WO2023154693A1 - Aav capsid variants and uses thereof - Google Patents
Aav capsid variants and uses thereof Download PDFInfo
- Publication number
- WO2023154693A1 WO2023154693A1 PCT/US2023/062101 US2023062101W WO2023154693A1 WO 2023154693 A1 WO2023154693 A1 WO 2023154693A1 US 2023062101 W US2023062101 W US 2023062101W WO 2023154693 A1 WO2023154693 A1 WO 2023154693A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- amino acid
- acid sequence
- aav capsid
- capsid variant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/0008—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition
- A61K48/0025—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition wherein the non-active part clearly interacts with the delivered nucleic acid
- A61K48/0041—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition wherein the non-active part clearly interacts with the delivered nucleic acid the non-active part being polymeric
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/0075—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the delivery route, e.g. oral, subcutaneous
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
- C07K7/04—Linear peptides containing only normal peptide links
- C07K7/06—Linear peptides containing only normal peptide links having 5 to 11 amino acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1058—Directional evolution of libraries, e.g. evolution of libraries is achieved by mutagenesis and screening or selection of mixed population of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B40/00—Libraries per se, e.g. arrays, mixtures
- C40B40/04—Libraries containing only organic compounds
- C40B40/06—Libraries containing nucleotides or polynucleotides, or derivatives thereof
- C40B40/08—Libraries containing RNA or DNA which encodes proteins, e.g. gene libraries
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
- C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
- C12N2750/14145—Special targeting system for viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14151—Methods of production or purification of viral material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/008—Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/50—Vector systems having a special element relevant for transcription regulating RNA stability, not being an intron, e.g. poly A signal
Definitions
- AAV-derived vectors are promising tools for clinical gene transfer because of their non- pathogenic nature, their low immunogenic profile, low rate of integration into the host genome and long-term transgene expression in non-dividing cells.
- AAV capsids with improved properties, e.g., improved tropism to a target cell or tissue upon systemic administration, have had limited success. As such, there is a need for improved methods of producing AAV capsids and resulting AAV capsids for delivery of a payload of interest to a target cell or tissue, e.g., a CNS cell or tissue, or a muscle cell or tissue.
- a target cell or tissue e.g., a CNS cell or tissue, or a muscle cell or tissue.
- AAV capsid polypeptide e.g., an AAV capsid variant (e.g., an AAV5 capsid variant).
- the AAV capsid variant has an enhanced tropism for a tissue or a cell, e.g., a CNS tissue, a CNS cell, a heart cell, a heart tissue, a muscle cell, a muscle tissue, a liver cell, or a liver tissue.
- Said tropism can be useful for delivery of a payload, e.g., a payload described herein, to a cell or tissue, for the treatment of a disorder, e.g., a neurological or a neurodegenerative disorder, a muscular or a neuromuscular disorder, or a neuro- oncological disorder.
- the present disclosure provides an AAV capsid variant, e.g., an AAV5 capsid variant, which comprises an amino acid other than T at position 577 (e.g., Y, N, or C), numbered relative to SEQ ID NO: 138.
- the AAV capsid variant comprises a Y at position 577, numbered relative to SEQ ID NO: 138.
- the AAV capsid variant comprises a N at position 577, numbered relative to SEQ ID NO: 138.
- the AAV capsid variant comprises a C at position 577, numbered relative to SEQ ID NO: 138.
- an AAV capsid variant e.g., a variant of the wild-type AAV5 capsid, which comprises more than one amino acid that replaces the threonine (T) at position 577, numbered relative to SEQ ID NO: 138.
- T threonine
- an insert of two, three, four, five, six, seven, eight, nine, or ten amino acids replaces the T at position 577, numbered relative to SEQ ID NO: 138.
- an insert of eight amino acids replaces the T at position 577, numbered relative to SEQ ID NO: 138.
