WO2023158214A1 - Composition for preventing or treating sarcopenia by using insulin-like growth factor-1 isoform - Google Patents

Composition for preventing or treating sarcopenia by using insulin-like growth factor-1 isoform Download PDF

Info

Publication number
WO2023158214A1
WO2023158214A1 PCT/KR2023/002208 KR2023002208W WO2023158214A1 WO 2023158214 A1 WO2023158214 A1 WO 2023158214A1 KR 2023002208 W KR2023002208 W KR 2023002208W WO 2023158214 A1 WO2023158214 A1 WO 2023158214A1
Authority
WO
WIPO (PCT)
Prior art keywords
igf
seq
isoform
muscle
ptx
Prior art date
Application number
PCT/KR2023/002208
Other languages
French (fr)
Korean (ko)
Inventor
이정훈
고경량
이나연
김소진
이재만
Original Assignee
주식회사 헬릭스미스
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 헬릭스미스 filed Critical 주식회사 헬릭스미스
Publication of WO2023158214A1 publication Critical patent/WO2023158214A1/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/22—Hormones
    • A61K38/30—Insulin-like growth factors, i.e. somatomedins, e.g. IGF-1, IGF-2
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575—Hormones
    • C07K14/65—Insulin-like growth factors, i.e. somatomedins, e.g. IGF-1, IGF-2

Definitions

  • the present invention is for preventing or treating sarcopenia comprising, as an active ingredient, an isoform of insulin-like growth factor-1 (IGF-1) or a polynucleotide encoding the isoform. It relates to pharmaceutical compositions.
  • IGF-1 insulin-like growth factor-1
  • Sarcopenia is defined as a decrease in muscle mass and a decrease in muscle strength accompanying age ( The Korean Journal of Medicine 83(4):444-454, 2012). Recent studies have shown that sarcopenia is not a simple condition caused by nutritional deficiency or a sedentary lifestyle, but is caused by a complex multipathway pathogenesis ( Endocrinol Metab 35:716-732, 2020 ). Sarcopenia ranges from mild symptoms such as muscle weakness, lower extremity weakness, and tiredness to conditions in which daily life is difficult depending on the cause. Therefore, it may be possible to recover to some extent through simple strength training, aerobic exercise, or nutritional supplementation, but appropriate treatment is required depending on the degree of symptoms.
  • sarcopenia Currently, resistance exercise and supplementation of protein and vitamin D are established as basic treatments for sarcopenia. Pharmacological intervention for the treatment of sarcopenia includes administration of high doses of testosterone to increase muscle strength and function, but treatment is limited due to side effects.
  • Drugs in clinical development for the treatment of sarcopenia include growth hormone, selective androgen receptor modulators (SARMS), ghrelin agonists, myostatin antibodies, and activin 11R antagonists. , activin 11R antagonist), angiotensin converting enzyme inhibitor (myostatin angiotensin converting enzyme inhibitor, ACE inhibitor, perindopril), fast skeletal muscle troponin activator (Tirasemtiv), B 1 /B 2 adrenergic receptor antagonist (B 1 /B 2 adrenergic receptor antagonist, Espindolol) ( Calcif Tissue Int. 2016 Apr;98(4):319-33; and Journal of Korean Academy of Geriatric Rehabilitation Medicine 2017; 7: 52-58.).
  • SARMS selective androgen receptor modulators
  • ghrelin agonists myostatin antibodies
  • activin 11R antagonists activin 11R antagonist
  • angiotensin converting enzyme inhibitor myostatin angiotensin converting enzyme inhibitor
  • the present inventors have intensively researched to develop a pharmaceutical composition for preventing or treating sarcopenia caused by nerve damage, aging, or the like.
  • IGF-1Ea and IGF-1Ec which are isoforms of IGF-1 (Insulin-Like Growth Factor-1)
  • the present invention was completed by identifying that muscle regeneration markers Pax7, MyoG, and MyoD are increased, and muscle weight and muscle fiber size are increased to promote muscle regeneration.
  • an object of the present invention is an IGF-1Ea isoform and an IGF-1Ec isoform, or a polynucleotide encoding the IGF-1Ea isoform and a polynucleotide encoding the IGF-1Ec isoform as an active ingredient. It is to provide a composition for preventing or treating sarcopenia comprising sarcopenia.
  • Another object of the present invention is i) the polynucleotide sequence of SEQ ID NO: 1 or a degenerate sequence thereof, ii) the polynucleotide sequence of SEQ ID NO: 2 or a fragment thereof, iii) the polynucleotide sequence of SEQ ID NO: 3 or a degenerate sequence thereof, iv ) A polynucleotide sequence of SEQ ID NO: 4 or a fragment thereof, and v) a polynucleotide sequence of SEQ ID NO: 5 or a degenerate sequence thereof sequentially linked in 5' to 3' order.
  • Sarcopenia comprising a single polynucleotide as an active ingredient To provide a pharmaceutical composition for prevention or treatment.
  • the present invention provides a pharmaceutical composition for preventing or treating sarcopenia comprising the following as active ingredients:
  • IGF-1 insulin-Like Growth Factor-1
  • sarcopenia refers to a state in which the weight, quality, and/or function (muscle strength) of muscle is lost or reduced.
  • insulin-like growth factor-1 refers to a protein having a molecular structure similar to that of insulin, also called insulin-like growth factor-1 or somatomedin C.
  • the Igf-1 gene is about 80 kb or more, contains 6 exons, and has 2 selective signal peptides and 3 optional C-terminal E-domains. It exhibits different alternative splicing patterns from its precursor (i.e., produces different isoforms), but eventually produces a single mature IGF-1 protein (Wallis M. New insulin-like growth factor (IGF)-precursor sequences from mammalian genomes: the molecular evolution of IGFs and associated peptides in primates. See Growth Horm IGF Res. 2009 Feb;19(1):12-23.).
  • IGF insulin-like growth factor
  • IGF-1 isoform or IGF-1 isoform refers to IGF-1 naturally produced in animals, including humans, including all allelic variants.
  • IGF-1 isoforms include the endogenous form or wild type of IGF-1, and various variants of IGF-1 (e.g., mRNA variants, splicing variants, post-translational variants). modified variant) has a meaning encompassing all.
  • the IGF-1 isoform of the present invention consists of translational results of exons spliced in different combinations from a primary RNA transcript by alternative splicing of the Igf-1 gene.
  • a pre-pro-peptide, pro-peptide, polypeptide, or polypeptide fragment having at least 80% identity to their amino acid sequence Philippou A, Maridaki M, Halapas A, Koutsilieris M.
  • IGF-1 isoforms of the present invention are translated from IGF-1 mRNA transcripts/variants.
  • the IGF-1 mRNA variants of the present invention are divided into Class I and Class II by using different leader sequences.
  • Class I has its initiation moiety in exon 1 (promoter 1), whereas class II has it in exon 2 (promoter 2), either class I (exon 1 to exon 3) or class II (exon 2 to exon 3).
  • mRNA transcripts differentially splice each of exon 1 and exon 2 to the common exon 3.
  • mRNA transcripts containing exon 5 and not exon 6 are class B, and mRNA transcripts without exon 5 and containing exon 6 are class A.
  • mRNA transcripts containing both exon 5 and exon 6 are class C (Philippou A, Maridaki M, Pneumaticos S, Koutsilieris M. The complexity of the IGF1 gene splicing, posttranslational modification and bioactivity. Mol Med. 2014 May 7; 20(1):202-14.).
  • class I and class A IGF-1 transcripts are exon 1-3-4-6 splice variants
  • class I and class B IGF-1 transcripts are exon 1-3-4-5 splice variants
  • IGF-1 transcripts of class I and class C are exon 1-3-4-5-6 splicing variants
  • IGF-1 transcripts of class II and class A are exon 2-3-4 -6 splicing variant
  • class II and class B IGF-1 transcripts are exons 2-3-4-5 splicing variants
  • class II and class C IGF-1 transcripts are exons 2-3 -4-5-6 splicing variant.
  • the aforementioned IGF-1 transcripts and/or variants encode the IGF-1 isoforms of the present invention.
  • the human IGF-1 isoform is an IGF-1Ea isoform comprising the amino acid sequence of SEQ ID NO: 11, an IGF-1Ec isoform comprising the amino acid sequence of SEQ ID NO: 13, or any of these isoforms. is a combination; or
  • the polynucleotide is a polynucleotide encoding the IGF-1Ea isoform, the IGF-1Ec isoform, or a combination thereof.
  • the human IGF-1 isoform is an IGF-1Ea isoform comprising the amino acid sequence of SEQ ID NO: 11 and an IGF-1Ec isoform comprising the amino acid sequence of SEQ ID NO: 13; or
  • the polynucleotide is a polynucleotide encoding the IGF-1Ea isoform and the IGF-1Ec isoform.
  • the present invention also provides a pharmaceutical composition for preventing or treating sarcopenia comprising the following as active ingredients:
  • an IGF-1Ea isoform comprising the amino acid sequence of SEQ ID NO: 11 and an IGF-1Ec isoform comprising the amino acid sequence of SEQ ID NO: 13; or
  • the IGF-1 isoform of the present invention may be a polypeptide that has undergone posttranslational modification.
  • the posttranslational modification is posttranslational cleavage, N-linked glycosylation, O-linked glycosylation, ubiquitination, SUMOylation, phosphorylation ), or a combination thereof.
  • the 140th asparagine residue of the amino acid sequence of SEQ ID NO: 11 is subjected to N-linked glycosylation.
  • N-linked glycosylation refers to an oligosaccharide composed of several sugar molecules (glycan) at a nitrogen atom such as the amide nitrogen of an asparagine (Asn) residue of a protein. oligosaccharide).
  • the IGF-1 isoform of the present invention is a pro-IGF-1 isoform containing an E-peptide.
  • the pro-IGF-1 isomers include, but are not limited to, pro-IGF-1Ea, glycosylated pro-IGF-1Ea, pro-IGF-1Eb, and pro-IGF-1Ec.
  • the IGF-1 isoform of the present invention is a pre-pro-IGF-1 isoform containing a signal sequence and an E-peptide.
  • the pre-pro-IGF-1 isoform includes pre-pro-IGF-1Ea, glycosylated pre-pro-IGF-1Ea, pre-pro-IGF-1Eb and pre-pro-IGF-1Ec, but is not necessarily limited thereto. it is not going to be
  • SEQ ID NO: 11 of the present invention is class I and class A pre-pro-IGF-1Ea.
  • Amino acids 1 to 48 of SEQ ID NO: 11 are signal peptides composed of 48 amino acids, amino acids 49 to 118 are mature IGF-1 peptides composed of 70 amino acids, and amino acids 119 to 153 are 35 amino acids. It is the composed Ea peptide.
  • SEQ ID NO: 13 of the present invention is pre-pro-IGF-1Ec of class I and class C.
  • Amino acids 1 to 48 of SEQ ID NO: 13 are signal peptides composed of 48 amino acids, amino acids 49 to 118 are mature IGF-1 peptides composed of 70 amino acids, and amino acids 119 to 158 are 40 amino acids. It is composed of EC peptide.
  • the signal peptide is cleaved to form a pro-IGF-1 heteromeric polypeptide.
  • the E-peptide of the pro-IGF-1 isomer is cleaved by a protein convertase such as furin to form a mature IGF-1 protein.
  • E-domains located in exon 4, exon 5 and exon 6 of IGF-1 encode different E-peptides, Ea peptide, Eb peptide and Ec peptide, by different combinations of alternative splicing.
  • 16 amino acids from exon 4 of IGF-1 and 19 amino acids from exon 6 of IGF-1 are translated to form a 35 amino acid Ea peptide.
  • 16 amino acids from exon 4 of IGF-1 and 61 amino acids from exon 5 of IGF-1 after translational cleavage constitute the 77 amino acid Eb peptide.
  • 16 amino acids from exon 4 of IGF-1, 16 amino acids from exon 5 of IGF-1, and 8 amino acids from exon 6 of IGF-1 are translated to form an Ec peptide of 40 amino acids.
  • exon 4 of SEQ ID NO: 1 of the present invention and exons 6-2 of SEQ ID NO: 5 of the present invention encode the Ea peptide of SEQ ID NO: 21 of the present invention. That is, the Ea peptide is translated into 16 amino acids from exon 4 and 19 amino acids from exons 6-2, and consists of a total of 35 amino acids.
  • exon 4 of SEQ ID NO: 1 and exon 5 and exon 6-1 of SEQ ID NO: 3 of the present invention encode the Ec peptide of SEQ ID NO: 22 of the present invention. That is, the Ec peptide is translated into 16 amino acids from exon 4, 16 amino acids from exon 5, and 8 amino acids from exon 6-1, and is composed of a total of 40 amino acids.
  • E-peptides of IGF-1 isoforms are known as regulatory elements that regulate IGF-1 production and secretion (Annibalini G. et al., The intrinsically disordered E-domains regulate the IGF-1 prohormones stability, subcellular localization and secretion Sci Rep. 2018 Jun 11;8(1):8919.).
  • E peptide activates and proliferates quiescent satellite cells, thereby providing a niche for myogenic precursor cells (MPC) and helping muscle recovery.
  • MPC myogenic precursor cells
  • Hill M Goldspink G. Expression and splicing of the insulin-like growth factor gene in rodent muscle is associated with muscle satellite (stem) cell activation following local tissue damage. J Physiol. 2003 Jun 1;549(Pt 2): 409-18., and Vassilakos G, Philippou A, Tsakiroglou P, Koutsilieris M. Biological activity of the e domain of the IGF-1Ec as addressed by synthetic peptides. Hormones (Athens). 2014 Apr-Jun;13(2): 182-96.).
  • tellite cell refers to a multipotent stem cell located between a basement membrane and a plasma membrane, generally at the end of a muscle fiber.
  • quiescent satellite cells When quiescent satellite cells are activated, they proliferate and fuse into muscle fibers. Activation of satellite cells is accompanied by changes in the expression of adhesion molecules such as M-cadherin, followed by transcription of myogenic factors such as MyoD.
  • Deficiencies of active satellite cells and myogenic factors have been associated with muscular dystrophy, and the reduced regenerative ability of aged muscle is also considered to be due to a reduced ability to activate satellite cell proliferation.
  • low IGF-1Ec expression in muscle response to mechanical loading is associated with failure to activate satellite cells, and is known to result in age-related muscle loss.
  • a human IGF-1 (Insulin-Like Growth Factor-1) isoform; or (b) when using a pharmaceutical composition for preventing or treating sarcopenia comprising a polynucleotide encoding at least one human IGF-1 isoform as an active ingredient, not only the mature IGF-1 protein but also the E peptide together Since it can express a single mature IGF-1 protein or a single type of IGF-1 isoform, it has an improved preventive or therapeutic effect on sarcopenia due to various causes such as aging and nerve damage than conventional gene delivery systems designed to express only a single mature IGF-1 protein or a single type of IGF-1 isoform. can exert a pharmaceutical composition for preventing or treating sarcopenia comprising a polynucleotide encoding at least one human IGF-1 isoform as an active ingredient, not only the mature IGF-1 protein but also the E peptide together Since it can express a single mature IGF-1 protein or a single type of IGF-1
  • the expression of the present invention “comprising as an active ingredient” means (a) an IGF-1Ea isomer comprising the amino acid sequence of SEQ ID NO: 11 and an IGF-1Ec isomer comprising the amino acid sequence of SEQ ID NO: 13; or (b) an amount sufficient to achieve pharmacological efficacy or activity of the polynucleotide encoding the IGF-1Ea isoform and the polynucleotide encoding the IGF-1Ec isoform, delivery of a drug; It means that various components can be additionally added for stabilization and formulation.
  • prevention refers to preventive or protective treatment of a disease or disease state.
  • treatment refers to reduction, suppression, sedation or eradication of a disease state.
  • the pharmaceutical composition of the present invention may further include a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable carrier is commonly used in the art to which the present invention pertains, and the active ingredient of the present invention (a) an IGF-1Ea isomer comprising the amino acid sequence of SEQ ID NO: 11 and an IGF-1Ec isoform comprising the amino acid sequence of SEQ ID NO: 13; or (b) is pharmacologically compatible with the polynucleotide encoding the IGF-1Ea isoform and the polynucleotide encoding the IGF-1Ec isoform.
  • Pharmaceutically acceptable carriers of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose , water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, and the like, but are not limited thereto.
  • the pharmaceutical composition of the present invention may further include excipients, stabilizers, diluents, lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, and the like, in addition to the above components.
  • excipients stabilizers, diluents, lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, and the like.
  • Suitable pharmaceutically acceptable carriers, vehicles, excipients, stabilizers or diluents are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).
  • composition of the present invention can be administered orally or parenterally, and in the case of parenteral administration, intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, percutaneous injection ), intracerebral injection, intraspinal injection, etc.
  • the suitable dosage of the pharmaceutical composition of the present invention varies depending on factors such as formulation method, administration method, patient's age, weight, sex, medical condition, food, administration time, administration route, excretion rate and reaction sensitivity, A ordinarily skilled physician can readily determine and prescribe dosages effective for the desired treatment or prophylaxis.
  • the dosage of the pharmaceutical composition of the present invention is preferably 0.0001-100 mg/kg (body weight) per day.
  • the pharmaceutical composition of the present invention is prepared in unit dosage form by formulation using a pharmaceutically acceptable carrier and/or excipient according to a method that can be easily performed by those skilled in the art. or it may be prepared by incorporating into a multi-dose container.
  • the formulation may be in the form of a solution, suspension or emulsion in an oil or aqueous medium, or may be in the form of an extract, powder, granule, tablet or capsule, and may additionally contain a dispersing agent or stabilizer.
  • the polynucleotide encoding the IGF-1Ea isoform includes the nucleotide sequence of SEQ ID NO: 12.
  • the polynucleotide encoding the IGF-1Ec isoform includes the nucleotide sequence of SEQ ID NO: 14.
  • the IGF-1Ea isoform and the IGF-1Ec isoform are encoded by separate nucleotide sequences.
  • the IGF-1Ea isoform and the IGF-1Ec isoform are encoded by a single nucleotide sequence.
  • the pharmaceutical composition of the present invention includes two or more polynucleotides when the two isoforms of different types of IGF-1 are encoded by separate polynucleotides, and the two isoforms of different types of IGF-1 are encoded by separate polynucleotides.
  • When encoded by a single polynucleotide it includes one or more polynucleotides including the single polynucleotide.
  • a polynucleotide of the invention may be operably linked to one or more regulatory sequences (eg, a promoter and/or enhancer) that control expression of IGF-1 isoforms.
  • expression cassettes can be constructed in two ways.
  • an expression cassette is constructed by linking an expression control sequence to a coding sequence (CDS) for each isoform.
  • CDS coding sequence
  • expression cassettes are constructed using IRES or 2A peptides in sequence.
  • the IRES sequence is located between the CDS of two different IGF-1 isoforms, allowing the expression of both protein products from a single transcript, more specifically by allowing translation of a gene to begin at the IRES sequence, More than one gene of interest is allowed to be expressed from the same construct.
  • the polynucleotide encoding both of the two or more different types of isoforms can operate on a single expression control sequence.
  • the present invention provides i) the nucleotide sequence of SEQ ID NO: 1 or a degenerate sequence thereof; ii) the nucleotide sequence of SEQ ID NO: 2 or a fragment thereof; iii) the nucleotide sequence of SEQ ID NO: 3 or a degenerate sequence thereof; iv) the nucleotide sequence of SEQ ID NO: 4 or a fragment thereof; and v) a pharmaceutical composition for preventing or treating sarcopenia comprising, as an active ingredient, a single polynucleotide in which the nucleotide sequence of SEQ ID NO: 5 or a degenerate sequence thereof is sequentially linked in 5' to 3' order.
  • the nucleotide sequence of i) is a nucleotide sequence encoding exons 1, 3 and 4 of IGF-1, the nucleotide sequence of ii) is intron 4 of IGF-1, and the nucleotide sequence of iii)
  • the nucleotide sequence of ) is a nucleotide sequence encoding exons 5 and 6-1 of IGF-1, the nucleotide sequence of iv) is intron 5 of IGF-1, and the nucleotide sequence of v) is exon 6 of IGF-1 is the nucleotide sequence encoding -2.
  • the present inventors constructed a single nucleotide sequence capable of simultaneously expressing two different types of IGF-1 isoforms by designing the nucleotide sequence in the above order.
  • the single polynucleotide sequence includes nucleotides encoding a signal peptide and a mature IGF-1 peptide, which are identically included by IGF-1Ea and IGF-1Ec isoforms, and are differentially included by IGF-1Ea and IGF-1Ec isoforms. Includes all nucleotides that encode the peptide.
  • intron 5 between the nucleotides encoding the E peptides that differentially comprise, i.e., between exon 6-1 and exon 6-2 of the present invention, according to alternative splicing, different polynucleotides from a single polynucleotide can be obtained. It can express IGF-1 isoforms, IGF-1Ea and IGF-Ec.
  • the single nucleotide When the single nucleotide is spliced into a combination of exons 1, 3, 4, and 6-2 of IGF-1, the Ea peptide is expressed, and thus the IGF-1Ea isoform is expressed.
  • the Ec peptide When the single nucleotide is spliced into a combination of exons 1, 3, 4, 5, and 6-1 of IGF-1, the Ec peptide is expressed, and thus the IGF-1Ec isoform is expressed.
  • degenerate sequence refers to a nucleotide sequence that can be translated to provide an amino acid sequence identical to that translated from a reference nucleotide sequence.
  • IGF-1 isoforms can be encoded by a plasmid DNA construct that simultaneously expresses two or more isoforms of different types, such as IGF-1Ea and IGF-1Ec. .
  • the fragment of the nucleotide sequence of ii) is the nucleotide sequence of SEQ ID NO: 6.
  • the fragment of the nucleotide sequence of ii) is the nucleotide sequence of SEQ ID NO: 7.
  • the fragment of the nucleotide sequence of iv) is the nucleotide sequence of SEQ ID NO: 8.
  • the polynucleotide according to the present invention is naked DNA or contained in a gene carrier.
  • the gene carrier is a vector.
  • the vector is a plasmid.
  • the vector is a viral vector.
  • the plasmid is pCK, pCP, pVAXl, pCY, or pTx.
  • Plasmid DNA capable of expressing both IGF-1Ea and IGF-1Ec was constructed using pCK or pTx vectors, details of which are described in Korean Patent Publication Nos. 10-2021-0025122 and 10-2021-0052443. Reference is made to the contents, the entire contents of which are incorporated herein by reference.
  • the plasmid is pCK.
  • the pCK of the present invention is a plasmid vector of SEQ ID NO: 15. Details of the pCK are described in WO 2000/040737 and Lee et al. , Biochem. Biophys. Res. Comm. 272:230-235 (2000). Briefly, E. coli transformed with pCK (ToplO-pCK) was deposited with the Korean Microorganism Conservation Center (KCCM) on March 21, 2003 under the Budapest Treaty (accession number: KCCM-10476). WO 2000/040737 and Lee et al. , Biochem. Biophys. Res. Commun.
  • the pCK vector is such that expression of genes, eg, IGF-1Ea and IGF-1Ec genes, is controlled under the enhancer/promoter of human cytomegalovirus (HCMV). is produced
  • HCMV human cytomegalovirus
  • the nucleotide sequences encoding the IGF-1Ea isoform and the IGF-1Ec isoform are cloned into a pCK plasmid.
  • the plasmid is pTx. Details of the pTx can be referred to Korean Patent Publication Nos. 10-2021-0025122 (published on March 08, 2021) and 10-2021-0052443 (published on May 10, 2021). More specifically, the plasmid pTx is a plasmid vector of SEQ ID NO: 16 derived from pCK. The pTx is generated by twice consecutive mutagenesis of pCK. Defective mutagenesis PCR was performed to remove unnecessary sequences between the kanamycin resistance gene of pCK and ColEl.
  • the IGF-1Ea isoform and the IGF-1Ec isoform are cloned into a pTx plasmid composed of SEQ ID NO: 16.
  • cloning can be performed by ligation of IGF-1Ea and/or IGF-1Ec from pTx cleaved 5' with Cla I enzyme and 3' with Sal 1 enzyme.
  • the polynucleotide of the present invention may be naked DNA or included in a gene carrier.
  • the polynucleotide is a single or separate polynucleotide.
  • the polynucleotide encoding the IGF-1Ea isomer, which is the active ingredient of the present invention, and the polynucleotide encoding the IGF-1Ec isomer are a single polynucleotide.
  • the single polynucleotide includes a single polynucleotide of SEQ ID NO: 9.
  • the single polynucleotide includes a single polynucleotide of SEQ ID NO: 10.
  • the active ingredient of the present invention is a plasmid DNA expressing IGF-1, which includes the pTx vector of SEQ ID NO: 16 and the nucleotide sequence of SEQ ID NO: 9 cloned into the pTx vector.
  • the active ingredient of the present invention is a plasmid DNA expressing IGF-1, which includes the pTx vector of SEQ ID NO: 16 and the nucleotide sequence of SEQ ID NO: 10 cloned into the pTx vector.
  • IGF-1-X series refers to class I IGF-1Ea (i.e., IGF1-1Ea) and class I IGF-1Ec (i.e., IGF1-1Ec) through alternative splicing of RNA transcripts. It refers to a plasmid designed to simultaneously express two isoforms. For example, there are IGF-1-X6 composed of SEQ ID NO: 9, IGF-1-X10 composed of SEQ ID NO: 10, and the like.
  • the active ingredient of the present invention is a plasmid DNA expressing IGF-1, which includes the nucleotide sequence of SEQ ID NO: 17 (pTx-IGF-1-X10).
  • the active ingredient of the present invention is a plasmid DNA expressing IGF-1, which includes the nucleotide sequence of SEQ ID NO: 19 (pTx-IGF-1-X6).
  • the active ingredient of the present invention is a plasmid DNA expressing IGF-1, which includes the pCK vector of SEQ ID NO: 15 and the nucleotide sequence of SEQ ID NO: 9 cloned into the pCK vector. .
  • the active ingredient of the present invention is a plasmid DNA expressing IGF-1, which includes the pCK vector of SEQ ID NO: 15 and the nucleotide sequence of SEQ ID NO: 10 cloned into the pCK vector. .
  • a person skilled in the art can express the IGF-1-X series by appropriately selecting the multiple cloning site (MCS) of the pTx vector and the pCK vector, that is, the restriction enzyme site, or by changing some of the nucleotide sequences of the MCS as necessary.
  • MCS multiple cloning site
  • a plasmid can be constructed for For example, SEQ ID NO: 18 and SEQ ID NO: 20 are IGF-1 isoform expression plasmids prepared by appropriately selecting or altering the MCS region of the pCK vector of SEQ ID NO: 15.
  • ggtacc gagctcggat ccactagtcc agtgtggtgg aattctgcag is the MCS region sequence of the pCK vector, and its restriction enzyme site is appropriately selected or some base sequences are selected.
  • nucleotide sequence encoding IGF-1-X6 between atcgat which is bases 1575 to 1580 in the nucleotide sequence of pCK-IGF-1-X6 shown in SEQ ID NO: 20, and gtcgac, which is bases 2514 to 2518 in the sequence, is inserted
  • aag cttatcgatt gaattccccg gggatcccga tcggtcgacc tcgagtctag agggcccgtt taaa c which are bases 1148 to 1215 in the nucleotide sequence of the pTx vector shown in SEQ ID NO: 16, is the MCS region sequence of the pTx vector, and as described above, the restriction enzyme site thereof is appropriately selected. It will be apparent to those skilled in the art that a plasmid for expressing the IGF-1-X series having a partially altered MCS sequence can be constructed by appropriately altering the nucleotide sequence or partially altering the nucleotide sequence.
  • the active ingredient of the present invention is a plasmid DNA expressing IGF-1, which includes the nucleotide sequence of SEQ ID NO: 18 (pCK-IGF-1-X10).
  • the active ingredient of the present invention is a plasmid DNA expressing IGF-1, which includes the nucleotide sequence of SEQ ID NO: 20 (pCK-IGF-1-X6).
  • the viral vector is exemplified by a retrovirus vector, a lentivirus vector, an adenovirus vector, an adeno-associated virus (AAV) vector, a vaccinia virus vector, a herpes simplex virus vector, etc., but is limited thereto It is not necessary, and each commercially available product can be used.
  • the adenovirus vectors have 42 different serotypes and subgroups A-F.
  • adenovirus type 5 belonging to subgroup C may be used as the adenovirus vector, but is not limited thereto. Biochemical and genetic information about adenovirus type 5 is well known. Foreign genes carried by adenovirus are replicated in the same way as episomes, and thus have very low genetic toxicity to host cells. Therefore, gene therapy using the adenoviral gene delivery system is considered to be safe.
  • the viral vector is an adeno-associated virus (AAV) vector.
  • Adeno-associated virus (AAV) vectors are suitable for the gene delivery system of the present invention because they can infect non-dividing cells and have the ability to infect various types of cells. Detailed descriptions of the production and use of AAV vectors are disclosed in detail in US Pat. Nos. 5,139,941 and 4,797,368.
  • an AAV virus is a plasmid containing a target gene sequence flanked by two AAV terminal repeats (McLaughlin et al., J. Virol., 62:1963-1973 (1988); and Samulski et al., J. Virol., 63:3822-3828 (1989)) and an expression plasmid containing wild-type AAV coding sequence without end repeats (McCarty et al., J. Virol., 65:2936-2945 (1991)). It is prepared by transfection.
  • the AAV vector may be used to transfer a foreign gene sequence into cells according to various viral infection methods known in the art, and the method is not particularly limited.
  • the AAV vector of the present invention has an AAV serotype selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15 and AAV16.
  • the AAV may be selected from the group consisting of serotypes AAV1, AAV2, AAV5, and AAV6.
  • the foreign gene sequence can be transferred into cells according to various viral infection methods known in the art, and the method is not particularly limited.
  • the polynucleotide sequence of the present invention can be transformed into an appropriate host cell, for example, a mammalian cell such as 293T or an insect cell, using the above-described AAV vector, and the transformed host
  • an appropriate host cell for example, a mammalian cell such as 293T or an insect cell
  • the DNA of the gene of the present invention can be copied in large quantities or proteins can be mass-produced using cells.
  • sarcopenia of the present invention is malnutrition, aging, immobility, muscle injury, nerve injury, spinal cord injury It may be caused by spinal cord injury, cancer, stroke, or cachexia, but is not necessarily limited thereto. In a specific embodiment of the present invention, the sarcopenia of the present invention is caused by muscle damage, nerve damage, or aging.
  • malnutrition is a condition that occurs when energy consumed is higher than that consumed or absorbed, primary malnutrition due to insufficient nutritional supply and acute or chronic disease despite sufficient nutritional supply It means to include all secondary malnutrition caused by deficiency.
  • aging refers to a process in which the structure and function of the body gradually deteriorate with age and the susceptibility to disease and death rapidly increases while deteriorating.
  • immobility refers to a state in which movement of a living body is reduced or a state in which there is no movement is maintained. This immobility can degrade or degenerate the functions of the nervous system, muscles, skeletal system, and internal organs. More specifically, immobility can lead to loss of muscle strength.
  • muscle injury refers to a strain caused by a direct impact applied to a muscle from the outside or stretched by pulling a muscle by an external force in the opposite direction to the contracting muscle and ruptures in which the muscle loses continuity. Muscle damage can be caused by excessive physical activity, shock caused by it, or a traffic accident.
  • nerve injury refers to damage to nerve tissue, including peripheral nerves and/or central nerves caused by trauma, traumatic brain injury, motor nerve damage, ischemic brain injury, neonatal hypoxic ischemic brain Including damage to peripheral and central nervous tissue due to injury, epilepsy, etc., in particular, alpha motor neurons, gamma motor neurons, dorsal root ganglion (DRG, dorsal root gaglion), interneuron, primary motor cortex, M1), supplementary motor cortex (SMA), cerebellum, spinal cord, and the like, but are not limited thereto.
  • DDG dorsal root ganglion
  • SMA supplementary motor cortex
  • spinal cord injury refers to damage to the spinal cord that causes temporary or permanent changes in the function of the spinal cord.
  • cancer refers to a general term for diseases accompanied by abnormal cell growth that may infiltrate or spread to other parts of the body.
  • stroke refers to a medical condition in which blood flow to the brain is reduced or stopped to cause cell death.
  • cachexia refers to a complex syndrome associated with an underlying disease and/or condition of a patient that causes persistent muscle loss that is not completely recovered with nutritional supplementation.
  • the underlying disease may include diseases that may cause sarcopenia, such as malnutrition, aging, immobility, muscle damage, nerve damage, spinal cord injury, cancer, stroke, etc., but are not necessarily limited thereto.
  • sarcopenia of the present invention is muscular atrophy (muscular atrophy), myasthenia (myasthenia), muscular dystrophy (muscular dystrophy, muscular dystrophy), myotonia (myotonia), hypotonia (hypotonia), muscle weakness It is selected from the group consisting of (muscular weakness) and inflammatory myopathy (inflammatory myopathy), but is not limited thereto.
  • the sarcopenia of the present invention is selected from the group consisting of muscular dystrophy, myasthenia gravis, and muscular dystrophy.
  • muscle atrophy refers to loss or reduction of muscle tissue.
  • myasthenia refers to a disease in which muscles are weakened due to muscle neurological disorders.
  • the myasthenia of the present invention is myasthenia gravis (myasthenia gravis), but is not necessarily limited thereto.
  • myasthenia gravis is a disease including ocular myasthenia gravis, generalized myasthenia gravis, transient neonatal myasthenia gravis and congenital myasthenia gravis, which is related to acetylcholine receptors in the neuromuscular junction. It refers to an antibody-mediated autoimmune disease in which autoantibodies are formed and signals are not transmitted from nerves to muscles.
  • muscle dystrophy (muscular dystrophy) refers to a general term for diseases that damage or weaken muscles over time.
  • myotonia refers to a symptom of a neurological disease characterized by delayed relaxation or delayed contraction of skeletal muscle after spontaneous contraction or electrical stimulation.
  • hypotonia means a state in which muscle tone is reduced. Hypotonia is usually accompanied by a decrease in muscle strength.
  • muscle weakness refers to a state in which muscle strength is insufficient due to lack of exercise, aging, muscle damage, and the like.
  • inflammatory myopathy refers to a disease characterized by muscle weakness and inflammation and, in some cases, muscle pain. Inflammatory myopathy is idiopathic in most cases.
  • the muscular atrophy of the present invention is spinal muscular atrophy, amyotrophic lateral sclerosis and Charcot-Marie-Tooth disease. It is selected from the group consisting of, but is not limited thereto.
  • spinal muscular atrophy is caused by a mutation in the SNM1 gene encoding the SMN (survival motor neuron) protein, resulting in motor neuron function damage between the spinal cord and the brain stem, resulting in muscle signal refers to a degenerative neurological disease in which
  • ALS amyotrophic lateral sclerosis
  • Lou Gehrig's disease is a progressive loss of motor neurons in the cerebral cortex, brainstem and spinal cord, and voluntary muscle control It means a degenerative neurological disease that leads to loss.
  • Charge-Marie-Tooth disease refers to a hereditary motor and sensory neuropathy of the peripheral nervous system in which gradual loss of body muscle tissue and tactile sensation occurs.
  • the muscular dystrophy of the present invention is Fukuyama congenital muscular dystrophy, Duchenne muscular dystrophy, Becker muscular dystrophy, Steinert's disease 's disease), Limb-girdle muscular dystrophy, Facioscpulohueral dystrophy, pseudohypertrophic type muscular dystrophy, oculopharyngeal muscular dystrophy, myotonic dystrophy ), distal muscular dystrophy, metabolic myopathy, and Emery-Dreifuss muscular dystrophy, but is not limited thereto. Muscular dystrophy of the present invention may be progressive.
  • Fukuyama congenital muscular dystrophy is a congenital muscular dystrophy accompanied by a central nervous system disorder inherited in an autosomal recessive manner, and a disease accompanied by general muscle weakness, brain deformity, and heart abnormality. it means.
  • DMD Duchenne muscular dystrophy
  • Betacker muscular dystrophy refers to myopathy caused by partial loss of the dystrophin gene.
  • Steps disease is a hereditary muscular dystrophy of a common form in adults, also called myotonic dystrophy, which is inherited as an autosomal dominant, smooth muscle, skeletal muscle, central nervous system, heart, eye It means a disease that affects, and it has symptoms that it takes a long time for the muscles that have been contracted once to relax.
  • Limb-girdle muscular dystrophy means a genetic disease showing progressive weakness of the muscles connecting the limbs.
  • facioscpulohueral dystrophy refers to a hereditary disease showing symptoms of asymmetrical muscle weakness or atrophy in the face, shoulder joint, and the like.
  • progenital hypertrophic type muscular dystrophy refers to a disease showing progressive muscle weakness without nerve damage due to an abnormality of the dystrophin gene.
  • oculopharyngeal muscular dystrophy is a dystrophy of the muscles of the eyelids and pharynx, and is a hereditary muscle disease showing symptoms of ptosis, dysarthria, and dysphagia.
  • MDA myotonic dystrophy
  • distal muscular dystrophy refers to the distal muscle, that is, starting from the muscle farther from the center of the body and gradually progressing to the proximal muscle, that is, the muscle closer to the center of the body. It refers to a hereditary muscle disease that manifests weakness.
  • metabolic myopathy refers to a disease that occurs due to congenital enzyme deficiency or mitochondrial abnormality in metabolic processes such as glucose and lipid metabolism, or includes myopathy accompanying endocrine metabolic diseases. do.
  • Emery-Dreifuss muscular dystrophy is a muscular dystrophy accompanied by premature contraction, a disease in which the muscles of the arms, legs, face, neck, and spine gradually deteriorate.
  • the composition of the present invention increases the expression of one or more muscle regeneration related factors selected from the group consisting of Pax7, MyoD, MyoG and phospho-P70S6K.
  • Pax7 (paired box 7) is a human protein encoded by the PAX7 gene, and is a transcription factor that plays an important role in myogenesis by regulating the growth of muscle precursor cells. It refers to a standard biomarker for satellite cells that is specifically expressed in quiescent cells and proliferating satellite cells.
  • MyoD myoblast determination protein 1 or myogenic differentiation 1
  • MyoD refers to a transcription factor that plays an important role in regulating muscle differentiation.
  • MyoD is one of the myogenic regulatory factors (MRFs) and is activated in response to exercise or damage to muscle tissue, although its expression level is extremely low to the point of being undetectable in quiescent satellite cells.
  • MRFs myogenic regulatory factors
  • MyoG Myogenin, myogniec factr 4
  • bHLH basic-helix-loop-helix transcription factor involved in the coordination of skeletal muscle development or myogenesis (myogenesis) and damage repair. it means.
  • Pax7 - MyoD - MyoG are sequentially required in the process of muscle regeneration.
  • the quiescent satellite cells are activated due to damage or the like and begin to proliferate and differentiate into myogenic precursor cells.
  • myogenic progenitor cells differentiate into myocytes, which fuse to form myotubes and mature into myofibers, which are contractile units of skeletal muscle.
  • myogenic regulators are expressed in the order of Pax7, MyoD, and MyoG to mediate the muscle regeneration process (Schmidt M, Schuler SC, Huttner SS, von Eyss B, von Malt leopard J.
  • P70S6K 70-kDa ribosomal portein S6 kinase
  • P70S6K is a cytoplasmic serine / threonine kinase known to regulate protein translation mainly through phosphorylation of the 40S ribosomal protein S6 subunit means P70S6K is required for G1 cell cycle progression and cell growth.
  • phospho-P70S6K or p-P70S6K refers to a form in which multiple serine/threonine residues on P70S6K are phosphorylated by growth factors. do.
  • P70S6K Due to the phosphorylation, P70S6K is activated (Parkington JD, LeBrasseur NK, Siebert AP, Fielding RA. Contraction-mediated mTOR, p70S6k, and ERK1/2 phosphorylation in aged skeletal muscle. J Appl Physiol (1985). 2004 Jul;97( 1):243-8. doi: 10.1152/japlphysiol.01383.2003. See Epub 2004 Mar 19.).
  • eMHC epidermal myosin heavy chain
  • MyHC-emb myosin heavy chain-embryonic
  • the composition of the present invention can promote muscle regeneration and does not increase the expression of eMHC in muscle. That is, the composition of the present invention prevents muscle damage or regenerates damaged muscle. In one embodiment of the present invention, the composition of the present invention increases the weight of muscle tissue or increases the size of muscle fibers.
  • the regeneration process of skeletal muscle is a complex process consisting of many steps.
  • the muscle regeneration process can be divided into several steps: necrosis of damaged muscle cells, activation of muscle stem cells, proliferation of activated muscle stem cells, differentiation of muscle stem cells, maturation and remodeling of newly formed muscle fibers, and these muscle regeneration In almost all stages, infiltrated immune cells such as mast cells and neutrophils play an important role (Yang W, Hu P. Skeletal muscle regeneration is modulated by inflammation. J Orthop Translat . 2018 Feb 7;13:25 See -32.)
  • the composition of the present invention increases the number of infiltrating cells.
  • the composition of the present invention increases the number of regenerating myofibers.
  • the present invention provides a method for treating sarcopenia comprising administering the pharmaceutical composition to a subject.
  • the subject is specifically a mammal.
  • the mammal includes, but is not limited to, mice, rats, dogs, cats, pigs, cows, horses, monkeys, chimpanzees, orangutans, and humans.
  • the method for treating sarcopenia according to another aspect of the present invention is a method in which the above-described pharmaceutical composition is commonly used, description of redundant information is omitted in order to avoid excessive complexity of description in this specification.
  • SEQ ID NO: 1 is the nucleotide sequence of exons 1, 3 and 4 of human IGF-1 (Homo sapiens).
  • SEQ ID NO: 2 is the nucleotide sequence of intron 4 of human IGF-1 (Homo sapiens).
  • SEQ ID NO: 3 is the nucleotide sequence of exon 5 and exon 6-1 of human IGF-1 (Homo sapiens).
  • SEQ ID NO: 4 is the nucleotide sequence of intron 5 of human IGF-1 (Homo sapiens).
  • SEQ ID NO: 5 is the nucleotide sequence of exon 6-2 of human IGF-1 (Homo sapiens).
  • SEQ ID NO: 6 is the nucleotide sequence of intron 4 of human IGF-1 used in IGF-1-X6 (Homo sapiens).
  • SEQ ID NO: 7 is the nucleotide sequence of intron 4 of human IGF-1 used in IGF-1-X10 (Homo sapiens).
  • SEQ ID NO: 8 is the nucleotide sequence of intron 5 of human IGF-1 used in IGF-1-X6 and IGF-1-X10 (Homo sapiens).
  • SEQ ID NO: 9 is the nucleotide sequence of IGF-1-X6 (artificial sequence).
  • SEQ ID NO: 10 is the nucleotide sequence of IGF-1-X10 (artificial sequence).
  • SEQ ID NO: 11 is the amino acid sequence of human class I IGF-1Ea (Homo sapiens).
  • SEQ ID NO: 12 is the nucleotide sequence of human class I IGF-1Ea (Homo sapiens).
  • SEQ ID NO: 13 is the amino acid sequence of human class I IGF-1Ec (Homo sapiens).
  • SEQ ID NO: 14 is the nucleotide sequence of human class I IGF-1Ec (Homo sapiens).
  • SEQ ID NO: 15 is the nucleotide sequence of the pCK vector (artificial sequence).
  • SEQ ID NO: 16 is the nucleotide sequence of the pTx vector (artificial sequence).
  • SEQ ID NO: 17 is the nucleotide sequence of pTx-IGF-1-X10 (artificial sequence).
  • SEQ ID NO: 18 is the nucleotide sequence of pCK-IGF-1-X10 (artificial sequence).
  • SEQ ID NO: 19 is the nucleotide sequence of pTx-IGF-1-X6 (artificial sequence).
  • SEQ ID NO: 20 is the nucleotide sequence of pCK-IGF-1-X6 (artificial sequence).
  • SEQ ID NO: 21 is the amino acid sequence of the Ea peptide of IGF-1 (Homo sapiens).
  • SEQ ID NO: 22 is the amino acid sequence of the Ec peptide of IGF-1 (Homo sapiens).
  • the present invention relates to an insulin-like growth factor (IGF)-1Ea isoform and an IGF-1Ec isoform, or a polynucleotide encoding the IGF-1Ea isoform and a polynucleotide encoding the IGF-1Ec isoform It provides a pharmaceutical composition for preventing or treating sarcopenia containing as an active ingredient.
  • IGF insulin-like growth factor
  • the present invention is i) the polynucleotide sequence of SEQ ID NO: 1, ii) the polynucleotide sequence of SEQ ID NO: 2, iii) the polynucleotide sequence of SEQ ID NO: 3, iv) the polynucleotide sequence of SEQ ID NO: 4 and v) SEQ ID NO:
  • a pharmaceutical composition for preventing or treating sarcopenia comprising, as an active ingredient, a single polynucleotide sequence in which 5 polynucleotide sequences are sequentially linked in 5' to 3' order.
  • the present invention provides a method for treating sarcopenia comprising administering the pharmaceutical composition described above to a subject.
  • the expression of both IGF-1Ea and IGF-1Ec isoforms is increased, which is a muscle regeneration marker compared to the control vector administration group or the mature IGF-1 plasmid administration group. It can increase the expression of Pax7, MyoG, and MyoD, increase muscle weight and muscle fiber size, and promote muscle regeneration, preventing sarcopenia caused by various causes including nerve damage, aging, and cardiotoxin exposure. and can be useful for treatment.
  • FIG. 1A shows schematic structures of transcripts of IGF-1Ea and IGF-1Ec, which are isoforms of human IGF-1, and mature IGF-1.
  • Figure 1b shows the mRNA levels of IGF-1 isoforms after transfection of 293T/17 cells with NC (negative control), pTx-IGF-1Ea, pTx-IGF-1Ec and pTx-IGF-1-X10 plasmids, respectively.
  • Figure 1c shows the protein expression patterns of IGF-1 isoforms and mature IGF-1 confirmed by Western blot after IGF-1 protein was isolated after immunoprecipitation analysis.
  • Figure 1d shows the activation levels of sub-signaling pathways, namely p-AKT(S473) and p-p70S6K, confirmed by western blot after C2C12 cells were treated with pTx vectors, pTx-IGF-1Ea and pTx-IGF-1Ec as negative controls.
  • the protein expression pattern results of pERK and pGSK2a/b (left) and a graph quantifying them (right) are shown.
  • 1E shows a graph obtained by confirming and quantifying the protein expression pattern of p-p70S6K through Western block, in order to compare the activation levels of sub-signaling pathways between pTx-IGF-1-X10 and single isoforms.
  • 1f shows a graph obtained by confirming and quantifying the protein expression pattern of pGSK3 ⁇ through Western block, in order to compare the activation levels of sub-signaling pathways between pTx-IGF-1-X10 and single isoforms.
  • Figure 2 is muscle regeneration markers, Pax7, MyoG, MyoD and phospho-P70S6K proteins confirmed by Western blot when pTx-IGF-1-X10 is administered to a mouse model of sciatic nerve transection caused by permanent motor nerve damage shows the expression pattern.
  • Figure 3 shows the muscle weight (%) of the pTx-administered group and the pTx-IGF-1-X10-administered group in the sarcopenia mouse model.
  • FIG. 4 shows H&E staining photographs showing the number of regenerated muscle fibers in the control vector pTx-administered group and the pTx-IGF-1-X10-administered group in the geriatric sarcopenic disease mouse model.
  • FIG. 5 shows immunofluorescence (IFA) pictures showing the expression patterns of Pax7 and eMHC in the control vector pTx-administered group and the pTx-IGF-1-X10-administered group in the geriatric sarcopenic disease mouse model.
  • IFA immunofluorescence
  • FIG. 6 shows the muscle fiber cross section area (CSA) of the tibialis anterior muscle in the control vector pTx-administered group and the pTx-IGF-1-X10-administered group in the geriatric sarcopenic disease mouse model.
  • CSA muscle fiber cross section area
  • Figure 7 shows the expression patterns of Pax7, MyoD, and MyoG in control vector-administered group (pTx), pTx-IGF-1-X10-administered group, and mature IGF-1-administered group (pTx-Mature IGF1) in mice with cardiotoxin (CTX)-induced muscle damage.
  • FIG. 8 shows the muscle weight (%) of the control vector-administered group (pTx), the pTx-IGF-1-X10-administered group, and the mature IGF-1-administered group (pTx-Mature IGF1) in mice with cardiotoxin-induced muscle damage.
  • % used to indicate the concentration of a particular substance is (weight/weight) % for solids/solids, (weight/volume) % for solids/liquids, and liquid/liquid is (volume/volume) %.
  • the present inventors simultaneously synthesized both class I and class A IGF-1 isoforms, IGF-1Ea, and class I and class C IGF-1 isoforms, IGF-1Ec, through alternative splicing of RNA transcripts using a pTx vector. Plasmids designed to express were constructed and named as pTx-IGF-1-X series.
  • plasmid DNA containing sequences of exons 1, 3, 4, 5, and 6 of the IGF-1 gene and introns or fragments thereof was cloned into the pTx vector, and then cloned into the pTx vector.
  • -IGF-1-X6 or pTx-IGF-1-X10 was named.
  • the plasmid DNA of the pTx-IGF-1-X series was constructed based on pTx as a plasmid and containing an insert operably linked to the pTx expression control sequence.
  • the insert comprises (1) a first nucleotide sequence encoding human IGF-I exons 1, 3 and 4 (SEQ ID NO: 1); (2) the second nucleotide sequence of human IGF-1 intron 4 (SEQ ID NO: 2) or a fragment thereof (SEQ ID NO: 6 or SEQ ID NO: 7); (3) a third nucleotide sequence encoding human IGF-1 exons 5 and 6-1 (SEQ ID NO: 3); (4) the fourth nucleotide sequence of human IGF-1 intron 5 (SEQ ID NO: 4) or a fragment thereof (SEQ ID NO: 8); and (5) concatenating a fifth nucleotide sequence (SEQ ID NO: 5) encoding human IGF-1 exon 6-2, wherein the first nucleotide sequence, the
  • SEQ ID NO: 6 provides the nucleotide sequence of the intron 4 fragment used in the vector pTx-IGF-1-X6
  • SEQ ID NO: 7 provides the nucleotide sequence of the intron 4 fragment used in the vector pTx-IGF-1-X10.
  • SEQ ID NO: 8 provides the nucleotide sequence of the intron 5 fragment used in the vectors pTx-IGF-1-X6 and pTx-IGF-1-X10.
  • IGF-1-X6 composed of the nucleotide sequence of SEQ ID NO: 9
  • pTx-IGF-1-X6 the nucleotide sequence of SEQ ID NO: 16
  • its nucleotide sequence in SEQ ID NO: 19 showed up
  • IGF-1-X10 composed of the nucleotide sequence of SEQ ID NO: 10
  • pTx-IGF-1-X10 pTx-IGF-1-X10
  • its nucleotide sequence is shown in SEQ ID NO: 17.
  • a group treated with the pTx vector consisting of the nucleotide sequence of SEQ ID NO: 16 or a group without any treatment was used as a negative control (NC).
  • NC negative control
  • pTx-IGF-1-X series of the present invention which simultaneously expresses two different isoforms
  • pTx-IGF-1Ea and pTx-IGF-1Ec which respectively express one IGF-1 isoform, are used as positive controls. was used as
  • Figure 1a shows the transcript structures of IGF-1Ea isoforms (top), IGF-1Ec isoforms (middle) and mature IGF1 (bottom).
  • Red box is exon 1 of IGF-1
  • green box is exon 3 of IGF-1
  • orange box is exon 4 of IGF-1
  • light blue box is exon 5 of IGF-1
  • blue box is exon 6 of IGF-1 means
  • mice muscle cell line C2C12 cells Mus musculus (mmu), myoblast, ATCC, CRL-1772 TM ) or 293T / 17 cells ( Homo sapiens (hsa), kidney, epithelial, HEK 293T / 17, ATCC CRL-11268 TM ), a negative control (NC) without any treatment, pTx-IGF-1Ea and pTx-IGF-1Ec expressing one IGF-1 isoform, respectively, and designed to simultaneously express two IGF-1 isoforms.
  • Cells were transfected with the same amount of the pTx-IGF-1-X10 plasmid DNA of the present invention, respectively, and the mRNA transcription level and protein expression pattern of IGF-1 were confirmed. Two days after transfection (i.e., after 48 hours), supernatants of cells and cell culture were obtained.
  • RNA was isolated from the C2C12 cells obtained in Example 1-2 using Trizol (Invitrogen, 15596026). Thereafter, RT-PCR (reverse transcription PCR) was performed on the total RNA using Oligo dT primers (Qiagen, 79237) to prepare a cell cDNA library.
  • RNA transcripts of IGF-1 isoforms IGF-1Ea and IGF-1Ec by pTx-IGF-1-X10 of the present invention were confirmed.
  • pTx-IGF-1- The mRNA relative value of each isomer by X10 was calculated, and the specific result values are shown in Table 2 below.
  • IGF-1Ea relative value
  • IGF-1Ec relative values Sum of relative values of IGF-1Ea and IGF-1Ec negative control (NC) 0 0 0 0 pTx-IGF-1Ea One 0 One pTx-IGF-1Ec 0 One One pTx-IGF-1-X10 0.576 1.469 2.045
  • the relative value of human IGF-1Ea was 0.576 and the relative value of human IGF-1Ec was 1.469. That is, the level of transcription of IGF-1Ea by pTx-IGF-1-X10 was about 57.6% compared to that of pTx-IGF-1Ea, and the level of transcription of IGF-1Ec by pTx-IGF-1-X10 was higher than that of pTx-IGF-1Ec. It was confirmed that it was about 146.9%.
  • IGF-1 protein was isolated from the supernatant obtained from the 293T/17 cells of Example 1-2 using immunoprecipitation analysis.
  • IGF-1 protein was isolated from the supernatant using the Dynabeads ProteinG Immunoprecipitation Kit (Thermo scientific, Cat.10007D) according to the manufacturer's instructions, and anti-IGF-1 that specifically binds to IGF-1 As an antibody, R&D's anti-IGF1 antibody (MAB291) was used.
  • IGF-1 isoforms and mature IGF-1 were confirmed by conventional Western blotting of the IGF-1 protein isolated from the immunoprecipitation assay of Examples 1-6.
  • Western blotting was performed using Boltjon Bis-Tris Plus Gels (Invitrogen, NW04120BOX), with anti-IGF-1 antibody (Abcam, Ab9572) as the primary antibody and Goat Anti-Rabbit IgG H&L as the secondary antibody ( HRP) (Abcam, Ab205718) product was used.
  • Western blot results were visualized using ImageQuant LAS4000 (GE Healthcare, LAS4000) to obtain blot images, and the results are shown in FIG. 1c.
  • Western blot quantification data are shown in Table 3 below.
  • glycosylated pro-IGF-1Ea and IGF-1Ec which are IGF-1 isoforms
  • expression of mature IGF-1 were confirmed by pTx-IGF-1-X10.
  • Table 3 the western blot image of FIG. 1c was measured by densitometry using Image J software, and the IGF-1Ea and IGF-1Ec protein quantification data were based on the value of the pTx vector, and the mature For the IGF-1 protein quantification data, relative protein expression values were calculated based on the values of the pTx-IGF-1-X10 vector.
  • the arithmetic mean of the relative values of pTx-IGF-1Ea and pTx-IGF-1Ec expressing a single isoform is higher than the arithmetic mean of the IGF-1Ea isoform in pTx-IGF-1-X10, the IGF-1Ea isoform, It was found that the relative values of the 1Ec isoform and the mature IGF-1 protein were both high.
  • each IGF-1Ea and IGF-1Ec isoform is compared to a vector expressing a single isoform.
  • the expression levels of the respective IGF-1Ea and IGF-1Ec isoforms and mature IGF-1 are markedly increased, as well as the transcriptional level of the body.
  • mice were transfected with the pTx vector, pTx-IGF-1Ea and pTx-IGF-1Ec, respectively, and human IGF-1 isolated from the supernatant was isolated from mice.
  • the myoclonic C2C12 cells were treated and the activation levels of lower signaling pathways were compared by Western blot.
  • Human IGF-1 was diluted to a final concentration of 25 ng/ml and treated with C2C12 cells (mmu).
  • C2C12 cells (mmu) were obtained at 30 minutes and 1 hour after human IGF-1 treatment, and RIPA buffer (Sigma, R0278) containing protease inhibitor and phosphatase inhibitor cocktail (Roche Diagnostic Ltd.) Protein was extracted using
  • Western blotting was performed with the extracted protein using Boltjel Bis-Tris Plus Gels (Invitrogen, NW04120BOX).
  • Primary antibodies include anti-phospho AKT (Ser473) antibody (CST, 9271), anti-phospho p70S6K antibody (CST, 8209), anti-phospho ERK antibody (CST, 4370), anti-phospho GSK3 ⁇ / ⁇ antibody (CST , 9331) and anti-GAPDH antibody (CST, 2118) were used, and as a secondary antibody, Goat Anti-Rabbit IgG H&L (HRP) (Abcam, Ab205718) was used.
  • Western blotting results were visualized using Fusion solo (VILBER) to obtain blot images, and the results are shown in FIG. 1d.
  • IGF-1 isoforms IGF-1Ea and IGF-1Ec, showed different activity patterns of phospho-AKT (p-AKT) signaling factors. These results imply that a synergistic effect may be induced by simultaneously expressing IGF-1Ea and IGF-1Ec using pTx-IGF-1-X10.
  • 293T/17 cells were transfected with 1 ug each of pTx vector, pTx-IGF-1Ea, pTx-IGF-1Ec and pTx-IGF-1-X10.
  • the supernatant was harvested after 48 hours.
  • the supernatant was quantified by IGF-1 ELISA (R&D, DG100B) and treated with 50 ng each of C2C12 cells.
  • 50 ng of rhIGF-1 a recombinant protein, was also treated.
  • Western blotting was performed after harvesting C2C12 cells at each time point and extracting proteins. The results are shown in Figures 1e and 1f.
  • Example 2 Confirmation of muscle regeneration effect by pTx-IGF-1-X10 in sarcopenia caused by permanent motor nerve damage
  • the sarcopenic disease mouse model is a sciatic nerve transection model that causes permanent motor nerve damage by cutting the sciatic nerve of an 8-week-old male C57BL/6 mouse and severing the motor nerve connected to the muscles of the lower extremity. am. It is known that nerve damage muscle loss is induced in the sciatic nerve cut model (Williams et al., Science 326(5959):1549-1554, 2009).
  • Equal amounts of proteins were separated on a 10% SDS-polyacrylamide gel and transferred to a Western membrane (PVDF, Polyvinylidene fluoride).
  • PVDF Polyvinylidene fluoride
  • the membrane was blocked with TBST (20 mM Tris-HCl, pH 7.4, 0.9% NaCl and 0.1% Tween-20) containing BSA (Invitrogen-Gibco) for 1 hour, and diluted in blocking solution.
  • the primary antibody was probed overnight at 4°C.
  • Example 3 Confirmation of muscle regeneration effect by pTx-IGF-1-X10 in geriatric sarcopenia
  • H&E staining Hematoxylin and eosin staining
  • Hematoxylin stains anionic or acidic substances such as DNA and RNA in the nucleus and rough endoplasmic reticulum ribosomes in blue or purple
  • eosin stains cationic amino acids such as arginine and lysine in the cytoplasm and the microstructure of muscle cells.
  • Dye cationic or basic materials such as fibers red or pink.
  • the muscle tissue was observed under an optical microscope and images were obtained and shown in FIG. 4 .
  • IFA immunofluorescence assay staining was performed by the following method to obtain the muscle injected with the plasmid of Example 3-2. Muscles isolated from mice were made into OCT blocks using a snap freezing technique, and then immunofluorescence was performed by thinly cutting muscle tissue to prepare slides. Laminin (Laminin, Sigma, L9393) was stained with red fluorescence (Invitrogen, A32754), eMHC (DSHB, F1.652) with green fluorescence (Invitrogen, A32766), and nuclei were stained with blue DAPI fluorescence (Sigma, D9542). The muscle tissue was observed under a fluorescence microscope and images were obtained and shown in FIG. 5 .
  • muscle fibers injected with the plasmid of Example 3-1 were obtained and the size of the muscle fiber was investigated through cross section area (CSA) measurement.
  • the cross-sectional area of muscle fibers was measured as follows.
  • the muscle tissue stained by the immunofluorescence method described in 3-4 above was observed with an LSM900 fluorescence microscope (ZEISS, LSM900).
  • the laminin antibody stains the edge of the cell membrane of the muscle fiber, and the cross-sectional area of the inner side of the muscle fiber stained with laminin was measured with the LSM900 analysis program. The results are shown in FIG. 6 .
  • the CSA of a muscle fiber is proportional to the function and weight of a muscle.
  • FIG. 6 as a result of measuring the CSA size of the plasmid-injected muscle and dividing it by size and graphing it, the CSA graph of the pTx-IGF-1-X10-administered group is moved to the right and upper, compared to the pTx-administered group.
  • -It was confirmed that a larger number of muscle fibers with a larger cross-sectional area were present in the group administered with IGF-1-X10.
  • Control vector (pTx), pTx-IGF-1-X10, and mature IGF-1 (pTx-Mature IGF1) plasmid DNA were injected intramuscularly into the tibialis anterior muscle of C57BL/6 mice. After 3 days of administration, muscle damage was induced by administering cardiotoxin (CTX) to the muscles into which the plasmid DNA was administered. C57BL/6 mice without any treatment were used as a negative control (NC). The next day, after extracting proteins from damaged muscles, Western blotting was performed on Pax7, MyoD, and MyoG by the method of Example 2-2. The results are shown in FIG. 7 .
  • Example 5 Increase in muscle mass by pTx-IGF-1-X10
  • Damaged muscles were obtained from the cardiotoxin-induced muscle injury mouse model of Example 4-1, and the weight of the muscles was measured in the following manner.
  • the muscle isolated from the mouse was directly placed on a microbalance to measure the weight (mg unit), and the value was calculated by correcting the measured muscle mass with the body weight of the mouse.
  • the results are shown in FIG. 8 .
  • the present inventors found that the expression of two different IGF-1 isoforms due to pTx-IGF-1-X10 administration increased muscle weight, compared to single administration of mature IGF-1 pTx-IGF-1-X10. It was confirmed that administration has a higher potential for muscle regeneration.
  • IGF-1Ea, IGF-1Ec, Ea peptide, Ec peptide and/or mature IGF-1Ea formed from the pTx-IGF-1-X series of the present invention co-expressing IGF-1Ea isoforms and IGF-1Ec isoforms. 1 suggests that either itself or their interactions have significant preventive or therapeutic effects on muscle damage.
  • the polynucleotide encoding at least one human IGF-1 isoform according to the present invention can be usefully used for preventing or treating sarcopenia due to various causes such as nerve damage, aging, and toxin exposure.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Veterinary Medicine (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Endocrinology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Diabetes (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Toxicology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Immunology (AREA)
  • Neurology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present invention relates to a pharmaceutical composition for preventing or treating sarcopenia, comprising, as active ingredients, an IGF-1 isoform and a polynucleotide encoding the IGF-1 isoform. More specifically, provided is a pharmaceutical composition for preventing or treating sarcopenia, comprising, as active ingredients, IGF-1Ea and IGF-1Ec isoforms or a combination thereof, or a polynucleotide encoding the IGF-1Ea and IGF-1Ec isoforms or a combination thereof. If the pharmaceutical composition for preventing or treating sarcopenia, of the present invention, is used, the mature IGF-1 expression is increased, and the expression of muscle regeneration markers Pax7, MyoG and MyoD is higher in groups of sarcopenia caused by neural damage, aging, exposure to cardiotoxin, and the like than in groups to which a control vector and mature IGF-1 plasmid DNA are administered, and muscle mass and muscle fiber size are increased such that muscle regeneration can be promoted, and thus the present invention can be effectively used in the prevention and treatment of sarcopenia induced by various causes.

