WO2023161633A1

WO2023161633A1 - Method and reagents for hla typing

Info

Publication number: WO2023161633A1
Application number: PCT/GB2023/050408
Authority: WO
Inventors: Colin Brown; Winnie CHONG
Original assignee: Nhs Blood And Transplant
Priority date: 2022-02-23
Filing date: 2023-02-22
Publication date: 2023-08-31

Abstract

A method for typing an HLA-DQB1 gene comprising (a) selectively amplifying a nucleic acid molecule from a sample obtained from a subject using a primer set which comprises a first primer which targets a sequence upstream of the 5' UTR of the HLA-DQB1 gene; (b) performing a sequencing read of at least part of an amplicon generated using the primer set; and (c) determining the HLA-DQB1 type of the subject based on the sequencing read.

Description

METHOD AND REAGENTS FOR HLA TYPING

FIELD OF THE INVENTION

The present invention relates to methods and reagents for HLA typing. In particular, the present invention provides oligonucleotides which are suitable for use as primers to selectively amplify an HLA gene, kits comprising said oligonucleotides and methods using the same. The oligonucleotides, kits and methods of the invention are particularly useful for HLA matching in transplantation, in particular haematopoietic stem cell transplantation.

BACKGROUND TO THE INVENTION

Human leukocyte antigen (HLA) typing is critical in the practice of transplanting various solid organs and stem cells, and there are various systems and methods known in the art to determine the HLA type of the patient and donor.

HLA typing may be performed using DNA-based methods using polymerase chain reaction (PCR), including PCR-SSP (PCR-sequence-specific primer), PCR-SSOP (PCR-sequence- specific oligonucleotide probes), and PCR-RFLP (PCR-restriction fragment length polymorphism) and sequence-based typing (SBT). SBT was considered the gold-standard method for high-resolution HLA genotyping, although this technique may produce uncertain results due to insufficient sequencing and ambiguous haplotype phasing. Recent advancements in next-generation sequencing (NGS) technologies have significantly impacted the HLA-typing process. Different NGS-based HLA-typing methods have been established, such as amplicon-based HLA sequencing, target enrichment of HLA genes, and whole exome or genome sequencing data-derived typing.

HLA genotyping is a complex procedure due to the high degree of polymorphism in the human major histocompatibility complex (MHC). The most polymorphic regions, known as the core exons, are exons 2 and 3 in HLA class I genes and exon 2 in HLA class II genes. The sequences of the core exons are the most popular targets for genotyping as they are believed to be essential determinants of antigen specificity, which is informative for transplantation. However, in population genetic and evolutionary studies, many polymorphisms in other exons, introns, and UTRs have been identified and contribute to creating HLA nomenclature.

HLA matching is associated with better survival and reduced post-transplant complications, including graft-versus-host disease (GVHD).

In this regard, comprehensive HLA typing is expected to be associated with improved transplant outcomes, particularly for haematopoietic stem cell transplantation. The outcome and success of a transplant could be affected by a single SNP between the recipient and the donor. It is therefore vital for any repository storing HLA sequences and donor panels to undertake HLA typing which is as comprehensive as possible. This is particularly important for populations and donor panels comprising a wide range of ethnicities, which may be associated with different HLA allele frequencies. For example, the HLA-A*02:01 allele is found in approximately 48% of Caucasoid individuals in the USA but only in 20% of Han Chinese. By contrast, the HLA-A*02:07 allele is more frequent in Han Chinese individuals (25%), but it is found in less than 1% of Caucasoids in the USA.

There is thus a need for reagents and methods which enable improved HLA typing.

SUMMARY OF THE INVENTION

The present invention relates to reagents and methods that enable the preparation of nucleic acid molecule templates for HLA typing. In particular, the invention provides oligonucleotides and combinations of oligonucleotides that are capable of acting as primers that enable the amplification of particular regions and/or particular alleles of HLA genes wherein the regions/alleles amplified provide relevant information to improve HLA typing. The oligonucleotides and combinations of oligonucleotides of the invention are particularly advantageous when used in combination with long-read sequencing approaches in order to provide sequence information regarding the particular regions and/or particular alleles of HLA genes which provide relevant information to improve HLA typing. For example, long-read sequencing allows sequencing of essentially entire, suitably entire, HLA genes with minimal or no phasing required.

The invention further provides combinations of oligonucleotides, and methods using said combinations of oligonucleotides, which enable amplifications of HLA genes to be performed in the same reaction (i.e. multiplex PCRs of the same sample). Such multiplexing is advantageous in reducing sample handling and process times.

Thus, in a first aspect the present invention provides a method for typing an HLA-DQB1 gene comprising

(a) selectively amplifying a nucleic acid molecule from a sample obtained from a subject using a primer set which comprises a first primer which targets a sequence upstream of the 5’ UTR of the HLA-DQB1 gene;

(b) performing a sequencing read of at least part of an amplicon generated using the primer set; and (c) determining the HLA-DQB1 type of the subject based on the sequencing read.

The use of a primer which targets a sequence upstream of the 5’ UTR of the HLA-DQB1 gene enables the identification of HLA-DQB1 null alleles which comprise a deletion comprising at least part of exon 1 of HLA-DQB1. In particular, the primer enables the identification of an HLA-DQB1 null allele which comprises a deletion between the following genomic co-ordinates: chromosome:GRCh38.p13:6:32665750-32669454 (DQB1*03:276N). As will be appreciated, the deletion may occur at slightly different end-points in different individuals, but will still be recognised as the same general deletion. Advantageously, the primer also enables the identification of the following further HLA-DQB1 null alleles: DQB1*02:163N and DQB1*06:422N.

In a further aspect, the method further comprises typing a HLA-DPB1 gene, the method comprising: (a’) selectively amplifying a second nucleic acid molecule in the same reaction as the HLA-DQB1 amplification using a second primer set comprising a third primer and a fourth primer, preferably wherein amplification between the third primer and the fourth primer generates a whole gene amplicon of a HLA-DPB1 gene; (b’) performing a sequencing read of at least part of an amplicon generated using the second primer set; (o’) determining the HLA- DPB1 type of the individual based on the sequencing read.

Accordingly, the invention provides a method wherein HLA-DQB1 and HLA-DPB1 amplifications are multiplexed in a single reaction. This is advantageous in terms of minimizing sample handling in preparation for typing of HLA class II genes, in particular HLA-DQB1 and HLA-DPB1.

In another aspect, the present invention provides a method for typing a HLA-DRB1 gene comprising: (A) selectively amplifying a nucleic acid molecule from a sample obtained from an individual using a primer set comprising at least one first primer which comprises or consists of SEQ ID NO: 5 or 6 or a variant which has at least 80% sequence identity to SEQ ID NO: 5 or 6; (B) performing a sequencing read of at least part of an amplicon generated using the primer set; and (C) determining the HLA-DRB1 type of the individual based on the sequencing read.

The primers which comprise or consist of SEQ ID NO: 5 or 6, or a variant which has at least 80% sequence identity to SEQ ID NO: 5 or 6, advantageously enable the detection of DRB1 alleles such as DRB1*13.03, *03:02 and *10.01.

In a further aspect, the invention provides a method for typing a HLA-DQB1 and a HLA-DRB1 gene comprising: (i) selectively amplifying a nucleic acid molecule from a sample obtained from an individual using a first primer set comprising a first primer which targets a sequence upstream of the 5’ UTR of HLA-DQB1 ; (ii) selectively amplifying a nucleic acid molecule from a sample obtained from the individual using a second primer set comprising at least one first primer which comprises or consists of SEQ ID NO: 5 or 6 or a variant which has at least 80% sequence identity to SEQ ID NO: 5 or 6; (iii) performing a sequencing read of at least part of an amplicon generated using the first primer set and the second primer set; and (iv) determining the HLA-DQB1 and HLA-DRB1 types of the individual based on the sequencing reads.

The method may further comprise selectively amplifying a further nucleic acid molecule in the same reaction as the HLA-DQB1 amplification using a further primer set, preferably wherein amplification between primers of the further primer set generates a whole gene amplicon of an HLA-DPB1 gene.

In further embodiments, the present invention provides further embodiments which comprise typing at least one additional HLA gene in the individual. The further HLA gene may be selected from one or more of HLA-A, HLA-B, HLA-C, HLA-DQA1 , HLA-DPA1.

In one embodiment, the invention provides a method in which an HLA-DQB1 , HLA-DRB1 , HLA-DPB1 , HLA-A, HLA-B, HLA-C, HLA-DQA1, and HLA-DPA1 gene are typed in an individual.

Advantageously, amplifications of two or more HLA genes may be multiplexed in the same reaction sample.

Suitably (i) HLA-DQB1 and HLA-DPB1 amplifications may be multiplexed in the same reaction sample; (ii) HLA-DQA1 and HLA-DPA1 amplifications may be multiplexed in the same reaction sample; and/or (iii) HLA-A, HLA-B and HLA-C amplifications may be multiplexed in the same reaction sample. Suitably, HLA-DQB1 , HLA-DPB1 , HLA-DQA1 and HLA-DPA-1 amplifications may be multiplexed in the same reaction sample. The multiplexed amplifications may be performed using primer sets for each respective HLA gene as provided herein.

The present invention further provides isolated oligonucleotides which are capable of functioning as primers for use in the methods of the invention.

The invention also provides kits comprising combinations or isolated oligonucleotides which are capable of functioning as primers for use in the methods of the invention. BRIEF DESCRIPTION OF THE FIGURES

Figure 1 : Singleplex PCR of HLA-C using HLA-C_sdF11 and HLA-C_sdR9 primers and analysed by 1 % agarose gel electrophoresis.

Figure 2: Multiplex HLA Class I Amp1 amplicons analysed by 1 % agarose gel electrophoresis.

Figure 3: Singleplex PCR of HLA-DQB1 using HLA-DQB1_1del1 F primer and HLA- DQB1_HosR and analysed by 1 % agarose gel electrophoresis.

Figure 4: Multiplex HLA-DQB1 , -DPB1 Amp2 amplicons analysed by 1 % agarose gel electrophoresis.

Figure 5: HLA-DQA1 singleplex PCR (using HLA-DQA1_F1.6 and HLA-DQA1_R1.3 primers) analysed by 1 % agarose gel electrophoresis. Amplicons produced by singleplex PCRs of H LA- DQB1 and HLA-DPB1 are also shown.

Figure 6: Multiplex HLA-DQA1 , -DPA1 Amp3 amplicons analysed by 1 % agarose gel electrophoresis.

Figure 7: PCR amplification of homozygous DRB1*03:02:01 and DRB1*13:03:01 samples (using DRB1_E2_3568-F and DRB1_E2_3568hR3 primer) and analysed by 1% agarose gel electrophoresis.

Figure 8: PCR amplification of homozygous DRB1*10:01 :01 samples (using DRB1-E2-10-F and DRB1_E2_10sR6 primer) and analysed by 1% agarose gel electrophoresis.

Figure 9: HLA-DRB1 Mix 1 and Mix 2 PCR amplifications of samples S1-S3. Amp4 and Amp5 amplicons were analysed by 1 % agarose gel electrophoresis.

Figure 10: Multiplex HLA-DRB1 PCR amplifications of samples S1-S3. Amp6 amplicons were analysed by 1 % agarose gel electrophoresis.

Figure 11 : Sequence reads captured and analysed by GenDx NGSengine for HLA-DQA1.

Figure 12: Sequencing of the same DNA sample sequenced by short-read sequencing on the MiSeq (A) and long-read sequencing on the MinlON (B).

Figure 13: Example of sequencing data from an individual with a DQB1*03:01 :01 allele whereby the DQB1_1delF1 primer captures the entire 5’UTR-lntron 1 region, which is a region absent in the DQB1*03:276N allele. Figure 14: A schematic of the long-range PCR amplification performed for HLA class I (multiplex HLA-A, -B, -C).

Figure 15: A schematic of the long-range PCR amplification performed for HLA-DQB1 , -DPB1 (multiplex HLA-DQB1 , -DPB1).

Figure 16: A schematic of the long-range PCR amplification performed for HLA-DQA1 , -DPA1 (multiplex HLA-DQA1 , -DPA1).

Figure 17: A schematic of the long-range PCR amplification performed for 5’ UTR to exon 2 of HLA-DRB1 (multiplex MIX 1).

Figure 18: A schematic of the long-range PCR amplification performed for exon 2 to 3’ UTR of HLA-DRB1 (multiplex MIX 2).

Figure 19: A schematic of the long-range PCR amplification performed for 5’ UTR to exon 2 of HLA-DRB1 and exon 2 to 3’ UTR of HLA-DRB1 (multiplex single MIX).

Figure 20: Multiplex HLA-DPB1 , -DPA1 , -DQB1 , -DQA1 amplicons were analysed by 1 % agarose gel electrophoresis.

Figure 21 : Singleplex PCR amplifications of HLA-DRB3, HLA-DRB4 and HLA-DRB5 in samples S1-S6 with analysis by 0.6% agarose gel electrophoresis.

Figure 22: Singleplex PCR of HLA-B using HLA-B_F1 and HLA-B_sdR5 primers and analysed by 1 % agarose gel electrophoresis.

Figure 23: PCR amplification of HLA-DRB3 using DRB3_sdF7 and DRB3_sdR8 primers and analysed by 1 % agarose gel electrophoresis.

Figure 24: A schematic of the long-range PCR amplification performed for 5’UTR to 3’UTR HLA-DRB1 (single amplicon Amp7).

Figure 25: (A) PCR amplification of DRB1*10:01 allele (using DRB1_E2-10sR6 primer in combination with either DRB1 _PE-F1 or DRB1 _PE-F2 or DRB1 _PE-F3) and analysed by 1% agarose gel electrophoresis (B) PCR amplification of DRB1*03:02 allele (using DRB1 _PE- F1 and DRB1_E2-3568hR3 primers) and analysed by 1 % agarose gel electrophoresis (C) PCR amplification of DRB1*13:03 allele (using DRB1_E2-3568hR3 primer in combination with either DRB1 _PE-F1 or DRB1 _PE-F2 or DRB1 _PE-F3) and analysed by 1 % agarose gel electrophoresis. Figure 26: Example of long read sequencing data from an individual homozygous for DRB1*10:01 captured by amplification of the DRB1 gene with DRB1 _PE-F1 and DRB1_E2- 10sR6 primers.

Figure 27: Example of long read sequencing data from an individual homozygous for DRB1*03:02 captured by amplification of the DRB1 gene with DRB1 _PE-F1 and DRB1_ E2- 3568hR3 primers.

Figure 28: Example of long read sequencing data from an individual homozygous for DRB1*13:03 captured by amplification of the DRB1 gene with DRB1 _PE-F1 and DRB1_ E2- 3568hR3 primers.

DETAILED DESCRIPTION OF THE INVENTION

HLA

The human leukocyte antigen (HLA) is a large genetic locus in the human genome - spanning approximately 3.6 mega bases on the short arm of chromosome 6 - containing a set of polymorphic genes that encode major histocompatibility complex (MHC) class I and MHC class II molecules - cell surface proteins essential for the adaptive immune system. The HLA region is the human equivalent of the MHC found in vertebrate genomes. The MHC class I and MHC class II molecules bind a peptide derived from self-proteins (i.e. self-antigens) or from pathogen (i.e. non-self proteins and antigens) and present the peptide on the cell surface for recognition by the appropriate T-cells.

As used herein, the terms “MHC class I molecule” and “MHC class I” are used interchangeably to refer to heterodimers of p2-microglubulin and a heavy chain which are encoded by the MHC locus.

As used herein, the terms “MHC class II molecule” and “MHC class II” are used interchangeably to refer to heterodimers of an α chain and a β chain which are encoded by the MHC locus.