- an AAV capsid variant (e.g., an AAV5 capsid variant) comprising the formula [N2]-[N3], wherein: (i) [N2] comprises positions X1, X2, X3, X4, and X5, wherein: (a) position X1 is Y, N, or C; (b) position X2 is P, K, T, or Q; (c) position X3 is A or P; (d) position X4 is E, S, or A; and (e) position X5 is V, L, or E; and (ii) the amino acid sequence of [N3] comprises the amino acid sequence of VQK, EQK, VKK, VHK, VQQ, or LQK; and optionally wherein the AAV capsid variant comprises an amino acid modification, e.g., a conservative substitution, of any of the aforesaid amino acids in (i) and/or (ii); optionally wherein [N2] comprises positions X1, X2,
- [N2] comprises Y at position X1. In some embodiments, [N2] comprises P at position X2. In some embodiments, [N2] comprises A at position X3. In some embodiments, [N2] comprises E at position X4. In some embodiments, [N2] comprises V at position X5. In some embodiments, the amino acid sequence of [N3] is VQK.
- X1 of [N2] is present at position 577
- X2 of [N2] is present at position 578
- X3 of [N2] is present at position 579
- X4 of [N2] is present at position 580
- X5 of [N2] is present at position 581, numbered according to SEQ ID NO: 982.
- [N2] is present at positions 577-581, numbered according to SEQ ID NO: 982.
- [N3] is present at positions 582-584, numbered according to SEQ ID NO: 982.
- [N2]-[N3] is present at positions 577-584, numbered according to SEQ ID NO: 982.
- the amino acid sequence of [N2] consists of YPAEV (SEQ ID NO: 1). In some embodiments, the amino acid sequence of [N3] consists of VQK. In some embodiments, [N2]-[N3] replaces the threonine (T) at position 577 of wild-type AAV5, e.g., SEQ ID NO: 138.
- [N2]-[N3] replaces the threonine (T) at position 577 of wild-type AAV5, e.g., SEQ ID NO: 138, and the amino acid sequence of [N2] consists of YPAEV (SEQ ID NO: 1), and the amino acid sequence of [N3] consists of VQK.
- [N2] is present at positions 577-581, numbered according to SEQ ID NO: 982.
- [N3] is present at positions 582-584, numbered according to SEQ ID NO: 982.
- [N2]-[N3] is present at positions 577-584, numbered according to SEQ ID NO: 982.
- an AAV capsid variant comprising one, two, three, or all of: (i) an [N0], wherein the amino acid sequence of [N0] comprises TNN, TNT, INN, TNS, NNN, or TNK; (ii) an [N1], wherein the amino acid sequence of [N1] comprises QSS, QSK, TSL, SSS, QSR, AGA, IGS, QAS, ASS, LGS, QST, HSS, LSS, or QRS; (iii) an [N2], wherein the amino acid sequence of [N2] comprises YPAEV (SEQ ID NO: 1), YPPSL (SEQ ID NO: 2), NKAEV (SEQ ID NO: 3), YTAEV (SEQ ID NO: 4), YPAEE (SEQ ID NO: 5), YQAEV (SEQ ID NO: 6), YTPSL (SEQ ID NO: 7),
- the amino acid sequence of [N0] is TNN. In some embodiments, the amino acid sequence of [N1] is QSS. In some embodiments, the amino acid sequence of [N2] is YPAEV (SEQ ID NO: 1). In some embodiments, the amino acid sequence of [N3] is VQK. In some embodiments, the amino acid sequence of [N4] is TA. In some embodiments, the amino acid sequence of [N0] is TNN, the amino acid sequence of [N1] is QSS, the amino acid sequence of [N2] is YPAEV (SEQ ID NO: 1), the amino acid sequence of [N3] is VQK, and/or the amino acid sequence of [N4] is TA.
- the amino acid sequence of [N0] is TNN
- the amino acid sequence of [N1] is QSS
- the amino acid sequence of [N2] is YPAEV (SEQ ID NO: 1)
- the amino acid sequence of [N3] is VQK
- the amino acid sequence of [N4] is TA.