Description

인슐린-유사 성장인자-1의 이형체를 이용한 근감소증 예방 또는 치료용 조성물Composition for preventing or treating sarcopenia using an isoform of insulin-like growth factor-1
본 특허출원은 2022년 2월 15일에 대한민국 특허청에 제출된 대한민국 특허출원 제10-2022-0019804호에 대하여 우선권을 주장하며, 상기 특허출원의 개시사항은 본 명세서에 참조로서 삽입된다.This patent application claims priority to Korean Patent Application No. 10-2022-0019804 filed with the Korean Intellectual Property Office on February 15, 2022, the disclosure of which is incorporated herein by reference.
본 발명은 인슐린-유사 성장인자-1(Insulin-like growth factor-1, IGF-1)의 이형체 또는 상기 이형체를 인코딩하는 폴리뉴클레오타이드를 유효성분으로 포함하는 근감소증(sarcopenia) 예방 또는 치료용 약제학적 조성물에 관한 것이다.The present invention is for preventing or treating sarcopenia comprising, as an active ingredient, an isoform of insulin-like growth factor-1 (IGF-1) or a polynucleotide encoding the isoform. It relates to pharmaceutical compositions.
근감소증(sarcopenia)은 나이가 증감함에 따라 동반되는 근육 양의 감소와 동시에 근력의 감소로 정의되고 있다(The Korean Journal of Medicine 83(4):444-454, 2012). 최근 연구에서 근감소증은 영양 결핍이나 좌식 생활방식에 의해 발생하는 단순한 현상(simple condition)이 아니라, 복잡한 다중경로의 병인(multipathway pathogenesis)으로 인해 발생하는 것으로 알려졌다(Endocrinol Metab 35:716-732, 2020). 근감소증은 근력저하, 하지 무력감, 피곤감 등의 가벼운 증상부터 그 원인에 따라 일상 생활이 어려운 상태에 이르기까지 다양하다. 따라서 간단한 근력 운동이나 유산소 운동, 영양 보충을 통해 어느 정도 회복이 가능할 수도 있지만, 증상 정도에 따라 적절한 치료가 필요하다.Sarcopenia is defined as a decrease in muscle mass and a decrease in muscle strength accompanying age ( The Korean Journal of Medicine 83(4):444-454, 2012). Recent studies have shown that sarcopenia is not a simple condition caused by nutritional deficiency or a sedentary lifestyle, but is caused by a complex multipathway pathogenesis ( Endocrinol Metab 35:716-732, 2020 ). Sarcopenia ranges from mild symptoms such as muscle weakness, lower extremity weakness, and tiredness to conditions in which daily life is difficult depending on the cause. Therefore, it may be possible to recover to some extent through simple strength training, aerobic exercise, or nutritional supplementation, but appropriate treatment is required depending on the degree of symptoms.
현재, 근감소증의 치료에는 저항 운동(resistance exercise)과 단백질 및 비타민 D의 보충이 기본적인 치료로서 확립되어 있다. 근감소증 치료를 위한 약리학적 개입으로는 근력과 근육의 기능을 증가시키는 고용량의 테스토스테론 투여가 있으나, 부작용이 있어 치료에 제한적이다. Currently, resistance exercise and supplementation of protein and vitamin D are established as basic treatments for sarcopenia. Pharmacological intervention for the treatment of sarcopenia includes administration of high doses of testosterone to increase muscle strength and function, but treatment is limited due to side effects.
근감소증의 치료를 위한 임상 개발 중인 약물에는 성장호르몬, 선택적 안드로겐 수용체 조절자(selective androgen receptor modulators, SARMS), 그렐린 작용제(ghrelin agonist), 마이오스타틴 항체(myostatin antibody), 액티빈 11R 길항제(antibodies, activin 11R antagonist), 안지오텐신 전환 효소 억제제(myostatin angiotensin converting enzyme inhibitor, ACE inhibitor, perindopril), 속골격근 트로포닌 활성화제(fast skeletal muscle troponin activator, Tirasemtiv), B1/B2 아드레날린 수용체 길항체(B1/B2 adrenergic receptor antagonist, Espindolol)(Calcif Tissue Int. 2016 Apr;98(4):319-33; 및 Journal of Korean Academy of Geriatric Rehabilitation Medicine 2017; 7: 52-58.) 등이 있으나, 현재 FDA 승인을 받은 근육 감소 개선 및 근육량 증진과 같은 직접적인 근감소증 치료제는 없어, 개발이 필요한 실정이다.Drugs in clinical development for the treatment of sarcopenia include growth hormone, selective androgen receptor modulators (SARMS), ghrelin agonists, myostatin antibodies, and activin 11R antagonists. , activin 11R antagonist), angiotensin converting enzyme inhibitor (myostatin angiotensin converting enzyme inhibitor, ACE inhibitor, perindopril), fast skeletal muscle troponin activator (Tirasemtiv), B 1 /B 2 adrenergic receptor antagonist (B 1 /B 2 adrenergic receptor antagonist, Espindolol) ( Calcif Tissue Int. 2016 Apr;98(4):319-33; and Journal of Korean Academy of Geriatric Rehabilitation Medicine 2017; 7: 52-58.). There is no direct sarcopenia treatment that has been approved by the FDA to improve muscle loss and increase muscle mass, and development is required.
본 발명자들은 신경 손상, 노화 등에 의한 근감소증의 예방 또는 치료용 약제학적 조성물을 개발하고자 예의 연구 노력하였다. 그 결과, 근감소증 마우스 모델에서 IGF-1(Insulin-Like Growth Factor-1)의 이형체인 IGF-1Ea 및 IGF-1Ec를 모두 발현하는 플라스미드를 투여하는 경우 대조 벡터 및 성숙 IGF-1 플라스미드 DNA 투여 대비 근육 재생 마커인 Pax7, MyoG 및 MyoD가 증가하고, 근육 무게와 근섬유의 크기가 증가하여 근육의 재생을 촉진시킬 수 있음을 규명함으로써, 본 발명을 완성하였다.The present inventors have intensively researched to develop a pharmaceutical composition for preventing or treating sarcopenia caused by nerve damage, aging, or the like. As a result, when plasmids expressing both IGF-1Ea and IGF-1Ec, which are isoforms of IGF-1 (Insulin-Like Growth Factor-1), were administered in a sarcopenia mouse model, compared to administration of control vector and mature IGF-1 plasmid DNA. The present invention was completed by identifying that muscle regeneration markers Pax7, MyoG, and MyoD are increased, and muscle weight and muscle fiber size are increased to promote muscle regeneration.
따라서, 본 발명의 목적은 IGF-1Ea 이형체 및 IGF-1Ec 이형체, 또는 상기 IGF-1Ea 이형체를 인코딩(encoding)하는 폴리뉴클레오타이드 및 상기 IGF-1Ec 이형체를 인코딩하는 폴리뉴클레오타이드를 유효성분으로 포함하는 근감소증(sarcopenia) 예방 또는 치료용 조성물을 제공하는 것이다.Accordingly, an object of the present invention is an IGF-1Ea isoform and an IGF-1Ec isoform, or a polynucleotide encoding the IGF-1Ea isoform and a polynucleotide encoding the IGF-1Ec isoform as an active ingredient. It is to provide a composition for preventing or treating sarcopenia comprising sarcopenia.
본 발명의 다른 목적은 i) 서열번호 1의 폴리뉴클레오타이드 서열 또는 이의 축퇴성 서열, ii) 서열번호 2의 폴리뉴클레오타이드 서열 또는 이의 단편, iii) 서열번호 3의 폴리뉴클레오타이드 서열 또는 이의 축퇴성 서열, iv) 서열번호 4의 폴리뉴클레오타이드 서열 또는 이의 단편, 및 v) 서열번호 5의 폴리뉴클레오타이드 서열 또는 이의 축퇴성 서열이 순차적으로 5'에서 3'순서로 연결된 단일의 폴리뉴클레오타이드를 유효성분으로 포함하는 근감소증 예방 또는 치료용 약제학적 조성물을 제공하는 것이다.Another object of the present invention is i) the polynucleotide sequence of SEQ ID NO: 1 or a degenerate sequence thereof, ii) the polynucleotide sequence of SEQ ID NO: 2 or a fragment thereof, iii) the polynucleotide sequence of SEQ ID NO: 3 or a degenerate sequence thereof, iv ) A polynucleotide sequence of SEQ ID NO: 4 or a fragment thereof, and v) a polynucleotide sequence of SEQ ID NO: 5 or a degenerate sequence thereof sequentially linked in 5' to 3' order. Sarcopenia comprising a single polynucleotide as an active ingredient To provide a pharmaceutical composition for prevention or treatment.
본 발명의 일 양태에 따르면, 본 발명은 다음을 유효성분으로 포함하는 근감소증(sarcopenia) 예방 또는 치료용 약제학적 조성물을 제공한다:According to one aspect of the present invention, the present invention provides a pharmaceutical composition for preventing or treating sarcopenia comprising the following as active ingredients:
(a) 적어도 하나의 인간 IGF-1(Insulin-Like Growth Factor-1) 이형체; 또는 (a) at least one isoform of human Insulin-Like Growth Factor-1 (IGF-1); or
(b) 적어도 하나의 인간 IGF-1 이형체를 인코딩하는 폴리뉴클레오타이드.(b) a polynucleotide encoding at least one human IGF-1 isoform.
본 발명의 용어, "근감소증(sarcopenia)"은 근육(muscle)의 무게, 질 및/또는 기능(근력)이 손실되거나 저하된 상태를 의미한다.As used herein, "sarcopenia" refers to a state in which the weight, quality, and/or function (muscle strength) of muscle is lost or reduced.
본 발명의 용어, "IGF-1(insulin-like growth factor-1)"은 인슐린-유사 성장인자-1 또는 소마토메딘 C(somatomedin C)라고도 불리는 인슐린과 유사한 분자 구조를 갖는 단백질을 의미한다. As used herein, the term "insulin-like growth factor-1 (IGF-1)" refers to a protein having a molecular structure similar to that of insulin, also called insulin-like growth factor-1 or somatomedin C.
Igf-1 유전자는 약 80 kb 이상이고, 6개의 엑손(exon)을 포함하며, 2개의 선택적 신호 펩타이드(signal peptide)와 3개의 선택적 C-말단 E-도메인(E-domain)이 있는 IGF-1 전구체(precursor)로부터 상이한 선택적 스플라이싱(alternative splicing) 양상을 나타내지만(즉, 상이한 이형체를 생성하지만), 결국 단일 성숙(mature) IGF-1 단백질을 생성한다(Wallis M. New insulin-like growth factor (IGF)-precursor sequences from mammalian genomes: the molecular evolution of IGFs and associated peptides in primates. Growth Horm IGF Res. 2009 Feb;19(1):12-23. 참조). The Igf-1 gene is about 80 kb or more, contains 6 exons, and has 2 selective signal peptides and 3 optional C-terminal E-domains. It exhibits different alternative splicing patterns from its precursor (i.e., produces different isoforms), but eventually produces a single mature IGF-1 protein (Wallis M. New insulin-like growth factor (IGF)-precursor sequences from mammalian genomes: the molecular evolution of IGFs and associated peptides in primates. See Growth Horm IGF Res. 2009 Feb;19(1):12-23.).
본 발명의 용어, "IGF-1의 이형체 또는 IGF-1 이형체(IGF-1 isoform)"는 모든 대립 유전자 변이체(variant)를 포함하는, 인간을 포함하는 동물에서 자연적으로 생성되는 IGF-1 아미노산 서열과 적어도 80%의 동일성을 가지는 아미노산 서열을 갖는 IGF-1 폴리펩타이드를 의미한다. 예를 들어, IGF-1 이형체는 IGF-1의 내인성 형태(endogenous form) 또는 야생형(wild type), 및 IGF-1의 다양한 변이체(varinat)(예컨대, mRNA 변이체, 스플라이싱 변이체, 번역 후 변형 변이체)를 모두 포괄하는 의미를 갖는다.As used herein, the term "IGF-1 isoform or IGF-1 isoform" refers to IGF-1 naturally produced in animals, including humans, including all allelic variants. An IGF-1 polypeptide having an amino acid sequence with at least 80% identity to the amino acid sequence. For example, IGF-1 isoforms include the endogenous form or wild type of IGF-1, and various variants of IGF-1 (e.g., mRNA variants, splicing variants, post-translational variants). modified variant) has a meaning encompassing all.
보다 상세하게는, 본 발명의 IGF-1 이형체는 Igf-1 유전자의 선택적 스플라이싱에 의해, 1차 RNA 전사체(primary RNA transcript)로부터 상이한 조합으로 스플라이싱된 엑손의 번역 결과로 이루어진 프리-프로 펩타이드(pre-pro-peptide), 프로-펩타이드(pro-peptide), 폴리펩타이드, 또는 이들의 아미노산 서열과 적어도 80%의 동일성을 가지는 폴리펩타이드 단편을 의미한다(Philippou A, Maridaki M, Halapas A, Koutsilieris M. The role of the insulin-like growth factor 1 (IGF-1) in skeletal muscle physiology. In Vivo. 2007 Jan-Feb;21(1):45-54. 참조). More specifically, the IGF-1 isoform of the present invention consists of translational results of exons spliced in different combinations from a primary RNA transcript by alternative splicing of the Igf-1 gene. A pre-pro-peptide, pro-peptide, polypeptide, or polypeptide fragment having at least 80% identity to their amino acid sequence (Philippou A, Maridaki M, Halapas A, Koutsilieris M. The role of the insulin-like growth factor 1 (IGF-1) in skeletal muscle physiology. In Vivo. 2007 Jan-Feb;21(1):45-54.).
본 발명의 IGF-1 이형체는 IGF-1 mRNA 전사체(transcript)/변이체(variant)로부터 번역된다. 본 발명의 IGF-1 mRNA 변이체는 상이한 리더 서열(leader sequence)을 사용함으로써 클래스 I 및 클래스 II로 나뉜다. 클래스 I은 개시 부분을 엑손 1(프로모터 1)에 가지고 있는 반면, 클래스 II는 엑손 2(프로모터 2)에 가지고 있고, 클래스 I(엑손 1에서 엑손 3으로) 또는 클래스 II(엑손 2에서 엑손 3으로) mRNA 전사체는 엑손 1 및 엑손 2 각각을 공통의 엑손 3으로 상이하게 스플라이싱한다.IGF-1 isoforms of the present invention are translated from IGF-1 mRNA transcripts/variants. The IGF-1 mRNA variants of the present invention are divided into Class I and Class II by using different leader sequences. Class I has its initiation moiety in exon 1 (promoter 1), whereas class II has it in exon 2 (promoter 2), either class I (exon 1 to exon 3) or class II (exon 2 to exon 3). ) mRNA transcripts differentially splice each of exon 1 and exon 2 to the common exon 3.
또한, 엑손 5의 선택적 스플라이싱으로 인해, 엑손 5를 포함하고 엑손 6은 포함하지 않는 mRNA 전사체는 클래스 B이고, 엑손 5는 포함하지 않고, 엑손 6은 포함하는 mRNA 전사체는 클래스 A이며, 엑손 5 및 엑손 6을 모두 포함하는 mRNA 전사체는 클래스 C이다(Philippou A, Maridaki M, Pneumaticos S, Koutsilieris M. The complexity of the IGF1 gene splicing, posttranslational modification and bioactivity. Mol Med. 2014 May 7;20(1):202-14. 참조).In addition, due to the alternative splicing of exon 5, mRNA transcripts containing exon 5 and not exon 6 are class B, and mRNA transcripts without exon 5 and containing exon 6 are class A. , mRNA transcripts containing both exon 5 and exon 6 are class C (Philippou A, Maridaki M, Pneumaticos S, Koutsilieris M. The complexity of the IGF1 gene splicing, posttranslational modification and bioactivity. Mol Med. 2014 May 7; 20(1):202-14.).
결국, 클래스 I 및 클래스 A의 IGF-1 전사체는 엑손 1-3-4-6 스플라이싱 변이체이고, 클래스 I 및 클래스 B의 IGF-1 전사체는 엑손 1-3-4-5 스플라이싱 변이체이며, 클래스 I 및 클래스 C의 IGF-1 전사체는 엑손 1-3-4-5-6 스플라이싱 변이체이고, 클래스 II 및 클래스 A의 IGF-1 전사체는 엑손 2-3-4-6 스플라이싱 변이체이며, 클래스 II 및 클래스 B의 IGF-1 전사체는 엑손 2-3-4-5 스플라이싱 변이체이고, 클래스 II 및 클래스 C의 IGF-1 전사체는 엑손 2-3-4-5-6 스플라이싱 변이체이다. Consequently, class I and class A IGF-1 transcripts are exon 1-3-4-6 splice variants, and class I and class B IGF-1 transcripts are exon 1-3-4-5 splice variants. IGF-1 transcripts of class I and class C are exon 1-3-4-5-6 splicing variants, and IGF-1 transcripts of class II and class A are exon 2-3-4 -6 splicing variant, class II and class B IGF-1 transcripts are exons 2-3-4-5 splicing variants, class II and class C IGF-1 transcripts are exons 2-3 -4-5-6 splicing variant.
상술한 IGF-1 전사체 및/또는 변이체는 본 발명의 IGF-1 이형체를 인코딩한다.The aforementioned IGF-1 transcripts and/or variants encode the IGF-1 isoforms of the present invention.
본 발명의 일 구현예에 있어서, 상기 인간 IGF-1 이형체는 서열번호 11의 아미노산 서열을 포함하는 IGF-1Ea 이형체, 서열번호 13의 아미노산 서열을 포함하는 IGF-1Ec 이형체, 또는 이들의 조합이거나; 또는In one embodiment of the present invention, the human IGF-1 isoform is an IGF-1Ea isoform comprising the amino acid sequence of SEQ ID NO: 11, an IGF-1Ec isoform comprising the amino acid sequence of SEQ ID NO: 13, or any of these isoforms. is a combination; or
상기 폴리뉴클레오타이드는 상기 IGF-1Ea 이형체, 상기 IGF-1Ec 이형체, 또는 이들의 조합을 인코딩하는 폴리뉴클레오타이드이다. The polynucleotide is a polynucleotide encoding the IGF-1Ea isoform, the IGF-1Ec isoform, or a combination thereof.
본 발명의 일 구현예에 있어서, 상기 인간 IGF-1 이형체는 서열번호 11의 아미노산 서열을 포함하는 IGF-1Ea 이형체 및 서열번호 13의 아미노산 서열을 포함하는 IGF-1Ec 이형체이거나; 또는In one embodiment of the present invention, the human IGF-1 isoform is an IGF-1Ea isoform comprising the amino acid sequence of SEQ ID NO: 11 and an IGF-1Ec isoform comprising the amino acid sequence of SEQ ID NO: 13; or
상기 폴리뉴클레오타이드는 상기 IGF-1Ea 이형체 및 상기 IGF-1Ec 이형체를 인코딩하는 폴리뉴클레오타이드이다.The polynucleotide is a polynucleotide encoding the IGF-1Ea isoform and the IGF-1Ec isoform.
구체적으로, 본 발명은 또한 다음을 유효성분으로 포함하는 근감소증 예방 또는 치료용 약제학적 조성물을 제공한다:Specifically, the present invention also provides a pharmaceutical composition for preventing or treating sarcopenia comprising the following as active ingredients:
서열번호 11의 아미노산 서열을 포함하는 IGF-1Ea 이형체 및 서열번호 13의 아미노산 서열을 포함하는 IGF-1Ec 이형체; 또는an IGF-1Ea isoform comprising the amino acid sequence of SEQ ID NO: 11 and an IGF-1Ec isoform comprising the amino acid sequence of SEQ ID NO: 13; or
서열번호 11의 아미노산 서열을 포함하는 IGF-1Ea 이형체 및 서열번호 13의 아미노산 서열을 포함하는 IGF-1Ec 이형체를 인코딩하는 폴리뉴클레오타이드Polynucleotides encoding an IGF-1Ea isoform comprising the amino acid sequence of SEQ ID NO: 11 and an IGF-1Ec isoform comprising the amino acid sequence of SEQ ID NO: 13
본 발명의 IGF-1 이형체는 번역 후 변형(posttranslational modification)을 거친 폴리펩타이드일 수 있다. 상기 번역 후 변형은 번역 후 절단(posttranslational cleavage), N-연결 당화(N-linked glycosylation), O-연결 당화(O-linked glycosylation), 유비퀴틴화(ubiquitination), 수모화(SUMOylation), 인산화(phosphorylation), 또는 이들의 조합일 수 있다.The IGF-1 isoform of the present invention may be a polypeptide that has undergone posttranslational modification. The posttranslational modification is posttranslational cleavage, N-linked glycosylation, O-linked glycosylation, ubiquitination, SUMOylation, phosphorylation ), or a combination thereof.
본 발명의 일 구현예에 있어서, 상기 IGF-1Ea 이형체는 서열번호 11의 아미노산 서열의 140번째 아스파라긴(asparagine) 잔기가 N-연결 당화(N-linked glycosylation)된다.In one embodiment of the present invention, in the IGF-1Ea isoform, the 140th asparagine residue of the amino acid sequence of SEQ ID NO: 11 is subjected to N-linked glycosylation.
본 발명의 용어, "N-연결 당화(N-linked glycosylation)"란, 단백질의 아스파라긴(asparagine, Asn) 잔기의 아마이드 질소와 같은 질소 원자에 여러 개의 당 분자(글리칸, glycan)로 이루어진 올리고당(oligosaccharide)의 부착을 의미한다.The term of the present invention, "N-linked glycosylation" refers to an oligosaccharide composed of several sugar molecules (glycan) at a nitrogen atom such as the amide nitrogen of an asparagine (Asn) residue of a protein. oligosaccharide).
본 발명의 일 구현예에 있어서, 본 발명의 IGF-1 이형체는 E-펩타이드(E-peptide)를 포함하는 pro-IGF-1 이형체이다. 상기 pro-IGF-1 이형체에는 pro-IGF-1Ea, glycosylated pro-IGF-1Ea, pro-IGF-1Eb 및 pro-IGF-1Ec가 포함되나, 반드시 이에 제한되는 것은 아니다. In one embodiment of the present invention, the IGF-1 isoform of the present invention is a pro-IGF-1 isoform containing an E-peptide. The pro-IGF-1 isomers include, but are not limited to, pro-IGF-1Ea, glycosylated pro-IGF-1Ea, pro-IGF-1Eb, and pro-IGF-1Ec.
본 발명의 다른 일 구현예에 있어서, 본 발명의 IGF-1 이형체는 신호 서열 및 E-펩타이드를 포함하는 pre-pro-IGF-1 이형체이다. 상기 pre-pro-IGF-1 이형체에는 pre-pro-IGF-1Ea, glycosylated pre-pro-IGF-1Ea, pre-pro-IGF-1Eb 및 pre-pro-IGF-1Ec가 포함되나, 반드시 이에 제한되는 것은 아니다.In another embodiment of the present invention, the IGF-1 isoform of the present invention is a pre-pro-IGF-1 isoform containing a signal sequence and an E-peptide. The pre-pro-IGF-1 isoform includes pre-pro-IGF-1Ea, glycosylated pre-pro-IGF-1Ea, pre-pro-IGF-1Eb and pre-pro-IGF-1Ec, but is not necessarily limited thereto. it is not going to be
보다 구체적으로, 본 발명의 서열번호 11은 클래스 I 및 클래스 A의 pre-pro-IGF-1Ea이다. 서열번호 11의 1번 내지 48번 아미노산은 48개의 아미노산으로 구성된 신호 펩타이드이고, 49번 내지 118번 아미노산은 70개의 아미노산으로 구성된 성숙 IGF-1 펩타이드이며, 119번 내지 153번 아미노산은 35개의 아미노산으로 구성된 Ea 펩타이드이다.More specifically, SEQ ID NO: 11 of the present invention is class I and class A pre-pro-IGF-1Ea. Amino acids 1 to 48 of SEQ ID NO: 11 are signal peptides composed of 48 amino acids, amino acids 49 to 118 are mature IGF-1 peptides composed of 70 amino acids, and amino acids 119 to 153 are 35 amino acids. It is the composed Ea peptide.
또한, 본 발명의 서열번호 13은 클래스 I 및 클래스 C의 pre-pro-IGF-1Ec이다. 서열번호 13의 1번 내지 48번 아미노산은 48개의 아미노산으로 구성된 신호 펩타이드이고, 49번 내지 118번 아미노산은 70개의 아미노산으로 구성된 성숙 IGF-1 펩타이드이며, 119번 내지 158번 아미노산은 40개의 아미노산으로 구성된 Ec펩타이드이다.In addition, SEQ ID NO: 13 of the present invention is pre-pro-IGF-1Ec of class I and class C. Amino acids 1 to 48 of SEQ ID NO: 13 are signal peptides composed of 48 amino acids, amino acids 49 to 118 are mature IGF-1 peptides composed of 70 amino acids, and amino acids 119 to 158 are 40 amino acids. It is composed of EC peptide.
상술한 pre-pro-IGF-1 이형체 폴리펩타이드는 소포체(endoplasmic reticulum)를 통과하면서 신호 펩타이드가 절단되어 pro-IGF-1 이형체가 형성된다. 그 다음, pro-IGF-1 이형체의 E-펩타이드는 푸린(furin)과 같은 단백질 전환효소(protein convertase)에 의해 절단되어 성숙 IGF-1 단백질이 형성된다. As the above-described pre-pro-IGF-1 heteromeric polypeptide passes through the endoplasmic reticulum, the signal peptide is cleaved to form a pro-IGF-1 heteromeric polypeptide. Then, the E-peptide of the pro-IGF-1 isomer is cleaved by a protein convertase such as furin to form a mature IGF-1 protein.
IGF-1의 엑손 4, 엑손 5 및 엑손 6에 위치한 E-도메인은 상이한 조합의 선택적 스플라이싱에 의해 상이한 E-펩타이드인 Ea 펩타이드, Eb 펩타이드 및 Ec 펩타이드를 인코딩한다. The E-domains located in exon 4, exon 5 and exon 6 of IGF-1 encode different E-peptides, Ea peptide, Eb peptide and Ec peptide, by different combinations of alternative splicing.
구체적으로, IGF-1의 엑손 4로부터 16개의 아미노산 및 IGF-1의 엑손 6으로부터 19개의 아미노산이 번역되어 35개 아미노산의 Ea 펩타이드를 구성한다. IGF-1의 엑손 4로부터 16개의 아미노산 및 IGF-1의 엑손 5로부터 번역 후 절단을 거친 61개의 아미노산이 77개 아미노산의 Eb 펩타이드를 구성한다. IGF-1의 엑손 4로부터 16개의 아미노산, IGF-1의 엑손 5로부터 16개의 아미노산 및 IGF-1의 엑손 6으로부터 8개의 아미노산이 번역되어 40개 아미노산의 Ec펩타이드를 구성한다.Specifically, 16 amino acids from exon 4 of IGF-1 and 19 amino acids from exon 6 of IGF-1 are translated to form a 35 amino acid Ea peptide. 16 amino acids from exon 4 of IGF-1 and 61 amino acids from exon 5 of IGF-1 after translational cleavage constitute the 77 amino acid Eb peptide. 16 amino acids from exon 4 of IGF-1, 16 amino acids from exon 5 of IGF-1, and 8 amino acids from exon 6 of IGF-1 are translated to form an Ec peptide of 40 amino acids.
보다 구체적으로, 본 발명의 서열번호 1에 포함된 엑손 4 및 서열번호 5에 포함된 엑손 6-2는 본 발명의 서열번호 21의 Ea 펩타이드를 인코딩한다. 즉, Ea 펩타이드는 상기 엑손 4로부터 16개의 아미노산 및 상기 엑손 6-2로부터 19개의 아미노산으로 번역되어, 총 35개의 아미노산으로 구성된다.More specifically, exon 4 of SEQ ID NO: 1 of the present invention and exons 6-2 of SEQ ID NO: 5 of the present invention encode the Ea peptide of SEQ ID NO: 21 of the present invention. That is, the Ea peptide is translated into 16 amino acids from exon 4 and 19 amino acids from exons 6-2, and consists of a total of 35 amino acids.
또한, 본 발명의 서열번호 1에 포함된 엑손 4 및 서열번호 3에 포함된 엑손 5 및 엑손 6-1은 본 발명의 서열번호 22의 Ec 펩타이드를 인코딩한다. 즉, Ec 펩타이드는 상기 엑손 4로부터 16개의 아미노산, 상기 엑손 5로부터 16개의 아미노산 및 상기 엑손 6-1로부터 8개의 아미노산으로 번역되어, 총 40개의 아미노산으로 구성된다.In addition, exon 4 of SEQ ID NO: 1 and exon 5 and exon 6-1 of SEQ ID NO: 3 of the present invention encode the Ec peptide of SEQ ID NO: 22 of the present invention. That is, the Ec peptide is translated into 16 amino acids from exon 4, 16 amino acids from exon 5, and 8 amino acids from exon 6-1, and is composed of a total of 40 amino acids.
IGF-1 이형체의 E-펩타이드는 IGF-1 생산과 분비를 조절하는 조절 요소로 알려져 있다(Annibalini G. et al., The intrinsically disordered E-domains regulate the IGF-1 prohormones stability, subcellular localisation and secretion. Sci Rep. 2018 Jun 11;8(1):8919.).E-peptides of IGF-1 isoforms are known as regulatory elements that regulate IGF-1 production and secretion (Annibalini G. et al., The intrinsically disordered E-domains regulate the IGF-1 prohormones stability, subcellular localization and secretion Sci Rep. 2018 Jun 11;8(1):8919.).
또한, E 펩타이드는 정지 위성 세포(quiescent satellite cell)를 활성화시키고 증식시킴으로써 근원성 전구세포(myogenic precursor cell, MPC)의 환경(niche)을 제공하고, 근육의 회복을 돕는 역할을 하는 것으로 보고된 바 있다(Hill M, Goldspink G. Expression and splicing of the insulin-like growth factor gene in rodent muscle is associated with muscle satellite (stem) cell activation following local tissue damage. J Physiol. 2003 Jun 1;549(Pt 2):409-18.; 및 Vassilakos G, Philippou A, Tsakiroglou P, Koutsilieris M. Biological activity of the e domain of the IGF-1Ec as addressed by synthetic peptides. Hormones (Athens). 2014 Apr-Jun;13(2):182-96. 참조).In addition, it has been reported that E peptide activates and proliferates quiescent satellite cells, thereby providing a niche for myogenic precursor cells (MPC) and helping muscle recovery. (Hill M, Goldspink G. Expression and splicing of the insulin-like growth factor gene in rodent muscle is associated with muscle satellite (stem) cell activation following local tissue damage. J Physiol. 2003 Jun 1;549(Pt 2): 409-18., and Vassilakos G, Philippou A, Tsakiroglou P, Koutsilieris M. Biological activity of the e domain of the IGF-1Ec as addressed by synthetic peptides. Hormones (Athens). 2014 Apr-Jun;13(2): 182-96.).
본 발명의 용어, "위성 세포(satellite cell)" 란, 일반적으로 근섬유(muscle fiber) 말단에, 기저막과 원형질막 사이에 위치하는 다분화능 줄기 세포(multipotent stem cell)를 의미한다. 정지(quiescent) 위성 세포가 활성화되면, 증식하여 근섬유에 융합된다. 위성 세포의 활성화는 M-cadherin과 같은 부착 분자(adhesion molecule)의 발현 변화와, 이에 뒤따르는 MyoD와 같은 근원성 인자의 전사를 수반한다.As used herein, the term "satellite cell" refers to a multipotent stem cell located between a basement membrane and a plasma membrane, generally at the end of a muscle fiber. When quiescent satellite cells are activated, they proliferate and fuse into muscle fibers. Activation of satellite cells is accompanied by changes in the expression of adhesion molecules such as M-cadherin, followed by transcription of myogenic factors such as MyoD.
활성 위성 세포 및 근원성 인자의 결핍은 근이영양증(muscular dystrophy)과 연관된 바 있고, 노화된 근육의 감소된 재생 능력 또한 위성 세포 증식을 활성화하는 능력의 감소로 인한 것으로 간주되고 있다. 더욱이, 기계적 부하에 대한 근육의 반응으로 IGF-1Ec 발현이 낮은 것은 위성 세포를 활성화하는 데 실패한 것과 연관되고 있으며, 노화-관련 근손실을 일으키게 된다고 알려져 있다.Deficiencies of active satellite cells and myogenic factors have been associated with muscular dystrophy, and the reduced regenerative ability of aged muscle is also considered to be due to a reduced ability to activate satellite cell proliferation. Moreover, low IGF-1Ec expression in muscle response to mechanical loading is associated with failure to activate satellite cells, and is known to result in age-related muscle loss.
따라서, 본 발명의 상술한 일 양태에 따른 (a) 적어도 하나의 인간 IGF-1(Insulin-Like Growth Factor-1) 이형체; 또는 (b) 상기 적어도 하나의 인간 IGF-1 이형체를 인코딩하는 폴리뉴클레오타이드를 유효성분으로 포함하는 근감소증 예방 또는 치료용 약제학적 조성물을 이용하는 경우, 성숙 IGF-1 단백질뿐만 아니라, E 펩타이드 또한 함께 발현할 수 있으므로, 종래의 단일의 성숙 IGF-1 단백질 또는 단일 종류의 IGF-1이형체만 발현되도록 설계된 유전자 전달 시스템보다 노화, 신경 손상 등 다양한 원인으로 인한 근감소증에 대한 향상된 예방 또는 치료 효과를 발휘할 수 있다.Accordingly, according to the above-described aspect of the present invention, (a) at least one human IGF-1 (Insulin-Like Growth Factor-1) isoform; or (b) when using a pharmaceutical composition for preventing or treating sarcopenia comprising a polynucleotide encoding at least one human IGF-1 isoform as an active ingredient, not only the mature IGF-1 protein but also the E peptide together Since it can express a single mature IGF-1 protein or a single type of IGF-1 isoform, it has an improved preventive or therapeutic effect on sarcopenia due to various causes such as aging and nerve damage than conventional gene delivery systems designed to express only a single mature IGF-1 protein or a single type of IGF-1 isoform. can exert
본 발명의 표현, "유효성분으로 포함하는"이란, (a) 서열번호 11의 아미노산 서열을 포함하는 IGF-1Ea 이형체 및 서열번호 13의 아미노산 서열을 포함하는 IGF-1Ec 이형체; 또는 (b) 상기 IGF-1Ea 이형체를 인코딩하는 폴리뉴클레오타이드 및 상기 IGF-1Ec 이형체를 인코딩하는 폴리뉴클레오타이드의 약리학적 효능 또는 활성을 달성하는 데 충분한 양을 포함하는 것을 의미하며, 약물의 전달, 안정화 및 제제화를 위하여 다양한 성분이 부가적으로 첨가될 수 있는 것을 포함하는 의미이다.The expression of the present invention, "comprising as an active ingredient" means (a) an IGF-1Ea isomer comprising the amino acid sequence of SEQ ID NO: 11 and an IGF-1Ec isomer comprising the amino acid sequence of SEQ ID NO: 13; or (b) an amount sufficient to achieve pharmacological efficacy or activity of the polynucleotide encoding the IGF-1Ea isoform and the polynucleotide encoding the IGF-1Ec isoform, delivery of a drug; It means that various components can be additionally added for stabilization and formulation.
본 명세서의 용어, "예방"은 질환 또는 질환 상태의 방지 또는 보호적인 치료를 의미한다. 본 명세서의 용어, "치료"는 질환 상태의 감소, 억제, 진정 또는 근절을 의미한다.As used herein, the term "prevention" refers to preventive or protective treatment of a disease or disease state. As used herein, the term "treatment" refers to reduction, suppression, sedation or eradication of a disease state.
본 발명의 다른 일 구현예에 있어서, 본 발명의 약제학적 조성물은 약제학적으로 허용 가능한 담체를 추가로 포함할 수 있다.In another embodiment of the present invention, the pharmaceutical composition of the present invention may further include a pharmaceutically acceptable carrier.
본 발명의 용어, "약제학적으로 허용 가능한 담체"는 본 발명이 속하는 기술분야에서 통상적으로 사용되는 것으로 본 발명의 유효성분인 (a) 서열번호 11의 아미노산 서열을 포함하는 IGF-1Ea 이형체 및 서열번호 13의 아미노산 서열을 포함하는 IGF-1Ec 이형체; 또는 (b) 상기 IGF-1Ea 이형체를 인코딩하는 폴리뉴클레오타이드 및 상기 IGF-1Ec 이형체를 인코딩하는 폴리뉴클레오타이드와 약리학적으로 양립할 수 있다.The term of the present invention, "pharmaceutically acceptable carrier" is commonly used in the art to which the present invention pertains, and the active ingredient of the present invention (a) an IGF-1Ea isomer comprising the amino acid sequence of SEQ ID NO: 11 and an IGF-1Ec isoform comprising the amino acid sequence of SEQ ID NO: 13; or (b) is pharmacologically compatible with the polynucleotide encoding the IGF-1Ea isoform and the polynucleotide encoding the IGF-1Ec isoform.