The HLAs corresponding to MHC class I are HLA-A, HLA-B and HLA-C. HLA alleles A, B and C present peptides derived mainly from intracellular proteins, e.g. proteins expressed within the cell. The HLAs corresponding to MHC class II are HLA-DP, HLA-DM, HLA-DOA, HLA- DOB, HLA-DQ, and HLA-DR. The six main MHC class II genes in humans are HLA-DPA1 , HLA-DPB1 , HLA-DQA1, HLA-DQB1, HLA-DRA1 and HLA-DRB1.

MHC family is highly polymorphic, with several thousand alleles encoding for functional peptides and in excess of 220 genes in the genetic locus. More than 13000 HLA alleles have been deposited in the Immuno Polymorphism Database (IPD) and IMGT/HLA Database (https://www.ebi.ac.uk/ipd/imgt/hla/). The IPD provides a centralized system for the study of polymorphism in genes of the immune system and consists of 5 core databases, with the IMGT/HLA Database as the primary database. The IMGT/HLA Database provides a locus- specific database for the allelic sequences of the genes in the HLA system. Therefore, many HLA alleles are known and sequence information relating to the known alleles are available in the IMGT/HLA Database. Therefore, canonical genomic sequences for each of the known HLA alleles are available. Sequencing results generated by the present methods can be compared to such HLA databases in order to identify the HLA allele(s) present in the sample.

A single HLA allele typically contains multiple polymorphisms, such as Single Nucleotide Polymorphisms (SNPs), deletions and/or insertions, within a particular genomic region. Thus, each HLA allele is defined as a unique nucleotide sequence and may cover the full-length of the gene, from 5’ UTR to 3’ UTR, or particular exons of the gene.

HLA Typing

The success of solid organ and bone marrow transplantation correlates with the extent to which donors and recipient are HLA matched. Similarly, it has been shown that HLA matching is a critical determinant of outcome for patients receiving allogeneic donor haematopoietic stem cells for haematological disorders. In particular, HLA matching is associated with improved engraftment (in the context of haematopoietic stem cell transplantation), better survival and reduced post-transplant complications, including graft-versus-host disease (GVHD). During GVHD, the native T-cell receptor (TCR) of the allogeneic transplant product (e.g. engineered T-cells) recognises antigens in recipient tissues and starts attacking normal tissue. GVHD typically occurs in the setting of allogeneic haematopoietic stem cell transplantation (HSCT) where the donor and recipient are fully or partially matched.

Thus, comprehensive HLA typing is expected to be associated with improved transplant outcomes, particularly for haematopoietic stem cell transplantation. The outcome and success of a transplant could be affected by a single SNP between the recipient and the donor. It is therefore vital for any repository storing HLA sequences and donor panels to undertake HLA typing which is as comprehensive as possible. This is particularly important for populations and donor panels comprising a wide range of ethnicities, which may be associated with different HLA allele frequencies. For example, the HLA-A*02:01 allele is expressed in the vast majority (60%) of the Caucasian population. By contrast, approximately 60% of Japanese people carry the HLA-A*24:02 allele. The Allele Frequency Net Database (AFND) provides the frequencies of HLA alleles and haplotypes from diverse populations (http://www.allelefrequencies.net/).

Minimum HLA matching on the basis of an 8 out of 8 high-resolution HLA match (HLA-A, HLA- B, HLA-C and HLA-DRB1) at antigen recognition domain (ARD) level is widely accepted for transplant procedures. However, due to the benefits of comprehensive typing, a 10 out of 10 HLA match (HLA-A, HLA-B, HLA-C and HLA-DRB1 , plus HLA-DQB1) at high-resolution may be preferred. It is therefore advantageous to conduct HLA typing of HLA-A, HLA-B, HLA-C, HLA-DRB1 and HLA-DQB1 at the highest resolution possible.

HLA genotyping is a complex procedure due to the extreme degree of polymorphism in the MHC family. The most polymorphic regions, known as the core exons, are exons 2 and 3 in HLA class I genes and exon 2 in HLA class II genes. Exons 2 and 3 of HLA class I code for the α1 and α2 extracellular domains of the HLA molecule, which form a groove-like structure known as the peptide-binding region (PBR) which engages the peptides (Saper et al. (1991) J. Mol. Biol. 219: 277-319).

As a result of the degree of polymorphism in these regions and since they are believed to be essential determinants of antigen specificity, which is informative for transplantation, the sequences of the core exons are the most popular targets for genotyping. Hence, the IMGT/HLA Database has previously been populated with data focussing specifically on exons 2 and 3 of class I and exon 2 of class II. Therefore, whilst the database holds a large number of polymorphic sequences, these sequences can be limited to particular regions of the HLA genes.

Further improvements in the level of resolution achieved by HLA class I and II typing methods are urgently needed.

The present invention relates to oligonucleotides and combinations of oligonucleotides which are capable of acting as primers that enable the amplification of particular regions and/or particular alleles of HLA genes wherein the regions/alleles amplified provide relevant information to improve HLA typing. The present inventors designed oligonucleotide primers to enable the capture of essentially all known HLA alleles. In this regard, the oligonucleotides and combinations of oligonucleotides of the invention may enable the amplification of the full HLA genes. The sequencing of full HLA genes enables the identification of HLA alleles which cannot be identified by conventional approaches due to insufficient sequencing across the entire length of the gene and/or ambiguous haplotype phasing. The oligonucleotides and combinations of oligonucleotides of the invention find particular utility in combination with long read sequencing, which enables HLA typing using full HLA gene sequences. In particular, the oligonucleotides and combinations of oligonucleotides of the invention produce 5’ UTR-3’ UTR amplicons for HLA-A, -B, -C, -DQB1 , -DQA1 , -DPB1 , -DPA1 as well as 5’ UTR-Exon 2 and Exon 2-3’ UTR amplicons for HLA-DRB1 for long read sequencing by Oxford Nanopore technology. These present oligonucleotides may thus be used in combination with long-read sequencing (e.g. using Oxford Nanopore technology).

Thus, the oligonucleotides, combinations of oligonucleotides and methods of the invention enable the identification of essentially all known HLA-A, -B, -C, -DQB1 , -DQA1 , -DPB1 , -DPA1 and -DRB1 alleles.

HLA-DQB1

The present inventors have designed oligonucleotide primers which target a sequence upstream of the 5’ UTR of the HLA-DQB1 gene. This provides the advantage that HLA-DQB1 null alleles which comprise a deletion comprising at least part of exon 1 of HLA-DQB1 can be identified during HLA typing. In particular, the primers enable the identification of the HLA- DQB1 null allele DQB1*03:276N which comprises a deletion between the following genomic co-ordinates: chromosome:GRCh38.p13:6:32665750-32669454. As will be appreciated, the deletion may occur at slightly different end-points in different individuals, but will still be recognised as the same general deletion. By contrast, commercially available kits for typing of the HLA-DQB1 gene which are currently available do not permit detection of such null alleles of HLA-DQB1 since these kits do not capture the 5’ UTR-intron 1 region of the HLA- DQB1 gene.

Suitably, the 5’ UTR of the HLA-DQB1 gene is located at the following genomic coordinates: chromosome:GRCh38.p13:6:32666560-32667132. Suitably, the position of the 5’ UTR of the HLA-DQB1 gene may defined as the 5’ terminus of the 5’ UTR. Suitably, the 5’ terminus of the 5’ UTR may be positioned at about the following genomic coordinate: chromosome:GRCh38.p 13:6:32667132.

Suitably, the oligonucleotide primer which targets a sequence upstream of the 5’ UTR of the HLA-DQB1 gene targets a sequence within the following genomic coordinates: chromosome:GRCh38.p13:6:32669454-32670291. This region lies between two known deletions which overlap or are upstream of the 5’ UTR of the HLA-DQB1 gene. Suitably, the oligonucleotide primer which targets a sequence upstream of the 5’ UTR of the HLA-DQB1 gene targets the following genomic coordinates: chromosome:GRCh38.p13:6:32669764- 32669794. Thus, the primer may bind 309 bases upstream from the 3.7kb deleted region which encompasses 5’ UTR-exon 1-intron 1 of HLA-DQB1 as described herein. It will be understood that the present methods are applicable to e.g. long-read sequencing which enables large regions to be sequenced in a single read (e.g. up to at least about 100, 000 bases). Accordingly, the primer may be complementary to a sequence far upstream of the 5’ UTR of the HLA-DQB1 gene and still facilitate productive amplification and sequencing of the HLA-DQB1 gene, including identification of the HLA-DQB1 null allele DQB1*03:276N.

For example, in one aspect the invention provides an isolated polynucleotide which is complementary to a sequence from 2323 to 7000 base pairs upstream of the 5’ UTR of the HLA-DQB1 gene, for example 2330 to 7000 base pair upstream of the 5’ UTR of the HLA- DQB1 gene. As noted above, the is a known deletion which may occur upstream of the 5’ UTR of the HLA-DQB1 gene, between the following genomic coordinates: chromosome:GRCh38.p13:6:32670291 -32673351. Suitably, the oligonucleotide primer does not target a sequence within this potential deletion in order to avoid non-productive amplification in samples from individuals with this deletion.

In some embodiments, the isolated polynucleotide is complementary to a sequence from 2350 to 6000 base pairs upstream of the 5’ UTR of the HLA-DQB1 gene. Suitably, the isolated polynucleotide is complementary to a sequence from 2350 to 5000, 2350 to 4000, 2500 to 4000, 2500 to 3500 base pairs upstream of the 5’ UTR of the HLA-DQB1 gene.

Preferably, the isolated polynucleotide is complementary to a sequence from 2400 to 4000 or from 2500 to 3000 base pairs upstream of the 5’ UTR of the HLA-DQB1 gene.

In some embodiments, the primer may be targeted downstream or upstream of the deletion which occurs between the following genomic coordinates: chromosome:GRCh38.p13:6:32670291 -32673351. Accordingly, the isolated polynucleotide may be complementary to a sequence from 2350 to 3100 or 6200 to 8000 base pairs (suitably, from 2350 to 3100 or 6200 to 7000) base pairs upstream of the 5’ UTR of the HLA-DQB1 gene.

An illustrative sequence of an isolated polynucleotide which is complementary to a sequence from 2323 to 7000 base pairs upstream of the 5’ UTR of the HLA-DQB1 gene (“HLA- DQB1_1delF1 primer”) is provided below:

In some embodiments, the isolated polynucleotide comprises the sequence as set forth in SEQ ID NO: 1 or a variant thereof which has at least 80% identity to SEQ ID NO: 1. In some embodiments, the isolated polynucleotide consists of the sequence as set forth in SEQ ID NO: 1 or a variant thereof which has at least 80% identity to SEQ ID NO: 1.

In some embodiments, the isolated polynucleotide comprises the sequence as set forth in SEQ ID NO: 1.

In some embodiments, the isolated polynucleotide consists of the sequence as set forth in SEQ ID NO: 1.

It will be appreciated by one skilled in the art that a variant of a primer sequence (e.g. of SEQ ID NO: 1) can retain the ability to anneal to the complimentary sequence and thereby enable the PCR amplification of the desired region. Thus, the variant is a functional variant which retains the function of the parent polynucleotide sequence. It is known in the art that the terminal nucleotides (and in particular, up to three nucleotides) at the 3’ end of a primer sequence are important for the ability of the primer to anneal to the complimentary sequence and thereby enable extension of the primer, and facilitate the PCR amplification of the desired region. Suitably, the terminal nucleotide at the 3’ end of the variant is identical to the corresponding nucleotide at the same position within the parent sequence. Suitably, the two terminal nucleotides at the 3’ end of the variant are identical to the corresponding nucleotides at the same positions within the parent sequence. Preferably, the three terminal nucleotides at the 3’ end of the variant are identical to the corresponding nucleotides at the same positions within the parent sequence.

As used herein, a “variant thereof’ refers to a sequence having at least 80%, at least 85%, at least 80% (suitably, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%) sequence identity to the parent sequence or to a sequence having one, two or three nucleic acid substitutions, insertions and/or deletions compared to the reference sequence. Suitably, the variant has one, two or three nucleic acid substitutions. Preferably, the variant has a sequence having at least 90% (suitably, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%) sequence identity to the parent sequence. Suitably, the variant has a sequence having at least 80%, at least 85%, at least 90% (suitably, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%) sequence identity to the parent sequence, wherein one, two or three nucleotides at the 3’ end (i.e. the terminal nucleotide, two terminal nucleotides or three terminal nucleotides at the 3’ end) of the variant are identical to the corresponding nucleotide(s) at the same position(s) within the parent sequence. Preferably, the variant has a sequence having at least 80%, at least 85%, at least 90% (suitably, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%) sequence identity to the parent sequence, wherein the three terminal nucleotides at the 3’ end of the variant are identical to the corresponding nucleotides at the same positions within the parent sequence.

Preferably, the variant has a sequence having at least 90% (suitably, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%) sequence identity to the parent sequence, wherein one, two or three nucleotides at the 3’ end (i.e. the terminal nucleotide, two terminal nucleotides or three terminal nucleotides at the 3’ end) of the variant are identical to the corresponding nucleotide(s) at the same position(s) within the parent sequence. Preferably, the variant has a sequence having at least at least 90% (suitably, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%) sequence identity to the parent sequence, wherein the three terminal nucleotides at the 3’ end of the variant are identical to the corresponding nucleotides at the same positions within the parent sequence.

It is routine for one skilled in the art to determine whether a candidate variant sequence is suitable for use according to the present invention. For example, one skilled in the art may determine whether a candidate variant produces a PCR product of the expected size when used in combination with a suitable opposing primer as compared to a control product obtained using the control primer (e.g. the nucleotide sequence of SEQ ID NO: 1 for candidate variants of SEQ ID NO: 1 , etc.) in combination with the same suitable opposing primer. Suitable opposing primers for use as control primers are described herein (see the Examples).

In some embodiments, the isolated polynucleotide comprises 35 or fewer nucleotides. Suitably, the isolated polynucleotide comprises 34 (suitably, 33, 32, 31 , 30, 29, 28, 27, 26, 25, 24, 23, 22, 21 or 20) or fewer nucleotides. Suitably, the isolated polynucleotide comprises 31 nucleotides.

In a further aspect, the invention provides a method for typing an HLA-DQB1 gene comprising

(b) performing a sequencing read of at least part of an amplicon generated using the primer set; and

(c) determining the HLA-DQB1 type of the subject based on the sequencing read. In some embodiments, the first primer which targets a sequence upstream of the 5’ UTR of the HLA-DQB1 gene is an isolated polynucleotide which is complementary to a sequence from 2325 to 7000 base pairs upstream of the 5’ UTR of the HLA-DQB1 gene as described herein.

In some embodiments, the primer set further comprises a second primer which targets the 3’ UTR of the HLA-DQB1 gene, wherein amplification between the first primer and the second primer generates a whole gene amplicon of HLA-DQB1.

In the context of the present invention, the term “targets” refers to the ability of the polynucleotide sequence to complementary base pair with the indicated nucleic acid sequence.

As used herein, the term “whole gene amplicon” refers to an amplicon which comprises from the 5’ UTR to the 3’ UTR (inclusive) of the gene, i.e. the entire coding region flanked by at least a portion of the 5’ UTR and at least a portion of the 3’ UTR. Suitably, the whole gene amplicon comprises the full 5’ UTR and the full 3’ UTR of the gene.

An illustrative sequence of a second primer which targets the 3’ UTR of the HLA-DQB1 gene (“HLA-DQB1_HosR”) is provided below:

In one embodiment, the second primer comprises or consists of SEQ ID NO: 2 or a variant thereof.

In some embodiments, the second primer comprises or consists of the sequence as set forth in SEQ ID NO: 2.

In some embodiments, the second primer comprises 35 or fewer nucleotides. Suitably, the second primer comprises 34 (suitably, 33, 32, 31 , 30, 29, 28, 27, 26, 25, 24, 23, 22, 21 or 20) or fewer nucleotides. Suitably, the second primer comprises 26 nucleotides.