- [N0] is present immediately subsequent to position 570, numbered relative to SEQ ID NO: 138.
- [N0] replaces positions 571- 573 (e.g., T571, N572, and N573), numbered relative to SEQ ID NO: 138.
- [N0] is present immediately subsequent to position 570, and [N0] positions 571-573 (e.g., T571, N572, and N573), numbered relative to SEQ ID NO: 138.
- [N1] is present immediately subsequent to position 573, numbered relative to SEQ ID NO: 138.
- [N1] replaces positions 574-576 (e.g., Q574, S575, and S576), numbered relative to SEQ ID NO: 138.
- [N1] is present immediately subsequent to position 573, and [N1] replaces positions 574-576 (e.g., Q574, S575, and S576), numbered relative to SEQ ID NO: 138.
- [N2] is present immediately subsequent to position 576, numbered relative to SEQ ID NO: 138.
- [N2] replaces position 577 (e.g., T577), numbered relative to SEQ ID NO: 138.
- [N2] is present immediately subsequent to position 576, and [N2] replaces position 577 (e.g., T577), numbered relative to SEQ ID NO: 138.
- [N2]-[N3] is present immediately subsequent to position 576, numbered relative to SEQ ID NO: 138. In any of these embodiments, [N2]-[N3] replaces position 577 (e.g., T577), numbered relative to SEQ ID NO: 138. In any of these embodiments, [N2]-[N3] is present immediately subsequent to position 576, and [N2]-[N3] replaces position 577 (e.g., T577), numbered relative to SEQ ID NO: 138.
- [N2]- [N3]-[N4] replaces positions 577-579 (e.g., T577, T578, and A579), numbered relative to SEQ ID NO: 138.
- [N2]-[N3]-[N4] is present immediately subsequent to position 576, and [N2]-[N3]-[N4] replaces positions 577-579 (e.g., T577, T578, and A579), numbered relative to SEQ ID NO: 138.
- [N0]-[N1]-[N2]-[N3]-[N4] is present immediately subsequent to position 570, numbered relative to SEQ ID NO: 138.
- [N0]-[N1]-[N2]-[N3]-[N4] replaces positions 571-579 (e.g., T571, N572, N573, Q574, S575, S576, T577, T578, and A579), numbered relative to SEQ ID NO: 138.
- [N0]-[N1]-[N2]-[N3]-[N4] is present immediately subsequent to position 570, and [N0]-[N1]-[N2]- [N3]-[N4] replaces positions 571-579 (e.g., T571, N572, N573, Q574, S575, S576, T577, T578, and A579), numbered relative to SEQ ID NO: 138.
- [N0]-[N1]-[N2]- [N3]-[N4] is TNNQSSYPAEVVQKTA (SEQ ID NO: 1533) and is present immediately subsequent to position 570, numbered relative to SEQ ID NO: 138, wherein [N2]-[N3] (YPAEVVQK (SEQ ID NO: 943)) replaces position 577 (e.g., replaces T577), numbered relative to SEQ ID NO: 138.
- [N0] is present at positions 571-573, numbered according to SEQ ID NO: 982.
- [N1] is present at positions 574-576, numbered according to SEQ ID NO: 982.
- [N2] is present at positions 577-581, numbered according to SEQ ID NO: 982.
- [N3] is present at positions 582-584, numbered according to SEQ ID NO: 982.
- [N4] is present at positions 585-586, numbered according to SEQ ID NO: 982.
- [N2]-[N3] is present at positions 577-584, numbered according to SEQ ID NO: 982.
- [N0]-[N1]-[N2]-[N3]-[N4] is present at positions 571-586, numbered according to SEQ ID NO: 982.