본 발명의 약제학적으로 허용 가능한 담체에는 락토오스, 덱스트로오스, 수크로오스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘, 미네랄 오일 등이 포함되나, 이에 한정되는 것은 아니다.Pharmaceutically acceptable carriers of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose , water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, and the like, but are not limited thereto.
본 발명의 약제학적 조성물은 상기 성분들 이외에 부형제, 안정제, 희석제, 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다. 적합한 약제학적으로 허용 가능한 담체, 운반체, 부형제, 안정제 또는 희석제는 Remington's Pharmaceutical Sciences(19th ed., 1995)에 상세히 기재되어 있다.The pharmaceutical composition of the present invention may further include excipients, stabilizers, diluents, lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, and the like, in addition to the above components. Suitable pharmaceutically acceptable carriers, vehicles, excipients, stabilizers or diluents are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).
본 발명의 약제학적 조성물은 경구 또는 비경구로 투여할 수 있고, 비경구 투여인 경우에는 정맥내(intravenous) 주입, 피하(subcutaneous) 주입, 근육(intramuscular) 주입, 복강(intraperitoneal) 주입, 경피(percutaneous) 투여, 뇌내(intracerebral) 주입, 척수내(intraspinal) 주입 등으로 투여할 수 있다.The pharmaceutical composition of the present invention can be administered orally or parenterally, and in the case of parenteral administration, intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, percutaneous injection ), intracerebral injection, intraspinal injection, etc.
본 발명의 약제학적 조성물의 적합한 투여량은 제제화 방법, 투여방식, 환자의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하며, 보통으로 숙련된 의사는 소망하는 치료 또는 예방에 효과적인 투여량을 용이하게 결정 및 처방할 수 있다. 한편, 본 발명의 약제학적 조성물의 투여량은 바람직하게는 1일 당 0.0001-100 mg/kg(체중)이다.The suitable dosage of the pharmaceutical composition of the present invention varies depending on factors such as formulation method, administration method, patient's age, weight, sex, medical condition, food, administration time, administration route, excretion rate and reaction sensitivity, A ordinarily skilled physician can readily determine and prescribe dosages effective for the desired treatment or prophylaxis. On the other hand, the dosage of the pharmaceutical composition of the present invention is preferably 0.0001-100 mg/kg (body weight) per day.
본 발명의 약제학적 조성물은 당해 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약제학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다. 이때 제형은 오일 또는 수성 매질중의 용액, 현탁액 또는 유화액 형태이거나 엑스제, 분말제, 과립제, 정제 또는 캅셀제 형태일 수도 있으며, 분산제 또는 안정화제를 추가적으로 포함할 수 있다.The pharmaceutical composition of the present invention is prepared in unit dosage form by formulation using a pharmaceutically acceptable carrier and/or excipient according to a method that can be easily performed by those skilled in the art. or it may be prepared by incorporating into a multi-dose container. In this case, the formulation may be in the form of a solution, suspension or emulsion in an oil or aqueous medium, or may be in the form of an extract, powder, granule, tablet or capsule, and may additionally contain a dispersing agent or stabilizer.
본 발명의 일 구현예에 있어서, 상기 IGF-1Ea 이형체를 인코딩하는 폴리뉴클레오타이드는 서열번호 12의 뉴클레오타이드 서열을 포함한다.In one embodiment of the present invention, the polynucleotide encoding the IGF-1Ea isoform includes the nucleotide sequence of SEQ ID NO: 12.
본 발명의 일 구현예에 있어서, 상기 IGF-1Ec 이형체를 인코딩하는 폴리뉴클레오타이드는 서열번호 14의 뉴클레오타이드 서열을 포함한다.In one embodiment of the present invention, the polynucleotide encoding the IGF-1Ec isoform includes the nucleotide sequence of SEQ ID NO: 14.
본 발명의 일 구현예에 있어서, 상기 IGF-1Ea 이형체 및 상기 IGF-1Ec 이형체는 별도의 뉴클레오타이드 서열에 의해 인코딩된다.In one embodiment of the present invention, the IGF-1Ea isoform and the IGF-1Ec isoform are encoded by separate nucleotide sequences.
본 발명의 일 구현예에 있어서, 상기 IGF-1Ea 이형체 및 상기 IGF-1Ec 이형체는 단일의 뉴클레오타이드 서열에 의해 인코딩된다.In one embodiment of the present invention, the IGF-1Ea isoform and the IGF-1Ec isoform are encoded by a single nucleotide sequence.
본 발명의 약제학적 조성물은 IGF-1의 서로 다른 종류의 두 개의 이형체들이 별도의 폴리뉴클레오타이드에 의하여 인코딩되는 경우 둘 이상의 폴리뉴클레오타이드를 포함하고, IGF-1의 서로 다른 종류의 두 개의 이형체들이 단일의 폴리뉴클레오타이드에 의하여 인코딩되는 경우에는 상기 단일의 폴리뉴클레오타이드를 포함하는 하나 이상의 폴리뉴클레오타이드를 포함한다. 본 발명의 폴리뉴클레오타이드는 IGF-1 이형체들의 발현을 조절하는 하나 이상의 조절 서열(예컨대, 프로모터 및/또는 인핸서)에 작동가능하게 연결될 수 있다.The pharmaceutical composition of the present invention includes two or more polynucleotides when the two isoforms of different types of IGF-1 are encoded by separate polynucleotides, and the two isoforms of different types of IGF-1 are encoded by separate polynucleotides. When encoded by a single polynucleotide, it includes one or more polynucleotides including the single polynucleotide. A polynucleotide of the invention may be operably linked to one or more regulatory sequences (eg, a promoter and/or enhancer) that control expression of IGF-1 isoforms.
IGF-1의 서로 다른 종류의 두 개 이상의 이형체들이 별도의 폴리뉴클레오타이드에 의하여 인코딩되는 경우, 두 가지 방식으로 발현 카세트를 구축할 수 있다. 첫 번째 방식에서는, 이형체 각각에 대한 CDS(coding sequence)에 발현 조절 서열을 연결하여 발현 카세트를 구축한다. 두 번째 방식에서는, "(1) 발현 조절 서열 - (2) 제1이형체 CDS - (3) IRES(internal ribosomal entry site) - (4) 제2이형체 CDS - (5) 전사 종결 서열"의 순서로 IRES 또는 2A 펩타이드를 이용하여 발현 카세트를 구축한다. IRES 서열은 두 개의 상이한 IGF-1 이형체의 CDS 사이에 위치하여, 단일 전사체로부터 두 가지의 단백질 생성물이 발현될 수 있게 하는데, 보다 상세하게는 유전자의 번역이 IRES 서열에서 시작되도록 함으로써, 2개 이상의 관심 유전자가 동일한 컨스트럭트(construct)에서 발현되도록 한다.When two or more isoforms of different types of IGF-1 are encoded by separate polynucleotides, expression cassettes can be constructed in two ways. In the first method, an expression cassette is constructed by linking an expression control sequence to a coding sequence (CDS) for each isoform. In the second way, "(1) expression control sequence - (2) first heteromeric CDS - (3) IRES (internal ribosomal entry site) - (4) second heteromeric CDS - (5) transcription termination sequence" Expression cassettes are constructed using IRES or 2A peptides in sequence. The IRES sequence is located between the CDS of two different IGF-1 isoforms, allowing the expression of both protein products from a single transcript, more specifically by allowing translation of a gene to begin at the IRES sequence, More than one gene of interest is allowed to be expressed from the same construct.
IGF-1의 서로 다른 종류의 두 개 이상의 이형체들이 단일의 폴리뉴클레오타이드에 의하여 인코딩되는 경우, 상기 서로 다른 종류의 두 개 이상의 이형체들을 모두 인코딩하고 있는 폴리뉴클레오타이드는 단일의 발현 조절 서열에 작동가능하게 연결된다.When two or more isoforms of different types of IGF-1 are encoded by a single polynucleotide, the polynucleotide encoding both of the two or more different types of isoforms can operate on a single expression control sequence. are connected
본 발명의 다른 일 양태에 따르면, 본 발명은 i) 서열번호 1의 뉴클레오타이드 서열 또는 이의 축퇴성 서열(degenerate sequence); ii) 서열번호 2의 뉴클레오타이드 서열 또는 이의 단편(fragment); iii) 서열번호 3의 뉴클레오타이드 서열 또는 이의 축퇴성 서열; iv) 서열번호 4의 뉴클레오타이드 서열 또는 이의 단편; 및 v) 서열번호 5의 뉴클레오타이드 서열 또는 이의 축퇴성 서열이 순차적으로 5'에서 3'순서로 연결된 단일의 폴리뉴클레오타이드를 유효성분으로 포함하는 근감소증 예방 또는 치료용 약제학적 조성물을 제공한다.According to another aspect of the present invention, the present invention provides i) the nucleotide sequence of SEQ ID NO: 1 or a degenerate sequence thereof; ii) the nucleotide sequence of SEQ ID NO: 2 or a fragment thereof; iii) the nucleotide sequence of SEQ ID NO: 3 or a degenerate sequence thereof; iv) the nucleotide sequence of SEQ ID NO: 4 or a fragment thereof; and v) a pharmaceutical composition for preventing or treating sarcopenia comprising, as an active ingredient, a single polynucleotide in which the nucleotide sequence of SEQ ID NO: 5 or a degenerate sequence thereof is sequentially linked in 5' to 3' order.
본 발명의 일 구현예에 있어서, 상기 i)의 뉴클레오타이드 서열은 IGF-1의 엑손 1, 3 및 4를 인코딩하는 뉴클레오타이드 서열이고, 상기 ii)의 뉴클레오타이드 서열은 IGF-1의 인트론 4이고, 상기 iii)의 뉴클레오타이드 서열은 IGF-1의 엑손 5 및 6-1을 인코딩하는 뉴클레오타이드 서열이고, 상기 iv)의 뉴클레오타이드 서열은 IGF-1의 인트론 5이고, 상기 v)의 뉴클레오타이드 서열은 IGF-1의 엑손 6-2를 인코딩하는 뉴클레오타이드 서열이다.In one embodiment of the present invention, the nucleotide sequence of i) is a nucleotide sequence encoding exons 1, 3 and 4 of IGF-1, the nucleotide sequence of ii) is intron 4 of IGF-1, and the nucleotide sequence of iii) The nucleotide sequence of ) is a nucleotide sequence encoding exons 5 and 6-1 of IGF-1, the nucleotide sequence of iv) is intron 5 of IGF-1, and the nucleotide sequence of v) is exon 6 of IGF-1 is the nucleotide sequence encoding -2.
본 발명자들은 상기 순서로 뉴클레오타이드 서열을 설계함으로써, 상이한 두 종류의 IGF-1 이형체를 동시에 발현할 수 있는 단일의 뉴클레오타이드 서열을 구축하였다. 상기 단일의 폴리뉴클레오타이드 서열은 IGF-1Ea 및 IGF-1Ec 이형체가 동일하게 포함하는 신호 펩타이드 및 성숙 IGF-1 펩타이드를 인코딩하는 뉴클레오타이드를 포함하고, IGF-1Ea 및 IGF-1Ec 이형체가 상이하게 포함하는 E 펩타이드를 인코딩하는 뉴클레오타이드를 모두 포함한다. 특히, 상이하게 포함하는 E 펩타이드를 인코딩하는 뉴클레오타이드들 사이에, 즉 본 발명의 엑손 6-1 및 엑손 6-2 사이에 인트론 5를 삽입함으로써, 선택적 스플라이싱에 따라, 단일의 폴리뉴클레오타이드로부터 상이한 IGF-1 이형체, IGF-1Ea 및 IGF-Ec를 발현할 수 있다. The present inventors constructed a single nucleotide sequence capable of simultaneously expressing two different types of IGF-1 isoforms by designing the nucleotide sequence in the above order. The single polynucleotide sequence includes nucleotides encoding a signal peptide and a mature IGF-1 peptide, which are identically included by IGF-1Ea and IGF-1Ec isoforms, and are differentially included by IGF-1Ea and IGF-1Ec isoforms. Includes all nucleotides that encode the peptide. In particular, by inserting intron 5 between the nucleotides encoding the E peptides that differentially comprise, i.e., between exon 6-1 and exon 6-2 of the present invention, according to alternative splicing, different polynucleotides from a single polynucleotide can be obtained. It can express IGF-1 isoforms, IGF-1Ea and IGF-Ec.
상기 단일의 뉴클레오타이드가 IGF-1의 엑손 1, 3, 4 및 6-2의 조합으로 스플라이싱되면, Ea 펩타이드를 발현하게 되므로, IGF-1Ea 이형체를 발현하게 된다. When the single nucleotide is spliced into a combination of exons 1, 3, 4, and 6-2 of IGF-1, the Ea peptide is expressed, and thus the IGF-1Ea isoform is expressed.
상기 단일의 뉴클레오타이드가 IGF-1의 엑손 1, 3, 4, 5 및 6-1의 조합으로 스플라이싱되면, Ec 펩타이드를 발현하게 되므로, IGF-1Ec 이형체를 발현하게 된다.When the single nucleotide is spliced into a combination of exons 1, 3, 4, 5, and 6-1 of IGF-1, the Ec peptide is expressed, and thus the IGF-1Ec isoform is expressed.
본 발명의 용어, "축퇴성 서열(degenerate sequence)"이란, 레퍼런스 뉴클레오타이드 서열로부터 번역된 것과 동일한 아미노산 서열을 제공하도록 번역될 수 있는 뉴클레오타이드 서열을 의미한다.As used herein, "degenerate sequence" refers to a nucleotide sequence that can be translated to provide an amino acid sequence identical to that translated from a reference nucleotide sequence.
본 발명의 바람직한 일 구현예에 있어서, IGF-1 이형체들은 서로 다른 종류의 두 개 이상의 이형체들, 예컨대 IGF-1Ea 및 IGF-1Ec를 동시에 발현하는 플라스미드 DNA 컨스트럭트에 의해 인코딩될 수 있다.In a preferred embodiment of the present invention, IGF-1 isoforms can be encoded by a plasmid DNA construct that simultaneously expresses two or more isoforms of different types, such as IGF-1Ea and IGF-1Ec. .
본 발명의 일 구현예에 따른 별도의 뉴클레오타이드 서열에 의해 인코딩되는 IGF-1Ea 이형체 및 IGF-1Ec 이형체와 본 발명의 다른 일 구현예에 따른 단일의 뉴클레오타이드 서열에 의해 인코딩되는 IGF-1Ea 이형체 및 IGF-1Ec 이형체는, 단일의 뉴클레오타이드 서열에 의해 인코딩되는 각각의 IGF-1의 단일 이형체, 즉 IGF-1Ea 이형체 또는 IGF-1Ec 이형체와 비교하여, 총 IGF-1 이형체의 전사 수준과 이의 단백질 발현량이 높아, 결국 성숙 IGF-1 단백질을 더 높은 수준으로 발현한다.IGF-1Ea isoforms and IGF-1Ec isoforms encoded by separate nucleotide sequences according to one embodiment of the present invention and IGF-1Ea isoforms encoded by a single nucleotide sequence according to another embodiment of the present invention and IGF-1Ec isoforms, compared to a single isoform of each IGF-1 encoded by a single nucleotide sequence, i.e. IGF-1Ea isoform or IGF-1Ec isoform, transcription of total IGF-1 isoforms. levels and their protein expression are high, resulting in higher levels of mature IGF-1 protein.
본 발명의 일 구현예에 있어서, 상기 ii)의 뉴클레오타이드 서열의 단편은 서열번호 6의 뉴클레오타이드 서열이다.In one embodiment of the present invention, the fragment of the nucleotide sequence of ii) is the nucleotide sequence of SEQ ID NO: 6.
본 발명의 일 구현예에 있어서, 상기 ii)의 뉴클레오타이드 서열의 단편은 서열번호 7의 뉴클레오타이드 서열이다.In one embodiment of the present invention, the fragment of the nucleotide sequence of ii) is the nucleotide sequence of SEQ ID NO: 7.
본 발명의 일 구현예에 있어서, 상기 iv)의 뉴클레오타이드 서열의 단편은 서열번호 8의 뉴클레오타이드 서열이다.In one embodiment of the present invention, the fragment of the nucleotide sequence of iv) is the nucleotide sequence of SEQ ID NO: 8.
본 발명의 일 구현예에 있어서, 본 발명에 따른 폴리뉴클레오타이드는 네이키드 DNA(naked DNA)이거나 또는 유전자 운반체에 포함되어 있다.In one embodiment of the present invention, the polynucleotide according to the present invention is naked DNA or contained in a gene carrier.
본 발명의 일 구체예에 있어서, 상기 유전자 운반체는 벡터이다.In one embodiment of the present invention, the gene carrier is a vector.
본 발명의 일 구체예에 있어서, 상기 벡터는 플라스미드이다.In one embodiment of the present invention, the vector is a plasmid.
본 발명의 일 구체예에 있어서, 상기 벡터는 바이러스 벡터이다.In one embodiment of the present invention, the vector is a viral vector.
본 발명의 일 구체예에 있어서, 상기 플라스미드는 pCK, pCP, pVAXl, pCY, 또는 pTx이다. In one embodiment of the present invention, the plasmid is pCK, pCP, pVAXl, pCY, or pTx.
IGF-1Ea 및 IGF-1Ec을 모두 발현할 수 있는 플라스미드 DNA를 pCK 또는 pTx 벡터를 이용하여 제작하였고, 이의 세부 사항은 대한민국 공개특허 제10-2021-0025122호 및 제10-2021-0052443호에 기재된 내용을 참조하였으며, 이의 전문은 본원에 참조로 포함되어 있다.Plasmid DNA capable of expressing both IGF-1Ea and IGF-1Ec was constructed using pCK or pTx vectors, details of which are described in Korean Patent Publication Nos. 10-2021-0025122 and 10-2021-0052443. Reference is made to the contents, the entire contents of which are incorporated herein by reference.
본 발명의 바람직한 일 구체예에 있어서, 상기 플라스미드는 pCK이다. 본 발명의 pCK는 서열번호 15의 플라스미드 벡터이다. 상기 pCK의 상세한 내용은 WO 2000/040737 및 Lee et al., Biochem. Biophys. Res. Comm. 272:230-235(2000)에서 참조할 수 있다. 간략히 설명하자면, pCK (ToplO-pCK)로 형질전환된 E. coli를 부다페스트 조약하에서, 한국 미생물 보존센터(KCCM)에 2003년 3월 21일에 기탁하였다(수탁번호: KCCM-10476). WO 2000/040737 및 Lee et al., Biochem. Biophys. Res. Commun. 272: 230 (2000)에 상세히 개시된 바와 같이, 상기 pCK 벡터는 유전자, 예를 들어, IGF-1Ea 및 IGF-1Ec 유전자의 발현이 인간 거대분자바이러스(HCMV, Human cytomegalovirus)의 인핸서/프로모터 하에서 제어되도록 제작된다. 상기 pCK 벡터는 인체 임상 시험에서 그 안전성과 효율이 확인되었다(Henry et al., Gene Ther. 18:788 (2011)).In one preferred embodiment of the present invention, the plasmid is pCK. The pCK of the present invention is a plasmid vector of SEQ ID NO: 15. Details of the pCK are described in WO 2000/040737 and Lee et al. , Biochem. Biophys. Res. Comm. 272:230-235 (2000). Briefly, E. coli transformed with pCK (ToplO-pCK) was deposited with the Korean Microorganism Conservation Center (KCCM) on March 21, 2003 under the Budapest Treaty (accession number: KCCM-10476). WO 2000/040737 and Lee et al. , Biochem. Biophys. Res. Commun. 272: 230 (2000), the pCK vector is such that expression of genes, eg, IGF-1Ea and IGF-1Ec genes, is controlled under the enhancer/promoter of human cytomegalovirus (HCMV). is produced The safety and efficiency of the pCK vector was confirmed in human clinical trials (Henry et al. , Gene Ther. 18:788 (2011)).
본 발명의 바람직한 다른 일 구체예에 있어서, 상기 IGF-1Ea 이형체 및 IGF-1Ec 이형체를 인코딩하는 뉴클레오타이드 서열은 pCK 플라스미드에 클로닝되어 있다.In another preferred embodiment of the present invention, the nucleotide sequences encoding the IGF-1Ea isoform and the IGF-1Ec isoform are cloned into a pCK plasmid.
본 발명의 특히 바람직한 일 구체예에 있어서, 상기 플라스미드는 pTx이다. 상기 pTx의 상세한 내용은 대한민국 공개특허 제10-2021-0025122호(공개일자 2021년 03월 08일) 및 10-2021-0052443호(공개일자 2021년 05월 10일)에서 참조할 수 있다. 보다 구체적으로, 상기 플라스미드 pTx는 pCK로부터 유래된, 서열번호 16의 플라스미드 벡터이다. 상기 pTx는 pCK를 두 번 연속 돌연변이 유발함으로써 생성된다. 결손 돌연변이 유발 PCR을 수행하여 pCK의 카나마이신 내성 유전자 및 ColEl 사이의 불필요한 서열을 제거하였다.In one particularly preferred embodiment of the present invention, the plasmid is pTx. Details of the pTx can be referred to Korean Patent Publication Nos. 10-2021-0025122 (published on March 08, 2021) and 10-2021-0052443 (published on May 10, 2021). More specifically, the plasmid pTx is a plasmid vector of SEQ ID NO: 16 derived from pCK. The pTx is generated by twice consecutive mutagenesis of pCK. Defective mutagenesis PCR was performed to remove unnecessary sequences between the kanamycin resistance gene of pCK and ColEl.
본 발명의 보다 바람직한 일 구체예에 있어서, 상기 IGF-1Ea 이형체 및 상기 IGF-1Ec 이형체는 서열번호 16으로 구성된 pTx 플라스미드에 클로닝되어 있다. 예를 들어, ClaI 효소로 5'에서 및 Sal1 효소로 3'에서 절단한 pTx에서 IGF-1Ea 및/또는 IGF-1Ec를 라이게이션함으로써 클로닝할 수 있다.In a more preferred embodiment of the present invention, the IGF-1Ea isoform and the IGF-1Ec isoform are cloned into a pTx plasmid composed of SEQ ID NO: 16. For example, cloning can be performed by ligation of IGF-1Ea and/or IGF-1Ec from pTx cleaved 5' with Cla I enzyme and 3' with Sal 1 enzyme.
본 발명의 폴리뉴클레오타이드는 네이키드 DNA이거나 또는 유전자 운반체에 포함될 수 있다.The polynucleotide of the present invention may be naked DNA or included in a gene carrier.
본 발명의 일 구체예에 있어서, 상기 폴리뉴클레오타이드는 단일의 또는 별도의 폴리뉴클레오타이드이다. In one embodiment of the present invention, the polynucleotide is a single or separate polynucleotide.
보다 구체적으로, 본 발명의 유효성분인 상기 IGF-1Ea 이형체를 인코딩하는 폴리뉴클레오타이드 및 상기 IGF-1Ec 이형체를 인코딩하는 폴리뉴클레오타이드는 단일의 폴리뉴클레오타이드이다.More specifically, the polynucleotide encoding the IGF-1Ea isomer, which is the active ingredient of the present invention, and the polynucleotide encoding the IGF-1Ec isomer are a single polynucleotide.
본 발명의 구체적인 일 구체예에 있어서, 상기 단일의 폴리뉴클레오타이드는 서열번호 9의 단일의 폴리뉴클레오타이드를 포함한다.In one specific embodiment of the present invention, the single polynucleotide includes a single polynucleotide of SEQ ID NO: 9.
본 발명의 구체적인 일 구체예에 있어서, 상기 단일의 폴리뉴클레오타이드는 서열번호 10의 단일의 폴리뉴클레오타이드를 포함한다.In one specific embodiment of the present invention, the single polynucleotide includes a single polynucleotide of SEQ ID NO: 10.
본 발명의 바람직한 일 구체예에 있어서, 본 발명의 유효성분은 IGF-1을 발현하는 플라스미드 DNA로, 이는 서열번호 16의 pTx 벡터 및 상기 pTx 벡터에 클로닝된 서열번호 9의 뉴클레오타이드 서열을 포함한다.In one preferred embodiment of the present invention, the active ingredient of the present invention is a plasmid DNA expressing IGF-1, which includes the pTx vector of SEQ ID NO: 16 and the nucleotide sequence of SEQ ID NO: 9 cloned into the pTx vector.
본 발명의 바람직한 일 구체예에 있어서, 본 발명의 유효성분은 IGF-1을 발현하는 플라스미드 DNA로, 이는 서열번호 16의 pTx 벡터 및 상기 pTx 벡터에 클로닝된 서열번호 10의 뉴클레오타이드 서열을 포함한다.In a preferred embodiment of the present invention, the active ingredient of the present invention is a plasmid DNA expressing IGF-1, which includes the pTx vector of SEQ ID NO: 16 and the nucleotide sequence of SEQ ID NO: 10 cloned into the pTx vector.
본 발명의 용어, "IGF-1-X 시리즈"란, RNA 전사체의 선택적 스플라이싱을 통해서 클래스 I IGF-1Ea (즉, IGF1-1Ea) 및 클래스 I IGF-1Ec (즉, IGF1-1Ec) 두 개의 이형체를 동시에 발현하도록 설계된 플라스미드를 의미한다. 예를 들어, 서열번호 9으로 구성된 IGF-1-X6, 서열번호 10으로 구성된 IGF-1-X10 등이 있다.The term "IGF-1-X series" of the present invention refers to class I IGF-1Ea (i.e., IGF1-1Ea) and class I IGF-1Ec (i.e., IGF1-1Ec) through alternative splicing of RNA transcripts. It refers to a plasmid designed to simultaneously express two isoforms. For example, there are IGF-1-X6 composed of SEQ ID NO: 9, IGF-1-X10 composed of SEQ ID NO: 10, and the like.
본 발명의 보다 바람직한 일 구체예에 있어서, 본 발명의 유효성분은 IGF-1을 발현하는 플라스미드 DNA로, 이는 서열번호 17의 뉴클레오타이드 서열(pTx-IGF-1-X10)을 포함한다.In a more preferred embodiment of the present invention, the active ingredient of the present invention is a plasmid DNA expressing IGF-1, which includes the nucleotide sequence of SEQ ID NO: 17 (pTx-IGF-1-X10).
본 발명의 다른 바람직한 일 구체예에 있어서, 본 발명의 유효성분은 IGF-1을 발현하는 플라스미드 DNA로, 이는 서열번호 19의 뉴클레오타이드 서열(pTx-IGF-1-X6)을 포함한다.In another preferred embodiment of the present invention, the active ingredient of the present invention is a plasmid DNA expressing IGF-1, which includes the nucleotide sequence of SEQ ID NO: 19 (pTx-IGF-1-X6).
본 발명의 바람직한 다른 일 구체예에 있어서, 본 발명의 유효성분은 IGF-1을 발현하는 플라스미드 DNA로, 이는 서열번호 15의 pCK 벡터 및 상기 pCK 벡터에 클로닝된 서열번호 9의 뉴클레오타이드 서열을 포함한다.In another preferred embodiment of the present invention, the active ingredient of the present invention is a plasmid DNA expressing IGF-1, which includes the pCK vector of SEQ ID NO: 15 and the nucleotide sequence of SEQ ID NO: 9 cloned into the pCK vector. .
본 발명의 바람직한 다른 일 구체예에 있어서, 본 발명의 유효성분은 IGF-1을 발현하는 플라스미드 DNA로, 이는 서열번호 15의 pCK 벡터 및 상기 pCK 벡터에 클로닝된 서열번호 10의 뉴클레오타이드 서열을 포함한다.In another preferred embodiment of the present invention, the active ingredient of the present invention is a plasmid DNA expressing IGF-1, which includes the pCK vector of SEQ ID NO: 15 and the nucleotide sequence of SEQ ID NO: 10 cloned into the pCK vector. .
당업자라면 상기 pTx 벡터 및 pCK 벡터의 MCS(multiple cloning site), 즉 제한효소부위(restriction enzyme site)를 적절히 선택하거나, MCS의 일부 염기 서열을 필요에 따라 변경함으로써, IGF-1-X 시리즈의 발현을 위한 플라스미드를 구축할 수 있다. 예를 들어, 서열번호 18 및 서열번호 20은 서열번호 15의 pCK 벡터 MCS 부위를 적절히 선택하거나 변경함으로써 제조한 IGF-1 이형체 발현 플라스미드이다.A person skilled in the art can express the IGF-1-X series by appropriately selecting the multiple cloning site (MCS) of the pTx vector and the pCK vector, that is, the restriction enzyme site, or by changing some of the nucleotide sequences of the MCS as necessary. A plasmid can be constructed for For example, SEQ ID NO: 18 and SEQ ID NO: 20 are IGF-1 isoform expression plasmids prepared by appropriately selecting or altering the MCS region of the pCK vector of SEQ ID NO: 15.
구체적으로, 서열번호 15에 제시된 pCK 벡터 뉴클레오타이드 서열에서 1575번 내지 1642번 염기인, ggtacc gagctcggat ccactagtcc agtgtggtgg aattctgcag atatccagca cagtggcggc cg는 pCK 벡터의 MCS 부위 서열이고, 이의 제한효소부위를 적절히 선택하거나 일부 염기 서열을 적절히 변경함으로써, 서열번호 18에 제시된 pCK-IGF-1-X10의 뉴클레오타이드 서열에서 변경된 MCS 서열인 1575번 내지 1580번 염기인 atcgat 및 서열에서 2439번 내지 2444번 염기인 gtcgac 사이에 IGF-1-X10을 인코딩하는 뉴클레오타이드 서열이 삽입되어 있다. 또한, 서열번호 20에 제시된 pCK-IGF-1-X6의 뉴클레오타이드 서열에서 1575번 내지 1580번 염기인 atcgat 및 서열에서 2514번 내지 2518번 염기인 gtcgac 사이에 IGF-1-X6을 인코딩하는 뉴클레오타이드 서열이 삽입되어 있다.Specifically, ggtacc gagctcggat ccactagtcc agtgtggtgg aattctgcag atatccagca cagtggcggc cg, which is bases 1575 to 1642 in the pCK vector nucleotide sequence shown in SEQ ID NO: 15, is the MCS region sequence of the pCK vector, and its restriction enzyme site is appropriately selected or some base sequences are selected. By appropriately changing, in the nucleotide sequence of pCK-IGF-1-X10 shown in SEQ ID NO: 18, IGF-1-X10 A nucleotide sequence encoding is inserted. In addition, the nucleotide sequence encoding IGF-1-X6 between atcgat, which is bases 1575 to 1580 in the nucleotide sequence of pCK-IGF-1-X6 shown in SEQ ID NO: 20, and gtcgac, which is bases 2514 to 2518 in the sequence, is inserted
또한, 서열번호 16에 제시된 pTx 벡터 뉴클레오타이드 서열에서 1148번 내지 1215번 염기인, aag cttatcgatt gaattccccg gggatcccga tcggtcgacc tcgagtctag agggcccgtt taaa c는 pTx 벡터의 MCS 부위 서열이고, 상술한 바와 같이, 이의 제한효소부위를 적절히 선택하거나 일부 염기 서열을 적절히 변경함으로써, 일부 변경된 MCS 서열을 갖는 IGF-1-X 시리즈 발현을 위한 플라스미드를 구축할 수 있음은 당업자에게 자명할 것이다.In addition, aag cttatcgatt gaattccccg gggatcccga tcggtcgacc tcgagtctag agggcccgtt taaa c, which are bases 1148 to 1215 in the nucleotide sequence of the pTx vector shown in SEQ ID NO: 16, is the MCS region sequence of the pTx vector, and as described above, the restriction enzyme site thereof is appropriately selected. It will be apparent to those skilled in the art that a plasmid for expressing the IGF-1-X series having a partially altered MCS sequence can be constructed by appropriately altering the nucleotide sequence or partially altering the nucleotide sequence.
본 발명의 또 다른 바람직한 일 구체예에 있어서, 본 발명의 유효성분은 IGF-1을 발현하는 플라스미드 DNA로, 이는 서열번호 18의 뉴클레오타이드 서열(pCK-IGF-1-X10)을 포함한다.In another preferred embodiment of the present invention, the active ingredient of the present invention is a plasmid DNA expressing IGF-1, which includes the nucleotide sequence of SEQ ID NO: 18 (pCK-IGF-1-X10).
본 발명의 다른 바람직한 일 구체예에 있어서, 본 발명의 유효성분은 IGF-1을 발현하는 플라스미드 DNA로, 이는 서열번호 20의 뉴클레오타이드 서열(pCK-IGF-1-X6)을 포함한다.In another preferred embodiment of the present invention, the active ingredient of the present invention is a plasmid DNA expressing IGF-1, which includes the nucleotide sequence of SEQ ID NO: 20 (pCK-IGF-1-X6).
본 발명의 일 구체예에 있어서, 상기 바이러스 벡터는 레트로바이러스 벡터, 렌티바이러스 벡터, 아데노바이러스 벡터, 아데노 연관 바이러스(AAV) 벡터, 백시니아 바이러스 벡터, 헤르페스 심플렉스 바이러스 벡터 등이 예시되나 이에 한정되는 것은 아니며, 각각의 시판품을 사용할 수 있다. In one embodiment of the present invention, the viral vector is exemplified by a retrovirus vector, a lentivirus vector, an adenovirus vector, an adeno-associated virus (AAV) vector, a vaccinia virus vector, a herpes simplex virus vector, etc., but is limited thereto It is not necessary, and each commercially available product can be used.
본 발명의 일 구현예에 있어서, 상기 아데노바이러스 벡터는 42개의 상이한 혈청형 및 A-F의 서브그룹을 갖는다. 본 발명의 구체적인 구현예에 있어서, 상기 아데노바이러스 벡터로는 서브그룹 C에 속하는 아데노바이러스 타입 5가 사용될 수 있으나 이에 한정되는 것은 아니다. 아데노바이러스 타입 5에 대한 생화학적 및 유전적 정보는 잘 알려져 있다. 아데노바이러스에 의해 운반되는 외래 유전자는 에피좀과 동일한 방식으로 복제되며, 이에 숙주세포에 대해 유전적 독성이 매우 낮다. 따라서, 아데노바이러스 유전자 전달 시스템을 이용한 유전자 치료는 안전할 것으로 판단된다.In one embodiment of the present invention, the adenovirus vectors have 42 different serotypes and subgroups A-F. In a specific embodiment of the present invention, adenovirus type 5 belonging to subgroup C may be used as the adenovirus vector, but is not limited thereto. Biochemical and genetic information about adenovirus type 5 is well known. Foreign genes carried by adenovirus are replicated in the same way as episomes, and thus have very low genetic toxicity to host cells. Therefore, gene therapy using the adenoviral gene delivery system is considered to be safe.
본 발명의 일 구현예에 있어서, 상기 바이러스 벡터는 아데노-연관 바이러스(Adeno-associated virus, AAV) 벡터이다. 아데노-연관 바이러스(Adeno-associated virus, AAV) 벡터는 비분열 세포를 감염시킬 수 있고, 다양한 종류의 세포에 감염할 수 있는 능력을 갖고 있기 때문에 본 발명의 유전자 전달 시스템으로 적합하다. AAV 벡터의 제조 및 용도에 대한 상세한 설명은 미국 특허 제5,139,941 호 및 제4,797,368 호에 상세하게 개시되어 있다.In one embodiment of the present invention, the viral vector is an adeno-associated virus (AAV) vector. Adeno-associated virus (AAV) vectors are suitable for the gene delivery system of the present invention because they can infect non-dividing cells and have the ability to infect various types of cells. Detailed descriptions of the production and use of AAV vectors are disclosed in detail in US Pat. Nos. 5,139,941 and 4,797,368.
유전자 전달 시스템으로서의 AAV에 대한 연구는 LaFace et al, Viology, 162:483486 (1988), Zhou et al., Exp. Hematol. (NY), 21:928-933 (1993), Walsh et al, J. Clin. Invest., 94:1440-1448 (1994) 및 Flotte et al., Gene Therapy, 2:29-37 (1995)에 개시되어 있다. Studies of AAV as a gene delivery system are described in LaFace et al, Viology, 162:483486 (1988), Zhou et al., Exp. Hematol. (NY), 21:928-933 (1993), Walsh et al, J. Clin. Invest., 94:1440-1448 (1994) and Flotte et al., Gene Therapy, 2:29-37 (1995).
전형적으로, AAV 바이러스는 두 개의 AAV 말단 리피트가 옆에 위치되어 있는 타겟 유전자 서열을 포함하는 플라스미드 (McLaughlin et al., J. Virol., 62:1963-1973 (1988); 및 Samulski et al., J. Virol., 63:3822- 3828 (1989)) 및 말단 리피트가 없는 야생형 AAV 코딩 서열을 포함하는 발현 플라스미드 (McCarty et al., J. Virol., 65:2936-2945 (1991))를 동시 전달(transfection)하여 제조된다.Typically, an AAV virus is a plasmid containing a target gene sequence flanked by two AAV terminal repeats (McLaughlin et al., J. Virol., 62:1963-1973 (1988); and Samulski et al., J. Virol., 63:3822-3828 (1989)) and an expression plasmid containing wild-type AAV coding sequence without end repeats (McCarty et al., J. Virol., 65:2936-2945 (1991)). It is prepared by transfection.