In some preferred embodiments, the method further of typing an HLA-DQB1 gene further comprises typing an HLA-DPB1 gene, the method comprising:

(a’) selectively amplifying a second nucleic acid molecule in the same reaction as amplifying the nucleic acid molecule in step (a), using a second primer set comprising a third primer and a fourth primer, preferably wherein amplification between the third primer and the fourth primer generates a whole gene amplicon of an HLA-DPB1 gene;

(b’) performing a sequencing read of at least part of an amplicon generated using the second primer set; and (c’) determining the HLA-DPB1 type of the subject based on the sequencing read.

Accordingly, in a further aspect the invention provides a method for typing an HLA-DQB1 gene and an HLA-DPB1 gene, the method comprising:

(a) selectively amplifying nucleic acid molecules from a sample obtained from a subject using a first primer set which comprises a first primer which targets a sequence upstream of the 5’ UTR of the HLA-DQB1 gene and a second primer set comprising a third primer and a fourth primer, preferably wherein amplification between the third primer and the fourth primer generates a whole gene amplicon of the HLA-DPB1 gene;

(b) performing a sequencing read of at least part of an amplicon generated using the first primer set and of at least part of an amplicon generated using the second primer set; and

(c) determining the HLA-DQB1 and HLA-DPB1 types of the subject based on the sequencing reads.

Suitably, step (c) comprises determining the HLA-DQB1 type of the subject based on the sequencing read of at least part of an amplicon generated using the first primer set and the HLA-DPB1 type of the subject based on the sequencing read of at least part of an amplicon generated using the second primer set.

Suitably, the amplifications of the HLA-DQB1 and HLA-DPB1 genes are multiplexed in the same reaction.

In some embodiments, the first primer set further comprises a second primer which targets the 3’ UTR of the HLA-DQB1 gene, wherein amplification between the first primer and the second primer generates a whole gene amplicon of HLA-DQB1.

In some embodiments, the first primer, second primer, third primer and fourth primer are as described herein.

In some embodiments, the third primer targets the 5’ UTR of the HLA-DPB1 gene.

In some embodiments, the fourth primer targets the 3’ UTR of the HLA-DPB1 gene.

In some embodiments, the third primer targets the 5’ UTR of the HLA-DPB1 gene and the fourth primer targets the 3’ UTR of the HLA-DPB1 gene.

An illustrative sequence of a third primer which targets the 5’ UTR of the HLA-DPB1 gene (“HLA-DPB1-F”) is provided below:

In one embodiment, the third primer comprises or consists of SEQ ID NO: 3 or a variant thereof. Suitably, the variant has at least 80% identity to SEQ ID NO: 3.

In some embodiments, the third primer comprises or consists of the sequence as set forth in SEQ ID NO: 3.

In some embodiments, the third primer comprises 35 or fewer nucleotides. Suitably, the third primer comprises 34 (suitably, 33, 32, 31 , 30, 29, 28, 27, 26, 25, 24, 23, 22, 21 or 20) or fewer nucleotides. Suitably, the second primer comprises 29 nucleotides.

An illustrative sequence of a fourth primer which targets the 3’ UTR of the HLA-DPB1 gene (“HLA-DPB1-R”) is provided below:

In one embodiment, the fourth primer comprises or consists of SEQ ID NO: 4 or a variant thereof. Suitably, the variant has at least 80% identity to SEQ ID NO: 4.

In some embodiments, the fourth primer comprises or consists of the sequence as set forth in SEQ ID NO: 4.

In some embodiments, the fourth primer comprises 35 or fewer nucleotides. Suitably, the fourth primer comprises 34 (suitably, 33, 32, 31 , 30, 29, 28, 27, 26, 25, 24, 23, 22, 21 or 20) or fewer nucleotides. Suitably, the fourth primer comprises 27 nucleotides.

As used herein, the term “HLA-XXX type” (e.g. “HLA-DQB1 type”) refers to the HLA type of the subject with respect to the specified gene, i.e. the HLA-XXX (e.g. HLA-DQB1) alleles present in the genome of the subject.

HLA-DRB1

The present inventors have designed oligonucleotide primers which target a sequence within or downstream of the 3’ UTR of the HLA-DRB1 gene. This provides the advantage that HLA- DRB1 alleles which comprise polymorphisms from exon 2 to the 3’ UTR of the HLA-DRB1 gene can be identified during HLA typing. In particular, the primers enable the identification of the HLA-DRB1 alleles HLA-DRB1*10:01 , *03:02 and *13:03. Furthermore, the primers can be used in methods that enable full-gene sequencing and the determination of unambiguous HLA-DRB1 types. Suitably, the 3’ UTR of the HLA-DRB1 gene is located at the following genomic coordinates: chromosome:GRCh38.p13:6:32578769-32579125.

Suitably, the oligonucleotide primer which targets a sequence within the 3’ UTR of the HLA- DRB1 gene (“DRB1_E2_10sR6”) targets the following genomic coordinates: chromosome:GRCh38:6.p 13: 32578828-32578852.

Suitably, the oligonucleotide primer which targets a sequence downstream of the 3’ UTR of the HLA-DRB1 gene targets the following genomic coordinates: chromosome:GRCh38.p13:6:32578441 -32578470.

An illustrative sequence of an isolated polynucleotide which is complementary to a sequence within the 3’ UTR of the HLA-DRB1 gene (“DRB1_E2_10sR6”) is provided below:

An illustrative sequence of an isolated polynucleotide which is complementary to a sequence downstream of the 3’ UTR of the HLA-DRB1 gene (“DRB1_E2_3568hR3”) is provided below:

Accordingly, in a further aspect the invention provides an isolated polynucleotide comprising the sequence as set forth in SEQ ID NO: 5 or 6 or a variant thereof. Suitably, the variant has at least 80% identity to SEQ ID NO: 5 or 6.

In some embodiments, the isolated polynucleotide comprises the sequence as set forth in SEQ ID NO: 5 or a variant thereof. Suitably, the variant has at least 80% identity to SEQ ID NO: 5.

In some embodiments, the isolated polynucleotide comprises the sequence as set forth in SEQ ID NO: 6 or a variant thereof. Suitably, the variant has at least 80% identity to SEQ ID NO: 6.

In some embodiments, the isolated polynucleotide comprises the sequence as set forth in SEQ ID NO: 5 or 6.

In some embodiments, the isolated polynucleotide consists of the sequence as set forth in SEQ ID NO: 5 or 6 or a variant thereof.

In some embodiments, the isolated polynucleotide consists of the sequence as set forth in SEQ ID NO: 5 or a variant thereof. In some embodiments, the isolated polynucleotide consists of the sequence as set forth in SEQ ID NO: 6 or a variant thereof.

In some embodiments, the isolated polynucleotide consists of the sequence as set forth in SEQ ID NO: 5.

In some embodiments, the isolated polynucleotide consists of the sequence as set forth in SEQ ID NO: 6.

In some embodiments, the isolated polynucleotide comprises 35 or fewer nucleotides. Suitably, the isolated polynucleotide comprises 34 (suitably, 33, 32, 31 , 30, 29, 28, 27, 26, 25, 24, 23, 22, 21 or 20) or fewer nucleotides. Suitably, the isolated polynucleotide comprises 25 or 30 nucleotides.

Accordingly, in another aspect, the present invention provides a method for typing an HLA- DRB1 gene comprising

(A) selectively amplifying a nucleic acid molecule from a sample obtained from an individual using a primer set comprising at least one first primer which comprises or consists of SEQ ID NO: 5 or 6 or a variant which has at least 80% sequence identity to SEQ ID NO: 5 or 6;

(C) determining the HLA-DRB1 type of the individual based on the sequencing read.

In some embodiments, the first primer is an isolated polynucleotide comprising or consisting of the sequence as set forth in SEQ ID NO: 5 or 6 or a variant thereof as described herein.

In some embodiments, the primer set further comprises a second primer which targets exon 2 of the HLA-DRB1 gene, preferably wherein amplification between the first primer and the second primer generates an amplicon from within exon 2 to within or downstream of the 3’ UTR of HLA-DRB1.

An illustrative sequence of a second primer which targets exon 2 of the HLA-DRB1 gene (“DRB1-E2-10-F”) is provided below:

A further illustrative sequence of a second primer which targets exon 2 of the HLA-DRB1 gene (“DRB1-E2-3568-F”) is provided below:

In one embodiment, the second primer comprises or consists of SEQ ID NO: 13 or 14 or a variant thereof as described herein. Suitably, the variant has at least 80% identity to SEQ ID NO: 13 or 14.

In some embodiments, the second primer comprises or consists of the sequence as set forth in SEQ ID NO: 13 or 14.

In some embodiments, the second primer comprises 35 or fewer nucleotides. Suitably, the second primer comprises 34 (suitably, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21 or 20) or fewer nucleotides. Suitably, the second primer comprises 23 or 24 nucleotides.

In some preferred embodiments, the first primer comprises or consists of a sequence as set forth in SEQ ID NO: 5 or a variant thereof as described herein and the second primer comprises or consists of a sequence as set forth in SEQ ID NO: 13 or a variant thereof as described herein.

In some preferred embodiments, the first primer comprises or consists of a sequence as set forth in SEQ ID NO: 6 or a variant thereof as described herein and the second primer comprises or consists of a sequence as set forth in SEQ ID NO: 14 or a variant thereof as described herein.

In some preferred embodiments, the first primer comprises or consists of a sequence as set forth in SEQ ID NO: 12 or a variant thereof as described herein and the second primer comprises or consists of a sequence as set forth in SEQ ID NO: 13 or a variant thereof as described herein.

In some preferred embodiments, the first primer comprises or consists of a sequence as set forth in SEQ ID NO: 8 or a variant thereof as described herein and the second primer comprises or consists of a sequence as set forth in SEQ ID NO: 14 or a variant thereof as described herein.

Illustrative sequences of primers which are complementary to a sequence within or downstream of the 3’ UTR of the HLA-DRB1 gene are provided in Table 1 below:

Table 1. Illustrative sequences of primers which are complementary to a sequence within or downstream of the 3’ UTR of the HLA-DRB1 gene.

Illustrative sequences of primers which are complementary to a sequence within exon 2 of the HLA-DRB1 gene are provided in Table 2 below:

Table 2. Illustrative sequences of forward primers which are complementary to a sequence within exon 2 of the HLA-DRB1 gene.

In some embodiments, the first primer set further comprises one or more primers which are complementary to a sequence within or downstream of the 3’ UTR of the HLA-DRB1 gene.

In some embodiments, the first primer set further comprises one or more further primers which are complementary to a sequence within exon 2 of the HLA-DRB1 gene.

In some embodiments, the first primer set further comprises one or more primers which are complementary to a sequence within or downstream of the 3’ UTR of the HLA-DRB1 gene and one or more further primers which are complementary to a sequence within exon 2 of the HLA-DRB1 gene. In some embodiments, the first primer set further comprises one or more primers which comprise or consist of a sequence as set forth in SEQ ID NO: 7 to 12 or a variant thereof as described herein.

In some embodiments, the first primer set further comprises one or more primers which comprise or consist of a sequence as set forth in SEQ ID NO: 15 to 20 or a variant thereof as described herein.

In some embodiments, the first primer set further comprises primers which comprise or consist of a sequence as set forth in SEQ I D NO: 7 to 12 and 15 to 20 or variants thereof as described herein.

In some embodiments, the one or more primers comprises or consists of the sequence as set forth in SEQ ID NO: 7 to 12.

In some embodiments, the one or more primers comprises or consists of the sequence as set forth in SEQ ID NO: 15 to 20.

In some embodiments, the first primer set further comprises primers which comprise or consist of a sequence as set forth in SEQ ID NO: 7 to 12 and 15 to 20.

In some preferred embodiments, the method further comprises performing HLA-DPB1 typing as described herein.

Thus, in some preferred embodiments, the method further comprises

(A’) selectively amplifying a nucleic acid molecule from a sample obtained from the subject using a second primer set comprising a third primer and a fourth primer, preferably wherein amplification between the third primer and the fourth primer generates an amplicon from the 5’ UTR to exon 2 of the HLA-DRB1 gene;

(B’) performing a sequencing read of at least part of an amplicon generated using the second primer set; and

(C’) determining the HLA-DRB1 type of the subject based on the sequencing read.

Accordingly, in a further aspect the invention provides a method fortyping an HLA-DRB1 gene, the method comprising:

(a) selectively amplifying nucleic acid molecules from a sample obtained from a subject using a first primer set which comprises at least one first primer which comprises or consists of SEQ ID NO: 5 or 6 or a variant thereof which has at least 80% sequence identity to SEQ ID NO: 5 or 6, and a second primer set comprising a third primer and a fourth primer;

(c) determining the HLA-DRB1 types of the subject based on the sequencing reads.

In some embodiments, the first primer set comprises a second primer which targets exon 2 of the HLA-DRB1 gene as described herein, wherein amplification between the first primer and the second primer generates an amplicon from exon 2 to the 3’ UTR of HLA-DRB1.

The first primer, second primer, third primer and fourth primer may be primers for amplifying HLA-DQB1 or HLA-DRB1 as described herein.

In some embodiments, the third primer targets the 5’ UTR of the HLA-DRB1 gene.

In some embodiments, the fourth primer targets exon 2 of the HLA-DRB1 gene.

In some embodiments, the third primer targets the 5’ UTR of the HLA-DRB1 gene and the fourth primer targets exon 2 of the HLA-DRB1 gene.

An illustrative sequence of a third primer which targets the 5’ UTR of the HLA-DRB1 gene (“DRB1-PE2-F1”) is provided below:

A further illustrative sequence of a third primer which targets the 5’ UTR of the HLA-DRB1 gene (“DRB1-PE2-F3”) is provided below:

In one embodiment, the third primer comprises or consists of SEQ ID NO: 21 or 22 or a variant thereof as described herein. Suitably, the variant has at least 80% identity to SEQ ID NO: 21 or 22.

In some embodiments, the third primer comprises or consists of the sequence as set forth in SEQ ID NO: 21 or 22.

In some embodiments, the third primer comprises 35 or fewer nucleotides. Suitably, the third primer comprises 34 (suitably, 33, 32, 31 , 30, 29, 28, 27, 26, 25, 24, 23, 22, 21 or 20) or fewer nucleotides. Suitably, the third primer comprises 26 nucleotides. An illustrative sequence of a fourth primer which targets exon 2 of the HLA-DRB1 gene (“DRB1-PE2-R1”) is provided below:

A further illustrative sequence of a fourth primer which targets exon 2 of the HLA-DRB1 gene (“DRB1-PE2-R6”) is provided below:

In one embodiment, the fourth primer comprises or consists of SEQ ID NO: 24 or 25 or a variant thereof as described herein. Suitably, the variant has at least 80% to SEQ ID NO: 24 or 25.

In some embodiments, the fourth primer comprises or consists of the sequence as set forth in SEQ ID NO: 24 or 25.

In some embodiments, the fourth primer comprises 35 or fewer nucleotides. Suitably, the fourth primer comprises 34 (suitably, 33, 32, 31 , 30, 29, 28, 27, 26, 25, 24, 23, 22, 21 or 20) or fewer nucleotides. Suitably, the fourth primer comprises 23 or 24 nucleotides.

In some preferred embodiments, the third primer comprises or consists of a sequence as set forth in SEQ ID NO: 21 or a variant thereof as described herein and the fourth primer comprises or consists of a sequence as set forth in SEQ ID NO: 24 or a variant thereof as described herein.

In some preferred embodiments, the third primer comprises or consists of a sequence as set forth in SEQ ID NO: 21 or a variant thereof as described herein and the fourth primer comprises or consists of a sequence as set forth in SEQ ID NO: 25 or a variant thereof as described herein.

In some preferred embodiments, the third primer comprises or consists of a sequence as set forth in SEQ ID NO: 22 or a variant thereof as described herein and the fourth primer comprises or consists of a sequence as set forth in SEQ ID NO: 24 or a variant thereof as described herein.

