WO2023154900A2 - Microtubule associated protein tau (mapt) irna agent compositions and methods of use thereof - Google Patents
Microtubule associated protein tau (mapt) irna agent compositions and methods of use thereof Download PDFInfo
- Publication number
- WO2023154900A2 WO2023154900A2 PCT/US2023/062440 US2023062440W WO2023154900A2 WO 2023154900 A2 WO2023154900 A2 WO 2023154900A2 US 2023062440 W US2023062440 W US 2023062440W WO 2023154900 A2 WO2023154900 A2 WO 2023154900A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nucleotide
- dsrna agent
- nucleotides
- tau
- antisense strand
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/713—Double-stranded nucleic acids or oligonucleotides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/312—Phosphonates
- C12N2310/3125—Methylphosphonates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/315—Phosphorothioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/321—2'-O-R Modification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/322—2'-R Modification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/351—Conjugate
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/351—Conjugate
- C12N2310/3515—Lipophilic moiety, e.g. cholesterol
Definitions
- the XML copy, created on February 10, 2023, is named A108868_1580WO_SL_XML and is 4,839,728 bytes in size.
- the microtubule associated protein tau (MAPT) gene encoding the protein Microtubule- Associated Protein Tau (Mapt), a member of the microtubule-associated protein family, is located in the chromosomal region 17q21.31 (base pairs 45,894,382 to 46,028,334 on chromosome 17).
- the MAPT gene consists of 16 exons. Alternative mRNA splicing gives rise to six MAPT isoforms with a total of 352–441 amino acids.
- the microtubule-binding domain of MAPT contains three repeated segments (3R-tau isoforms), whereas the corresponding domain contains four repeated segments in the other three MAPT isoforms (4R-tau isoforms).
- MAPT transcripts are differentially expressed throughout the body, predominantly in the central and peripheral nervous system. Wild type Tau is involved in stabilizing microtubules in neuronal axons, maintaining dendric spines, and regulating axonal transport, microtubule dynamics, and cell division. Pathogenic variants of MAPT are found in approximately 10% of patients with primary tauopathy.
- Variants are primarily missense mutations and localized in exons 9-13 (microtubule binding domains), with many affecting the alternative splicing of exon 10.
- Tauopathies are a heterogeneous class of progressive neurodegenerative disorders pathologically characterized by the presence of Tau aggregates in the brain. Phenotypically, tauopathies show variable progression of motor, cognitive, and behavioral impairment. Humans normally express equal ratios of 3R-tau and 4R-tau. In some tauopathies, such as Alzheimer’s disease, experimental evidence from post-mortem brain tissue suggest that the insoluble aggregates of tau are comprised of 3R- tau and 4R-tau.
- agents that can efficiently, and preferably preferentially, inhibit or adjust the expression of 4R-tau such that subjects having a 4R-tau-associated disorder, such as progressive supranuclear palsy (PSP), corticobasal syndrome (CBD), argyrophilic grain disease (AGD), multiple system tauopathy with presensile dementia (MSTD), globular glial tauopathy (GGT), sporadic (spAD) Alzheimer’s disease, rapidly progressive (rpAD) Alzheimer’s disease, or another 4R-tauopathy, can be effectively treated.
- a 4R-tau-associated disorder such as progressive supranuclear palsy (PSP), corticobasal syndrome (CBD), argyrophilic grain disease (AGD), multiple system tauopathy with presensile dementia (MSTD), globular glial tauopathy (GGT), sporadic (spAD) Alzheimer’s disease, rapidly progressive (rpAD) Alzheimer’s disease, or another 4R-tauopathy, can be effectively
- RNAi compositions which effect the RNA-induced silencing complex (RISC)-mediated cleavage of 4R-tau RNA transcripts of a MAPT gene by targeting a particular hotspot region within exon 10 of the MAPT gene.
- the MAPT gene may be within a cell, e.g., a cell within a subject, such as a human.
- RISC RNA-induced silencing complex
- the use of these iRNAs enables the targeted degradation of 4R-tau mRNAs of the corresponding gene (MAPT gene) in mammals.
- the iRNAs of the disclosure have been designed to target a hotspot within exon 10 of a MAPT gene, e.g., a MAPT gene having missense and/or deletion mutations in the exons of the gene, and having a combination of nucleotide modifications.
- the iRNAs of the disclosure inhibit the expression of 4R-tau transcripts by at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 95%, relative to control levels, and reduce the level of sense- and antisense-containing foci.
- a combination or sub-combination of the foregoing properties and the specific target sites, or the specific modifications in these iRNAs confer to the iRNAs of the disclosure improved efficacy, stability, potency, durability, and safety.
- the combination or sub-combination of the foregoing properties and the specific target sites, or the specific modifications in these iRNAs may also confer to the iRNAs of the disclosure enhanced specificity for 4R-tau isoforms of the MAPT gene, relative to 3R-tau isoforms.
- the present disclosure provides a double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of 4R-tau
- dsRNA double stranded ribonucleic acid
- the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region
- the sense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of nucleotides 1009- 1053 of SEQ ID NO: 3
- the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of nucleotides 1007-1053 of SEQ ID NO: 4.
- the sense strand comprises at least 15 contiguous nucleotides of nucleotides 1009-1053 of SEQ ID NO: 3
- the antisense strand comprises at least 15 contiguous nucleotides of nucleotides 1007-1053 of SEQ ID NO: 4.
- the present disclosure provides a dsRNA agent for inhibiting expression of 4R- tau, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a region of complementarity to an mRNA encoding 4R- tau, and wherein the region of complementarity comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of nucleotides 1007-1053 of SEQ ID NO: 4. In a particular embodiment, the region of complementarity comprises at least 15 contiguous nucleotides of nucleotides 1007-1053 of SEQ ID NO: 4.
- the region of complementarity may reside fully within nucleotides 1007-1053 of SEQ ID NO: 4.
- the present disclosure provides a dsRNA agent for inhibiting expression of 4R-tau, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a region of complementarity to an mRNA encoding 4R-tau, and wherein the region of complementarity comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the antisense nucleotide sequences in Table 7 or 8.
- the nucleotide sequence of the sense and antisense strand comprise any the sense and antisense strand nucleotide sequences of any one of the duplexes in Table 7 or 8.
- the sense strand comprises at least 15 contiguous nucleotides differing by no more than three nucleotides from any one of the nucleotide sequence of nucleotides 1009-1029, 1016-1036, 1018-1038, 1020-1040, 1021-1041, 1022-1042, 1024-1044, 1027-1047, 1028-1048, 1029-1049, 1030-1050, 1032-1052, 1033- 1053, 1014-1048, and 1022-1048 of SEQ ID NO: 3, and the antisense strand comprises at least 15 contiguous nucleotides from the corresponding nucleotide sequence of SEQ ID NO: 4.
- the antisense strand comprises at least 15 contiguous nucleotides differing by no more than three nucleotides from any one of the antisense strand nucleotide sequences of a duplex selected from the group consisting of AD-1423276, AD-1423283, AD-1423285, AD-1423287, AD- 1423288, AD-1423289, AD-1423291, AD-1423294, AD-1423295, AD-1423296, AD-1423297, AD- 1423299, and AD-1423300.
- the antisense strand comprises at least 15 contiguous nucleotides differing by no more than three nucleotides from any one of the antisense strand nucleotide sequences of a duplex selected from the group consisting of AD-1423283, AD-1423291, AD- 1423294, and AD-1423295.
- the dsRNA agent is able to decrease 4R-tau isoform mRNA expression by at least about 50%, 55%, 60%, 65%, 70%, or 75%, while decreasing 3R-tau isoform mRNA expression by no more than about 40%, 35%, 30%, 25%, 20%, 15%, 10%, or 5% in a cell expressing both 3R tau and 4R tau isoforms.
- the dsRNA agent is able to decrease 4R-tau isoform mRNA expression by at least about 70%, while decreasing 3R-tau isoform mRNA expression by no more than about 30% in a cell expressing both 3R tau and 4R tau isoforms.
- the sense strand, the antisense strand, or both the sense strand and the antisense strand described herein is/are conjugated to one or more lipophilic moieties.
- the lipophilic moiety is conjugated to one or more internal positions in the double stranded region of the dsRNA agent.
- the lipophilic moiety is conjugated via a linker or carrier.
- the lipophilicity of the lipophilic moiety exceeds 0.
- the hydrophobicity of the double-stranded RNA agent measured by the unbound fraction in a plasma protein binding assay of the double-stranded RNA agent, exceeds 0.2.
- the plasma protein binding assay is an electrophoretic mobility shift assay using human serum albumin protein.
- the dsRNA agent comprises at least one modified nucleotide. In one embodiment, no more than five of the sense strand nucleotides and no more than five of the nucleotides of the antisense strand in a dsRNA agent of the present disclosure are unmodified nucleotides.
- all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand in the dsRNA agent are modified nucleotides.
- at least one of the modified nucleotides of the dsRNA agent is selected from the group consisting of a deoxy-nucleotide, a 3’-terminal deoxythimidine (dT) nucleotide, a 2'-O- methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an unlocked nucleotide, a conformationally restricted nucleotide, a constrained ethyl nucleotide, an abasic nucleotide, a 2’-amino-modified nucleotide, a 2’-O-allyl-modified nucleotide, 2’-C
- the modified nucleotide of the dsRNA agent is selected from the group consisting of a 2'-deoxy-2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, 3’-terminal deoxythimidine nucleotides (dT), a locked nucleotide, an abasic nucleotide, a 2’-amino-modified nucleotide, a 2’-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, and a non- natural base comprising nucleotide.
- dT deoxythimidine nucleotides
- the modified nucleotide of the dsRNA comprises a short sequence of 3’- terminal deoxythimidine nucleotides (dT).
- the modifications on the nucleotides of the dsRNA agent are 2’-O-methyl, 3- RNA, and 2’-deoxy-2’-fluoro modifications.
- the modifications on the nucleotides of the dsRNA agent are selected from 2’-O-methyl, 2’-deoxy, GNA, and 2’-deoxy-2’-fluoro modifications.
- the dsRNA agent further comprises at least one phosphorothioate internucleotide linkage.
- the dsRNA agent comprises 6-8 phosphorothioate internucleotide linkages. In one embodiment, each strand of the dsRNA is no more than 30 nucleotides in length. In one embodiment, at least one strand of the dsRNA agent comprises a 3’ overhang of at least 1 nucleotide. In another embodiment, at least one strand of the dsRNA agent comprises a 3’ overhang of at least 2 nucleotides.
- the double stranded region of the dsRNA agent may be 15-30 nucleotide pairs in length; 17-23 nucleotide pairs in length; 17-25 nucleotide pairs in length; 23-27 nucleotide pairs in length; 19-21 nucleotide pairs in length; or 21-23 nucleotide pairs in length.
- each strand of the dsRNA may have 19-30 nucleotides;19-23 nucleotides; or 21-23 nucleotides.
- one or more lipophilic moieties are conjugated to one or more internal positions on at least one strand, such as via a linker or carrier.
- the internal positions include all positions except the terminal two positions from each end of the at least one strand. In another embodiment, the internal positions include all positions except the terminal three positions from each end of the at least one strand. In one embodiment, the internal positions exclude a cleavage site region of the sense strand. In one embodiment, the internal positions include all positions except positions 9-12, counting from the 5’-end of the sense strand. In another embodiment, the internal positions include all positions except positions 11-13, counting from the 3’-end of the sense strand. In one embodiment, the internal positions exclude a cleavage site region of the antisense strand. In one embodiment, the internal positions include all positions except positions 12-14, counting from the 5’-end of the antisense strand.
- the internal positions include all positions except positions 11-13 on the sense strand, counting from the 3’-end, and positions 12-14 on the antisense strand, counting from the 5’- end.
- the one or more lipophilic moieties are conjugated to one or more of the internal positions selected from the group consisting of positions 4-8 and 13-18 on the sense strand, and positions 6-10 and 15-18 on the antisense strand, counting from the 5’end of each strand.
- the one or more lipophilic moieties are conjugated to one or more of the internal positions selected from the group consisting of positions 5, 6, 7, 15, and 17 on the sense strand, and positions 15 and 17 on the antisense strand, counting from the 5’-end of each strand.
- the internal positions in the double stranded region exclude a cleavage site region of the sense strand.
- the sense strand is 21 nucleotides in length
- the antisense strand is 23 nucleotides in length
- the lipophilic moiety is conjugated to position 21, position 20, position 15, position 1, position 7, position 6, or position 2 of the sense strand or position 16 of the antisense strand.
- the lipophilic moiety is conjugated to position 21, position 20, position 15, position 1, or position 7 of the sense strand.
- the lipophilic moiety is conjugated to position 21, position 20, or position 15 of the sense strand.
- the lipophilic moiety is conjugated to position 20 or position 15 of the sense strand.
- the lipophilic moiety is conjugated to position 16 of the antisense strand.
- the lipophilic moiety is an aliphatic, alicyclic, or polyalicyclic compound.
- the lipophilic moiety is selected from the group consisting of lipid, cholesterol, retinoic acid, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyanol, hexadecylglycerol, borneol, menthol, 1,3- propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl) lithocholic acid, O3- (oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine.
- the lipophilic moiety contains a saturated or unsaturated C4-C30 hydrocarbon chain, and an optional functional group selected from the group consisting of hydroxyl, amine, carboxylic acid, sulfonate, phosphate, thiol, azide, and alkyne.
- the lipophilic moiety contains a saturated or unsaturated C6-C18 hydrocarbon chain.
- the lipophilic moiety contains a saturated or unsaturated C16 hydrocarbon chain.
- the saturated or unsaturated C16 hydrocarbon chain is conjugated to position 6, counting from the 5’-end of the strand.
- the modifications on the nucleotides of the dsRNA agent are selected from 2’-O-methyl, 2’-deoxy, 3-RNA, and 2’-deoxy-2’-fluoro modifications; and at least one nucleotide comprising a lipophilic moiety (e.g., 2’-hexadecyloxy).
- the modifications on the nucleotides of the dsRNA agent are selected from 2’-O-methyl, 2’-deoxy, GNA, and 2’-deoxy-2’-fluoro modifications; and at least one nucleotide comprising a lipophilic moiety(e.g., 2’-hexadecyloxy).
- the lipophilic moiety is conjugated via a carrier that replaces one or more nucleotide(s) in the internal position(s) or the double stranded region.
- the carrier is a cyclic group selected from the group consisting of pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1,3] dioxolanyl, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuranyl, and decalinyl; or is an acyclic moiety based on a serinol backbone or a diethanolamine backbone.
- the lipophilic moiety is conjugated to the double-stranded iRNA agent via a linker containing an ether, thioether, urea, carbonate, amine, amide, maleimide-thioether, disulfide, phosphodiester, sulfonamide linkage, a product of a click reaction, or carbamate.
- the lipophilic moiety is conjugated to a nucleobase, sugar moiety, or internucleosidic linkage.
- the lipophilic moiety or targeting ligand is conjugated via a bio- linker selected from the group consisting of DNA, RNA, disulfide, amide, functionalized monosaccharides or oligosaccharides of galactosamine, glucosamine, glucose, galactose, mannose, and combinations thereof.
- a bio- linker selected from the group consisting of DNA, RNA, disulfide, amide, functionalized monosaccharides or oligosaccharides of galactosamine, glucosamine, glucose, galactose, mannose, and combinations thereof.
- the 3’ end of the sense strand is protected via an end cap which is a cyclic group having an amine, said cyclic group being selected from the group consisting of pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1,3] dioxolanyl, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuranyl, and decalinyl.
- an end cap which is a cyclic group having an amine, said cyclic group being selected from the group consisting of pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidin
- the dsRNA agent further comprises a targeting ligand that targets a neuronal cell.
- the dsRNA agent further comprises a terminal, chiral modification occurring at the first internucleotide linkage at the 3’ end of the antisense strand, having the linkage phosphorus atom in Sp configuration, a terminal, chiral modification occurring at the first internucleotide linkage at the 5’ end of the antisense strand, having the linkage phosphorus atom in Rp configuration, and a terminal, chiral modification occurring at the first internucleotide linkage at the 5’ end of the sense strand, having the linkage phosphorus atom in either Rp configuration or Sp configuration.
- the dsRNA agent further comprises a terminal, chiral modification occurring at the first and second internucleotide linkages at the 3’ end of the antisense strand, having the linkage phosphorus atom in Sp configuration, a terminal, chiral modification occurring at the first internucleotide linkage at the 5’ end of the antisense strand, having the linkage phosphorus atom in Rp configuration, and a terminal, chiral modification occurring at the first internucleotide linkage at the 5’ end of the sense strand, having the linkage phosphorus atom in either Rp or Sp configuration.
- the dsRNA agent further comprises a terminal, chiral modification occurring at the first, second and third internucleotide linkages at the 3’ end of the antisense strand, having the linkage phosphorus atom in Sp configuration, a terminal, chiral modification occurring at the first internucleotide linkage at the 5’ end of the antisense strand, having the linkage phosphorus atom in Rp configuration, and a terminal, chiral modification occurring at the first internucleotide linkage at the 5’ end of the sense strand, having the linkage phosphorus atom in either Rp or Sp configuration.
- the dsRNA agent further comprises a terminal, chiral modification occurring at the first, and second internucleotide linkages at the 3’ end of the antisense strand, having the linkage phosphorus atom in Sp configuration, a terminal, chiral modification occurring at the third internucleotide linkages at the 3’ end of the antisense strand, having the linkage phosphorus atom in Rp configuration, a terminal, chiral modification occurring at the first internucleotide linkage at the 5’ end of the antisense strand, having the linkage phosphorus atom in Rp configuration, and a terminal, chiral modification occurring at the first internucleotide linkage at the 5’ end of the sense strand, having the linkage phosphorus atom in either Rp or Sp configuration.
- the dsRNA agent further comprises a terminal, chiral modification occurring at the first, and second internucleotide linkages at the 3’ end of the antisense strand, having the linkage phosphorus atom in Sp configuration, a terminal, chiral modification occurring at the first, and second internucleotide linkages at the 5’ end of the antisense strand, having the linkage phosphorus atom in Rp configuration, and a terminal, chiral modification occurring at the first internucleotide linkage at the 5’ end of the sense strand, having the linkage phosphorus atom in either Rp or Sp configuration.
- the dsRNA agent further comprises a phosphate or phosphate mimic at the 5’-end of the antisense strand.
- the phosphate mimic is a 5’-vinyl phosphonate (VP).
- the base pair at the 1 position of the 5 ⁇ -end of the antisense strand of the duplex is an AU base pair.
- the sense strand has a total of 21 nucleotides and the antisense strand has a total of 23 nucleotides.
- the present disclosure also provides cells and pharmaceutical compositions comprising a dsRNA agent of the disclosure and a lipid formulation.
- the present disclosure also provides pharmaceutical compositions for inhibiting expression of a gene encoding 4R-tau comprising a dsRNA agent of the disclosure.
- the present disclosure also provides pharmaceutical compositions for reducing abberant expression (e.g., overexpression) of exon 10-containing MAPT transcripts comprising a dsRNA agent of the disclosure.
- the dsRNA agent is in an unbuffered solution, such as saline or water.
- the dsRNA agent is in a buffer solution, such as a buffer solution comprising acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof; or phosphate buffered saline (PBS).
- the present disclosure provides a method of inhibiting or reducing expression of 4R-tau in a cell, the method comprising contacting the cell with a dsRNA agent of the disclosure, or a pharmaceutical composition of the disclosure, thereby inhibiting expression of 4R-tau in the cell.
- the present disclosure provides a method of reducing abberant expression (e.g., overexpression) of exon 10-containing MAPT transcripts in a cell, the method comprising contacting the cell with a dsRNA agent of the disclosure, or a pharmaceutical composition of the disclosure, thereby degrading exon 10-containing MAPT transcripts in the cell.
- the cell is within a subject. In one embodiment, the subject is a human.
- the subject has a 4R-tau-associated disorder. In one embodiment, the subject has a 4R-tau-associated disorder that is a neurodegenerative disorder. In one embodiment, the neurodegenerative disorder of the subject is associated with an abnormality of MAPT gene encoded protein 4R-tau. In one embodiment, the abnormality of MAPT gene encoded protein 4R-tau results in aggregation of 4R-tau in subject’s brain. In one embodiment, the neurodegenerative disorder is a familial disorder. In one embodiment, the neurodegenerative disorder is a sporadic disorder.
- the 4R-tau-associated disorder is a 4R-tauopathy selected from the group consisting of progressive supranuclear palsy (PSP), progressive supranuclear palsy-Richardson’s syndrome (PSP-RS), corticobasal syndrome (CBD), argyrophilic grain disease (AGD), frontotemporal lobar degeneration due to tau (FTLD-tau), FTLD-tau due to MAPT mutation (e.g., a mutation selected from N279K, L284L, DN296, N296N, N296H,P301L P301S, S305N, and S305S), multiple system tauopathy with presensile dementia (MSTD), globular glial tauopathy (GGT), Parkinsonism similar to Parkinson’s disease, nonfluent variant of primary progressive aphasia (nfvPPA), behavioral variant of frontotemporal dementia (bvFTD), primary akinesia with gait freezing (PAGF), primary lateral lateral a
- the 4R-tau-associated disorder is a 4R-tauopathy is rapidly progressive Alzheimer’s Disease (rpAD). In one embodiment, the 4R-tau-associated disorder is a 4R-tauopathy is sporadic Alzheimer’s Disease (spAD). In one embodiment, the 4R-tau-associated disorder is a 4R-tauopathy progressive supranuclear palsy (PSP) or progressive supranuclear palsy-Richardson’s syndrome (PSP-RS). In another embodiment, the 4R-tau-associated disorder is a 4R-tauopathy progressive supranuclear palsy (PSP).
- PSP 4R-tauopathy progressive supranuclear palsy
- PSP-RS progressive supranuclear palsy
- contacting the cell with the dsRNA agent inhibits the expression of 4R-tau by at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 95%, relative to control levels.
- the dsRNA agent inhibits the expression of 4R-tau by at least about 25%.
- inhibiting expression of 4R-tau decreases 4R-tau protein level in serum of the subject by at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 95%, relative to control levels.
- the dsRNA agent decreases 4R-tau protein level in serum of the subject by at least about 25%.
- the present disclosure provides a method of treating a subject having a disorder that would benefit from reduction in 4R-tau expression, comprising administering to the subject a therapeutically effective amount of a dsRNA agent of the disclosure, or a pharmaceutical composition of the disclosure, thereby treating the subject having the disorder that would benefit from reduction in 4R- tau expression.
- the present disclosure provides a method of preventing at least one symptom in a subject having a disorder that would benefit from reduction in 4R-tau expression, comprising administering to the subject a prophylactically effective amount of a dsRNA agent of the disclosure, or a pharmaceutical composition of the disclosure, thereby preventing at least one symptom in the subject having the disorder that would benefit from reduction in 4R-tau expression.
- the disorder is a 4R-tau-associated disorder.
- the disorder is associated with an abnormality of MAPT gene encoded protein 4R-tau.
- the abnormality of MAPT gene encoded protein 4R-tau results in aggregation of 4R-tau in the subject’s brain.
- the 4R-tau-associated disorder is a 4R-tauopathy selected from the group consisting of progressive supranuclear palsy (PSP), progressive supranuclear palsy-Richardson’s syndrome (PSP-RS), corticobasal syndrome (CBD), argyrophilic grain disease (AGD), frontotemporal lobar degeneration due to tau (FTLD-tau), FTLD-tau due to MAPT mutation (e.g., a mutation selected from N279K, L284L, DN296, N296N, N296H,P301L P301S, S305N, and S305S), multiple system tauopathy with presensile dementia (MSTD), globular glial tauopathy (GGT), Parkinsonism similar to Parkinson’s disease, nonfluent variant of primary progressive aphasia (nfvPPA), behavioral variant of frontotemporal dementia (bvFTD), primary akinesia with gait freezing (PAGF), primary lateral lateral a
- the 4R-tau-associated disorder is a 4R-tauopathy, for example, selected from the group consisting of progressive supranuclear palsy (PSP), corticobasal syndrome (CBD), argyrophilic grain disease (AGD), multiple system tauopathy with presensile dementia (MSTD), globular glial tauopathy (GGT), sporadic (spAD) Alzheimer’s disease, rapidly progressive (rpAD) Alzheimer’s disease.
- the subject is human.
- the administration of the dsRNA agent of the disclosure, or the pharmaceutical composition of the disclosure causes a decrease in 4R-tau aggregation in the subject’s brain.
- the administration of the agent to the subject causes a decrease in 4R-tau accumulation.
- the dsRNA agent is administered to the subject at a dose of about 0.01 mg/kg to about 50 mg/kg.
- the dsRNA agent is administered to the subject intrathecally (IT) or intracerebroventricularly (ICV).
- the dsRNA agent is administered to the subject intracisternally.
- a non-limiting exemplary intracisternal administration comprises an injection into the cisterna magna (cerebellomedullary cistern) by suboccipital puncture.
- the methods of the disclosure further comprise determining the level of 4R- tau in a sample(s) from the subject.
- the level of 4R-tau in the subject sample(s) is a 4R-tau protein level in a blood, serum, or cerebrospinal fluid sample(s).
- the methods of the disclosure further comprise administering to the subject an additional therapeutic agent.
- the present disclosure provides a kit comprising a dsRNA agent of the disclosure, or a pharmaceutical composition of the disclosure.
- the present disclosure provides a vial comprising a dsRNA agent of the disclosure, or a pharmaceutical composition of the disclosure.
- the present disclosure provides a syringe comprising a dsRNA agent of the disclosure, or a pharmaceutical composition of the disclosure.
- the present disclosure provides an intrathecal pump comprising a dsRNA agent of the disclosure, or a pharmaceutical composition of the disclosure.
- FIG. 1 shows percent RNA knockdown as measured by 4R tau and mCherry TaqMan assays for the 65 candidate 4R tau siRNAs.
- FIG. 2 shows relative 4R tau and mCherry expression for thirteen 4R-preferential siRNAs (1 nM and 0.1 nM). Lipofectamine was used as a negative control. Two total tau siRNAs were also used as controls.
- FIG.3 shows TaqMan qPCR data of expression levels of 4R tau and mCherry (3R tau surrogate) following treatment of HEK293-2N4R-YFP + 2N3R-mCherry dual reporter cells with 1 nM of 65 different GalNAc-conjugated siRNAs that were produced by walking the entirety of exon 10 of the MAPT gene. Lipofectamine was used as a negative control. A total tau siRNA was also used as a control.
- FIG.4 shows the location of where the thirteen 4R preferential siRNAs bind in exon 10 of the MAPT gene.
- FIG.5 shows a summary of the IC50 (potency) and percent knockdown at 100 pM concentration of siRNA.
- the doses for the siRNA treatment were 8-point dose curves and ranged from 0.01 pM to 10 nM depending on the experiment. Tables were sorted on the 4R tau column.
- FIGS.6A-6B show IC50 graphs for the top four siRNAs that were chosen for in vivo testing (AD-1423291.2, AD-1423283.2, AD-1423294.2, AD-1423295.2).
- the siRNAs were tested at eight different concentrations in the HEK293 dual reporter cells, the HEK293-2N3R- mCherry only cells, and the HEK293-2N4R-YFP only cells.
- FIG.7 shows confirmation of 4R preferential knockdown with the duplexes using protein dot blotting.
- the left panel shows confirmation of specificity of commercially available total tau antibody (mouse monoclonal; clone Tau12), 4R tau antibody (mouse monoclonal, clone 7D12.1), and 3R tau antibody (mouse monoclonal, clone 8E6 ⁇ C11) by blotting with recombinant 1N3R or 1N4R proteins.
- the experimental set-up is shown at the top.
- FIG.8 shows confirmation of 4R preferential knockdown with the siRNA duplexes were using protein ELISA-type assays.
- panel A a commercially available total tau ALPHALISA (Perkin Elmer, cat no: AL271C) was used to measure total soluble tau according to the manufacturer’s instructions.
- panel B 4R tau protein was measured using the PathScan ELISA kit from Cell Signaling Technologies (cat no: 29443). The experimental set-up is shown at the top.
- FIG.9 shows in vivo validation of tau knockdown using the 4R tau siRNAs.
- the table shows the C16-conjugated duplexes for in vivo dosing, corresponding GalNAc-conjugated duplexes used for in vitro experiments, and sample size for number of mouse samples used for the RT-qPCR assays.
- the graph shows RT-qPCR data of expression levels of total tau and 4R tau on RNA extracted from the brains of mice treated with 4R tau siRNAs. Values are graphed as relative expression (1/2 ⁇ Ct ) to the na ⁇ ve group and normalized to mouse GAPDH.
- FIG.10 shows dose-response graphs for the dual reporter cell line (HEK293-2N4R-YFP + 2N3R-mCherry) for the three TaqMan assays that were performed (mCherry, YFP, 4R tau).
- FIG.11 shows dose-response graphs for the 3R only reporter cell line (HEK293-2N3R- mCherry) for the three TaqMan assays that were performed (mCherry, YFP, 4R tau).
- FIG.12 shows dose-response graphs for the 4R only reporter cell line (HEK293-2N4R- YFP) for the three TaqMan assays that were performed (mCherry, YFP, 4R tau).
- RNAi compositions targeting a “hotspot” region mapped to nucleotides 1007-1053 of NM_005910.6) of exon 10 of the MAPT gene, which effect the RNA-induced silencing complex (RISC)-mediated cleavage of 4R-tau RNA transcripts of the MAPT gene.
- the MAPT gene may be within a cell, e.g., a cell within a subject, such as a human.
- the use of these iRNAs enables the targeted degradation of 4R-tau mRNAs of the corresponding gene (MAPT gene) in mammals.
- the iRNAs of the disclosure have been designed to target a hotspot region of exon 10 of the MAPT gene, e.g., a MAPT gene either with or without nucleotide modifications.
- the iRNAs of the disclosure inhibit the expression of the 4R-tau isoform by at least about 25%, and reduce the level of sense- and antisense-containing foci. Without intending to be limited by theory, it is believed that a combination or sub-combination of the foregoing properties and the specific target sites, or the specific modifications in these iRNAs confer to the iRNAs of the disclosure improved efficacy, stability, potency, durability, and safety.
- the present disclosure also provides methods of using the RNAi compositions of the disclosure for inhibiting the expression of a 4R-tau isoform or for treating a subject having a disorder that would benefit from inhibiting or reducing the expression of a 4R-tau isoform, e.g., a 4R-tau-associated disease, such as a 4R-tauopathy, e.g., PSP, CBD, AGD, MSTD, GGT, spAD, or rpAD.
- the present disclosure provides methods of using the RNAi compositions of the disclosure for preferentially inhibiting the expression of 4R-tau isoforms with respect to inhibition of 3R-tau isoforms.
- RNAi agents of the disclosure include an RNA strand (the antisense strand) having a region which is about 30 nucleotides or less in length, e.g., 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15- 23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18- 22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20- 29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21- 24, 21-23, or 21-22 nucleotides in length, which region is substantially complementary to a hotspot within exon
- the RNAi agents of the disclosure include an RNA strand (the antisense strand) having a region which is about 21-23 nucleotides in length, which region is substantially complementary to a hotspot within exon 10 of an mRNA transcript of a MAPT gene.
- the RNAi agents of the disclosure include an RNA strand (the antisense strand) which can include longer lengths, for example up to 66 nucleotides, e.g., 36-66, 26-36, 25-36, 31- 60, 22-43, 27-53 nucleotides in length with a region of at least 19 contiguous nucleotides that is substantially complementary to a hotspot within exon 10 of an mRNA transcript of a MAPT gene.
- RNA strand the antisense strand
- the antisense strand can include longer lengths, for example up to 66 nucleotides, e.g., 36-66, 26-36, 25-36, 31- 60, 22-43, 27-53 nucleotides in length with a region of at least 19 contiguous nucleotides that is substantially complementary to a hotspot within exon 10 of an mRNA transcript of a MAPT gene.
- RNAi agents with the longer length antisense strands preferably include a second RNA strand (the sense strand) of 20-60 nucleotides in length wherein the sense and antisense strands form a duplex of 18-30 contiguous nucleotides.
- the use of these RNAi agents enables the targeted degradation and/or inhibition of 4R-tau mRNAs of a MAPT gene in mammals.
- RNAi agents are useful for treating a subject who would benefit by a reduction in the levels or activity of a 4R-tau, such as a subject having a 4R-tau-associated disease, such as a 4R-tauopathy, e.g., PSP, CBD, AGD, MSTD, GGT, spAD, or rpAD.
- methods and compositions including these RNAi agents are useful for treating a subject who would benefit by a preferential reduction in the levels or activity of 4R-tau, with respect to 3R-tau.
- compositions containing RNAi agents to inhibit the expression of a 4R-tau isoform of a MAPT gene, as well as compositions and methods for treating subjects having diseases and disorders that would benefit from inhibition or reduction of the expression of the genes.
- certain terms are first defined.
- values and ranges intermediate to the recited values are also intended to be part of this disclosure.
- the articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article.
- an element means one element or more than one element, e.g., a plurality of elements.
- the term “including” is used herein to mean, and is used interchangeably with, the phrase “including but not limited to.”
- the term “or” is used herein to mean, and is used interchangeably with, the term “and/or,” unless context clearly indicates otherwise.
- the term “about” is used herein to mean within the typical ranges of tolerances in the art. For example, “about” can be understood as about 2 standard deviations from the mean. In certain embodiments, about means ⁇ 10%. In certain embodiments, about means ⁇ 5%. When about is present before a series of numbers or a range, it is understood that “about” can modify each of the numbers in the series or range.
- the term “at least” prior to a number or series of numbers is understood to include the number adjacent to the term “at least”, and all subsequent numbers or integers that could logically be included, as clear from context.
- the number of nucleotides in a nucleic acid molecule must be an integer.
- “at least 18 nucleotides of a 21 nucleotide nucleic acid molecule” means that 18, 19, 20, or 21 nucleotides have the indicated property.
- nucleotide overhang As used herein, “no more than” or “less than” is understood as the value adjacent to the phrase and logical lower values or integers, as logical from context, to zero. For example, a duplex with an overhang of “no more than 2 nucleotides” has a 2, 1, or 0 nucleotide overhang. When “no more than” is present before a series of numbers or a range, it is understood that “no more than” can modify each of the numbers in the series or range.
- the inhibition of expression of the MAPT gene by “at least about 25%” means that the inhibition of expression of the MAPT gene can be measured to be any value +/-20% of the specified 25%, i.e., 20%, 30 % or any intermediary value between 20-30%.
- control level refers to the levels of expression of a gene, or expression level of an RNA molecule or expression level of one or more proteins or protein subunits, in a non-modulated cell, tissue or a system identical to the cell, tissue or a system where the RNAi agents, described herein, are expressed.
- the cell, tissue or a system where the RNAi agents are expressed have at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2-fold, 3-fold, 4-fold, 5-fold or more expression of the gene, RNA and/or protein described above from that observed in the absence of the RNAi agent.
- methods of detection can include determination that the amount of analyte present is below the level of detection of the method.
- the indicated sequence takes precedence.
- the chemical structure takes precedence.
- MAPT microtubule-associated protein tau
- DDPAC DDPAC
- FTDP-17 MAPTL
- MSTD MAPTL
- MTBT1 MTBT2
- PND PPP1R103
- TAU microtubule-associated protein tau
- MAPT mRNA is expressed throughout the body, predominantly in the central nervous system (i.e., the brain and the spinal cord) and the peripheral nervous system. Wild type Tau is involved in stabilizing microtubules in neuronal axons, regulating axonal transport and microtubule dynamics, maintaining dendric spines, and contributing to genomic DNA integrity.
- Tauopathies are a heterogeneous class of progressive neurodegenerative disorders pathologically characterized by the presence of Tau aggregates in the brain. Intra- and extra-cellular neuronal Tau aggregates cause microtubule disassembly and axonal degeneration, impaired synaptic vesicle release, and prion-like inter-neuronal spread of tau aggregates called “seeding.” Phenotypically, tauopathies show variable progression of motor, cognitive, and behavioral impairment.
- Tauopathies include, but are not limited to, Alzheimer’s disease, the most common form of presenile dementia that primarily starts with selective memory impairment, and is associated with degeneration of the frontal lobe, temporal lobe (including hippocampus), and parietal lobe of the brain; frontotemporal dementia (FTD), the second most common form of presenile dementia associated with neuronal atrophy of the frontal and temporal lobes, exhibiting a spectrum of behavioral, language, and movement disorders; and progressive supranuclear palsy (PSP), degeneration of brainstem and basal ganglia, exhibiting gaze dysfunction, extrapyramidal symptoms (Parkinsonism symptoms including limb apraxia, akinesia/bradykinesia, rigidity, and dystonia), and cognitive dysfunction, affecting approximately 20,000 people in the United States.
- Alzheimer’s disease the most common form of presenile dementia that primarily starts with selective memory impairment, and is associated with degeneration of the frontal lobe, temporal
- FTD further includes, but are not limited to, behavioral variant frontotemporal dementia (bvFTD), associated pathologically with progressive atrophy in the prefrontal and anterior temporal lobes, and clinically with alterations in complex thinking, personality, and behavior, affecting approximately 30,000 people in the United states; primary progressive aphasia - semantic (PPA-S), degeneration of frontal and temporal lobes associated with difficulty comprehending words and struggle with naming; nonfluent variant primary progressive aphasia (nfvPPA), involving degeneration of left post frontal lobe and insula, and exhibiting poor grammar and inability to understand complex sentences, affecting approximately 1,000 people in the United States; primary progressive aphasia - logopenic (PPA-L), degeneration of the left post/spur temporal lobe and the medial parietal lobe, associated with difficulty retrieving words and frequent pauses; frontotemporal dementia with parkinsonism linked to chromosome 17 (FTDP-17), associated pathological
- MAPT MAPT protein truncation protein
- bvFTD nfvPPA
- CBS nfvPPA
- PSP PSP
- MAPT is a major component of neurofibrillary tangles in the neuronal cytoplasm, a hallmark in Alzheimer’s disease.
- the aggregation and deposition of MAPT were also observed in approximately 50% of the brains of patients with Parkinson’s disease.
- Involvement of Tau is indicated in the pathogenesis of other diseases including, but not limited to, argyrophilic grain disease (AGD), multiple system tauopathy with presenile dementia (MSTD), white matter tauopathy with globular glial inclusions (FTLD with GGIs), FTLD with MAPT mutations, neurofibrillary tangle (NFT) dementia, FTD with motor neuron disease, amyotrophic lateral sclerosis (ALS), postencephalitic Parkinsonism, Niemann-Pick disease, Huntington disease, type 1 myotonic dystrophy, and Down syndrome (DS).
- ALD argyrophilic grain disease
- MSTD multiple system tauopathy with presenile dementia
- FTLD with GGIs white matter tauopathy with globular glial inclusions
- MAPT neurofibrillary tangle
- the MAPT gene consists of 16 exons (E1-E16).
- E2 Alternative mRNA splicing of E2, E3, and E10 gives rise to six tau isoforms (352-441 amino acids).
- E1, E4, E5, E7, E9, E11, E12, E13 are the constitutively spliced exons.
- E6 and E8 are not transcribed in human brain.
- E4a is only expressed in the peripheral nervous system.
- E0 (part of the promotor) and E14 are noncoding exons.
- Pathogenic variants in MAPT are found in approximately 10% of patients with primary tauopathy. Variants are primarily missense and localized in exons 9-13 (microtubule binding domains), with many affecting the alternative splicing of exon 10.
- Examples of coding region mutations include R5H and R5L in E1; K257T, I260V, L266V, G272V, and G273R in E9; N279K, K280del, L284L, ⁇ N296, N296N, N296H, ⁇ N298, P301L, P301S, P301T, G303V, G304S, S305I, S305N, and S305S in E10; L315R, K317M, S320F, P332S in E11; G335S, G335V, Q336R, V337M, E342V, S352L, S356T, V363I, P364S, G366R, and K369I in E12; G389R, R406W, and T427M in E13 of the MAPT gene.
- MAPT (tau) null (-/-) humans are likely non-viable.
- the MAPT heterozygote (+/-) humans have unclear or unknown phenotypes.
- the MAPT over-expressing (+/+/+) humans are associated with early onset dementia, FTD, PSP, and CBD.