상기 AAV 벡터는 당업계에 공지된 다양한 바이러스 감염 방법에 따라 외래 유전자 서열을 세포 내로 운반하는데 이용될 수 있으며, 그 방법은 특별히 제한되지 않는다. 본 발명의 AAV 벡터는 AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15 및 AAV16으로 이루어진 군으로부터 선택되는 AAV serotype을 갖는다. 상기 AAV는 serotype AAV1, AAV2, AAV5, 및 AAV6로 이루어진 군으로부터 선택될 수 있다.The AAV vector may be used to transfer a foreign gene sequence into cells according to various viral infection methods known in the art, and the method is not particularly limited. The AAV vector of the present invention has an AAV serotype selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15 and AAV16. The AAV may be selected from the group consisting of serotypes AAV1, AAV2, AAV5, and AAV6.
본 발명의 폴리뉴클레오타이드 서열이 바이러스 벡터에 기초하여 제작된 경우에는 당업계에 공지된 다양한 바이러스 감염 방법에 따라 외래 유전자 서열을 세포 내로 운반할 수 있으며, 그 방법은 특별히 제한되지 않는다.When the polynucleotide sequence of the present invention is prepared based on a viral vector, the foreign gene sequence can be transferred into cells according to various viral infection methods known in the art, and the method is not particularly limited.
본 발명의 폴리뉴클레오타이드 서열을 상술한 AAV 벡터를 이용하여 적절한 숙주 세포, 예를 들어, 293T와 같은 포유동물세포(mammalian cell) 또는 곤충세포(insect cell) 등에 형질 전환시킬 수 있고, 형질 전환된 숙주 세포를 이용하여 본 발명의 유전자의 DNA를 대량으로 복제하거나 단백질을 대량 생산할 수 있다.The polynucleotide sequence of the present invention can be transformed into an appropriate host cell, for example, a mammalian cell such as 293T or an insect cell, using the above-described AAV vector, and the transformed host The DNA of the gene of the present invention can be copied in large quantities or proteins can be mass-produced using cells.
본 발명의 일 구현예에 있어서, 본 발명의 근감소증(sarcopenia)은 영양실조(malnutrition), 노화(aging), 부동성(immobility), 근육손상(muscle injury), 신경 손상(nerve injury), 척수손상(spinal cord injury), 암(cancer), 뇌졸중(stroke), 또는 악액질(cachexia)에 의한 것일 수 있으나, 이에 반드시 제한되는 것은 아니다. 본 발명의 구체적인 일 구현예에 있어서, 본 발명의 근감소증은 근육손상, 신경 손상, 또는 노화에 의한 것이다.In one embodiment of the present invention, sarcopenia of the present invention is malnutrition, aging, immobility, muscle injury, nerve injury, spinal cord injury It may be caused by spinal cord injury, cancer, stroke, or cachexia, but is not necessarily limited thereto. In a specific embodiment of the present invention, the sarcopenia of the present invention is caused by muscle damage, nerve damage, or aging.
본 발명의 용어, "영양실조(malnutrition)"란, 섭취하거나 흡수하는 에너지 대비 소비하는 에너지가 많을 때 생기는 상태로, 부족한 영양 공급으로 인한 일차적인 영양실조와 충분한 영양 공급에도 급성 또는 만성 질환으로 영양 결핍이 생긴 이차적인 영양실조를 모두 포함하는 의미이다.The term of the present invention, "malnutrition" is a condition that occurs when energy consumed is higher than that consumed or absorbed, primary malnutrition due to insufficient nutritional supply and acute or chronic disease despite sufficient nutritional supply It means to include all secondary malnutrition caused by deficiency.
본 발명의 용어, "노화(aging)"란, 나이가 들면서 신체의 구조와 기능이 점진적으로 저하되고 질병과 사망에 대한 감수성이 급격히 증가하면서 쇠약해지는 과정을 의미한다.As used herein, the term "aging" refers to a process in which the structure and function of the body gradually deteriorate with age and the susceptibility to disease and death rapidly increases while deteriorating.
본 발명의 용어, "부동성(immobility)"이란, 생체의 움직임이 감소하거나 움직임이 없는 상태가 지속되는 상태를 의미한다. 이러한 부동성은 신경계, 근육, 골격계, 내장기관의 기능을 저하시키거나 퇴화시킬 수 있다. 보다 구체적으로는 부동성은 근력을 손실시킬 수 있다.As used herein, "immobility" refers to a state in which movement of a living body is reduced or a state in which there is no movement is maintained. This immobility can degrade or degenerate the functions of the nervous system, muscles, skeletal system, and internal organs. More specifically, immobility can lead to loss of muscle strength.
본 발명의 용어, "근육손상(muscle injury)"이란, 외부에서 근육에 대해 직접적인 충격이 가해져 생기거나 수축하고 있는 근육에 대해 수축하는 방향 반대로 외부의 힘에 의해 근육이 잡아당겨져 늘어나는 염좌(strain)와 근육이 연속성을 소실하는 파열(rupture)을 모두 포함하는 의미이다. 근육손상은 과도한 신체활동 및 이로 인한 충격, 교통 사고 등에 의해 발생할 수 있다.The term "muscle injury" as used herein refers to a strain caused by a direct impact applied to a muscle from the outside or stretched by pulling a muscle by an external force in the opposite direction to the contracting muscle and ruptures in which the muscle loses continuity. Muscle damage can be caused by excessive physical activity, shock caused by it, or a traffic accident.
본 발명의 용어, "신경 손상(nerve injury)"이란, 신경조직에 대한 손상으로, 외상에 의한 말초신경 및/또는 중추신경, 외상성 뇌손상, 운동신경 손상, 허혈성 뇌손상, 신생아 저산소성 허혈성 뇌손상, 간질 등에 의한 말초 및 중추 신경조직의 손상을 포함하며, 특히, 알파 운동뉴런, 감마 운동뉴런, 후근신경절(DRG, dorsal root gaglion), 연합뉴런(interneuron), 일차 운동 피질(primary motor cortex, M1), 보조 운동 피질(supplementary motor cortex, SMA), 소뇌(cerebellum), 척수(spinal cord) 등의 손상을 포함하나, 이에 제한되는 것은 아니다.As used herein, the term "nerve injury" refers to damage to nerve tissue, including peripheral nerves and/or central nerves caused by trauma, traumatic brain injury, motor nerve damage, ischemic brain injury, neonatal hypoxic ischemic brain Including damage to peripheral and central nervous tissue due to injury, epilepsy, etc., in particular, alpha motor neurons, gamma motor neurons, dorsal root ganglion (DRG, dorsal root gaglion), interneuron, primary motor cortex, M1), supplementary motor cortex (SMA), cerebellum, spinal cord, and the like, but are not limited thereto.
본 발명의 용어, "척수손상(spinal cord injury)"이란, 척수의 기능에서 일시적 또는 영구적 변화를 유발하는 척수의 손상을 의미한다.As used herein, the term "spinal cord injury" refers to damage to the spinal cord that causes temporary or permanent changes in the function of the spinal cord.
본 발명의 용어, "암(cancer)"이란, 신체의 다른 부위에 침투하거나 퍼질 가능성이 있는 비정상적인 세포 성장을 수반하는 질병의 총칭을 의미한다.As used herein, the term "cancer" refers to a general term for diseases accompanied by abnormal cell growth that may infiltrate or spread to other parts of the body.
본 발명의 용어, "뇌졸중(stroke)"이란, 뇌로 가는 혈류가 감소하거나 정지되어 세포 사멸을 유발하는 의학적 상태를 의미한다.As used herein, the term "stroke" refers to a medical condition in which blood flow to the brain is reduced or stopped to cause cell death.
본 발명의 용어, "악액질(cachexia)"이란, 영양 보충으로는 완전히 회복되지 않는 지속적인 근육 손실을 유발하는 기저 질환 및/또는 환자의 상태와 연관되어 있는 복합 증후군을 의미한다. 상기 기저 질환은 근감소증을 유발할 수 있는 질환들, 예를 들어, 영양실조, 노화, 부동성, 근육손상, 신경 손상, 척수손상, 암, 뇌졸중, 등이 있으나, 반드시 이에 제한되는 것은 아니다.As used herein, "cachexia" refers to a complex syndrome associated with an underlying disease and/or condition of a patient that causes persistent muscle loss that is not completely recovered with nutritional supplementation. The underlying disease may include diseases that may cause sarcopenia, such as malnutrition, aging, immobility, muscle damage, nerve damage, spinal cord injury, cancer, stroke, etc., but are not necessarily limited thereto.
본 발명의 일 구현예에 있어서, 본 발명의 근감소증은 근위축증(muscular atrophy), 근무력증(myasthenia), 근이영양증(muscular dystrophy, 근육퇴행위축), 근육긴장증(myotonia), 근긴장 저하(hypotonia), 근력 약화(muscular weakness) 및 염증성 근육병(inflammatory myopathy)으로 이루어진 군으로부터 선택되는 것이나 이에 제한되는 것은 아니다. In one embodiment of the present invention, sarcopenia of the present invention is muscular atrophy (muscular atrophy), myasthenia (myasthenia), muscular dystrophy (muscular dystrophy, muscular dystrophy), myotonia (myotonia), hypotonia (hypotonia), muscle weakness It is selected from the group consisting of (muscular weakness) and inflammatory myopathy (inflammatory myopathy), but is not limited thereto.
본 발명의 구체적인 일 구현예에 있어서, 본 발명의 근감소증은 근위축증, 근무력증 및 근이영양증으로부터 이루어진 군으로부터 선택되는 것이다.In a specific embodiment of the present invention, the sarcopenia of the present invention is selected from the group consisting of muscular dystrophy, myasthenia gravis, and muscular dystrophy.
본 발명의 용어, "근위축증(muscular atrophy)"이란, 근육 조직의 손실 또는 감소를 의미한다.As used herein, the term "muscular atrophy" refers to loss or reduction of muscle tissue.
본 발명의 용어, "근무력증(myasthenia)"이란, 근육의 신경장애로 인해 근육이 쇠약해지는 질환을 의미한다.The term of the present invention, "myasthenia" refers to a disease in which muscles are weakened due to muscle neurological disorders.
본 발명의 일 구체예에 있어서, 본 발명의 근무력증(myasthenia)은 중증 근무력증(myasthenia gravis)이나, 반드시 이에 제한되는 것은 아니다.In one embodiment of the present invention, the myasthenia of the present invention is myasthenia gravis (myasthenia gravis), but is not necessarily limited thereto.
본 발명의 용어, "중증 근무력증(myasthenia gravis)"이란, 안구형 중증 근육무력증, 전신 중증 근육무력증, 일과성 신생아 중증 근육무력증 및 선천성 근육무력증을 포함하는 질환으로, 신경근육접합부의 아세틸콜린 수용체에 대한 자가 항체가 형성되어 신경으로부터 근육으로 신호가 전달되지 못하는 항체-매개 자가면역질환을 의미한다.The term of the present invention, "myasthenia gravis" is a disease including ocular myasthenia gravis, generalized myasthenia gravis, transient neonatal myasthenia gravis and congenital myasthenia gravis, which is related to acetylcholine receptors in the neuromuscular junction. It refers to an antibody-mediated autoimmune disease in which autoantibodies are formed and signals are not transmitted from nerves to muscles.
본 발명의 용어, "근이영양증(muscular dystrophy, 근육퇴행위축)"이란, 시간이 지남에 따라 근육을 손상시키거나 약화시키는 질환의 총칭을 의미한다.As used herein, the term "muscular dystrophy (muscular dystrophy)" refers to a general term for diseases that damage or weaken muscles over time.
본 발명의 용어, "근육긴장증(myotonia)"이란, 자발적인 수축 또는 전기적 자극 후 골격근의 지연된 이완 또는 지연된 수축을 특징으로 하는 신경 질환의 증상을 의미한다.As used herein, "myotonia" refers to a symptom of a neurological disease characterized by delayed relaxation or delayed contraction of skeletal muscle after spontaneous contraction or electrical stimulation.
본 발명의 용어, "근긴장 저하(hypotonia)"이란, 근긴장도(muscle tone)가 감소한 상태를 의미한다. 근긴장 저하는 대개 근력 감소를 동반한다.The term of the present invention, "hypotonia" means a state in which muscle tone is reduced. Hypotonia is usually accompanied by a decrease in muscle strength.
본 발명의 용어, "근력 약화(muscular weakness)"란, 운동의 부족, 노화, 근육 손상 등으로 인해 발생하는 근육 힘이 부족한 상태를 의미한다.As used herein, the term "muscular weakness" refers to a state in which muscle strength is insufficient due to lack of exercise, aging, muscle damage, and the like.
본 발명의 용어, "염증성 근육병(inflammatory myopathy)"이란, 근육의 쇠약 및 염증과 일부 경우 근육통을 특징으로 하는 질병을 의미한다. 염증성 근육병은 대부분의 경우 특발성(idiopathic)이다.As used herein, the term "inflammatory myopathy" refers to a disease characterized by muscle weakness and inflammation and, in some cases, muscle pain. Inflammatory myopathy is idiopathic in most cases.
본 발명의 일 구체예에 있어서, 본 발명의 근위축증(muscular atrophy)는 척수성 근위축증(spinal muscular atrophy), 근위축성 측삭경화증(amyotrophic lateral sclerosis) 및 샤르코마리투스병(Charcot-Marie-Tooth disease)으로 이루어진 군으로부터 선택되나, 이에 제한되는 것은 아니다.In one embodiment of the present invention, the muscular atrophy of the present invention is spinal muscular atrophy, amyotrophic lateral sclerosis and Charcot-Marie-Tooth disease. It is selected from the group consisting of, but is not limited thereto.
본 발명의 용어, "척수성 근위축증(spinal muscular atrophy)"은 SMN (survival motor neuron) 단백질을 암호화하는 SNM1 유전자의 돌연변이에 의해 발생하는, 척수와 뇌간 사이의 운동신경세포 기능 손상으로 인해 근육이 신호를 받지 못하게 되는 퇴행성 신경질환을 의미한다.The term of the present invention, "spinal muscular atrophy", is caused by a mutation in the SNM1 gene encoding the SMN (survival motor neuron) protein, resulting in motor neuron function damage between the spinal cord and the brain stem, resulting in muscle signal refers to a degenerative neurological disease in which
본 발명의 용어, "근위축성 측삭경화증(amyotrophic lateral sclerosis, ALS)"이란, 루게릭병(Lou Gehrig's disease)으로도 알려져 있으며, 대뇌 피질, 뇌간 및 척수의 운동 신경세포가 점진적으로 소실되고 수의근 제어를 잃게 되는 퇴행성 신경질환을 의미한다.The term of the present invention, "amyotrophic lateral sclerosis (ALS)", also known as Lou Gehrig's disease, is a progressive loss of motor neurons in the cerebral cortex, brainstem and spinal cord, and voluntary muscle control It means a degenerative neurological disease that leads to loss.
본 발명의 용어, "샤르코마리투스병(Charcot-Marie-Tooth disease)"은 신체 근육 조직과 촉각의 점진적인 손실이 일어나는 말초신경계의 유전성 운동 및 감각 신경병증을 의미한다.As used herein, "Charcot-Marie-Tooth disease" refers to a hereditary motor and sensory neuropathy of the peripheral nervous system in which gradual loss of body muscle tissue and tactile sensation occurs.
본 발명의 일 구체예에 있어서, 본 발명의 근이영양증(muscular dystrophy)은 후쿠야마형 선천성 근이영양증(Fukuyama congenital muscular dystrophy), 뒤센 근이영양증(Duchenne muscular dystrophy), 베커 근이영양증(Becker muscular dystrophy), 스타이너트 병(Steinert′s disease), 지대형 근이영양증(Limb-girdle muscular dystrophy), 안면견갑상완 근이영양증(Facioscpulohueral dystrophy), 가성 비대 근이영양증(pseudohypertrophic type muscular dystrophy), 안인두근 이영양증(oculopharyngeal muscular dystrophy), 근육긴장 이영양증(myotonic dystrophy), 원위근이영양증(distal muscular dystrophy), 대사성 근이영양증(metabolic myopathy) 및 에머리-드라이프스 근이영양증(Emery-Dreifuss muscular dystrophy)으로 이루어진 군으로부터 선택되나, 이에 제한되는 것은 아니다. 본 발명의 근이영양증은 진행성일 수 있다. In one embodiment of the present invention, the muscular dystrophy of the present invention is Fukuyama congenital muscular dystrophy, Duchenne muscular dystrophy, Becker muscular dystrophy, Steinert's disease 's disease), Limb-girdle muscular dystrophy, Facioscpulohueral dystrophy, pseudohypertrophic type muscular dystrophy, oculopharyngeal muscular dystrophy, myotonic dystrophy ), distal muscular dystrophy, metabolic myopathy, and Emery-Dreifuss muscular dystrophy, but is not limited thereto. Muscular dystrophy of the present invention may be progressive.
본 발명의 용어, "후쿠야마형 선천성 근이영양증(Fukuyama congenital muscular dystrophy)"이란, 상염색체 열성으로 유전되는 중추신경계 장애를 동반한 선천성 근이영양증으로, 전반적인 근육의 약화, 뇌기형 및 심장 이상을 동반하는 질환을 의미한다.The term of the present invention, "Fukuyama congenital muscular dystrophy (Fukuyama congenital muscular dystrophy)" is a congenital muscular dystrophy accompanied by a central nervous system disorder inherited in an autosomal recessive manner, and a disease accompanied by general muscle weakness, brain deformity, and heart abnormality. it means.
본 발명의 용어, "뒤센 근이영양증(Duchenne muscular dystrophy, DMD)"이란, 디스트로핀(dystrophin) 유전자의 돌연변이로 인한 유전병으로, 근육줄기세포의 재생능력에 문제가 있어 근육에 이상이 생겨 근육이 약화되는 질병을 의미한다.The term of the present invention, "Duchenne muscular dystrophy (DMD)" is a genetic disease caused by a mutation in the dystrophin gene, and a disease in which muscles are weakened due to problems in the regeneration ability of muscle stem cells. means
본 발명의 용어, "베커 근이영양증(Becker muscular dystrophy)"이란, 디스트로핀 유전자의 부분적 손실로 인한 근육병증을 의미한다.As used herein, the term "Becker muscular dystrophy" refers to myopathy caused by partial loss of the dystrophin gene.
본 발명의 용어, "스타이너트 병(Steinert′s disease)"이란, 상염색체 우성으로 유전되는 근육긴장성 이영양증이라고도 불리는 성인에게서 흔한 형태의 유전성 근육 영양장애로, 평활근, 골격근, 중추신경계, 심장, 눈에 영향을 주는 질환을 의미하며, 한 번 수축한 근육이 이완되는 데 시간이 오래걸리는 증상을 갖는다.The term of the present invention, "Steinert's disease", is a hereditary muscular dystrophy of a common form in adults, also called myotonic dystrophy, which is inherited as an autosomal dominant, smooth muscle, skeletal muscle, central nervous system, heart, eye It means a disease that affects, and it has symptoms that it takes a long time for the muscles that have been contracted once to relax.
본 발명의 용어, "지대형 근이영양증(Limb-girdle muscular dystrophy)"이란, 사지 연결 근육의 진행성 약화를 나타내는 유전성 질환을 의미한다.The term of the present invention, "Limb-girdle muscular dystrophy" means a genetic disease showing progressive weakness of the muscles connecting the limbs.
본 발명의 용어, "안면견갑상완 근이영양증(Facioscpulohueral dystrophy)"이란, 얼굴, 어깨 이음부 등에서 좌우 비대칭적인 근력 저하 또는 위축의 증상을 나타내는 유전성 질환을 의미한다.The term of the present invention, "facioscpulohueral dystrophy" refers to a hereditary disease showing symptoms of asymmetrical muscle weakness or atrophy in the face, shoulder joint, and the like.
본 발명의 용어, "가성 비대 근이영양증(pseudohypertrophic type muscular dystrophy)"이란, 디스트로핀 유전자의 이상으로 인한 신경 손상이 없이 근육의 진행성 약화를 나타내는 질환을 의미한다.The term of the present invention, "pseudohypertrophic type muscular dystrophy" refers to a disease showing progressive muscle weakness without nerve damage due to an abnormality of the dystrophin gene.
본 발명의 용어, "안인두근 이영양증(oculopharyngeal muscular dystrophy)"이란, 눈꺼풀 및 인두 근육의 이영양증으로 안검하수, 구음장애 및 연하 곤란의 증상을 나타내는 유전성 근육 질환이다.The term of the present invention, "oculopharyngeal muscular dystrophy" is a dystrophy of the muscles of the eyelids and pharynx, and is a hereditary muscle disease showing symptoms of ptosis, dysarthria, and dysphagia.
본 발명의 용어, "근육긴장 이영양증(myotonic dystrophy, MDA)"이란, 근육 기능을 손상시키는 장기간인 유전 질환의 총칭으로, 점진적인 근육 소모 및 약화를 나타내는 질환을 의미한다.The term of the present invention, "myotonic dystrophy (MDA)" is a generic term for long-term genetic diseases that impair muscle function, and refers to diseases that show progressive muscle wasting and weakness.
본 발명의 용어, "원위근이영양증(distal muscular dystrophy)"이란, 원위 근육에서, 즉 몸의 중심에서 더 먼쪽의 근육에서 시작해서 근위근육으로, 즉 신체의 중심에 가까운 근육으로 점진적으로 진행되는 근육의 약화를 나타내는 유전성 근육 질환을 의미한다.The term of the present invention, "distal muscular dystrophy", refers to the distal muscle, that is, starting from the muscle farther from the center of the body and gradually progressing to the proximal muscle, that is, the muscle closer to the center of the body. It refers to a hereditary muscle disease that manifests weakness.
본 발명의 용어, "대사성 근이영양증(metabolic myopathy)"이란, 글루코오스, 지질 대사와 같은 대사과정에서 선척적 효소 결손이나 미토콘드리아 이상 등으로 발생하거나, 내분비 대사질환에 수반되는 근병변을 포함하는 질환을 의미한다.The term of the present invention, "metabolic myopathy" refers to a disease that occurs due to congenital enzyme deficiency or mitochondrial abnormality in metabolic processes such as glucose and lipid metabolism, or includes myopathy accompanying endocrine metabolic diseases. do.
본 발명의 용어, "에머리-드라이프스 근이영양증(Emery-Dreifuss muscular dystrophy)"이란, 조기 수축을 동반하는 근육영양장애로, 주로 팔, 다리, 얼굴, 목, 척추의 근육이 점진적으로 쇠약해지는 질환을 의미한다.The term of the present invention, "Emery-Dreifuss muscular dystrophy (Emery-Dreifuss muscular dystrophy)" is a muscular dystrophy accompanied by premature contraction, a disease in which the muscles of the arms, legs, face, neck, and spine gradually deteriorate. means
본 발명의 일 구현예에 있어서, 본 발명의 조성물은 Pax7, MyoD, MyoG 및 phospho-P70S6K 로 이루어진 군으로부터 선택되는 1종 이상의 근육 재생 관련 인자의 발현을 증가시킨다.In one embodiment of the present invention, the composition of the present invention increases the expression of one or more muscle regeneration related factors selected from the group consisting of Pax7, MyoD, MyoG and phospho-P70S6K.
본 발명의 용어, "Pax7 (paired box 7)"은 PAX7 유전자에 의해 인코딩되는 인간 단백질로, 근육 전구체 세포의 증식 조절을 통해 근육 생성(myogenesis)에 중요한 역할을 하는 전사 인자(transcription factor)이며, 정지 세포(quiescent cell) 및 증식하는 위성 세포(satellite cell)에서 특이적으로 발현하는 위성 세포에 대한 표준 바이오마커를 의미한다.The term of the present invention, "Pax7 (paired box 7)" is a human protein encoded by the PAX7 gene, and is a transcription factor that plays an important role in myogenesis by regulating the growth of muscle precursor cells. It refers to a standard biomarker for satellite cells that is specifically expressed in quiescent cells and proliferating satellite cells.
본 발명의 용어, "MyoD (myoblast determination protein 1 또는 myogenic differentiation 1)"은 근육 분화를 조절하는 데 중요한 역할을 하는 전사 인자를 의미한다. MyoD는 근원성 조절 인자(myogenic regulatory factor, MRF) 중 하나이며, 정지 위성 세포(quiescent satellite cell)에서는 감지할 수 없을 정도로 발현 수준이 극히 낮으나, 운동 또는 근육 조직의 손상에 반응하여 활성화된다.The term of the present invention, "MyoD (myoblast determination protein 1 or myogenic differentiation 1)" refers to a transcription factor that plays an important role in regulating muscle differentiation. MyoD is one of the myogenic regulatory factors (MRFs) and is activated in response to exercise or damage to muscle tissue, although its expression level is extremely low to the point of being undetectable in quiescent satellite cells.
본 발명의 용어, "MyoG (Myogenin, myogniec factr 4)"는 골격근 발달 또는 근발생(myogenesis) 및 손상 복구의 조정에 관연하는 근육-특이적 bHLH(basic-helix-loop-helix) 전사 인자를 의미한다.The term of the present invention, "MyoG (Myogenin, myogniec factr 4)" refers to a muscle-specific bHLH (basic-helix-loop-helix) transcription factor involved in the coordination of skeletal muscle development or myogenesis (myogenesis) and damage repair. it means.
근육이 재생되는 과정에서 Pax7 - MyoD - MyoG가 순차적으로 필요한 것은 당업계에 잘 공지되어 있다. 정지 위성 세포는 손상 등으로 인해 활성화되고 증식하기 시작하여, 근원성 전구 세포(myogenic precursor cell)로 분화한다. 분화시 근원성 전구 세포는 근세포(myocyte)로 분화하고, 이는 융합하여 근관세포(myotube)를 형성하고, 성숙하여 골격근의 수축단위인 근섬유(myofiber)가 된다. 이러한 근육 재생 과정에서 근원성 조절 인자는 Pax7, MyoD, MyoG의 순서로 발현되어 근육 재생 과정을 매개한다(Schmidt M, Schuler SC, Huttner SS, von Eyss B, von Maltzahn J. Adult stem cells at work: regenerating skeletal muscle. Cell Mol Life Sci. 2019 Jul;76(13):2559-2570. doi: 10.1007/s00018-019-03093-6. Epub 2019 Apr 11. 참조).It is well known in the art that Pax7 - MyoD - MyoG are sequentially required in the process of muscle regeneration. The quiescent satellite cells are activated due to damage or the like and begin to proliferate and differentiate into myogenic precursor cells. During differentiation, myogenic progenitor cells differentiate into myocytes, which fuse to form myotubes and mature into myofibers, which are contractile units of skeletal muscle. In this muscle regeneration process, myogenic regulators are expressed in the order of Pax7, MyoD, and MyoG to mediate the muscle regeneration process (Schmidt M, Schuler SC, Huttner SS, von Eyss B, von Maltzahn J. Adult stem cells at work: regenerating skeletal muscle. Cell Mol Life Sci. 2019 Jul;76(13):2559-2570. doi: 10.1007/s00018-019-03093-6. See Epub 2019 Apr 11.).
본 발명의 용어, "P70S6K (70-kDa ribosomal portein S6 kinase)"는 주로 40S 리보솜단백질 S6 서브유닛의 인산화를 통해 단백질 번역을 조절하는 것으로 알려져 있는 세포질의 세린/트레오닌 인산화효소(Ser/Thr kinase)를 의미한다. P70S6K는 G1 세포주기 진행 및 세포 성장에 필요하다.본 발명의 용어, "phospho-P70S6K 또는 p-P70S6K"는 성장인자(growth factor)에 의해 P70S6K상의 다수의 세린/트레오닌 잔기가 인산화된 형태를 의미한다. 상기 인산화로 인해 P70S6K는 활성화된다(Parkington JD, LeBrasseur NK, Siebert AP, Fielding RA. Contraction-mediated mTOR, p70S6k, and ERK1/2 phosphorylation in aged skeletal muscle. J Appl Physiol (1985). 2004 Jul;97(1):243-8. doi: 10.1152/japplphysiol.01383.2003. Epub 2004 Mar 19.　참조).The term of the present invention, "P70S6K (70-kDa ribosomal portein S6 kinase)" is a cytoplasmic serine / threonine kinase known to regulate protein translation mainly through phosphorylation of the 40S ribosomal protein S6 subunit means P70S6K is required for G1 cell cycle progression and cell growth. As used herein, the term "phospho-P70S6K or p-P70S6K" refers to a form in which multiple serine/threonine residues on P70S6K are phosphorylated by growth factors. do. Due to the phosphorylation, P70S6K is activated (Parkington JD, LeBrasseur NK, Siebert AP, Fielding RA. Contraction-mediated mTOR, p70S6k, and ERK1/2 phosphorylation in aged skeletal muscle. J Appl Physiol (1985). 2004 Jul;97( 1):243-8. doi: 10.1152/japlphysiol.01383.2003. See Epub 2004 Mar 19.).
본 발명의 용어, "eMHC(embryonic myosin heavy chain, 배아 미오신 중쇄)"는 MyHC-emb(myosin heavy chain-embryonic)이라고도 불리며 근육 발달 과정에서 발현되는 골격근-특이적 수축성 단백질(skeletal muscle-specific contractile protein)을 의미한다. 근육이 손상되는 경우, 근육 내 eMHC의 발현이 증가한다.The term of the present invention, "eMHC (embryonic myosin heavy chain)" is also called MyHC-emb (myosin heavy chain-embryonic) and is a skeletal muscle-specific contractile protein expressed during muscle development. ) means. When the muscle is damaged, the expression of eMHC in the muscle increases.
본 발명의 조성물은 근육의 재생을 촉진시킬 수 있어 근육 내 eMHC의 발현을 증가시키지 않는다. 즉, 본 발명의 조성물은 근육의 손상을 방지하거나 손상된 근육을 재생한다. 본 발명의 일 구현예에 있어서, 본 발명의 조성물은 근육 조직의 무게를 증가시키거나 또는 근섬유의 크기를 증가시킨다.The composition of the present invention can promote muscle regeneration and does not increase the expression of eMHC in muscle. That is, the composition of the present invention prevents muscle damage or regenerates damaged muscle. In one embodiment of the present invention, the composition of the present invention increases the weight of muscle tissue or increases the size of muscle fibers.
골격근의 재생 과정은 다수의 단계로 이루어진 복잡한 과정이다. 근육 재생 과정은 손상된 근육 세포의 괴사, 근육 줄기 세포의 활성화, 활성화된 근육 줄기 세포의 증식, 근육 줄기 세포의 분화, 새로 형성된 근육 섬유의 성숙 및 리모델링의 여러 단계로 나눌 수 있고, 이러한 근육 재생의 거의 모든 단계에서 비만 세포 및 호중구와 같은 침윤된 면역 세포(infiltrated immune cell)가 중요한 역할을 한다(Yang W, Hu P. Skeletal muscle regeneration is modulated by inflammation. J Orthop Translat. 2018 Feb 7;13:25-32. 참조)The regeneration process of skeletal muscle is a complex process consisting of many steps. The muscle regeneration process can be divided into several steps: necrosis of damaged muscle cells, activation of muscle stem cells, proliferation of activated muscle stem cells, differentiation of muscle stem cells, maturation and remodeling of newly formed muscle fibers, and these muscle regeneration In almost all stages, infiltrated immune cells such as mast cells and neutrophils play an important role (Yang W, Hu P. Skeletal muscle regeneration is modulated by inflammation. J Orthop Translat . 2018 Feb 7;13:25 See -32.)
구체적으로, 근육 재생의 초기 단계에서 손상된 근육 세포는 외상에 반응하여 괴사되면, 근육 섬유의 막이 손상되고 세포 내용물과 주화성 인자(chemotactic factor)가 세포 외 공간으로 방출되어 여러 유형의 면역 세포가 침투하여, 손상 부위의 손상된 근섬유를 제거하는 데 도움을 주는 동시에, 대식세포와 같은 더 많은 면역 세포를 모집하기 위해 다양한 유형의 사이토 카인을 분비한다. 이러한 면역 세포는 근육 줄기 세포 활성화, 증식 및 분화를 조절하는 일련의 세포 반응을 유발함으로써, 근육 재생을 조율하는 중요한 매개체로서 역할을 한다고 알려져 있다(Yang W, Hu P. Skeletal muscle regeneration is modulated by inflammation. J Orthop Translat. 2018 Feb 7;13:25-32. 참조). Specifically, in the early stage of muscle regeneration, when damaged muscle cells die in response to trauma, the membrane of muscle fibers is damaged and cell contents and chemotactic factors are released into the extracellular space, allowing various types of immune cells to penetrate. In this way, it secretes various types of cytokines to recruit more immune cells, such as macrophages, while helping to remove damaged muscle fibers at the site of injury. These immune cells are known to play a role as an important mediator in orchestrating muscle regeneration by triggering a series of cellular responses that regulate muscle stem cell activation, proliferation and differentiation (Yang W, Hu P. Skeletal muscle regeneration is modulated by inflammation). See J Orthop Translat . 2018 Feb 7;13:25-32).
본 발명의 다른 일 구현예에 있어서, 본 발명의 조성물은 침윤 세포(infiltrating cell)의 수를 증가시킨다.In another embodiment of the present invention, the composition of the present invention increases the number of infiltrating cells.
본 발명의 또 다른 일 구현예에 있어서, 본 발명의 조성물은 재생 근섬유(regenerating myofiber)의 수를 증가시킨다.In another embodiment of the present invention, the composition of the present invention increases the number of regenerating myofibers.
본 발명의 또 다른 일 양태에 따르면, 본 발명은 상기 약제학적 조성물을 대상체에 투여하는 단계를 포함하는 근감소증의 치료방법을 제공한다. According to another aspect of the present invention, the present invention provides a method for treating sarcopenia comprising administering the pharmaceutical composition to a subject.
본 발명의 일 구현예에 있어서, 상기 대상체는 구체적으로 포유동물이다. 상기 포유동물은 마우스, 랫트, 개, 고양이, 돼지, 소, 말, 원숭이, 침팬지, 오랑우탄, 및 사람이 있으나, 이에 한정되는 것은 아니다. In one embodiment of the present invention, the subject is specifically a mammal. The mammal includes, but is not limited to, mice, rats, dogs, cats, pigs, cows, horses, monkeys, chimpanzees, orangutans, and humans.