An illustrative sequence of a further primer which is complementary to a sequence within the 5’ UTR of the HLA-DRB1 gene (DRB1_PE2_F2) is provided below:

Illustrative sequences of primers which are complementary to a sequence within exon 2 of the

HLA-DRB1 gene are provided in Table 3 below:

Table 3. Illustrative sequences of reverse primers which are complementary to a sequence within exon 2 of the HLA-DRB1 gene.

In some embodiments, the second primer set further comprises one or more primers which are complementary to a sequence within the 5’ UTR of the HLA-DRB1 gene.

In some embodiments, the second primer set further comprises one or more further primers which are complementary to a sequence within exon 2 of the HLA-DRB1 gene.

In some embodiments, the second primer set further comprises one or more primers which are complementary to a sequence within the 5’ UTR of the HLA-DRB1 gene and one or more further primers which are complementary to a sequence within exon 2 of the HLA-DRB1 gene.

In some embodiments, the second primer set further comprises a primer which comprises or consists of a sequence as set forth in SEQ ID NO: 23 or a variant thereof as described herein. Suitably, the variant has at least 80% sequence identity to SEQ ID NO: 23.

In some embodiments, the second primer set further comprises one or more primers which comprise or consist of a sequence as set forth in SEQ ID NO: 26 to 29 or a variant thereof as described herein. Suitably, the variant has at least 80% sequence identity to one of SEQ ID NO: 26 to 29.

In some embodiments, the second primer set further comprises primers which comprise or consist of a sequence as set forth in SEQ ID NO: 23 and 26 to 29 or variants thereof as described herein.

In some embodiments, the one or more primers comprises or consists of the sequence as set forth in SEQ ID NO: 23. In some embodiments, the one or more primers comprises or consists of the sequence as set forth in SEQ ID NO: 26 to 29.

In some embodiments, the second primer set further comprises primers which comprise or consist of a sequence as set forth in SEQ ID NO: 23 and 26 to 29.

In some embodiments:

(i) the first primer set comprises primers which comprise or consist of sequences as set forth in SEQ ID NO: 5 and 13 or variants thereof as described herein and the second primer set comprises primers which comprise or consist of sequences as set forth in SEQ ID NO: 21 and 24 or variants thereof as described herein;

(ii) the first primer set comprises primers which comprise or consist of sequences as set forth in SEQ ID NO: 6 and 14 or variants thereof as described herein and the second primer set comprises primers which comprise or consist of sequences as set forth in SEQ ID NO: 21 and 25 or variants thereof as described herein; and/or

(iii) the first primer set comprises primers which comprise or consist of sequences as set forth in SEQ ID NO: 6 and 14 or variants thereof as described herein and the second primer set comprises primers which comprise or consist of sequences as set forth in SEQ ID NO: 22 and 24 or variants thereof which have at least 80% sequence identity to SEQ ID NO: 22 and 24.

In another aspect, the primer set further comprises a first primer comprising SEQ ID NO: 5 or 6, or a variant thereof as defined herein, and a second primer which targets a sequence within or upstream of the HLA-DRB1 gene, preferably wherein amplification between the first primer and the second primer generates a whole gene amplicon of the HLA-DRB1 gene.

Advantageously, such embodiments enable amplification of a single amplicon from 5’IITR to 3’IITR of the HLA-DRB1 gene in a single PCR reaction and allow for the detection of DRB*10:01, DRB1*03:02 and DRB1*13:03 alleles.

In some embodiments, the second primer comprises or consists of the sequence as set forth in one of SEQ ID NO: 21-23 or a variant thereof as described herein. Suitably, the variant has at least 80% identity to SEQ ID NO: 21-23.

In some preferred embodiments, the first primer comprises or consists of a sequence as set forth in SEQ ID NO: 5 or a variant thereof as described herein and the second primer comprises or consists of a sequence as set forth in SEQ ID NO: 21-23 or a variant thereof as described herein. In some preferred embodiments, the first primer comprises or consists of a sequence as set forth in SEQ ID NO: 6 or a variant thereof as described herein and the second primer comprises or consists of a sequence as set forth in SEQ ID NO: 21 or a variant thereof as described herein.

In some preferred embodiments, the first primer comprises or consists of a sequence as set forth in SEQ ID NO: 6 or a variant thereof as described herein and the second primer comprises or consists of a sequence as set forth in SEQ ID NO: 21-23 or a variant thereof as described herein.

Preferred primer pairs for use according to the invention are provided in Table 4.

Table 4 - Primer pairs for the identification of the HLA-DRB1 alleles HLA-DRB1*10:01, *03:02 and *13:03.

Suitably, the following primers may be used to identify the stated allele: DRB1*10 alleles - SEQ ID NO. 12 and 13 in combination with SEQ ID NO. 21+24 (or variants thereof as described herein); DRB1*10:01 - SEQ ID NO: 5 +13 in combination with SEQ ID NO: 21+24 (or variants thereof as described herein); DRB1*03 and *13 alleles - SEQ ID NO. 8+14 in combination with SEQ ID NO: 21+24 and SEQ ID NO: 22+24 (or variants thereof as described herein); DRB1*13:03- SEQ ID NO: 6+14 in combination with SEQ ID NO: 21+25 (or variants thereof as described herein); DRB1*03:02 - SEQ ID NO: 6+14 in combination with 22+24 (or variants thereof as described herein).

Suitably, the following primers may be used to identify the stated allele: DRB1*10:01 - SEQ ID NO. 5 in combination with SEQ ID NO. 21-23 (or variants thereof as described herein); DRB1*13:03 - SEQ ID NO: 6 in combination with SEQ ID NO: 21 (or variants thereof as described herein); DRB1*03:02 - SEQ ID NO: 6 in combination with 21 (or variants thereof as described herein).

Preferably, for full DRB1 gene sequencing capable of detecting all known DRB1 alleles, the entire set of DRB1 primers, or variants thereof, as described herein are required.

In some preferred embodiments, the method further comprises typing an HLA-DPB1 gene as described herein.

Accordingly, in a further aspect the invention provides a method for typing an HLA-DRB1 gene and an HLA-DPB1 gene, the method comprising:

(a) selectively amplifying nucleic acid molecules from a sample obtained from a subject using a first primer set as described herein, and optionally a second primer set as described herein, for the selective amplification of DRB1 and a third primer set comprising a fifth and a sixth primer, preferably wherein amplification between the fifth primer and the sixth primer generates a whole gene amplicon of an HLA-DPB1 gene;

(c) determining the HLA-DRB1 and HLA-DPB1 types of the subject based on the sequencing reads.

Suitably, step (c) comprises determining the HLA-DRB1 type of the subject based on the sequencing read of at least part of an amplicon generated using the first primer set, and optionally the second primer set, and the HLA-DPB1 type of the subject based on the sequencing read of at least part of an amplicon generated using the third primer set.

In some embodiments, the first primer set further comprises a second primer as described herein, wherein amplification between the first primer and the second primer generates an amplicon from exon 2 to the 5’ UTR of HLA-DRB1.

In some embodiments, the second primer set generates an amplicon from the 5’ UTR to exon 2 of DRB1 ,

In some embodiments, the first primer, second primer, third primer and fourth primer are as described herein for DRB1.

In some embodiments, the fifth primer targets the 5’ UTR of the HLA-DPB1 gene.

In some embodiments, the sixth primer targets the 3’ UTR of the HLA-DPB1 gene. In some embodiments, the fifth primer targets the 5’ UTR of the HLA-DPB1 gene and the sixth primer targets the 3’ UTR of the HLA-DPB1 gene.

In one embodiment, the fifth primer comprises or consists of SEQ ID NO: 3 or a variant thereof as described herein. Suitably, the variant has at least 80% identity to SEQ ID NO: 3.

In one embodiment, the sixth primer comprises or consists of SEQ ID NO: 4 or a variant thereof as described herein. Suitably, the variant has at least 80% identity to SEQ ID NO: 4.

HLA-C

The present inventors have developed primers for the amplification of the whole HLA-C gene, i.e. from the 5’ UTR to the 3’ UTR. Advantageously, these primers enable the typing of HLA- C in combination with HLA-A and HLA-B in a multiplex approach.

An illustrative sequence of a primer which targets the 5’ UTR of HLA-C (“HLA-C_sdF11”) is provided below:

An illustrative sequence of a primer which targets the 3’ UTR of HLA-C (“HLA-C_sdR9”) is provided below:

Accordingly, in a further aspect, the invention provides an isolated polynucleotide comprising or consisting of SEQ ID NO: 40 or 30 or a variant thereof as described herein. Suitably, the variant has at least 80% identity to SEQ ID NO: 40 or 30.

In some embodiments, the isolated polynucleotide comprises or consists of SEQ ID NO: 40 or 30.

In some embodiments, the isolated polynucleotide comprises or consists of SEQ ID NO: 40.

In some embodiments, the isolated polynucleotide comprises or consists of SEQ ID NO: 30. HLA-DBR3, HLA-DRB4 and HLA-DRB5

The present invention further provides methods and isolated polynucleotides for the amplification of the HLA-DRB3, HLA-DRB4 or HLA-DRB5 genes.

An illustrative sequence of a primer which targets the 5’ UTR of HLA-DRB3 (“HLA- DRB3_sdF2”) is provided below:

An illustrative sequence of a primer which targets the 3’ UTR of HLA- DRB3 (“HLA- DRB3_sdR1”) is provided below:

Accordingly, in a further aspect, the invention provides an isolated polynucleotide comprising or consisting of SEQ ID NO: 41 or 42 or a variant thereof as described herein. Suitably, the variant has at least 80% identity to SEQ ID NO: 41 or 42.

In some embodiments, the isolated polynucleotide comprises or consists of SEQ ID NO: 41 or 42.

An illustrative preferred sequence of a primer which targets upstream of the 5’ UTR of HLA- DRB3 (“HLA-DRB3_sdF8”) is provided below:

An illustrative sequence of a primer which targets downstream of the 3’ UTR of HLA- DRB3 (“HLA- DRB3_sdR7”) is provided below:

Accordingly, in a further aspect, the invention provides an isolated polynucleotide comprising or consisting of SEQ ID NO: 48 or 49 or a variant thereof as described herein. Suitably, the variant has at least 80% identity to SEQ ID NO: 48 or 49.

In some embodiments, the isolated polynucleotide comprises or consists of SEQ ID NO: 48 or 49.

An illustrative sequence of a primer which targets the 5’ UTR of HLA-DRB4 (“HLA- DRB4_sdF1”) is provided below:

An illustrative sequence of a primer which targets the 3’ UTR of HLA-DRB4 (“HLA- DRB4_sdR1”) is provided below:

Accordingly, in a further aspect, the invention provides an isolated polynucleotide comprising or consisting of SEQ ID NO: 43 or 44 or a variant thereof as described herein. Suitably, the variant has at least 80% identity to SEQ ID NO: 43 or 44.

In some embodiments, the isolated polynucleotide comprises or consists of SEQ ID NO: 43 or 44.

The present HLA-DRB4 primers advantageously enable the identification of DRB4*01 :03:01:02N, DRB4*01 :01 :01:13N, DRB4*01:14N, DRB4:01 :115N and

DRB4*01 :121N.

An illustrative sequence of a primer which targets the 5’ UTR of HLA-DRB5 (“HLA- DRB5_sdF1”) is provided below:

An illustrative sequence of a primer which targets the 3’ UTR of HLA-DRB5 (“HLA- DRB5_sdR3”) is provided below:

Accordingly, in a further aspect, the invention provides an isolated polynucleotide comprising or consisting of SEQ ID NO: 45 or 46 or a variant thereof as described herein. Suitably, the variant has at least 80% identity to SEQ ID NO: 45 or 46.

In some embodiments, the isolated polynucleotide comprises or consists of SEQ ID NO: 45 or 46.

Further HLA genes

Primers for the amplification of further HLA genes are known in the art. Illustrative primers for the amplification of HLA genes are provided in the table below.

Table 4. Primers for the amplification of HLA genes.

The present inventors have developed primers for the amplification of the whole HLA-DQA1 gene, i.e. from the 5’ UTR to the 3’ UTR. Advantageously, these primers enable the typing of HLA-DQA1 in combination with HLA-DPA1 in a multiplex approach. Furthermore, these primers enable the typing of HLA-DQA1 , HLA-DPA1 , HLA-DQB1 and HLA-DPB1 in a multiplex approach.

Accordingly, in a further aspect, the invention provides an isolated polynucleotide comprising or consisting of SEQ ID NO: 36 or 37 or a variant thereof as described herein. Suitably, the variant has at least 80% identity to SEQ ID NO: 36 or 37.

In some embodiments, the isolated polynucleotide comprises or consists of SEQ ID NO: 36 or 37.

In some embodiments, the isolated polynucleotide comprises or consists of SEQ ID NO: 36.

In some embodiments, the isolated polynucleotide comprises or consists of SEQ ID NO: 37.

In some embodiments, the methods of the invention further comprise typing at least one additional HLA gene in the subject.

In some embodiments, the at least one additional HLA gene is selected from one or more of HLA-A, HLA-B, HLA-C, HLA-DQA1 and HLA-DPA1.

In some embodiments, each of the HLA-A, HLA-B, HLA-C, HLA-DQA1 and HLA-DPA1 genes are typed.

Accordingly, in a further aspect the invention provides a method for typing HLA-DQB1 , HLA- DRB1 , HLA-DPB1 , HLA-A, HLA-B, HLA-C, HLA-DQA1 and HLA-DPA1 genes comprising:

(i) selectively amplifying nucleic acid molecules from a sample obtained from a subject using primer sets for each respective HLA gene as provided herein;

(ii) performing sequencing reads of at least part of an amplicon generated using the primer sets; and

(iii) determining the HLA-DQB1 , HLA-DRB1 , HLA-DPB1 , HLA-A, HLA-B, HLA-C, HLA-DQA1 and HLA-DPA1 types of the subject based on the sequencing reads.

Accordingly, in a further aspect the invention provides a method for typing HLA-A, HLA-B, HLA-C and HLA-DRB1 genes comprising: (i) selectively amplifying nucleic acid molecules from a sample obtained from a subject using primer sets for each respective HLA gene as provided herein;

(ii) performing a sequencing read of at least part of an amplicon generated using the primer sets; and

(iii) determining the HLA-A, HLA-B, HLA-C and HLA-DRB1 types of the subject based on the sequencing reads.

Accordingly, in a further aspect the invention provides a method for typing HLA-A, HLA-B, HLA-C, HLA-DRB1 and HLA-DQB1 genes comprising:

(iii) determining the HLA-A, HLA-B, HLA-C, HLA-DRB1 and HLA-DQB1 types of the subject based on the sequencing reads.

The HLA-DQB1 typing may be performed as described herein.

The HLA-DRB1 typing may be performed as described herein.

The HLA-DPB1 typing may be performed as described herein.

In some embodiments, a nucleic acid molecule comprising an HLA-C gene is selectively amplified in a sample from the subject using primers which comprise or consist of SEQ ID NO: 40 and 30 or a variant thereof as described herein.

In some embodiments, a nucleic acid molecule comprising an HLA-A gene is selectively amplified in a sample from the subject using primers which comprise or consist of SEQ ID NO: 31 or 32 and SEQ ID NO: 33 or a variant thereof as described herein.

In some embodiments, a nucleic acid molecule comprising an HLA-B gene is selectively amplified in a sample from the subject using primers which comprise or consist of SEQ ID NO: 34 and 35 or a variant thereof as described herein.

In some embodiments, a nucleic acid molecule comprising an HLA-B gene is selectively amplified in a sample from the subject using primers which comprise or consist of SEQ ID NO: 34 and 47 or a variant thereof as described herein. In some embodiments, the HLA-C and HLA-A and/or HLA-B amplifications are performed in the same reaction.

In some embodiments, the HLA-A, HLA-B and HLA-C amplification are performed in the same reaction.