- Each of the six isoforms of the MAPT (tau) protein contains three or four repeated segments (R1, R2, R3, and R4) in its microtubule-binding domain. Each repeat is 31 or 32 amino acids in length. Splicing of E9, E10, E11, and E12 gives rise to the R1, R2, R3, and R4, respectively, of the repeated segments in the MAPT’s microtubule-binding domain.
- the 3R/4R isoform ratio is skewed in disease states and the ratio predicts the tau aggregate type.
- certain intronic mutations and coding region mutations in exon 10 of MAPT can increase the splicing of exon 10 which results in an altered ratio between three- and four-repeat isoforms, and overproduction of four-repeat tau.
- the assembly of four-repeat tau into filaments is characteristic of PSP, CBD, argyrophilic grain disease (AGD), multiple system tauopathy with presenile dementia (MSTD), and white matter tauopathy with globular glial inclusions (FTD with GGIs or “globular glial tauopathy” (GGT)), which belong to the FTD spectrum (4R-tauopathy).
- ATD argyrophilic grain disease
- MSTD multiple system tauopathy with presenile dementia
- GTT white matter tauopathy with globular glial inclusions
- R-tauopathy globular glial tauopathy
- Pick’s disease three-repeat tau predominates in the neuronal inclusions (3R- tauopathy).
- NFT dementia neurodegenerative diseases with neurofibrillary tangles
- both three- and four-repeat tau isoforms may make up the neurofibrillary lesions (3/4R tauopathy).
- FTLD with MAPT mutations can be 3R, 4R, or 3/4R tauopathy.
- FTD with motor neuron disease is associated with the FTLD-TDP43 and FTLD-FUS pathology. It is associated with gene mutations of C9ORF72, FUS, TARDBP, and VCP.
- bvFTD is associated with the FTLD-Tau (3R) and FTLD-TDP43 pathology. Ten percent of the cases involve MAPT mutation. It is associated with gene mutations of C9ORF72, GRN, and VCP.
- PPA-S may be sporadic.
- nfvPPA is associated with the FTLD-Tau (4R), Alzheimer’s disease, and FTLD-TDP43 pathology, in the order of significance. Ten percent of the cases involve MAPT mutation. nfvPPA is further associated with mutations of GRN. PPA-L may be sporadic. It is associated with the Alzheimer’s disease and FTLD-Tau pathology, in the order of significance. CBS is associated with the FTLD-Tau (4R) and Alzheimer’s disease pathology, in the order of significance. Ten percent of the case is associated with MAPT mutation. The rest of the cases may be sporadic. PSP involves FTLD-Tau (4R) pathology.
- Tauopathy Ten percent of the case is associated with MAPT mutation. The rest of the cases may be sporadic. Tauopathy generally starts at age 60-80 years, and affects the remaining lifespan of 6-10 years. Tauopathies are phenotypically heterogeneous, with variable involvement of motor, cognitive, and behavioral impairment. In particular, progression of motor symptoms is variable. There are currently no approved disease-modifying therapies for tauopathies. Available treatments are only aimed at alleviating the symptoms and improving the patient’s quality of life as the disease progresses.
- Drugs in preclinical or clinical development include active and passive immunotherapies; inhibitors of O-deglycosylation, aggregation, kinases, acetylation, caspases or tau expression; phosphatase activators; microtubule stabilizers; and modulators of autophagy or proteosomal degradation.
- Biomarkers and testing used in clinical trials to assess tauopathy include tau protein phosphorylated at threonine 181 (pTau), total tau protein (tTau), neurofilament light chain (NfL), volumetric MRI (vMRI), and 18 F-diagnostic PET labels (e.g., 18 F-flortaucipir (AV-1451, TAUVIDTM)).
- Exemplary nucleotide and amino acid sequences of MAPT can be found, for example, at GenBank Accession No. NM_016841.4 (Homo sapiens MAPT variant 4, SEQ ID NO: 1, reverse complement, SEQ ID NO: 2); GenBank Accession No. NM_005910 (Homo sapiens MAPT variant 2, SEQ ID NO: 3, reverse complement, SEQ ID NO: 4); GenBank Accession No.
- NM_001038609.2 (Mus musculus MAPT, SEQ ID NO: 5; reverse complement, SEQ ID NO: 6); GenBank Accession No.: XM_005584540.1 (Macaca fascicularis MAPT variant X13, SEQ ID NO: 7, reverse complement, SEQ ID NO: 8); GenBank Accession No.: XM_008768277.2 (Rattus norvegicus MAPT, variant X7, SEQ ID NO: 9, reverse complement, SEQ ID NO: 10) and GenBank Accession No.: XM_005624183.3 (Canis lupus MAPT variant X23, SEQ ID NO: 11, reverse complement, SEQ ID NO: 12).
- the nucleotide sequence of the genomic region of human chromosome harboring the MAPT gene may be found in, for example, the Genome Reference Consortium Human Build 38 (also referred to as Human Genome build 38 or GRCh38) available at GenBank.
- the nucleotide sequence of the genomic region of human chromosome 17 harboring the MAPT gene may also be found at, for example, GenBank Accession No. NC_000017.11, corresponding to nucleotides 45894382-46028334 of human chromosome 17.
- the nucleotide sequence of the human MAPT gene may be found in, for example, GenBank Accession No.
- MAPT sequences can be found in publically available databases, for example, GenBank, OMIM, and UniProt. Additional information on MAPT can be found, for example, at the NCBI web site that refers to gene 100128977.
- the term MAPT as used herein also refers to variations of the MAPT gene including variants provided in the clinical variant database, for example, at the NCBI clinical variants web site that refers to the term mapt.
- the entire contents of each of the foregoing GenBank Accession numbers and the Gene database numbers are incorporated herein by reference as of the date of filing this application.
- target sequence refers to a contiguous portion of the nucleotide sequence of exon 10 (SEQ ID NO: 13) in a 4R-tau mRNA molecule formed during the transcription of a MAPT gene, including mRNA that is a product of RNA processing of a primary transcription product (e.g., MAPT mRNA resulting from alternate splicing).
- the target portion of the sequence will be at least long enough to serve as a substrate for RNAi-directed cleavage at or near that portion of the nucleotide sequence of an mRNA molecule formed during the transcription of a MAPT gene.
- the target sequence is about 15-30 nucleotides in length.
- the target sequence can be from about 15-30 nucleotides, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15- 19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19- 29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20- 25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length.
- the target sequence is 19-23 nucleotides in length, optionally 21-23 nucleotides in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the disclosure.
- strand comprising a sequence refers to an oligonucleotide comprising a chain of nucleotides that is described by the sequence referred to using the standard nucleotide nomenclature.
- G,” “C,” “A,” “T”, and “U” each generally stand for a nucleotide that contains guanine, cytosine, adenine, thymidine, and uracil as a base, respectively in the context of a modified or unmodified nucleotide.
- ribonucleotide or “nucleotide” can also refer to a modified nucleotide, as further detailed below, or a surrogate replacement moiety (see, e.g., Table 2).
- nucleotide comprising inosine as its base can base pair with nucleotides containing adenine, cytosine, or uracil.
- nucleotides containing uracil, guanine, or adenine can be replaced in the nucleotide sequences of dsRNA featured in the disclosure by a nucleotide containing, for example, inosine.
- RNAi agent RNA agent
- RISC RNA-induced silencing complex
- RNA interference is a process that directs the sequence-specific degradation of mRNA.
- RNAi modulates, e.g., inhibits, the expression of 4R-tau in a cell, e.g., a cell within a subject, such as a mammalian subject.
- an RNAi agent of the disclosure includes a single stranded RNAi that interacts with a target RNA sequence, e.g., a 4R-tau target mRNA sequence, to direct the cleavage of the target RNA.
- RNAs double-stranded short interfering RNAs
- Dicer a Type III endonuclease known as Dicer (Sharp et al. (2001) Genes Dev. 15:485).
- Dicer a ribonuclease-III-like enzyme, processes this dsRNA into 19-23 base pair short interfering RNAs with characteristic two base 3' overhangs (Bernstein, et al., (2001) Nature 409:363).
- siRNAs are then incorporated into an RNA-induced silencing complex (RISC) where one or more helicases unwind the siRNA duplex, enabling the complementary antisense strand to guide target recognition (Nykanen, et al., (2001) Cell 107:309).
- RISC RNA-induced silencing complex
- one or more endonucleases within the RISC cleave the target to induce silencing (Elbashir, et al., (2001) Genes Dev. 15:188).
- the disclosure relates to a single stranded RNA (ssRNA) (the antisense strand of a siRNA duplex) generated within a cell and which promotes the formation of a RISC complex to effect silencing of the target gene, i.e., a MAPT gene.
- ssRNA single stranded RNA
- the RNAi agent may be a single-stranded RNA that is introduced into a cell or organism to inhibit a target mRNA.
- Single-stranded RNAi agents bind to the RISC endonuclease, Argonaute 2, which then cleaves the target mRNA.
- the single-stranded siRNAs are generally 15-30 nucleotides and are chemically modified.
- the design and testing of single-stranded RNAs are described in U.S. Patent No. 8,101,348 and in Lima et al., (2012) Cell 150:883-894, the entire contents of each of which are hereby incorporated herein by reference.
- Any of the antisense nucleotide sequences described herein may be used as a single-stranded siRNA as described herein or as chemically modified by the methods described in Lima et al., (2012) Cell 150:883-894.
- RNAi agent for use in the compositions and methods of the disclosure is a double stranded RNA and is referred to herein as a “double stranded RNAi agent,” “double stranded RNA (dsRNA) molecule,” “dsRNA agent,” or “dsRNA”.
- dsRNA refers to a complex of ribonucleic acid molecules, having a duplex structure comprising two anti-parallel and substantially complementary nucleic acid strands, referred to as having “sense” and “antisense” orientations with respect to a target RNA, i.e., a MAPT gene.
- a double stranded RNA triggers the degradation of a target RNA, e.g., an mRNA, through a post-transcriptional gene-silencing mechanism referred to herein as RNA interference or RNAi.
- a dsRNA molecule can include ribonucleotides, but as described in detail herein, each or both strands can also include one or more non-ribonucleotides, e.g., a deoxyribonucleotide, a modified nucleotide.
- an “RNAi agent” may include ribonucleotides with chemical modifications; an RNAi agent may include substantial modifications at multiple nucleotides.
- modified nucleotide refers to a nucleotide having, independently, a modified sugar moiety, a modified internucleotide linkage, or a modified nucleobase.
- modified nucleotide encompasses substitutions, additions or removal of, e.g., a functional group or atom, to internucleoside linkages, sugar moieties, or nucleobases.
- the modifications suitable for use in the agents of the disclosure include all types of modifications disclosed herein or known in the art.
- RNAi agent any such modifications, as used in a siRNA type molecule, are encompassed by “RNAi agent” for the purposes of this specification and claims.
- RNAi agent inclusion of a deoxy-nucleotide if present within an RNAi agent can be considered to constitute a modified nucleotide.
- the duplex region may be of any length that permits specific degradation of a desired target RNA through a RISC pathway, and may range from about 15-36 base pairs in length, for example, about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 base pairs in length, such as about 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15- 17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19- 27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20- 23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26,
- the duplex region is 19-21 base pairs in length, e.g., 21 base pairs in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the disclosure.
- the two strands forming the duplex structure may be different portions of one larger RNA molecule, or they may be separate RNA molecules. Where the two strands are part of one larger molecule, and therefore are connected by an uninterrupted chain of nucleotides between the 3’-end of one strand and the 5’-end of the respective other strand forming the duplex structure, the connecting RNA chain is referred to as a “hairpin loop.”
- a hairpin loop can comprise at least one unpaired nucleotide.
- the hairpin loop can comprise at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 23 or more unpaired nucleotides or nucleotides not directed to the target site of the dsRNA.
- the hairpin loop can be 10 or fewer nucleotides.
- the hairpin loop can be 8 or fewer unpaired nucleotides.
- the hairpin loop can be 4-10 unpaired nucleotides.
- the hairpin loop can be 4-8 nucleotides.
- the connecting structure is referred to as a “linker” (though it is noted that certain other structures defined elsewhere herein can also be referred to as a “linker”).
- the RNA strands may have the same or a different number of nucleotides. The maximum number of base pairs is the number of nucleotides in the shortest strand of the dsRNA minus any overhangs that are present in the duplex.
- an RNAi may comprise one or more nucleotide overhangs.
- At least one strand comprises a 3’ overhang of at least 1 nucleotide. In another embodiment, at least one strand comprises a 3’ overhang of at least 2 nucleotides, e.g., 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, or 15 nucleotides. In other embodiments, at least one strand of the RNAi agent comprises a 5’ overhang of at least 1 nucleotide. In certain embodiments, at least one strand comprises a 5’ overhang of at least 2 nucleotides, e.g., 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, or 15 nucleotides.
- both the 3’ and the 5’ end of one strand of the RNAi agent comprise an overhang of at least 1 nucleotide.
- an RNAi agent of the disclosure is a dsRNA, each strand of which independently comprises 19-23 nucleotides, that interacts with a target RNA sequence, e.g., a MAPT target mRNA sequence, to direct the cleavage of the target RNA.
- an iRNA of the disclosure is a dsRNA of 24-30 nucleotides that interacts with a target RNA sequence, e.g., a MAPT target mRNA sequence, to direct the cleavage of the target RNA.
- nucleotide overhang refers to at least one unpaired nucleotide that protrudes from the duplex structure of an RNAi agent, e.g., a dsRNA.
- a dsRNA can comprise an overhang of at least one nucleotide; alternatively, the overhang can comprise at least two nucleotides, at least three nucleotides, at least four nucleotides, at least five nucleotides or more.
- a nucleotide overhang can comprise or consist of a nucleotide/nucleoside analog, including a deoxynucleotide/nucleoside.
- the overhang(s) can be on the sense strand, the antisense strand or any combination thereof.
- the nucleotide(s) of an overhang can be present on the 5'-end, 3'-end or both ends of either an antisense or sense strand of a dsRNA.
- the antisense strand of a dsRNA has a 1-10 nucleotide, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide overhang at the 3’-end or the 5’-end.
- the sense strand of a dsRNA has a 1-10 nucleotide, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide overhang at the 3’-end or the 5’-end.
- one or more of the nucleotides in the overhang is replaced with a nucleoside thiophosphate.
- the antisense strand of a dsRNA has a 1-10 nucleotide, e.g., 0-3, 1-3, 2-4, 2-5, 4-10, 5-10, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide overhang at the 3’-end or the 5’-end.
- the sense strand of a dsRNA has a 1-10 nucleotide, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide overhang at the 3’-end or the 5’-end.
- one or more of the nucleotides in the overhang is replaced with a nucleoside thiophosphate.
- the overhang on the sense strand or the antisense strand can include extended lengths longer than 10 nucleotides, e.g., 1-30 nucleotides, 2-30 nucleotides, 10-30 nucleotides, or 10-15 nucleotides in length.
- an extended overhang is on the sense strand of the duplex. In certain embodiments, an extended overhang is present on the 3’end of the sense strand of the duplex. In certain embodiments, an extended overhang is present on the 5’end of the sense strand of the duplex. In certain embodiments, an extended overhang is on the antisense strand of the duplex. In certain embodiments, an extended overhang is present on the 3’end of the antisense strand of the duplex. In certain embodiments, an extended overhang is present on the 5’end of the antisense strand of the duplex. In certain embodiments, one or more of the nucleotides in the overhang is replaced with a nucleoside thiophosphate.
- the overhang includes a self-complementary portion such that the overhang is capable of forming a hairpin structure that is stable under physiological conditions.
- the terms “blunt” or “blunt ended” as used herein in reference to a dsRNA mean that there are no unpaired nucleotides or nucleotide analogs at a given terminal end of a dsRNA, i.e., no nucleotide overhang.
- One or both ends of a dsRNA can be blunt. Where both ends of a dsRNA are blunt, the dsRNA is said to be blunt ended.
- a “blunt ended” dsRNA is a dsRNA that is blunt at both ends, i.e., no nucleotide overhang at either end of the molecule. Most often such a molecule will be double stranded over its entire length.
- the term “antisense strand” or “guide strand” refers to the strand of an RNAi agent, e.g., a dsRNA, which includes a region that is substantially complementary to a target sequence, e.g., a MAPT mRNA.
- region of complementarity refers to the region on the antisense strand that is substantially complementary to a sequence, for example a target sequence, e.g., a MAPT nucleotide sequence, as defined herein.
- a target sequence e.g., a MAPT nucleotide sequence
- the mismatches can be in the internal or terminal regions of the molecule.
- the most tolerated mismatches are in the terminal regions, e.g., within 5, 4, 3, or 2 nucleotides of the 5’- or 3’-terminus of the RNAi agent.
- a double stranded RNA agent of the disclosure includes a nucleotide mismatch in the antisense strand.
- the antisense strand of the double stranded RNA agent of the disclosure includes no more than 4 mismatches with the target mRNA, e.g., the antisense strand includes 4, 3, 2, 1, or 0 mismatches with the target mRNA.
- the antisense strand double stranded RNA agent of the disclosure includes no more than 4 mismatches with the sense strand, e.g., the antisense strand includes 4, 3, 2, 1, or 0 mismatches with the sense strand.
- a double stranded RNA agent of the disclosure includes a nucleotide mismatch in the sense strand.
- the sense strand of the double stranded RNA agent of the disclosure includes no more than 4 mismatches with the antisense strand, e.g., the sense strand includes 4, 3, 2, 1, or 0 mismatches with the antisense strand.
- the nucleotide mismatch is, for example, within 5, 4, 3 nucleotides from the 3’-end of the iRNA.
- the nucleotide mismatch is, for example, in the 3’-terminal nucleotide of the iRNA agent.
- the mismatch(s) is not in the seed region.
- an RNAi agent as described herein can contain one or more mismatches to the target sequence.
- an RNAi agent as described herein contains no more than 3 mismatches (i.e., 3, 2, 1, or 0 mismatches). In one embodiment, an RNAi agent as described herein contains no more than 2 mismatches. In one embodiment, an RNAi agent as described herein contains no more than 1 mismatch. In one embodiment, an RNAi agent as described herein contains 0 mismatches. In certain embodiments, if the antisense strand of the RNAi agent contains mismatches to the target sequence, the mismatch can optionally be restricted to be within the last 5 nucleotides from either the 5’- or 3’-end of the region of complementarity.
- the strand which is complementary to a region of a MAPT gene generally does not contain any mismatch within the central 13 nucleotides.
- the methods described herein or methods known in the art can be used to determine whether an RNAi agent containing a mismatch to a target sequence is effective in inhibiting the expression of a 4R-tau isoform.
- Jackson et al. (Nat. Biotechnol. 2003;21: 635–637) described an expression profile study where the expression of a small set of genes with sequence identity to the MAPK14 siRNA only at 12–18 nt of the sense strand, was down-regulated with similar kinetics to MAPK14.
- RNAi agent refers to the strand of an RNAi agent that includes a region that is substantially complementary to a region of the antisense strand as that term is defined herein.
- cleavage region refers to a region that is located immediately adjacent to the cleavage site.
- the cleavage site is the site on the target at which cleavage occurs.
- the cleavage region comprises three bases on either end of, and immediately adjacent to, the cleavage site.
- the cleavage region comprises two bases on either end of, and immediately adjacent to, the cleavage site.
- the cleavage site specifically occurs at the site bound by nucleotides 10 and 11 of the antisense strand, and the cleavage region comprises nucleotides 11, 12 and 13.
- the term “complementary,” when used to describe a first nucleotide sequence in relation to a second nucleotide sequence refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide comprising the second nucleotide sequence, as will be understood by the skilled person.
- Such conditions can be, for example, “stringent conditions”, including but not limited to, 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50°C or 70°C for 12-16 hours followed by washing (see, e.g., “Molecular Cloning: A Laboratory Manual, Sambrook, et al. (1989) Cold Spring Harbor Laboratory Press).
- stringent conditions or “stringent hybridization conditions” refers to conditions under which an antisense compound will hybridize to its target sequence, but to a minimal number of other sequences.
- Stringent conditions are sequence-dependent and will be different in different circumstances, and “stringent conditions” under which antisense compounds hybridize to a target sequence are determined by the nature and composition of the antisense compounds and the assays in which they are being investigated. Other conditions, such as physiologically relevant conditions as can be encountered inside an organism, can apply. The skilled person will be able to determine the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the hybridized nucleotides.
- RNAi agent e.g., within a dsRNA as described herein
- oligonucleotide or polynucleotide comprising a first nucleotide sequence to an oligonucleotide or polynucleotide comprising a second nucleotide sequence over the entire length of one or both nucleotide sequences.
- sequences can be referred to as “fully complementary” with respect to each other herein.
- first sequence is referred to as “substantially complementary” with respect to a second sequence herein
- the two sequences can be fully complementary, or they can form one or more, but generally not more than 5, 4, 3 or 2 mismatched base pairs upon hybridization for a duplex up to 30 base pairs.
- the “substantially complementary” sequences disclosed herein comprise a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to the equivalent region of the target exon 10-MAPT sequence, such as about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary.
- a dsRNA comprising one oligonucleotide 21 nucleotides in length and another oligonucleotide 23 nucleotides in length, wherein the longer oligonucleotide comprises a sequence of 21 nucleotides that is fully complementary to the shorter oligonucleotide, can yet be referred to as “fully complementary” for the purposes described herein.
- “Complementary” sequences can also include, or be formed entirely from, non- Watson-Crick base pairs or base pairs formed from non-natural and modified nucleotides, in so far as the above requirements with respect to their ability to hybridize are fulfilled.
- Such non-Watson-Crick base pairs include, but are not limited to, G:U Wobble or Hoogstein base pairing.
- the terms “complementary,” “fully complementary” and “substantially complementary” herein can be used with respect to the base matching between the sense strand and the antisense strand of a dsRNA, or between the antisense strand of an RNAi agent and a target sequence, as will be understood from the context of their use.
- a polynucleotide that is “substantially complementary to at least part of” a messenger RNA (mRNA) refers to a polynucleotide that is substantially complementary to a contiguous portion of the mRNA of interest (e.g., an mRNA encoding Tau).
- mRNA messenger RNA
- a polynucleotide is complementary to at least a part of a MAPT mRNA if the sequence is substantially complementary to a non-interrupted portion of an mRNA encoding Tau.
- the antisense polynucleotides disclosed herein are fully complementary to the target MAPT sequence.
- the antisense polynucleotides disclosed herein are substantially complementary to the target MAPT sequence and comprise a contiguous nucleotide sequence which is at least 80% complementary over its entire length to the equivalent region of the nucleotide sequence of the exon 10 hotspot (mapped to nucleotides 1007-1053 of SEQ ID NO: 3), or a fragment thereof, such as about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary.
- the antisense polynucleotides disclosed herein are substantially complementary to a fragment of a target MAPT sequence and comprise a contiguous nucleotide sequence which is at least 80% complementary over its entire length to a fragment of SEQ ID NO: 3 selected from the group of nucleotides 1009-1029, 1010-1030, 1011-1031, 1012-1032, 1013-1033, 1014-1034, 1015- 1035, 1016-1036, 1017-1037, 1018-1038, 1019-1039, 1020-1040, 1021-1041, 1022-1042, 1023-1043, 1024-1044, 1025-1045, 1026-1046, 1027-1047, 1028-1048, 1029-1049, 1030-1050, 1031-1051, 1032- 1052, 1033-1053, 1014-1048, and 1022-1048 of SEQ ID NO: 3, such as about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%,
- the antisense polynucleotides disclosed herein are substantially complementary to a fragment of a target MAPT sequence and comprise a contiguous nucleotide sequence which is at least 80% complementary over its entire length to a fragment of SEQ ID NO: 3 selected from the group of nucleotides 1009-1029, 1016-1036, 1018-1038, 1020-1040, 1021-1041, 1022-1042, 1024- 1044, 1027-1047, 1028-1048, 1029-1049, 1030-1050, 1032-1052, 1033-1053, 1014-1048, and 1022-1048 of SEQ ID NO: 3, such as about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary.
- the antisense polynucleotides disclosed herein are substantially complementary to the target MAPT sequence and comprise a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to any one of the sense strand nucleotide sequences in Table 7 or 8, or a fragment of any one of the sense strand nucleotide sequences in Table 7 or 8, such as about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% complementary.
- an RNAi agent of the disclosure includes a sense strand that is substantially complementary to an antisense polynucleotide which, in turn, is complementary to a target MAPT sequence, and wherein the sense strand polynucleotide comprises a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to the equivalent region of the nucleotide sequence of nucleotides 1007-1053 of SEQ ID NO: 4, or a fragment thereof, such as about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% complementary.
- an iRNA of the disclosure includes a sense strand that is substantially complementary to an antisense polynucleotide which, in turn, is complementary to a target MAPT sequence, and wherein the sense strand polynucleotide comprises a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to any one of the antisense strand nucleotide sequences in Table 7 or 8, or a fragment of any one of the antisense strand nucleotide sequences in Table 7 or 8, such as about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% complementary.
- the sense and antisense strands are selected from any one of duplexes AD-1423276, AD-1423277, AD-1423278, AD-1423279, AD-1423280, AD-1423281, AD-1423282, AD- 1423283, AD-1423284, AD-1423285, AD-1423286, AD-1423287, AD-1423288, AD-1423289, AD- 1423290, AD-1423291, AD-1423292, AD-1423293, AD-1423294, AD-1423295, AD-1423296, AD- 1423297, AD-1423298, AD-1423299, and AD-1423300.
- the sense and antisense strands are selected from any one of duplexes AD-1423276, AD-1423283, AD-1423285, AD- 1423287, AD-1423288, AD-1423289, AD-1423291, AD-1423294, AD-1423295, AD-1423296, AD- 1423297, AD-1423299, and AD-1423300.
- the sense and antisense strands are selected from any one of duplexes AD-1423283, AD-1423291, AD-1423294, and AD- 1423295.
- At least partial suppression of the expression of a 4R-tau isoform is assessed by a reduction of the amount of 4R-tau mRNA, e.g., sense mRNA, antisense mRNA, total 4R-tau mRNA, which can be isolated from or detected in a first cell or group of cells in which a MAPT gene is transcribed and which has or have been treated such that the expression of a 4R-tau isoform is inhibited, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has or have not been so treated (control cells).
- 4R-tau mRNA e.g., sense mRNA, antisense mRNA, total 4R-tau mRNA
- the degree of inhibition may be expressed in terms of: ( mRNA in control cells) - (mRNA in treated cells) X 100 ( mRNA in control cells)
- contacting a cell with an RNAi agent includes contacting a cell by any possible means. Contacting a cell with an RNAi agent includes contacting a cell in vitro with the RNAi agent or contacting a cell in vivo with the RNAi agent. The contacting may be done directly or indirectly. Thus, for example, the RNAi agent may be put into physical contact with the cell by the individual performing the method, or alternatively, the RNAi agent may be put into a situation that will permit or cause it to subsequently come into contact with the cell.
- Contacting a cell in vitro may be done, for example, by incubating the cell with the RNAi agent.
- Contacting a cell in vivo may be done, for example, by injecting the RNAi agent into or near the tissue where the cell is located, or by injecting the RNAi agent into another area, e.g., the central nervous system (CNS), optionally via intrathecal, intravitreal, intracisternal or other injection, or to the bloodstream or the subcutaneous space, such that the agent will subsequently reach the tissue where the cell to be contacted is located.
- CNS central nervous system
- the RNAi agent may contain or be coupled to a ligand, e.g., a lipophilic moiety or moieties as described below and further detailed, e.g., in PCT/US2019/031170, which is incorporated herein by reference, that directs or otherwise stabilizes the RNAi agent at a site of interest, e.g., the CNS.
- a ligand e.g., a lipophilic moiety or moieties as described below and further detailed, e.g., in PCT/US2019/031170, which is incorporated herein by reference, that directs or otherwise stabilizes the RNAi agent at a site of interest, e.g., the CNS.
- a ligand e.g., a lipophilic moiety or moieties as described below and further detailed, e.g., in PCT/US2019/031170, which is incorporated herein by reference, that directs or otherwise stabilizes the RNAi agent at a
- contacting a cell with an RNAi agent includes “introducing” or “delivering the RNAi agent into the cell” by facilitating or effecting uptake or absorption into the cell.
- Absorption or uptake of an RNAi agent can occur through unaided diffusive or active cellular processes, or by auxiliary agents or devices.
- Introducing an RNAi agent into a cell may be in vitro or in vivo.
- an RNAi agent can be injected into a tissue site or administered systemically.
- In vitro introduction into a cell includes methods known in the art such as electroporation and lipofection. Further approaches are described herein below or are known in the art.
- lipophile or “lipophilic moiety” broadly refers to any compound or chemical moiety having an affinity for lipids.
- One way to characterize the lipophilicity of the lipophilic moiety is by the octanol-water partition coefficient, logK ow , where K ow is the ratio of a chemical’s concentration in the octanol-phase to its concentration in the aqueous phase of a two-phase system at equilibrium.
- the octanol-water partition coefficient is a laboratory-measured property of a substance. However, it may also be predicted by using coefficients attributed to the structural components of a chemical which are calculated using first-principle or empirical methods (see, for example, Tetko et al., J.
- a chemical substance is lipophilic in character when its logK ow exceeds 0.
- the lipophilic moiety possesses a logK ow exceeding 1, exceeding 1.5, exceeding 2, exceeding 3, exceeding 4, exceeding 5, or exceeding 10.
- the logK ow of 6-amino hexanol for instance, is predicted to be approximately 0.7.
- the logK ow of cholesteryl N-(hexan-6-ol) carbamate is predicted to be 10.7.
- the lipophilicity of a molecule can change with respect to the functional group it carries. For instance, adding a hydroxyl group or amine group to the end of a lipophilic moiety can increase or decrease the partition coefficient (e.g., logK ow ) value of the lipophilic moiety.
- the hydrophobicity of the double-stranded RNAi agent, conjugated to one or more lipophilic moieties can be measured by its protein binding characteristics.
- the unbound fraction in the plasma protein binding assay of the double-stranded RNAi agent could be determined to positively correlate to the relative hydrophobicity of the double-stranded RNAi agent, which could then positively correlate to the silencing activity of the double-stranded RNAi agent.
- the plasma protein binding assay determined is an electrophoretic mobility shift assay (EMSA) using human serum albumin protein.
- ESA electrophoretic mobility shift assay
- An exemplary protocol of this binding assay is illustrated in detail in, e.g., PCT/US2019/031170. Briefly, duplexes were incubated with human serum albumin and the unbound fraction was determined.
- Exemplary assay protocol includes duplexes at a stock concentration of 10 ⁇ M, diluted to a final concentration of 0.5 ⁇ M (20 ⁇ L total volume) containing 0, 20, or 90% serum in 1x PBS.
- the samples can be mixed, centrifuged for 30 seconds, and subsequently incubated at room temperature for 10 minutes. Once incubation step is completed, 4 ⁇ L of 6x EMSA Gel- loading solution can be added to each sample, centrifuged for 30 seconds, and 12 ⁇ L of each sample can be loaded onto a 26 well BioRad 10% PAGE (polyacrylamide gel electrophoresis). The gel can be run for 1 hour at 100 volts.
- the gel is removed from the casing and washed in 50 mL of 10% TBE (Tris base, boric acid and EDTA). Once washing is complete, 5 ⁇ L of SYBR Gold can be added to the gel, which is then allowed to incubate at room temperature for 10 minutes, and the gel- washed again in 50 mL of 10% TBE.
- a Gel Doc XR+ gel documentation system may be used to read the gel using the following parameters: the imaging application set to SYBR Gold, the size set to Bio-Rad criterion gel, the exposure set to automatic for intense bands, the highlight saturated pixels may be turned one and the color is set to gray. The detection, molecular weight analysis, and output can all disabled.
- Image Lab 5.2 may be used to process the image.
- the lanes and bands can be manually set to measure band intensity. Band intensities of each sample can be normalized to PBS to obtain the fraction of unbound siRNA. From this measurement relative hydrophobicity can determined.
- lipid nanoparticle is a vesicle comprising a lipid layer encapsulating a pharmaceutically active molecule, such as a nucleic acid molecule, e.g., a RNAi agent or a plasmid from which an RNAi agent is transcribed.
- LNPs are described in, for example, U.S. Patent Nos. 6,858,225, 6,815,432, 8,158,601, and 8,058,069, the entire contents of which are hereby incorporated herein by reference.
- a “subject” is an animal, such as a mammal, including a primate (such as a human, a non-human primate, e.g., a monkey, and a chimpanzee), or a non-primate (such as a rat, or a mouse).
- a primate such as a human, a non-human primate, e.g., a monkey, and a chimpanzee
- a non-primate such as a rat, or a mouse
- the subject is a human, such as a human being treated or assessed for a disease, disorder, or condition that would benefit from reduction in 4R-tau expression; a human at risk for a disease, disorder, or condition that would benefit from reduction in 4R-tau expression; a human having a disease, disorder, or condition that would benefit from reduction in 4R-tau expression; or human being treated for a disease, disorder, or condition that would benefit from reduction in 4R-tau expression as described herein.
- the subject is a female human.
- the subject is a male human.
- the subject is an adult subject.
- the subject is a pediatric subject.
- the subject is a juvenile subject, i.e., a subject below 20 years of age.
- treating or “treatment” refer to a beneficial or desired result including, but not limited to, alleviation or amelioration of one or more signs or symptoms associated with 4R-tau expression or 4R-tau production in 4R-tau-associated diseases, such as 4R-tauopathies, e.g., PSP, CBD, AGD, MSTD, GGT, spAD, or rpAD.
- Treatment can also mean prolonging survival as compared to expected survival in the absence of treatment.
- the term “lower” in the context of the level of 4R-tau in a subject or a disease marker or symptom refers to a statistically significant decrease in such level.
- the decrease can be, for example, at least 10%, 15%, 20%, 25%, 30%, %, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more. In certain embodiments, a decrease is at least 20%.
- the decrease is at least 50% in a disease marker, e.g., the level of sense- or antisense-containing foci and/or the level of aberrant dipeptide repeat protein, e.g., a decrease of 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more.
- a disease marker e.g., the level of sense- or antisense-containing foci and/or the level of aberrant dipeptide repeat protein, e.g., a decrease of 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more.
- a decrease is at least about 25% in a disease marker, e.g., 4R-tau protein and/or gene expression level is decreased by, e.g., at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 95% “Lower” in the context of the level of 4R-tau in a subject is preferably down to a level accepted as within the range of normal for an individual without such disorder.
- a disease marker e.g., 4R-tau protein and/or gene expression level is decreased by, e.g., at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 95% “Lower” in the context of the level of 4R-tau in a subject is preferably down to a level accepted as within the range of normal for an individual without such
- “lower” is the decrease in the difference between the level of a marker or symptom for a subject suffering from a disease and a level accepted within the range of normal for an individual, e.g., the level of decrease in bodyweight between an obese individual and an individual having a weight accepted within the range of normal.
- “prevention” or “preventing,” when used in reference to a disease, disorder, or condition thereof, that would benefit from a reduction in expression of a 4R-tau isoform or production of a 4R-tau refers to a reduction in the likelihood that a subject will develop a symptom associated with such a disease, disorder, or condition, e.g., a symptom of a 4R-tau-associated disease.
- 4R-tau-associated disease or “4R-tau-associated disorder” includes any disease or disorder that would benefit from reduction in the expression and/or activity of a 4R-tau isoform.
- Exemplary 4R-tau diseases include 4R-tauopathies.
- a “4R-tauopathy” is a tauopathy characterized by the aggregation of tau protein in which the 4R-tau isoform is the primary or predominant Tau isoform.
- 4R-tauopathies include, but are not limited to, progressive supranuclear palsy (PSP), corticobasal syndrome (CBD), argyrophilic grain disease (AGD), multiple system tauopathy with presensile dementia (MSTD), globular glial tauopathy (GGT), sporadic (spAD) Alzheimer’s disease, and rapidly progressive (rpAD) Alzheimer’s disease.
- “Therapeutically effective amount,” as used herein, is intended to include the amount of an RNAi agent that, when administered to a subject having a 4R-tau-associated disease, is sufficient to effect treatment of the disease (e.g., by diminishing, ameliorating, or maintaining the existing disease or one or more symptoms of disease).
- the “therapeutically effective amount” may vary depending on the RNAi agent, how the agent is administered, the disease and its severity and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the subject to be treated.
- “Prophylactically effective amount,” as used herein, is intended to include the amount of an RNAi agent that, when administered to a subject having a 4R-tau-associated disorder, is sufficient to prevent or ameliorate the disease or one or more symptoms of the disease. Ameliorating the disease includes slowing the course of the disease or reducing the severity of later-developing disease.
- the “prophylactically effective amount” may vary depending on the RNAi agent, how the agent is administered, the degree of risk of disease, and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the patient to be treated.
- a “therapeutically-effective amount” or “prophylactically effective amount” also includes an amount of an RNAi agent that produces some desired local or systemic effect at a reasonable benefit/risk ratio applicable to any treatment.
- An RNAi agent employed in the methods of the present disclosure may be administered in a sufficient amount to produce a reasonable benefit/risk ratio applicable to such treatment.
- pharmaceutically acceptable is employed herein to refer to those compounds, materials, compositions, or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human subjects and animal subjects without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
- pharmaceutically-acceptable carrier means a pharmaceutically- acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid), or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body.
- manufacturing aid e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid
- solvent encapsulating material involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body.
- Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject being treated.
- materials which can serve as pharmaceutically-acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricating agents, such as magnesium state, sodium lauryl sulfate and talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (1
- sample includes a collection of similar fluids, cells, or tissues isolated from a subject, as well as fluids, cells, or tissues present within a subject.
- biological fluids include blood, serum and serosal fluids, plasma, cerebrospinal fluid, ocular fluids, lymph, urine, saliva, and the like.
- Tissue samples may include samples from tissues, organs or localized regions. For example, samples may be derived from particular organs, parts of organs, or fluids or cells within those organs.
- samples may be derived from the brain (e.g., whole brain or certain segments of brain, e.g., striatum, or certain types of cells in the brain, such as, e.g., neurons and glial cells (astrocytes, oligodendrocytes, microglial cells)).
- a “sample derived from a subject” refers to blood drawn from the subject or plasma or serum derived therefrom.
- a “sample derived from a subject” refers to brain tissue (or subcomponents thereof) or retinal tissue (or subcomponents thereof) derived from the subject.
- substituted refers to the replacement of one or more hydrogen radicals in a given structure with the radical of a specified substituent including, but not limited to: alkyl, alkenyl, alkynyl, aryl, heterocyclyl, halo, thiol, alkylthio, arylthio, alkylthioalkyl, arylthioalkyl, alkylsulfonyl, alkylsulfonylalkyl, arylsulfonylalkyl, alkoxy, aryloxy, aralkoxy, aminocarbonyl, alkylaminocarbonyl, arylaminocarbonyl, alkoxycarbonyl, aryloxycarbonyl, haloalkyl, amino, trifluoromethyl, cyano, nitro, alkylamino, arylamino, alkylaminoalkyl, arylaminoalkyl, aminoalkylamino, hydroxy
- alkyl refers to saturated and unsaturated non-aromatic hydrocarbon chains that may be a straight chain or branched chain, containing the indicated number of carbon atoms (these include without limitation propyl, allyl, or propargyl), which may be optionally inserted with N, O, or S.
- (C1-C6) alkyl means a radical having from 1 6 carbon atoms in a linear or branched arrangement.
- “(C1-C6) alkyl” includes, for example, methyl, ethyl, propyl, iso-propyl, n-butyl, tert-butyl, pentyl and hexyl.
- a lipophilic moiety of the instant disclosure can include a C6- C18 alkyl hydrocarbon chain.
- alkylene refers to an optionally substituted saturated aliphatic branched or straight chain divalent hydrocarbon radical having the specified number of carbon atoms.
- (C1-C6) alkylene means a divalent saturated aliphatic radical having from 1-6 carbon atoms in a linear arrangement, e.g., [(CH 2 ) n ] , where n is an integer from 1 to 6.
- “(C1-C6) alkylene” includes methylene, ethylene, propylene, butylene, pentylene and hexylene.