상기 본 발명의 다른 일 양태에 따른 근감소증의 치료방법은, 상술한 약제학적 조성물을 공통적으로 사용하는 방법이므로, 중복되는 내용에 대해서는 본 명세서 기재의 과도한 복잡성을 피하기 위하여 그 기재를 생략한다. Since the method for treating sarcopenia according to another aspect of the present invention is a method in which the above-described pharmaceutical composition is commonly used, description of redundant information is omitted in order to avoid excessive complexity of description in this specification.
서열에 대한 간단한 설명A brief description of the sequence
서열번호 1은 인간 IGF-1의 엑손 1, 3 및 4의 뉴클레오타이드 서열이다(Homo sapiens).SEQ ID NO: 1 is the nucleotide sequence of exons 1, 3 and 4 of human IGF-1 (Homo sapiens).
서열번호 2는 인간 IGF-1의 인트론 4의 뉴클레오타이드 서열이다(Homo sapiens).SEQ ID NO: 2 is the nucleotide sequence of intron 4 of human IGF-1 (Homo sapiens).
서열번호 3은 인간 IGF-1의 엑손 5 및 엑손 6-1의 뉴클레오타이드 서열이다(Homo sapiens).SEQ ID NO: 3 is the nucleotide sequence of exon 5 and exon 6-1 of human IGF-1 (Homo sapiens).
서열번호 4는 인간 IGF-1의 인트론 5의 뉴클레오타이드 서열이다(Homo sapiens).SEQ ID NO: 4 is the nucleotide sequence of intron 5 of human IGF-1 (Homo sapiens).
서열번호 5는 인간 IGF-1의 엑손 6-2의 뉴클레오타이드 서열이다(Homo sapiens).SEQ ID NO: 5 is the nucleotide sequence of exon 6-2 of human IGF-1 (Homo sapiens).
서열번호 6은 IGF-1-X6에서 사용된 인간 IGF-1의 인트론 4의 뉴클레오타이드 서열이다(Homo sapiens).SEQ ID NO: 6 is the nucleotide sequence of intron 4 of human IGF-1 used in IGF-1-X6 (Homo sapiens).
서열번호 7은 IGF-1-X10에서 사용된 인간 IGF-1의 인트론 4의 뉴클레오타이드 서열이다(Homo sapiens).SEQ ID NO: 7 is the nucleotide sequence of intron 4 of human IGF-1 used in IGF-1-X10 (Homo sapiens).
서열번호 8은 IGF-1-X6 및 IGF-1-X10에서 사용된 인간 IGF-1의 인트론 5의 뉴클레오타이드 서열이다(Homo sapiens).SEQ ID NO: 8 is the nucleotide sequence of intron 5 of human IGF-1 used in IGF-1-X6 and IGF-1-X10 (Homo sapiens).
서열번호 9는 IGF-1-X6의 뉴클레오타이드 서열이다(artificial sequence).SEQ ID NO: 9 is the nucleotide sequence of IGF-1-X6 (artificial sequence).
서열번호 10은 IGF-1-X10의 뉴클레오타이드 서열이다(artificial sequence).SEQ ID NO: 10 is the nucleotide sequence of IGF-1-X10 (artificial sequence).
서열번호 11은 인간 클래스 I IGF-1Ea의 아미노산 서열이다(Homo sapiens).SEQ ID NO: 11 is the amino acid sequence of human class I IGF-1Ea (Homo sapiens).
서열번호 12는 인간 클래스 I IGF-1Ea의 뉴클레오타이드 서열이다(Homo sapiens).SEQ ID NO: 12 is the nucleotide sequence of human class I IGF-1Ea (Homo sapiens).
서열번호 13은 인간 클래스 I IGF-1Ec의 아미노산 서열이다(Homo sapiens).SEQ ID NO: 13 is the amino acid sequence of human class I IGF-1Ec (Homo sapiens).
서열번호 14는 인간 클래스 I IGF-1Ec의 뉴클레오타이드 서열이다(Homo sapiens).SEQ ID NO: 14 is the nucleotide sequence of human class I IGF-1Ec (Homo sapiens).
서열번호 15는 pCK 벡터의 뉴클레오타이드 서열이다(artificial sequence).SEQ ID NO: 15 is the nucleotide sequence of the pCK vector (artificial sequence).
서열번호 16은 pTx 벡터의 뉴클레오타이드 서열이다(artificial sequence).SEQ ID NO: 16 is the nucleotide sequence of the pTx vector (artificial sequence).
서열번호 17은 pTx-IGF-1-X10의 뉴클레오타이드 서열이다(artificial sequence).SEQ ID NO: 17 is the nucleotide sequence of pTx-IGF-1-X10 (artificial sequence).
서열번호 18은 pCK-IGF-1-X10의 뉴클레오타이드 서열이다(artificial sequence). SEQ ID NO: 18 is the nucleotide sequence of pCK-IGF-1-X10 (artificial sequence).
서열번호 19는 pTx-IGF-1-X6의 뉴클레오타이드 서열이다(artificial sequence).SEQ ID NO: 19 is the nucleotide sequence of pTx-IGF-1-X6 (artificial sequence).
서열번호 20은 pCK-IGF-1-X6의 뉴클레오타이드 서열이다(artificial sequence).SEQ ID NO: 20 is the nucleotide sequence of pCK-IGF-1-X6 (artificial sequence).
서열번호 21은 IGF-1의 Ea 펩타이드의 아미노산 서열이다(Homo sapiens).SEQ ID NO: 21 is the amino acid sequence of the Ea peptide of IGF-1 (Homo sapiens).
서열번호 22는 IGF-1의 Ec 펩타이드의 아미노산 서열이다(Homo sapiens).SEQ ID NO: 22 is the amino acid sequence of the Ec peptide of IGF-1 (Homo sapiens).
본 발명의 특징 및 이점을 요약하면 다음과 같다:The features and advantages of the present invention are summarized as follows:
(a) 본 발명은 IGF(Insulin-Like Growth Factor)-1Ea 이형체 및 IGF-1Ec 이형체, 또는 상기 IGF-1Ea 이형체를 인코딩하는 폴리뉴클레오타이드 및 상기 IGF-1Ec 이형체를 인코딩하는 폴리뉴클레오타이드를 유효성분으로 포함하는 근감소증(sarcopenia) 예방 또는 치료용 약제학적 조성물을 제공한다. (a) The present invention relates to an insulin-like growth factor (IGF)-1Ea isoform and an IGF-1Ec isoform, or a polynucleotide encoding the IGF-1Ea isoform and a polynucleotide encoding the IGF-1Ec isoform It provides a pharmaceutical composition for preventing or treating sarcopenia containing as an active ingredient.
(b) 본 발명은 i) 서열번호 1의 폴리뉴클레오타이드 서열, ii) 서열번호 2의 폴리뉴클레오타이드 서열, iii) 서열번호 3의 폴리뉴클레오타이드 서열, iv) 서열번호 4의 폴리뉴클레오타이드 서열 및 v) 서열번호 5의 폴리뉴클레오타이드 서열이 순차적으로 5'에서 3'순서로 연결된 단일의 폴리뉴클레오타이드를 유효성분으로 포함하는 근감소증 예방 또는 치료용 약제학적 조성물을 제공한다.(b) the present invention is i) the polynucleotide sequence of SEQ ID NO: 1, ii) the polynucleotide sequence of SEQ ID NO: 2, iii) the polynucleotide sequence of SEQ ID NO: 3, iv) the polynucleotide sequence of SEQ ID NO: 4 and v) SEQ ID NO: Provided is a pharmaceutical composition for preventing or treating sarcopenia comprising, as an active ingredient, a single polynucleotide sequence in which 5 polynucleotide sequences are sequentially linked in 5' to 3' order.
(c) 본 발명은 상술한 약제학적 조성물을 대상체에 투여하는 단계를 포함하는 근감소증의 치료방법을 제공한다.(c) The present invention provides a method for treating sarcopenia comprising administering the pharmaceutical composition described above to a subject.
(d) 본 발명의 근감소증 예방 또는 치료용 약제학적 조성물을 이용하는 경우, IGF-1Ea 및 IGF-1Ec 이형체의 발현을 모두 증가시킴으로써, 대조 벡터 투여군 또는 성숙 IGF-1 플라스미드 투여군 대비 근육 재생 마커인 Pax7, MyoG 및 MyoD의 발현을 증가시키고, 근육 무게와 근섬유의 크기를 증가시키며, 근육의 재생을 촉진시킬 수 있어, 신경 손상, 노화, 카디오톡신 노출을 포함하는 다양한 원인으로부터 유발되는 근감소증의 예방과 치료에 유용하게 사용할 수 있다.(d) When the pharmaceutical composition for preventing or treating sarcopenia of the present invention is used, the expression of both IGF-1Ea and IGF-1Ec isoforms is increased, which is a muscle regeneration marker compared to the control vector administration group or the mature IGF-1 plasmid administration group. It can increase the expression of Pax7, MyoG, and MyoD, increase muscle weight and muscle fiber size, and promote muscle regeneration, preventing sarcopenia caused by various causes including nerve damage, aging, and cardiotoxin exposure. and can be useful for treatment.
도 1a는 인간 IGF-1의 이형체인 IGF-1Ea 및 IGF-1Ec와 성숙 IGF-1의 개략적인 전사체(transcripts) 구조를 나타낸다.1A shows schematic structures of transcripts of IGF-1Ea and IGF-1Ec, which are isoforms of human IGF-1, and mature IGF-1.
도 1b는 293T/17 세포에 NC(negative control), pTx-IGF-1Ea, pTx-IGF-1Ec 및 pTx-IGF-1-X10 플라스미드를 각각 트랜스펙션한 후 IGF-1 이형체의 mRNA 수준을 나타낸다.Figure 1b shows the mRNA levels of IGF-1 isoforms after transfection of 293T/17 cells with NC (negative control), pTx-IGF-1Ea, pTx-IGF-1Ec and pTx-IGF-1-X10 plasmids, respectively. indicate
도 1c는 면역침전 분석 후 IGF-1 단백질을 분리하여 웨스턴 블롯을 통해 확인한 IGF-1 이형체 및 성숙 IGF-1의 단백질 발현 양상을 나타낸다.Figure 1c shows the protein expression patterns of IGF-1 isoforms and mature IGF-1 confirmed by Western blot after IGF-1 protein was isolated after immunoprecipitation analysis.
도 1d는 음성 대조군으로서 pTx 벡터, pTx-IGF-1Ea 및 pTx-IGF-1Ec를 C2C12 세포에 처리 후, 웨스턴 블롯을 통해 확인한 하위 시그널링 경로의 활성화 정도, 즉 p-AKT(S473), p-p70S6K, pERK 및 pGSK2a/b의 단백질 발현 양상 결과(좌측) 및 이를 정량화한 그래프(우측)를 나타낸다.Figure 1d shows the activation levels of sub-signaling pathways, namely p-AKT(S473) and p-p70S6K, confirmed by western blot after C2C12 cells were treated with pTx vectors, pTx-IGF-1Ea and pTx-IGF-1Ec as negative controls. , The protein expression pattern results of pERK and pGSK2a/b (left) and a graph quantifying them (right) are shown.
도 1e는 pTx-IGF-1-X10과 단일 이형체 간 하위 시그널링 경로의 활성화 정도를 비교하기 위해, 웨스턴 블록을 통해 p-p70S6K의 단백질 발현 양상을 확인하여 정량화한 그래프를 나타낸다.1E shows a graph obtained by confirming and quantifying the protein expression pattern of p-p70S6K through Western block, in order to compare the activation levels of sub-signaling pathways between pTx-IGF-1-X10 and single isoforms.
도 1f는 pTx-IGF-1-X10과 단일 이형체 간 하위 시그널링 경로의 활성화 정도를 비교하기 위해, 웨스턴 블록을 통해 pGSK3β의 단백질 발현 양상을 확인하여 정량화한 그래프를 나타낸다.1f shows a graph obtained by confirming and quantifying the protein expression pattern of pGSK3β through Western block, in order to compare the activation levels of sub-signaling pathways between pTx-IGF-1-X10 and single isoforms.
도 2는 영구적 운동 신경 손상에 의한 근육감소질환(sciatic nerve transection) 마우스 모델에 pTx-IGF-1-X10 투여시 웨스턴 블롯을 통해 확인한 근육 재생 마커인, Pax7, MyoG, MyoD 및 phospho-P70S6K의 단백질 발현 양상을 나타낸다.Figure 2 is muscle regeneration markers, Pax7, MyoG, MyoD and phospho-P70S6K proteins confirmed by Western blot when pTx-IGF-1-X10 is administered to a mouse model of sciatic nerve transection caused by permanent motor nerve damage shows the expression pattern.
도 3은 노인성 근육 감소 질환(sarcopenia) 마우스 모델에서 pTx 투여군과 pTx-IGF-1-X10 투여군의 근육 무게(%)를 나타낸다.Figure 3 shows the muscle weight (%) of the pTx-administered group and the pTx-IGF-1-X10-administered group in the sarcopenia mouse model.
도 4는 노인성 근육 감소 질환 마우스 모델에서 대조 벡터 pTx 투여군과 pTx-IGF-1-X10 투여군의 재생 근섬유 수를 보여주는 H&E 염색 사진을 나타낸다.4 shows H&E staining photographs showing the number of regenerated muscle fibers in the control vector pTx-administered group and the pTx-IGF-1-X10-administered group in the geriatric sarcopenic disease mouse model.
도 5는 노인성 근육 감소 질환 마우스 모델에서 대조 벡터 pTx 투여군과 pTx-IGF-1-X10 투여군의 Pax7 및 eMHC 발현 양상을 보여주는 면역형광법(IFA) 사진을 나타낸다.FIG. 5 shows immunofluorescence (IFA) pictures showing the expression patterns of Pax7 and eMHC in the control vector pTx-administered group and the pTx-IGF-1-X10-administered group in the geriatric sarcopenic disease mouse model.
도 6은 노인성 근육 감소 질환 마우스 모델에서 대조 벡터 pTx 투여군과 pTx-IGF-1-X10 투여군의 전경골 근육의 근섬유 단면적(cross section area, CSA)을 나타낸다.6 shows the muscle fiber cross section area (CSA) of the tibialis anterior muscle in the control vector pTx-administered group and the pTx-IGF-1-X10-administered group in the geriatric sarcopenic disease mouse model.
도 7은 카디오톡신(cardiotoxin, CTX) 유발 근손상 마우스에서 대조 벡터 투여군(pTx), pTx-IGF-1-X10 투여군 및 성숙 IGF-1 투여군(pTx-Mature IGF1)의 Pax7, MyoD 및 MyoG 발현 양상을 나타낸다.Figure 7 shows the expression patterns of Pax7, MyoD, and MyoG in control vector-administered group (pTx), pTx-IGF-1-X10-administered group, and mature IGF-1-administered group (pTx-Mature IGF1) in mice with cardiotoxin (CTX)-induced muscle damage. indicates
도 8은 카디오톡신 유발 근손상 마우스에서 대조 벡터 투여군(pTx), pTx-IGF-1-X10 투여군 및 성숙 IGF-1 투여군(pTx-Mature IGF1)의 체중에 대한 근육 무게(%)를 나타낸다.FIG. 8 shows the muscle weight (%) of the control vector-administered group (pTx), the pTx-IGF-1-X10-administered group, and the mature IGF-1-administered group (pTx-Mature IGF1) in mice with cardiotoxin-induced muscle damage.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.Hereinafter, the present invention will be described in more detail through examples. These examples are only for explaining the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .
본 명세서 전체에 걸쳐, 특정 물질의 농도를 나타내기 위하여 사용되는 "%"는 별도의 언급이 없는 경우, 고체/고체는 (중량/중량) %, 고체/액체는 (중량/부피) %, 그리고 액체/액체는 (부피/부피) %이다.Throughout this specification, unless otherwise specified, "%" used to indicate the concentration of a particular substance is (weight/weight) % for solids/solids, (weight/volume) % for solids/liquids, and liquid/liquid is (volume/volume) %.
실시예Example
실시예 1: pTx-IGF-1-X 시리즈 플라스미드에 의한 IGF-1 발현Example 1: IGF-1 expression by pTx-IGF-1-X series plasmids
1-1: pTx-IGF-1-X 시리즈 플라스미드 DNA의 제작 - IGF-1Ea 및 IGF-1Ec를 모두 발현할 수 있는 발현 벡터의 제작 방법1-1: Construction of pTx-IGF-1-X series plasmid DNA - Construction method of expression vector capable of expressing both IGF-1Ea and IGF-1Ec
본 발명자들은 pTx 벡터를 이용해 RNA 전사체의 선택적 스플라이싱을 통해서, 클래스 I 및 클래스 A의 IGF-1 이형체인 IGF-1Ea 및 클래스 I 및 클래스 C의 IGF-1 이형체인 IGF-1Ec 모두를 동시에 발현하도록 설계된 플라스미드를 제작하고, 이를 pTx-IGF-1-X 시리즈로 명명하였다.The present inventors simultaneously synthesized both class I and class A IGF-1 isoforms, IGF-1Ea, and class I and class C IGF-1 isoforms, IGF-1Ec, through alternative splicing of RNA transcripts using a pTx vector. Plasmids designed to express were constructed and named as pTx-IGF-1-X series.
구체적으로, pTx-IGF-1-X 시리즈 중, IGF-1 유전자의 엑손 1, 3, 4, 5 및 6과 인트론들의 서열 또는 이들의 단편을 포함하는 플라스미드 DNA를 pTx 벡터에 클로닝하고, 이를 pTx-IGF-1-X6 또는 pTx-IGF-1-X10으로 명명하였다. pTx-IGF-1-X6 및 pTx-IGF-1-X10과 관련된 일부 사항은 대한민국 공개특허 제10-2021-0025122호 및 제10-2021-0052443호에 기재된 내용을 참조하였으며, 이의 전문은 본원에 참조로 포함되어 있다.Specifically, in the pTx-IGF-1-X series, plasmid DNA containing sequences of exons 1, 3, 4, 5, and 6 of the IGF-1 gene and introns or fragments thereof was cloned into the pTx vector, and then cloned into the pTx vector. -IGF-1-X6 or pTx-IGF-1-X10 was named. Some details related to pTx-IGF-1-X6 and pTx-IGF-1-X10 refer to the contents described in Korean Patent Publication Nos. 10-2021-0025122 and 10-2021-0052443, the entire contents of which are herein Included by reference.
pTx-IGF-1-X 시리즈의 플라스미드 DNA는, pTx를 플라스미드 기초로 하여 pTx 발현 조절 서열에 작동가능하게 연결된 삽입체(insert)를 포함하도록 제작하였다. 상기 삽입체는, (1) 인간 IGF-1 엑손 1, 3 및 4를 인코딩하는 제1 뉴클레오타이드 서열 (서열번호 1); (2) 인간 IGF-1 인트론 4의 제2 뉴클레오타이드 서열 (서열번호 2) 또는 이의 단편 (서열번호 6 또는 서열번호 7); (3) 인간 IGF-1 엑손 5 및 6-1을 인코딩하는 제3 뉴클레오타이드 서열 (서열번호 3); (4) 인간 IGF-1 인트론 5의 제4 뉴클레오타이드 서열 (서열번호 4) 또는 이의 단편 (서열번호 8); 및 (5) 인간 IGF-1 엑손 6-2를 암호화하는 제5 뉴클레오타이드 서열 (서열번호 5)을 연쇄 연결(concatenating)시키는 바, 상기 제1 뉴클레오타이드 서열, 상기 제2 뉴클레오타이드 서열, 상기 제3 뉴클레오타이드 서열, 상기 제4 뉴클레오타이드 서열 및 상기 제5 뉴클레오타이드 서열의 순서로 5'에서 3' 방향으로 연결시킴으로써 생성되었다. 이로써, pTx-IGF-1-X 시리즈의 플라스미드 DNA는 IGF-1Ea 및 IGF-1Ec 이형체를 동시에 발현하게 되었다.The plasmid DNA of the pTx-IGF-1-X series was constructed based on pTx as a plasmid and containing an insert operably linked to the pTx expression control sequence. The insert comprises (1) a first nucleotide sequence encoding human IGF-I exons 1, 3 and 4 (SEQ ID NO: 1); (2) the second nucleotide sequence of human IGF-1 intron 4 (SEQ ID NO: 2) or a fragment thereof (SEQ ID NO: 6 or SEQ ID NO: 7); (3) a third nucleotide sequence encoding human IGF-1 exons 5 and 6-1 (SEQ ID NO: 3); (4) the fourth nucleotide sequence of human IGF-1 intron 5 (SEQ ID NO: 4) or a fragment thereof (SEQ ID NO: 8); and (5) concatenating a fifth nucleotide sequence (SEQ ID NO: 5) encoding human IGF-1 exon 6-2, wherein the first nucleotide sequence, the second nucleotide sequence, and the third nucleotide sequence , in the order of the fourth nucleotide sequence and the fifth nucleotide sequence in the 5' to 3' direction. As a result, the plasmid DNA of the pTx-IGF-1-X series was able to simultaneously express the isoforms of IGF-1Ea and IGF-1Ec.
상기 pTx-IGF-1-X 시리즈의 플라스미드에서 사용된 인트론 4 및/또는 인트론 5의 단편 크기는 상이하다. 특히, 서열번호 6은 벡터 pTx-IGF-1-X6에 사용된 인트론 4 단편의 뉴클레오타이드 서열을 제공하고, 서열번호 7은 벡터 pTx-IGF-1-Xl0에 사용된 인트론 4 단편의 뉴클레오타이드 서열을 제공한다. 서열번호 8은 벡터 pTx-IGF-1-X6 및 pTx-IGF-l-Xl0에 사용된 인트론 5 단편의 뉴클레오타이드 서열을 제공한다.The fragment sizes of intron 4 and/or intron 5 used in the pTx-IGF-1-X series of plasmids are different. In particular, SEQ ID NO: 6 provides the nucleotide sequence of the intron 4 fragment used in the vector pTx-IGF-1-X6, and SEQ ID NO: 7 provides the nucleotide sequence of the intron 4 fragment used in the vector pTx-IGF-1-X10. do. SEQ ID NO: 8 provides the nucleotide sequence of the intron 5 fragment used in the vectors pTx-IGF-1-X6 and pTx-IGF-1-X10.
구체적으로, 서열번호 16의 뉴클레오타이드 서열로 구성된 pTx 벡터에 서열번호 9의 뉴클레오타이드로 구성된 IGF-1-X6를 삽입한 경우, pTx-IGF-1-X6으로 명명하고, 서열번호 19에 이의 뉴클레오타이드 서열을 나타내었다.Specifically, when IGF-1-X6 composed of the nucleotide sequence of SEQ ID NO: 9 is inserted into the pTx vector composed of the nucleotide sequence of SEQ ID NO: 16, it is named pTx-IGF-1-X6, and its nucleotide sequence in SEQ ID NO: 19 showed up
또한, 서열번호 16의 뉴클레오타이드 서열로 구성된 pTx 벡터에 서열번호 10의 뉴클레오타이드로 구성된 IGF-1-X10을 삽입한 경우, pTx-IGF-1-X10으로 명명하고, 서열번호 17에 이의 뉴클레오타이드 서열을 나타내었다.In addition, when IGF-1-X10 composed of the nucleotide sequence of SEQ ID NO: 10 is inserted into the pTx vector composed of the nucleotide sequence of SEQ ID NO: 16, it is named pTx-IGF-1-X10, and its nucleotide sequence is shown in SEQ ID NO: 17. was
서열번호 16의 뉴클레오타이드 서열로 구성된 pTx 벡터를 처리한 군 또는 어떠한 처리도 하지 않은 군을 음성 대조군(negative control, NC)로 사용하였다. 두 개의 상이한 이형체를 동시에 발현하는 본 발명의 pTx-IGF-1-X 시리즈와 비교를 위해, 하나의 IGF-1 이형체를 각각 발현하는 pTx-IGF-1Ea 및 pTx-IGF-1Ec를 양성 대조군으로 사용하였다.A group treated with the pTx vector consisting of the nucleotide sequence of SEQ ID NO: 16 or a group without any treatment was used as a negative control (NC). For comparison with the pTx-IGF-1-X series of the present invention, which simultaneously expresses two different isoforms, pTx-IGF-1Ea and pTx-IGF-1Ec, which respectively express one IGF-1 isoform, are used as positive controls. was used as
도 1a에 IGF-1Ea 이형체(상단), IGF-1Ec 이형체(중간) 및 성숙 IGF1(하단)의 전사체 구조를 나타내었다. 붉은색 박스는 IGF-1의 엑손 1, 초록색 박스는 IGF-1의 엑손 3, 주황색 박스는 IGF-1의 엑손 4, 하늘색 박스는 IGF-1의 엑손 5, 파란색 박스는 IGF-1의 엑손 6을 의미한다.Figure 1a shows the transcript structures of IGF-1Ea isoforms (top), IGF-1Ec isoforms (middle) and mature IGF1 (bottom). Red box is exon 1 of IGF-1, green box is exon 3 of IGF-1, orange box is exon 4 of IGF-1, light blue box is exon 5 of IGF-1, blue box is exon 6 of IGF-1 means
1-2: 대조 벡터, pTx-IGF-1Ea, pTx-IGF-1Ec 및 pTx-IGF-1-X10 플라스미드 DNA의 트랜스펙션 방법1-2: Transfection method of control vector, pTx-IGF-1Ea, pTx-IGF-1Ec and pTx-IGF-1-X10 plasmid DNA
실시예 1-1에서 제조한 pTx-IGF-1-X 시리즈 중 일 실시예인 pTx-IGF-1-X10에 의해 IGF-1Ea, IGF-1Ec 이형체 및 성숙 IGF-1이 효과적으로 전사되고 발현되는지 확인하기 위해서, 마우스 근세포 세포주인 C2C12 세포(Mus musculus (mmu), myoblast, ATCC, CRL-1772TM) 혹은 293T/17 세포(Homo sapiens (hsa), kidney, epithelial, HEK 293T/17, ATCC CRL-11268TM)에 어떠한 처리도 하지 않은 음성 대조군(NC)과 하나의 IGF-1 이형체를 각각 발현하는 pTx-IGF-1Ea 및 pTx-IGF-1Ec, 그리고 두 개의 IGF-1 이형체를 동시에 발현하도록 설계된 본 발명의 pTx-IGF-1-X10 플라스미드 DNA를 동일한 양으로 세포에 각각 트랜스펙션(transfection)하여 IGF-1의 mRNA 전사 수준 및 단백질 발현 양상을 확인하였다. 트랜스펙션 2일 후(즉, 48시간 후), 세포 및 세포 배양액의 상층액(supernatant)을 얻었다. Confirmation that IGF-1Ea, IGF-1Ec isoform and mature IGF-1 are effectively transcribed and expressed by pTx-IGF-1-X10, which is one example of the pTx-IGF-1-X series prepared in Example 1-1 To do this, mouse muscle cell line C2C12 cells ( Mus musculus (mmu), myoblast, ATCC, CRL-1772 TM ) or 293T / 17 cells ( Homo sapiens (hsa), kidney, epithelial, HEK 293T / 17, ATCC CRL-11268 TM ), a negative control (NC) without any treatment, pTx-IGF-1Ea and pTx-IGF-1Ec expressing one IGF-1 isoform, respectively, and designed to simultaneously express two IGF-1 isoforms. Cells were transfected with the same amount of the pTx-IGF-1-X10 plasmid DNA of the present invention, respectively, and the mRNA transcription level and protein expression pattern of IGF-1 were confirmed. Two days after transfection (i.e., after 48 hours), supernatants of cells and cell culture were obtained.
1-3: RNA 분리 및 cDNA 라이브러리(library) 제작1-3: RNA isolation and cDNA library construction
상기 실시예 1-2에서 수득한 C2C12 세포로부터 Trizol(Invitrogen, 15596026)을 이용하여 전체 RNA를 분리하였다. 그 후, 전체 RNA에서 Oligo dT 프라이머(Qiagen, 79237)를 이용해 RT-PCR(reverse transcription PCR)을 수행하여 세포의 cDNA 라이브러리(library)를 제작하였다.Total RNA was isolated from the C2C12 cells obtained in Example 1-2 using Trizol (Invitrogen, 15596026). Thereafter, RT-PCR (reverse transcription PCR) was performed on the total RNA using Oligo dT primers (Qiagen, 79237) to prepare a cell cDNA library.
1-4: Quantitative Real-Time PCR 방법1-4: Quantitative Real-Time PCR method
상기 실시예 1-3과 같은 방법으로 제작한 cDNA를 TB Green Premix EX Taq(Takara, RR420A)와 하기 표 1에 나타낸 IGF-1Ea mRNA, IGF-1Ec mRNA 및 Mouse GAPDH mRNA에 특이적으로 결합하는 정방향(forward, F) 및 역방향(reverse, R) 프라이머 세트를 이용하여 정량적 실시간 PCR(Quantitative Real-Time PCR, qRT-PCR)을 수행하였다. 세포에서 IGF-1Ea 및 IGF-1Ec mRNA 전사체의 전사 수준을 확인하였다. Forward direction that specifically binds cDNA prepared by the same method as in Example 1-3 to TB Green Premix EX Taq (Takara, RR420A) and IGF-1Ea mRNA, IGF-1Ec mRNA and Mouse GAPDH mRNA shown in Table 1 below Quantitative Real-Time PCR (qRT-PCR) was performed using (forward, F) and reverse (R) primer sets. Transcription levels of IGF-1Ea and IGF-1Ec mRNA transcripts in cells were confirmed.
유전자 명칭gene name 정방향(F)/역방향(R)Forward (F)/Reverse (R) 프라이머 서열 (5' to 3')Primer sequence (5' to 3')
Human IGF-1EaHuman IGF-1Ea FF GGAGGCTGGAGATGTATTGCGGAGGCTGGAGATGTATTGC
Human IGF-1EaHuman IGF-1Ea RR CTACATCCTGTAGTTCTTGTTTCCTGCCTACATCCTGTAGTTCTTGTTTCCTGC
Human IGF-1EcHuman IGF-1Ec FF AACAAGCCCACAGGGTATGGAACAAGCCCACAGGGTATGG
Human IGF-1EcHuman IGF-1Ec RR TTGGTAGATGGGGGCTGATACTTTGGTAGATGGGGGCTGATACT
Mouse GAPDHMouse GAPDH FF CTGGAAAGCTGTGGCGTGATCTGGAAAGCTGTGGCGTGAT
Mouse GAPDHMouse GAPDH RR CAGGCGGCACGTCAGATCCCAGGCGGCACGTCAGATCC
qRT-PCR 실험으로부터 얻은 인간 IGF-1Ea 및 IGF-1Ec의 Ct(cycle threshold) 값을 내인성 유전자(endogenous gene)인 마우스 GAPDH의 Ct 값으로 보정(normalization)하고, 2-ΔΔCt의 방법을 이용하여 상대 값(relative fold) 변화를 계산하였다. 그 결과는 도 1b 및 표 2에 나타내었다. The Ct (cycle threshold) values of human IGF - 1Ea and IGF-1Ec obtained from qRT-PCR experiments were normalized to the Ct value of mouse GAPDH, an endogenous gene, and the relative The relative fold change was calculated. The results are shown in Figure 1b and Table 2.
1-5: IGF-1 이형체 mRNA의 전사 수준 조사 결과1-5: IGF-1 isoform mRNA transcript level investigation result
도 1b에 나타낸 바와 같이, 본 발명의 pTx-IGF-1-X10에 의한 IGF-1 이형체인 IGF-1Ea 및 IGF-1Ec의 RNA 전사체 수준을 확인하였다. pTx-IGF-1Ea에 의한 IGF-1Ea의 mRNA 전사 상대 값(relative fold)을 1, pTx-IGF-1Ec에 의한 IGF-1Ec의 mRNA 전사 상대 값을 1이 되도록 기준으로 하여 pTx-IGF-1-X10에 의한 각 이형체의 mRNA 상대 값을 계산하고, 그 구체적인 결과 값은 하기 표 2에 나타내었다. As shown in FIG. 1B , the levels of RNA transcripts of IGF-1 isoforms IGF-1Ea and IGF-1Ec by pTx-IGF-1-X10 of the present invention were confirmed. pTx-IGF-1- The mRNA relative value of each isomer by X10 was calculated, and the specific result values are shown in Table 2 below.
구분division IGF-1Ea 상대 값IGF-1Ea relative value IGF-1Ec 상대 값IGF-1Ec relative values IGF-1Ea 및 IGF-1Ec의 상대 값 합Sum of relative values of IGF-1Ea and IGF-1Ec
음성 대조군(NC)negative control (NC) 00 00 00
pTx-IGF-1EapTx-IGF-1Ea 1One 00 1One
pTx-IGF-1EcpTx-IGF-1Ec 00 1One 1One
pTx-IGF-1-X10pTx-IGF-1-X10 0.5760.576 1.4691.469 2.0452.045
표 2에 나타낸 바와 같이, 각각 동일한 양의 플라스미드 DNA를 세포에 형질전환하였을 때, 마우스 근세포 세포주인 C2C12에 어떠한 처리도 하지 않은 음성 대조군(NC)에서는, 예상할 수 있듯이, 인간의 IGF-1Ea 및 IGF-1Ec 이형체의 전사체 상대값(relative fold)은 모두 0이었다. As shown in Table 2, when cells were transformed with the same amount of plasmid DNA, respectively, in the negative control (NC) in which C2C12, a mouse myocyte cell line, was not treated in any way, as expected, human IGF-1Ea and The relative folds of all transcripts of the IGF-1Ec isoforms were 0.
pTx-IGF-1Ea 플라스미드를 마우스 C2C12 세포에 형질전환하였을 때, 인간 IGF-1Ea 상대 값은 1이었으나, 인간 IGF-1Ec 상대 값은 0이었고, pTx-IGF-1Ec 플라스미드를 마우스 C2C12 세포에 형질전환하였을 때, 인간 IGF-1Ea 상대 값은 0이었으나, 인간 IGF-1Ec 상대 값은 1이었다.When the pTx-IGF-1Ea plasmid was transformed into mouse C2C12 cells, the relative value of human IGF-1Ea was 1, but the relative value of human IGF-1Ec was 0. At this time, the relative value of human IGF-1Ea was 0, but the relative value of human IGF-1Ec was 1.
반면에, 본 발명의 pTx-IGF-1-X10 플라스미드를 마우스 C2C12 세포에 형질전환하였을 때, 인간 IGF-1Ea 상대 값은 0.576이고, 인간 IGF-1Ec 상대 값은 1.469이었다. 즉, pTx-IGF-1-X10에 의한 IGF-1Ea 전사 수준은 pTx-IGF-1Ea 대비 약 57.6% 정도였고, pTx-IGF-1-X10에 의한 IGF-1Ec 전사 수준은 pTx-IGF-1Ec 대비 약 146.9%임을 확인할 수 있었다.On the other hand, when the pTx-IGF-1-X10 plasmid of the present invention was transformed into mouse C2C12 cells, the relative value of human IGF-1Ea was 0.576 and the relative value of human IGF-1Ec was 1.469. That is, the level of transcription of IGF-1Ea by pTx-IGF-1-X10 was about 57.6% compared to that of pTx-IGF-1Ea, and the level of transcription of IGF-1Ec by pTx-IGF-1-X10 was higher than that of pTx-IGF-1Ec. It was confirmed that it was about 146.9%.
또한, IGF-1Ea 및 IGF-1Ec의 각 전사 상대 값의 합을 그룹별로 비교해 보면, 동일한 세포주에 동일한 백본(backbone)에 삽입된 상이한 플라스미드 DNA를 동일한 양으로 형질전환하였음에도 불구하고, pTx-IGF-1Ea 또는 pTx-IGF-1Ec 플라스미드로 각각 형질전환된 그룹 대비 본 발명의 pTx-IGF-1-X10 플라스미드로 형질전환된 그룹에서 IGF-1Ea 및 IGF-1Ec 이형체의 상대 값의 합이 2.045배임을 알 수 있었다.In addition, when comparing the sum of each transcriptional relative value of IGF-1Ea and IGF-1Ec by group, even though the same cell line was transformed with the same amount of different plasmid DNA inserted into the same backbone, pTx-IGF- The sum of the relative values of IGF-1Ea and IGF-1Ec isoforms in the group transformed with the pTx-IGF-1-X10 plasmid of the present invention was 2.045 times compared to the group transformed with 1Ea or pTx-IGF-1Ec plasmid, respectively. Could know.
이는 동량의 각 이형체에 대한 플라스미드로 형질전환한 경우와 비교해, 본 발명의 pTx-IGF-1-X10 플라스미드에서 전체 IGF-1 이형체 전사 수준이 현저하게 증가되었다는 것을 의미한다.This means that the transcription level of all IGF-1 isoforms was remarkably increased in the pTx-IGF-1-X10 plasmid of the present invention, compared to the case of transformation with the same amount of plasmids for each isoform.
상기 결과로부터 pTx-IGF-1-X10에 의해 두 가지 IGF-1 이형체가 모두 전사되고 있고, IGF-1Ec가 IGF-1Ea 보다 RNA 전사체 상대 값이 높았으며, 또한 전체 IGF-1 이형체의 전사체 상대 값이 현저하게 증가되었음을 확인할 수 있었다.From the above results, both IGF-1 isoforms are transcribed by pTx-IGF-1-X10, and IGF-1Ec has a higher RNA transcript relative value than IGF-1Ea. It was confirmed that the carcass relative value was significantly increased.
1-6: 면역침전 분석법(Immunoprecipitation) 방법1-6: Immunoprecipitation method
상기 실시예 1-2의 293T/17 세포로부터 수득한 상층액으로부터 면역침전 분석법을 이용하여 IGF-1 단백질만을 분리하였다. 면역침전 분석법에서는 Dynabeads쪠 ProteinG Immunoprecipitation Kit(Thermo scientific, Cat.10007D)를 이용하여 제조사의 지시에 따라 상층액으로부터 IGF-1 단백질을 분리하였으며, IGF-1에 특이적으로 결합하는 항-IGF-1 항체로는 R&D사의 anti-IGF1 antibody (MAB291)를 사용하였다. Only IGF-1 protein was isolated from the supernatant obtained from the 293T/17 cells of Example 1-2 using immunoprecipitation analysis. In the immunoprecipitation assay, IGF-1 protein was isolated from the supernatant using the Dynabeads ProteinG Immunoprecipitation Kit (Thermo scientific, Cat.10007D) according to the manufacturer's instructions, and anti-IGF-1 that specifically binds to IGF-1 As an antibody, R&D's anti-IGF1 antibody (MAB291) was used.
1-7: 웨스턴 블롯(Western blot) 방법1-7: Western blot method
상기 실시예 1-6의 면역침전 분석법으로부터 분리한 IGF-1 단백질을 통상적인 웨스턴 블롯을 통해 IGF-1 이형체와 성숙 IGF-1의 발현 양상을 확인하였다. Bolt쪠 Bis-Tris Plus Gels (Invitrogen, NW04120BOX)을 이용하여 웨스턴 블롯을 수행하였으며, 1차 항체로는 anti-IGF-1 antibody (Abcam, Ab9572), 2차 항체로는 Goat Anti-Rabbit IgG H&L (HRP)(Abcam, Ab205718) 제품을 사용하였다. 웨스턴 블롯 결과는 ImageQuant LAS4000(GE Healthcare, LAS4000) 제품을 이용하여 가시화(visualization)해 블롯 이미지를 수득하였으며, 그 결과는 도 1c에 나타내었다. 웨스턴 블롯 정량 데이터는 하기 표 3에 나타내었다.The expression patterns of IGF-1 isoforms and mature IGF-1 were confirmed by conventional Western blotting of the IGF-1 protein isolated from the immunoprecipitation assay of Examples 1-6. Western blotting was performed using Boltjon Bis-Tris Plus Gels (Invitrogen, NW04120BOX), with anti-IGF-1 antibody (Abcam, Ab9572) as the primary antibody and Goat Anti-Rabbit IgG H&L as the secondary antibody ( HRP) (Abcam, Ab205718) product was used. Western blot results were visualized using ImageQuant LAS4000 (GE Healthcare, LAS4000) to obtain blot images, and the results are shown in FIG. 1c. Western blot quantification data are shown in Table 3 below.
1-8: IGF-1 이형체 및 성숙 IGF-1의 발현 양상 결과1-8: Results of expression patterns of IGF-1 isoforms and mature IGF-1