In some embodiments, a nucleic acid molecule comprising an HLA-DQA1 gene is selectively amplified in a sample from the subject using primers which comprise or consist of SEQ ID NO: 36 and 37 or a variant thereof as described herein.

In some embodiments, a nucleic acid molecule comprising an HLA-DPA1 gene is selectively amplified in a sample from the subject using primers which comprise or consist of SEQ ID NO: 38 and 39 or a variant thereof as described herein.

Multiplex HLA typing

Multiplex PCR is the simultaneous amplification of multiple different DNA sequences simultaneously in a single reaction, with a different pair of primers for each target. The use of multiplex PCR is advantageous over standard PCR since it minimizes sample handling in preparation for typing of HLA class II genes, such as HLA-DQB1 and HLA-DPB1.

Advantageously, amplifications of two or more HLA genes may be multiplexed in the same reaction (i.e. reaction sample) in the methods of the invention. As used herein, “reaction” or “reaction sample” refers to a solution in which the amplifications are performed. In contrast, a “sample” refers to a sample that is obtained from a subject - as described herein.

Suitably (i) HLA-DQB1 and HLA-DPB1 amplifications may be multiplexed in the same reaction sample; (ii) HLA-DQA1 and HLA-DPA1 amplifications may be multiplexed in the same reaction sample; and/or (iii) HLA-A, HLA-B and HLA-C amplifications may be multiplexed in the same reaction sample. Suitably, HLA-DQB1 , HLA-DPB1 , HLA-DQA1 and HLA-DPA1 amplifications may be multiplexed in the same reaction sample. The multiplexed amplifications may be performed using primer sets for each respective HLA gene as provided herein.

Accordingly, in a further aspect the invention provides a method for typing an HLA-DQB1 and an HLA-DPB1 gene comprising: a’) selectively amplifying a second nucleic acid molecule in the same reaction as the HLA- DQB1 amplification using a second primer set comprising a third primer and a fourth primer, preferably wherein amplification between the third primer and the fourth primer generates a whole gene amplicon of the HLA-DPB1 gene; (b’) performing a sequencing read of at least part of an amplicon generated using the first and second primer set;

(o’) determining the HLA-DQB1 and HLA-DPB1 type of the subject based on the sequencing reads. In a further aspect the invention provides a method for typing an HLA-DQB1 , HLA- DPB1 and HLA-DQA1 and/or HLA-DPA1 gene comprising: a”) selectively amplifying nucleic acid molecules comprising (i) HLA-DQB1 , HLA-DPB1 and

(ii) HLA-DQA1 and/or HLA-DPA1 genes in the same reaction;

(b”) performing a sequencing read of at least part of an amplicon generated using the primer sets;

(c”) determining the (i) HLA-DQB1 , HLA-DPB1 and (ii) HLA-DQA1 and/or HLA-DPA1 type of the subject based on the sequencing reads.

In some embodiments, the HLA-C and HLA-A and/or HLA-B amplifications are performed in the same reaction.

Accordingly, in some embodiments, the HLA-DQA1 and HLA-DPA1 amplifications are performed in the same reaction.

In some embodiments, the HLA-DQA1 , HLA-DPA1 , HLA-DQB1 and HLA-DPB1 amplifications are performed in the same reaction.

Suitable primers for multiplexing HLA-DQA1 , HLA-DPA1 , HLA-DQB1 and/or HLA-DPB1 amplifications are as follows: (i) HLA-DQA1 - SEQ ID NO: 36 and 37 or variants thereof as defined herein; (ii) HLA-DPA1 - SEQ ID NO: 38 and 39 or variants thereof as defined herein;

(iii) HLA-DQB1 - SEQ ID NO: 1 and 2 or variants thereof as defined herein; (iv) HLA-DPB1 - SEQ ID NO: 3 and 4 or variants thereof as defined herein.

Amplifying

As described herein, the first step in the methods of the invention is the selective amplification of a nucleic acid molecule from a sample obtained from a subject.

As used herein, the term “amplifying” refers to a polynucleotide amplification reaction, namely, a population of polynucleotides that are replicated from one or more starting sequences. Amplifying may refer to a variety of amplification reactions, including but not limited to polymerase chain reaction (PCR), linear polymerase reactions, nucleic acid sequence- based amplification, rolling circle amplification and like reactions.

In the methods of the invention, the selective amplification step is preferably a PCR amplification. Linear PCR amplification may be employed. PCR amplification is well-known in the art. Any suitable PCR conditions and any suitable DNA polymerase may be used for the amplification step. It is well within the capabilities of a person skilled in the art to determine suitable annealing timings and temperatures, as well as a suitable DNA polymerase, for use in a PCR amplification step. For example, suitable conditions are described herein (see Examples).

Suitably, the PCR amplification step may be performed using Takara PrimeStar® GXL polymerase or Quantabio repliQa Hi Fi ToughMix®. Suitable cycling parameters for PCR using these polymerases are described herein (see Examples 1-4).

As used herein, the terms “oligonucleotide primers” or “primers” are used interchangeably, in general, to refer to strands of nucleotides which can prime the synthesis of DNA. DNA polymerase cannot synthesize DNA de novo without primers. A primer hybridises to the DNA, i.e. base pairs are formed. Nucleotides that can form base pairs, that are complementary to one another, are e.g. cytosine and guanine, thymine and adenine, adenine and uracil, guanine and uracil. The complementarity between the primer and the existing DNA strand does not have to be 100%, i.e. not all bases of a primer need to base pair with the existing DNA strand. From the 3’-end of a primer hybridised with the existing DNA strand, nucleotides are incorporated using the existing strand as a template (template directed DNA synthesis).

In some embodiments of the methods of the invention, an amplicon of essentially the entire HLA gene is generated by amplification of the nucleic acid molecule.

In some embodiments, the amplicon is generated using a primer set which comprises a primer which targets the 5’ UTR of the HLA gene and a primer which targets the 3’ UTR of the HLA gene.

Sequencing

Next, the sequencing read of at least part of an amplicon generated using the primer set is performed.

The amplicon DNA may be prepared as a DNA sequencing library and/or sequenced according to standard protocols. Conventional genome sequencing or next generation sequencing (NGS) approaches can be used. Determining the sequence is preferably performed using NGS, as this is more convenient and allows a high number of sequences to be determined. High throughput sequencing methods are well known in the art, and in principle any method may be contemplated to be used in the invention. High throughput sequencing technologies may be performed according to the manufacturer’s instructions (as e.g. provided by Illumina, Thermo Fisher, Pacific Biosciences or Oxford Nanopore Technologies).

DNA sequences may be compared to a reference sequence and/or compared with each other. The International Immunogenetics (IMGT) HLA database contains human MHC sequences that have been officially named by the World Health Organisation (WHO) Nomenclature Committee for factors of the HLA system since 1998. The nomenclature committee have assigned HLA allele names based on both partial and full gene sequences. Hence, it is not required to provide for a complete sequence of the HLA gene, although this is preferred.

As used herein, the term “sequencing” refers to determining the order of nucleotides (base sequences) in a nucleic acid sample, e.g. DNA or RNA. Many techniques are available such as Sanger sequencing and next generation sequencing technologies such as offered by Roche, Illumina and Thermo Fisher. Long read sequencing approaches are also available, such as single molecule real-time (SMRT) sequencing by Pacific Biosciences or nanopore sequencing by Oxford Nanopore Technologies.

As used herein, the term “sequencing read” means an inferred sequence of bases (or base probabilities) corresponding to all or part of a single DNA fragment or a single amplicon that is sequenced.

Preferably long sequence reads may be generated in the next generation sequencing method used. As the name suggests, long-read sequencing approaches enable the production of sequencing reads that are considerably longer than those resulting from short-read sequencing approaches. Typically, short-read sequencing approaches enable the sequencing of approximately 150-300 bp fragments of DNA which are then assembled together using bioinformatics approaches. By contrast, long-read sequencing allows for the generation of much longer sequence reads of over 10, 000 bp in length. Read lengths of 10, 000 - 100, 000 bp are common in long-read sequencing approaches, although read lengths of over 2, 000, 000 bases (2 MB) have been reported.

Long-read sequencing (also called third generation sequencing) can enable the sequencing of regions of the genome which cannot easily be sequenced by short-read sequencing. For example, certain features of individual genomes are particularly difficult to detect and quantify using short-read sequencing approaches, such as large insertions or deletions of DNA and highly polymorphic regions. With short-read sequencing, phasing information is often lost and the data analysis is highly dependent on reference genomes/sequences, which may be imperfect. In particular, in order to phase two heterozygous polymorphisms to differentiate between two different HLA alleles, they would need to be covered by a single sequencing read. Long-read sequencing reads can span larger parts of highly polymorphic regions, enabling the detection of a greater number of variants. In addition, long sequencing reads provide the long-range information required for resolving haplotypes without additional statistical inference, maternal/paternal sequencing, or sample preparation, which is required for approximations of phasing using short-read sequencing approaches.

As used herein, the terms “genome phasing”, “haplotype phasing” or “phasing” are used interchangeably to refer to phased sequencing in which alleles of the maternally and paternally-derived chromosomes for an individual are identified, i.e. the identification of the haplotypes. By identifying haplotype information, phased sequencing can inform studies of complex traits, which are often influenced by interactions among multiple genes and alleles.

As used herein, the term “haplotype” refers to a group of alleles in an organism that are inherited together from a single parent.

In some preferred embodiments of the methods of the invention, the sequencing is performed using a long-read sequencing approach. Suitable long-read sequencing approaches include Oxford Nanopore technology or Pacific Biosciences SMRT. Preferably, Oxford Nanopore technology is used.

Suitable protocols for long-read sequencing are known in the art. In addition, a suitable protocol is provided herein (see Materials and Methods).

The analysis of the data produced by NGS techniques, whether it is long-reads or short-reads is well-known in the art. Various bioinformatics tools are available for the analysis of sequencing reads, including long-reads (see the review article Amarasinghe et al. (2020), Genome Biology 21 : 30). For example, an open-source catalogue of long-read sequence analysis tools has recently been made available (long-read-tools.org). Therefore, suitable tools for the analysis of the sequencing reads are known in the art. Such tools can be used for determining the HLA type of the subject based on the sequencing read.

Sample

As described herein, the first step in the methods of the invention is the selective amplification of a nucleic acid molecule from a sample obtained from a subject. As used herein, the term “sample” refers to a sample that is obtained from a subject or from a tissue of a subject which comprises DNA. The sample may comprise cells, cell nuclei and/or cell free DNA. Suitably, the sample may comprise or consist of isolated DNA. The sample may be a tissue sample, a cell sample and/or a blood sample.

A sample from a subject may be obtained from any mammal.

Preferably, the sample is obtained from a human.

Samples may be taken from a patient or an individual, and may also be derived from other patients/individuals or from separate sections of the same patient/individual, such as samples from one patient and from one donor. Samples may thus be analysed according to the invention and compared with a reference sample, or different samples may be analysed and compared with each other.

Individual

In some embodiments, the sample DNA is from a patient or an individual who may be at risk of, suspected of having, or has a particular disease, for example cancer, a viral infection (e.g. HIV-1) or any other condition which warrants the investigation of their HLA type.

In some embodiments, the sample DNA is from a patient or an individual who is a person who is at risk of requiring or requires a transplant, for example a solid organ or haematopoietic stem cell transplant.

In some embodiments, the sample DNA is from a patient or an individual who is undergoing a transplant, for example a solid organ or haematopoietic stem cell transplant.

In some embodiments, the sample DNA is from an individual who is a transplant donor, for example a solid organ or haematopoietic stem cell transplant donor.

In some embodiments, the sample DNA is from donated tissue or cells, such as donor haematopoietic stem cells.

Kits

The invention further provides kits comprising the reagents of the invention.

In one aspect, the invention provides a kit comprising a first isolated polynucleotide which is complementary to a sequence from 2323 to 8000 base pairs upstream of the 5’ UTR of the HLA-DQB1 gene and at least one further isolated polynucleotide which is a second primer for typing DQB1 as described herein. In one embodiment, the first isolated polynucleotide comprises SEQ ID NO: 1 or a variant which has at least 80% identity to SEQ ID NO: 1 .

In one embodiment, the kit further comprises at least two further isolated polynucleotides which are a third or fourth primer for typing of DPB1 as described herein.

In a further aspect, the invention provides a kit comprising isolated oligonucleotides which comprise or consist of SEQ ID NO: 5 and 6 or a variant which has at least 80% sequence identity to SEQ ID NO: 5 or 6.

In a further aspect, the invention provides a kit comprising at least one first isolated oligonucleotide which comprises or consists of SEQ ID NO: 5 and/or 6 or a variant which has at least 80% sequence identity to SEQ ID NO: 5 or 6; and at least one further isolated oligonucleotide which is a primer for typing DRB1 as described herein.

In a further aspect, the invention provides a kit comprising: (a) a first isolated polynucleotide which is complementary to a sequence from 2323 to 8000 base pairs upstream of the 5’ UTR of the HLA-DQB1 gene; (b) at least two further isolated polynucleotides which are a primer set for the typing of DPB1 as described herein; and (c) one or more further isolated polynucleotide(s) which comprise or consist of SEQ ID NO: 5 and/or 6 or a variant which has at least 80% sequence identity to SEQ ID NO: 5 or 6.

In some embodiments, the kit further comprises at least one further isolated oligonucleotide which is a primer as described herein.

In some embodiments, the kit further comprises at least two further isolated oligonucleotides which provide an additional primer set for amplifying at least one additional HLA gene.

In some embodiments, the additional primer set is suitable for amplifying an HLA gene selected from one or more of HLA-A, HLA-B, HLA-C, HLA-DQA1 , HLA-DPA1.

In some embodiments, the kit further comprises further isolated pairs of oligonucleotides which provide primer sets suitable for amplifying each of HLA-A, HLA-B, HLA-C, HLA-DQA1 , and HLA-DPA1.

In some embodiments, the additional primer sets are primers as described herein.

The kits of the invention may further comprise instructions for use.

In some embodiments, the isolated polynucleotides and/or primers may be provided in any suitable container. Suitably, the primer sets for each respective HLA gene as provided herein may be provided in separate containers. Suitably, primer sets for each respective HLA gene as provided herein may be provided in the same container (e.g. for multiplex applications).

Variants, homologues and fragments

In addition to the specific nucleotides mentioned herein, the invention also encompasses the use of variants, derivatives, analogues, homologues and fragments thereof.

In the context of the invention, a variant of any given sequence is a sequence in which the specific sequence of or nucleic acid residues has been modified in such a manner that the polynucleotide in question substantially retains its function. A variant sequence can be obtained by addition, deletion, substitution, modification, replacement and/or variation of at least one residue present in the naturally-occurring polynucleotide.

The term “derivative” as used herein, in relation to polypeptides of the invention includes any substitution of, variation of, modification of, replacement of, deletion of and/or addition of one (or more) nucleic acid residues from or to the sequence providing that the resultant polypeptide substantially retains at least one of its endogenous functions.

The term “analogue” as used herein, in relation to polynucleotides includes any mimetic, that is, a chemical compound that possesses at least one of the endogenous functions of the polynucleotides which it mimics.

The term “homologue” as used herein means an entity having a certain homology with the wild type nucleotide sequence. The term “homology” can be equated with “identity”.

A homologous sequence may include a nucleotide sequence which may be at least 80%, 85% or 90% identical, preferably at least 95% or 97% or 99% identical to the subject sequence. Although homology can also be considered in terms of similarity, in the context of the invention it is preferred to express homology in terms of sequence identity.

Preferably, reference to a sequence which has a percent identity to any one of the SEQ ID NOs detailed herein refers to a sequence which has the stated percent identity over the entire length of the SEQ ID NO referred to.

Homology comparisons can be conducted by eye or, more usually, with the aid of readily available sequence comparison programs. These commercially available computer programs can calculate percentage homology or identity between two or more sequences.