- (C1-C6) alkylene means a divalent saturated radical having from 1-6 carbon atoms in a branched arrangement, for example: [(CH 2 CH 2 CH 2 CH 2 CH(CH 3 )], [(CH 2 CH 2 CH 2 CH 2 C(CH 3 ) 2 ], [(CH 2 C(CH 3 ) 2 CH(CH 3 ))], and the like.
- alkylenedioxo refers to a divalent species of the structure —O—R—O—, in which R represents an alkylene.
- mercapto refers to an —SH radical.
- thioalkoxy refers to an —S— alkyl radical.
- halo refers to any radical of fluorine, chlorine, bromine or iodine. “Halogen” and “halo” are used interchangeably herein.
- cycloalkyl means a saturated or unsaturated nonaromatic hydrocarbon ring group having from 3 to 14 carbon atoms, unless otherwise specified.
- (C3-C10) cycloalkyl means a hydrocarbon radical of a (3-10)-membered saturated aliphatic cyclic hydrocarbon ring.
- cycloalkyl groups include, but are not limited to, cyclopropyl, methyl-cyclopropyl, 2,2- dimethyl-cyclobutyl, 2-ethyl-cyclopentyl, cyclohexyl, etc. Cycloalkyls may include multiple spiro- or fused rings. Cycloalkyl groups are optionally mono-, di-, tri-, tetra-, or penta-substituted on any position as permitted by normal valency.
- alkenyl refers to a non-aromatic hydrocarbon radical, straight or branched, containing at least one carbon-carbon double bond, and having from 2 to 10 carbon atoms unless otherwise specified.
- C2-C6 alkenyl is defined as an alkenyl radical having from 2 to 6 carbon atoms.
- alkenyl groups include, but are not limited to, ethenyl, propenyl, butenyl, and cyclohexenyl.
- the straight, branched, or cyclic portion of the alkenyl group may contain double bonds and is optionally mono-, di-, tri-, tetra-, or penta-substituted on any position as permitted by normal valency.
- cycloalkenyl means a monocyclic hydrocarbon group having the specified number of carbon atoms and at least one carbon-carbon double bond.
- alkynyl refers to a hydrocarbon radical, straight or branched, containing from 2 to 10 carbon atoms, unless otherwise specified, and containing at least one carbon- carbon triple bond. Up to 5 carbon-carbon triple bonds may be present.
- C2-C6 alkynyl means an alkynyl radical having from 2 to 6 carbon atoms. Examples of alkynyl groups include, but are not limited to, ethynyl, 2-propynyl, and 2-butynyl.
- alkynyl group may contain triple bonds as permitted by normal valency, and may be optionally mono-, di-, tri-, tetra-, or penta- substituted on any position as permitted by normal valency.
- alkoxyl or “alkoxy” refers to an alkyl group as defined above with the indicated number of carbon atoms attached through an oxygen bridge.
- (C1-C3)alkoxy includes methoxy, ethoxy and propoxy.
- (C1-C6)alkoxy is intended to include C1, C2, C3, C4, C5, and C6 alkoxy groups.
- (C1-C8)alkoxy is intended to include C1, C2, C3, C4, C5, C6, C7, and C8 alkoxy groups.
- alkoxy include, but are not limited to, methoxy, ethoxy, n-propoxy, i- propoxy, n-butoxy, s-butoxy, t-butoxy, n-pentoxy, s-pentoxy, n-heptoxy, and n-octoxy.
- Alkylthio means an alkyl radical attached through a sulfur linking atom.
- alkylamino or “aminoalkyl”, means an alkyl radical attached through an NH linkage.
- Dialkylamino means two alkyl radical attached through a nitrogen linking atom.
- the amino groups may be unsubstituted, monosubstituted, or di- substituted.
- the two alkyl radicals are the same (e.g., N,N-dimethylamino).
- the two alkyl radicals are different (e.g., N-ethyl-N-methylamino).
- aryl or “aromatic” means any stable monocyclic or polycyclic carbon ring of up to 7 atoms in each ring, wherein at least one ring is aromatic.
- aryl groups include, but are not limited to, phenyl, naphthyl, anthracenyl, tetrahydronaphthyl, indanyl, and biphenyl. In cases where the aryl substituent is bicyclic and one ring is non-aromatic, it is understood that attachment is via the aromatic ring.
- Aryl groups are optionally mono-, di-, tri-, tetra-, or penta-substituted on any position as permitted by normal valency.
- arylalkyl or the term “aralkyl” refers to alkyl substituted with an aryl.
- arylalkoxy refers to an alkoxy substituted with aryl.
- Hetero refers to the replacement of at least one carbon atom in a ring system with at least one heteroatom selected from N, S and O. “Hetero” also refers to the replacement of at least one carbon atom in an acyclic system.
- a hetero ring system or a hetero acyclic system may have, for example, 1, 2 or 3 carbon atoms replaced by a heteroatom.
- heteroaryl represents a stable monocyclic or polycyclic ring of up to 7 atoms in each ring, wherein at least one ring is aromatic and contains from 1 to 4 heteroatoms selected from the group consisting of O, N and S.
- heteroaryl groups include, but are not limited to, acridinyl, carbazolyl, cinnolinyl, quinoxalinyl, pyrrazolyl, indolyl, benzotriazolyl, furanyl, thienyl, benzothienyl, benzofuranyl, benzimidazolonyl, benzoxazolonyl, quinolinyl, isoquinolinyl, dihydroisoindolonyl, imidazopyridinyl, isoindolonyl, indazolyl, oxazolyl, oxadiazolyl, isoxazolyl, indolyl, pyrazinyl, pyridazinyl, pyridinyl, pyrimidinyl, pyrrolyl, tetrahydroquinoline.
- Heteroaryl is also understood to include the N-oxide derivative of any nitrogen-containing heteroaryl. In cases where the heteroaryl substituent is bicyclic and one ring is non-aromatic or contains no heteroatoms, it is understood that attachment is via the aromatic ring or via the heteroatom containing ring. Heteroaryl groups are optionally mono-, di-, tri-, tetra-, or penta-substituted on any position as permitted by normal valency.
- heterocycle means a 3- to 14- membered aromatic or nonaromatic heterocycle containing from 1 to 4 heteroatoms selected from the group consisting of O, N and S, including polycyclic groups.
- heterocyclic is also considered to be synonymous with the terms “heterocycle” and “heterocyclyl” and is understood as also having the same definitions set forth herein.
- Heterocyclyl includes the above mentioned heteroaryls, as well as dihydro and tetrahydro analogs thereof.
- heterocyclyl groups include, but are not limited to, azetidinyl, benzoimidazolyl, benzofuranyl, benzofurazanyl, benzopyrazolyl, benzotriazolyl, benzothiophenyl, benzoxazolyl, carbazolyl, carbolinyl, cinnolinyl, furanyl, imidazolyl, indolinyl, indolyl, indolazinyl, indazolyl, isobenzofuranyl, isoindolyl, isoquinolyl, isothiazolyl, isoxazolyl, naphthpyridinyl, oxadiazolyl, oxooxazolidinyl, oxazolyl, oxazoline, oxopiperazinyl, oxopyrrolidinyl, oxomorpholinyl, isoxazoline, oxetanyl, pyranyl,
- Heterocyclyl groups are optionally mono-, di-, tri-, tetra-, or penta-substituted on any position as permitted by normal valency.
- “Heterocycloalkyl” refers to a cycloalkyl residue in which one to four of the carbons is replaced by a heteroatom such as oxygen, nitrogen or sulfur.
- heterocycles whose radicals are heterocyclyl groups include tetrahydropyran, morpholine, pyrrolidine, piperidine, thiazolidine, oxazole, oxazoline, isoxazole, dioxane, tetrahydrofuran and the like.
- heteroaryl refers to an aromatic 5-8 membered monocyclic, 8-12 membered bicyclic, or 11-14 membered tricyclic ring system having 1-3 heteroatoms if monocyclic, 1-6 heteroatoms if bicyclic, or 1-9 heteroatoms if tricyclic, said heteroatoms selected from O, N, or S (e.g., carbon atoms and 1-3, 1-6, or 1-9 heteroatoms of N, O, or S if monocyclic, bicyclic, or tricyclic, respectively), wherein 0, 1, 2, 3, or 4 atoms of each ring may be substituted by a substituent.
- heteroaryl groups include pyridyl, furyl or furanyl, imidazolyl, benzimidazolyl, pyrimidinyl, thiophenyl or thienyl, quinolinyl, indolyl, thiazolyl, and the like.
- heteroarylalkyl or the term “heteroaralkyl” refers to an alkyl substituted with a heteroaryl.
- heteroarylalkoxy refers to an alkoxy substituted with heteroaryl.
- cycloalkyl as employed herein includes saturated and partially unsaturated cyclic hydrocarbon groups having 3 to 12 carbons, for example, 3 to 8 carbons, and, for example, 3 to 6 carbons, wherein the cycloalkyl group additionally may be optionally substituted.
- Cycloalkyl groups include, without limitation, cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cycloheptyl, and cyclooctyl.
- acyl refers to an alkylcarbonyl, cycloalkylcarbonyl, arylcarbonyl, heterocyclylcarbonyl, or heteroarylcarbonyl substituent, any of which may be further substituted by substituents.
- keto refers to any alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, heterocyclyl, heteroaryl, or aryl group as defined herein attached through a carbonyl bridge.
- keto groups include, but are not limited to, alkanoyl (e.g., acetyl, propionyl, butanoyl, pentanoyl, hexanoyl), alkenoyl (e.g., acryloyl) alkynoyl (e.g., ethynoyl, propynoyl, butynoyl, pentynoyl, hexynoyl), aryloyl (e.g., benzoyl), heteroaryloyl (e.g., pyrroloyl, imidazoloyl, quinolinoyl, pyridinoyl).
- alkanoyl e.g., acetyl, propionyl, butanoyl, pentanoyl, hexanoyl
- alkenoyl e.g., acryloyl alkynoyl (e.g.
- alkoxycarbonyl refers to any alkoxy group as defined above attached through a carbonyl bridge (i.e., —C(O)O-alkyl).
- alkoxycarbonyl groups include, but are not limited to, methoxycarbonyl, ethoxycarbonyl, iso-propoxycarbonyl, n-propoxycarbonyl, t-butoxycarbonyl, benzyloxycarbonyl or n-pentoxycarbonyl.
- aryloxycarbonyl refers to any aryl group as defined herein attached through an oxycarbonyl bridge (i.e., —C(O)O-aryl).
- aryloxycarbonyl groups include, but are not limited to, phenoxycarbonyl and naphthyloxycarbonyl.
- heteroaryloxycarbonyl refers to any heteroaryl group as defined herein attached through an oxycarbonyl bridge (i.e., —C(O)O-heteroaryl).
- heteroaryloxycarbonyl groups include, but are not limited to, 2-pyridyloxycarbonyl, 2-oxazolyloxycarbonyl, 4-thiazolyloxycarbonyl, or pyrimidinyloxycarbonyl.
- oxo refers to an oxygen atom, which forms a carbonyl when attached to carbon, an N- oxide when attached to nitrogen, and a sulfoxide or sulfone when attached to sulfur.
- the compounds and compositions disclosed herein may have certain atoms (e.g., N, O, or S atoms) in a protonated or deprotonated state, depending upon the environment in which the compound or composition is placed.
- the structures disclosed herein envisage that certain functional groups, such as, for example, OH, SH, or NH, may be protonated or deprotonated.
- RNAi Agents of the Disclosure Described herein are RNAi agents which inhibit the expression of a 4R-tau isoform.
- the RNAi agent includes double stranded ribonucleic acid (dsRNA) molecules for inhibiting the expression of 4R-tau in a cell, such as a cell within a subject, e.g., a mammal, such as a human having a 4R-tau-associated disease, such as a 4R-tauopathy, e.g., PSP, CBD, AGD, MSTD, GGT, spAD, or rpAD.
- the dsRNA includes an antisense strand having a region of complementarity which is complementary to at least a part of a hotspot within exon 10 in an mRNA formed in the expression of a 4R-tau isoform.
- the region of complementarity is about 15-30 nucleotides or less in length.
- the RNAi agent inhibits the expression of 4R-tau isoforms (e.g., expressed by a human gene, a primate gene, a non-primate gene) by at least 25%, or higher as described herein, when compared to a similar cell not contacted with the RNAi agent or an RNAi agent not complementary to the MAPT gene.
- Expression of the 4R-tau isoform may be assayed by, for example, a PCR or branched DNA (bDNA)-based method, or by a protein-based method, such as by immunofluorescence analysis, using, for example, western blotting or flowcytometric techniques.
- the level of knockdown is assayed in BE (2)-C cells using an assay method provided in Example 1 below.
- the level of knockdown is assayed in primary mouse hepatocytes.
- the level of knockdown is assayed in Neuro-2a cells.
- a dsRNA includes two RNA strands that are complementary and hybridize to form a duplex structure under conditions in which the dsRNA will be used.
- One strand of a dsRNA includes a region of complementarity that is substantially complementary, and generally fully complementary, to a target sequence.
- the target sequence can be derived from the sequence of a hotspot within exon 10 in an mRNA formed during the expression of a 4R-tau isoform.
- the other strand includes a region that is complementary to the antisense strand, such that the two strands hybridize and form a duplex structure when combined under suitable conditions.
- the complementary sequences of a dsRNA can also be contained as self- complementary regions of a single nucleic acid molecule, as opposed to being on separate oligonucleotides.
- the duplex structure is 15 to 30 base pairs in length, e.g., 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs in length.
- the duplex structure is 18 to 25 base pairs in length, e.g., 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-25, 19-24, 19- 23, 19-22, 19-21, 19-20, 20-25, 20-24,20-23, 20-22, 20-21, 21-25, 21-24, 21-23, 21-22, 22-25, 22-24, 22- 23, 23-25, 23-24 or 24-25 base pairs in length, for example, 19-21 base pairs in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the disclosure.
- the region of complementarity to the target sequence is 15 to 30 nucleotides in length, e.g., 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length, for example 19-23 nucleotides in length or 21-23 nucleotides in length.
- the duplex structure is 19 to 30 base pairs in length.
- the region of complementarity to the target sequence is 19 to 30 nucleotides in length.
- the dsRNA is 15 to 23 nucleotides in length, 19 to 23 nucleotides in length, or 25 to 30 nucleotides in length.
- the dsRNA is long enough to serve as a substrate for the Dicer enzyme. For example, it is well known in the art that dsRNAs longer than about 21-23 nucleotides can serve as substrates for Dicer.
- RNAi-directed cleavage i.e., cleavage through a RISC pathway
- the duplex region is a primary functional portion of a dsRNA, e.g., a duplex region of about 15 to 36 base pairs, e.g., 15-36, 15-35, 15-34, 15-33, 15-32, 15- 31, 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18- 30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19- 26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20- 22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-26, 21-25, 21, 21
- an RNA molecule or complex of RNA molecules having a duplex region greater than 30 base pairs is a dsRNA.
- a miRNA is a dsRNA.
- a dsRNA is not a naturally occurring miRNA.
- an RNAi agent useful to target 4R-tau expression is not generated in the target cell by cleavage of a larger dsRNA.
- a dsRNA as described herein can further include one or more single-stranded nucleotide overhangs e.g., 1, 2, 3, or 4 nucleotides.
- a nucleotide overhang can comprise or consist of a nucleotide/nucleoside analog, including a deoxynucleotide/nucleoside.
- the overhang(s) can be on the sense strand, the antisense strand or any combination thereof.
- the nucleotide(s) of an overhang can be present on the 5'-end, 3'-end or both ends of either an antisense or sense strand of a dsRNA.
- a dsRNA can be synthesized by standard methods known in the art.
- Double stranded RNAi compounds of the disclosure may be prepared using a two-step procedure. First, the individual strands of the double stranded RNA molecule are prepared separately. Then, the component strands are annealed. The individual strands of the siRNA compound can be prepared using solution-phase or solid-phase organic synthesis or both. Organic synthesis offers the advantage that the oligonucleotide strands comprising unnatural or modified nucleotides can be easily prepared. Similarly, single-stranded oligonucleotides of the disclosure can be prepared using solution-phase or solid-phase organic synthesis or both.
- a dsRNA of the disclosure includes at least two nucleotide sequences, a sense sequence and an antisense sequence.
- the sense strand sequence for MAPT may be selected from the group of sequences provided in Table 7 or 8
- the corresponding nucleotide sequence of the antisense strand of the sense strand may be selected from the group of sequences of Table 7 or 8.
- one of the two sequences is complementary to the other of the two sequences, with one of the sequences being substantially complementary to a sequence of an mRNA generated in the expression of a 4R-tau isoform.
- a dsRNA will include two oligonucleotides, where one oligonucleotide is described as the sense strand (passenger strand) in Table 7 or 8, and the second oligonucleotide is described as the corresponding antisense strand (guide strand) of the sense strand in Table 7 or 8.
- the sense strand comprises at least 15 contiguous nucleotides differing by no more than three nucleotides from any one of the nucleotide sequence of nucleotides 1009-1029, 1010- 1030, 1011-1031, 1012-1032, 1013-1033, 1014-1034, 1015-1035, 1016-1036, 1017-1037, 1018-1038, 1019-1039, 1020-1040, 1021-1041, 1022-1042, 1023-1043, 1024-1044, 1025-1045, 1026-1046, 1027- 1047, 1028-1048, 1029-1049, 1030-1050, 1031-1051, 1032-1052, 1033-1053, 1014-1048, and 1022-1048 of SEQ ID NO: 3, and the antisense strand comprises at least 15 contiguous nucleotides from the corresponding nucleotide sequence of SEQ ID NO: 4.
- the sense strand comprises at least 15 contiguous nucleotides differing by no more than three nucleotides from any one of the nucleotide sequence of nucleotides 1009-1029, 1016-1036, 1018-1038, 1020-1040, 1021-1041, 1022- 1042, 1024-1044, 1027-1047, 1028-1048, 1029-1049, 1030-1050, 1032-1052, 1033-1053, 1014-1048, and 1022-1048 of SEQ ID NO: 3, and the antisense strand comprises at least 15 contiguous nucleotides from the corresponding nucleotide sequence of SEQ ID NO: 4.
- the antisense polynucleotides disclosed herein are substantially complementary to a fragment of a target MAPT sequence and comprise a contiguous nucleotide sequence which is at least 80% complementary over its entire length to a fragment of SEQ ID NO: 3, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than three nucleotides from any one of the nucleotide sequence of nucleotides 1009-1029, 1010-1030, 1011-1031, 1012-1032, 1013-1033, 1014-1034, 1015-1035, 1016-1036, 1017-1037, 1018-1038, 1019-1039, 1020-1040, 1021- 1041, 1022-1042, 1023-1043, 1024-1044, 1025-1045, 1026-1046, 1027-1047, 1028-1048, 1029-1049, 1030-1050, 1031-1051, 1032-1052, 1033-1053, 1014-1048, and 1022-1048 of SEQ ID
- the antisense polynucleotides disclosed herein are substantially complementary to a fragment of a target MAPT sequence and comprise a contiguous nucleotide sequence complementary over its entire length to a fragment of SEQ ID NO: 3, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than three nucleotides from any one of the nucleotide sequence of nucleotides 1009-1029, 1016-1036, 1018-1038, 1020-1040, 1021-1041, 1022- 1042, 1024-1044, 1027-1047, 1028-1048, 1029-1049, 1030-1050, 1032-1052, 1033-1053, 1014-1048, and 1022-1048 of SEQ ID NO: 3, and the antisense strand comprises at least 15 contiguous nucleotides from the corresponding nucleotide sequence of SEQ ID NO: 4.
- the antisense strand comprises at least 15 contiguous nucleotides differing by no more than three nucleotides from any one of the antisense strand nucleotide sequences of a duplex selected from the group consisting of AD-1423276, AD-1423277, AD-1423278, AD-1423279, AD- 1423280, AD-1423281, AD-1423282, AD-1423283, AD-1423284, AD-1423285, AD-1423286, AD- 1423287, AD-1423288, AD-1423289, AD-1423290, AD-1423291, AD-1423292, AD-1423293, AD- 1423294, AD-1423295, AD-1423296, AD-1423297, AD-1423298, AD-1423299, and AD-1423300.
- the antisense strand comprises at least 15 contiguous nucleotides differing by no more than three nucleotides from any one of the antisense strand nucleotide sequences of a duplex selected from the group consisting of AD-1423276, AD-1423283, AD-1423285, AD-1423287, AD- 1423288, AD-1423289, AD-1423291, AD-1423294, AD-1423295, AD-1423296, AD-1423297, AD- 1423299, and AD-1423300.
- the present disclosure provides a dsRNA agent for inhibiting expression of 4R-tau, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a region of complementarity to an mRNA encoding 4R-tau, and wherein the region of complementarity comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the antisense nucleotide sequences in Table 7 or 8.
- the substantially complementary sequences of the dsRNA are contained on separate oligonucleotides.
- the substantially complementary sequences of the dsRNA are contained on a single oligonucleotide.
- the RNA of the RNAi agent of the disclosure e.g., a dsRNA of the disclosure, may comprise any one of the sequences set forth in Tables 7 and 8, that is un-modified, un-conjugated, or modified or conjugated differently than described therein.
- the sense strands of the agents of the disclosure may be conjugated to a GalNAc ligand, these agents may be conjugated to a moiety that directs delivery to the CNS, e.g., a C16 ligand, as described herein.
- the lipophilic moiety contains a saturated or unsaturated C16 hydrocarbon chain (e.g., a linear C16 alkyl or alkenyl).
- a lipophilic ligand can be included in any of the positions provided in the instant application.
- the lipophilic moiety is conjugated to a nucleobase, sugar moiety, or internucleosidic linkage of the double-stranded iRNA agent.
- a C16 ligand may be conjugated via the 2’- oxygen of a ribonucleotide as shown in the following structure: , where * denotes a bond to an adjacent nucleotide, and B is a nucleobase or a nucleobase analog, optionally where B is adenine, guanine, cytosine, thymine or uracil.
- Design and Synthesis of the ligands and monomers provided herein are described, for example, in PCT publication Nos. WO2019/217459, WO2020/132227, and WO2020/257194, contents of which are incorporated herein by reference in their entirety.
- the double-stranded iRNA agent further comprises a phosphate or phosphate mimic at the 5’-end of the antisense strand.
- the phosphate mimic is a 5’- vinyl phosphonate (VP).
- the phosphate mimic is a 5’-cyclopropyl phosphonate (VP).
- the 5’-end of the antisense strand of the double-stranded iRNA agent does not contain a 5’-vinyl phosphonate (VP).
- At least one of the modified nucleotides is selected from the group consisting of a deoxy-nucleotide, a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-deoxy- modified nucleotide, a glycol modified nucleotide (GNA), e.g., Ggn, Cgn, Tgn, or Agn, a nucleotide with a 2’ phosphate, e.g., G2p, C2p, A2p or U2p, and, a vinyl-phosphonate nucleotide; and combinations thereof.
- GUA glycol modified nucleotide
- each of the duplexes of Tables 7 and 8 may be particularly modified to provide another double-stranded iRNA agent of the present disclosure.
- the 3’-terminus of each sense duplex may be modified by removing the 3’-terminal L96 ligand and exchanging the two phosphodiester internucleotide linkages between the three 3’-terminal nucleotides with phosphorothioate internucleotide linkages.
- the three 3’-terminal nucleotides (N) of a sense sequence of the formula: 5’- N 1 -... -N n-2 N n-1 N n L963’ may be replaced with 5’- N 1 -... -N n-2 sN n-1 sN n 3’. That is, for example, for AD-1423297, the sense sequence: asasgga(Uhd)aaUfAfUfcaaacacguaL96 may be replaced with asasgga(Uhd)aaUfAfUfcaaacacgsusa while the antisense sequence remains unchanged to provide another double-stranded iRNA agent of the present disclosure.
- the sense strand of each of the following duplexes are modified according to the preceding description to provide a duplex of the disclosure: AD-1423277, AD-1423278, AD-1423279, AD-1423280, AD-1423281, AD-1423282, AD-1423283, AD-1423284, AD-1423285, AD- 1423286, AD-1423287, AD-1423288, AD-1423289, AD-1423290, AD-1423291, AD-1423292, AD- 1423293, AD-1423294, AD-1423295, AD-1423296, AD-1423297, AD-1423298, AD-1423299, and AD- 1423300.
- dsRNAs having a duplex structure of about 20 to 23 base pairs, e.g., 21, base pairs have been hailed as particularly effective in inducing RNA interference (Elbashir et al., (2001) EMBO J., 20:6877-6888).
- RNA duplex structures can also be effective (Chu and Rana (2007) RNA 14:1714-1719; Kim et al. (2005) Nat Biotech 23:222-226).
- dsRNAs described herein can include at least one strand of a length of minimally 21 nucleotides.
- dsRNAs having a sequence of at least 15, 16, 17, 18, 19, 20, or more contiguous nucleotides derived from one of the sequences provided herein, and differing in their ability to inhibit the expression of a 4R-tau isoform by at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 95% inhibition relative to a control level, from a dsRNA comprising the full sequence using the in vitro assay with, e.g., A549 cells and a 10 nM concentration of the RNA agent and the PCR assay as provided in the examples herein, are contemplated to be within the scope of the present disclosure.
- inhibition from a dsRNA comprising the full sequence was measured using the in vitro assay with primary mouse hepatocytes.
- the RNAs described herein identify a site(s) in a MAPT transcript that is susceptible to RISC-mediated cleavage.
- the present disclosure further features RNAi agents that target within this site(s).
- an RNAi agent is said to target within a particular site of an RNA transcript if the RNAi agent promotes cleavage of the transcript anywhere within that particular site.
- RNAi agent will generally include at least about 15 contiguous nucleotides, preferably at least 19 nucleotides, from one of the sequences provided herein coupled to additional nucleotide sequences taken from the region contiguous to the selected sequence in a MAPT gene.
- RNA of the RNAi agent of the disclosure e.g., a dsRNA
- the RNA of an RNAi agent of the disclosure is chemically modified to enhance stability or other beneficial characteristics.
- substantially all of the nucleotides of an RNAi agent of the disclosure are modified. In other embodiments of the disclosure, all of the nucleotides of an RNAi agent of the disclosure are modified.
- RNAi agents of the disclosure in which “substantially all of the nucleotides are modified” are largely but not wholly modified and can include not more than 5, 4, 3, 2, or unmodified nucleotides. In still other embodiments of the disclosure, RNAi agents of the disclosure can include not more than 5, 4, 3, 2 or 1 modified nucleotides.
- nucleic acids featured in the disclosure can be synthesized or modified by methods well established in the art, such as those described in “Current protocols in nucleic acid chemistry,” Beaucage, S.L. et al. (Edrs.), John Wiley & Sons, Inc., New York, NY, USA, which is hereby incorporated herein by reference.
- Modifications include, for example, end modifications, e.g., 5’-end modifications (phosphorylation, conjugation, inverted linkages) or 3’-end modifications (conjugation, DNA nucleotides, inverted linkages, etc.); base modifications, e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, removal of bases (abasic nucleotides), or conjugated bases; sugar modifications (e.g., at the 2’-position or 4’-position) or replacement of the sugar; or backbone modifications, including modification or replacement of the phosphodiester linkages.
- end modifications e.g., 5’-end modifications (phosphorylation, conjugation, inverted linkages) or 3’-end modifications (conjugation, DNA nucleotides, inverted linkages, etc.
- base modifications e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, removal of bases (abasic nucleot
- RNAi agents useful in the embodiments described herein include, but are not limited to, RNAs containing modified backbones or no natural internucleoside linkages.
- RNAs having modified backbones include, among others, those that do not have a phosphorus atom in the backbone.
- modified RNAs that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides.
- a modified RNAi agent will have a phosphorus atom in its internucleoside backbone.
- Modified RNA backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3'-5' linkages, 2'-5'-linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'.
- the dsRNA agents of the disclosure are in a free acid form. In other embodiments of the disclosure, the dsRNA agents of the disclosure are in a salt form. In one embodiment, the dsRNA agents of the disclosure are in a sodium salt form. In certain embodiments, when the dsRNA agents of the disclosure are in the sodium salt form, sodium ions are present in the agent as counterions for substantially all of the phosphodiester and/or phosphorothiotate groups present in the agent.
- Agents in which substantially all of the phosphodiester and/or phosphorothioate linkages have a sodium counterion include not more than 5, 4, 3, 2, or 1 phosphodiester and/or phosphorothioate linkages without a sodium counterion.
- sodium ions are present in the agent as counterions for all of the phosphodiester and/or phosphorothiotate groups present in the agent.
- Representative U.S. patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. Patent Nos.
- Modified RNA backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages.
- patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Patent Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,64,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and, 5,677,439, the entire contents of each of which are hereby incorporated herein by reference.
- RNA mimetics are contemplated for use in RNAi agents, in which both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with alternate groups.
- the base units are maintained for hybridization with an appropriate nucleic acid target compound.
- a RNA mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA).
- PNA peptide nucleic acid
- the sugar backbone of an RNA is replaced with an amide containing backbone, in particular an aminoethylglycine backbone.
- nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone.
- Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Patent Nos. 5,539,082; 5,714,331; and 5,719,262, the entire contents of each of which are hereby incorporated herein by reference. Additional PNA compounds suitable for use in the RNAi agents of the disclosure are described in, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.
- RNAs with phosphorothioate backbones and oligonucleosides with heteroatom backbones and in particular --CH 2 --NH--CH 2 -, --CH 2 --N(CH 3 )--O- -CH 2 --[known as a methylene (methylimino) or MMI backbone], --CH 2 --O--N(CH 3 )--CH 2 --, --CH 2 -- N(CH 3 )--N(CH 3 )--CH 2 -- and --N(CH 3 )--CH 2 ----[wherein the native phosphodiester backbone is represented as --O--P--O--CH 2 --] of the above-referenced U.S. Patent No.
- RNAs featured herein have morpholino backbone structures of the above-referenced US5,034,506. Modified RNAs can also contain one or more substituted sugar moieties.
- RNAi agents e.g., dsRNAs
- featured herein can include one of the following at the 2'-position: OH; F; O-, S-, or N-alkyl; O- , S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl can be substituted or unsubstituted C 1 to C 10 alkyl or C 2 to C 10 alkenyl and alkynyl.
- Exemplary suitable modifications include O[(CH 2 ) n O] m CH 3 , O(CH 2 ).
- n OCH 3 O(CH 2 ) n NH 2 , O(CH 2 ) n CH 3 , O(CH 2 ) n ONH 2 , and O(CH 2 ) n ON[(CH 2 ) n CH 3 )] 2 , where n and m are from 1 to about 10.
- dsRNAs include one of the following at the 2' position: C 1 to C 10 lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH 3 , OCN, Cl, Br, CN, CF 3 , OCF 3 , SOCH 3 , SO 2 CH 3 , ONO 2 , NO 2 , N 3 , NH 2 , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an RNAi agent, or a group for improving the pharmacodynamic properties of an RNAi agent, and other substituents having similar properties.
- the modification includes a 2'-methoxyethoxy (2'-O--CH 2 CH 2 OCH 3 , also known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504) i.e., an alkoxy-alkoxy group.
- Another exemplary modification is 2'- dimethylaminooxyethoxy, i.e., a O(CH 2 ) 2 ON(CH 3 ) 2 group, also known as 2'-DMAOE, as described in examples herein below, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O- dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O--CH 2 --O--CH 2 --N(CH 2 ) 2 .
- modifications include: 5’-Me-2’-F nucleotides, 5’-Me-2’-OMe nucleotides, 5’-Me-2’-deoxynucleotides, (both R and S isomers in these three families); 2’-alkoxyalkyl; and 2’-NMA (N-methylacetamide).
- Other modifications include 2'-methoxy (2'-OCH 3 ), 2'-aminopropoxy (2'-OCH 2 CH 2 CH 2 NH 2 ), 2’- O-hexadecyl, and 2'-fluoro (2'-F).
- RNAi agents can also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar.
- Representative U.S. patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Pat. Nos.
- RNAi agent of the disclosure can also include nucleobase (often referred to in the art simply as “base”) modifications or substitutions.
- unmodified or “natural” nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
- Modified nucleobases include other synthetic and natural nucleobases such as 5- methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8- thiol, 8-thioalkyl, 8-hydroxyl anal other 8-substituted adenines and guanines, 5-halo, particularly 5- bromo, 5-trifluoromethyl and other 5-
- nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008; those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. L, ed. John Wiley & Sons, 1990, these disclosed by Englisch et al., (1991) Angewandte Chemie, International Edition, 30:613, and those disclosed by Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., Ed., CRC Press, 1993.
- nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds featured in the disclosure.
- These include 5-substituted pyrimidines, 6-azapyrimidines and N- 2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5- propynylcytosine.
- 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2 °C (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., Eds., dsRNA Research and Applications, CRC Press, Boca Raton, 1993, pp.
- RNAi agent of the disclosure can also be modified to include one or more locked nucleic acids (LNA).
- LNA locked nucleic acids
- a locked nucleic acid is a nucleotide having a modified ribose moiety in which the ribose moiety comprises an extra bridge connecting the 2' and 4' carbons. This structure effectively “locks” the ribose in the 3'-endo structural conformation.
- the addition of locked nucleic acids to siRNAs has been shown to increase siRNA stability in serum, and to reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, OR. et al., (2007) Mol Canc Ther 6(3):833-843; Grunweller, A.
- RNAi agent of the disclosure can also be modified to include one or more bicyclic sugar moieties.
- a “bicyclic sugar” is a furanosyl ring modified by the bridging of two atoms.
- a “bicyclic nucleoside” (“BNA”) is a nucleoside having a sugar moiety comprising a bridge connecting two carbon atoms of the sugar ring, thereby forming a bicyclic ring system. In certain embodiments, the bridge connects the 4′-carbon and the 2′-carbon of the sugar ring.
- an agent of the disclosure may include one or more locked nucleic acids (LNA).
- a locked nucleic acid is a nucleotide having a modified ribose moiety in which the ribose moiety comprises an extra bridge connecting the 2' and 4' carbons.
- an LNA is a nucleotide comprising a bicyclic sugar moiety comprising a 4'-CH2-O-2' bridge. This structure effectively “locks” the ribose in the 3'-endo structural conformation.
- the addition of locked nucleic acids to siRNAs has been shown to increase siRNA stability in serum, and to reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, OR.
- bicyclic nucleosides for use in the polynucleotides of the disclosure include without limitation nucleosides comprising a bridge between the 4′ and the 2′ ribosyl ring atoms.
- the antisense polynucleotide agents of the disclosure include one or more bicyclic nucleosides comprising a 4′ to 2′ bridge.
- 4′ to 2′ bridged bicyclic nucleosides include but are not limited to 4′-(CH2)—O-2′ (LNA); 4′-(CH2)—S-2′; 4′-(CH2)2—O-2′ (ENA); 4′- CH(CH3)—O-2′ (also referred to as “constrained ethyl” or “cEt”) and 4′-CH(CH2OCH3)—O-2′ (and analogs thereof; see, e.g., U.S. Pat. No. 7,399,845); 4′-C(CH3)(CH3)—O-2′ (and analogs thereof; see e.g., US Patent No.
- RNAi agent of the disclosure can also be modified to include one or more constrained ethyl nucleotides.
- a “constrained ethyl nucleotide” or “cEt” is a locked nucleic acid comprising a bicyclic sugar moiety comprising a 4'-CH(CH3)-0-2' bridge.
- a constrained ethyl nucleotide is in the S conformation referred to herein as “S-cEt.”
- An RNAi agent of the disclosure may also include one or more “conformationally restricted nucleotides” (“CRN”).
- CRN are nucleotide analogs with a linker connecting the C2’and C4’ carbons of ribose or the C3 and -C5′ carbons of ribose. CRN lock the ribose ring into a stable conformation and increase the hybridization affinity to mRNA.
- the linker is of sufficient length to place the oxygen in an optimal position for stability and affinity resulting in less ribose ring puckering.
- an RNAi agent of the disclosure comprises one or more monomers that are UNA (unlocked nucleic acid) nucleotides.
- UNA is unlocked acyclic nucleic acid, wherein any of the bonds of the sugar has been removed, forming an unlocked “sugar” residue.
- UNA also encompasses monomer with bonds between C1'-C4' have been removed (i.e. the covalent carbon-oxygen- carbon bond between the C1' and C4' carbons).
- the C2'-C3' bond i.e. the covalent carbon-carbon bond between the C2' and C3' carbons
- Representative U.S. publications that teach the preparation of UNA include, but are not limited to, US8,314,227; and US Patent Publication Nos. 2013/0096289; 2013/0011922; and 2011/0313020, the entire contents of each of which are hereby incorporated herein by reference.
- RNAi agent of the disclosure may also include one or more “cyclohexene nucleic acids” or (“CeNA”).
- CeNA are nucleotide analogs with a replacement of the furanose moiety of DNA by a cyclohexene ring. Incorporation of cylcohexenyl nucleosides in a DNA chain increases the stability of a DNA/RNA hybrid. CeNA is stable against degradation in serum and a CeNA/RNA hybrid is able to activate E. Coli RNase H, resulting in cleavage of the RNA strand. (see Wang et al., Am. Chem. Soc. 2000, 122, 36, 8595–8602, hereby incorporated by reference).
- RNA molecules can include N- (acetylaminocaproyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-(caproyl-4-hydroxyprolinol (Hyp-C6), N- (acetyl-4-hydroxyprolinol (Hyp-NHAc), thymidine-2'-0-deoxythymidine (ether), N-(aminocaproyl)-4- hydroxyprolinol (Hyp-C6-amino), 2-docosanoyl-uridine-3"- phosphate, inverted base dT(idT) and others. Disclosure of this modification can be found in WO 2011/005861.
- RNAi agent of the disclosure examples include a 5’ phosphate or 5’ phosphate mimic, e.g., a 5’-terminal phosphate or phosphate mimic on the antisense strand of an RNAi agent. Suitable phosphate mimics are disclosed in, for example US 2012/0157511, the entire contents of which are incorporated herein by reference.
- the double-stranded RNAi agents of the disclosure include agents with chemical modifications as disclosed, for example, in WO 2013/075035, the entire contents of which are incorporated herein by reference.
- RNAi agent may be optionally conjugated with a lipophilic ligand, e.g., a C16 ligand, for instance on the sense strand.
- the RNAi agent may be optionally modified with a (S)- glycol nucleic acid (GNA) modification, for instance on one or more residues of the antisense strand.
- the resulting RNAi agents present superior gene silencing activity.
- the disclosure provides double stranded RNAi agents capable of inhibiting the expression of a target gene (i.e., a MAPT gene) in vivo.
- the RNAi agent comprises a sense strand and an antisense strand. Each strand of the RNAi agent may be 15-30 nucleotides in length.
- each strand may be 16-30 nucleotides in length, 17-30 nucleotides in length, 25-30 nucleotides in length, 27-30 nucleotides in length, 17-23 nucleotides in length, 17-21 nucleotides in length, 17-19 nucleotides in length, 19-25 nucleotides in length, 19-23 nucleotides in length, 19-21 nucleotides in length, 21-25 nucleotides in length, or 21-23 nucleotides in length. In certain embodiments, each strand is 19-23 nucleotides in length.
- RNAi agent a duplex double stranded RNA
- the duplex region of an RNAi agent may be 15-30 nucleotide pairs in length.
- the duplex region can be 16-30 nucleotide pairs in length, 17-30 nucleotide pairs in length, 27-30 nucleotide pairs in length, 17 - 23 nucleotide pairs in length, 17-21 nucleotide pairs in length, 17-19 nucleotide pairs in length, 19-25 nucleotide pairs in length, 19-23 nucleotide pairs in length, 19- 21 nucleotide pairs in length, 21-25 nucleotide pairs in length, or 21-23 nucleotide pairs in length.
- the duplex region is selected from 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, and 27 nucleotides in length.
- the duplex region is 19-21 nucleotide pairs in length.
- the RNAi agent may contain one or more overhang regions or capping groups at the 3’-end, 5’-end, or both ends of one or both strands.
- the overhang can be 1-6 nucleotides in length, for instance 2-6 nucleotides in length, 1-5 nucleotides in length, 2-5 nucleotides in length, 1-4 nucleotides in length, 2-4 nucleotides in length, 1-3 nucleotides in length, 2-3 nucleotides in length, or 1-2 nucleotides in length.
- the nucleotide overhang region is 2 nucleotides in length.