도 1c에 나타낸 바와 같이, pTx-IGF-1-X10에 의한 IGF-1 이형체인 당화된 (glycosylated) pro-IGF-1Ea 및 IGF-1Ec의 발현과 성숙(mature) IGF-1의 발현을 확인하였다. 하기 표 3에서는 도 1c의 웨스턴 블롯 이미지를 Image J 소프트웨어를 이용해 밀도측정방법(densitometry)으로 값을 측정한 다음, IGF-1Ea 및 IGF-1Ec 단백질 정량 데이터는 pTx 벡터의 값을 기준으로 하고, 성숙 IGF-1 단백질 정량 데이터는 pTx-IGF-1-X10 벡터의 값을 기준으로 하여, 단백질 발현 상대 값을 계산하였다.As shown in FIG. 1c, expression of glycosylated pro-IGF-1Ea and IGF-1Ec, which are IGF-1 isoforms, and expression of mature IGF-1 were confirmed by pTx-IGF-1-X10. . In Table 3 below, the western blot image of FIG. 1c was measured by densitometry using Image J software, and the IGF-1Ea and IGF-1Ec protein quantification data were based on the value of the pTx vector, and the mature For the IGF-1 protein quantification data, relative protein expression values were calculated based on the values of the pTx-IGF-1-X10 vector.
발현 상대 값을 계산하였다.Expression relative values were calculated.
구분division pTxpTx pTx-IGF-1EapTx-IGF-1Ea pTx-IGF-1EcpTx-IGF-1Ec pTx-IGF-1Ea 및 pTx-IGF-1Ec의 산술 평균Arithmetic mean of pTx-IGF-1Ea and pTx-IGF-1Ec pTx-IGF-1-X10pTx-IGF-1-X10
IGF-1EaIGF-1Ea 1One 14.1214.12 1.121.12 7.627.62 12.9512.95
IGF-1EcIGF-1Ec 1One 1.091.09 15.3015.30 8.198.19 10.9510.95
Mature IGF-1Mature IGF-1 00 0.360.36 0.820.82 0.590.59 1One
상기 결과로부터 pTx-IGF-1-X10에 의해 전구 형태(proform)인 IGF-1Ea 및 IGF-1Ec 이형체가 모두 발현되고, 상기 이형체가 절단되어 성숙 IGF-1이 형성되었음을 확인할 수 있었다. 또한, pTx-IGF-1-X10에 의해 발현된 IGF-1Ea가 당화되어 있음을 확인하였다. 특히, 성숙 IGF-1과 상이한 전구 형태의 IGF-1 이형체가 공존하는 것을 확인할 수 있었다.From the above results, it was confirmed that both proforms, IGF-1Ea and IGF-1Ec isoforms, were expressed by pTx-IGF-1-X10, and that the isoforms were cleaved to form mature IGF-1. In addition, it was confirmed that IGF-1Ea expressed by pTx-IGF-1-X10 was glycosylated. In particular, it was confirmed that mature IGF-1 and different progenitor IGF-1 isoforms coexist.
게다가, 상기 표 3에 나타낸 바와 같이, 단일 이형체를 발현하는 pTx-IGF-1Ea 및 pTx-IGF-1Ec 상대 값의 산술 평균보다 pTx-IGF-1-X10에서의 IGF-1Ea 이형체, IGF-1Ec 이형체 및 성숙 IGF-1 단백질의 상대 값이 모두 높았음을 알 수 있었다.In addition, as shown in Table 3 above, the arithmetic mean of the relative values of pTx-IGF-1Ea and pTx-IGF-1Ec expressing a single isoform is higher than the arithmetic mean of the IGF-1Ea isoform in pTx-IGF-1-X10, the IGF-1Ea isoform, It was found that the relative values of the 1Ec isoform and the mature IGF-1 protein were both high.
따라서, 본 발명에 따른 IGF-1Ea 및 IGF-1Ec 이형체를 모두 발현할 수 있는 pTx-IGF-1-X10 벡터를 이용하면, 단일 이형체를 발현하는 벡터 대비 각 IGF-1Ea 및 IGF-1Ec 이형체의 전사 수준뿐만 아니라, 각 IGF-1Ea 및 IGF-1Ec 이형체 및 성숙 IGF-1의 발현 수준이 현저하게 증가된다.Therefore, when the pTx-IGF-1-X10 vector capable of expressing both IGF-1Ea and IGF-1Ec isoforms according to the present invention is used, each IGF-1Ea and IGF-1Ec isoform is compared to a vector expressing a single isoform. The expression levels of the respective IGF-1Ea and IGF-1Ec isoforms and mature IGF-1 are markedly increased, as well as the transcriptional level of the body.
1-9: IGF-1 이형체의 기능 차이 확인1-9: Confirmation of functional differences of IGF-1 isoforms
IGF-1 이형체간의 기능 차이를 확인하기 위하여, pTx 벡터, pTx-IGF-1Ea 및 pTx-IGF-1Ec 각각을 293T/17 세포에 트랜스펙션하고, 상층액에서 분리한 인간 IGF-1을 마우스 근세주인 C2C12 세포에 처리하여 하위 시그널링 경로의 활성화 정도를 웨스턴 블롯으로 비교하였다. In order to confirm the functional difference between IGF-1 isoforms, 293T/17 cells were transfected with the pTx vector, pTx-IGF-1Ea and pTx-IGF-1Ec, respectively, and human IGF-1 isolated from the supernatant was isolated from mice. The myoclonic C2C12 cells were treated and the activation levels of lower signaling pathways were compared by Western blot.
상기 실시예 1-2의 트랜스펙션 방법을 이용하여 수득한 293T/17 세포(hsa) 상층액에 들어있는 인간 IGF-1의 농도를 Human IGF-1 ELISA(R&D, DG100B)로 측정한 뒤, 인간 IGF-1의 최종 농도가 25 ng/ml이 되도록 희석하여 C2C12 세포(mmu)에 처리하였다.After measuring the concentration of human IGF-1 in the supernatant of 293T/17 cells (hsa) obtained by the transfection method of Example 1-2 by Human IGF-1 ELISA (R&D, DG100B), Human IGF-1 was diluted to a final concentration of 25 ng/ml and treated with C2C12 cells (mmu).
인간 IGF-1 처리 후 30분 및 1시간 시점에 C2C12 세포(mmu)를 얻었으며, 단백질 분해효소 저해제 및 포스파타제 저해제 칵테일(Roche Diagnostic Ltd.)이 포함된 리파 버퍼(RIPA buffer, Sigma, R0278)를 이용하여 단백질을 추출하였다.C2C12 cells (mmu) were obtained at 30 minutes and 1 hour after human IGF-1 treatment, and RIPA buffer (Sigma, R0278) containing protease inhibitor and phosphatase inhibitor cocktail (Roche Diagnostic Ltd.) Protein was extracted using
추출한 단백질로 Bolt쪠 Bis-Tris Plus Gels (Invitrogen, NW04120BOX)을 이용하여 웨스턴 블롯을 수행하였다. 1차 항체로는 anti-phospho AKT(Ser473) antibody (CST, 9271), anti-phospho p70S6K antibody (CST, 8209), anti-phospho ERK antibody (CST, 4370), anti-phospho GSK3α/β antibody (CST, 9331) 및 anti-GAPDH antibody (CST, 2118)를 사용하였으며, 2차 항체로는 Goat Anti-Rabbit IgG H&L(HRP) (Abcam, Ab205718) 제품을 사용하였다. 웨스턴 블롯 결과는 Fusion solo (VILBER)제품을 이용하여 가시화(visualization)해 블롯 이미지를 얻었으며, 결과는 도 1d에 나타내었다.Western blotting was performed with the extracted protein using Boltjel Bis-Tris Plus Gels (Invitrogen, NW04120BOX). Primary antibodies include anti-phospho AKT (Ser473) antibody (CST, 9271), anti-phospho p70S6K antibody (CST, 8209), anti-phospho ERK antibody (CST, 4370), anti-phospho GSK3α/β antibody (CST , 9331) and anti-GAPDH antibody (CST, 2118) were used, and as a secondary antibody, Goat Anti-Rabbit IgG H&L (HRP) (Abcam, Ab205718) was used. Western blotting results were visualized using Fusion solo (VILBER) to obtain blot images, and the results are shown in FIG. 1d.
도 1d에 나타낸 바와 같이, IGF-1 이형체인 IGF-1Ea와 IGF-1Ec는 phospho-AKT(p-AKT) 시그널링 인자의 활성 양상이 다르게 나타나는 것을 확인할 수 있었다. 이러한 결과는 pTx-IGF-1-X10을 이용해 IGF-1Ea 및 IGF-1Ec를 동시에 발현하면 시너지 효과를 유도할 수도 있음을 암시하는 결과이다.As shown in FIG. 1D, it was confirmed that IGF-1 isoforms, IGF-1Ea and IGF-1Ec, showed different activity patterns of phospho-AKT (p-AKT) signaling factors. These results imply that a synergistic effect may be induced by simultaneously expressing IGF-1Ea and IGF-1Ec using pTx-IGF-1-X10.
1-10: pTx-IGF-1-X10와 단일 이형체 간 비교1-10: Comparison between pTx-IGF-1-X10 and single isoforms
근육세포에서의 시그널링 경로의 활성화 정도를 비교하기 위해, pTx 벡터, pTx-IGF-1Ea, pTx-IGF-1Ec 및 pTx-IGF-1-X10 각각을 293T/17 세포에 1 ug씩 트랜스펙션하고 48시간 후 상등액을 수거하였다. 상등액은 IGF-1 ELISA (R&D, DG100B)로 정량하여 C2C12 세포에 50 ng씩 처리하였다. 대조군으로 재조합 단백질인 rhIGF-1 또한 50 ng을 처리하였다. 시간대별로 C2C12 세포를 수거하여 단백질을 추출한 후 웨스턴 블롯을 수행하였다. 결과는 도 1e 및 도 1f에 나타내었다.To compare the activation of signaling pathways in muscle cells, 293T/17 cells were transfected with 1 ug each of pTx vector, pTx-IGF-1Ea, pTx-IGF-1Ec and pTx-IGF-1-X10. The supernatant was harvested after 48 hours. The supernatant was quantified by IGF-1 ELISA (R&D, DG100B) and treated with 50 ng each of C2C12 cells. As a control, 50 ng of rhIGF-1, a recombinant protein, was also treated. Western blotting was performed after harvesting C2C12 cells at each time point and extracting proteins. The results are shown in Figures 1e and 1f.
도 1e 및 도 1f에 나타낸 바와 같이, phospho-p70S6K(p70S6K)와 phospho-GSK3β(pGSK3β) 시그널링 인자의 활성이 IGF-1Ea 및 IGF-1Ec 이형체를 모두 발현하는 pTx-IGF-1-X10의 상등액 처리군에서, 단일 이형체를 발현하는 다른 군에 비해 유의미하게 증가하였음을 확인할 수 있었다. As shown in FIGS. 1E and 1F, the activity of phospho-p70S6K (p70S6K) and phospho-GSK3β (pGSK3β) signaling factors was significantly increased in the supernatant of pTx-IGF-1-X10 expressing both IGF-1Ea and IGF-1Ec isoforms. In the treatment group, it was confirmed that the expression of a single isoform was significantly increased compared to other groups.
근감소증을 개선하기 위해서는 단백질 합성을 통한 근육량 유지가 중요한데, 상기 phospho-p70S6K(p70S6K)와 phospho-GSK3β(pGSK3β) 시그널링 인자는 단백질 합성을 유도하는 과정에 중요하게 작용하는 것으로 알려져 있다. 따라서 pTx-IGF-1-X10에 의한 IGF-1 이형체의 발현이 이러한 단백질 합성의 신호 전달 과정에 유의미하게 작용하여 근감소증을 개선할 것으로 예상된다.In order to improve sarcopenia, it is important to maintain muscle mass through protein synthesis, and the phospho-p70S6K (p70S6K) and phospho-GSK3β (pGSK3β) signaling factors are known to play an important role in the process of inducing protein synthesis. Therefore, expression of the IGF-1 isoform by pTx-IGF-1-X10 is expected to significantly affect the signal transduction process of protein synthesis and improve sarcopenia.
실시예 2: 영구적 운동 신경 손상에 의한 근육 감소질환에서 pTx-IGF-1-X10에 의한 근육 재생 효과 확인Example 2: Confirmation of muscle regeneration effect by pTx-IGF-1-X10 in sarcopenia caused by permanent motor nerve damage
2-1: 근육 감소 질환 마우스 모델의 생성2-1: Generation of sarcopenic disease mouse model
pTx-IGF-1-X10에 의한 근육 재생 효과를 확인하기 위해서, 근육 감소 질환 마우스 모델을 생성하였다. 근육 감소 질환 마우스 모델은 8주령의 수컷 C57BL/6 마우스의 좌골 신경(sciatic nerve)을 잘라 하지 근육과 연결된 운동 신경을 끊음으로써, 영구적 운동 신경 손상을 유발한 좌골 신경 절단 모델(sciatic nerve transection model)이다. 상기 좌골 신경 절단 모델에서 신경 손상성 근감소가 유발되는 것은 공지되어 있다(Williams et al., Science 326(5959):1549-1554, 2009). In order to confirm the muscle regeneration effect by pTx-IGF-1-X10, a muscle loss disease mouse model was created. The sarcopenic disease mouse model is a sciatic nerve transection model that causes permanent motor nerve damage by cutting the sciatic nerve of an 8-week-old male C57BL/6 mouse and severing the motor nerve connected to the muscles of the lower extremity. am. It is known that nerve damage muscle loss is induced in the sciatic nerve cut model (Williams et al., Science 326(5959):1549-1554, 2009).
2-2: 근육 재생 마커 발현 양상 조사 방법2-2: Method for examining expression patterns of muscle regeneration markers
근육이 재생되는 과정에서 Pax7 - MyoD - MyoG가 순차적으로 필요하다. 이러한 근육 재생 마커가 상기 근육 감소 질환 마우스 모델의 손상된 전경골 근육에서 pTx-IGF-1-X10에 의해 증가하는지 여부를 관찰하기 위해, 다음과 같이 실험하였다.In the process of muscle regeneration, Pax7 - MyoD - MyoG are sequentially required. In order to observe whether these muscle regeneration markers are increased by pTx-IGF-1-X10 in the damaged tibialis anterior muscle of the sarcopenic disease mouse model, the following experiment was conducted.
상기 근육 감소 질환 마우스 모델의 전경골(Tibialis anterior, T.A.) 근육에 근육 내 주사(intramuscular injection)를 통해 50 μg의 pTx 또는 pTx-IGF-1-X10 플라스미드를 투여하였다. 아무런 처리를 하지 않은 8주령의 수컷 C57BL/6 마우스를 음성 대조군(NC)으로 사용하였다. 플라스미드 주사 7일 후, 손상된 T.A. 근육을 얻어, 단백질을 추출한 후 근육 재생 마커인 Pax7, MyoD, MyoG 및 phospho-P70S6K에 대한 통상적인 웨스턴 블롯을 다음과 같이 수행하였다.50 μg of pTx or pTx-IGF-1-X10 plasmid was administered to the Tibialis anterior (TA) muscle of the sarcopenic disease mouse model through intramuscular injection. 8-week-old male C57BL/6 mice without any treatment were used as negative controls (NC). Seven days after plasmid injection, damaged T.A. After muscle was obtained and proteins were extracted, conventional Western blotting for muscle regeneration markers Pax7, MyoD, MyoG, and phospho-P70S6K was performed as follows.
단백질 추출을 위해, 단백질 분해효소 저해제 및 포스파타제 저해제 칵테일(Roche Diagnostic Ltd.) 및 PMSF(Phenylmethanesulfonyl Fluoride, Sigma-Aldrich)를 함유하는 용해 완충액(lysis buffer)에서, 폴리프로필렌 막자(Bel-Ar Scienceware)를 사용해 T.A. 근육을 균질화하여 샘플을 준비하였다. 샘플을 12,000 rpm에서 15분간 4℃에서 원심분리하고, 총 단백질을 함유하는 상층액을 분석하였다. BCA 단백질 분석 키트(Thermo, IL, USA)로 측정하여 조직으로부터 얻은 단백질 추출물의 총량에 정규화하였다. For protein extraction, in a lysis buffer containing protease inhibitor and phosphatase inhibitor cocktail (Roche Diagnostic Ltd.) and PMSF (Phenylmethanesulfonyl Fluoride, Sigma-Aldrich), a polypropylene pestle (Bel-Ar Scienceware) was used. Use T.A. Samples were prepared by homogenizing the muscle. Samples were centrifuged at 12,000 rpm for 15 minutes at 4° C. and the supernatants containing total protein were analyzed. It was normalized to the total amount of protein extract obtained from the tissue as measured by the BCA protein assay kit (Thermo, IL, USA).
동량의 단백질들을 10% SDS-폴리아크릴아미드 겔 상에서 분리하고, 웨스턴 막(PVDF, Polyvinylidene fluoride)으로 전이시켰다. 상기 막(membrane)을 BSA(Invitrogen-Gibco)를 함유한 TBST(20 mM Tris-HCl, pH 7.4, 0.9% NaCl 및 0.1% Tween-20)로 1시간 블록킹(blocking)하고, 블록킹 용액에 희석된 일차 항체로 4℃에서 밤새 탐침 처리하였다. Equal amounts of proteins were separated on a 10% SDS-polyacrylamide gel and transferred to a Western membrane (PVDF, Polyvinylidene fluoride). The membrane was blocked with TBST (20 mM Tris-HCl, pH 7.4, 0.9% NaCl and 0.1% Tween-20) containing BSA (Invitrogen-Gibco) for 1 hour, and diluted in blocking solution. The primary antibody was probed overnight at 4°C.
Pax7(Santa Cruz, SC-81648), MyoD(Santa Cruz, SC-377460), MyoG(Santa Cruz, SC-12732) 및 phospho-P70S6K (CST, 8209S)의 발현을 조사하기 위해 사용된 일차 항체는 Abcam (UK) 및 Sigma-Aldrich (US)로부터 구입하였다. Abcam (UK) and Sigma-Aldrich (US).
TBST로 세척 후, 막을 HRP-접합 염소 항-마우스 또는 HRP-접합 염소 항-토끼 IgG 이차 항체(Sigma-Aldrich)로 실온에서 1시간 인큐베이션하였다. 그 다음, 블랏(blot)을 TBST로 3회 세척하고, 상기 단백질 밴드를 향상된 화학발광 시스템(enhanced chemiluminescence system, Millipore 사)을 사용하여 시각화해 블롯 이미지를 얻었다. 결과는 도 2에 나타내었다.After washing with TBST, membranes were incubated with HRP-conjugated goat anti-mouse or HRP-conjugated goat anti-rabbit IgG secondary antibodies (Sigma-Aldrich) for 1 hour at room temperature. Then, the blot was washed three times with TBST, and the protein band was visualized using an enhanced chemiluminescence system (Millipore) to obtain a blot image. The results are shown in Figure 2.
2-3: 근육 재생 마커 발현 양상 결과2-3: Muscle regeneration marker expression pattern results
도 2에 나타낸 바와 같이, 우선 아무런 처리를 하지 않은 음성 대조군(NC)에서는 근육이 재생되는 과정에서 Pax7 - MyoD - MyoG의 순서로 발현되는 근원성 인자의 발현은 거의 없었다. pTx 투여군 대비 pTx-IGF-1-X10 투여군에서 근육 재생 마커 단백질인, Pax7, MyoD, MyoG 및 phospho-P70S6K의 발현이 증가하는 양상을 관찰할 수 있었다. 따라서, pTx-IGF-1-X10 투여로 인한 상이한 두 개의 IGF-1 이형체 발현은 신경 손상성 근감소 모델에서 근육의 재생을 촉진할 수 있음을 확인하였다.As shown in Figure 2, in the negative control group (NC), which was not treated first, there was little expression of myogenic factors expressed in the order of Pax7 - MyoD - MyoG during muscle regeneration. Expression of muscle regeneration marker proteins, Pax7, MyoD, MyoG, and phospho-P70S6K, increased in the pTx-IGF-1-X10-administered group compared to the pTx-administered group. Therefore, it was confirmed that expression of two different IGF-1 isoforms due to administration of pTx-IGF-1-X10 can promote muscle regeneration in a neuromuscular muscle loss model.
실시예 3: 노인성 근육 감소질환에서 pTx-IGF-1-X10에 의한 근육 재생 효과 확인Example 3: Confirmation of muscle regeneration effect by pTx-IGF-1-X10 in geriatric sarcopenia
3-1: 노인성 근육 감소 질환 마우스 모델3-1: senile sarcopenia disease mouse model
노인성 근육 감소 질환(sarcopenia)에서 pTx-IGF-1-X10에 의한 근육 재생 효과가 있는지 여부를 확인하기 위해, 노인성 근육 감소질환 마우스 모델로 18개월령의 C57BL/6 마우스를 이용하였다.In order to confirm whether there is a muscle regeneration effect by pTx-IGF-1-X10 in sarcopenia, 18-month-old C57BL/6 mice were used as a mouse model for geriatric sarcopenia.
3-2: 근육 무게 변화 양상3-2: Changes in muscle weight
상기 마우스 모델의 전경골 근육에 pTx 또는 pTx-IGF-1-X10 플라스미드 50 μg을 각각 근육 내 주사하였다. 주사 7일 후, 플라스미드를 주사한 근육을 얻어 근육의 무게를 측정하였다. 결과는 도 3에 나타내었다.50 μg of pTx or pTx-IGF-1-X10 plasmid was intramuscularly injected into the tibialis anterior muscle of the mouse model, respectively. 7 days after the injection, the plasmid-injected muscle was obtained and the muscle weight was measured. The results are shown in Figure 3.
도 3에 나타낸 바와 같이, pTx 대조군의 근육 무게를 100%으로 하여 비교하였을 때, pTx-IGF-1-X10 투여군에서 근육의 무게가 증가하는 경향을 확인할 수 있었다.As shown in FIG. 3 , when the muscle weight of the pTx control group was compared to 100%, it was confirmed that the muscle weight increased in the pTx-IGF-1-X10 group.
3-3: H&E 염색에 의한 근육 조직 변화 확인3-3: Confirmation of changes in muscle tissue by H&E staining
근육의 조직 상태를 관찰하기 위해, 상기 실시예 3-2의 플라스미드를 주사한 근육을 얻어 다음의 방법으로 H&E 염색(Hematoxylin and eosin staining)을 수행하였다. 헤마톡실린(hematoxylin)은 핵과 조면소포체 리보솜의 DNA 및 RNA와 같은 음이온성 또는 산성 물질을 파란색 또는 보라색으로 염색하고, 에오신(eosin)은 세포질의 아르기닌, 리신과 같은 양이온성 아미노산과 근육세포의 미세섬유와 같은 양이온성 또는 염기성 물질을 빨간색 또는 분홍색으로 염색한다. 광학현미경으로 근육 조직을 관찰하고 이미지를 얻어 도 4에 나타내었다.In order to observe the tissue state of the muscle, the muscle injected with the plasmid of Example 3-2 was obtained and H&E staining (Hematoxylin and eosin staining) was performed by the following method. Hematoxylin stains anionic or acidic substances such as DNA and RNA in the nucleus and rough endoplasmic reticulum ribosomes in blue or purple, and eosin stains cationic amino acids such as arginine and lysine in the cytoplasm and the microstructure of muscle cells. Dye cationic or basic materials such as fibers red or pink. The muscle tissue was observed under an optical microscope and images were obtained and shown in FIG. 4 .
근육 내 주사는 주사기로부터 나오는 용액의 액압에 의해 근육에 약간의 손상이 필연적으로 유도될 수밖에 없다. 따라서, 도 4의 좌측 H&E 절편에 나타낸 바와 같이, pTx를 주사한 근육에서는 근손상으로 인해 면역 세포 등의 침윤 세포(infiltrating cell)와 근육 재생 과정에 있는 재생 근섬유(regenerating myofiber)의 수가 증가하였음을 관찰할 수 있었다. 이에 비해, 도 4의 우측 사진에 나타낸 바와 같이, pTx-IGF-1-X10 투여군에서는 이와 같은 형상이 거의 관찰되지 않았음을 확인할 수 있었다. 이러한 결과는 pTx-IGF-1-X10이 근육의 재생을 촉진시킬 수 있음을 의미한다.In intramuscular injection, some damage to the muscle is inevitably induced by the hydraulic pressure of the solution coming out of the syringe. Therefore, as shown in the left H&E slice of FIG. 4, in the muscles injected with pTx, the number of infiltrating cells such as immune cells and regenerating myofibers in the muscle regeneration process increased due to muscle damage. could observe In contrast, as shown in the right picture of FIG. 4 , it was confirmed that such a shape was hardly observed in the pTx-IGF-1-X10 administration group. These results indicate that pTx-IGF-1-X10 can promote muscle regeneration.
3-4: 면역형광법 염색에 의한 eMHC 발현 양상 확인3-4: Confirm eMHC expression pattern by immunofluorescence staining
근육의 조직 상태를 관찰하기 위해, 상기 실시예 3-2의 플라스미드를 주사한 근육을 얻어 다음의 방법으로 면역형광법(Immunofluorescence Assay, IFA) 염색을 다음의 방법으로 수행하였다. 마우스로부터 분리한 근육을 급속 냉동(Snap freezing) 기법을 이용하여 OCT 블록으로 만든 뒤, 근육 조직을 얇게 잘라 슬라이드를 제작하여 면역형광법을 수행하였다. 라미닌(Laminin, Sigma, L9393)은 붉은색 형광(Invitrogen, A32754), eMHC(DSHB, F1.652)는 초록색 형광 (Invitrogen, A32766) 및 핵은 파란색 DAPI 형광(Sigma, D9542)으로 염색되었다. 현광현미경으로 근육 조직을 관찰하고 이미지를 얻어 도 5에 나타내었다.In order to observe the tissue state of the muscle, immunofluorescence assay (IFA) staining was performed by the following method to obtain the muscle injected with the plasmid of Example 3-2. Muscles isolated from mice were made into OCT blocks using a snap freezing technique, and then immunofluorescence was performed by thinly cutting muscle tissue to prepare slides. Laminin (Laminin, Sigma, L9393) was stained with red fluorescence (Invitrogen, A32754), eMHC (DSHB, F1.652) with green fluorescence (Invitrogen, A32766), and nuclei were stained with blue DAPI fluorescence (Sigma, D9542). The muscle tissue was observed under a fluorescence microscope and images were obtained and shown in FIG. 5 .
상술한 바와 같이, 본래 근육 내 주사에 의해 근육에 약간의 손상이 유도될 수밖에 없다. 도 5의 좌측 현미경 사진에 나타낸 바와 같이, pTx를 주사한 근육에서는 근손상으로 인해 eMHC(embryonic myosin heavy chain)의 발현이 증가해 있는 것을 관찰할 수 있었다. 이에 비해, 도 5의 우측 사진에 나타낸 바와 같이, pTx-IGF-1-X10 투여군에서는 이와 같은 형상이 거의 관찰되지 않았음을 확인할 수 있었다. 이러한 결과는 pTx-IGF-1-X10이 근육의 재생을 촉진시킬 수 있음을 의미한다.As described above, some damage to the muscle is inevitably induced by the original intramuscular injection. As shown in the photomicrograph on the left of FIG. 5 , it was observed that expression of embryonic myosin heavy chain (eMHC) increased due to muscle damage in the pTx-injected muscles. In contrast, as shown in the right picture of FIG. 5 , it was confirmed that such a shape was hardly observed in the pTx-IGF-1-X10 administration group. These results indicate that pTx-IGF-1-X10 can promote muscle regeneration.
3-5: 근섬유 단면적 측정3-5: Measurement of muscle fiber cross-sectional area
근육의 크기를 관찰하기 위해, 상기 실시예 3-1의 플라스미드를 주사한 근육을 얻어 근섬유의 크기를 단면적(cross section area, CSA) 측정을 통해 조사하였다. 근섬유의 단면적 측정은 다음과 같이 수행하였다. 상기 3-4에 기재된 면역형광법으로 염색한 근육 조직을 LSM900 형광현미경 (ZEISS, LSM900)으로 관찰하였다. 라미닌(Laminin) 항체는 근섬유의 세포막 가장자리를 염색하며, 라미닌으로 염색된 근섬유의 안쪽의 단면적을 LSM900 분석 프로그램으로 측정하였다. 결과는 도 6에 나타내었다.In order to observe the size of the muscle, muscle fibers injected with the plasmid of Example 3-1 were obtained and the size of the muscle fiber was investigated through cross section area (CSA) measurement. The cross-sectional area of muscle fibers was measured as follows. The muscle tissue stained by the immunofluorescence method described in 3-4 above was observed with an LSM900 fluorescence microscope (ZEISS, LSM900). The laminin antibody stains the edge of the cell membrane of the muscle fiber, and the cross-sectional area of the inner side of the muscle fiber stained with laminin was measured with the LSM900 analysis program. The results are shown in FIG. 6 .
근섬유의 CSA는 근육의 기능 및 무게와 비례한다는 것은 잘 공지된 사실이다. 도 6에 나타낸 바와 같이, 플라스미드를 주사한 근육의 CSA 크기를 측정하여 크기별로 구분하여 그래프화한 결과, pTx 투여군보다 pTx-IGF-1-X10 투여군의 CSA 그래프가 우측 및 상측으로 이동되어, pTx-IGF-1-X10 투여군에서 단면적이 더 큰 근섬유의 수가 더 많이 존재함을 확인할 수 있었다. 이러한 결과는 pTx-IGF-1-X10이 근육 재생을 촉진할 수 있음을 의미한다.It is a well-known fact that the CSA of a muscle fiber is proportional to the function and weight of a muscle. As shown in FIG. 6, as a result of measuring the CSA size of the plasmid-injected muscle and dividing it by size and graphing it, the CSA graph of the pTx-IGF-1-X10-administered group is moved to the right and upper, compared to the pTx-administered group. -It was confirmed that a larger number of muscle fibers with a larger cross-sectional area were present in the group administered with IGF-1-X10. These results indicate that pTx-IGF-1-X10 can promote muscle regeneration.
실시예 4: pTx-IGF-1-X10에 의한 근육 재생 프로그램 촉진Example 4: Promotion of muscle regeneration program by pTx-IGF-1-X10
4-1: 카디오톡신 유발 근육 손상 마우스 모델의 생성4-1: Generation of cardiotoxin-induced muscle damage mouse model
C57BL/6 마우스의 전경골 근육에 대조 벡터(pTx), pTx-IGF-1-X10 및 성숙 IGF-1(pTx-Mature IGF1) 플라스미드 DNA를 50 μg씩 근육 내 주사를 통해 투여하였다. 투여 3일 후, 플라스미드 DNA를 투여한 근육에 카디오톡신(cardiotoxin, CTX)을 투여하여 근육에 손상을 유도하였다. 아무런 처리를 하지 않은 C57BL/6 마우스를 음성 대조군(NC)으로 사용하였다. 다음날, 손상된 근육을 얻어 단백질을 추출한 후 Pax7, MyoD 및 MyoG에 대하여 상기 실시예 2-2의 방법으로 웨스턴 블롯을 수행하였다. 결과는 도 7에 나타내었다.Control vector (pTx), pTx-IGF-1-X10, and mature IGF-1 (pTx-Mature IGF1) plasmid DNA were injected intramuscularly into the tibialis anterior muscle of C57BL/6 mice. After 3 days of administration, muscle damage was induced by administering cardiotoxin (CTX) to the muscles into which the plasmid DNA was administered. C57BL/6 mice without any treatment were used as a negative control (NC). The next day, after extracting proteins from damaged muscles, Western blotting was performed on Pax7, MyoD, and MyoG by the method of Example 2-2. The results are shown in FIG. 7 .
4-2: 근육 재생 관련 인자 발현 양상4-2: Expression pattern of muscle regeneration related factors
전술하였듯이, 근육 재생 프로그램 과정이 진행되기 위해서는, Pax7 - MyoD - MyoG가 순차적으로 필요하다. 도 7에 나타낸 바와 같이, 대조 벡터(pTx) 투여군뿐만 아니라 성숙 IGF-1(pTx-mature IGF-1) 투여군과 비교하였을 때도, pTx-IGF-1-X10 투여군에서 상기 단백질의 발현이 증가하는 양상을 관찰할 수 있었다. 따라서 pTx-IGF-1-X10 투여에 의한 두 개의 상이한 IGF-1 이형체 발현은 성숙 IGF-1(pTx-mature IGF-1) 투여에 비해 근육 재생의 초기 단계를 활성화시킬 수 있음을 알 수 있었다.As described above, in order for the muscle regeneration program process to proceed, Pax7 - MyoD - MyoG are sequentially required. As shown in FIG. 7, the expression of the protein increased in the pTx-IGF-1-X10 administration group compared to the control vector (pTx) administration group as well as the pTx-mature IGF-1 administration group. was able to observe Therefore, it was found that expression of two different IGF-1 isoforms by administration of pTx-IGF-1-X10 can activate the early stage of muscle regeneration compared to administration of pTx-mature IGF-1. .
실시예 5: pTx-IGF-1-X10에 의한 근육량의 증가Example 5: Increase in muscle mass by pTx-IGF-1-X10
5-1: 카디오톡신 유발 근육 손상 마우스 모델의 근육량 측정 방법5-1: Method for measuring muscle mass in cardiotoxin-induced muscle damage mouse model
상기 실시예 4-1의 카디오톡신 유발 근육 손상 마우스 모델로부터 손상된 근육을 얻어, 다음과 같은 방법으로 근육의 무게를 측정하였다. 마우스로부터 분리한 근육을 바로 미세저울 위에 올려 무게를 측정한 뒤(mg 단위), 측정된 근육 무게(muscle mass)를 마우스의 체중(body weight)으로 보정하여 값을 계산하였다. 결과는 도 8에 나타내었다.Damaged muscles were obtained from the cardiotoxin-induced muscle injury mouse model of Example 4-1, and the weight of the muscles was measured in the following manner. The muscle isolated from the mouse was directly placed on a microbalance to measure the weight (mg unit), and the value was calculated by correcting the measured muscle mass with the body weight of the mouse. The results are shown in FIG. 8 .
5-2: 카디오톡신 유발 근육 손상 마우스 모델의 근육량 측정 결과5-2: Muscle mass measurement result of cardiotoxin-induced muscle damage mouse model
도 8에 나타낸 바와 같이, 아무런 처리를 하지 않은 C57BL/6 마우스의 근육무게/체중 비율을 기준(100%)으로 하여 비교하면, 대조 벡터(pTx) 투여군에서 카디오톡신(CTX)을 투여한 경우, 근육의 무게가 약 86.1% 수준으로 감소, 즉 13.9% 감소하였다. 반면, pTx-IGF-1-X10을 투여한 경우, 아무런 처리를 하지 않은 C57BL/6 마우스(도 8의 NC)와 비교해 체중에 대한 근육의 무게 백분율에 유의한 차이가 없었음을 관찰하였는데, 이는 본 발명의 pTx-IGF-1-X10의 카디오톡신 유발 근육 손상에 대한 유의한 회복 효과를 의미한다. 성숙 IGF-1 투여군(pTx-mature IGF-1)에서는 pTx 투여군 대비 체중에 대한 근육 무게의 백분율이 증가하는 경향은 있었으나, 본 발명의 pTx-IGF-1-X10에 준하는 유의한 회복 효과는 관찰되지 않았다. As shown in Figure 8, when comparing the muscle weight / body weight ratio of C57BL / 6 mice without any treatment as a reference (100%), when cardiotoxin (CTX) was administered in the control vector (pTx) administration group, The muscle weight was reduced by about 86.1%, that is, by 13.9%. On the other hand, when pTx-IGF-1-X10 was administered, it was observed that there was no significant difference in the percentage of muscle weight to body weight compared to C57BL/6 mice that did not receive any treatment (NC in FIG. 8). This means that the pTx-IGF-1-X10 of the present invention has a significant recovery effect on cardiotoxin-induced muscle damage. In the mature IGF-1 administration group (pTx-mature IGF-1), the percentage of muscle weight to body weight tended to increase compared to the pTx administration group, but no significant recovery effect was observed according to pTx-IGF-1-X10 of the present invention. did not
따라서, 상기 결과로부터 본 발명자들은 pTx-IGF-1-X10 투여로 인한 상이한 두 개의 IGF-1 이형체의 발현이 근육 무게를 증가시켰기 때문에, 성숙 IGF-1 단일 투여 대비 pTx-IGF-1-X10 투여는 근육의 재생에 대한 보다 높은 잠재력이 있음을 확인할 수 있었다.Therefore, from the above results, the present inventors found that the expression of two different IGF-1 isoforms due to pTx-IGF-1-X10 administration increased muscle weight, compared to single administration of mature IGF-1 pTx-IGF-1-X10. It was confirmed that administration has a higher potential for muscle regeneration.
이러한 결과는 IGF-1Ea 이형체 및 IGF-1Ec 이형체를 동시에 발현하는 본발명의 pTx-IGF-1-X 시리즈로부터 형성된 IGF-1Ea, IGF-1Ec, Ea 펩타이드, Ec 펩타이드 및/또는 성숙 IGF-1 자체 또는 이들의 상호작용이 근육 손상에 대한 유의한 예방 또는 치료 효과가 있음을 암시한다.These results indicate that IGF-1Ea, IGF-1Ec, Ea peptide, Ec peptide and/or mature IGF-1Ea formed from the pTx-IGF-1-X series of the present invention co-expressing IGF-1Ea isoforms and IGF-1Ec isoforms. 1 suggests that either itself or their interactions have significant preventive or therapeutic effects on muscle damage.
따라서, 본 발명에 따른 적어도 하나의 인간 IGF-1 이형체를 인코딩하는 폴리뉴클레오타이드는 신경 손상, 노화, 독소 노출 등 다양한 원인으로 인한 근감소증의 예방 또는 치료에 유용하게 사용될 수 있다.Therefore, the polynucleotide encoding at least one human IGF-1 isoform according to the present invention can be usefully used for preventing or treating sarcopenia due to various causes such as nerve damage, aging, and toxin exposure.