Percentage homology may be calculated over contiguous sequences, i.e., one sequence is aligned with the other sequence and each amino acid in one sequence is directly compared with the corresponding amino acid in the other sequence, one residue at a time. This is called an “ungapped” alignment. Typically, such ungapped alignments are performed only over a relatively short number of residues.

Although this is a very simple and consistent method, it fails to take into consideration that, for example, in an otherwise identical pair of sequences, one insertion or deletion in the nucleotide sequence may cause the following codons to be put out of alignment, thus potentially resulting in a large reduction in percent homology when a global alignment is performed. Consequently, most sequence comparison methods are designed to produce optimal alignments that take into consideration possible insertions and deletions without penalising unduly the overall homology score. This is achieved by inserting “gaps” in the sequence alignment to try to maximise local homology.

However, these more complex methods assign “gap penalties” to each gap that occurs in the alignment so that, for the same number of identical amino acids, a sequence alignment with as few gaps as possible, reflecting higher relatedness between the two compared sequences, will achieve a higher score than one with many gaps. “Affine gap costs” are typically used that charge a relatively high cost for the existence of a gap and a smaller penalty for each subsequent residue in the gap. This is the most commonly used gap scoring system. High gap penalties will of course produce optimised alignments with fewer gaps. Most alignment programs allow the gap penalties to be modified. However, it is preferred to use the default values when using such software for sequence comparisons. For example, when using the GCG Wisconsin Bestfit package the default gap penalty for amino acid sequences is -12 for a gap and -4 for each extension.

Calculation of maximum percentage homology therefore firstly requires the production of an optimal alignment, taking into consideration gap penalties. A suitable computer program for carrying out such an alignment is the GCG Wisconsin Bestfit package (University of Wisconsin, U.S.A.; Devereux et al. (1984) Nucleic Acids Res. 12: 387), minimap or Burrows- Wheeler Aligner (BWA). Examples of other software that can perform sequence comparisons include, but are not limited to, the BLAST package (see Ausubel et al. (1999) ibid - Ch. 18), FASTA (Atschul et al. (1990) J. Mol. Biol. 403-410) and the GENEWORKS suite of comparison tools. Both BLAST and FASTA are available for offline and online searching (see Ausubel et al. (1999) ibid, pages 7-58 to 7-60). However, for some applications, it is preferred to use the GCG Bestfit program. Another tool, called BLAST 2 Sequences is also available for comparing protein and nucleotide sequences (see FEMS Microbiol. Lett. (1999) 174: 247-50; FEMS Microbiol. Lett. (1999) 177: 187-8). Although the final percent homology can be measured in terms of identity, the alignment process itself is typically not based on an all-or-nothing pair comparison. Instead, a scaled similarity score matrix is generally used that assigns scores to each pairwise comparison based on chemical similarity or evolutionary distance. An example of such a matrix commonly used is the BLOSUM62 matrix - the default matrix for the BLAST suite of programs. GCG Wisconsin programs generally use either the public default values or a custom symbol comparison table if supplied (see the user manual for further details). For some applications, it is preferred to use the public default values for the GCG package, or in the case of other software, the default matrix, such as BLOSUM62.

Once the software has produced an optimal alignment, it is possible to calculate percent homology, preferably percent sequence identity. The software typically does this as part of the sequence comparison and generates a numerical result.

“Fragments” are also variants and the term typically refers to a selected region of the polypeptide or polynucleotide that is of interest either functionally or, for example, in an assay. “Fragment” thus refers to an amino acid or nucleic acid sequence that is a portion of a full- length polypeptide or polynucleotide.

Such variants may be prepared using standard recombinant DNA techniques such as site- directed mutagenesis. Where insertions are to be made, synthetic DNA encoding the insertion together with 5' and 3' flanking regions corresponding to the naturally-occurring sequence either side of the insertion site may be made. The flanking regions will contain convenient restriction sites corresponding to sites in the naturally-occurring sequence so that the sequence may be cut with the appropriate enzyme(s) and the synthetic DNA ligated into the cut. The DNA is then expressed in accordance with the invention to make the encoded protein. These methods are only illustrative of the numerous standard techniques known in the art for manipulation of DNA sequences and other known techniques may also be used.

This disclosure is not limited by the exemplary methods and materials disclosed herein, and any methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of this disclosure. Numeric ranges are inclusive of the numbers defining the range. Unless otherwise indicated, any nucleic acid sequences are written left to right in 5' to 3' orientation; amino acid sequences are written left to right in amino to carboxy orientation, respectively.

It must be noted that as used herein and in the appended claims, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. The terms "comprising", "comprises" and "comprised of as used herein are synonymous with "including", "includes" or "containing", "contains", and are inclusive or open-ended and do not exclude additional, non-recited members, elements or method steps. The terms "comprising", "comprises" and "comprised of' also include the term "consisting of'.

The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that such publications constitute prior art to the claims appended hereto.

The invention will now be further described by way of Examples, which are meant to serve to assist one of ordinary skill in the art in carrying out the invention and are not intended in any way to limit the scope of the invention.

EXAMPLES

Materials and Methods

DNA extraction

DNA was extracted by QIAsymphony using the QIAsymphony DNA Midi Kit. DNA was purified with 1x Ampure XP beads and quantified by the Qubit dsDNA BR Assay kit.

Targeted HLA PCR

PCR amplification of HLA genes is detailed below.

Amplicons were purified with 0.6x Ampure XP beads.

Library preparation

Library preparation was performed with Oxford Nanopore Ligation Sequencing Kit (SQK- LSK109). PCR amplicons were subjected to end repair and dA-tailing in a 27.25μl reaction: 75-150fmols of amplicon in 24μl, 1.75μl NEB Ultra II End-prep reaction buffer, 1.5μl NEB Ultra II End-prep enzyme mix. End repaired and dA-tailed amplicons were purified with 1x Ampure XP beads and quantified by the Qubit dsDNA HS Assay kit.

Native barcode ligation was performed in a 20μl reaction (optional if required, if more than one sample): 60-120fmols of amplicon in 9μl, 1ul ONT native barcode, 10μl NEB Blunt/TA Ligase Master Mix. Barcoded libraries were purified with 0.4x Ampure XP beads and quantified by the Qubit dsDNA HS Assay kit. Libraries were pooled and analysed on the Agilent Bioanalyser to determine average DNA length. Adapter ligation was then performed in a 100μI reaction: 150-300fmols of barcoded libraries in 65μI, 5μI ONT Adapter Mix II (AM 11) , 1x NEB NEBNext Quick Ligation Reaction Buffer, 10ul NEB Quick T4 DNA Ligase. Adapter-ligated, barcoded libraries were purified with 0.5x Ampure XP beads and washed with 250pl ONT Long Fragment Buffer (LFB).

25-75 fmols of final prepared library was loaded onto the MinlON R10 flow cell (FLO-MIN111). Sequencing was performed for up to 8hrs for 24 samples.

E.g. 8hrs sequencing = approx. 3Gb data = 6,000 reads per gene per sample for class I.

Example 1 - Multiplex HLA-A, -B, -C typing

Long range PCR amplification was performed for HLA class I (multiplex HLA-A, -B, -C). A schematic of the approach used in shown in Figure 14. Novel primers were used for the HLA- C and HLA-B amplification.

Table 5 - Primers used in this study.

PCRs were performed using Takara PrimeStar GXL polymerase or Quantabio repliQa HiFi ToughMix in a 20pl reaction:

50-1 OOng of gDNA, 1x PrimeStar GXL buffer, 0.2mM each of dATP, dCTP, dGTP and dTTP, 1 U PrimeStar GXL polymerase, 90nM HLA-A_F1 , 90nM HLA-A_F2, 180nM HLA-A_R1 , 60nM HLA-B_F1 , 60 nM HLA-B_R1 , 60nM HLA-C_sdF11 , 60nM HLA- C_sdR9 (0.6μM total primer). Cycling parameters for the PCR are as follows: 30 cycles of 98°C for 10s, 60°C for 20s and 68°C for 5 min.

Or

50-100ng of gDNA, 1x repliQa HiFi ToughMix, 150nM HLA-A_F1 , 150nM HLA-A_F2, 300nM HLA-A_R1 , 100nM HLA-B_F1 , 100 nM HLA-B_R1 , 100nM HLA-C_sdF11 , 100nM HLA-C_sdR9 (1 μM total primer). Cycling parameters for the PCR are as follows: 30 cycles of 98°C for 10s, 60°C for 20s and 68°C for 30s. Productive amplifications are shown in Figures 1 and 2.

HLA-B_sdR5 (SEQ ID NO: 47 - TTACCACCTTCTAGCACTTTCCTTC) is located downstream of the 3’UTR region. In combination with HLA-B_F1 (SEQ ID NO: 34), the whole HLA-B gene was amplified for sequencing (Figure 22).

Example 2 - Multiplex HLA-DQB1, -DPB1 typing

Long range PCR amplification was performed for HLA-DQB1 , -DPB1 (multiplex HLA-DQB1 , - DPB1). A schematic of the approach used in shown in Figure 15. A novel primer was used for the HLA-DQB1 amplification.

Table 6 - Primers used in this study

100ng of gDNA, 1x PrimeStar GXL buffer, 0.2mM each of dATP, dCTP, dGTP and dTTP, 1M betaine, 0.5U PrimeStar GXL polymerase, 55nM HLA-DQB1_1delF1 , 55nM HLA-DQB1_HosR, 445nM HLA-DPB1_F, 445nM HLA-DPB1_R, (1 μM total primer). Cycling parameters for the PCR are as follows: 30 cycles of 98°C for 10s, 60°C for 20s and 68°C for 5 min.

Or

50-100ng of gDNA, 1x repliQa HiFi ToughMix, 55nM HLA-DQB1_1delF1, 55nM HLA- DQB1_HosR, 445nM HLA-DPB1_F, 445nM HLA-DPB1_R (1 μM total primer). Cycling parameters for the PCR are as follows: 30 cycles of 98°C for 10s, 60°C for 20s and 68°C for 3 min.

The expected amplicon sizes are: HLA-DQB1 = 10kb; HLA-DPB1 = 13.6kb.

Productive amplifications are shown in Figures 3 and 4. Example 3 - Multiplex HLA-DQA1, DPA1 typing

Long range PCR amplification was performed for HLA-DQA1 , -DPA1 (multiplex HLA-DQA1 , - DPA1). A schematic of the approach used in shown in Figure 16. Novel primers were used for the HLA-DQA1 amplification.

Table 7 - Primers used in this study

50-1 OOng of gDNA, 1x PrimeStar GXL buffer, 0.2mM each of dATP, dCTP, dGTP and dTTP, 1 M betaine, 1 U PrimerStar GXL polymerase, 135nM HLA-DQA1_1.6, 135nM HLA-DQA1_R1.3, 265nM HLA-DPA1_F1 , 265nM HLA-DPA1_R1 , (0.8μM total primer). Cycling parameters for the PCR are as follows: 30 cycles of 98°C for 10s, 60°C for 20s and 68°C for 10 min.

Or

50-100ng of gDNA, 1x repliQa HiFi ToughMix, 135nM HLA-DQA1_1.6, 135nM HLA- DQA1_R1.3, 265nM HLA-DPA1_F1 , 265nM HLA-DPA1_R1 , (0.8μM total primer). Cycling parameters for the PCR are as follows: 30 cycles of 98°C for 10s, 60°C for 20s and 68°C for 3 mins.

Productive amplifications are shown in Figures 5 and 6.

In addition, long range PCR amplification was performed for HLA-DQB1 , -DPB1 , -DQA1 , - DPA1 (multiplex HLA-DQA1 , -DPA1).

Primers used in this study were:

50-1 OOng of gDNA, 1x PrimeStar GXL buffer, 0.2mM each of dATP, dCTP, dGTP and dTTP, 1M betaine, 0.5U PrimerStar GXL polymerase, 30nM HLA-DQB1_1delF1 , 30nM HLA-DQB1_HosR, 430nM HLA-DPB1_F, 430nM HLA-DPB1_R, 120nM HLA- DQA1_1.6, 120nM HLA-DQA1_R1.3, 120nM HLA-DPA1_F1 , 120nM HLA-DPA1_R1 , (1 ,4μM total primer). Cycling parameters for the PCR are as follows: 30 cycles of 98°C for 10s, 60°C for 20s and 68°C for 10 min.

Or

50-100ng of gDNA, 1x repliQa HiFi ToughMix, 30nM HLA-DQB1_1delF1, 30nM HLA- DQB1_HosR, 430nM HLA-DPB1_F, 430nM HLA-DPB1_R, 120nM HLA-DQA1_1 .6, 120nM HLA-DQA1_R1.3, 120nM HLA-DPA1_F1 , 120nM HLA-DPA1_R1 , (1.4μM total primer). Cycling parameters for the PCR are as follows: 30 cycles of 98°C for 10s, 60°C for 20s and 68°C for 3 mins.

Productive amplifications are shown in Figure 20.

Example 4 - Multiplex HLA-DRB1 typing

Long range PCR amplifications were performed for HLA-DRB1 (multiplex Mix 1 ; Mix 2 and single Mix). Schematics of the PCR reactions are shown in Figures 17-19.

Table 8 - Primers used in this study - Mix 1

Table 9 - Primers used in this study - Mix 2

Multiplex Mix 1 PCRs were performed using Takara PrimeStar GXL polymerase or Quantabio repliQa HiFi ToughMix in a 20pl reaction:

50-1 OOng of gDNA, 1x PrimeStar GXL buffer, 0.2mM each of dATP, dCTP, dGTP and dTTP, 1 U PrimerStar GXL polymerase, 100nM HLA-DRB1_PE2_F1 , 100nM HLA- DRB1_PE2_F2, 100nM HLA-DRB1_PE2_F3, 100nM HLA-DRB1_PE2_R1 , 100nM HLA-DRB1_PE2_R2, 100nM HLA-DRB1_PE2_R3, 100nM HLA-DRB1_PE2_R4, 100nM HLA-DRB1_PE2_R5, 100nM HLA-DRB1_PE2_R6 (0.9μM total primer). Cycling parameters for the PCR are as follows: 30 cycles of 98°C for 10s and 72°C for 10 min

Or

50-1 OOng of gDNA, 1x repliQa HiFi ToughMix, 100nM HLA-DRB1_PE2_F1 , 100nM HLA- DRB1_PE2_F2, 100nM HLA-DRB1_PE2_F3, 100nM HLA-DRB1_PE2_R1 , 100nM HLA- DRB1_PE2_R2, 100nM HLA-DRB1_PE2_R3, 100nM HLA-DRB1_PE2_R4, 100nM HLA- DRB1_PE2_R5, 100nM HLA-DRB1_PE2_R6 (0.9μM total primer). Cycling parameters for the PCR are as follows: 30 cycles of 98°C for 10s and 72°C for 1 , 2, 3 or 5 mins. Multiplex Mix 2 PCRs were performed using Takara PrimeStar GXL polymerase or Quantabio repliQa HiFi ToughMix in a 20pl reaction:

50-1 OOng of gDNA, 1x PrimeStar GXL buffer, 0.2mM each of dATP, dCTP, dGTP and dTTP, 1 U Primer PrimeStar GXL polymerase, 15nM HLA-DRB1-E2-1.1-F, 15nM HLA-DRB1-E2-1.2- F, 100nM HLA-DRB1-E2-2-F, 75nM HLA-DRB1-E2-3568-F, 54nM HLA-DRB1-E2-4-F, 84nM HLA-DRB1-E2-7-F4, 182nM HLA-DRB1-E2-9-F, 170nM HLA-DRB1-E2-10-F, 100nM HLA- DRB1-E2-12-R, 44nM H LA-DR B1-E2-3568-R, 54nM HLA-DRB1-E2-4-R, 84nM HLA-DRB1- E2-7-R2, 182nM HLA-DRB1-E2-9-R, 85nM HLA-DRB1-E2-10-R, 44nM HLA-DRB1-E2- 3568hR3, 170nM HLA-DRB1-E2-10sR6 (1.458 μM total primer). Cycling parameters for the PCR are as follows: 30 cycles of 98°C for 10s and 72°C for 10 min. Or