- the overhangs can be the result of one strand being longer than the other, or the result of two strands of the same length being staggered.
- the overhang can form a mismatch with the target mRNA or it can be complementary to the gene sequences being targeted or can be another sequence.
- the first and second strands can also be joined, e.g., by additional bases to form a hairpin, or by other non-base linkers.
- the nucleotides in the overhang region of the RNAi agent can each independently be a modified or unmodified nucleotide including, but no limited to 2’-sugar modified, such as, 2-F, 2’-O-methyl, thymidine (T), and any combinations thereof.
- TT can be an overhang sequence for either end on either strand.
- the overhang can form a mismatch with the target mRNA or it can be complementary to the gene sequences being targeted or can be another sequence.
- the 5’- or 3’- overhangs at the sense strand, antisense strand or both strands of the RNAi agent may be phosphorylated.
- the overhang region(s) contains two nucleotides having a phosphorothioate between the two nucleotides, where the two nucleotides can be the same or different.
- the overhang is present at the 3’-end of the sense strand, antisense strand, or both strands.
- this 3’-overhang is present in the antisense strand. In one embodiment, this 3’-overhang is present in the sense strand.
- the RNAi agent may contain only a single overhang, which can strengthen the interference activity of the RNAi, without affecting its overall stability.
- the single-stranded overhang may be located at the 3'-terminal end of the sense strand or, alternatively, at the 3'-terminal end of the antisense strand.
- the RNAi may also have a blunt end, located at the 5’-end of the antisense strand (or the 3’-end of the sense strand) or vice versa.
- the antisense strand of the RNAi has a nucleotide overhang at the 3’-end, and the 5’-end is blunt. While not wishing to be bound by theory, the asymmetric blunt end at the 5’-end of the antisense strand and 3’-end overhang of the antisense strand favor the guide strand loading into RISC process.
- the RNAi agent is double blunt-ended and 19 nucleotides in length, wherein the sense strand contains at least one motif of three 2’-F modifications on three consecutive nucleotides at positions 7, 8, 9 from the 5’end.
- the antisense strand contains at least one motif of three 2’-O-methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5’end.
- the RNAi agent is double blunt-ended and 20 nucleotides in length, wherein the sense strand contains at least one motif of three 2’-F modifications on three consecutive nucleotides at positions 8, 9, 10 from the 5’end.
- the antisense strand contains at least one motif of three 2’-O-methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5’end.
- the RNAi agent is a double blunt-ended and 21 nucleotides in length, wherein the sense strand contains at least one motif of three 2’-F modifications on three consecutive nucleotides at positions 9, 10, 11 from the 5’end.
- the antisense strand contains at least one motif of three 2’-O-methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5’end.
- the RNAi agent comprises a 21 nucleotide sense strand and a 23 nucleotide antisense strand, wherein the sense strand contains at least one motif of three 2’-F modifications on three consecutive nucleotides at positions 9, 10, 11 from the 5’end; the antisense strand contains at least one motif of three 2’-O-methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5’end, wherein one end of the RNAi agent is blunt, while the other end comprises a 2 nucleotide overhang.
- the 2 nucleotide overhang is at the 3’-end of the antisense strand.
- the RNAi agent additionally has two phosphorothioate internucleotide linkages between the terminal three nucleotides at both the 5’-end of the sense strand and at the 5’-end of the antisense strand.
- every nucleotide in the sense strand and the antisense strand of the RNAi agent, including the nucleotides that are part of the motifs are modified nucleotides.
- each residue is independently modified with a 2’-O-methyl or 3’-fluoro, e.g., in an alternating motif.
- the RNAi agent further comprises a ligand (e.g., a lipophilic ligand, optionally a C16 ligand).
- the RNAi agent comprises a sense and an antisense strand, wherein the sense strand is 25-30 nucleotide residues in length, wherein starting from the 5' terminal nucleotide (position 1) positions 1 to 23 of the first strand comprise at least 8 ribonucleotides; the antisense strand is 36-66 nucleotide residues in length and, starting from the 3' terminal nucleotide, comprises at least 8 ribonucleotides in the positions paired with positions 1- 23 of sense strand to form a duplex; wherein at least the 3 ' terminal nucleotide of antisense strand is unpaired with sense strand, and up to 6 consecutive 3' terminal nucleotides are unpaired with sense strand, thereby forming a 3' single stranded overhang of 1- 6 nucleotides; wherein the 5' terminus of antisense strand comprises from 10-30 consecutive nucleotides which are unpaired with sense strand, thereby forming a 10
- the antisense strand contains at least one motif of three 2’-O-methyl modifications on three consecutive nucleotides at or near the cleavage site.
- the RNAi agent comprises sense and antisense strands, wherein the RNAi agent comprises a first strand having a length which is at least 25 and at most 29 nucleotides and a second strand having a length which is at most 30 nucleotides with at least one motif of three 2’-O-methyl modifications on three consecutive nucleotides at position 11, 12, 13 from the 5’ end; wherein the 3’ end of the first strand and the 5’ end of the second strand form a blunt end and the second strand is 1-4 nucleotides longer at its 3’ end than the first strand, wherein the duplex region which is at least 25 nucleotides in length, and the second strand is sufficiently complementary to a target mRNA along at least 19 nucleotide of the second strand length to reduce target gene expression when the RNAi agent is introduced into
- the RNAi agent further comprises a ligand.
- the sense strand of the RNAi agent contains at least one motif of three identical modifications on three consecutive nucleotides, where one of the motifs occurs at the cleavage site in the sense strand.
- the antisense strand of the RNAi agent can also contain at least one motif of three identical modifications on three consecutive nucleotides, where one of the motifs occurs at or near the cleavage site in the antisense strand.
- the cleavage site of the antisense strand is typically around the 10, 11 and 12 positions from the 5’-end.
- the motifs of three identical modifications may occur at the 9, 10, 11 positions; 10, 11, 12 positions; 11, 12, 13 positions; 12, 13, 14 positions; or 13, 14, 15 positions of the antisense strand, the count starting from the 1 st nucleotide from the 5’-end of the antisense strand, or, the count starting from the 1 st paired nucleotide within the duplex region from the 5’- end of the antisense strand.
- the cleavage site in the antisense strand may also change according to the length of the duplex region of the RNAi from the 5’-end.
- the sense strand of the RNAi agent may contain at least one motif of three identical modifications on three consecutive nucleotides at the cleavage site of the strand; and the antisense strand may have at least one motif of three identical modifications on three consecutive nucleotides at or near the cleavage site of the strand.
- the sense strand and the antisense strand can be so aligned that one motif of the three nucleotides on the sense strand and one motif of the three nucleotides on the antisense strand have at least one nucleotide overlap, i.e., at least one of the three nucleotides of the motif in the sense strand forms a base pair with at least one of the three nucleotides of the motif in the antisense strand.
- at least two nucleotides may overlap, or all three nucleotides may overlap.
- the sense strand of the RNAi agent may contain more than one motif of three identical modifications on three consecutive nucleotides.
- the first motif may occur at or near the cleavage site of the strand and the other motifs may be a wing modification.
- the term “wing modification” herein refers to a motif occurring at another portion of the strand that is separated from the motif at or near the cleavage site of the same strand. The wing modification is either adjacent to the first motif or is separated by at least one or more nucleotides.
- the motifs are immediately adjacent to each other, then the chemistry of the motifs are distinct from each other and when the motifs are separated by one or more nucleotide than the chemistries can be the same or different.
- each wing modification may occur at one end relative to the first motif which is at or near cleavage site or on either side of the lead motif.
- the antisense strand of the RNAi agent may contain more than one motif of three identical modifications on three consecutive nucleotides, with at least one of the motifs occurring at or near the cleavage site of the strand.
- This antisense strand may also contain one or more wing modifications in an alignment similar to the wing modifications that may be present on the sense strand.
- the wing modification on the sense strand or antisense strand of the RNAi agent typically does not include the first one or two terminal nucleotides at the 3’-end, 5’-end or both ends of the strand. In another embodiment, the wing modification on the sense strand or antisense strand of the RNAi agent typically does not include the first one or two paired nucleotides within the duplex region at the 3’-end, 5’-end or both ends of the strand. When the sense strand and the antisense strand of the RNAi agent each contain at least one wing modification, the wing modifications may fall on the same end of the duplex region, and have an overlap of one, two or three nucleotides.
- the sense strand and the antisense strand of the RNAi agent each contain at least two wing modifications
- the sense strand and the antisense strand can be so aligned that two modifications each from one strand fall on one end of the duplex region, having an overlap of one, two or three nucleotides; two modifications each from one strand fall on the other end of the duplex region, having an overlap of one, two or three nucleotides; two modifications one strand fall on each side of the lead motif, having an overlap of one, two, or three nucleotides in the duplex region.
- the RNAi agent comprises mismatch(es) with the target, within the duplex, or combinations thereof. The mismatch may occur in the overhang region or the duplex region.
- the base pair may be ranked on the basis of their propensity to promote dissociation or melting (e.g., on the free energy of association or dissociation of a particular pairing, the simplest approach is to examine the pairs on an individual pair basis, though next neighbor or similar analysis can also be used).
- A:U is preferred over G:C
- G:U is preferred over G:C
- Mismatches e.g., non-canonical or other than canonical pairings (as described elsewhere herein) are preferred over canonical (A:T, A:U, G:C) pairings; and pairings which include a universal base are preferred over canonical pairings.
- the RNAi agent comprises at least one of the first 1, 2, 3, 4, or 5 base pairs within the duplex regions from the 5’- end of the antisense strand independently selected from the group of: A:U, G:U, I:C, and mismatched pairs, e.g., non-canonical or other than canonical pairings or pairings which include a universal base, to promote the dissociation of the antisense strand at the 5’-end of the duplex.
- the nucleotide at the 1 position within the duplex region from the 5’-end in the antisense strand is selected from the group consisting of A, dA, dU, U, and dT.
- At least one of the first 1, 2 or 3 base pair within the duplex region from the 5’- end of the antisense strand is an AU base pair.
- the first base pair within the duplex region from the 5’- end of the antisense strand is an AU base pair.
- the nucleotide at the 3’-end of the sense strand is deoxy-thymine (dT).
- the nucleotide at the 3’-end of the antisense strand is deoxy-thymine (dT).
- there is a short sequence of deoxy-thymine nucleotides for example, two dT nucleotides on the 3’-end of the sense or antisense strand.
- the sense strand sequence may be represented by formula (I): 5' n p -N a -(X X ) i -N b -Y Y -N b -(Z ) j -N a -n q 3' (I) wherein: i and j are each independently 0 or 1; p and q are each independently 0-6; each N a independently represents an oligonucleotide sequence comprising 0-25 modified nucleotides, each sequence comprising at least two differently modified nucleotides; each N b independently represents an oligonucleotide sequence comprising 0-10 modified nucleotides; each n p and n q independently represent an overhang nucleotide; wherein Nb and Y do not have the same modification; and XXX, YYY and ZZZ each independently represent one motif of three identical modifications on three consecutive nucleotides.
- YYY is all 2’-F modified nucleotides.
- the N a or N b comprise modifications of alternating pattern.
- the YYY motif occurs at or near the cleavage site of the sense strand.
- the YYY motif can occur at or the vicinity of the cleavage site (e.g.: can occur at positions 6, 7, 8, 7, 8, 9, 8, 9, 10, 9, 10, 11, 10, 11,12 or 11, 12, 13) of the sense strand, the count starting from the 1 st nucleotide, from the 5’-end; or optionally, the count starting at the 1 st paired nucleotide within the duplex region, from the 5’- end.
- i is 1 and j is 0, or i is 0 and j is 1, or both i and j are 1.
- the sense strand can therefore be represented by the following formulas: 5' n p -N a -YYY-N b -ZZZ-N a -n q 3' (Ib); 5' n p -N a -XXX-N b -YYY-N a -n q 3' (Ic); or 5' n p -N a -XXX-N b -YYY-N b -ZZZ-N a -n q 3' (Id).
- N b represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N a independently can represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
- N b represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides.
- Each N a can independently represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
- each N b independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides.
- N b is 0, 1, 2, 3, 4, 5 or 6.
- Each N a can independently represent an oligonucleotide sequence comprising 2-20, 2- 15, or 2-10 modified nucleotides.
- Each of X, Y and Z may be the same or different from each other.
- i is 0 and j is 0, and the sense strand may be represented by the formula: 5' n p -N a -YYY- N a -n q 3' (Ia).
- each N a independently can represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
- the antisense strand sequence of the RNAi may be represented by formula (Ie): 5' n q’ -N a ′-(Z’Z′Z′) k -N b ′-Y′Y′Y′-N b ′-(X′X′X′) l -N′ a -n p ′ 3' (Ie) wherein: k and l are each independently 0 or 1; p’ and q’ are each independently 0-6; each N a ′ independently represents an oligonucleotide sequence comprising 0-25 modified nucleotides, each sequence comprising at least two differently modified nucleotides; each N b ′ independently represents an oligonucleotide sequence comprising 0-10 modified nucleotides; each
- the N a ’ or N b ’ comprise modifications of alternating pattern.
- the Y′Y′Y′ motif occurs at or near the cleavage site of the antisense strand.
- the Y′Y′Y′ motif can occur at positions 9, 10, 11;10, 11, 12; 11, 12, 13; 12, 13, 14; or 13, 14, 15 of the antisense strand, with the count starting from the 1 st nucleotide, from the 5’-end; or optionally, the count starting at the 1 st paired nucleotide within the duplex region, from the 5’- end.
- the Y′Y′Y′ motif occurs at positions 11, 12, 13.
- Y′Y′Y′ motif is all 2’-OMe modified nucleotides.
- k is 1 and l is 0, or k is 0 and l is 1, or both k and l are 1.
- the antisense strand can therefore be represented by the following formulas: 5' n q’ -N a ′-Z′Z′Z′-N b ′-Y′Y′Y′-N a ′-n p’ 3' (If); 5' n q’ -N a ′-Y′Y′Y′-N b ′-X′X′X′-n p’ 3' (Ig); or 5' n q’ -N a ′- Z′Z′Z′-N b ′-Y′Y′Y′-N b ′- X′X′X′-N a ′-n p’ 3' (Ih).
- N b represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides.
- Each N a ’ independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
- N b ’ represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides.
- Each N a ’ independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
- each N b ’ independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides.
- Each N a ’ independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
- N b is 0, 1, 2, 3, 4, 5 or 6.
- each N a ’ independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
- Each of X′, Y′ and Z′ may be the same or different from each other.
- Each nucleotide of the sense strand and antisense strand may be independently modified with LNA, HNA, CeNA, 2’-methoxyethyl, 2’-O-methyl, 2’-O-allyl, 2’-C- allyl, 2’-hydroxyl, or 2’-fluoro.
- each nucleotide of the sense strand and antisense strand is independently modified with 2’-O- methyl or 2’-fluoro.
- Each X, Y, Z, X′, Y′ and Z′ in particular, may represent a 2’-O-methyl modification or a 2’-fluoro modification.
- the sense strand of the RNAi agent may contain YYY motif occurring at 9, 10 and 11 positions of the strand when the duplex region is 21 nt, the count starting from the 1 st nucleotide from the 5’-end, or optionally, the count starting at the 1 st paired nucleotide within the duplex region, from the 5’- end; and Y represents 2’-F modification.
- the sense strand may additionally contain XXX motif or ZZZ motifs as wing modifications at the opposite end of the duplex region; and XXX and ZZZ each independently represents a 2’-OMe modification or 2’-F modification.
- the antisense strand may contain Y′Y′Y′ motif occurring at positions 11, 12, 13 of the strand, the count starting from the 1 st nucleotide from the 5’-end, or optionally, the count starting at the 1 st paired nucleotide within the duplex region, from the 5’- end; and Y′ represents 2’-O- methyl modification.
- the antisense strand may additionally contain X′X′X′ motif or Z′Z′Z′ motifs as wing modifications at the opposite end of the duplex region; and X′X′X′ and Z′Z′Z′ each independently represents a 2’-OMe modification or 2’-F modification.
- the sense strand represented by any one of the above formulas (Ia), (Ib), (Ic), and (Id) forms a duplex with an antisense strand being represented by any one of formulas (Ie), (If), (Ig), and (Ih), respectively.
- the RNAi agents for use in the methods of the disclosure may comprise a sense strand and an antisense strand, each strand having 14 to 30 nucleotides, the RNAi duplex represented by formula (Ii): sense: 5' n p -N a -(X X X) i -N b - Y Y Y -N b -(Z Z Z) j -N a -n q 3' antisense: 3' n p ’ -N a ’ -(X’X′X′) k -N b ’ -Y′Y′Y′-N b ’ -(Z′Z′Z′) l -N a ’ -n q ’ 5' (Ii) wherein: i, j, k, and l are each independently 0 or 1; p, p′, q, and q′ are each independently 0-6; each N a and N a
- i is 0 and j is 0; or i is 1 and j is 0; or i is 0 and j is 1; or both i and j are 0; or both i and j are 1.
- k is 0 and l is 0; or k is 1 and l is 0; k is 0 and l is 1; or both k and l are 0; or both k and l are 1.
- Exemplary combinations of the sense strand and antisense strand forming an RNAi duplex include the formulas below: 5' n p - N a -Y Y Y -N a -n q 3' 3' n p ’ -N a ’ -Y′Y′Y′ -N a ’ n q ’ 5' (Ij) 5' n p -N a -Y Y Y -N b -Z Z Z -N a -n q 3' 3' n p ’ -N a ’ -Y′Y′Y′-N b ’ -Z′Z′Z′-N a ’ n q ’ 5' (Ik) 5' n p -N a - X X X -N b -Y Y Y - N a -n q 3' 3' n p ’ -N a ’
- each N b independently represents an oligonucleotide sequence comprising 1-10, 1-7, 1-5 or 1-4 modified nucleotides.
- Each N a independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
- each N b , N b ’ independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides.
- Each N a independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
- each N b , N b ’ independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides.
- Each N a , N a ’ independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
- Each of N a , N a ’, N b and N b ’ independently comprises modifications of alternating pattern.
- the N a modifications are 2 ⁇ -O-methyl or 2 ⁇ -fluoro modifications.
- the N a modifications are 2 ⁇ -O-methyl or 2 ⁇ -fluoro modifications and n p ′ >0 and at least one n p ′ is linked to a neighboring nucleotide a via phosphorothioate linkage.
- the N a modifications are 2 ⁇ -O-methyl or 2 ⁇ -fluoro modifications , n p ′ >0 and at least one n p ′ is linked to a neighboring nucleotide via phosphorothioate linkage, and the sense strand is conjugated to one or more C16 (or related) moieties attached through a bivalent or trivalent branched linker (described below).
- the N a modifications are 2 ⁇ -O-methyl or 2 ⁇ -fluoro modifications , n p ′ >0 and at least one n p ′ is linked to a neighboring nucleotide via phosphorothioate linkage, the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more lipophilic, e.g., C16 (or related) moieties, optionally attached through a bivalent or trivalent branched linker.
- the N a modifications are 2 ⁇ -O-methyl or 2 ⁇ -fluoro modifications , n p ′ >0 and at least one n p ′ is linked to a neighboring nucleotide via phosphorothioate linkage, the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more lipophilic, e.g., C16 (or related) moieties, optionally attached through
- the N a modifications are 2 ⁇ -O-methyl or 2 ⁇ -fluoro modifications , n p ′ >0 and at least one n p ′ is linked to a neighboring nucleotide via phosphorothioate linkage, the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more lipophilic, e.g., C16 (or related) moieties attached through a bivalent or trivalent branched linker.
- the N a modifications are 2 ⁇ -O-methyl or 2 ⁇ -fluoro modifications , n p ′ >0 and at least one n p ′ is linked to a neighboring nucleotide via phosphorothioate linkage, the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more lipophilic, e.g., C16 (or related) moieties attached through a bivalent or trivalent
- the RNAi agent is a multimer containing at least two duplexes represented by formula (Ii), (Ij), (Ik), (Il), and (Im), wherein the duplexes are connected by a linker.
- the linker can be cleavable or non-cleavable.
- the multimer further comprises a ligand.
- Each of the duplexes can target the same gene or two different genes; or each of the duplexes can target same gene at two different target sites.
- the RNAi agent is a multimer containing three, four, five, six or more duplexes represented by formula (Ii), (Ij), (Ik), (Il), and (Im), wherein the duplexes are connected by a linker.
- the linker can be cleavable or non-cleavable.
- the multimer further comprises a ligand.
- Each of the duplexes can target the same gene or two different genes; or each of the duplexes can target same gene at two different target sites.
- two RNAi agents represented by formula (Ii), (Ij), (Ik), (Il), and (Im) are linked to each other at the 5’ end, and one or both of the 3’ ends and are optionally conjugated to a ligand.
- Each of the agents can target the same gene or two different genes; or each of the agents can target same gene at two different target sites.
- Various publications describe multimeric RNAi agents that can be used in the methods of the disclosure. Such publications include WO2007/091269, WO2010/141511, WO2007/117686, WO2009/014887, and WO2011/031520; and US 7858769, the entire contents of each of which are hereby incorporated herein by reference.
- compositions and methods of the disclosure include a vinyl phosphonate (VP) modification of an RNAi agent as described herein.
- a vinyl phosphonate of the instant disclosure may be attached to either the antisense or the sense strand of a dsRNA of the disclosure.
- a vinyl phosphonate of the instant disclosure is attached to the antisense strand of a dsRNA, optionally at the 5’ end of the antisense strand of the dsRNA.
- Vinyl phosphate modifications are also contemplated for the compositions and methods of the instant disclosure.
- a dsRNA molecule can be optimized for RNA interference by incorporating thermally destabilizing modifications in the seed region of the antisense strand (i.e., at positions 2-9 of the 5’-end of the antisense strand) to reduce or inhibit off-target gene silencing. It has been discovered that dsRNAs with an antisense strand comprising at least one thermally destabilizing modification of the duplex within the first 9 nucleotide positions, counting from the 5’ end, of the antisense strand have reduced off-target gene silencing activity.
- the antisense strand comprises at least one (e.g., one, two, three, four, five or more) thermally destabilizing modification of the duplex within the first 9 nucleotide positions of the 5’ region of the antisense strand.
- one or more thermally destabilizing modification(s) of the duplex is/are located in positions 2-9, or preferably positions 4-8, from the 5’-end of the antisense strand.
- the thermally destabilizing modification(s) of the duplex is/are located at position 6, 7 or 8 from the 5’-end of the antisense strand.
- the thermally destabilizing modification of the duplex is located at position 7 from the 5’-end of the antisense strand.
- the term “thermally destabilizing modification(s)” includes modification(s) that would result with a dsRNA with a lower overall melting temperature (Tm) (preferably a Tm with one, two, three or four degrees lower than the Tm of the dsRNA without having such modification(s).
- Tm overall melting temperature
- the thermally destabilizing modification of the duplex is located at position 2, 3, 4, 5 or 9 from the 5’-end of the antisense strand.
- the thermally destabilizing modifications can include, but are not limited to, abasic modification; mismatch with the opposing nucleotide in the opposing strand; and sugar modification such as 2’-deoxy modification or acyclic nucleotide, e.g., unlocked nucleic acids (UNA) or glycol nucleic acid (GNA).
- B is a modified or unmodified nucleobase.
- Exemplified sugar modifications include, but are not limited to the following: wherein B is a modified or unmodified nucleobase.
- the thermally destabilizing modification of the duplex is selected from the group consisting of: wherein B is a modified or unmodified nucleobase and the asterisk on each structure represents either R, S or racemic.
- the thermally destabilizing modification of the duplex is selected from the group consisting of: wherein B is a modified or unmodified nucleobase and the asterisk represents either R, S or racemic (e.g. S).
- acyclic nucleotide refers to any nucleotide having an acyclic ribose sugar, for example, where any of bonds between the ribose carbons (e.g., C1’-C2’, C2’-C3’, C3’-C4’, C4’-O4’, or C1’-O4’) is absent or at least one of ribose carbons or oxygen (e.g., C1’, C2’, C3’, C4’ or O4’) are independently or in combination absent from the nucleotide.
- bonds between the ribose carbons e.g., C1’-C2’, C2’-C3’, C3’-C4’, C4’-O4’, or C1’-O4’
- ribose carbons or oxygen e.g., C1’, C2’, C3’, C4’ or O4’
- acyclic nucleotide i wherein B is a modified or unmodified nucleobase, R 1 and R 2 independently are H, halogen, OR 3 , or alkyl; and R 3 is H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or sugar).
- R 1 and R 2 independently are H, halogen, OR 3 , or alkyl; and R 3 is H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or sugar).
- the acyclic derivative provides greater backbone flexibility without affecting the Watson-Crick pairings.
- the acyclic nucleotide can be linked via 2’-5’ or 3’-5’ linkage.
- the term ‘GNA’ refers to glycol nucleic acid which is a polymer similar to DNA or RNA but differing in the composition of its “backbone” in that is composed of repeating glycerol units linked by phosphodiester bonds: .
- the thermally destabilizing modification of the duplex can be mismatches (i.e., noncomplementary base pairs) between the thermally destabilizing nucleotide and the opposing nucleotide in the opposite strand within the dsRNA duplex.
- Exemplary mismatch base pairs include G:G, G:A, G:U, G:T, A:A, A:C, C:C, C:U, C:T, U:U, T:T, U:T, or a combination thereof.
- mismatch base pairings known in the art are also amenable to the present disclosure.
- a mismatch can occur between nucleotides that are either naturally occurring nucleotides or modified nucleotides, i.e., the mismatch base pairing can occur between the nucleobases from respective nucleotides independent of the modifications on the ribose sugars of the nucleotides.
- the dsRNA molecule contains at least one nucleobase in the mismatch pairing that is a 2’-deoxy nucleobase; e.g., the 2’-deoxy nucleobase is in the sense strand.
- the thermally destabilizing modification of the duplex in the seed region of the antisense strand includes nucleotides with impaired W-C H-bonding to complementary base on the target mRNA, such as:
- thermally destabilizing modifications may also include universal base with reduced or abolished capability to form hydrogen bonds with the opposing bases, and phosphate modifications.
- the thermally destabilizing modification of the duplex includes nucleotides with non-canonical bases such as, but not limited to, nucleobase modifications with impaired or completely abolished capability to form hydrogen bonds with bases in the opposite strand.
- nucleobase modifications have been evaluated for destabilization of the central region of the dsRNA duplex as described in WO 2010/0011895, which is herein incorporated by reference in its entirety.
- Exemplary nucleobase modifications are: .
- the thermally destabilizing modification of the duplex in the seed region of the antisense strand includes one or more ⁇ -nucleotide complementary to the base on the target mRNA, such as: , wherein R is H, OH, OCH 3 , F, NH 2 , NHMe, NMe 2 or O-alkyl.
- the alkyl for the R group can be a C 1 -C 6 alkyl.
- Specific alkyls for the R group include, but are not limited to methyl, ethyl, propyl, isopropyl, butyl, pentyl and hexyl.
- nucleobase modifications can be performed in the various manners as described herein, e.g., to introduce destabilizing modifications into an RNAi agent of the disclosure, e.g., for purpose of enhancing on-target effect relative to off-target effect, the range of modifications available and, in general, present upon RNAi agents of the disclosure tends to be much greater for non-nucleobase modifications, e.g., modifications to sugar groups or phosphate backbones of polyribonucleotides.
- the dsRNA can also comprise one or more stabilizing modifications.
- the dsRNA can comprise at least two (e.g., two, three, four, five, six, seven, eight, nine, ten or more) stabilizing modifications.
- the stabilizing modifications all can be present in one strand.
- both the sense and the antisense strands comprise at least two stabilizing modifications.
- the stabilizing modification can occur on any nucleotide of the sense strand or antisense strand.
- the stabilizing modification can occur on every nucleotide on the sense strand or antisense strand; each stabilizing modification can occur in an alternating pattern on the sense strand or antisense strand; or the sense strand or antisense strand comprises both stabilizing modification in an alternating pattern.
- the alternating pattern of the stabilizing modifications on the sense strand may be the same or different from the antisense strand, and the alternating pattern of the stabilizing modifications on the sense strand can have a shift relative to the alternating pattern of the stabilizing modifications on the antisense strand.
- the antisense strand comprises at least two (e.g., two, three, four, five, six, seven, eight, nine, ten or more) stabilizing modifications.
- a stabilizing modification in the antisense strand can be present at any positions.
- the antisense comprises stabilizing modifications at positions 2, 6, 8, 9, 14, and 16 from the 5’-end.
- the antisense comprises stabilizing modifications at positions 2, 6, 14, and 16 from the 5’-end.
- the antisense comprises stabilizing modifications at positions 2, 14, and 16 from the 5’-end.
- the antisense strand comprises at least one stabilizing modification adjacent to the destabilizing modification.
- the stabilizing modification can be the nucleotide at the 5’-end or the 3’-end of the destabilizing modification, i.e., at position -1 or +1 from the position of the destabilizing modification.
- the antisense strand comprises a stabilizing modification at each of the 5’-end and the 3’-end of the destabilizing modification, i.e., positions -1 and +1 from the position of the destabilizing modification.
- the antisense strand comprises at least two stabilizing modifications at the 3’-end of the destabilizing modification, i.e., at positions +1 and +2 from the position of the destabilizing modification.
- the sense strand comprises at least two (e.g., two, three, four, five, six, seven, eight, nine, ten or more) stabilizing modifications.
- a stabilizing modification in the sense strand can be present at any positions.
- the sense strand comprises stabilizing modifications at positions 7, 10, and 11 from the 5’-end.
- the sense strand comprises stabilizing modifications at positions 7, 9, 10, and 11 from the 5’-end.
- the sense strand comprises stabilizing modifications at positions opposite or complementary to positions 11, 12, and 15 of the antisense strand, counting from the 5’-end of the antisense strand.
- the sense strand comprises stabilizing modifications at positions opposite or complementary to positions 11, 12, 13, and 15 of the antisense strand, counting from the 5’-end of the antisense strand.
- the sense strand comprises a block of two, three, or four stabilizing modifications.
- the sense strand does not comprise a stabilizing modification in position opposite or complementary to the thermally destabilizing modification of the duplex in the antisense strand.
- Exemplary thermally stabilizing modifications include, but are not limited to, 2’-fluoro modifications. Other thermally stabilizing modifications include, but are not limited to, LNA.
- the dsRNA of the disclosure comprises at least four (e.g., four, five, six, seven, eight, nine, ten, or more) 2’-fluoro nucleotides.
- the 2’-fluoro nucleotides all can be present in one strand.
- both the sense and the antisense strands comprise at least two 2’-fluoro nucleotides. The 2’-fluoro modification can occur on any nucleotide of the sense strand or antisense strand.
- the 2’-fluoro modification can occur on every nucleotide on the sense strand or antisense strand; each 2’-fluoro modification can occur in an alternating pattern on the sense strand or antisense strand; or the sense strand or antisense strand comprises both 2’-fluoro modifications in an alternating pattern.
- the alternating pattern of the 2’-fluoro modifications on the sense strand may be the same or different from the antisense strand, and the alternating pattern of the 2’-fluoro modifications on the sense strand can have a shift relative to the alternating pattern of the 2’-fluoro modifications on the antisense strand.
- the antisense strand comprises at least two (e.g., two, three, four, five, six, seven, eight, nine, ten, or more) 2’-fluoro nucleotides.
- a 2’-fluoro modification in the antisense strand can be present at any positions.
- the antisense comprises 2’-fluoro nucleotides at positions 2, 6, 8, 9, 14, and 16 from the 5’-end.
- the antisense comprises 2’-fluoro nucleotides at positions 2, 6, 14, and 16 from the 5’-end.
- the antisense comprises 2’-fluoro nucleotides at positions 2, 14, and 16 from the 5’-end.
- the antisense strand comprises at least one 2’-fluoro nucleotide adjacent to the destabilizing modification.
- the 2’-fluoro nucleotide can be the nucleotide at the 5’-end or the 3’-end of the destabilizing modification, i.e., at position -1 or +1 from the position of the destabilizing modification.
- the antisense strand comprises a 2’-fluoro nucleotide at each of the 5’-end and the 3’-end of the destabilizing modification, i.e., positions -1 and +1 from the position of the destabilizing modification.
- the antisense strand comprises at least two 2’-fluoro nucleotides at the 3’- end of the destabilizing modification, i.e., at positions +1 and +2 from the position of the destabilizing modification.
- the sense strand comprises at least two (e.g., two, three, four, five, six, seven, eight, nine, ten or more) 2’-fluoro nucleotides.
- a 2’-fluoro modification in the sense strand can be present at any positions.
- the antisense comprises 2’-fluoro nucleotides at positions 7, 10, and 11 from the 5’-end.
- the sense strand comprises 2’-fluoro nucleotides at positions 7, 9, 10, and 11 from the 5’-end. In some embodiments, the sense strand comprises 2’-fluoro nucleotides at positions opposite or complementary to positions 11, 12, and 15 of the antisense strand, counting from the 5’-end of the antisense strand. In some other embodiments, the sense strand comprises 2’-fluoro nucleotides at positions opposite or complementary to positions 11, 12, 13, and 15 of the antisense strand, counting from the 5’-end of the antisense strand. In some embodiments, the sense strand comprises a block of two, three or four 2’-fluoro nucleotides.
- the sense strand does not comprise a 2’-fluoro nucleotide in position opposite or complementary to the thermally destabilizing modification of the duplex in the antisense strand.
- the dsRNA molecule of the disclosure comprises a 21 nucleotides (nt) sense strand and a 23 nucleotides (nt) antisense, wherein the antisense strand contains at least one thermally destabilizing nucleotide, where the at least one thermally destabilizing nucleotide occurs in the seed region of the antisense strand (i.e., at position 2-9 of the 5’-end of the antisense strand), wherein one end of the dsRNA is blunt, while the other end is comprises a 2 nt overhang, and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six or all seven) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5 or 6
- the 2 nt overhang is at the 3’-end of the antisense.
- the dsRNA molecule of the disclosure comprising a sense and antisense strands, wherein: the sense strand is 25-30 nucleotide residues in length, wherein starting from the 5' terminal nucleotide (position 1), positions 1 to 23 of said sense strand comprise at least 8 ribonucleotides; antisense strand is 36-66 nucleotide residues in length and, starting from the 3' terminal nucleotide, at least 8 ribonucleotides in the positions paired with positions 1- 23 of sense strand to form a duplex; wherein at least the 3 ' terminal nucleotide of antisense strand is unpaired with sense strand, and up to 6 consecutive 3' terminal nucleotides are unpaired with sense strand, thereby forming a 3' single stranded overhang of 1-6 nucleotides; wherein the 5' terminus of
- the thermally destabilizing nucleotide occurs between positions opposite or complementary to positions 14-17 of the 5’- end of the sense strand, and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six or all seven) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5, or 62’- fluoro modifications; (ii) the antisense comprises 1, 2, 3, 4, or 5 phosphorothioate internucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4, or 52’- fluoro modifications; (v) the sense strand comprises 1, 2, 3, 4, or 5 phosphorothioate internucleotide linkages; and (vi) the dsRNA comprises at least four 2’-fluoro modifications; and (vii) the dsRNA comprises a duplex region of
- the dsRNA molecule of the disclosure comprises a sense and antisense strands, wherein said dsRNA molecule comprises a sense strand having a length which is at least 25 and at most 29 nucleotides and an antisense strand having a length which is at most 30 nucleotides with the sense strand comprises a modified nucleotide that is susceptible to enzymatic degradation at position 11 from the 5’end, wherein the 3’ end of said sense strand and the 5’ end of said antisense strand form a blunt end and said antisense strand is 1-4 nucleotides longer at its 3’ end than the sense strand, wherein the duplex region which is at least 25 nucleotides in length, and said antisense strand is sufficiently complementary to a target mRNA along at least 19 nt of said antisense strand length to reduce target gene expression when said dsRNA molecule is introduced into a mammalian cell, and wherein dicer cleavage of said strand
- the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six or all seven) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5, or 6 2’-fluoro modifications; (ii) the antisense comprises 1, 2, 3, 4, or 5 phosphorothioate internucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4, or 5 2’-fluoro modifications; (v) the sense strand comprises 1, 2, 3, 4, or 5 phosphorothioate internucleotide linkages; and (vi) the dsRNA comprises at least four 2’-fluoro modifications; and (vii) the dsRNA has a duplex region of 12-29 nucleotide pairs in length.
- the antisense comprises 2, 3, 4, 5, or 6 2’-fluoro modifications
- the antisense comprises 1, 2, 3, 4, or 5 phosphorothioate internucleo
- every nucleotide in the sense strand and antisense strand of the dsRNA molecule may be modified.
- Each nucleotide may be modified with the same or different modification which can include one or more alteration of one or both of the non-linking phosphate oxygens or of one or more of the linking phosphate oxygens; alteration of a constituent of the ribose sugar, e.g., of the 2 ⁇ hydroxyl on the ribose sugar; wholesale replacement of the phosphate moiety with “dephospho” linkers; modification or replacement of a naturally occurring base; and replacement or modification of the ribose- phosphate backbone.
- nucleic acids are polymers of subunits
- many of the modifications occur at a position which is repeated within a nucleic acid, e.g., a modification of a base, or a phosphate moiety, or a non-linking O of a phosphate moiety.
- the modification will occur at all of the subject positions in the nucleic acid but in many cases it will not.
- a modification may only occur at a 3’ or 5’ terminal position, may only occur in a terminal region, e.g., at a position on a terminal nucleotide or in the last 2, 3, 4, 5, or 10 nucleotides of a strand.
- a modification may occur in a double strand region, a single strand region, or in both.
- a modification may occur only in the double strand region of an RNA or may only occur in a single strand region of an RNA.
- a phosphorothioate modification at a non-linking O position may only occur at one or both termini, may only occur in a terminal region, e.g., at a position on a terminal nucleotide or in the last 2, 3, 4, 5, or 10 nucleotides of a strand, or may occur in double strand and single strand regions, particularly at termini.
- the 5’ end or ends can be phosphorylated.
- nucleotides or nucleotide surrogates in single strand overhangs, e.g., in a 5’ or 3’ overhang, or in both.
- all or some of the bases in a 3’ or 5’ overhang may be modified, e.g., with a modification described herein.
- Modifications can include, e.g., the use of modifications at the 2’ position of the ribose sugar with modifications that are known in the art, e.g., the use of deoxyribonucleotides, 2’-deoxy-2’- fluoro (2’-F) or 2’-O-methyl modified instead of the ribosugar of the nucleobase, and modifications in the phosphate group, e.g., phosphorothioate modifications. Overhangs need not be homologous with the target sequence.
- each residue of the sense strand and antisense strand is independently modified with locked nucleic acid (LNA), unlocked nucleic acid (UNA), cyclohexene nucleic acid (CeNA), 2’-methoxyethyl, 2’- O-methyl, 2’-O-allyl, 2’-C- allyl, 2’-deoxy, or 2’-fluoro.
- LNA locked nucleic acid
- UNA unlocked nucleic acid
- CeNA cyclohexene nucleic acid
- 2’-methoxyethyl 2’- O-methyl, 2’-O-allyl, 2’-C- allyl, 2’-deoxy, or 2’-fluoro.
- the strands can contain more than one modification.
- each residue of the sense strand and antisense strand is independently modified with 2’-O-methyl or 2’-fluoro. It is to be understood that these modifications are in addition to the at least one thermally destabilizing modification
- the sense strand and antisense strand each comprises two differently modified nucleotides selected from 2’-O-methyl or 2’-deoxy.
- each residue of the sense strand and antisense strand is independently modified with 2'-O-methyl nucleotide, 2’-deoxy nucleotide, 2 ⁇ -deoxy-2’-fluoro nucleotide, 2'-O-N-methylacetamido (2'-O-NMA) nucleotide, a 2'-O-dimethylaminoethoxyethyl (2'-O-DMAEOE) nucleotide, 2'-O-aminopropyl (2'-O-AP) nucleotide, or 2'-ara-F nucleotide.
- the dsRNA molecule of the disclosure comprises modifications of an alternating pattern, particular in the B1, B2, B3, B1’, B2’, B3’, B4’ regions.
- alternating motif or “alternative pattern” as used herein refers to a motif having one or more modifications, each modification occurring on alternating nucleotides of one strand.