- an AAV capsid variant (e.g., an AAV5 capsid variant) comprising the formula [B]-[C], wherein: (i) [B] comprises positions X1, X2, and X3, wherein: (a) position X1 is Q, T, S, A, I, L, or H; (b) position X2 is S, G, or A; and (c) position X3 is S, K, L, R, or A; and (ii) [C] comprises the amino acid sequence of YPAEVVQK (SEQ ID NO: 943); and optionally wherein the AAV capsid variant comprises an amino acid modification, e.g., a conservative substitution, of any of the aforesaid amino acids in (i) and/or (ii); and further optionally wherein [B] is present immediately subsequent to position 573, numbered relative to SEQ ID NO: 138.
- AAV capsid variant comprises an amino acid modification, e.g., a conservative substitution, of any
- [B] comprises Q at position X1. In some embodiments, [B] comprises S at position X2. In some embodiments, [B] comprises S at position X3. In some embodiments, the amino acid sequence of [B] is QSS. In some embodiments, [B] is present immediately subsequent to position 573, relative to a reference sequence numbered according to SEQ ID NO: 138. In some embodiments, [B] replaces positions 574-576 (e.g., Q574, S575, and S576), relative to a reference sequence numbered according to SEQ ID NO: 138.
- positions 574-576 e.g., Q574, S575, and S576
- [B] is present immediately subsequent to position 573, and [B] replaces positions 574-576 (e.g., Q574, S575, and S576), relative to a reference sequence numbered according to SEQ ID NO: 138.
- [C] is present immediately subsequent to position 576, relative to a reference sequence numbered according to SEQ ID NO: 138.
- [C] replaces position 577 (e.g., T577), relative to a reference sequence numbered according to SEQ ID NO: 138.
- [C] is present immediately subsequent to position 576, and [C] replaces position 577 (e.g., T577), relative to a reference sequence numbered according to SEQ ID NO: 138.
- [B]-[C] is present immediately subsequent to position 573, relative to a reference sequence numbered according to SEQ ID NO: 138.
- [B]-[C] replaces positions 574-577 (e.g., Q574, S575, S576, and T577), relative to a reference sequence numbered according to SEQ ID NO: 138.
- [B]-[C] is present immediately subsequent to position 573, and [B]-[C] replaces positions 574-577 (e.g., Q574, S575, S576, and T577), relative to a reference sequence numbered according to SEQ ID NO: 138.
- X1 of [B] is present at position 574
- X2 of [B] is present at position 575
- X3 of [B] is present at position 576, numbered according to SEQ ID NO: 982.
- [B] is present at positions 574-576, numbered according to SEQ ID NO: 982.
- [C] is present at positions 577-584, numbered according to SEQ ID NO: 982.
- [B]-[C] is present at positions 574-584, numbered according to SEQ ID NO: 982.
- the present disclosure provides an AAV capsid variant (e.g., an AAV5 capsid variant) comprising one, two, three, or all of (i) an [A], wherein the amino acid sequence of [A] comprises TNN, TNT, INN, NNN, TNS, or TNK; (ii) a [B], wherein the amino acid sequence of [B] comprises QSS, TSL, SSS, QSR, QSK, AGA, IGS, QAS, ASS, LGS, or HSS; (iii) a [C], wherein [C] comprises the amino acid sequence of YPAEVVQK (SEQ ID NO: 943); and (iv) a [D], wherein [D] comprises the amino acid sequence of TA or PA; and optionally wherein the AAV capsid variant comprises an amino acid modification, e.g.
- the amino acid sequence of [A] is TNN. In some embodiments, the amino acid sequence of [B] is QSS. In some embodiments, the amino acid sequence of [A] is TNN and the amino acid sequence of [B] is QSS. In some embodiments, the amino acid sequence of [A] is TNN, the amino acid sequence of [B] is QSS, and the amino acid sequence of [C] is YPAEVVQK (SEQ ID NO: 943). In some embodiments, the amino acid sequence of [A] is TNN, the amino acid sequence of [B] is QSS, the amino acid sequence of [C] is YPAEVVQK (SEQ ID NO: 943), and the amino acid sequence of [D] is TA.