Claims (19)

  1. 다음을 유효성분으로 포함하는 근감소증(sarcopenia) 예방 또는 치료용 약제학적 조성물:A pharmaceutical composition for preventing or treating sarcopenia comprising the following as active ingredients:
    (a) 적어도 하나의 인간 IGF-1(Insulin-Like Growth Factor-1) 이형체; 또는 (a) at least one isoform of human Insulin-Like Growth Factor-1 (IGF-1); or
    (b) 적어도 하나의 인간 IGF-1 이형체를 인코딩하는 폴리뉴클레오타이드.(b) a polynucleotide encoding at least one human IGF-1 isoform.
  2. 제1항에 있어서, 상기 인간 IGF-1 이형체는 서열번호 11의 아미노산 서열을 포함하는 IGF-1Ea 이형체, 서열번호 13의 아미노산 서열을 포함하는 IGF-1Ec 이형체, 또는 이들의 조합이거나; 또는The method of claim 1, wherein the human IGF-1 isoform is an IGF-1Ea isoform comprising the amino acid sequence of SEQ ID NO: 11, an IGF-1Ec isoform comprising the amino acid sequence of SEQ ID NO: 13, or a combination thereof; or
    상기 폴리뉴클레오타이드는 상기 IGF-1Ea 이형체, 상기 IGF-1Ec 이형체, 또는 이들의 조합을 인코딩하는 폴리뉴클레오타이드인 것인, 약제학적 조성물.Wherein the polynucleotide is a polynucleotide encoding the IGF-1Ea isoform, the IGF-1Ec isoform, or a combination thereof, the pharmaceutical composition.
  3. 제1항에 있어서, 상기 인간 IGF-1 이형체는 서열번호 11의 아미노산 서열을 포함하는 IGF-1Ea 이형체 및 서열번호 13의 아미노산 서열을 포함하는 IGF-1Ec 이형체이거나; 또는The method of claim 1, wherein the human IGF-1 isoform is an IGF-1Ea isoform comprising the amino acid sequence of SEQ ID NO: 11 and an IGF-1Ec isoform comprising the amino acid sequence of SEQ ID NO: 13; or
    상기 폴리뉴클레오타이드는 상기 IGF-1Ea 이형체 및 상기 IGF-1Ec 이형체를 인코딩하는 폴리뉴클레오타이드인 것인, 약제학적 조성물.Wherein the polynucleotide is a polynucleotide encoding the IGF-1Ea isoform and the IGF-1Ec isoform, the pharmaceutical composition.
  4. 제2항에 있어서, 상기 IGF-1Ea 이형체는 서열번호 11의 아미노산 서열의 140번째 아스파라긴(asparagine) 잔기가 N-연결 당화(N-linked glycosylation)된 것인, 약제학적 조성물.The pharmaceutical composition according to claim 2, wherein the IGF-1Ea isomer is obtained by N-linked glycosylation of the 140th asparagine residue of the amino acid sequence of SEQ ID NO: 11.
  5. 제2항에 있어서, 상기 IGF-1Ea 이형체를 인코딩하는 폴리뉴클레오타이드는 서열번호 12의 뉴클레오타이드 서열을 포함하는 것인, 약제학적 조성물.The pharmaceutical composition according to claim 2, wherein the polynucleotide encoding the IGF-1Ea isoform comprises the nucleotide sequence of SEQ ID NO: 12.
  6. 제2항에 있어서, 상기 IGF-1Ec 이형체를 인코딩하는 폴리뉴클레오타이드는 서열번호 14의 뉴클레오타이드 서열을 포함하는 것인, 약제학적 조성물.The pharmaceutical composition according to claim 2, wherein the polynucleotide encoding the IGF-1Ec isoform comprises the nucleotide sequence of SEQ ID NO: 14.
  7. 제2항에 있어서, 상기 IGF-1Ea 이형체 및 상기 IGF-1Ec 이형체는 별도의 뉴클레오타이드 서열에 의해 인코딩되는 것인, 약제학적 조성물.The pharmaceutical composition according to claim 2, wherein the IGF-1Ea isoform and the IGF-1Ec isoform are encoded by separate nucleotide sequences.
  8. 제2항에 있어서, 상기 IGF-1Ea 이형체 및 상기 IGF-1Ec 이형체는 단일의 뉴클레오타이드 서열에 의해 인코딩되는 것인, 약제학적 조성물.The pharmaceutical composition according to claim 2, wherein the IGF-1Ea isoform and the IGF-1Ec isoform are encoded by a single nucleotide sequence.
  9. i) 서열번호 1의 뉴클레오타이드 서열 또는 이의 축퇴성 서열;i) the nucleotide sequence of SEQ ID NO: 1 or a degenerate sequence thereof;
    ii) 서열번호 2의 뉴클레오타이드 서열 또는 이의 단편;ii) the nucleotide sequence of SEQ ID NO: 2 or a fragment thereof;
    iii) 서열번호 3의 뉴클레오타이드 서열 또는 이의 축퇴성 서열;iii) the nucleotide sequence of SEQ ID NO: 3 or a degenerate sequence thereof;
    iv) 서열번호 4의 뉴클레오타이드 서열 또는 이의 단편; 및iv) the nucleotide sequence of SEQ ID NO: 4 or a fragment thereof; and
    v) 서열번호 5의 뉴클레오타이드 서열 또는 이의 축퇴성 서열이 순차적으로 5'에서 3'순서로 연결된 단일의 폴리뉴클레오타이드를 유효성분으로 포함하는 근감소증 예방 또는 치료용 약제학적 조성물.v) A pharmaceutical composition for preventing or treating sarcopenia comprising, as an active ingredient, a single polynucleotide in which the nucleotide sequence of SEQ ID NO: 5 or a degenerate sequence thereof is sequentially linked in 5' to 3' order.
  10. 제9항에 있어서, 상기 ii)의 뉴클레오타이드 서열의 단편은 서열번호 6의 뉴클레오타이드 서열인 것인, 약제학적 조성물.The pharmaceutical composition according to claim 9, wherein the fragment of the nucleotide sequence of ii) is the nucleotide sequence of SEQ ID NO: 6.
  11. 제9항에 있어서, 상기 ii)의 뉴클레오타이드 서열의 단편은 서열번호 7의 뉴클레오타이드 서열인 것인, 약제학적 조성물.The pharmaceutical composition according to claim 9, wherein the fragment of the nucleotide sequence of ii) is the nucleotide sequence of SEQ ID NO: 7.
  12. 제9항에 있어서, 상기 iv)의 뉴클레오타이드 서열의 단편은 서열번호 8의 뉴클레오타이드 서열인 것인, 약제학적 조성물.The pharmaceutical composition according to claim 9, wherein the fragment of the nucleotide sequence of iv) is the nucleotide sequence of SEQ ID NO: 8.
  13. 제1항 또는 제9항에 있어서, 상기 폴리뉴클레오타이드는 네이키드 DNA(naked DNA) 이거나 또는 유전자 운반체에 포함되어 있는 것인, 약제학적 조성물.The pharmaceutical composition according to claim 1 or 9, wherein the polynucleotide is naked DNA or contained in a gene carrier.
  14. 제13항에 있어서, 상기 유전자 운반체는 벡터인 것인, 약제학적 조성물.The pharmaceutical composition according to claim 13, wherein the gene carrier is a vector.
  15. 제14항에 있어서, 상기 벡터는 플라스미드인 것인, 약제학적 조성물.The pharmaceutical composition according to claim 14, wherein the vector is a plasmid.
  16. 제15항에 있어서, 상기 플라스미드는 pCK, pCP, pVAXl, pCY, 또는 pTx인 것인, 약제학적 조성물.The pharmaceutical composition according to claim 15, wherein the plasmid is pCK, pCP, pVAXl, pCY, or pTx.
  17. 제13항에 있어서, 상기 폴리뉴클레오타이드는 단일의 또는 별도의 폴리뉴클레오타이드인 것인, 약제학적 조성물.The pharmaceutical composition according to claim 13, wherein the polynucleotide is a single or separate polynucleotide.
  18. 제17항에 있어서, 상기 단일의 폴리뉴클레오타이드는 서열번호 9의 폴리뉴클레오타이드를 포함하는 것인, 약제학적 조성물.18. The pharmaceutical composition of claim 17, wherein the single polynucleotide comprises the polynucleotide of SEQ ID NO: 9.
  19. 제17항에 있어서, 상기 단일의 폴리뉴클레오타이드는 서열번호 10의 폴리뉴클레오타이드를 포함하는 것인, 약제학적 조성물.18. The pharmaceutical composition according to claim 17, wherein the single polynucleotide comprises the polynucleotide of SEQ ID NO: 10.
PCT/KR2023/002208 2022-02-15 2023-02-15 Composition for preventing or treating sarcopenia by using insulin-like growth factor-1 isoform WO2023158214A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20220019804 2022-02-15
KR10-2022-0019804 2022-02-15