- the alternating nucleotide may refer to one per every other nucleotide or one per every three nucleotides, or a similar pattern.
- the alternating motif can be “ABABABABABAB...,” “AABBAABBAABB...,” “AABAABAABAAB...,” “AAABAAABAAAB...,” “AAABBBAAABBB...,” or “ABCABCABCABC...,” etc.
- the type of modifications contained in the alternating motif may be the same or different.
- the alternating pattern i.e., modifications on every other nucleotide
- the alternating pattern may be the same, but each of the sense strand or antisense strand can be selected from several possibilities of modifications within the alternating motif such as “ABABAB...”, “ACACAC...” “BDBDBD...” or “CDCDCD...,” etc.
- the dsRNA molecule of the disclosure comprises the modification pattern for the alternating motif on the sense strand relative to the modification pattern for the alternating motif on the antisense strand is shifted.
- the shift may be such that the modified group of nucleotides of the sense strand corresponds to a differently modified group of nucleotides of the antisense strand and vice versa.
- the sense strand when paired with the antisense strand in the dsRNA duplex the alternating motif in the sense strand may start with “ABABAB” from 5’-3’ of the strand and the alternating motif in the antisense strand may start with “BABABA” from 3’-5’of the strand within the duplex region.
- the alternating motif in the sense strand may start with “AABBAABB” from 5’-3’ of the strand and the alternating motif in the antisense strand may start with “BBAABBAA” from 3’-5’of the strand within the duplex region, so that there is a complete or partial shift of the modification patterns between the sense strand and the antisense strand.
- the dsRNA molecule of the disclosure may further comprise at least one phosphorothioate or methylphosphonate internucleotide linkage.
- the phosphorothioate or methylphosphonate internucleotide linkage modification may occur on any nucleotide of the sense strand or antisense strand or both in any position of the strand.
- the internucleotide linkage modification may occur on every nucleotide on the sense strand or antisense strand; each internucleotide linkage modification may occur in an alternating pattern on the sense strand or antisense strand; or the sense strand or antisense strand comprises both internucleotide linkage modifications in an alternating pattern.
- the alternating pattern of the internucleotide linkage modification on the sense strand may be the same or different from the antisense strand, and the alternating pattern of the internucleotide linkage modification on the sense strand may have a shift relative to the alternating pattern of the internucleotide linkage modification on the antisense strand.
- the dsRNA molecule comprises the phosphorothioate or methylphosphonate internucleotide linkage modification in the overhang region.
- the overhang region comprises two nucleotides having a phosphorothioate or methylphosphonate internucleotide linkage between the two nucleotides.
- Internucleotide linkage modifications also may be made to link the overhang nucleotides with the terminal paired nucleotides within duplex region.
- the overhang nucleotides may be linked through phosphorothioate or methylphosphonate internucleotide linkage, and optionally, there may be additional phosphorothioate or methylphosphonate internucleotide linkages linking the overhang nucleotide with a paired nucleotide that is next to the overhang nucleotide.
- these terminal three nucleotides may be at the 3’-end of the antisense strand.
- the sense strand of the dsRNA molecule comprises 1-10 blocks of two to ten phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 phosphate internucleotide linkages, wherein one of the phosphorothioate or methylphosphonate internucleotide linkages is placed at any position in the oligonucleotide sequence and the said sense strand is paired with an antisense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.
- the antisense strand of the dsRNA molecule comprises two blocks of two phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 phosphate internucleotide linkages, wherein one of the phosphorothioate or methylphosphonate internucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.
- the antisense strand of the dsRNA molecule comprises two blocks of three phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 phosphate internucleotide linkages, wherein one of the phosphorothioate or methylphosphonate internucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.
- the antisense strand of the dsRNA molecule comprises two blocks of four phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 phosphate internucleotide linkages, wherein one of the phosphorothioate or methylphosphonate internucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.
- the antisense strand of the dsRNA molecule comprises two blocks of five phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 phosphate internucleotide linkages, wherein one of the phosphorothioate or methylphosphonate internucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.
- the antisense strand of the dsRNA molecule comprises two blocks of six phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 phosphate internucleotide linkages, wherein one of the phosphorothioate or methylphosphonate internucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.
- the antisense strand of the dsRNA molecule comprises two blocks of seven phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, or 8 phosphate internucleotide linkages, wherein one of the phosphorothioate or methylphosphonate internucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.
- the antisense strand of the dsRNA molecule comprises two blocks of eight phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3, 4, 5, or 6 phosphate internucleotide linkages, wherein one of the phosphorothioate or methylphosphonate internucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.
- the antisense strand of the dsRNA molecule comprises two blocks of nine phosphorothioate or methylphosphonate internucleotide linkages separated by 1, 2, 3, or 4 phosphate internucleotide linkages, wherein one of the phosphorothioate or methylphosphonate internucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.
- the dsRNA molecule of the disclosure further comprises one or more phosphorothioate or methylphosphonate internucleotide linkage modification within 1-10 of the termini position(s) of the sense or antisense strand.
- at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides may be linked through phosphorothioate or methylphosphonate internucleotide linkage at one end or both ends of the sense or antisense strand.
- the dsRNA molecule of the disclosure further comprises one or more phosphorothioate or methylphosphonate internucleotide linkage modification within 1-10 of the internal region of the duplex of each of the sense or antisense strand.
- nucleotides may be linked through phosphorothioate methylphosphonate internucleotide linkage at position 8-16 of the duplex region counting from the 5’-end of the sense strand; the dsRNA molecule can optionally further comprise one or more phosphorothioate or methylphosphonate internucleotide linkage modification within 1-10 of the termini position(s).
- the dsRNA molecule of the disclosure further comprises one to five phosphorothioate or methylphosphonate internucleotide linkage modification(s) within position 1-5 and one to five phosphorothioate or methylphosphonate internucleotide linkage modification(s) within position 18-23 of the sense strand (counting from the 5’-end), and one to five phosphorothioate or methylphosphonate internucleotide linkage modifications at positions 1 and 2 and one to five within positions 18-23 of the antisense strand (counting from the 5’-end).
- the dsRNA molecule of the disclosure further comprises one phosphorothioate internucleotide linkage modification within position 1-5 and one phosphorothioate or methylphosphonate internucleotide linkage modification within position 18-23 of the sense strand (counting from the 5’-end), and one phosphorothioate internucleotide linkage modification at position 1 or 2 and two phosphorothioate or methylphosphonate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end).
- the dsRNA molecule of the disclosure further comprises two phosphorothioate internucleotide linkage modifications within position 1-5 and one phosphorothioate internucleotide linkage modification within position 18-23 of the sense strand (counting from the 5’-end), and one phosphorothioate internucleotide linkage modification at position 1 or 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end).
- the dsRNA molecule of the disclosure further comprises two phosphorothioate internucleotide linkage modifications within position 1-5 and two phosphorothioate internucleotide linkage modifications within position 18-23 of the sense strand (counting from the 5’- end), and one phosphorothioate internucleotide linkage modification at position 1 or 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end).
- the dsRNA molecule of the disclosure further comprises two phosphorothioate internucleotide linkage modifications within position 1-5 and two phosphorothioate internucleotide linkage modifications within position 18-23 of the sense strand (counting from the 5’- end), and one phosphorothioate internucleotide linkage modification at position 1 or 2 and one phosphorothioate internucleotide linkage modification within positions 18-23 of the antisense strand (counting from the 5’-end).
- the dsRNA molecule of the disclosure further comprises one phosphorothioate internucleotide linkage modification within position 1-5 and one phosphorothioate internucleotide linkage modification within position 18-23 of the sense strand (counting from the 5’-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end).
- the dsRNA molecule of the disclosure further comprises one phosphorothioate internucleotide linkage modification within position 1-5 and one within position 18-23 of the sense strand (counting from the 5’-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and one phosphorothioate internucleotide linkage modification within positions 18-23 of the antisense strand (counting from the 5’-end).
- the dsRNA molecule of the disclosure further comprises one phosphorothioate internucleotide linkage modification within position 1-5 (counting from the 5’-end) of the sense strand, and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and one phosphorothioate internucleotide linkage modification within positions 18-23 of the antisense strand (counting from the 5’-end).
- the dsRNA molecule of the disclosure further comprises two phosphorothioate internucleotide linkage modifications within position 1-5 (counting from the 5’-end) of the sense strand, and one phosphorothioate internucleotide linkage modification at position 1 or 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end).
- the dsRNA molecule of the disclosure further comprises two phosphorothioate internucleotide linkage modifications within positions 1-5 and one within positions 18- 23 of the sense strand (counting from the 5’-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and one phosphorothioate internucleotide linkage modification within positions 18-23 of the antisense strand (counting from the 5’-end).
- the dsRNA molecule of the disclosure further comprises two phosphorothioate internucleotide linkage modifications within positions 1-5 and one phosphorothioate internucleotide linkage modification within positions 18-23 of the sense strand (counting from the 5’- end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end).
- the dsRNA molecule of the disclosure further comprises two phosphorothioate internucleotide linkage modifications within positions 1-5 and one phosphorothioate internucleotide linkage modification within positions 18-23 of the sense strand (counting from the 5’- end), and one phosphorothioate internucleotide linkage modification at position 1 or 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end).
- the dsRNA molecule of the disclosure further comprises two phosphorothioate internucleotide linkage modifications at position 1 and 2, and two phosphorothioate internucleotide linkage modifications at positions 20 and 21 of the sense strand (counting from the 5’- end), and one phosphorothioate internucleotide linkage modification at position 1 and one at position 21 of the antisense strand (counting from the 5’-end).
- the dsRNA molecule of the disclosure further comprises one phosphorothioate internucleotide linkage modification at position 1, and one phosphorothioate internucleotide linkage modification at position 21 of the sense strand (counting from the 5’-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications at positions 20 and 21 the antisense strand (counting from the 5’- end).
- the dsRNA molecule of the disclosure further comprises two phosphorothioate internucleotide linkage modifications at position 1 and 2, and two phosphorothioate internucleotide linkage modifications at position 21 and 22 of the sense strand (counting from the 5’-end), and one phosphorothioate internucleotide linkage modification at positions 1 and one phosphorothioate internucleotide linkage modification at position 21 of the antisense strand (counting from the 5’-end).
- the dsRNA molecule of the disclosure further comprises one phosphorothioate internucleotide linkage modification at position 1, and one phosphorothioate internucleotide linkage modification at position 21 of the sense strand (counting from the 5’-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications at positions 21 and 22 the antisense strand (counting from the 5’- end).
- the dsRNA molecule of the disclosure further comprises two phosphorothioate internucleotide linkage modifications at positions 1 and 2, and two phosphorothioate internucleotide linkage modifications at position 22 and 23 of the sense strand (counting from the 5’-end), and one phosphorothioate internucleotide linkage modification at position 1 and one phosphorothioate internucleotide linkage modification at position 21 of the antisense strand (counting from the 5’-end).
- the dsRNA molecule of the disclosure further comprises one phosphorothioate internucleotide linkage modification at position 1, and one phosphorothioate internucleotide linkage modification at position 21 of the sense strand (counting from the 5’-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications at positions 23 and 23 the antisense strand (counting from the 5’- end).
- compound of the disclosure comprises a pattern of backbone chiral centers.
- a common pattern of backbone chiral centers comprises at least 5 internucleotidic linkages in the Sp configuration.
- a common pattern of backbone chiral centers comprises at least 6 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 7 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 8 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 9 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 10 internucleotidic linkages in the Sp configuration.
- a common pattern of backbone chiral centers comprises at least 11 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 12 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 13 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 14 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 15 internucleotidic linkages in the Sp configuration.
- a common pattern of backbone chiral centers comprises at least 16 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 17 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 18 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises at least 19 internucleotidic linkages in the Sp configuration. In some embodiments, a common pattern of backbone chiral centers comprises no more than 8 internucleotidic linkages in the Rp configuration.
- a common pattern of backbone chiral centers comprises no more than 7 internucleotidic linkages in the Rp configuration. In some embodiments, a common pattern of backbone chiral centers comprises no more than 6 internucleotidic linkages in the Rp configuration. In some embodiments, a common pattern of backbone chiral centers comprises no more than 5 internucleotidic linkages in the Rp configuration. In some embodiments, a common pattern of backbone chiral centers comprises no more than 4 internucleotidic linkages in the Rp configuration. In some embodiments, a common pattern of backbone chiral centers comprises no more than 3 internucleotidic linkages in the Rp configuration.
- a common pattern of backbone chiral centers comprises no more than 2 internucleotidic linkages in the Rp configuration. In some embodiments, a common pattern of backbone chiral centers comprises no more than 1 internucleotidic linkages in the Rp configuration. In some embodiments, a common pattern of backbone chiral centers comprises no more than 8 internucleotidic linkages which are not chiral (as a non-limiting example, a phosphodiester). In some embodiments, a common pattern of backbone chiral centers comprises no more than 7 internucleotidic linkages which are not chiral.
- a common pattern of backbone chiral centers comprises no more than 6 internucleotidic linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises no more than 5 internucleotidic linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises no more than 4 internucleotidic linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises no more than 3 internucleotidic linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises no more than 2 internucleotidic linkages which are not chiral.
- a common pattern of backbone chiral centers comprises no more than 1 internucleotidic linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises at least 10 internucleotidic linkages in the Sp configuration, and no more than 8 internucleotidic linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises at least 11 internucleotidic linkages in the Sp configuration, and no more than 7 internucleotidic linkages which are not chiral.
- a common pattern of backbone chiral centers comprises at least 12 internucleotidic linkages in the Sp configuration, and no more than 6 internucleotidic linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises at least 13 internucleotidic linkages in the Sp configuration, and no more than 6 internucleotidic linkages which are not chiral. In some embodiments, a common pattern of backbone chiral centers comprises at least 14 internucleotidic linkages in the Sp configuration, and no more than 5 internucleotidic linkages which are not chiral.
- a common pattern of backbone chiral centers comprises at least 15 internucleotidic linkages in the Sp configuration, and no more than 4 internucleotidic linkages which are not chiral.
- the internucleotidic linkages in the Sp configuration are optionally contiguous or not contiguous.
- the internucleotidic linkages in the Rp configuration are optionally contiguous or not contiguous.
- the internucleotidic linkages which are not chiral are optionally contiguous or not contiguous.
- compound of the disclosure comprises a block is a stereochemistry block.
- a block is an Rp block in that each internucleotidic linkage of the block is Rp.
- a 5’-block is an Rp block.
- a 3’-block is an Rp block.
- a block is an Sp block in that each internucleotidic linkage of the block is Sp.
- a 5’-block is an Sp block.
- a 3’-block is an Sp block.
- provided oligonucleotides comprise both Rp and Sp blocks. In some embodiments, provided oligonucleotides comprise one or more Rp but no Sp blocks.
- provided oligonucleotides comprise one or more Sp but no Rp blocks. In some embodiments, provided oligonucleotides comprise one or more PO blocks wherein each internucleotidic linkage in a natural phosphate linkage. In some embodiments, compound of the disclosure comprises a 5’-block is an Sp block wherein each sugar moiety comprises a 2’-F modification. In some embodiments, a 5’-block is an Sp block wherein each of internucleotidic linkage is a modified internucleotidic linkage and each sugar moiety comprises a 2’-F modification.
- a 5’-block is an Sp block wherein each of internucleotidic linkage is a phosphorothioate linkage and each sugar moiety comprises a 2’-F modification.
- a 5’-block comprises 4 or more nucleoside units.
- a 5’-block comprises 5 or more nucleoside units.
- a 5’-block comprises 6 or more nucleoside units.
- a 5’-block comprises 7 or more nucleoside units.
- a 3’-block is an Sp block wherein each sugar moiety comprises a 2’-F modification.
- a 3’-block is an Sp block wherein each of internucleotidic linkage is a modified internucleotidic linkage and each sugar moiety comprises a 2’-F modification. In some embodiments, a 3’-block is an Sp block wherein each of internucleotidic linkage is a phosphorothioate linkage and each sugar moiety comprises a 2’-F modification. In some embodiments, a 3’-block comprises 4 or more nucleoside units. In some embodiments, a 3’-block comprises 5 or more nucleoside units. In some embodiments, a 3’-block comprises 6 or more nucleoside units.
- a 3’-block comprises 7 or more nucleoside units.
- compound of the disclosure comprises a type of nucleoside in a region or an oligonucleotide is followed by a specific type of internucleotidic linkage, e.g., natural phosphate linkage, modified internucleotidic linkage, Rp chiral internucleotidic linkage, Sp chiral internucleotidic linkage, etc.
- A is followed by Sp.
- A is followed by Rp.
- A is followed by natural phosphate linkage (PO).
- U is followed by Sp.
- U is followed by Rp.
- U is followed by natural phosphate linkage (PO).
- C is followed by Sp.
- C is followed by Rp.
- C is followed by natural phosphate linkage (PO).
- G is followed by Sp.
- G is followed by Rp.
- G is followed by natural phosphate linkage (PO).
- C and U are followed by Sp.
- C and U are followed by Rp.
- C and U are followed by natural phosphate linkage (PO).
- a and G are followed by Sp.
- a and G are followed by Rp.
- the antisense strand comprises phosphorothioate internucleotide linkages between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23, wherein the antisense strand contains at least one thermally destabilizing modification of the duplex located in the seed region of the antisense strand (i.e., at position 2-9 of the 5’-end of the antisense strand), and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six, seven or all eight) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5 or 6 2’-fluoro modifications; (ii) the antisense comprises 3, 4 or 5 phosphorothioate internucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4 or 52’-fluoro modifications; (v) the sense strand comprises 1, 2, 3, 4 or 5
- the antisense strand comprises phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23, wherein the antisense strand contains at least one thermally destabilizing modification of the duplex located in the seed region of the antisense strand (i.e., at position 2-9 of the 5’-end of the antisense strand), and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six, seven or all eight) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5 or 6 2’-fluoro modifications; (ii) the sense strand is conjugated with a ligand; (iii) the sense strand comprises 2, 3, 4 or 52’-fluoro modifications; (iv) the sense strand comprises 1, 2, 3, 4 or 5 phosphorothioate internu
- the sense strand comprises phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3, wherein the antisense strand contains at least one thermally destabilizing modification of the duplex located in the seed region of the antisense strand (i.e., at position 2-9 of the 5’-end of the antisense strand), and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six, seven or all eight) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5 or 6 2’-fluoro modifications; (ii) the antisense comprises 1, 2, 3, 4 or 5 phosphorothioate internucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4 or 5 2’-fluoro modifications; (v) the sense strand comprises 3, 4 or 5 phospho
- the sense strand comprises phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3, the antisense strand comprises phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23, wherein the antisense strand contains at least one thermally destabilizing modification of the duplex located in the seed region of the antisense strand (i.e., at position 2-9 of the 5’-end of the antisense strand), and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six or all seven) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5 or 6 2’-fluoro modifications; (ii) the sense strand is conjugated with a ligand; (iii) the sense
- the dsRNA molecule of the disclosure comprises mismatch(es) with the target, within the duplex, or combinations thereof.
- the mismatch can occur in the overhang region or the duplex region.
- the base pair can be ranked on the basis of their propensity to promote dissociation or melting (e.g., on the free energy of association or dissociation of a particular pairing, the simplest approach is to examine the pairs on an individual pair basis, though next neighbor or similar analysis can also be used).
- A:U is preferred over G:C
- G:U is preferred over G:C
- Mismatches e.g., non-canonical or other than canonical pairings (as described elsewhere herein) are preferred over canonical (A:T, A:U, G:C) pairings; and pairings which include a universal base are preferred over canonical pairings.
- the dsRNA molecule of the disclosure comprises at least one of the first 1, 2, 3, 4, or 5 base pairs within the duplex regions from the 5’- end of the antisense strand can be chosen independently from the group of: A:U, G:U, I:C, and mismatched pairs, e.g., non-canonical or other than canonical pairings or pairings which include a universal base, to promote the dissociation of the antisense strand at the 5’-end of the duplex.
- the nucleotide at the 1 position within the duplex region from the 5’-end in the antisense strand is selected from the group consisting of A, dA, dU, U, and dT.
- At least one of the first 1, 2 or 3 base pair within the duplex region from the 5’- end of the antisense strand is an AU base pair.
- the first base pair within the duplex region from the 5’- end of the antisense strand is an AU base pair.
- the introduction of a 4’-modified or a 5’-modified nucleotide to the 3’-end of a PO, PS, or PS2 linkage of a dinucleotide modifies the second nucleotide in the dinucleotide pair.
- the introduction of a 4’- modified or a 5’-modified nucleotide to the 3’-end of a PO, PS, or PS2 linkage of a dinucleotide modifies the nucleotide at the 3’-end of the dinucleotide pair.
- 5’-modified nucleotide is introduced at the 3’-end of a dinucleotide at any position of single stranded or double stranded siRNA.
- a 5’-alkylated nucleoside may be introduced at the 3’-end of a dinucleotide at any position of single stranded or double stranded siRNA.
- the alkyl group at the 5’ position of the ribose sugar can be racemic or chirally pure R or S isomer.
- An exemplary 5’-alkylated nucleotide is 5’-methyl nucleoside. The 5’-methyl can be either racemic or chirally pure R or S isomer.
- 4’-modified nucleotide is introduced at the 3’-end of a dinucleotide at any position of single stranded or double stranded siRNA.
- a 4’-alkylated nucleoside may be introduced at the 3’-end of a dinucleotide at any position of single stranded or double stranded siRNA.
- the alkyl group at the 4’ position of the ribose sugar can be racemic or chirally pure R or S isomer.
- An exemplary 4’-alkylated nucleotide is 4’-methyl nucleoside. The 4’-methyl can be either racemic or chirally pure R or S isomer.
- a 4’-O-alkylated nucleoside may be introduced at the 3’-end of a dinucleotide at any position of single stranded or double stranded siRNA.
- the 4’-O-alkyl of the ribose sugar can be racemic or chirally pure R or S isomer.
- An exemplary 4’-O-alkylated nucleotide is 4’-O- methyl nucleoside.
- the 4’-O-methyl can be either racemic or chirally pure R or S isomer.
- 5’-alkylated nucleotide is introduced at any position on the sense strand or antisense strand of a dsRNA, and such modification maintains or improves potency of the dsRNA.
- the 5’-alkyl can be either racemic or chirally pure R or S isomer.
- An exemplary 5’-alkylated nucleotide is 5’- methyl nucleoside.
- the 5’-methyl can be either racemic or chirally pure R or S isomer.
- 4’-alkylated nucleotide is introduced at any position on the sense strand or antisense strand of a dsRNA, and such modification maintains or improves potency of the dsRNA.
- the 4’-alkyl can be either racemic or chirally pure R or S isomer.
- An exemplary 4’-alkylated nucleotide is 4’- methyl nucleoside.
- the 4’-methyl can be either racemic or chirally pure R or S isomer.
- 4’-O-alkylated nucleotide is introduced at any position on the sense strand or antisense strand of a dsRNA, and such modification maintains or improves potency of the dsRNA.
- the 5’-alkyl can be either racemic or chirally pure R or S isomer.
- An exemplary 4’-O-alkylated nucleotide is 4’-O-methyl nucleoside.
- the 4’-O-methyl can be either racemic or chirally pure R or S isomer.
- the 2’-5’ linkages modifications can be used to promote nuclease resistance or to inhibit binding of the sense to the antisense strand, or can be used at the 5’ end of the sense strand to avoid sense strand activation by RISC.
- the dsRNA molecule of the disclosure can comprise L sugars (e.g., L ribose, L-arabinose with 2’-H, 2’-OH and 2’-OMe).
- these L sugars modifications can be used to promote nuclease resistance or to inhibit binding of the sense to the antisense strand, or can be used at the 5’ end of the sense strand to avoid sense strand activation by RISC.
- Various publications describe multimeric siRNA which can all be used with the dsRNA of the disclosure. Such publications include WO2007/091269, US 7858769, WO2010/141511, WO2007/117686, WO2009/014887, and WO2011/031520 which are hereby incorporated by their entirely.
- the RNAi agent that contains conjugations of one or more carbohydrate moieties to an RNAi agent can optimize one or more properties of the RNAi agent.
- the carbohydrate moiety will be attached to a modified subunit of the RNAi agent.
- the ribose sugar of one or more ribonucleotide subunits of a dsRNA agent can be replaced with another moiety, e.g., a non-carbohydrate (preferably cyclic) carrier to which is attached a carbohydrate ligand.
- a ribonucleotide subunit in which the ribose sugar of the subunit has been so replaced is referred to herein as a ribose replacement modification subunit (RRMS).
- RRMS ribose replacement modification subunit
- a cyclic carrier may be a carbocyclic ring system, i.e., all ring atoms are carbon atoms, or a heterocyclic ring system, i.e., one or more ring atoms may be a heteroatom, e.g., nitrogen, oxygen, sulfur.
- the cyclic carrier may be a monocyclic ring system, or may contain two or more rings, e.g. fused rings.
- the cyclic carrier may be a fully saturated ring system, or it may contain one or more double bonds.
- the ligand may be attached to the polynucleotide via a carrier.
- the carriers include (i) at least one “backbone attachment point,” preferably two “backbone attachment points” and (ii) at least one “tethering attachment point.”
- a “backbone attachment point” as used herein refers to a functional group, e.g. a hydroxyl group, or generally, a bond available for, and that is suitable for incorporation of the carrier into the backbone, e.g., the phosphate, or modified phosphate, e.g., sulfur containing, backbone, of a ribonucleic acid.
- a “tethering attachment point” in some embodiments refers to a constituent ring atom of the cyclic carrier, e.g., a carbon atom or a heteroatom (distinct from an atom which provides a backbone attachment point), that connects a selected moiety.
- the moiety can be, e.g., a carbohydrate, e.g. monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide and polysaccharide.
- the selected moiety is connected by an intervening tether to the cyclic carrier.
- the cyclic carrier will often include a functional group, e.g., an amino group, or generally, provide a bond, that is suitable for incorporation or tethering of another chemical entity, e.g., a ligand to the constituent ring.
- a functional group e.g., an amino group
- another chemical entity e.g., a ligand to the constituent ring.
- RNAi agents may be conjugated to a ligand via a carrier, wherein the carrier can be cyclic group or acyclic group; preferably, the cyclic group is selected from pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1,3]dioxolane, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuryl and and decalin; preferably, the acyclic group is selected from serinol backbone or diethanolamine backbone.
- the RNAi agent for use in the methods of the disclosure is an agent selected from the group of agents listed in any one of Tables 2-5, 7, or 8. These agents may further comprise a ligand.
- IV. iRNAs Conjugated to Ligands Another modification of the RNA of an iRNA of the disclosure involves chemically linking to the iRNA one or more ligands, moieties or conjugates that enhance the activity, cellular distribution or cellular uptake of the iRNA, e.g., into a cell.
- moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acid. Sci.
- Acids Res., 1990, 18:3777-3783 a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229-237), or an octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke et al., J. Pharmacol. Exp.
- a ligand alters the distribution, targeting or lifetime of an iRNA agent into which it is incorporated.
- a ligand provides an enhanced affinity for a selected target, e.g., molecule, cell or cell type, compartment, e.g., a cellular or organ compartment, tissue, organ or region of the body, as, e.g., compared to a species absent such a ligand.
- Typical ligands will not take part in duplex pairing in a duplexed nucleic acid.
- Ligands can include a naturally occurring substance, such as a protein (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulin); carbohydrate (e.g., a dextran, pullulan, chitin, chitosan, inulin, cyclodextrin or hyaluronic acid); or a lipid.
- the ligand may also be a recombinant or synthetic molecule, such as a synthetic polymer, e.g., a synthetic polyamino acid.
- polyamino acids examples include polyamino acid is a polylysine (PLL), poly L-aspartic acid, poly L-glutamic acid, styrene-maleic acid anhydride copolymer, poly(L-lactide-co-glycolied) copolymer, divinyl ether- maleic anhydride copolymer, N-(2-hydroxypropyl) methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly (2-ethylacryllic acid), N-isopropylacrylamide polymers, or polyphosphazine.
- PLL polylysine
- poly L-aspartic acid poly L-glutamic acid
- styrene-maleic acid anhydride copolymer poly(L-lactide-co-glycolied) copolymer
- divinyl ether-maleic anhydride copolymer divinyl ether-
- polyamines include: polyethylenimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipid, cationic porphyrin, quaternary salt of a polyamine, or an ⁇ helical peptide.
- Ligands can also include targeting groups, e.g., a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody, that binds to a specified cell type such as a kidney cell.
- a targeting group can be a thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, Mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin B12, biotin, or an RGD peptide or RGD peptide mimetic.
- the ligand is a multivalent galactose, e.g., an N-acetyl-galactosamine.
- ligands include dyes, intercalating agents (e.g. acridines), cross-linkers (e.g. psoralene, mitomycin C), porphyrins (TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g.
- EDTA lipophilic molecules, e.g., cholesterol, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-Bis- O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid,O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine)and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG] 2 , polyamino, alkyl,
- Biotin can be proteins, e.g., glycoproteins, or peptides, e.g., molecules having a specific affinity for a co-ligand, or antibodies e.g., an antibody, that binds to a specified cell type such as a cancer cell, endothelial cell, or bone cell.
- transport/absorption facilitators e.g., aspirin, vitamin E, folic acid
- synthetic ribonucleases e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ complexes of tetraazamacrocycles
- dinitrophenyl HRP
- Ligands can be proteins, e.g., glycoproteins, or peptides, e.g., molecules having a specific affinity for a co-ligand, or antibodies e.g., an antibody, that binds to a specified cell type such as
- Ligands may also include hormones and hormone receptors. They can also include non-peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine multivalent mannose, or multivalent fucose.
- the ligand can be, for example, a lipopolysaccharide, an activator of p38 MAP kinase, or an activator of NF- ⁇ B.
- the ligand can be a substance, e.g., a drug, which can increase the uptake of the iRNA agent into the cell, for example, by disrupting the cell’s cytoskeleton, e.g., by disrupting the cell’s microtubules, microfilaments, or intermediate filaments.
- the drug can be, for example, taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin.
- a ligand attached to an iRNA as described herein acts as a pharmacokinetic modulator (PK modulator).
- PK modulator pharmacokinetic modulator
- PK modulators include lipophiles, bile acids, steroids, phospholipid analogues, peptides, protein binding agents, PEG, vitamins etc.
- exemplary PK modulators include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglyceride, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin etc.
- Oligonucleotides that comprise a number of phosphorothioate linkages are also known to bind to serum protein, thus short oligonucleotides, e.g., oligonucleotides of about 5 bases, 10 bases, 15 bases or 20 bases, comprising multiple of phosphorothioate linkages in the backbone are also amenable to the present disclosure as ligands (e.g. as PK modulating ligands).
- ligands e.g. as PK modulating ligands
- aptamers that bind serum components are also suitable for use as PK modulating ligands in the embodiments described herein.
- Ligand-conjugated iRNAs of the disclosure may be synthesized by the use of an oligonucleotide that bears a pendant reactive functionality, such as that derived from the attachment of a linking molecule onto the oligonucleotide (described below).
- This reactive oligonucleotide may be reacted directly with commercially-available ligands, ligands that are synthesized bearing any of a variety of protecting groups, or ligands that have a linking moiety attached thereto.
- the oligonucleotides used in the conjugates of the present disclosure may be conveniently and routinely made through the well-known technique of solid-phase synthesis.
- the oligonucleotides and oligonucleosides may be assembled on a suitable DNA synthesizer utilizing standard nucleotide or nucleoside precursors, or nucleotide or nucleoside conjugate precursors that already bear the linking moiety, ligand-nucleotide or nucleoside- conjugate precursors that already bear the ligand molecule, or non-nucleoside ligand-bearing building blocks.
- the oligonucleotides or linked nucleosides of the present disclosure are synthesized by an automated synthesizer using phosphoramidites derived from ligand-nucleoside conjugates in addition to the standard phosphoramidites and non-standard phosphoramidites that are commercially available and routinely used in oligonucleotide synthesis.
- the ligand or conjugate is a lipid or lipid-based molecule.
- a lipid or lipid-based molecule can typically bind a serum protein, such as human serum albumin (HSA).
- HSA human serum albumin
- An HSA binding ligand allows for distribution of the conjugate to a target tissue, e.g., a non-kidney target tissue of the body.
- the target tissue can be the liver, including parenchymal cells of the liver.
- Other molecules that can bind HSA can also be used as ligands. For example, naproxen or aspirin can be used.
- a lipid or lipid-based ligand can (a) increase resistance to degradation of the conjugate, (b) increase targeting or transport into a target cell or cell membrane, or (c) can be used to adjust binding to a serum protein, e.g., HSA.
- a lipid-based ligand can be used to modulate, e.g., control (e.g., inhibit) the binding of the conjugate to a target tissue.
- a lipid or lipid-based ligand that binds to HSA more strongly will be less likely to be targeted to the kidney and therefore less likely to be cleared from the body.
- a lipid or lipid-based ligand that binds to HSA less strongly can be used to target the conjugate to the kidney.
- the lipid-based ligand binds HSA.
- the ligand can bind HSA with a sufficient affinity such that distribution of the conjugate to a non-kidney tissue is enhanced.
- the affinity is typically not so strong that the HSA-ligand binding cannot be reversed.
- the lipid-based ligand binds HSA weakly or not at all, such that distribution of the conjugate to the kidney is enhanced.
- Other moieties that target to kidney cells can also be used in place of or in addition to the lipid-based ligand.
- the ligand is a moiety, e.g., a vitamin, which is taken up by a target cell, e.g., a proliferating cell.
- exemplary vitamins include vitamin A, E, and K.
- Other exemplary vitamins include are B vitamin, e.g., folic acid, B12, riboflavin, biotin, pyridoxal or other vitamins or nutrients taken up by cancer cells.
- B. Cell Permeation Agents In another aspect, the ligand is a cell-permeation agent, such as a helical cell-permeation agent. In certain embodiments, the agent is amphipathic.
- An exemplary agent is a peptide such as tat or antennopedia.
- the agent is a peptide, it can be modified, including a peptidylmimetic, invertomers, non- peptide or pseudo-peptide linkages, and use of D-amino acids.
- the helical agent is typically an ⁇ -helical agent and can have a lipophilic and a lipophobic phase.
- the ligand can be a peptide or peptidomimetic.
- a peptidomimetic (also referred to herein as an oligopeptidomimetic) is a molecule capable of folding into a defined three-dimensional structure similar to a natural peptide.
- the attachment of peptide and peptidomimetics to iRNA agents can affect pharmacokinetic distribution of the iRNA, such as by enhancing cellular recognition and absorption.
- the peptide or peptidomimetic moiety can be about 5-50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long.
- a peptide or peptidomimetic can be, for example, a cell permeation peptide, cationic peptide, amphipathic peptide, or hydrophobic peptide (e.g., consisting primarily of Tyr, Trp, or Phe).
- the peptide moiety can be a dendrimer peptide, constrained peptide or crosslinked peptide.
- the peptide moiety can include a hydrophobic membrane translocation sequence (MTS).
- An exemplary hydrophobic MTS-containing peptide is RFGF having the amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO: 14.
- An RFGF analogue e.g., amino acid sequence AALLPVLLAAP (SEQ ID NO: 15)
- the peptide moiety can be a “delivery” peptide, which can carry large polar molecules including peptides, oligonucleotides, and protein across cell membranes.
- sequences from the HIV Tat protein (GRKKRRQRRRPPQ (SEQ ID NO: 16)
- the Drosophila Antennapedia protein RQIKIWFQNRRMKWKK (SEQ ID NO: 17)
- a peptide or peptidomimetic can be encoded by a random sequence of DNA, such as a peptide identified from a phage-display library, or one-bead-one-compound (OBOC) combinatorial library (Lam et al., Nature, 354:82-84, 1991).
- the peptide or peptidomimetic tethered to a dsRNA agent via an incorporated monomer unit is a cell targeting peptide such as an arginine-glycine-aspartic acid (RGD)- peptide, or RGD mimic.
- RGD arginine-glycine-aspartic acid
- a peptide moiety can range in length from about 5 amino acids to about 40 amino acids.
- the peptide moieties can have a structural modification, such as to increase stability or direct conformational properties. Any of the structural modifications described below can be utilized.
- An RGD peptide for use in the compositions and methods of the disclosure may be linear or cyclic, and may be modified, e.g., glycosylated or methylated, to facilitate targeting to a specific tissue(s).
- RGD-containing peptides and peptidiomimemtics may include D-amino acids, as well as synthetic RGD mimics.
- RGD one can use other moieties that target the integrin ligand. Preferred conjugates of this ligand target PECAM-1 or VEGF.
- An RGD peptide moiety can be used to target a particular cell type, e.g., a tumor cell, such as an endothelial tumor cell or a breast cancer tumor cell (Zitzmann et al., Cancer Res., 62:5139-43, 2002).
- An RGD peptide can facilitate targeting of an dsRNA agent to tumors of a variety of other tissues, including the lung, kidney, spleen, or liver (Aoki et al., Cancer Gene Therapy 8:783-787, 2001).
- the RGD peptide will facilitate targeting of an iRNA agent to the kidney.
- the RGD peptide can be linear or cyclic, and can be modified, e.g., glycosylated or methylated to facilitate targeting to specific tissues.
- a glycosylated RGD peptide can deliver an iRNA agent to a tumor cell expressing ⁇ V ß 3 (Haubner et al., Jour. Nucl. Med., 42:326-336, 2001).
- a “cell permeation peptide” is capable of permeating a cell, e.g., a microbial cell, such as a bacterial or fungal cell, or a mammalian cell, such as a human cell.
- a microbial cell-permeating peptide can be, for example, an ⁇ -helical linear peptide (e.g., LL-37 or Ceropin P1), a disulfide bond-containing peptide (e.g., ⁇ -defensin, ⁇ -defensin or bactenecin), or a peptide containing only one or two dominating amino acids (e.g., PR-39 or indolicidin).
- a cell permeation peptide can also include a nuclear localization signal (NLS).
- a cell permeation peptide can be a bipartite amphipathic peptide, such as MPG, which is derived from the fusion peptide domain of HIV-1 gp41 and the NLS of SV40 large T antigen (Simeoni et al., Nucl. Acids Res.31:2717-2724, 2003).
- MPG nuclear localization signal
- C. Carbohydrate Conjugates In some embodiments of the compositions and methods of the disclosure, an iRNA further comprises a carbohydrate.
- carbohydrate conjugated iRNA are advantageous for the in vivo delivery of nucleic acids, as well as compositions suitable for in vivo therapeutic use, as described herein.
- “carbohydrate” refers to a compound which is either a carbohydrate per se made up of one or more monosaccharide units having at least 6 carbon atoms (which can be linear, branched or cyclic) with an oxygen, nitrogen or sulfur atom bonded to each carbon atom; or a compound having as a part thereof a carbohydrate moiety made up of one or more monosaccharide units each having at least six carbon atoms (which can be linear, branched or cyclic), with an oxygen, nitrogen or sulfur atom bonded to each carbon atom.
- Representative carbohydrates include the sugars (mono-, di-, tri- and oligosaccharides containing from about 4, 5, 6, 7, 8, or 9 monosaccharide units), and polysaccharides such as starches, glycogen, cellulose and polysaccharide gums.
- Specific monosaccharides include C5 and above (e.g., C5, C6, C7, or C8) sugars; di- and tri-saccharides include sugars having two or three monosaccharide units (e.g., C5, C6, C7, or C8).
- a carbohydrate conjugate comprises a monosaccharide.
- the monosaccharide is an N-acetylgalactosamine (GalNAc).
- GalNAc conjugates which comprise one or more N-acetylgalactosamine (GalNAc) derivatives, are described, for example, in US 8,106,022, the entire content of which is hereby incorporated herein by reference.
- the GalNAc conjugate serves as a ligand that targets the iRNA to particular cells.
- the GalNAc conjugate targets the iRNA to liver cells, e.g., by serving as a ligand for the asialoglycoprotein receptor of liver cells (e.g., hepatocytes).
- the carbohydrate conjugate comprises one or more GalNAc derivatives.
- the GalNAc derivatives may be attached via a linker, e.g., a bivalent or trivalent branched linker.
- the GalNAc conjugate is conjugated to the 3’ end of the sense strand.