50-100ng of gDNA, 1x repliQa HiFi ToughMix, 15nM HLA-DRB1-E2-1.1-F, 15nM HLA-DRB1- E2-1.2-F, 100nM HLA-DRB1-E2-2-F, 75nM HLA-DRB1-E2-3568-F, 54nM HLA-DRB1-E2-4- F, 84nM HLA-DRB1-E2-7-F4, 182nM HLA-DRB1-E2-9-F, 170nM HLA-DRB1-E2-10-F, 100nM HLA-DRB1-E2-12-R, 44nM HLA-DRB1-E2-3568-R, 54nM HLA-DRB1-E2-4-R, 84nM HLA- DRB1-E2-7-R2, 182nM HLA-DRB1-E2-9-R, 85nM HLA-DRB1-E2-10-R, 44nM HLA-DRB1- E2-3568hR3, 170nM HLA-DRB1-E2-10sR6 (1.458 μM total primer) (0.9 μM total primer). Cycling parameters for the PCR are as follows: 30 cycles of 98°C for 10s and 72°C for 1 , 2, 3 or 5 mins. Multiplex Single Mix PCRs (using primers from both Mix 1 and Mix 2 in a single multiplex reaction) were also performed. These PCRs were performed using Takara PrimeStar GXL polymerase or Quantabio repliQa HiFi ToughMix in a 20pl reaction:

50-1 OOng of gDNA, 1x PrimeStar GXL buffer, 0.2mM each of dATP, dCTP, dGTP and dTTP, 1 U Primer PrimeStar GXL polymerase, 69nM HLA-DRB1_PE2_F1 , 69nM HLA- DRB1_PE2_F2, 69nM HLA-DRB1_PE2_F3, 69nM HLA-DRB1_PE2_R1 , 69nM HLA-

DRB1_PE2_R2, 69nM HLA-DRB1_PE2_R3, 69nM HLA-DRB1_PE2_R4, 69nM HLA-

DRB1_PE2_R5, 69nM HLA-DRB1_PE2_R6, 18nM HLA-DRB1-E2-1.1-F, 18nM HLA-DRB1- E2-1.2-F, 122nM HLA-DRB1-E2-2-F, 92nM HLA-DRB1-E2-3568-F, 66nM HLA-DRB1-E2-4- F, 103nM HLA-DRB1-E2-7-F4, 222nM HLA-DRB1-E2-9-F, 208nM HLA-DRB1-E2-10-F, 122nM HLA-DRB1-E2-12-R, 54nM HLA-DRB1-E2-3568-R, 66nM HLA-DRB1-E2-4-R, 103nM HLA-DRB1-E2-7-R2, 222nM HLA-DRB1-E2-9-R, 104nM HLA-DRB1-E2-10-R, 54nM HLA- DRB1-E2-3568hR3, 208nM HLA-DRB1-E2-10sR6 (2.4μM total primer). Cycling parameters for the PCR are as follows: 30 cycles of 98°C for 10s and 72°C for 10 min. Or

50-1 OOng of gDNA, 1x repliQa HiFi ToughMix, , 69nM HLA-DRB1_PE2_F1, 69nM HLA- DRB1_PE2_F2, 69nM HLA-DRB1_PE2_F3, 69nM HLA-DRB1_PE2_R1 , 69nM HLA- DRB1_PE2_R2, 69nM HLA-DRB1_PE2_R3, 69nM HLA-DRB1_PE2_R4, 69nM HLA- DRB1_PE2_R5, 69nM HLA-DRB1_PE2_R6, 18nM HLA-DRB1-E2-1.1-F, 18nM HLA-DRB1- E2-1.2-F, 122nM HLA-DRB1-E2-2-F, 92nM HLA-DRB1-E2-3568-F, 66nM HLA-DRB1-E2-4- F, 103nM HLA-DRB1-E2-7-F4, 222nM HLA-DRB1-E2-9-F, 208nM HLA-DRB1-E2-10-F, 122nM HLA-DRB1-E2-12-R, 54nM HLA-DRB1-E2-3568-R, 66nM HLA-DRB1-E2-4-R, 103nM HLA-DRB1-E2-7-R2, 222nM HLA-DRB1-E2-9-R, 104nM HLA-DRB1-E2-10-R, 54nM HLA- DRB1-E2-3568hR3, 208nM HLA-DRB1-E2-10sR6 (2.4μM total primer). Cycling parameters for the PCR are as follows: 30 cycles of 98°C for 10s and 72°C for 1 , 2, 3 or 5 mins. A specific combination of the Mix 1 and Mix 2 primers enables the capture of HLA-DRB1*10:01 , *03:02 and *13:03 alleles.

Table 10 - Primer pairs used in this study

Productive amplifications are shown in Figures 7-10.

Further -DRB1 As an alternative to amplifying Amp 4 (5’UTR to Exon 2) and Amp5 (Exon 2 to 3’UTR) or Amp 6 from (5’IITR to Exon 2 and Exon 2 to 3’IITR in a single PCR reaction) which generates two amplicons, a single amplicon (Amp 7) from 5’IITR to 3’IITR was amplified in a single PCR reaction for DRB*10:01 , DRB1*03:02 and DRB1*13:03 alleles (see Figure 24).

Figure 25(a)-(c) show PCR amplifications of DRB1*10:01 allele (using DRB1_E2-10sR6 primer in combination with either DRB1 _PE-F1 or DRB1 _PE-F2 or DRB1 _PE-F3); PCR amplification of DRB1*03:02 allele (using DRB1 _PE-F1 and DRB1_E2-3568hR3 primers) add PCR amplification of DRB1*13:03 allele (using DRB1_E2-3568hR3 primer in combination with either DRB1 _PE-F1 or DRB1 _PE-F2 or DRB1 _PE-F3) - as analysed by 1% agarose gel electrophoresis.

Figure 26 shows an example of long read sequencing data from an individual homozygous for DRB1*10:01 captured by amplification of the DRB1 gene with DRB1 _PE-F1 and DRB1_E2- 10sR6 primers.

Figure 27 shows an example of long read sequencing data from an individual homozygous for DRB1*03:02 captured by amplification of the DRB1 gene with DRB1 _PE-F1 and DRB1_ E2- 3568hR3 primers.

Figure 28shows an example of long read sequencing data from an individual homozygous for DRB1*13:03 captured by amplification of the DRB1 gene with DRB1 _PE-F1 and DRB1_ E2- 3568hR3 primers.

In contrast to the above, DRB1 primers described in Shiina et al. (Tissue Antigens; 2012; 80(4): 305-16) did not enable the identification of any of DRB1 *10:01 , DRB1 *03:02 and DRB1*13:03.

Conclusions

The methods produce continuous long sequence reads. Continuous long reads from 5’ UTR to 3’ UTR of HLA-A, -B, -C, -DQB1 , - DRB1 , -DQA1 , -DPB1 and -DPA1 genes were captured. For example, Fig. 11 shows the sequence reads captured and analysed by GenDx NGSengine for HI_A-DPA1.

The method of the invention resolves phasing ambiguities (e.g. DPB1). The same DNA sample was sequenced by short-read sequencing on the MiSeq and long-read sequencing on the MinlON. MiSeq sequencing produced genotype ambiguities with a typing result of HLA- DPB1*02:01:02, DPB1*04:02:01 or HLA-DPB1*105:01 :01 , DPB1*416:01 :01 (Figure 12A), whilst MinlON sequencing produced a fully phased typing result of DPB1*02:01 :02, DPB1*04:02:01 (Figure 12B).

The method of the invention also captures the region used to define the HLA-DQB1*03:276N allele. The novel primer DQB1_1delF1 is positioned upstream of the 5’ UTR to cover the 3.7kb deletion of 5’ UTR-lntron 1 region of the DQB1*03:276N allele. Detection of this region was achieved (Figure 13). All current commercial kits do not capture the 5’ UTR-lntron 1 region and therefore do not offer detection of this null allele.

Example 5 - Multiplex HLA-DRB3, HLA-DRB4 and HLA-DRB5

Primers against HLA-DRB3, HLA-DRB4 and HLA-DRB5 were designed and tested.

Table 11 - Primers used in study

All primer sequences are shown 5’ to 3’. These primers will enable all exon and intron regions of each gene to be captured for sequencing - including exon 1 and intron 1.

HLA-DRB3 Amplification

PCRs were performed using Takara PrimeStar GXL polymerase in a 20pl reaction:

50-1 OOng of gDNA, 1x PrimeStar GXL buffer, 0.2mM each of dATP, dCTP, dGTP and dTTP, 1M betaine, 1 U PrimeStar GXL polymerase, 200nM HLA-DRB3_sdF2, 200nM HLA- DRB3_sdR1 (0.4μM total primer). Cycling parameters for the PCR are as follows: 30 cycles of 98°C for 10s, 60°C for 15s and 68°C for 10 min.

HLA-DRB3 Amplification (sdF8 and sdR7)

PCRs were performed using Takara PrimeStar GXL polymerase in a 20ul reaction:

50-1 OOng of gDNA, 1x PrimeStar GXL buffer, 0.2mM each of dATP, dCTP, dGTP and dTTP, 1M betaine, 1 U PrimeStar GXL polymerase, 200nM HLA-DRB3_sdF8, 200nM HLA- DRB3_sdR7 (0.4μM total primer). Cycling parameters for the PCR are as follows: 94°C for 2mins followed by 30 cycles of 98°C for 10s, 60°C for 15s and 68°C for 10 min.

HLA-DRB4 Amplification

PCRs were performed using Takara PrimeStar GXL polymerase in a 20μl reaction:

50-1 OOng of gDNA, 1x PrimeStar GXL buffer, 0.2mM each of dATP, dCTP, dGTP and dTTP, 1M betaine, 1 U PrimeStar GXL polymerase, 200nM HLA-DRB4_sdF1 , 200nM HLA- DRB4_sdR1 (0.4μM total primer). Cycling parameters for the PCR are as follows: 30 cycles of 98°C for 10s, 60°C for 15s and 68°C for 10 min.

HLA-DRB5 Amplification

PCRs were performed using Takara PrimeStar GXL polymerase in a 20μl reaction:

50-1 OOng of gDNA, 1x PrimeStar GXL buffer, 0.2mM each of dATP, dCTP, dGTP and dTTP, 1M betaine, 1 U PrimeStar GXL polymerase, 200nM HLA-DRB5_sdF1 , 200nM HLA- DRB5_sdR3 (0.4μM total primer). Cycling parameters for the PCR are as follows: 30 cycles of 98°C for 10s, 60°C for 15s and 68°C for 10 min.

Productive amplification products for each reaction as shown in Figure 21 and Figure 23 (HLA- DRB3 Amplification (sdF8 and sdR7).

All publications mentioned in the above specification are herein incorporated by reference. Various modifications and variations of the described methods and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in molecular biology or related fields are intended to be within the scope of the following claims.

Claims

1. A method for typing an HLA-DQB1 gene comprising

(c) determining the HLA-DQB1 type of the subject based on the sequencing read.

2. The method according to claim 1 wherein the first primer comprises or consists of a sequence as set forth in SEQ ID NO: 1 or a variant thereof which has at least 85% identity to SEQ ID NO: 1.

3. The method according to claim 1 or claim 2 wherein the primer set further comprises a second primer which targets the 3’IITR of the HLA-DQB1 gene, wherein amplification between the first primer and the second primer generates a whole gene amplicon of HLA- DQB1.

4. The method according to claim 3 wherein the second primer comprises or consists of a sequence as set forth in SEQ ID NO: 2 or a variant thereof which has at least 85% identity to SEQ ID NO: 2.

5. The method according to any of claims 1 to 4 wherein the method further comprises typing an HLA-DPB1 gene, the method comprising:

(a’) selectively amplifying a second nucleic acid molecule in the same reaction as claim 1 , step (a) using a second primer set comprising a third primer and a fourth primer, preferably wherein amplification between the third primer and the fourth primer generates a whole gene amplicon of an HLA-DPB1 gene;

(b’) performing a sequencing read of at least part of an amplicon generated using the second primer set;

(o’) determining the HLA-DPB1 type of the subject based on the sequencing read.

6. The method according to claim 5 wherein the third primer targets the 5’IITR of the HLA-DPB1 gene and the fourth primer targets the 3’IITR of the HLA-DPB1 gene.

7. A method according to claim 6 wherein the third primer comprises or consists of a sequence as set forth in SEQ ID NO: 3 or a variant thereof which has at least 85% identity to SEQ ID NO: 3.

8. A method according to claims 6 or 7 wherein the fourth primer comprises or consists of a sequence as set forth in SEQ ID NO: 4 or a variant thereof which has at least 85% identity to SEQ ID NO: 4.

9. A method according to any preceding claim, which further comprises:

(a”) selectively amplifying one or more further nucleic acid molecules in the same reaction as claim 1 , step (a) or claim 5, step (a’) using at least one or two further primer sets comprising primers which generate a whole gene amplicon of an HLA-DQA1 gene or an HLA-DPA1 gene; (b”) performing a sequencing read of at least part of an amplicon generated using the further primer set(s);

(c”) determining the HLA-DQA1 gene and/or an HLA-DPA1 type of the subject based on the sequencing reads.

10. A method for typing an HLA-DRB1 gene comprising

(A) selectively amplifying a nucleic acid molecule from a sample obtained from a subject using a first primer set comprising at least one first primer which comprises or consists of a sequence as set forth in SEQ ID NO: 5 or 6 or a variant thereof which has at least 85% sequence identity to SEQ ID NO: 5 or 6;

(C) determining the HLA-DRB1 type of the subject based on the sequencing read.

11. The method according to claim 10 wherein the first primer set further comprises at least one second primer which targets exon 2 of the HLA-DRB1 gene, wherein amplification between the at least one first primer and the at least one second primer generates at least one amplicon from exon 2 to the 3’IITR of the HLA-DRB1 gene.

12. The method according to claim 10 or claim 11 wherein the at least one second primer comprises or consists of a sequence as set forth in SEQ ID NO: 13 or 14 or a variant thereof which has at least 80% sequence identity to SEQ ID NO: 13 or 14.

13. The method according to claim 11 or claim 12 wherein the first primer set comprises primers which:

(i) comprise or consist of sequences as set forth in SEQ ID NO: 5 and 13 or variants thereof which have at least 85% sequence identity to SEQ ID NO: 5 and 13; and/or

(ii) comprise or consist of sequences as set forth in SEQ ID NO: 6 and 14 or variants thereof which have at least 85% sequence identity to SEQ ID NO: 6 and 14.

14. The method according to any one of claims 10 to 13, wherein the first primer set further comprises one or more further primers which comprise or consist of a sequence as set forth in SEQ ID NO: 7 to 12 or a variant thereof which has at least 85% sequence identity to one of SEQ ID NO: 7 to 12 and/or which comprise or consist of a sequence as set forth in SEQ ID NO: 15 to 20 or a variant thereof which has at least 85% sequence identity to one of SEQ ID NO: 15 to 20.

15. The method according to any of claims 10 to 14 wherein the method further comprises (A’) selectively amplifying a nucleic acid molecule from the sample obtained from the subject using a second primer set comprising a third primer and a fourth primer, preferably wherein amplification between the third primer and the fourth primer generates an amplicon from the 5’ UTR to exon 2 of the HLA-DRB1 gene;

16. The method according to claim 15, wherein the third primer comprises or consists of a sequence as set forth in SEQ ID NO: 21 or 22 or a variant thereof which has at least 80% sequence identity to one of SEQ ID NO: 21 or 22.

17. The method according to claim 15 or claim 16, wherein the fourth primer comprises or consists of a sequence as set forth in SEQ ID NO: 24 or 25 or a variant thereof which has at least 85% sequence identity to one of SEQ ID NO: 24 or 25.