Publications (1)

Publication Number Publication Date
WO2023158214A1 true WO2023158214A1 (en) 2023-08-24

Family

ID=87578572

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/002208 WO2023158214A1 (en) 2022-02-15 2023-02-15 Composition for preventing or treating sarcopenia by using insulin-like growth factor-1 isoform

Country Status (2)

Country Link
KR (1) KR20230123448A (en)
WO (1) WO2023158214A1 (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140286906A1 (en) * 2011-10-06 2014-09-25 Daniel Bilbao Cortes Use of igf-1 in the modulation of treg cell activity and the treatment and prevention of autoimmune disorders or diseases
KR20190060016A (en) * 2014-10-20 2019-05-31 뉴럴스템, 인크. Stable neural stem cells comprising an exogenous polynucleotide coding for a growth factor and methods of use thereof
KR20210025122A (en) * 2018-07-17 2021-03-08 주식회사 헬릭스미스 Neuropathy treatment with IGF-1-encoding DNA constructs and HGF-encoding DNA constructs
KR20210052443A (en) * 2018-07-17 2021-05-10 뉴로마이언 주식회사 Treatment of neuropathy using DNA construct expressing IGF-1 isoform

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140286906A1 (en) * 2011-10-06 2014-09-25 Daniel Bilbao Cortes Use of igf-1 in the modulation of treg cell activity and the treatment and prevention of autoimmune disorders or diseases
KR20190060016A (en) * 2014-10-20 2019-05-31 뉴럴스템, 인크. Stable neural stem cells comprising an exogenous polynucleotide coding for a growth factor and methods of use thereof
KR20210025122A (en) * 2018-07-17 2021-03-08 주식회사 헬릭스미스 Neuropathy treatment with IGF-1-encoding DNA constructs and HGF-encoding DNA constructs
KR20210052443A (en) * 2018-07-17 2021-05-10 뉴로마이언 주식회사 Treatment of neuropathy using DNA construct expressing IGF-1 isoform

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
ASCENZI FRANCESCA, BARBERI LAURA, DOBROWOLNY GABRIELLA, VILLA NOVA BACURAU ALINE, NICOLETTI CARMINE, RIZZUTO EMANUELE, ROSENTHAL N: "Effects of IGF‐1 isoforms on muscle growth and sarcopenia", AGING CELL, BLACKWELL PUBLISHING,, GB, vol. 18, no. 3, 1 June 2019 (2019-06-01), GB , pages e12954, XP093085493, ISSN: 1474-9718, DOI: 10.1111/acel.12954 *

Also Published As

Publication number Publication date
KR20230123448A (en) 2023-08-23

Similar Documents

Publication Publication Date Title
AU2016346870B2 (en) Dual function proteins and pharmaceutical composition comprising same
WO2017078440A1 (en) Peptide having neuronal loss prevention and regeneration effects, and composition containing same
WO2017116204A1 (en) Triple activator activating glucagon, glp-1 and gip receptor
WO2019182370A1 (en) Pharmaceutical composition for preventing or treating neurodegenerative diseases comprising cox2 acetylating agent as active ingredient
WO2017082701A1 (en) Pharmaceutical composition for treatment of cardiac fibrosis
WO2018088838A1 (en) Pharmaceutical composition for preventing or treating hepatitis, hepatic fibrosis, and hepatic cirrhosis comprising fusion proteins
WO2018208011A2 (en) BIOCOMPATIBLE PEPTIDE SUPPRESSIVE OF AGGREGATION OF β-AMYLOID PROTEIN
WO2023158214A1 (en) Composition for preventing or treating sarcopenia by using insulin-like growth factor-1 isoform
AU2015372767B2 (en) Glucagon derivatives
WO2019156540A1 (en) Composition for increasing expression of growth factor gene, comprising core-shell structured microparticles as active ingredient
WO2020017788A1 (en) Composition for preventing or treating diabetes by using cd9, and method for screening for antidiabetic agents
WO2017213435A1 (en) Composition using slit-robo system for preventing or treating sarcopenia
WO2022050778A1 (en) Improved cell-permeable modified parkin recombinant protein for treatment of neurodegenerative diseases and use thereof
WO2022211454A1 (en) Pharmaceutical composition for preventing or treating charcot-marie-tooth disease
WO2022119380A1 (en) Novel ace2 variant and use thereof
WO2020184941A1 (en) Glp-1 fusion proteins and uses thereof
WO2018021778A1 (en) Composition for preventing or treating impotence, ischemic diseases or peripheral nerve diseases, containing fusion protein comprising lrg1 glycoprotein
WO2016178511A1 (en) Composition comprising kal1 polypeptide or gene encoding same for inhibiting angiogenesis, and use thereof
WO2021149925A1 (en) Pharmaceutical composition for treating trpv1 activity-mediated diseases
WO2023234701A1 (en) Composition for treating retinal or macular diseases
WO2024085637A1 (en) Composition for preventing aging comprising plasma-derived protein
WO2021251602A1 (en) Composition for preventing or treating disease caused by muscle loss, comprising agent inhibiting phf20
WO2022164260A1 (en) Gene therapy for treating neurodegenerative diseases
WO2022103220A1 (en) Use of therapeutic enzyme fusion protein in preventing and treating neuropathy attributed to or associated with farbry's disease
WO2022045775A1 (en) Peptide composition for prevention or treatment of alzheimer's disease

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23756626

Country of ref document: EP

Kind code of ref document: A1