- the GalNAc conjugate is conjugated to the iRNA agent (e.g., to the 3’ end of the sense strand) via a linker, e.g., a linker as described herein.
- the GalNAc conjugate is conjugated to the 5’ end of the sense strand.
- the GalNAc conjugate is conjugated to the iRNA agent (e.g., to the 5’ end of the sense strand) via a linker, e.g., a linker as described herein.
- the GalNAc or GalNAc derivative is attached to an iRNA agent of the disclosure via a monovalent linker.
- the GalNAc or GalNAc derivative is attached to an iRNA agent of the disclosure via a bivalent linker.
- the GalNAc or GalNAc derivative is attached to an iRNA agent of the disclosure via a trivalent linker.
- the GalNAc or GalNAc derivative is attached to an iRNA agent of the disclosure via a tetravalent linker.
- the double stranded RNAi agents of the disclosure comprise one GalNAc or GalNAc derivative attached to the iRNA agent.
- the double stranded RNAi agents of the disclosure comprise a plurality (e.g., 2, 3, 4, 5, or 6) GalNAc or GalNAc derivatives, each independently attached to a plurality of nucleotides of the double stranded RNAi agent through a plurality of monovalent linkers.
- each unpaired nucleotide within the hairpin loop may independently comprise a GalNAc or GalNAc derivative attached via a monovalent linker.
- the hairpin loop may also be formed by an extended overhang in one strand of the duplex.
- each unpaired nucleotide within the hairpin loop may independently comprise a GalNAc or GalNAc derivative attached via a monovalent linker.
- the hairpin loop may also be formed by an extended overhang in one strand of the duplex.
- the GalNAc conjugate is In some embodiments, the RNAi agent is attached to the carbohydrate conjugate via a linker as shown in the following schematic, wherein X is O or S . In some embodiments, the RNAi agent is conjugated to L96 as defined in Table 2 and shown below:
- a carbohydrate conjugate for use in the compositions and methods of the disclosure is selected from the group consisting of:
- a carbohydrate conjugate for use in the compositions and methods of the disclosure is a monosaccharide.
- the monosaccharide is an N- acetylgalactosamine, such as Another representative carbohydrate conjugate for use in the embodiments described herein includes, but is not limited to, , when one of X or Y is an oligonucleotide, the other is a hydrogen.
- a suitable ligand is a ligand disclosed in WO 2019/055633, the entire contents of which are incorporated herein by reference.
- the ligand comprises the structure below:
- the RNAi agents of the disclosure may include GalNAc ligands, even if such GalNAc ligands are currently projected to be of limited value for the preferred intrathecal/CNS delivery route(s) of the instant disclosure.
- the GalNAc or GalNAc derivative is attached to an iRNA agent of the disclosure via a monovalent linker.
- the GalNAc or GalNAc derivative is attached to an iRNA agent of the disclosure via a bivalent linker.
- the GalNAc or GalNAc derivative is attached to an iRNA agent of the disclosure via a trivalent linker.
- the double stranded RNAi agents of the disclosure comprise one or more GalNAc or GalNAc derivative attached to the iRNA agent.
- the GalNAc may be attached to any nucleotide via a linker on the sense strand or antsisense strand.
- the GalNac may be attached to the 5’-end of the sense strand, the 3’ end of the sense strand, the 5’-end of the antisense strand, or the 3’ –end of the antisense strand.
- the GalNAc is attached to the 3’ end of the sense strand, e.g., via a trivalent linker.
- the double stranded RNAi agents of the disclosure comprise a plurality (e.g., 2, 3, 4, 5, or 6) GalNAc or GalNAc derivatives, each independently attached to a plurality of nucleotides of the double stranded RNAi agent through a plurality of linkers, e.g., monovalent linkers.
- each unpaired nucleotide within the hairpin loop may independently comprise a GalNAc or GalNAc derivative attached via a monovalent linker.
- the carbohydrate conjugate further comprises one or more additional ligands as described above, such as, but not limited to, a PK modulator or a cell permeation peptide.
- linkers suitable for use in the present disclosure include those described in WO 2014/179620 and WO 2014/179627, the entire contents of each of which are incorporated herein by reference.
- the conjugate or ligand described herein can be attached to an iRNA oligonucleotide with various linkers that can be cleavable or non-cleavable.
- linker or “linking group” means an organic moiety that connects two parts of a compound, e.g., covalently attaches two parts of a compound.
- Linkers typically comprise a direct bond or an atom such as oxygen or sulfur, a unit such as NR8, C(O), C(O)NH, SO, SO 2 , SO 2 NH or a chain of atoms, such as, but not limited to, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl, alkylarylalkenyl, alkylarylalkynyl, alkenylarylalkyl, alkenylarylalkenyl,
- the linker is between about 1-24 atoms, 2-24, 3-24, 4-24, 5-24, 6-24, 6-18, 7-18, 8-18 atoms, 7-17, 8-17, 6-16, 7-16, or 8-16 atoms.
- a cleavable linking group is one which is sufficiently stable outside the cell, but which upon entry into a target cell is cleaved to release the two parts the linker is holding together.
- the cleavable linking group is cleaved at least about 10 times, 20, times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times or more, or at least about 100 times faster in a target cell or under a first reference condition (which can, e.g., be selected to mimic or represent intracellular conditions) than in the blood of a subject, or under a second reference condition (which can, e.g., be selected to mimic or represent conditions found in the blood or serum).
- Cleavable linking groups are susceptible to cleavage agents, e.g., pH, redox potential or the presence of degradative molecules.
- cleavage agents are more prevalent or found at higher levels or activities inside cells than in serum or blood.
- degradative agents include: redox agents which are selected for particular substrates or which have no substrate specificity, including, e.g., oxidative or reductive enzymes or reductive agents such as mercaptans, present in cells, that can degrade a redox cleavable linking group by reduction; esterases; endosomes or agents that can create an acidic environment, e.g., those that result in a pH of five or lower; enzymes that can hydrolyze or degrade an acid cleavable linking group by acting as a general acid, peptidases (which can be substrate specific), and phosphatases.
- redox agents which are selected for particular substrates or which have no substrate specificity, including, e.g., oxidative or reductive enzymes or reductive agents such as mercaptans, present in cells, that can degrade a redox cleavable linking group
- a cleavable linkage group such as a disulfide bond can be susceptible to pH.
- the pH of human serum is 7.4, while the average intracellular pH is slightly lower, ranging from about 7.1-7.3. Endosomes have a more acidic pH, in the range of 5.5-6.0, and lysosomes have an even more acidic pH at around 5.0.
- Some linkers will have a cleavable linking group that is cleaved at a preferred pH, thereby releasing a cationic lipid from the ligand inside the cell, or into the desired compartment of the cell.
- a linker can include a cleavable linking group that is cleavable by a particular enzyme.
- cleavable linking group incorporated into a linker can depend on the cell to be targeted.
- a liver-targeting ligand can be linked to a cationic lipid through a linker that includes an ester group.
- Liver cells are rich in esterases, and therefore the linker will be cleaved more efficiently in liver cells than in cell types that are not esterase-rich.
- Other cell-types rich in esterases include cells of the lung, renal cortex, and testis.
- Linkers that contain peptide bonds can be used when targeting cell types rich in peptidases, such as liver cells and synoviocytes.
- the suitability of a candidate cleavable linking group can be evaluated by testing the ability of a degradative agent (or condition) to cleave the candidate linking group. It will also be desirable to also test the candidate cleavable linking group for the ability to resist cleavage in the blood or when in contact with other non-target tissue.
- a degradative agent or condition
- the candidate cleavable linking group for the ability to resist cleavage in the blood or when in contact with other non-target tissue.
- the evaluations can be carried out in cell free systems, in cells, in cell culture, in organ or tissue culture, or in whole animals.
- useful candidate compounds are cleaved at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood or serum (or under in vitro conditions selected to mimic extracellular conditions).
- a cleavable linking group is a redox cleavable linking group that is cleaved upon reduction or oxidation.
- An example of reductively cleavable linking group is a disulphide linking group (-S-S-).
- a candidate cleavable linking group is a suitable “reductively cleavable linking group,” or for example is suitable for use with a particular iRNA moiety and particular targeting agent
- a candidate can be evaluated by incubation with dithiothreitol (DTT), or other reducing agent using reagents know in the art, which mimic the rate of cleavage which would be observed in a cell, e.g., a target cell.
- DTT dithiothreitol
- the candidates can also be evaluated under conditions which are selected to mimic blood or serum conditions. In one, candidate compounds are cleaved by at most about 10% in the blood.
- useful candidate compounds are degraded at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood (or under in vitro conditions selected to mimic extracellular conditions).
- the rate of cleavage of candidate compounds can be determined using standard enzyme kinetics assays under conditions chosen to mimic intracellular media and compared to conditions chosen to mimic extracellular media.
- Phosphate-based cleavable linking groups In certain embodiments, a cleavable linker comprises a phosphate-based cleavable linking group.
- a phosphate-based cleavable linking group is cleaved by agents that degrade or hydrolyze the phosphate group.
- An example of an agent that cleaves phosphate groups in cells are enzymes such as phosphatases in cells.
- Examples of phosphate-based linking groups are -O-P(O)(ORk)-O-, -O-P(S)(ORk)-O-, -O- P(S)(SRk)-O-, -S-P(O)(ORk)-O-, -O-P(O)(ORk)-S-, -O-P(O)(ORk)-S-, -O-P(O)(ORk)-S-, -O-P(S)(ORk)-S-, -S-P(S)(ORk)- O-, -O-P(O)(Rk)-O-, -O-P(S)(Rk)-O-, -S
- Preferred embodiments are -O-P(O)(OH)-O-, -O-P(S)(OH)-O-, -O-P(S)(SH)-O-, -S-P(O)(OH)-O-, -O- P(O)(OH)-S-, -S-P(O)(OH)-S-, -O-P(S)(OH)-S-, -S-P(S)(OH)-O-, -O-P(O)(H)-O-, -O-P(S)(H)-O-, -S- P(O)(H)-O, -S-P(S)(H)-O-, -S-P(O)(H)-S-, -O-P(S)(H)-S-.
- a preferred embodiment is -O-P(O)(OH)-O-. These candidates can be evaluated using methods analogous to those described above.
- a cleavable linker comprises an acid cleavable linking group.
- An acid cleavable linking group is a linking group that is cleaved under acidic conditions.
- acid cleavable linking groups are cleaved in an acidic environment with a pH of about 6.5 or lower (e.g., about 6.0, 5.75, 5.5, 5.25, 5.0, or lower), or by agents such as enzymes that can act as a general acid.
- acid cleavable linking groups include but are not limited to hydrazones, esters, and esters of amino acids.
- a preferred embodiment is when the carbon attached to the oxygen of the ester (the alkoxy group) is an aryl group, substituted alkyl group, or tertiary alkyl group such as dimethyl pentyl or t-butyl.
- a cleavable linker comprises an ester-based cleavable linking group.
- An ester-based cleavable linking group is cleaved by enzymes such as esterases and amidases in cells. Examples of ester-based cleavable linking groups include but are not limited to esters of alkylene, alkenylene and alkynylene groups. Ester cleavable linking groups have the general formula -C(O)O-, or - OC(O)-. These candidates can be evaluated using methods analogous to those described above. v.
- a cleavable linker comprises a peptide-based cleavable linking group.
- a peptide-based cleavable linking group is cleaved by enzymes such as peptidases and proteases in cells.
- Peptide-based cleavable linking groups are peptide bonds formed between amino acids to yield oligopeptides (e.g., dipeptides, tripeptides etc.) and polypeptides.
- Peptide-based cleavable groups do not include the amide group (-C(O)NH-).
- the amide group can be formed between any alkylene, alkenylene or alkynelene.
- a peptide bond is a special type of amide bond formed between amino acids to yield peptides and proteins.
- the peptide based cleavage group is generally limited to the peptide bond (i.e., the amide bond) formed between amino acids yielding peptides and proteins and does not include the entire amide functional group.
- Peptide-based cleavable linking groups have the general formula – NHCHRAC(O)NHCHRBC(O)-, where RA and RB are the R groups of the two adjacent amino acids. These candidates can be evaluated using methods analogous to those described above.
- an iRNA of the disclosure is conjugated to a carbohydrate through a linker.
- Non-limiting examples of iRNA carbohydrate conjugates with linkers of the compositions and methods of the disclosure include, but are not limited to,
- a ligand is one or more “GalNAc” (N-acetylgalactosamine) derivatives attached through a bivalent or trivalent branched linker.
- a dsRNA of the disclosure is conjugated to a bivalent or trivalent branched linker selected from the group of structures shown in any of formula (XLV) – (XLVIII):
- q2A, q2B, q3A, q3B, q4A, q4B, q5A, q5B and q5C represent independently for each occurrence 0-20 and wherein the repeating unit can be the same or different;
- P 2A , P 2B , P 3A , P 3B , P 4A , P 4B , P 5A , P 5B , P 5C , T 2A , T 2B , T 3A , T 3B , T 4A , T 4B , T 4A , T 5B , T 5C are each independently for each occurrence absent, CO, NH, O, S, OC(O), NHC(O), CH 2 , CH 2 NH or CH 2 O;
- Q 2A , Q 2B , Q 3A , Q 3B , Q 4A , Q 4B , Q 5A , Q 5B , Q 5C are independently for each occurrence absent, alkylene
- Trivalent conjugating GalNAc derivatives are particularly useful for use with RNAi agents for inhibiting the expression of a target gene, such as those of formula (XLIX): , wherein L 5A , L 5B and L 5C represent a monosaccharide, such as GalNAc derivative.
- Suitable bivalent and trivalent branched linker groups conjugating GalNAc derivatives include, but are not limited to, the structures recited above as formulas II, VII, X, XI, and XIII.
- Representative U.S. Patents that teach the preparation of RNA conjugates include, but are not limited to, U.S. Patent Nos.
- iRNA compounds that are chimeric compounds. “Chimeric” iRNA compounds or “chimeras,” in the context of this disclosure, are iRNA compounds, preferably dsRNA agents, that contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of a dsRNA compound.
- iRNAs typically contain at least one region wherein the RNA is modified so as to confer upon the iRNA increased resistance to nuclease degradation, increased cellular uptake, or increased binding affinity for the target nucleic acid.
- An additional region of the iRNA can serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids.
- RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of iRNA inhibition of gene expression.
- RNA of an iRNA can be modified by a non-ligand group.
- a number of non-ligand molecules have been conjugated to iRNAs in order to enhance the activity, cellular distribution or cellular uptake of the iRNA, and procedures for performing such conjugations are available in the scientific literature.
- Such non-ligand moieties have included lipid moieties, such as cholesterol (Kubo, T. et al., Biochem. Biophys. Res. Comm., 2007, 365(1):54-61; Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86:6553), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4:1053), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660:306; Manoharan et al., Bioorg.
- lipid moieties such as cholesterol (Kubo, T. et al., Biochem. Biophys. Res. Comm., 2007, 365(1):54-61; Letsinger et al., Proc. Natl. Ac
- Acids Res., 1990, 18:3777 a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923).
- RNA conjugation protocols involve the synthesis of RNAs bearing an aminolinker at one or more positions of the sequence. The amino group is then reacted with the molecule being conjugated using appropriate coupling or activating reagents. The conjugation reaction can be performed either with the RNA still bound to the solid support or following cleavage of the RNA, in solution phase. Purification of the RNA conjugate by HPLC typically affords the pure conjugate. V.
- RNAi agent of the disclosure Delivery of an RNAi Agent of the Disclosure
- a cell e.g., a cell within a subject, such as a human subject (e.g., a subject in need thereof, such as a subject having a 4R-tau-associated disease, such as a 4R-tauopathy, e.g., PSP, CBD, AGD, MSTD, GGT, spAD, or rpAD
- delivery may be performed by contacting a cell with an RNAi agent of the disclosure either in vitro or in vivo.
- In vivo delivery may also be performed directly by administering a composition comprising an RNAi agent, e.g., a dsRNA, to a subject.
- in vivo delivery may be performed indirectly by administering one or more vectors that encode and direct the expression of the RNAi agent.
- any method of delivering a nucleic acid molecule in vitro or in vivo can be adapted for use with an RNAi agent of the disclosure (see e.g., Akhtar S. and Julian RL., (1992) Trends Cell. Biol. 2(5):139-144 and WO94/02595, which are incorporated herein by reference in their entireties).
- RNAi agent For in vivo delivery, factors to consider in order to deliver an RNAi agent include, for example, biological stability of the delivered agent, prevention of non-specific effects, and accumulation of the delivered agent in the target tissue.
- the non-specific effects of an RNAi agent can be minimized by local administration, for example, by direct injection or implantation into a tissue or topically administering the preparation.
- Local administration to a treatment site maximizes local concentration of the agent, limits the exposure of the agent to systemic tissues that can otherwise be harmed by the agent or that can degrade the agent, and permits a lower total dose of the RNAi agent to be administered.
- Several studies have shown successful knockdown of gene products when an RNAi agent is administered locally.
- VEGF dsRNA intraocular delivery of a VEGF dsRNA by intravitreal injection in cynomolgus monkeys (Tolentino, MJ. et al., (2004) Retina 24:132-138) and subretinal injections in mice (Reich, SJ. et al. (2003) Mol. Vis. 9:210-216) were both shown to prevent neovascularization in an experimental model of age-related macular degeneration.
- direct intratumoral injection of a dsRNA in mice reduces tumor volume (Pille, J. et al. (2005) Mol. Ther. 11:267-274) and can prolong survival of tumor-bearing mice (Kim, WJ. et al., (2006) Mol. Ther.
- RNA interference has also shown success with local delivery to the CNS by direct injection (Dorn, G. et al., (2004) Nucleic Acids 32:e49; Tan, PH. et al. (2005) Gene Ther. 12:59-66; Makimura, H. et al. (2002) BMC Neurosci. 3:18; Shishkina, GT., et al. (2004) Neuroscience 129:521-528; Thakker, ER., et al. (2004) Proc. Natl. Acad. Sci. U.S.A.
- RNAi agent for administering an RNAi agent systemically for the treatment of a disease, the RNA can be modified or alternatively delivered using a drug delivery system; both methods act to prevent the rapid degradation of the dsRNA by endo- and exo-nucleases in vivo.
- RNAi agents can be modified by chemical conjugation to lipophilic groups such as cholesterol to enhance cellular uptake and prevent degradation.
- RNAi agent directed against ApoB conjugated to a lipophilic cholesterol moiety was injected systemically into mice and resulted in knockdown of apoB mRNA in both the liver and jejunum (Soutschek, J. et al., (2004) Nature 432:173-178). Conjugation of an RNAi agent to an aptamer has been shown to inhibit tumor growth and mediate tumor regression in a mouse model of prostate cancer (McNamara, JO. et al., (2006) Nat. Biotechnol. 24:1005-1015).
- the RNAi agent can be delivered using drug delivery systems such as a nanoparticle, a dendrimer, a polymer, liposomes, or a cationic delivery system.
- Positively charged cationic delivery systems facilitate binding of molecule RNAi agent (negatively charged) and also enhance interactions at the negatively charged cell membrane to permit efficient uptake of an RNAi agent by the cell.
- Cationic lipids, dendrimers, or polymers can either be bound to an RNAi agent, or induced to form a vesicle or micelle (see e.g., Kim SH. et al., (2008) Journal of Controlled Release 129(2):107-116) that encases an RNAi agent.
- vesicles or micelles further prevents degradation of the RNAi agent when administered systemically.
- Methods for making and administering cationic- RNAi agent complexes are well within the abilities of one skilled in the art (see e.g., Sorensen, DR., et al. (2003) J. Mol. Biol 327:761-766; Verma, UN. et al., (2003) Clin. Cancer Res. 9:1291-1300; Arnold, AS et al. (2007) J. Hypertens. 25:197-205, which are incorporated herein by reference in their entirety).
- RNAi agents include DOTAP (Sorensen, DR., et al (2003), supra; Verma, UN. et al., (2003), supra), Oligofectamine, “solid nucleic acid lipid particles” (Zimmermann, TS. et al., (2006) Nature 441:111-114), cardiolipin (Chien, PY. et al., (2005) Cancer Gene Ther. 12:321-328; Pal, A. et al., (2005) Int J. Oncol. 26:1087-1091), polyethyleneimine (Bonnet ME. et al., (2008) Pharm. Res. Aug 16 Epub ahead of print; Aigner, A.
- an RNAi agent forms a complex with cyclodextrin for systemic administration.
- Methods for administration and pharmaceutical compositions of RNAi agents and cyclodextrins can be found in U.S. Patent No.
- Certain aspects of the instant disclosure relate to a method of reducing the expression of 4R-tau in a cell, comprising contacting said cell with the double-stranded RNAi agent of the disclosure.
- the cell is an extrahepatic cell, optionally a CNS cell.
- the cell is a hepatic cell.
- Another aspect of the disclosure relates to a method of reducing the expression of 4R-tau in a subject, comprising administering to the subject the double-stranded RNAi agent of the disclosure.
- Another aspect of the disclosure relates to a method of treating a subject having a CNS disorder (neurodegenerative disorder), comprising administering to the subject a therapeutically effective amount of the double-stranded MAPT-targeting RNAi agent of the disclosure, thereby treating the subject.
- the neurodegenerative disorder of the subject is associated with an abnormality of MAPT gene encoded protein 4R-tau.
- the abnormality of MAPT gene encoded protein 4R-tau may result in aggregation of 4R- tau in subject’s brain.
- Exemplary CNS disorders that can be treated by the method of the disclosure include 4R-tau- associated diseases, such as 4R-tauopathies, e.g., PSP, CBD, AGD, MSTD, GGT, spAD, or rpAD.
- the double-stranded RNAi agent is administered intrathecally.
- the method can reduce the expression of a MAPT target gene encoding 4R-tau in a brain (e.g., striatum) or spine tissue, for instance, cortex, cerebellum, cervical spine, lumbar spine, and thoracic spine, immune cells such as monocytes and T-cells.
- compositions and methods in this section are discussed largely with regard to modified siRNA compounds. It may be understood, however, that these formulations, compositions and methods can be practiced with other siRNA compounds, e.g., unmodified siRNA compounds, and such practice is within the disclosure.
- a composition that includes an RNAi agent can be delivered to a subject by a variety of routes. Exemplary routes include: intrathecal, intravenous, topical, rectal, anal, vaginal, nasal, pulmonary, and ocular.
- the RNAi agents of the disclosure can be incorporated into pharmaceutical compositions suitable for administration. Such compositions typically include one or more species of RNAi agent and a pharmaceutically acceptable carrier.
- compositions of the present disclosure may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated.
- Administration may be topical (including ophthalmic, vaginal, rectal, intranasal, transdermal), intrathecal, oral, or parenteral.
- Parenteral administration includes intravenous drip, subcutaneous, intraperitoneal or intramuscular injection, or intrathecal or intraventricular administration.
- the route and site of administration may be chosen to enhance targeting. For example, to target neural or spinal tissue, intrathecal injection would be a logical choice.
- Lung cells might be targeted by administering the RNAi agent in aerosol form.
- the vascular endothelial cells could be targeted by coating a balloon catheter with the RNAi agent and mechanically introducing the RNA.
- Formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids, and powders.
- Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable.
- Coated condoms, gloves and the like may also be useful.
- Compositions for oral administration include powders or granules, suspensions or solutions in water, syrups, elixirs or non-aqueous media, tablets, capsules, lozenges, or troches.
- carriers that can be used include lactose, sodium citrate and salts of phosphoric acid.
- compositions for intrathecal or intraventricular administration may include sterile aqueous solutions which may also contain buffers, diluents, and other suitable additives.
- Formulations for parenteral administration may include sterile aqueous solutions which may also contain buffers, diluents, and other suitable additives.
- Intraventricular injection may be facilitated by an intraventricular catheter, for example, attached to a reservoir.
- the total concentration of solutes may be controlled to render the preparation isotonic.
- the administration of the siRNA compound e.g., a double-stranded siRNA compound, or ssiRNA compound, composition is parenteral, e.g., intravenous (e.g., as a bolus or as a diffusible infusion), intradermal, intraperitoneal, intramuscular, intrathecal, intraventricular, intracranial, subcutaneous, transmucosal, buccal, sublingual, endoscopic, rectal, oral, vaginal, topical, pulmonary, intranasal, urethral, or ocular.
- Administration can be provided by the subject or by another person, e.g., a health care provider.
- the medication can be provided in measured doses or in a dispenser which delivers a metered dose. Selected modes of delivery are discussed in more detail below.
- A. Intrathecal Administration the double-stranded RNAi agent is delivered by intrathecal injection (i.e., injection into the spinal fluid which bathes the brain and spinal cord tissue).
- intrathecal injection i.e., injection into the spinal fluid which bathes the brain and spinal cord tissue.
- Intrathecal injection of RNAi agents into the spinal fluid can be performed as a bolus injection or via minipumps which can be implanted beneath the skin, providing a regular and constant delivery of siRNA into the spinal fluid.
- the intrathecal administration is via a pump.
- the pump may be a surgically implanted osmotic pump.
- the osmotic pump is implanted into the subarachnoid space of the spinal canal to facilitate intrathecal administration.
- the intrathecal administration is via an intrathecal delivery system for a pharmaceutical including a reservoir containing a volume of the pharmaceutical agent, and a pump configured to deliver a portion of the pharmaceutical agent contained in the reservoir. More details about this intrathecal delivery system may be found in WO 2015/116658, which is incorporated by reference in its entirety.
- the amount of intrathecally injected RNAi agents may vary from one target gene to another target gene and the appropriate amount that has to be applied may have to be determined individually for each target gene. Typically, this amount ranges from 10 ⁇ g to 2 mg, preferably 50 ⁇ g to 1500 ⁇ g, more preferably 100 ⁇ g to 1000 ⁇ g. B.
- RNAi agents targeting the hotspot within exon 10 of the MAPT gene can be expressed from transcription units inserted into DNA or RNA vectors (see, e.g., Couture, A, et al., TIG. (1996), 12:5-10; WO 00/22113, WO 00/22114, and US 6,054,299). Expression is preferably sustained (months or longer), depending upon the specific construct used and the target tissue or cell type. These transgenes can be introduced as a linear construct, a circular plasmid, or a viral vector, which can be an integrating or non- integrating vector.
- the transgene can also be constructed to permit it to be inherited as an extrachromosomal plasmid (Gassmann, et al., (1995) Proc. Natl. Acad. Sci. USA 92:1292).
- the individual strand or strands of an RNAi agent can be transcribed from a promoter on an expression vector.
- two separate strands are to be expressed to generate, for example, a dsRNA
- two separate expression vectors can be co-introduced (e.g., by transfection or infection) into a target cell.
- each individual strand of a dsRNA can be transcribed by promoters both of which are located on the same expression plasmid.
- a dsRNA is expressed as inverted repeat polynucleotides joined by a linker polynucleotide sequence such that the dsRNA has a stem and loop structure.
- RNAi agent expression vectors are generally DNA plasmids or viral vectors. Expression vectors compatible with eukaryotic cells, preferably those compatible with vertebrate cells, can be used to produce recombinant constructs for the expression of an RNAi agent as described herein. Delivery of RNAi agent expressing vectors can be systemic, such as by intravenous or intramuscular administration, by administration to target cells ex-planted from the patient followed by reintroduction into the patient, or by any other means that allows for introduction into a desired target cell.
- Viral vector systems which can be utilized with the methods and compositions described herein include, but are not limited to, (a) adenovirus vectors; (b) retrovirus vectors, including but not limited to lentiviral vectors, moloney murine leukemia virus, etc.; (c) adeno- associated virus vectors; (d) herpes simplex virus vectors; (e) SV 40 vectors; (f) polyoma virus vectors; (g) papilloma virus vectors; (h) picornavirus vectors; (i) pox virus vectors such as an orthopox, e.g., vaccinia virus vectors or avipox, e.g.
- pox virus vectors such as an orthopox, e.g., vaccinia virus vectors or avipox, e.g.
- RNAi agent canary pox or fowl pox; and (j) a helper-dependent or gutless adenovirus. Replication-defective viruses can also be advantageous. Different vectors will or will not become incorporated into the cells’ genome.
- the constructs can include viral sequences for transfection, if desired. Alternatively, the construct can be incorporated into vectors capable of episomal replication, e.g. EPV and EBV vectors. Constructs for the recombinant expression of an RNAi agent will generally require regulatory elements, e.g., promoters, enhancers, etc., to ensure the expression of the RNAi agent in target cells. Other aspects to consider for vectors and constructs are known in the art. VI.
- compositions of the Disclosure also includes pharmaceutical compositions and formulations which include the RNAi agents of the disclosure.
- RNAi agents of the disclosure.
- provided herein are pharmaceutical compositions containing an RNAi agent, as described herein, and a pharmaceutically acceptable carrier.
- the pharmaceutical compositions containing the RNAi agent are useful for treating a disease or disorder associated with the expression or activity of 4R-tau, e.g., 4R-tau-associated disease.
- the pharmaceutical composition of the disclosure is the dsRNA agent for reducing abberant expression of exon 10-containing MAPT transcripts.
- the pharmaceutical compositions of the disclosure are sterile.
- the pharmaceutical compositions of the disclosure are pyrogen free.
- compositions are formulated based on the mode of delivery.
- One example is compositions that are formulated for systemic administration via parenteral delivery, e.g., by intravenous (IV), intramuscular (IM), or for subcutaneous (subQ) delivery.
- Another example is compositions that are formulated for direct delivery into the CNS, e.g., by intrathecal or intravitreal routes of injection, optionally by infusion into the brain (e.g., striatum), such as by continuous pump infusion.
- the pharmaceutical compositions of the disclosure may be administered in dosages sufficient to inhibit expression of a 4R-tau isoform.
- a suitable dose of an RNAi agent of the disclosure will be in the range of about 0.001 to about 200.0 milligrams per kilogram body weight of the recipient per day, generally in the range of about 1 to 50 mg per kilogram body weight per day.
- a repeat-dose regimen may include administration of a therapeutic amount of an RNAi agent on a regular basis, such as monthly to once every six months.
- the RNAi agent is administered about once per quarter (i.e., about once every three months) to about twice per year. After an initial treatment regimen (e.g., loading dose), the treatments can be administered on a less frequent basis.
- a single dose of the pharmaceutical compositions can be long lasting, such that subsequent doses are administered at not more than 1, 2, 3, or 4 or more month intervals.
- a single dose of the pharmaceutical compositions of the disclosure is administered once per month.
- a single dose of the pharmaceutical compositions of the disclosure is administered once per quarter to twice per year.
- treatment of a subject with a therapeutically effective amount of a composition can include a single treatment or a series of treatments.
- RNAi agents can be used for in vivo testing of RNAi agents, as well as for determining a therapeutically effective dose.
- Suitable rodent models are known in the art and include, for example, those described in, for example, Palleis et al. (2021) Mov Disord. 2021 Apr;36(4):883-894; Blair et al. (2015) Acta Neuropathol Commun. 2015 Jan 31;3:8; Denk et al. (2009) Neurobiol Aging. 2009 Jan; 30(1): 1–13; and Ferrer et al.
- compositions of the present disclosure can be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration can be topical (e.g., by a transdermal patch), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal, oral or parenteral.
- Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; subdermal, e.g., via an implanted device; or intracranial, e.g., by intraparenchymal, intrathecal or intraventricular, administration.
- the RNAi agents can be delivered in a manner to target a particular tissue, such as the CNS (e.g., neuronal, glial or vascular tissue of the brain).
- Pharmaceutical compositions and formulations for topical administration can include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders.
- Suitable topical formulations include those in which the RNAi agents featured in the disclosure are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants.
- Suitable lipids and liposomes include neutral (e.g., dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl choline) negative (e.g., dimyristoylphosphatidyl glycerol DMPG) and cationic (e.g., dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidyl ethanolamine DOTMA).
- neutral e.g., dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl choline
- negative e.g., dimyristoylphosphatidyl glycerol DMPG
- cationic e.g., dioleoyltetramethylaminopropyl DOTAP and
- RNAi agents can be complexed to lipids, in particular to cationic lipids.
- Suitable fatty acids and esters include but are not limited to arachidonic acid, oleic acid, eicosanoic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, 1-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or a C 1-20 alkyl ester (e.g., isopropylmyristate IPM), monoglyceride, diglyceride or pharmaceutically acceptable salt thereof.
- oleic acid eicosanoic acid
- lauric acid caprylic acid
- capric acid myristic acid, palmitic acid,
- RNAi Agent Formulations Comprising Membranous Molecular Assemblies
- An RNAi agent for use in the compositions and methods of the disclosure can be formulated for delivery in a membranous molecular assembly, e.g., a liposome or a micelle.
- liposome refers to a vesicle composed of amphiphilic lipids arranged in at least one bilayer, e.g., one bilayer or a plurality of bilayers.
- Liposomes include unilamellar and multilamellar vesicles that have a membrane formed from a lipophilic material and an aqueous interior.
- the aqueous portion contains the RNAi agent composition.
- the lipophilic material isolates the aqueous interior from an aqueous exterior, which typically does not include the RNAi agent composition, although in some examples, it may.
- Liposomes are useful for the transfer and delivery of active ingredients to the site of action. Because the liposomal membrane is structurally similar to biological membranes, when liposomes are applied to a tissue, the liposomal bilayer fuses with bilayer of the cellular membranes.
- the internal aqueous contents that include the RNAi agent are delivered into the cell where the RNAi agent can specifically bind to a target RNA and can mediate RNAi.
- the liposomes are also specifically targeted, e.g., to direct the RNAi agent to particular cell types.
- a liposome containing an RNAi agent can be prepared by a variety of methods.
- the lipid component of a liposome is dissolved in a detergent so that micelles are formed with the lipid component.
- the lipid component can be an amphipathic cationic lipid or lipid conjugate.
- the detergent can have a high critical micelle concentration and may be nonionic.
- Exemplary detergents include cholate, CHAPS, octylglucoside, deoxycholate, and lauroyl sarcosine.
- the RNAi agent preparation is then added to the micelles that include the lipid component.
- the cationic groups on the lipid interact with the RNAi agent and condense around the RNAi agent to form a liposome.
- the detergent is removed, e.g., by dialysis, to yield a liposomal preparation of RNAi agent.
- a carrier compound that assists in condensation can be added during the condensation reaction, e.g., by controlled addition.
- the carrier compound can be a polymer other than a nucleic acid (e.g., spermine or spermidine).
- pH can also be adjusted to favor condensation.
- Methods for producing stable polynucleotide delivery vehicles which incorporate a polynucleotide/cationic lipid complex as structural components of the delivery vehicle, are further described in, e.g., WO 96/37194, the entire contents of which are incorporated herein by reference.
- Liposome formation can also include one or more aspects of exemplary methods described in Felgner, P. L. et al., (1987) Proc. Natl. Acad. Sci. USA 8:7413-7417; United States Patent No. 4,897,355; United States Patent No. 5,171,678; Bangham et al., (1965) M. Mol. Biol.
- lipid aggregates of appropriate size for use as delivery vehicles include sonication and freeze-thaw plus extrusion (see, e.g., Mayer et al., (1986) Biochim. Biophys. Acta 858:161. Microfluidization can be used when consistently small (50 to 200 nm) and relatively uniform aggregates are desired (Mayhew et al., (1984) Biochim. Biophys. Acta 775:169. These methods are readily adapted to packaging RNAi agent preparations into liposomes. Liposomes fall into two broad classes. Cationic liposomes are positively charged liposomes which interact with the negatively charged nucleic acid molecules to form a stable complex.
- the positively charged nucleic acid/liposome complex binds to the negatively charged cell surface and is internalized in an endosome. Due to the acidic pH within the endosome, the liposomes are ruptured, releasing their contents into the cell cytoplasm (Wang et al. (1987) Biochem. Biophys. Res. Commun., 147:980-985). Liposomes, which are pH-sensitive or negatively charged, entrap nucleic acids rather than complex with them. Since both the nucleic acid and the lipid are similarly charged, repulsion rather than complex formation occurs. Nevertheless, some nucleic acid is entrapped within the aqueous interior of these liposomes.
- pH sensitive liposomes have been used to deliver nucleic acids encoding the thymidine kinase gene to cell monolayers in culture. Expression of the exogenous gene was detected in the target cells (Zhou et al. (1992) Journal of Controlled Release, 19:269-274).
- One major type of liposomal composition includes phospholipids other than naturally-derived phosphatidylcholine.
- Neutral liposome compositions for example, can be formed from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC).
- Anionic liposome compositions generally are formed from dimyristoyl phosphatidylglycerol, while anionic fusogenic liposomes are formed primarily from dioleoyl phosphatidylethanolamine (DOPE).
- DOPE dioleoyl phosphatidylethanolamine
- Another type of liposomal composition is formed from phosphatidylcholine (PC) such as, for example, soybean PC, and egg PC.
- PC phosphatidylcholine
- Another type is formed from mixtures of phospholipid or phosphatidylcholine or cholesterol. Examples of other methods to introduce liposomes into cells in vitro and in vivo include United States Patent No. 5,283,185; United States Patent No.
- Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drugs to the skin, in particular systems comprising non-ionic surfactant and cholesterol.
- Non-ionic liposomal formulations comprising NOVASOME TM I (glyceryl dilaurate/cholesterol/polyoxyethylene-10- stearyl ether) and NOVASOME TM II (glyceryl distearate/cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver cyclosporin-A into the dermis of mouse skin. Results indicated that such non-ionic liposomal systems were effective in facilitating the deposition of cyclosporine A into different layers of the skin (Hu et al., (1994) S.T.P.Pharma. Sci., 4(6):466).
- Liposomes also include “sterically stabilized” liposomes, a term which, as used herein, refers to liposomes comprising one or more specialized lipids that, when incorporated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids.
- sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome (A) comprises one or more glycolipids, such as monosialoganglioside G M1 , or (B) is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety.
- PEG polyethylene glycol
- Liposomes comprising sphingomyelin. Liposomes comprising 1,2-sn- dimyristoylphosphatidylcholine are disclosed in WO 97/13499 (Lim et al). In one embodiment, cationic liposomes are used. Cationic liposomes possess the advantage of being able to fuse to the cell membrane. Non-cationic liposomes, although not able to fuse as efficiently with the plasma membrane, are taken up by macrophages in vivo and can be used to deliver RNAi agents to macrophages.
- liposomes obtained from natural phospholipids are biocompatible and biodegradable; liposomes can incorporate a wide range of water and lipid soluble drugs; liposomes can protect encapsulated RNAi agents in their internal compartments from metabolism and degradation (Rosoff, in “Pharmaceutical Dosage Forms,” Lieberman, Rieger and Banker (Eds.), 1988, volume 1, p. 245).
- Important considerations in the preparation of liposome formulations are the lipid surface charge, vesicle size and the aqueous volume of the liposomes.
- a positively charged synthetic cationic lipid, N-[1-(2,3-dioleyloxy)propyl]-N,N,N- trimethylammonium chloride can be used to form small liposomes that interact spontaneously with nucleic acid to form lipid-nucleic acid complexes which are capable of fusing with the negatively charged lipids of the cell membranes of tissue culture cells, resulting in delivery of RNAi agent (see, e.g., Felgner, P. L. et al., (1987) Proc. Natl. Acad. Sci. USA 8:7413-7417, and United States Patent No.4,897,355 for a description of DOTMA and its use with DNA).
- RNAi agent see, e.g., Felgner, P. L. et al., (1987) Proc. Natl. Acad. Sci. USA 8:7413-7417, and United States Patent No.4,897,355 for a description of
- a DOTMA analogue, 1,2-bis(oleoyloxy)-3-(trimethylammonia)propane (DOTAP) can be used in combination with a phospholipid to form DNA-complexing vesicles.
- LIPOFECTINTM Bethesda Research Laboratories, Gaithersburg, Md. is an effective agent for the delivery of highly anionic nucleic acids into living tissue culture cells that comprise positively charged DOTMA liposomes which interact spontaneously with negatively charged polynucleotides to form complexes. When enough positively charged liposomes are used, the net charge on the resulting complexes is also positive.
- DOTAP 1,2-bis(oleoyloxy)-3,3-(trimethylammonia)propane
- cationic lipid compounds include those that have been conjugated to a variety of moieties including, for example, carboxyspermine which has been conjugated to one of two types of lipids and includes compounds such as 5-carboxyspermylglycine dioctaoleoylamide (“DOGS”) (TRANSFECTAMTM, Promega, Madison, Wisconsin) and dipalmitoylphosphatidylethanolamine 5- carboxyspermyl-amide (“DPPES”) (see, e.g., United States Patent No.5,171,678).