18. The method according to any one of claims 15 to 17 wherein the second primer set comprises primers which:

(i) comprise or consist of sequences as set forth in SEQ ID NO: 21 and 24 or variants thereof which have at least 85% sequence identity to SEQ ID NO: 21 and 24; (ii) comprise or consist of sequences as set forth in SEQ ID NO: 21 and 25 or variants thereof which have at least 85% sequence identity to SEQ ID NO: 21 and 25; and/or

(iii) comprise or consist of sequences as set forth in SEQ ID NO: 22 and 24 or variants thereof which have at least 85% sequence identity to SEQ ID NO: 22 and 24.

19. The method according to any one of claims 15 to 18, wherein the second primer set further comprises one or more further primers which comprise or consist of a sequence as set forth in SEQ ID NO: 23 or a variant thereof which has at least 85% sequence identity to SEQ ID NO: 23 and/or which comprise or consist of a sequence as set forth in SEQ ID NO: 26 to 29 or a variant thereof which has at least 80% sequence identity to one of SEQ ID NO: 26 to 29.

20. The method according to any one of claims 15 to 19, wherein:

(i) the first primer set comprises primers which comprise or consist of sequences as set forth in SEQ ID NO: 5 and 13 or variants thereof which have at 85% sequence identity to SEQ ID NO: 5 and 13 and the second primer set comprises primers which comprise or consist of sequences as set forth in SEQ ID NO: 21 and 24 or variants thereof which have at least 85% sequence identity to SEQ ID NO: 21 and 24;

(ii) the first primer set comprises primers which comprise or consist of sequences as set forth in SEQ ID NO: 6 and 14 or variants thereof which have at least 85% sequence identity to SEQ ID NO: 6 and 14 and the second primer set comprises primers which comprise or consist of sequences as set forth in SEQ ID NO: 21 and 25 or variants thereof which have at least 85% sequence identity to SEQ ID NO: 21 and 25; and/or

(iii) the first primer set comprises primers which comprise or consist of sequences as set forth in SEQ ID NO: 6 and 14 or variants thereof which have at least 85% sequence identity to SEQ ID NO: 6 and 14 and the second primer set comprises primers which comprise or consist of sequences as set forth in SEQ ID NO: 22 and 24 or variants thereof which have at least 85% sequence identity to SEQ ID NO: 22 and 24.

21. The method according to claim 10 wherein the first primer set further comprises at least one second primer which targets the 5’ UTR of the HLA-DRB1 gene, wherein amplification between at least one first primer and at least one second primer generates at least one whole gene amplicon of the HLA-DRB1 gene.

22. The method of claim 21 wherein the second primer comprises or consists of a sequence as set forth in SEQ ID NO: 21 , 22 or 23 or a variant thereof which has at least 85% identity to SEQ ID NO: 21 , 22 or 23.

23. The method according to claim 22 wherein the first primer set comprises primers which:

(i) comprise or consist of sequences as set forth in SEQ ID NO: 5 and at least one of SEQ ID NO: 21-23 or variants thereof which have at least 85% sequence identity to SEQ ID NO: 5 or 21-23; and/or

(ii) comprise or consist of sequences as set forth in SEQ ID NO: 6 and 21 or variants thereof which have at least 85% sequence identity to SEQ ID NO: 6 and 21 ; and/or.

(iii) comprise or consist of sequences as set forth in SEQ ID NO: 6 and at least one of SEQ ID NO: 21-23 or variants thereof which have at least 85% sequence identity to SEQ ID NO: 6 or 21-23 .

24. A method for typing an HLA-DQB1 and an HLA-DRB1 gene comprising:

(i) selectively amplifying nucleic acid molecules from a sample obtained from a subject using a first primer set comprising a first primer which targets a sequence upstream of the 5’ UTR of the HLA-DQB1 gene;

(ii) selectively amplifying nucleic acid molecules from a sample obtained from the subject using a second primer set comprising at least one first primer which comprises or consists of SEQ ID NO: 5 or 6 or a variant which has at least 85% sequence identity to SEQ ID NO: 5 or 6 ;

(iii) performing a sequencing read of at least part of an amplicon generated using the first primer set and the second primer set; and

(iv) determining the HLA-DQB1 and HLA-DRB1 types of the subject based on the sequencing reads.

25. The method according to claim 24, wherein the method further comprises typing an HLA-DPB1 gene comprising:

(i’) selectively amplifying a further nucleic acid molecule in the same reaction as claim 24, step (i) using a third primer set, preferably wherein amplification between primers of the third primer set generates a whole gene amplicon of a HLA-DPB1 gene; optionally wherein one or two further amplification are performed in the same reaction using primer sets comprising primers which generate a whole gene amplicon of a HLA-DQA1 gene and/or a HLA-DPA1 gene (ii’) performing a sequencing read of at least part of an amplicon generated using the third primer set, optionally performing sequencing reads of at least part of the amplicon generated by the further primers sets;

(iii’) determining the HLA-DPB1 type of the subject based on the sequencing read; optionally further determining the HLA-DQA1 and/or HLA-DPA1 type of the subject.

26. The method according to claim 24 or 25 wherein the HLA-DQB1 typing is performed according to any of claims 1 to 4.

27. The method according to any of claims 24 to 26 wherein the HLA-DRB1 typing is performed according to any of claims 10 to 23.

28. The method according to claim 25 wherein the HLA-DPB1 typing is performed according to any of claims 6 to 8.

29. A method according to any preceding claim which further comprises typing at least one additional HLA gene in the subject.

30. The method according to claim 29 wherein the HLA gene is selected from one or more of HLA-A, HLA-B, HLA-C, HLA-DQA1 , HLA-DPA1 , HLA-DPB1 , HLA-DRB3, HLA-DRB4 and/or HLA-DRB5.

31. The method according to claim 30 wherein each of HLA-A, HLA-B, HLA-C, HLA-DQA1 , HLA-DPA1 , HLA-DPB1 , HLA-DRB3, HLA-DRB4 and HLA-DRB5 is typed.

32. The method according to any of claims 29 to 31 wherein a nucleic acid molecule comprising an HLA-C gene is selectively amplified in a sample from the subject using primers which comprise or consist of SEQ ID NO: 40 and 30 or a variant which has at least 85% sequence identity to SEQ ID NO: 40 or 30.

33. The method according to any of claims 29 to 32 wherein a nucleic acid molecule comprising an HLA-A gene is selectively amplified in a sample from the subject using primers which comprise or consist of SEQ ID NO: 31-33 or a variant which has at least 85% sequence identity to SEQ ID NO: 31-33.

34. The method according to any of claims 29 to 33 wherein a nucleic acid molecule comprising an HLA-B gene is selectively amplified in a sample from the subject using primers which comprise or consist of SEQ ID NO: 34 and 35 or a variant which has at least 85% sequence identity to SEQ ID NO: 34 or 35; or using primers which comprise or consist of SEQ ID NO: 34 and 47 or a variant which has at least 85% sequence identity to SEQ ID NO: 34 or 47.

35. The method according to any of claims 29 to 34 wherein the HLA-C and HLA-A and/or HLA-B amplifications are performed in the same reaction.

36. The method of claim 35 wherein the HLA-A, HLA-B and HLA-C amplification are performed in the same reaction.

37. The method according to any of claims 29 to 36 wherein a nucleic acid molecule comprising an HLA-DQA1 gene is selectively amplified in a sample from the subject using primers which comprise or consist of SEQ ID NO: 36 and 37 or a variant which has at least 85% sequence identity to SEQ ID NO: 36 or 37.

38. The method according to any of claims 29 to 37 wherein a nucleic acid molecule comprising an HLA-DPA1 gene is selectively amplified in a sample from the subject using primers which comprise or consist of SEQ ID NO: 38 and 39 or a variant which has at least 85% sequence identity to SEQ ID NO: 38 or 39.

39. The method according to any of claims 29 to 38 wherein the HLA-DQA1 and HLA- DPA1 amplifications are performed in the same reaction, preferably wherein the HLA-DQA1 , HLA-DPA1 , HLA-DQB1 and HLA-DPB1 amplifications are performed in the same reaction.

40. The method according to any of claims 29 to 39 wherein; a) a nucleic acid molecule comprising an HLA-DRB3 gene is selectively amplified in a sample from the subject using primers which comprise or consist of SEQ ID NO: 41 and 42 or a variant which has at least 85% sequence identity to SEQ ID NO: 41 or 42; or preferably using primers which comprise or consist of SEQ ID NO: 48 and 49 or a variant which has at least 85% sequence identity to SEQ ID NO: 48 or 49; b) a nucleic acid molecule comprising an HLA-DRB4 gene is selectively amplified in a sample from the subject using primers which comprise or consist of SEQ ID NO: 43 and 44 or a variant which has at least 85% sequence identity to SEQ ID NO: 43 or 44 and/or c) a nucleic acid molecule comprising an HLA-DRB5 gene is selectively amplified in a sample from the subject using primers which comprise or consist of SEQ ID NO: 45 and 46 or a variant which has at least 85% sequence identity to SEQ ID NO: 45 or 46.

41 . A method for typing an HLA-DRB3 gene comprising

(A) selectively amplifying a nucleic acid molecule from a sample obtained from a subject using a primer set comprising a first primer which comprises or consists of a sequence as set forth in SEQ ID NO: 41 or a variant thereof which has at least 85% sequence identity to SEQ ID NO: 41 and a second primer which comprises or consists of a sequence as set forth in SEQ ID NO: 42 or a variant thereof which has at least 85% sequence identity to SEQ ID NO: 42; or preferably using primers which comprise or consist of SEQ ID NO: 48 and 49 or a variant which has at least 85% sequence identity to SEQ ID NO: 48 or 49

(C) determining the HLA-DRB3 type of the subject based on the sequencing read.

42. A method for typing an HLA-DRB4 gene comprising

(A) selectively amplifying a nucleic acid molecule from a sample obtained from a subject using a primer set comprising a first primer which comprises or consists of a sequence as set forth in SEQ ID NO: 43 or a variant thereof which has at least 85% sequence identity to SEQ ID NO: 43 and a second primer which comprises or consists of a sequence as set forth in SEQ ID NO: 44 or a variant thereof which has at least 85% sequence identity to SEQ ID NO: 44;

(C) determining the HLA-DRB4 type of the subject based on the sequencing read.

43. A method for typing an HLA-DRB5 gene comprising

(A) selectively amplifying a nucleic acid molecule from a sample obtained from a subject using a primer set comprising a first primer which comprises or consists of a sequence as set forth in SEQ ID NO: 45 or a variant thereof which has at least 85% sequence identity to SEQ ID NO: 45 and a second primer which comprises or consists of a sequence as set forth in SEQ ID NO: 46 or a variant thereof which has at least 85% sequence identity to SEQ ID NO: 46;

(C) determining the HLA-DRB5 type of the subject based on the sequencing read.

44. A method for typing an HLA-B gene comprising

(A) selectively amplifying a nucleic acid molecule from a sample obtained from a subject using a primer set comprising a first primer which comprises or consists of a sequence as set forth in SEQ ID NO: 34 or a variant thereof which has at least 85% sequence identity to SEQ ID NO: 34 and a second primer which comprises or consists of a sequence as set forth in SEQ ID NO: 47 or a variant thereof which has at least 85% sequence identity to SEQ ID NO: 47

(C) determining the HLA-B type of the subject based on the sequencing read.

45. The method according to any preceding claim wherein the sequencing is long-read sequencing.

46. The method according to any preceding claim wherein an amplicon of essentially the entire HLA gene is generated by amplification of the nucleic acid molecule.

47. The method according to claim 46 wherein the amplicon is generated using a primer set which comprises a primer which targets the 5’ UTR of the HLA gene and a primer which targets the 3’ UTR of the HLA gene.

48. An isolated polynucleotide which is complementary to a sequence from 2323 to 8000 base pairs upstream of the 5’ UTR of the HLA-DQB1 gene, preferably wherein the isolated polynucleotide is complementary to a sequence from 2350 to 5000, 2350 to 4000, 2500 to 4000, or 2500 to 3500 base pairs upstream of the 5’ UTR of the HLA-DQB1 gene.

49. An isolated polynucleotide according to claim 48 which comprises SEQ ID NO: 1 or a variant which has at least 85% identity to SEQ ID NO: 1.

50. An isolated polynucleotide comprising SEQ ID NO: 5 or 6 or a variant which has at least 85% identity to SEQ ID NO: 5 or 6.

51. An isolated polynucleotide comprising SEQ ID NO: 40 or 30 or a variant which has at least 85% identity to SEQ ID NO: 40 or 30.

52. An isolated polynucleotide comprising any one of SEQ ID NO: 41-46 or 48-49 or a variant which has at least 85% identity to one of SEQ ID NO: 41-46 or 48-49.

53. An isolated polynucleotide comprising SEQ ID NO: 34 or 47 or a variant which has at least 85% identity to SEQ ID NO: 34 or 47.

54. An isolated polynucleotide according to any of claims 48 to 53 which comprises 35 or fewer nucleotides.

55. A kit comprising a first isolated polynucleotide which is complementary to a sequence from 2323 to 8000 base pairs upstream of the 5’ UTR of the HLA-DQB1 gene, preferably wherein the isolated polynucleotide is complementary to a sequence from 2350 to 5000, 2350 to 4000, 2500 to 4000, or 2500 to 3500 base pairs upstream of the 5’ UTR of the HLA-DQB1 gene, and at least one further isolated polynucleotide which is a primer as defined in claim 3 or 4.

56. A kit according to claim 55 wherein the first isolated polynucleotide comprises SEQ ID NO: 1 or a variant which has at least 85% identity to SEQ ID NO: 1.

57. A kit according to claim 55 or 56 which comprises at least two further isolated polynucleotides which are a third or fourth primer as defined in any of claims 5 to 8.

58. A kit comprising isolated oligonucleotides which comprise or consist of SEQ ID NO: 5 and 6 or a variant which has at least 85% sequence identity to SEQ ID NO: 5 or 6.

59. A kit comprising at least one first isolated oligonucleotide which comprises or consists of SEQ ID NO: 5 or 6 or a variant which has at least 85% sequence identity to SEQ ID NO: 5 or 6; and at least one further isolated oligonucleotide which is a primer as defined in any of claims 12 to 17 or 19 to 23.

60. A kit comprising: (a) a first isolated polynucleotide which is complementary to a sequence from 2323 to 8000 base pairs upstream of the 5’ UTR of the HLA-DQB1 gene, preferably wherein the isolated polynucleotide is complementary to a sequence from 2350 to 5000, 2350 to 4000, 2500 to 4000, or 2500 to 3500 base pairs upstream of the 5’ UTR of the HLA-DQB1 gene; (b) at least two further isolated polynucleotides which are a third or fourth primer as defined in any of claims 5 to 8; and (c) one or more further isolated polynucleotide(s) which comprise or consist of SEQ ID NO: 5 and/or 6 or a variant which has at least 85% sequence identity to SEQ ID NO: 5 or 6.

61. A kit according to claim 60 which further comprises at least one further isolated oligonucleotide which is a primer as defined in any of claims 12 to 17 or 19 to 23.

62. A kit according to any of claims 55 to 61 which comprises at least two further isolated oligonucleotides which provide an additional primer set for amplifying at least one additional HLA gene.

63. A kit according to claim 62 wherein the additional primer set is suitable for amplifying an HLA gene selected from one or more of HLA-A, HLA-B, HLA-C, HLA-DQA1 , HLA-DPA1,

HLA-DRB3, HLA-DRB4 and/or HLA-DRB5.

64. A kit according to claim 63 which comprises further isolated pairs of oligonucleotides which provide primer sets suitable for amplifying each of HLA-A, HLA-B, HLA-C, HLA-DQA1, HLA-DPA1, HLA-DRB3, HLA-DRB4 and HLA-DRB5.

65. A kit according to any of claims 62 to 64, wherein the additional primer sets are primers as defined in any of claims 32-34, 37, 38 or 41-43.