 2022-02-28 2022-02-28
US63/314,800 2022-02-28

Publications (2)

Publication Number Publication Date
WO2023164696A2 true WO2023164696A2 (en) 2023-08-31
WO2023164696A3 WO2023164696A3 (en) 2023-10-05

Family

ID=87766801

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2023/063353 Ceased WO2023164696A2 (en) 2022-02-28 2023-02-27 Rnai agents of prion expression

Country Status (4)

Country Link
US (1) US20260028623A1 (https=)
EP (1) EP4486892A2 (https=)
JP (1) JP2025507749A (https=)
WO (1) WO2023164696A2 (https=)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12281305B2 (en) 2018-11-21 2025-04-22 Ionis Pharmaceuticals, Inc. Compounds and methods for reducing prion expression

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120225922A1 (en) * 2011-03-04 2012-09-06 Qr Pharma Effective Amounts of (3aR)-1,3a,8-Trimethyl-1,2,3,3a,8,8a-hexahydropyrrolo [2,3-b]indol-5-yl Phenylcarbamate and Methods of Treating or Preventing Neurodegeneration
SG11202103794QA (en) * 2018-11-21 2021-05-28 Ionis Pharmaceuticals Inc Compounds and methods for reducing prion expression

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12281305B2 (en) 2018-11-21 2025-04-22 Ionis Pharmaceuticals, Inc. Compounds and methods for reducing prion expression

Also Published As

Publication number Publication date
JP2025507749A (ja) 2025-03-21
EP4486892A2 (en) 2025-01-08
WO2023164696A3 (en) 2023-10-05
US20260028623A1 (en) 2026-01-29

Similar Documents

Publication Publication Date Title
WO2023064707A1 (en) Compounds and methods for reducing tau expression
US20240301415A1 (en) Compounds for modulating unc13a expression
US20220380773A1 (en) Compounds and methods for reducing app expression
EP4281084A1 (en) Compounds and methods for reducing dux4 expression
US20230055405A1 (en) Compounds and methods for reducing app expression
WO2022032060A2 (en) Compounds and methods for modulating scn2a
US20250109396A1 (en) Compounds and methods for modulating progranulin expression
CN117106778A (zh) 用于降低kcnt1表达的化合物和方法
EP4284504A1 (en) Compounds and methods for modulating huntingtin
US20220243203A1 (en) Compounds and methods for reducing fus expression
US20240279654A1 (en) Compounds for reducing ptbp1 expression
WO2023164696A2 (en) Rnai agents of prion expression
EP4216964A1 (en) Compounds and methods for reducing apoe expression
WO2023215863A2 (en) Rnai agents for modulating snca
EP4110919A1 (en) Compounds and methods for modulating scn1a expression
WO2024064854A2 (en) Compounds and methods for reducing mecp2 expression
WO2022072787A1 (en) Compounds for modulating chmp7
EP4499831A2 (en) Rnai agents of modulating plp1
US20250340874A1 (en) Compounds and methods for reducing pcdh19 expression

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 2024550753

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2023761016

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2023761016

Country of ref document: EP

Effective date: 20240930

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23761016

Country of ref document: EP

Kind code of ref document: A2