- DOGS 5-carboxyspermylglycine dioctaoleoylamide
- DPES dipalmitoylphosphatidylethanolamine 5- carboxyspermyl-amide
- Another cationic lipid conjugate includes derivatization of the lipid with cholesterol (“DC-Chol”) which has been formulated into liposomes in combination with DOPE (See, Gao, X.
- DC-Chol derivatization of the lipid with
- Lipopolylysine made by conjugating polylysine to DOPE, has been reported to be effective for transfection in the presence of serum (Zhou, X. et al., (1991) Biochim. Biophys. Acta 1065:8).
- these liposomes containing conjugated cationic lipids are said to exhibit lower toxicity and provide more efficient transfection than the DOTMA- containing compositions.
- Other commercially available cationic lipid products include DMRIE and DMRIE-HP (Vical, La Jolla, California) and Lipofectamine (DOSPA) (Life Technology, Inc., Gaithersburg, Maryland).
- cationic lipids suitable for the delivery of oligonucleotides are described in WO 98/39359 and WO 96/37194.
- Liposomal formulations are particularly suited for topical administration; liposomes present several advantages over other formulations. Such advantages include reduced side effects related to high systemic absorption of the administered drug, increased accumulation of the administered drug at the desired target, and the ability to administer RNAi agent into the skin.
- liposomes are used for delivering RNAi agent to epidermal cells and also to enhance the penetration of RNAi agent into dermal tissues, e.g., into skin.
- the liposomes can be applied topically.
- Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drugs to the skin, in particular systems comprising non-ionic surfactant and cholesterol.
- Non-ionic liposomal formulations comprising Novasome I (glyceryl dilaurate/cholesterol/polyoxyethylene-10- stearyl ether) and Novasome II (glyceryl distearate/ cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver a drug into the dermis of mouse skin.
- RNAi agent Such formulations with RNAi agent are useful for treating a dermatological disorder.
- Liposomes that include RNAi agents can be made highly deformable. Such deformability can enable the liposomes to penetrate through pore that are smaller than the average radius of the liposome.
- transfersomes are a type of deformable liposomes. Transferosomes can be made by adding surface edge activators, usually surfactants, to a standard liposomal composition. Transfersomes that include RNAi agent can be delivered, for example, subcutaneously by infection in order to deliver RNAi agent to keratinocytes in the skin.
- lipid vesicles In order to cross intact mammalian skin, lipid vesicles must pass through a series of fine pores, each with a diameter less than 50 nm, under the influence of a suitable transdermal gradient. In addition, due to the lipid properties, these transferosomes can be self-optimizing (adaptive to the shape of pores, e.g., in the skin), self-repairing, and can frequently reach their targets without fragmenting, and often self-loading. Other formulations amenable to the present disclosure are described in United States provisional application serial Nos.
- Transfersomes yet another type of liposomes, are highly deformable lipid aggregates which are attractive candidates for drug delivery vehicles. Transfersomes can be described as lipid droplets which are so highly deformable that they are easily able to penetrate through pores which are smaller than the droplet.
- Transfersomes are adaptable to the environment in which they are used, e.g., they are self- optimizing (adaptive to the shape of pores in the skin), self-repairing, frequently reach their targets without fragmenting, and often self-loading.
- surface edge- activators usually surfactants
- Transfersomes have been used to deliver serum albumin to the skin.
- the transfersome-mediated delivery of serum albumin has been shown to be as effective as subcutaneous injection of a solution containing serum albumin.
- Surfactants find wide application in formulations such as those described herein, particularly in emulsions (including microemulsions) and liposomes.
- HLB hydrophile/lipophile balance
- Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters.
- Nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated/propoxylated block polymers are also included in this class.
- the polyoxyethylene surfactants are the most popular members of the nonionic surfactant class. If the surfactant molecule carries a negative charge when it is dissolved or dispersed in water, the surfactant is classified as anionic.
- Anionic surfactants include carboxylates such as soaps, acyl lactylates, acyl amides of amino acids, esters of sulfuric acid such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isethionates, acyl taurates and sulfosuccinates, and phosphates.
- the most important members of the anionic surfactant class are the alkyl sulfates and the soaps. If the surfactant molecule carries a positive charge when it is dissolved or dispersed in water, the surfactant is classified as cationic.
- Cationic surfactants include quaternary ammonium salts and ethoxylated amines. The quaternary ammonium salts are the most used members of this class. If the surfactant molecule has the ability to carry either a positive or negative charge, the surfactant is classified as amphoteric. Amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N-alkylbetaines and phosphatides. The use of surfactants in drug products, formulations and in emulsions has been reviewed (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p.285).
- micellar formulations are defined herein as a particular type of molecular assembly in which amphipathic molecules are arranged in a spherical structure such that all the hydrophobic portions of the molecules are directed inward, leaving the hydrophilic portions in contact with the surrounding aqueous phase. The converse arrangement exists if the environment is hydrophobic.
- a mixed micellar formulation suitable for delivery through transdermal membranes may be prepared by mixing an aqueous solution of the siRNA composition, an alkali metal C 8 to C 22 alkyl sulphate, and a micelle forming compounds.
- Exemplary micelle forming compounds include lecithin, hyaluronic acid, pharmaceutically acceptable salts of hyaluronic acid, glycolic acid, lactic acid, chamomile extract, cucumber extract, oleic acid, linoleic acid, linolenic acid, monoolein, monooleates, monolaurates, borage oil, evening of primrose oil, menthol, trihydroxy oxo cholanyl glycine and pharmaceutically acceptable salts thereof, glycerin, polyglycerin, lysine, polylysine, triolein, polyoxyethylene ethers and analogues thereof, polidocanol alkyl ethers and analogues thereof, chenodeoxycholate, deoxycholate, and mixtures thereof.
- the micelle forming compounds may be added at the same time or after addition of the alkali metal alkyl sulphate.
- Mixed micelles will form with substantially any kind of mixing of the ingredients but vigorous mixing in order to provide smaller size micelles.
- a first micellar composition is prepared which contains the siRNA composition and at least the alkali metal alkyl sulphate.
- the first micellar composition is then mixed with at least three micelle forming compounds to form a mixed micellar composition.
- the micellar composition is prepared by mixing the siRNA composition, the alkali metal alkyl sulphate and at least one of the micelle forming compounds, followed by addition of the remaining micelle forming compounds, with vigorous mixing.
- Phenol or m-cresol may be added to the mixed micellar composition to stabilize the formulation and protect against bacterial growth.
- phenol or m-cresol may be added with the micelle forming ingredients.
- An isotonic agent such as glycerin may also be added after formation of the mixed micellar composition.
- the formulation can be put into an aerosol dispenser and the dispenser is charged with a propellant.
- the propellant which is under pressure, is in liquid form in the dispenser.
- the ratios of the ingredients are adjusted so that the aqueous and propellant phases become one, i.e., there is one phase.
- Propellants may include hydrogen-containing chlorofluorocarbons, hydrogen-containing fluorocarbons, dimethyl ether and diethyl ether.
- HFA 134a (1,1,1,2 tetrafluoroethane) may be used.
- concentrations of the essential ingredients can be determined by relatively straightforward experimentation. For absorption through the oral cavities, it is often desirable to increase, e.g., at least double or triple, the dosage for through injection or administration through the gastrointestinal tract.
- RNAi agents e.g., dsRNAs of in the disclosure may be fully encapsulated in a lipid formulation, e.g., a LNP, or other nucleic acid-lipid particle.
- LNP refers to a stable nucleic acid-lipid particle.
- LNPs typically contain a cationic lipid, a non-cationic lipid, and a lipid that prevents aggregation of the particle (e.g., a PEG-lipid conjugate).
- LNPs are extremely useful for systemic applications, as they exhibit extended circulation lifetimes following intravenous (i.v.) injection and accumulate at distal sites (e.g., sites physically separated from the administration site).
- LNPs include “pSPLP,” which include an encapsulated condensing agent-nucleic acid complex as set forth in WO 00/03683.
- the particles of the present disclosure typically have a mean diameter of about 50 nm to about 150 nm, more typically about 60 nm to about 130 nm, more typically about 70 nm to about 110 nm, most typically about 70 nm to about 90 nm, and are substantially nontoxic.
- the nucleic acids when present in the nucleic acid- lipid particles of the present disclosure are resistant in aqueous solution to degradation with a nuclease. Nucleic acid-lipid particles and their method of preparation are disclosed in, e.g., U.S. Patent Nos.
- the lipid to drug ratio (mass/mass ratio) (e.g., lipid to dsRNA ratio) will be in the range of from about 1:1 to about 50:1, from about 1:1 to about 25:1, from about 3:1 to about 15:1, from about 4:1 to about 10:1, from about 5:1 to about 9:1, or about 6:1 to about 9:1. Ranges intermediate to the above recited ranges are also contemplated to be part of the disclosure.
- LNP01 LNP01
- WO 2008/042973 WO 2008/042973
- Additional exemplary lipid-dsRNA formulations are identified in the Table 1 below. Table 1. Exemplary lipid-dsRNA formulations
- DSPC distearoylphosphatidylcholine
- DPPC dipalmitoylphosphatidylcholine
- PEG-DMG PEG- didimyristoyl glycerol (C14-PEG, or PEG-C14) (PEG with avg mol wt of 2000)
- PEG-DSG PEG- distyryl glycerol (C18-PEG, or PEG-C18) (PEG with avg mol wt of 2000)
- PEG-cDMA PEG- carbamoyl-1,2-dimyristyloxypropylamine (PEG with avg mol wt of 2000)
- SNALP l,2- Dilinolenyloxy-N,N-dimethylaminopropane (DLinDMA)
- XTC comprising formulations are described in WO 2010/088537, the entire contents of which are hereby incorporated herein by reference.
- MC3 comprising formulations are described, e.g., in United States Patent Publication No. 2010/0324120, the entire contents of which are hereby incorporated by reference.
- ALNY-100 comprising formulations are described in WO 2010/054406, the entire contents of which are hereby incorporated herein by reference.
- C12-200 comprising formulations are described in WO 2010/129709, the entire contents of which are hereby incorporated herein by reference.
- compositions and formulations for oral administration include powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders can be desirable.
- oral formulations are those in which dsRNAs featured in the disclosure are administered in conjunction with one or more penetration enhancer surfactants and chelators. Suitable surfactants include fatty acids or esters or salts thereof, bile acids or salts thereof.
- Suitable bile acids/salts include chenodeoxycholic acid (CDCA) and ursodeoxychenodeoxycholic acid (UDCA), cholic acid, dehydrocholic acid, deoxycholic acid, glucholic acid, glycholic acid, glycodeoxycholic acid, taurocholic acid, taurodeoxycholic acid, sodium tauro-24,25- dihydro-fusidate and sodium glycodihydrofusidate.
- DCA chenodeoxycholic acid
- UDCA ursodeoxychenodeoxycholic acid
- cholic acid dehydrocholic acid
- deoxycholic acid deoxycholic acid
- glucholic acid glycholic acid
- glycodeoxycholic acid taurocholic acid
- taurodeoxycholic acid sodium tauro-24,25- dihydro-fusidate and sodium glycodihydrofusidate.
- Suitable fatty acids include arachidonic acid, undecanoic acid, oleic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, 1- dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or a monoglyceride, a diglyceride or a pharmaceutically acceptable salt thereof (e.g., sodium).
- arachidonic acid arachidonic acid, undecanoic acid, oleic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyce
- combinations of penetration enhancers are used, for example, fatty acids/salts in combination with bile acids/salts.
- One exemplary combination is the sodium salt of lauric acid, capric acid and UDCA.
- Further penetration enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether.
- DsRNAs featured in the disclosure can be delivered orally, in granular form including sprayed dried particles, or complexed to form micro or nanoparticles.
- DsRNA complexing agents include poly-amino acids; polyimines; polyacrylates; polyalkylacrylates, polyoxethanes, polyalkylcyanoacrylates; cationized gelatins, albumins, starches, acrylates, polyethyleneglycols (PEG) and starches; polyalkylcyanoacrylates; DEAE-derivatized polyimines, pollulans, celluloses and starches.
- Suitable complexing agents include chitosan, N- trimethylchitosan, poly-L-lysine, polyhistidine, polyornithine, polyspermines, protamine, polyvinylpyridine, polythiodiethylaminomethylethylene P(TDAE), polyaminostyrene (e.g., p-amino), poly(methylcyanoacrylate), poly(ethylcyanoacrylate), poly(butylcyanoacrylate), poly(isobutylcyanoacrylate), poly(isohexylcynaoacrylate), DEAE-methacrylate, DEAE-hexylacrylate, DEAE-acrylamide, DEAE-albumin and DEAE-dextran, polymethylacrylate, polyhexylacrylate, poly(D,L-lactic acid), poly(DL-lactic-co-glycolic acid (PLGA), alginate, and polyethyleneglycol (PEG).
- TDAE polythiodiethylamino
- compositions and formulations for parenteral, intraparenchymal (into the brain), intrathecal, intraventricular or intrahepatic administration can include sterile aqueous solutions which can also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.
- Pharmaceutical compositions of the present disclosure include, but are not limited to, solutions, emulsions, and liposome-containing formulations.
- compositions can be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids and self- emulsifying semisolids. Particularly preferred are formulations that target the brain when treating 4R-tau- associated diseases or disorders.
- the pharmaceutical formulations of the present disclosure which can conveniently be presented in unit dosage form, can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.
- compositions of the present disclosure can be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas.
- the compositions of the present disclosure can also be formulated as suspensions in aqueous, non-aqueous or mixed media.
- Aqueous suspensions can further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol or dextran.
- the suspension can also contain stabilizers.
- C. Additional Formulations i. Emulsions The compositions of the present disclosure can be prepared and formulated as emulsions.
- Emulsions are typically heterogeneous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 ⁇ m in diameter (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p.
- Emulsions are often biphasic systems comprising two immiscible liquid phases intimately mixed and dispersed with each other.
- emulsions can be of either the water- in-oil (w/o) or the oil-in-water (o/w) variety.
- aqueous phase When an aqueous phase is finely divided into and dispersed as minute droplets into a bulk oily phase, the resulting composition is called a water-in-oil (w/o) emulsion.
- oil-in-water (o/w) emulsion When an oily phase is finely divided into and dispersed as minute droplets into a bulk aqueous phase, the resulting composition is called an oil-in-water (o/w) emulsion.
- Emulsions can contain additional components in addition to the dispersed phases, and the active drug which can be present as a solution in either aqueous phase, oily phase or itself as a separate phase.
- compositions can also be present in emulsions as needed.
- Pharmaceutical emulsions can also be multiple emulsions that are comprised of more than two phases such as, for example, in the case of oil-in-water-in-oil (o/w/o) and water-in-oil-in-water (w/o/w) emulsions.
- Such complex formulations often provide certain advantages that simple binary emulsions do not.
- Multiple emulsions in which individual oil droplets of an o/w emulsion enclose small water droplets constitute a w/o/w emulsion.
- a system of oil droplets enclosed in globules of water stabilized in an oily continuous phase provides an o/w/o emulsion.
- Emulsions are characterized by little or no thermodynamic stability.
- the dispersed or discontinuous phase of the emulsion is well dispersed into the external or continuous phase and maintained in this form through the means of emulsifiers or the viscosity of the formulation.
- Either of the phases of the emulsion can be a semisolid or a solid, as is the case of emulsion-style ointment bases and creams.
- Other means of stabilizing emulsions entail the use of emulsifiers that can be incorporated into either phase of the emulsion.
- Emulsifiers can broadly be classified into four categories: synthetic surfactants, naturally occurring emulsifiers, absorption bases, and finely dispersed solids (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p.199).
- Synthetic surfactants also known as surface active agents, have found wide applicability in the formulation of emulsions and have been reviewed in the literature (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p.
- HLB hydrophile/lipophile balance
- Surfactants can be classified into different classes based on the nature of the hydrophilic group: nonionic, anionic, cationic and amphoteric (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p.285).
- Naturally occurring emulsifiers used in emulsion formulations include lanolin, beeswax, phosphatides, lecithin and acacia.
- Absorption bases possess hydrophilic properties such that they can soak up water to form w/o emulsions yet retain their semisolid consistencies, such as anhydrous lanolin and hydrophilic petrolatum. Finely divided solids have also been used as good emulsifiers especially in combination with surfactants and in viscous preparations.
- polar inorganic solids such as heavy metal hydroxides, nonswelling clays such as bentonite, attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum silicate and colloidal magnesium aluminum silicate, pigments and nonpolar solids such as carbon or glyceryl tristearate.
- non-emulsifying materials are also included in emulsion formulations and contribute to the properties of emulsions.
- Hydrophilic colloids or hydrocolloids include naturally occurring gums and synthetic polymers such as polysaccharides (for example, acacia, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth), cellulose derivatives (for example, carboxymethylcellulose and carboxypropylcellulose), and synthetic polymers (for example, carbomers, cellulose ethers, and carboxyvinyl polymers). These disperse or swell in water to form colloidal solutions that stabilize emulsions by forming strong interfacial films around the dispersed-phase droplets and by increasing the viscosity of the external phase.
- polysaccharides for example, acacia, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth
- cellulose derivatives for example, carboxymethylcellulose and carboxypropylcellulose
- synthetic polymers for example, carbomers, cellulose ethers, and
- emulsions often contain a number of ingredients such as carbohydrates, proteins, sterols and phosphatides that can readily support the growth of microbes, these formulations often incorporate preservatives.
- preservatives included in emulsion formulations include methyl paraben, propyl paraben, quaternary ammonium salts, benzalkonium chloride, esters of p-hydroxybenzoic acid, and boric acid.
- Antioxidants are also commonly added to emulsion formulations to prevent deterioration of the formulation.
- Antioxidants used can be free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulfite, and antioxidant synergists such as citric acid, tartaric acid, and lecithin.
- free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulfite
- antioxidant synergists such as citric acid, tartaric acid, and lecithin.
- Emulsion formulations for oral delivery have been very widely used because of ease of formulation, as well as efficacy from an absorption and bioavailability standpoint (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p.
- RNAi agents and nucleic acids are formulated as microemulsions.
- a microemulsion can be defined as a system of water, oil and amphiphile which is a single optically isotropic and thermodynamically stable liquid solution (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245).
- microemulsions are systems that are prepared by first dispersing an oil in an aqueous surfactant solution and then adding a sufficient amount of a fourth component, generally an intermediate chain-length alcohol to form a transparent system. Therefore, microemulsions have also been described as thermodynamically stable, isotropically clear dispersions of two immiscible liquids that are stabilized by interfacial films of surface-active molecules (Leung and Shah, in: Controlled Release of Drugs: Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH Publishers, New York, pages 185-215). Microemulsions commonly are prepared via a combination of three to five components that include oil, water, surfactant, cosurfactant and electrolyte.
- microemulsion is of the water-in-oil (w/o) or an oil-in-water (o/w) type is dependent on the properties of the oil and surfactant used, and on the structure and geometric packing of the polar heads and hydrocarbon tails of the surfactant molecules (Schott, in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p.271).
- microemulsions offer the advantage of solubilizing water-insoluble drugs in a formulation of thermodynamically stable droplets that are formed spontaneously.
- Surfactants used in the preparation of microemulsions include, but are not limited to, ionic surfactants, non-ionic surfactants, Brij 96, polyoxyethylene oleyl ethers, polyglycerol fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol monooleate (MO310), hexaglycerol monooleate (PO310), hexaglycerol pentaoleate (PO500), decaglycerol monocaprate (MCA750), decaglycerol monooleate (MO750), decaglycerol sequioleate (SO750), decaglycerol decaoleate (DAO750), alone or in combination with cosurfactants.
- ionic surfactants non-ionic surfactants
- Brij 96 polyoxyethylene oleyl ethers
- polyglycerol fatty acid esters tetraglycerol monolaurate (ML310),
- the cosurfactant usually a short-chain alcohol such as ethanol, 1- propanol, and 1-butanol, serves to increase the interfacial fluidity by penetrating into the surfactant film and consequently creating a disordered film because of the void space generated among surfactant molecules.
- Microemulsions can, however, be prepared without the use of cosurfactants and alcohol-free self-emulsifying microemulsion systems are known in the art.
- the aqueous phase can typically be, but is not limited to, water, an aqueous solution of the drug, glycerol, PEG300, PEG400, polyglycerols, propylene glycols, and derivatives of ethylene glycol.
- the oil phase can include, but is not limited to, materials such as Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium chain (C8-C12) mono, di, and tri-glycerides, polyoxyethylated glyceryl fatty acid esters, fatty alcohols, polyglycolized glycerides, saturated polyglycolized C8-C10 glycerides, vegetable oils and silicone oil.
- Microemulsions are particularly of interest from the standpoint of drug solubilization and the enhanced absorption of drugs. Lipid based microemulsions (both o/w and w/o) have been proposed to enhance the oral bioavailability of drugs, including peptides (see e.g., U.S.
- Microemulsions afford advantages of improved drug solubilization, protection of drug from enzymatic hydrolysis, possible enhancement of drug absorption due to surfactant-induced alterations in membrane fluidity and permeability, ease of preparation, ease of oral administration over solid dosage forms, improved clinical potency, and decreased toxicity (see e.g., U.S. Patent Nos.
- microemulsions can form spontaneously when their components are brought together at ambient temperature. This can be particularly advantageous when formulating thermolabile drugs, peptides or RNAi agents. Microemulsions have also been effective in the transdermal delivery of active components in both cosmetic and pharmaceutical applications.
- microemulsion compositions and formulations of the present disclosure will facilitate the increased systemic absorption of RNAi agents and nucleic acids from the gastrointestinal tract, as well as improve the local cellular uptake of RNAi agents and nucleic acids.
- Microemulsions of the present disclosure can also contain additional components and additives such as sorbitan monostearate (Grill 3), Labrasol, and penetration enhancers to improve the properties of the formulation and to enhance the absorption of the RNAi agents and nucleic acids of the present disclosure.
- RNAi agent of the disclosure may be incorporated into a particle, e.g., a microparticle.
- Microparticles can be produced by spray-drying, but may also be produced by other methods including lyophilization, evaporation, fluid bed drying, vacuum drying, or a combination of these techniques.
- the present disclosure employs various penetration enhancers to effect the efficient delivery of nucleic acids, particularly RNAi agents, to the skin of animals.
- nucleic acids particularly RNAi agents
- Most drugs are present in solution in both ionized and nonionized forms. However, usually only lipid soluble or lipophilic drugs readily cross cell membranes. It has been discovered that even non-lipophilic drugs can cross cell membranes if the membrane to be crossed is treated with a penetration enhancer. In addition to aiding the diffusion of non-lipophilic drugs across cell membranes, penetration enhancers also enhance the permeability of lipophilic drugs.
- Penetration enhancers can be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92).
- surfactants fatty acids
- Surfactants are chemical entities which, when dissolved in an aqueous solution, reduce the surface tension of the solution or the interfacial tension between the aqueous solution and another liquid, with the result that absorption of RNAi agents through the mucosa is enhanced.
- these penetration enhancers include, for example, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether) (see e.g., Malmsten, M.
- fatty acids and their derivatives which act as penetration enhancers include, for example, oleic acid, lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein (1-monooleoyl-rac-glycerol), dilaurin, caprylic acid, arachidonic acid, glycerol 1-monocaprate, 1-dodecylazacycloheptan-2-one, acylcarnitines, acylcholines, C 1-20 alkyl esters thereof (e.g., methyl, isopropyl and t-butyl), and mono- and di-glycerides thereof (i.e., oleate, laurate, caprate, myristate, palmitate, stearate, linoleate, etc.) (see e.g., To,
- bile salts includes any of the naturally occurring components of bile as well as any of their synthetic derivatives.
- Suitable bile salts include, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate), dehydrocholic acid (sodium dehydrocholate), deoxycholic acid (sodium deoxycholate), glucholic acid (sodium glucholate), glycholic acid (sodium glycocholate), glycodeoxycholic acid (sodium glycodeoxycholate), taurocholic acid (sodium taurocholate), taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic acid (sodium chenodeoxycholate), ursodeoxycholic acid (UDCA), sodium tauro-24,25-dihydro-fusidate (STDHF), sodium glycodihydrofusidate and polyoxyethylene-9- lauryl ether (POE) (see e.g., Malmsten, M.
- POE polyoxyethylene-9- lauryl ether
- Chelating agents can be defined as compounds that remove metallic ions from solution by forming complexes therewith, with the result that absorption of RNAi agents through the mucosa is enhanced.
- chelating agents have the added advantage of also serving as DNase inhibitors, as most characterized DNA nucleases require a divalent metal ion for catalysis and are thus inhibited by chelating agents (Jarrett, J. Chromatogr., 1993, 618, 315-339).
- Suitable chelating agents include but are not limited to disodium ethylenediaminetetraacetate (EDTA), citric acid, salicylates (e.g., sodium salicylate, 5- methoxysalicylate and homovanilate), N-acyl derivatives of collagen, laureth-9 and N-amino acyl derivatives of beta-diketones (enamines)(see e.g., Katdare, A.
- EDTA disodium ethylenediaminetetraacetate
- citric acid e.g., citric acid
- salicylates e.g., sodium salicylate, 5- methoxysalicylate and homovanilate
- N-acyl derivatives of collagen e.g., laureth-9 and N-amino acyl derivatives of beta-diketones (enamines)(see e.g., Katdare, A.
- non-chelating non-surfactant penetration enhancing compounds can be defined as compounds that demonstrate insignificant activity as chelating agents or as surfactants but that nonetheless enhance absorption of RNAi agents through the alimentary mucosa (see e.g., Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33).
- This class of penetration enhancers includes, for example, unsaturated cyclic ureas, 1-alkyl- and 1-alkenylazacyclo-alkanone derivatives (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92); and non-steroidal anti- inflammatory agents such as diclofenac sodium, indomethacin and phenylbutazone (Yamashita et al., J. Pharm. Pharmacol., 1987, 39, 621-626).
- Agents that enhance uptake of RNAi agents at the cellular level can also be added to the pharmaceutical and other compositions of the present disclosure.
- cationic lipids such as lipofectin (Junichi et al, U.S.
- cationic glycerol derivatives and polycationic molecules, such as polylysine (WO 97/30731), are also known to enhance the cellular uptake of dsRNAs.
- Other agents can be utilized to enhance the penetration of the administered nucleic acids, including glycols such as ethylene glycol and propylene glycol, pyrrols such as 2-pyrrol, azones, and terpenes such as limonene and menthone.
- a “pharmaceutical carrier” or “excipient” is a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal.
- the excipient can be liquid or solid and is selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition.
- Typical pharmaceutical carriers include, but are not limited to, binding agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate
- compositions of the present disclosure can also be used to formulate the compositions of the present disclosure.
- suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.
- Formulations for topical administration of nucleic acids can include sterile and non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or solutions of the nucleic acids in liquid or solid oil bases.
- the solutions can also contain buffers, diluents and other suitable additives.
- Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration which do not deleteriously react with nucleic acids can be used. Suitable pharmaceutically acceptable excipients include, but are not limited to, water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like. vi.
- Other Components The compositions of the present disclosure can additionally contain other adjunct components conventionally found in pharmaceutical compositions, at their art-established usage levels.
- compositions can contain additional, compatible, pharmaceutically-active materials such as, for example, antipruritics, astringents, local anesthetics or anti-inflammatory agents, or can contain additional materials useful in physically formulating various dosage forms of the compositions of the present disclosure, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers.
- additional materials useful in physically formulating various dosage forms of the compositions of the present disclosure, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers.
- such materials when added, should not unduly interfere with the biological activities of the components of the compositions of the present disclosure.
- the formulations can be sterilized and, if desired, mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings or aromatic substances and the like which do not deleteriously interact with the nucleic acid(s) of the formulation.
- auxiliary agents e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings or aromatic substances and the like which do not deleteriously interact with the nucleic acid(s) of the formulation.
- Aqueous suspensions can contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol or dextran.
- the suspension can also contain stabilizers.
- compositions featured in the disclosure include (a) one or more RNAi agents and (b) one or more agents which function by a non-RNAi mechanism and which are useful in treating a 4R-tau-associated disorder.
- agents include, but are not limited to, cholinesterase inhibitors, memantine, monoamine inhibitors, reserpine, anticonvulsants, antipsychotic agents, and antidepressants. Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD 50 (the dose lethal to 50% of the population) and the ED 50 (the dose therapeutically effective in 50% of the population).
- the dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD 50 /ED 50 .
- Compounds that exhibit high therapeutic indices are preferred.
- the data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans.
- the dosage of compositions featured herein in the disclosure lies generally within a range of circulating concentrations that include the ED 50 with little or no toxicity. The dosage can vary within this range depending upon the dosage form employed and the route of administration utilized.
- the therapeutically effective dose can be estimated initially from cell culture assays.
- a dose can be formulated in animal models to achieve a circulating plasma concentration range of the compound or, when appropriate, of the polypeptide product of a target sequence (e.g., achieving a decreased concentration of the polypeptide) that includes the IC 50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture.
- IC 50 i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms
- levels in plasma can be measured, for example, by high performance liquid chromatography.
- the RNAi agents featured in the disclosure can be administered in combination with other known agents effective in treatment of clinical symptoms processes related to the aberrant expression of 4R-tau. Such co-administrations may be separately or simultaneously.
- an RNAi agent featured in the disclosure may be administered in combination with an antioxidant such as CoQ10 (e.g., Ubidecarenon; an O-linked N-acetylglucosamine glycoside hydrolase (OGA) inhibitor such as ASN120290 (ASN-561), MK-8719, or LY3372689; a Tau aggregation inhibitor (TAI) such as AZP2006, methylthioninium chloride (TRx0237), or leuco-methylthioninium bis(hydromethanesulfonate (LMTM); a Tau N-term monoclonal antibody such as BIIB092 (gosuranemab, BMS-986168, IPN007) or ABBV-8E12 (C2N 8E12, tilavonemab); a Tau mid-domain monoclonal antibody such as UCB 0107; specificity protein 1 (Sp1) degradation promoter such as tolfen
- CoQ10 e.g., Ubidecar
- kits that include a suitable container containing a pharmaceutical formulation of a siRNA compound, e.g., a double-stranded siRNA compound, or ssiRNA compound, (e.g., a precursor, e.g., a larger siRNA compound which can be processed into a ssiRNA compound, or a DNA which encodes an siRNA compound, e.g., a double-stranded siRNA compound, or ssiRNA compound, or precursor thereof).
- a suitable container containing a pharmaceutical formulation of a siRNA compound, e.g., a double-stranded siRNA compound, or ssiRNA compound, (e.g., a precursor, e.g., a larger siRNA compound which can be processed into a ssiRNA compound, or a DNA which encodes an siRNA compound, e.g., a double-stranded siRNA compound, or ssiRNA compound, or precursor thereof).
- a siRNA compound e.g
- kits include one or more dsRNA agent(s) and instructions for use, e.g., instructions for administering a prophylactically or therapeutically effective amount of a dsRNA agent(s).
- the dsRNA agent may be in a vial or a pre-filled syringe.
- the kits may optionally further comprise means for administering the dsRNA agent (e.g., an injection device, such as a pre-filled syringe or an intrathecal pump), or means for measuring the inhibition of 4R-tau (e.g., means for measuring the inhibition of MAPT mRNA encoding 4R-tau, 4R-tau, and/or 4R-tau activity).
- kits of the disclosure may optionally further comprise means for determining the therapeutically effective or prophylactically effective amount.
- the individual components of the pharmaceutical formulation may be provided in one container.
- the kit may be packaged in a number of different configurations such as one or more containers in a single box. The different components can be combined, e.g., according to instructions provided with the kit.
- the components can be combined according to a method described herein, e.g., to prepare and administer a pharmaceutical composition.
- the kit can also include a delivery device.
- the present disclosure also provides methods of inhibiting expression of 4R-tau in a cell.
- the methods include contacting a cell with an RNAi agent, e.g., double stranded RNAi agent, in an amount effective to inhibit expression and/or activity of 4R-tau in the cell, thereby inhibiting expression and/or activity of 4R-tau in the cell.
- the present disclosure also provides methods of reducing abberant expression of exon 10-containing MAPT transcripts in a cell.
- the methods include contacting the cell with a dsRNA agent of the present disclosure, or a pharmaceutical composition of the present disclosure, thereby degrading exon 10-containing MAPT transcripts in the cell.
- the dsRNA agents of the present disclosure may be used by the methods described herein to preferentially inhibit the expression and/or activity of 4R-tau, with respect to the inhibition of 3R-tau.
- the cell is within a subject.
- the subject is a human.
- the subject has a 4R- tau-associated disorder.
- the 4R-tau-associated disorder is a neuro-degenerative disorder.
- the neurodegenerative disorder is associated with an abnormality of MAPT gene encoded protein 4R-tau.
- the abnormality of MAPT gene encoded protein 4R-tau results in aggregation of 4R-tau in the subject’s brain.
- 4R-tau expression and/or activity is inhibited by at least 30%, preferentially in CNS (e.g., brain) cells.
- 4R-tau expression and/or activity is inhibited by at least 30%.
- 4R-tau protein level in serum of the subject is inhibited by at least 30%.
- 4R-tau expression and/or activity is inhibited by at least 30%, preferentially in hepatocytes.
- RNAi agent e.g., a double stranded RNAi agent
- Contacting of a cell in vivo with the RNAi agent includes contacting a cell or group of cells within a subject, e.g., a human subject, with the RNAi agent. Combinations of in vitro and in vivo methods of contacting a cell are also possible. Contacting a cell may be direct or indirect, as discussed above. Furthermore, contacting a cell may be accomplished via a targeting ligand, including any ligand described herein or known in the art.
- the targeting ligand is a carbohydrate moiety, e.g., a GalNAc ligand, or any other ligand that directs the RNAi agent to a site of interest.
- the term “inhibiting,” as used herein, is used interchangeably with “reducing,” “silencing,” “downregulating,” “suppressing” and other similar terms, and includes any level of inhibition.
- a level of inhibition e.g., for an RNAi agent of the instant disclosure, can be assessed in cell culture conditions, e.g., wherein cells in cell culture are transfected via LIPOFECTAMINE TM - mediated transfection at a concentration in the vicinity of a cell of 10 nM or less, 1 nM or less, etc.
- Knockdown of a given RNAi agent can be determined via comparison of pre-treated levels in cell culture versus post-treated levels in cell culture, optionally also comparing against cells treated in parallel with a scrambled or other form of control RNAi agent.
- knockdown of 4R-tau by exon 10- targeting agents may be compared against knockdown of 4R-tau, 3R-tau, and/or total tau by total tau targeting agents (i.e. agents that target a sequence within the MAPT gene shared by 3R-tau and 4R-tau isoforms).
- Knockdown in cell culture of, e.g., at least about 30% can thereby be identified as indicative of “inhibiting” or “reducing”, “downregulating” or “suppressing”, etc. having occurred. It is expressly contemplated that assessment of targeted mRNA or encoded protein levels (and therefore an extent of “inhibiting”, etc.
- RNAi agent of the disclosure can also be assessed in in vivo systems for the RNAi agents of the instant disclosure, under properly controlled conditions as described in the art.
- MAPT gene such as, e.g., a mouse MAPT gene, a rat MAPT gene, a monkey MAPT gene, or a human MAPT gene
- the MAPT gene may be a wild-type MAPT gene, a mutant MAPT gene, or a transgenic MAPT gene in the context of a genetically manipulated cell, group of cells, or organism.
- “Inhibiting expression of 4R-tau” includes any level of inhibition of a MAPT gene that encodes a 4R-tau, e.g., at least partial suppression of the expression of a MAPT gene, such as an inhibition by at least about 25%. In certain embodiments, inhibition is at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 95%, or at least about 99%, relative to a control level.
- 4R-tau inhibition can be measured using the in vitro assay with, e.g., A549 cells and a 10 nM concentration of the RNA agent and the PCR assay as provided in the examples herein, are contemplated to be within the scope of the present disclosure.
- 4R-tau inhibition can be measured using the in vitro assay with BE(2)- C cells.
- 4R-tau inhibition can be measured using the in vitro assay with Neuro-2a cells.
- 4R-tau inhibition can be measured using the in vitro assay with Cos-7 (Dual-Luciferase psiCHECK2 vector).
- 4R-tau inhibition can be measured using the in vitro assay with primary mouse hepatocytes.
- the expression of a 4R-tau isoform may be assessed based on the level of any variable associated with 4R-tau expression, e.g., 4R-tau encoding MAPT mRNA level (e.g., sense mRNA, antisense mRNA, total MAPT mRNA) or 4R-tau level (e.g., total 4R-tau or wild-type 4R-tau), or, for example, the level of sense- or antisense-containing foci and/or the level of aberrant dipeptide repeat protein.
- MAPT mRNA level e.g., sense mRNA, antisense mRNA, total MAPT mRNA
- 4R-tau level e.g., total 4R-tau or wild-type 4R-tau
- Inhibition may be assessed by a decrease in an absolute or relative level of one or more of these variables compared with a control level.
- the control level may be any type of control level that is utilized in the art, e.g., a pre-dose baseline level, or a level determined from a similar subject, cell, or sample that is untreated or treated with a control (such as, e.g., buffer only control or inactive agent control).
- expression of a 4R-tau isoform is inhibited by at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, or 95%, relative to a control level, or to below the level of detection of the assay.
- expression of a 4R-tau isoform is inhibited by at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 95% relative to a control level.
- the methods include a clinically relevant inhibition of expression of 4R- tau, e.g. as demonstrated by a clinically relevant outcome after treatment of a subject with an agent of the disclosure to reduce the expression of 4R-tau.
- Inhibition of the expression of a 4R-tau isoform may be manifested by a reduction of the amount of mRNA expressed by a first cell or group of cells (such cells may be present, for example, in a sample derived from a subject) in which a MAPT gene is transcribed and which has or have been treated (e.g., by contacting the cell or cells with an RNAi agent of the disclosure, or by administering an RNAi agent of the disclosure to a subject in which the cells are or were present) such that the expression of a 4R-tau isoform is inhibited, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has not or have not been so treated (control cell(s) not treated with an RNAi agent or not treated with an RNAi agent targeted to the gene of interest).
- the degree of inhibition may be expressed in terms of:
- inhibition of the expression of a 4R-tau isoform may be assessed in terms of a reduction of a parameter that is functionally linked to expression of a 4R-tau isoform, e.g., 4R-tau expression, sense- or antisense-containing foci and/or the level of aberrant dipeptide repeat protein.
- 4R- tau silencing may be determined in any cell expressing 4R-tau, either endogenous or heterologous from an expression construct, and by any assay known in the art.
- Inhibition of the expression of 4R-tau may be manifested by a reduction in the level of the 4R-tau protein (or functional parameter, e.g., reduction in microtubule assembly) that is expressed by a cell or group of cells (e.g., the level of protein expressed in a sample derived from a subject).
- a cell or group of cells e.g., the level of protein expressed in a sample derived from a subject.
- the inhibition of protein expression levels in a treated cell or group of cells may similarly be expressed as a percentage of the level of protein in a control cell or group of cells.
- the phrase “inhibiting 4R-tau”, can refer to the inhibition of 4R-tau mRNA expression or 4R-tau protein expression, e.g., at least partial suppression or 4R-tau expression, such as an inhibition by at least about 25%.
- inhibition of the 4R-tau activity is by at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 95%, or at least about 99%, relative to a control level.
- Tau protein levels can be measured using an in vitro assay (e.g., with the assay described in Rubenstein et al. (2015) J.
- MAPT expression e.g., 4R-tau isoforms, 3R-tau isoforms
- an in vitro assay e.g., with the assay described in Caillet-Boudin et al. (2015) Mol Neurodegener. 2015; 10:28; Hefti et al. (2016) PLoS ONE 13(4): e0195771; and/or Chen et al.
- a control cell or group of cells that may be used to assess the inhibition of the expression of a 4R- tau isoform includes a cell or group of cells that has not yet been contacted with an RNAi agent of the disclosure.
- the control cell or group of cells may be derived from an individual subject (e.g., a human or animal subject) prior to treatment of the subject with an RNAi agent.
- the level of 4R-tau mRNA that is expressed by a cell or group of cells may be determined using any method known in the art for assessing mRNA expression.
- the level of expression of 4R-tau in a sample is determined by detecting a transcribed polynucleotide, or portion thereof, e.g., mRNA of the MAPT gene.
- RNA may be extracted from cells using RNA extraction techniques including, for example, using acid phenol/guanidine isothiocyanate extraction (RNAzol B; Biogenesis), RNEASY TM RNA preparation kits (QIAGEN®) or PAXgene (PreAnalytix, Switzerland).
- Typical assay formats utilizing ribonucleic acid hybridization include nuclear run-on assays, RT-PCR, RNase protection assays, northern blotting, in situ hybridization, and microarray analysis.
- Strand specific 4R-tau mRNAs may be detected using the quantitative RT-PCR and or droplet digital PCR methods described in, for example, Jiang, et al. supra, Lagier-Tourenne, et al., supra and Jiang, et al., supra. Circulating 4R-tau mRNA may be detected using methods the described in WO2012/177906, the entire contents of which are hereby incorporated herein by reference.
- the level of expression of 4R-tau is determined using a nucleic acid probe.
- the term “probe”, as used herein, refers to any molecule that is capable of selectively binding to a specific 4R-tau nucleic acid or protein, or fragment thereof.
- Probes can be synthesized by one of skill in the art, or derived from appropriate biological preparations. Probes may be specifically designed to be labeled. Examples of molecules that can be utilized as probes include, but are not limited to, RNA, DNA, proteins, antibodies, and organic molecules. Isolated mRNA can be used in hybridization or amplification assays that include, but are not limited to, Southern or northern analyses, polymerase chain reaction (PCR) analyses and probe arrays. One method for the determination of mRNA levels involves contacting the isolated mRNA with a nucleic acid molecule (probe) that can hybridize to 4R-tau mRNA.
- probe nucleic acid molecule
- the mRNA is immobilized on a solid surface and contacted with a probe, for example by running the isolated mRNA on an agarose gel and transferring the mRNA from the gel to a membrane, such as nitrocellulose.
- the probe(s) are immobilized on a solid surface and the mRNA is contacted with the probe(s), for example, in an Affymetrix ® gene chip array.
- a skilled artisan can readily adapt known mRNA detection methods for use in determining the level of 4R-tau mRNA.
- An alternative method for determining the level of expression of 4R-tau in a sample involves the process of nucleic acid amplification or reverse transcriptase (to prepare cDNA) of for example mRNA in the sample, e.g., by RT-PCR (the experimental embodiment set forth in Mullis, 1987, US Patent No. 4,683,202), ligase chain reaction (Barany (1991) Proc. Natl. Acad. Sci. USA 88:189-193), self-sustained sequence replication (Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87:1874-1878), transcriptional amplification system (Kwoh et al. (1989) Proc. Natl. Acad. Sci.
- the level of expression of 4R-tau is determined by quantitative fluorogenic RT-PCR (i.e., the TAQMAN TM System), by a DUAL-GLO® Luciferase assay, or by other art-recognized method for measurement of 4R-tau expression or mRNA level.
- the expression level of 4R-tau mRNA may be monitored using a membrane blot (such as used in hybridization analysis such as northern, Southern, dot, and the like), or microwells, sample tubes, gels, beads or fibers (or any solid support comprising bound nucleic acids). See US Patent Nos.
- the determination of 4R-tau expression level may also comprise using nucleic acid probes in solution.
- the level of mRNA expression is assessed using branched DNA (bDNA) assays or real time PCR (qPCR). The use of this PCR method is described and exemplified in the Examples presented herein. Such methods can also be used for the detection of 4R-tau nucleic acids.
- the level of 4R-tau expression may be determined using any method known in the art for the measurement of protein levels.
- Such methods include, for example, electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography, fluid or gel precipitin reactions, absorption spectroscopy, a colorimetric assays, spectrophotometric assays, flow cytometry, immunodiffusion (single or double), immunoelectrophoresis, western blotting, radioimmunoassay (RIA), enzyme-linked immunosorbent assays (ELISAs), immunofluorescent assays, electrochemiluminescence assays, and the like.
- assays can also be used for the detection of proteins indicative of the presence or replication of 4R-tau.
- Total Tau, 3R-tau, and/or 4R-tau protein levels can be measured using an in vitro assay (e.g., with the assay described in Rubenstein et al. (2015) J. Neurotrauma 2015 Mar1: 32 (5):342-352; Lim et al. (2014) Comput Struct Biotechnol J. 2014;12(20-21):7–13; and/or Espindola, et al. (2016) Cell Reports 2018 Apr 17; 23:709–715).
- an in vitro assay e.g., with the assay described in Rubenstein et al. (2015) J. Neurotrauma 2015 Mar1: 32 (5):342-352; Lim et al. (2014) Comput Struct Biotechnol J. 2014;12(20-21):7–13; and/or Espindola, et al. (2016) Cell Reports 2018 Apr 17; 23:709–715).
- the level of sense- or antisense-containing foci and the level of aberrant dipeptide repeat protein may be assessed using methods well-known to one of ordinary skill in the art, including, for example, fluorescent in situ hybridization (FISH), immunohistochemistry and immunoassay (see, e.g., Jiang, et al. supra).
- FISH fluorescent in situ hybridization
- immunohistochemistry immunohistochemistry
- immunoassay see, e.g., Jiang, et al. supra.
- the efficacy of the methods of the disclosure in the treatment of a 4R-tau- associated disease is assessed by a decrease in 4R-tau mRNA level (e.g, by assessment of a CSF sample and/or plasma sample for 4R-tau level, by brain biopsy, or otherwise).
- the RNAi agent is administered to a subject such that the RNAi agent is delivered to a specific site within the subject.
- the inhibition of expression of 4R-tau may be assessed using measurements of the level or change in the level of 4R-tau mRNA (e.g., sense mRNA, antisense mRNA, total 4R-tau mRNA), 4R-tau protein (e.g., total 4R-tau protein, wild-type 4R-tau protein), sense-containing foci, antisense-containing foci, aberrant dipeptide repeat protein in a sample derived from a specific site within the subject, e.g., CNS cells.
- 4R-tau mRNA e.g., sense mRNA, antisense mRNA, total 4R-tau mRNA
- 4R-tau protein e.g., total 4R-tau protein, wild-type 4R-tau protein
- sense-containing foci e.g., antisense-containing foc
- the methods include a clinically relevant inhibition of expression of 4R-tau, e.g. as demonstrated by a clinically relevant outcome after treatment of a subject with an agent of the disclosure to reduce the expression of 4R-tau, such as, for example, stabilization or inhibition of caudate atrophy (e.g., as assessed by volumetric MRI (vMRI)), a stabilization or reduction in neurofilament light chain (NfL) levels in a CSF sample from a subject, a reduction in mutant 4R-tau mRNA or a cleaved mutant 4R-tau, e.g., full-length mutant 4R-tau mRNA or protein and a cleaved mutant 4R-tau mRNA or protein.
- vMRI volumetric MRI
- NfL neurofilament light chain
- an RNAi e.g., dsRNA
- agent of the disclosure may preferentially inhibit 4R-tau, with respect to 3R-tau. Preferential inhibition may occur when the agent is substantially more effective in inhibiting a 4R-tau isoform when compared to inhibition of 3R-tau isoforms (e.g., significantly higher inhibition).
- an agent which is 4R-preferential is able to decrease 4R-tau isoform expression (e.g., mRNA levels) by at least about 50%, 55%, 60%, 65%, 70%, or 75%, while decreasing 3R-tau isoform expression (e.g., mRNA levels) by a substantially lesser amount (e.g., by a difference of at least 10%, 15%, 20%, 25%, 30%, 40%, 50%, or more).
- an agent which is 4R-preferential is able to decrease 4R-tau isoform expression (e.g., mRNA levels) by no more than about 40%, 35%, 30%, 25%, 20%, 15%, 10%, or 5%, while decreasing 4R-tau isoform expression (e.g., mRNA levels) by a substantially larger amount (e.g., by a difference of at least 10%, 15%, 20%, 25%, 30%, 40%, 50%, or more).
- the agent is able to decrease 4R-tau isoform expression by at least about 70%, while decreasing 3R-tau isoform expression by more than about 30% in a cell expressing both 3R-tau and 4R-tau isoforms.
- Levels of inhibition may be determined, for example, using methods described herein on a cell which expresses both 3R-tau and 4R-tau isoforms.
- the cell expresses substantially similar levels of the 3R-tau and 4R-tau isoform (by whatever indicator is being used to measure inhibition), such as a 1:1 ratio, or the level of inhibition is able to be normalized to account for differences in control levels of expression.
- Preferential inhibition may be measured, for instance, using the transfection protocols described in Example 1 and/or the cellular assay described in Example 3.
- preferential inhibition is measured in cells (e.g., HEK293 cells) transfected with exongenous MAPT genes expressing both 3R-tau and 4R-tau isoforms.
- cells e.g., HEK293 cells
- detecting or determining a level of an analyte are understood to mean performing the steps to determine if a material, e.g., protein, RNA, is present.
- methods of detecting or determining include detection or determination of an analyte level that is below the level of detection for the method used. IX.
- the present disclosure also provides methods of using an RNAi agent of the disclosure or a composition containing an RNAi agent of the disclosure to reduce or inhibit 4R-tau expression in a cell.
- the methods include contacting the cell with a dsRNA of the disclosure and maintaining the cell for a time sufficient to obtain degradation of the 4R-tau mRNA transcript of a MAPT gene, thereby inhibiting expression of the 4R-tau isoform in the cell.
- the present disclosure also provides methods of using an RNAi agent of the disclosure or a composition containing an RNAi agent of the disclosure to reduce the level and/or inhibit formation of sense- and antisense-containing foci in a cell.
- the methods include contacting the cell with a dsRNA of the disclosure, thereby reducing the level of the 4R-tau sense- and antisense-containing foci in the cell.
- the present disclosure also provides methods of using an RNAi agent of the disclosure or a composition containing an RNAi agent of the disclosure to reduce the level and/or inhibit formation of aberrant dipeptide repeat protein in a cell.
- the methods include contacting the cell with a dsRNA of the disclosure, thereby reducing the level of the aberrant dipeptide repeat protein in the cell. Reduction in gene expression, the level of 4R-tau sense- and antisense-containing foci, and/or aberrant dipeptide repeat protein can be assessed by any methods known in the art.
- a reduction in the expression of 4R-tau may be determined by determining the 4R-tau mRNA expression level of MAPT using methods routine to one of ordinary skill in the art, e.g., northern blotting, qRT-PCR; by determining the protein level of 4R-tau using methods routine to one of ordinary skill in the art, such as western blotting, immunological techniques.
- the cell may be contacted in vitro or in vivo, i.e., the cell may be within a subject.
- the subject may be a human.
- the subject may have a 4R-tau-associated disorder.
- the 4R-tau-associated disorder may be a neurodegenerative disorder.
- the neurodegenerative disorder of the subject can be associated with an abnormality of MAPT gene encoded protein 4R-tau.
- the abnormality of MAPT gene encoded protein 4R-tau may result in aggregation of 4R-tau in the subject’s brain.
- a cell suitable for treatment using the methods of the disclosure may be any cell that expresses a 4R-tau isoform.
- a cell suitable for use in the methods of the disclosure may be a mammalian cell, e.g., a primate cell (such as a human cell or a non-human primate cell, e.g., a monkey cell or a chimpanzee cell), a non-primate cell (such as a rat cell, or a mouse cell).
- the cell is a human cell, e.g., a human CNS cell.
- 4R-tau expression e.g., as assessed by sense mRNA, antisense mRNA, total 4R-tau mRNA, total 4R-tau protein
- 4R-tau expression is inhibited in the cell by about 20%, 25%, 30%, 35%, 40%, 45%, or 50% relative to the expression in a control cell.
- 4R-tau expression is inhibited by at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 95% relative to a control level.
- 4R-tau expression is inhibited in the cell by at least 30%.
- inhibiting expression of 4R-tau may decrease 4R-tau protein level in serum of the subject by at least 30%.
- Inhibition, as assessed by sense- or antisense-containing foci and/or aberrant dipeptide repeat protein level) is inhibited in the cell by at least 20%, 30%, 40%, preferably at least 50%, 60%, 70%, 80%, 85%, 90%, or 95%, or to below the level of detection of the assay.
- the in vivo methods of the disclosure may include administering to a subject a composition containing an RNAi agent of the disclosure, where the RNAi agent includes a nucleotide sequence that is complementary to at least a part of a hotspot within exon 10 of an RNA transcript of the MAPT gene of the mammal to be treated.
- the composition can be administered by any means known in the art including, but not limited to oral, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal, and intrathecal), intravenous, intramuscular, intravitreal, subcutaneous, transdermal, airway (aerosol), nasal, rectal, and topical (including buccal and sublingual) administration.
- intracranial e.g., intraventricular, intraparenchymal, and intrathecal
- intravenous intramuscular, intravitreal, subcutaneous, transdermal, airway (aerosol), nasal, rectal, and topical (including buccal and sublingual) administration.
- the compositions are administered by intravenous infusion or injection.
- the compositions are administered by subcutaneous injection.
- the compositions are administered by intrathecal injection.
- the administration is via a depot injection.
- a depot injection may release the RNAi agent in a consistent way over a prolonged time period.
- a depot injection may reduce the frequency of dosing needed to obtain a desired effect, e.g., a desired inhibition of 4R-tau, or a therapeutic or prophylactic effect.
- a depot injection may also provide more consistent serum concentrations.
- Depot injections may include subcutaneous injections or intramuscular injections.
- the depot injection is a subcutaneous injection.
- the administration is via a pump.
- the pump may be an external pump or a surgically implanted pump.
- the pump is a subcutaneously implanted osmotic pump.
- the pump is an infusion pump.
- An infusion pump may be used for intracranial, intravenous, subcutaneous, arterial, or epidural infusions.
- the infusion pump is a subcutaneous infusion pump.
- the pump is a surgically implanted pump that delivers the RNAi agent to the CNS.
- the mode of administration may be chosen based upon whether local or systemic treatment is desired and based upon the area to be treated.
- the route and site of administration may be chosen to enhance targeting.
- the present disclosure also provides methods for inhibiting the expression of a 4R- tau isoform in a mammal.
- the methods include administering to the mammal a composition comprising a dsRNA of the disclosure that targets a 4R-tau transcript in a cell of the mammal, thereby inhibiting expression of the 4R-tau isoform in the cell.
- Reduction in gene expression can be assessed by any methods known it the art and by methods, e.g. qRT-PCR, described herein.
- Reduction in protein production can be assessed by any methods known it the art and by methods, e.g. ELISA, described herein.
- a CNS biopsy sample or a cerebrospinal fluid (CSF) sample serves as the tissue material for monitoring the reduction in 4R-tau mRNA or protein expression (or of a proxy therefore).
- the present disclosure further provides methods of treatment of a subject in need thereof.
- the treatment methods of the disclosure include administering an RNAi agent of the disclosure to a subject, e.g., a subject that would benefit from inhibition of 4R-tau expression, such as a subject having missense and/or deletion mutations in the MAPT gene, in a therapeutically effective amount of the RNAi agent or a pharmaceutical composition comprising the RNAi agent.
- the present disclosure provides methods of preventing, treating or inhibiting the progression of a 4R-tau-associated disease, such as a 4R-tauopathy (e.g., PSP, CBD, AGD, MSTD, GGT, spAD, or rpAD), in a subject.
- a 4R-tauopathy e.g., PSP, CBD, AGD, MSTD, GGT, spAD, or rpAD
- the methods include administering to the subject a therapeutically effective amount of any of the RNAi agent, e.g., dsRNA agents, of the disclosure or a pharmaceutical composition comprising an RNAi agent of the disclosure as provided herein, thereby preventing, treating or inhibiting the progression of a 4R-tau-associated disease or disorder in the subject.
- a 4R-tau-associated disease or disorder that can be prevented by the method of the disclosure can be associated with an abnormality of MAPT gene encoded protein 4R-tau.
- the abnormality of MAPT gene encoded protein 4R-tau results in aggregation of 4R-tau in subject’s brain.
- the subject may be human.
- RNAi agent of the disclosure may cause a decrease in 4R-tau aggregation in the subject’s brain.
- An RNAi agent of the disclosure may be administered as a “free RNAi agent.”
- a free RNAi agent is administered in the absence of a pharmaceutical composition.
- the naked RNAi agent may be in a suitable buffer solution.
- the buffer solution may comprise acetate, citrate, prolamine, carbonate, or phosphate, or any combination thereof.
- the buffer solution is phosphate buffered saline (PBS).
- RNAi agent of the disclosure may be administered as a pharmaceutical composition, such as a dsRNA liposomal formulation.
- Subjects that would benefit from a reduction or inhibition of 4R-tau isoform expression are those having a 4R-tau-associated disease.
- Exemplary 4R-tau-associated diseases include 4R-tauopathies, which include, but are not limited to, PSP, CBD, AGD, MSTD, GGT, spAD, and rpAD.
- the disclosure further provides methods for the use of an RNAi agent of the disclosure or a pharmaceutical composition thereof, e.g., for treating a subject that would benefit from reduction or inhibition of 4R-tau expression, e.g., a subject having a 4R-tau-associated disorder, in combination with other pharmaceuticals or other therapeutic methods, e.g., with known pharmaceuticals or known therapeutic methods, such as, for example, those which are currently employed for treating these disorders.
- an RNAi agent targeting 4R-tau is administered in combination with, e.g., an agent useful in treating a 4R-tau-associated disorder as described elsewhere herein or as otherwise known in the art.
- additional agents suitable for treating a subject that would benefit from reduction in 4R-tau expression may include agents currently used to treat symptoms of 4R-tau-associated diseases.
- the RNAi agent and additional therapeutic agents may be administered at the same time or in the same combination, e.g., intrathecally, or the additional therapeutic agent can be administered as part of a separate composition or at separate times or by another method known in the art or described herein.
- Exemplary additional therapeutics include, for example, a monoamine inhibitor, e.g., tetrabenazine (Xenazine), deutetrabenazine (Austedo), and reserpine, an anticonvulsant, e.g., valproic acid (Depakote, Depakene, Depacon), and clonazepam (Klonopin), an antipsychotic agent, e.g., risperidone (Risperdal), and haloperidol (Haldol), and an antidepressant, e.g., paroxetine (Paxil).
- a monoamine inhibitor e.g., tetrabenazine (Xenazine), deutetrabenazine (Austedo), and reserpine
- an anticonvulsant e.g., valproic acid (Depakote, Depakene, Depacon), and
- the method includes administering a composition featured herein such that expression of the target 4R-tau isoform is decreased, for at least one month. In preferred embodiments, expression is decreased for at least 2 months, 3 months, or 6 months.
- the RNAi agents useful for the methods and compositions featured herein specifically target RNAs (primary or processed) of the target 4R-tau isoform. Compositions and methods for inhibiting the expression of these isoforms using RNAi agents can be prepared and performed as described herein. Administration of the dsRNA according to the methods of the disclosure may result in a reduction of the severity, signs, symptoms, or markers of such diseases or disorders in a patient with a 4R-tau- associated disorder.
- reduction in this context is meant a statistically significant or clinically significant decrease in such level.
- the reduction can be, for example, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% relative to a control level.
- Efficacy of treatment or prevention of disease can be assessed, for example by measuring disease progression, disease remission, symptom severity, reduction in pain, quality of life, dose of a medication required to sustain a treatment effect, level of a disease marker or any other measurable parameter appropriate for a given disease being treated or targeted for prevention. It is well within the ability of one skilled in the art to monitor efficacy of treatment or prevention by measuring any one of such parameters, or any combination of parameters.
- efficacy of treatment of a 4R-associated disorder may be assessed, for example, by periodic monitoring of a subject’s. Comparisons of the later readings with the initial readings provide a physician an indication of whether the treatment is effective.
- RNAi agent targeting 4R-tau or pharmaceutical composition thereof “effective against” a 4R-tau-associated disorder indicates that administration in a clinically appropriate manner results in a beneficial effect for at least a statistically significant fraction of patients, such as an improvement of symptoms, a cure, a reduction in disease, extension of life, improvement in quality of life, or other effect generally recognized as positive by medical doctors familiar with treating 4R-tau-associated disorders and the related causes.
- a treatment or preventive effect is evident when there is a statistically significant improvement in one or more parameters of disease status, or by a failure to worsen or to develop symptoms where they would otherwise be anticipated.
- a favorable change of at least 10% in a measurable parameter of disease, and preferably at least 20%, 30%, 40%, 50% or more can be indicative of effective treatment.
- Efficacy for a given RNAi agent drug or formulation of that drug can also be judged using an experimental animal model for the given disease as known in the art. When using an experimental animal model, efficacy of treatment is evidenced when a statistically significant reduction in a marker or symptom is observed.
- the efficacy can be measured by a reduction in the severity of disease as determined by one skilled in the art of diagnosis based on a clinically accepted disease severity grading scale. Any positive change resulting in e.g., lessening of severity of disease measured using the appropriate scale, represents adequate treatment using an RNAi agent or RNAi agent formulation as described herein.
- subjects can be administered a therapeutic amount of dsRNA, such as about 0.01 mg/kg to about 200 mg/kg.
- subjects can be administered a therapeutic amount of dsRNA, such as about 0.01 mg/kg to about 500 mg/kg.
- subjects can be administered a therapeutic amount of dsRNA of about 500 mg/kg or more.
- the RNAi agent can be administered intrathecally, via intravitreal injection, or by intravenous infusion over a period of time, on a regular basis. In certain embodiments, after an initial treatment regimen, the treatments can be administered on a less frequent basis.
- Administration of the RNAi agent can reduce 4R-tau levels, e.g., in a cell, tissue, blood, CSF sample or other compartment of the patient. In one embodiment, administration of the RNAi agent can reduce 4R-tau levels, e.g., in a cell, tissue, blood, CSF sample or other compartment of the patient by at least about 25%, such as about 25%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 95% relative to a control level.
- RNAi agent can be administered subcutaneously, i.e., by subcutaneous injection.
- One or more injections may be used to deliver the desired, e.g., monthly dose of RNAi agent to a subject.
- the injections may be repeated over a period of time.
- the administration may be repeated on a regular basis.
- a repeat-dose regimen may include administration of a therapeutic amount of RNAi agent on a regular basis, such as monthly or extending to once a quarter, twice per year, once per year.
- the RNAi agent is administered about once per month to about once per quarter (i.e., about once every three months).
- RNAi Agent Design, Synthesis, Selection, and in vitro Evaluation This Example describes methods for the design, synthesis, selection, and in vitro evaluation of candidate 4R-tau RNAi agents.
- reagents targeting exon 10 SEQ ID NO: 13, nucleotides 973-1065 of SEQ ID NO: 3
- MAPT Homo sapiens microtubule associated protein tau
- transcript variant 2 mRNA
- NCBI refseqID NM_005910.6 NCBI GeneID: 4137
- the human NM_005910.6 mRNA has a length of 5,639 bases.
- BE(2)-C were transfected by adding 5 ⁇ L of Opti-MEM plus 0.1 ⁇ L of Lipofectamine RNAimax per well (Invitrogen, Carlsbad CA. cat # 13778-150) to 5 ⁇ Lof siRNA duplexes per well, with 4 replicates of each siRNA duplex, into a 384-well plate, and incubating at room temperature for 15 minutes. Forty ⁇ L of 1:1 mixture of Minimum Essential Medium and F12 Medium (ThermoFisher) containing ⁇ 5 x10 3 cells were then added to the siRNA mixture. Cells were incubated for 24 hours prior to RNA purification. Three dose experiments were performed at 10nM, 1nM and 0.1nM.
- RNA isolation using DYNABEADS mRNA Isolation Kit RNA was isolated using an automated protocol on a BioTek-EL406 platform using DYNABEADs (Invitrogen, cat#61012). Briefly, 70 ⁇ L of Lysis/Binding Buffer and 10 ⁇ L of lysis buffer containing 3 ⁇ L of magnetic beads were added to the plate with cells. Plates were incubated on an electromagnetic shaker for 10 minutes at room temperature and then magnetic beads were captured and the supernatant was removed. Bead-bound RNA was then washed 2 times with 150 ⁇ L Wash Buffer A and once with Wash Buffer B.
- RNA isolation was then washed with 150 ⁇ L Elution Buffer, re-captured and supernatant removed.
- iii cDNA synthesis using ABI High capacity cDNA reverse transcription kit (Applied Biosystems, Foster City, CA, Cat #4368813): Ten ⁇ L of a master mix containing 1 ⁇ L ⁇ 10X Buffer, 0.4ul 25X dNTPs, 1 ⁇ L ⁇ 10x Random primers, 0.5 ⁇ L ⁇ Reverse Transcriptase, 0.5 ⁇ L ⁇ RNase inhibitor and 6.6 ⁇ L of water per reaction was added to RNA isolated above. Plates were sealed, mixed, and incubated on an electromagnetic shaker for 10 minutes at room temperature, followed by 2 hours at 37 o C.
- Each duplex was tested at least two times and data were normalized to cells transfected with a non-targeting control siRNA. To calculate relative fold change, real time data were analyzed using the ⁇ Ct method and normalized to assays performed with cells transfected with a non-targeting control siRNA. Table 2. Abbreviations of nucleotide monomers used in nucleic acid sequence representation.
- Example 2 In Vivo Evaluation in Transgenic Mice This Example describes methods for the in vivo evaluation of MAPT RNAi agents in transgenic mice expressing human MAPT RNAs. The ability of selected candidate dsRNA agents designed and assayed in Example 1 are assessed for their ability to reduce the level of both sense- or antisense-containing foci in mice expressing human MAPT RNAs. Briefly, duplexes of interest, identified from the above in vitro studies and shown in Tables 3- 5, are evaluated in vivo.
- mice are transduced by retroorbital administration of 2x10 10 genome copies of AAV that expresses a portion of the human MAPT gene.
- mice are administered an AAV encoding a portion of human MAPT gene coding exon 10 of sequence of NM_005910, cloned in it.
- the mice are administered subcutaneously a single dose of one of the dsRNA agents of interest at 3mg/Kg or PBS control.
- animals are sacrificed, liver samples are collected and snap-frozen in liquid nitrogen.
- Tissue mRNA is extracted and analyzed by the RT-QPCR method for human 4R-tau expression.
- Human MAPT mRNA levels are compared to housekeeping gene GAPDH and normalized to the average of levels in the corresponding PBS vehicle control group. The values are then normalized to the average of PBS vehicle control group. The data may be expressed as percent of baseline value, and presented as mean plus standard deviation.
- Example 3 In vitro Screening for 4R-preferential mRNA suppression The human MAPT gene encodes 6 different isoforms of tau: 2N4R, 1N4R, 0N4R, 2N3R, 1N3R, 0N3R.
- transcripts containing the 4R (4 repeat) versus 3R (3 repeat) tau are based on the inclusion (4R) or exclusion (3R) of exon 10.
- Humans normally express equal ratios of 3R and 4R tau.
- some tauopathies such as Alzheimer’s disease
- experimental evidence from post- mortem brain tissue suggest that the insoluble aggregates of tau are comprised of 3R and 4R tau.
- rarer tauopathy diseases such as progressive supranuclear palsy (PSP) and cortical basal degeneration (CBD)
- the 4R tau proteins are the aggregate-prone species of tau. Therapies which target total tau (e.g., 3R + 4R tau) versus only 4R tau could have beneficial effects in different disease states.
- siRNAs specifically targeting 4R tau and not 3R tau was sought. Because mRNA assays to measure 3R tau was lacking, a dual reporter cell line was created in which full-length 2N4R tau was fused to YFP, and 2N3R Tau was fused to mCherry. Thus, the mCherry mRNA was used as a surrogate for siRNA activity against 3R tau. To test candidate 4R-preferential siRNAs, a dual reporter HEK2932N4R-YFP fusion protein + 2N3R-mCherry fusion protein cell line was used.
- YFP expression is a proxy for 4R-tau levels
- mCherry expression is a proxy for 3R-tau levels.
- Sixty-five different siRNAs targeting exon 10 (R2 domain of tau) were synthesized by walking the entirety of the exon.
- Two total tau siRNAs were used as a positive control, a YFP siRNA was used as a YFP knockdown control, and an mCherry siRNA was used as an mCherry knockdown control. Doses of 0.1 nM and 1 nM were tested in triplicate at 24 hours after treatment. TaqMan assays for total tau, 4R-tau, mCherry (3R tau surrogate), and YFP (4R tau surrogate) were performed. Relative 4R tau and mCherry expression for the 65 candidate 4R siRNA duplexes are shown in Figure 3.
- HEK293-2N4R-YFP + 2N3R-mCherry cells were treated with 1 nM of GalNAc-conjugated siRNA in lipofectamine and harvested 48 hours later for TaqMan assays (mCherry and YFP).
- the left bar shows the results of the 4R assay
- the right bar shows the results for the mCherry assay (surrogate for 3R tau).
- siRNAs were selected as 4R-preferential if they resulted in robust knockdown of 4R-tau (at least 70% reduction of mRNA) and little knockdown effect on mCherry (no more than 30% reduction of mCherry mRNA).
- thirteen of the sixty-five candidate 4R-tau siRNAs met these criteria when dosed at 1 nM (i.e., no more than 30% of 4R-tau message remaining and no greater than 30% knockdown of mCherry at 1 nM): AD-142376; AD-142383; AD-142385; AD-142387; AD- 142388; AD-142389; AD-142391; AD-142394; AD-142395; AD-142396; AD-142397; AD-142399; and AD-1423300.
- Relative 4R-tau and mCherry expression for the thirteen selected siRNAs are shown in Figure 2.
- AD-1397080.2 has the unmodified sense sequence UGCAAAUAGUCUACAAACCAA (SEQ ID NO: 638), and unmodified antisense sequence UUGGTUTGUAGACUAUUUGCACA (SEQ ID NO: 639).
- the modified sense sequence is usgscaa(Ahd)uaGfUfCfuacaaaccaaL96 (SEQ ID NO: 640) and modified antisense sequence is VPusUfsggdTu(Tgn)guagacUfaUfuugcascsa (SEQ ID NO: 641).
- Analysis of the MAPT sequences targeted by the thirteen selected siRNAs revealed a particularly efficacious region of exon 10 for 4R-preferential knockdown targeting, suggesting a likely “hotspot.” See Figure 4.
- any RNAi agents possessing target sequences that reside fully within the following window of exon 10 positions are likely to exhibit a robust 4R-tau inhibitory effect: MAPT NM_005910.6 positions 1007-1053. It is also expressly contemplated that any RNAi agents possessing target sequences that reside fully within the following window of exon 10 positions may likely exhibit at least some degree of preference for knockdown of 4R-tau relative to 3R-tau (e.g., a significantly greater inhibition of 4R-tau than of 3R-tau).
- Example 4 Validation of 4R-Preferential mRNA Suppression Following identification of the thirteen 4R preferential siRNAs, the duplexes were further studied and ranked in order to select candidates for in vivo testing. To do this, dose-response experiments were performed in the dual-reporter cells lines (HEK203 2N4R-YFP + 2N3R-mCherry) and expression of 4R tau and YFP (surrogate for 4R tau) and mCherry (surrogate for 3R tau) were evaluated. From these data, IC50 curves were generated to evaluate potency and knockdown efficiency at a fixed dose (summarized in tables with IC50 values and knockdown at 100 pM in Figure 5).
- the three most potent 4R preferential siRNAs (AD-1423291.2, AD-1423283.2, AD-1423294.2), plus one siRNA (AD- 1423295.2) that had mixed selectivity (4R > 3R) were selected, which provided siRNAs that have a more potent effect on 4R and/or reduce 3R to a lesser extent).
- a 4R preferential knockdown was validated with the duplexes using protein dot blotting with commercially available total tau antibody (mouse monoclonal; clone Tau12), 4R tau antibody (mouse monoclonal, clone 7D12.1), and 3R tau antibody (mouse monoclonal, clone 8E6 ⁇ C11).
- Lysates were collected in RIPA buffer supplemented with protease/phosphatase inhibitors, a total of 7 ⁇ g (for total tau dot blot), or 21 ⁇ g (for 4R tau dot blot), or 7 ⁇ g (for 3R tau dot blot) was spotted into the dot blot apparatus, and blots were subjected to blotting with the total tau, 4R tau and 3R tau antibodies. The results validated the 4R preferential knockdown observed in the HEK293 dual reporter cells.
- AD-1091966 has the unmodified sense sequence CGCAUGGUCAGUAAAAGCAAA (SEQ ID NO: 642), and unmodified antisense sequence UUUGCUUUUACUGACCAUGCGAG (SEQ ID NO: 643).
- the modified sense sequence is csgscau(Ghd)GfuCfAfGfuaaagcasasa (SEQ ID NO: 644) and modified antisense sequence is VPusUfsugcUfuUfUfacugAfcCfaugcgsasg (SEQ ID NO: 645).
- a 4R preferential knockdown was also validated with the duplexes using protein ELISA-type assays.
- siRNAs with identical targeting sequences had to be synthesized with C16 conjugates to allow for CNS cell delivery.
- Intracerebral injection of 300 ⁇ g of each siRNA was performed and the siRNA was allowed to incubate in vivo for 30 days.
- the reporter tags YFP and mCherry were not able to be used to assess levels of 4R and 3R tau mRNA and protein.
- total tau TaqMan assays to assess global levels of 3R +4R tau
- 4R tau assays were used. See Figure 9.
- Dot blotting was performed with the total tau, 3R tau, and 4R tau antibodies on the brain lysates of the MAPT humanized mice that were treated with the 4R tau siRNAs. Lysates were collected, and a total of 1 ⁇ g/well (for total tau dot blot), 1 ⁇ g/well (for 4R tau dot blot), or 5 ⁇ g/well (for 3R tau dot blot) was spotted into the dot blot apparatus, and blots were subjected to blotting with the total tau, 4R tau and 3R tau antibodies. The results confirmed the 4R preferential knockdown for the top 4 siRNAs (data not shown).
- RNAscope assays to detect mRNA for 3R tau, 4R tau, and total tau are performed on neuronal cultures (in vitro) and on slices from the brains of mice treated with the 4R tau preferential siRNAs.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicinal Preparation (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Priority Applications (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2024547599A JP2025507372A (ja) | 2022-02-11 | 2023-02-10 | 微小管関連タンパク質タウ(MAPT)iRNA剤組成物およびその使用方法 |
| US18/837,453 US20250171777A1 (en) | 2022-02-11 | 2023-02-10 | Microtubule Associated Protein Tau (MAPT) iRNA Agent Compositions and Methods of Use Thereof |
| EP23753727.9A EP4476338A2 (en) | 2022-02-11 | 2023-02-10 | Microtubule associated protein tau (mapt) irna agent compositions and methods of use thereof |
| CN202380029685.XA CN118922537A (zh) | 2022-02-11 | 2023-02-10 | 微管相关蛋白Tau(MAPT)iRNA剂组合物及其使用方法 |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202263309399P | 2022-02-11 | 2022-02-11 | |
| US63/309,399 | 2022-02-11 | ||
| US202263322618P | 2022-03-22 | 2022-03-22 | |
| US63/322,618 | 2022-03-22 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2023154900A2 true WO2023154900A2 (en) | 2023-08-17 |
| WO2023154900A3 WO2023154900A3 (en) | 2023-09-28 |
Family
ID=87565165
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2023/062440 Ceased WO2023154900A2 (en) | 2022-02-11 | 2023-02-10 | Microtubule associated protein tau (mapt) irna agent compositions and methods of use thereof |
Country Status (4)
| Country | Link |
|---|---|
| US (1) | US20250171777A1 (https=) |
| EP (1) | EP4476338A2 (https=) |
| JP (1) | JP2025507372A (https=) |
| WO (1) | WO2023154900A2 (https=) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12551569B2 (en) | 2024-03-31 | 2026-02-17 | Arrowhead Pharmaceuticals, Inc. | RNAi agents for inhibiting expression of microtubule associated protein tau (MAPT), compositions thereof, and methods of use |
| WO2026048822A1 (ja) * | 2024-08-30 | 2026-03-05 | 東亞合成株式会社 | Mapt rna配列に基づく新規二本鎖rna及びその利用 |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2145014B1 (en) | 2007-04-05 | 2012-12-12 | The J. David Gladstone Institutes | Agents that reduce neuronal overexcitation |
| US10513701B2 (en) * | 2015-03-25 | 2019-12-24 | Università Degli Studi Di Trento | RNA interference mediated therapy for neurodegenerative diseases |
| AU2021246024A1 (en) | 2020-03-30 | 2022-10-27 | Alnylam Pharmaceuticals, Inc. | Microtubule associated protein Tau (MAPT) iRNA agent compositions and methods of use thereof |
-
2023
- 2023-02-10 JP JP2024547599A patent/JP2025507372A/ja active Pending
- 2023-02-10 US US18/837,453 patent/US20250171777A1/en active Pending
- 2023-02-10 EP EP23753727.9A patent/EP4476338A2/en active Pending
- 2023-02-10 WO PCT/US2023/062440 patent/WO2023154900A2/en not_active Ceased
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12551569B2 (en) | 2024-03-31 | 2026-02-17 | Arrowhead Pharmaceuticals, Inc. | RNAi agents for inhibiting expression of microtubule associated protein tau (MAPT), compositions thereof, and methods of use |
| WO2026048822A1 (ja) * | 2024-08-30 | 2026-03-05 | 東亞合成株式会社 | Mapt rna配列に基づく新規二本鎖rna及びその利用 |
Also Published As
| Publication number | Publication date |
|---|---|
| EP4476338A2 (en) | 2024-12-18 |
| JP2025507372A (ja) | 2025-03-18 |
| US20250171777A1 (en) | 2025-05-29 |
| WO2023154900A3 (en) | 2023-09-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20230203486A1 (en) | MICROTUBULE ASSOCIATED PROTEIN TAU (MAPT) iRNA AGENT COMPOSITIONS AND METHODS OF USE THEREOF | |
| US12516322B2 (en) | Microtubule associated protein Tau (MAPT) iRNA agent compositions and methods of use thereof | |
| US20240301426A1 (en) | Leucine-rich repeat kinase 2 (lrrk2) irna agent compositions and methods of use thereof | |
| JP7826211B2 (ja) | ロイシンリッチリピートキナーゼ2(LRRK2)iRNA剤組成物およびその使用方法 | |
| AU2022246786A1 (en) | Huntingtin (htt) irna agent compositions and methods of use thereof | |
| EP4298220A1 (en) | Prion protein (prnp) irna compositions and methods of use thereof | |
| EP4291654A2 (en) | Superoxide dismutase 1 (sod1) irna compositions and methods of use thereof for treating or preventing superoxide dismutase 1- (sod1-) associated neurodegenerative diseases | |
| US20250171777A1 (en) | Microtubule Associated Protein Tau (MAPT) iRNA Agent Compositions and Methods of Use Thereof | |
| EP4013870A1 (en) | Small ribosomal protein subunit 25 (rps25) irna agent compositions and methods of use thereof | |
| US20250283079A1 (en) | ACTIN-BINDING LIM PROTEIN 3 (ABLIM3) iRNA AGENT COMPOSITIONS AND METHODS OF USE THEREOF | |
| WO2021202902A1 (en) | ALPHA-2A ADRENERGIC RECEPTOR (ADRA2A) iRNA AGENT COMPOSITIONS AND METHODS OF USE THEREOF | |
| EP4308130A1 (en) | Stearoyl-coa desaturase 5 (scd5) irna agent compositions and methods of use thereof | |
| US20240209373A1 (en) | ELONGATION OF VERY LONG CHAIN FATTY ACIDS PROTEIN 1 (ELOVL1) iRNA AGENT COMPOSITIONS AND METHODS OF USE THEREOF |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 23753727 Country of ref document: EP Kind code of ref document: A2 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 18837453 Country of ref document: US Ref document number: 2024547599 Country of ref document: JP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2023753727 Country of ref document: EP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 202380029685.X Country of ref document: CN |
|
| ENP | Entry into the national phase |
Ref document number: 2023753727 Country of ref document: EP Effective date: 20240911 |
|
| WWP | Wipo information: published in national office |
Ref document number: 18837453 Country of ref document: US |