- [A] is present immediately subsequent to position 570, numbered relative to SEQ ID NO: 138. In any of these embodiments, [A] replaces positions 571-573 (e.g., T571, N572, and N573) numbered relative to SEQ ID NO: 138. In any of these embodiments, [A] is present immediately subsequent to position 570, and [A] replaces positions 571-573 (e.g., T571, N572, and N573) numbered relative to SEQ ID NO: 138. In any of these embodiments, [B] is present immediately subsequent to position 573, relative to a reference sequence numbered according to SEQ ID NO: 138.
- [B] replaces positions 574- 576 (e.g., Q574, S575, and S576), numbered relative to SEQ ID NO: 138.
- [B] is present immediately subsequent to position 573, and [B] replaces positions 574- 576 (e.g., Q574, S575, and S576), numbered relative to SEQ ID NO: 138.
- [C] is present immediately subsequent to position 576, numbered relative to SEQ ID NO: 138.
- [C] replaces position 577 (e.g., T577), numbered relative to SEQ ID NO: 138.
- [C] is present immediately subsequent to position 576, and [C] replaces position 577 (e.g., T577), numbered relative to SEQ ID NO: 138.
- [B]-[C] is present immediately subsequent to position 573, numbered relative to SEQ ID NO: 138.
- [B]-[C] replaces positions 574-577 (e.g., Q574, S575, S576, and T577), numbered relative to SEQ ID NO: 138.
- [B]-[C] is present immediately subsequent to position 573, and [B]-[C] replaces positions 574-577 (e.g., Q574, S575, S576, and T577), numbered relative to SEQ ID NO: 138.
- [C]-[D] is present immediately subsequent to position 576, numbered relative to SEQ ID NO: 138.
- [C]-[D] replaces positions 577-579 (e.g., T577, T578, and A579), numbered relative to SEQ ID NO: 138.
- [A]-[B]-[C]-[D] is present immediately subsequent to position 570, numbered relative to SEQ ID NO: 138.
- [A]-[B]-[C]-[D] replaces positions 571-579 (e.g., T571, N572, N573, Q574, S575, S576, T577, T578, and A579), numbered relative to SEQ ID NO: 138.
- [A]-[B]-[C]-[D] is present immediately subsequent to position 570, and [A]-[B]-[C]-[D] replaces positions 571-579 (e.g., T571, N572, N573, Q574, S575, S576, T577, T578, and A579), numbered relative to SEQ ID NO: 138.
- positions 571-579 e.g., T571, N572, N573, Q574, S575, S576, T577, T578, and A579
- [A]-[B]-[C]-[D] is TNNQSSYPAEVVQKTA (SEQ ID NO: 1533) and is present immediately subsequent to position 570, numbered relative to SEQ ID NO: 138, wherein [C] (YPAEVVQK (SEQ ID NO: 943)) replaces position 577 (e.g., replaces T577) numbered relative to SEQ ID NO: 138.
- [A] is present at positions 571-573, numbered according to SEQ ID NO: 982.
- [B] is present at positions 574-576, numbered according to SEQ ID NO: 982.
- [C] is present at positions 577-584, numbered according to SEQ ID NO: 982.
- [D] is present at positions 585-586, numbered according to SEQ ID NO: 982.
- [A]- [B]-[C]-[D] is present at positions 571-586, numbered according to SEQ ID NO: 982.
- an AAV capsid variant (e.g., an AAV5 capsid variant) comprising the formula [N2]-[N3], wherein: (i) [N2] comprises positions X1, X2, X3, X4, and X5, wherein: (a) position X1 is Y or T; (b) position X2 is Q, T, P, or E; (c) position X3 is A; (d) position X4 is E or D; and (e) position X5 is V or E; and (ii) [N3] comprises the amino acid sequence of VQK or VQN; and optionally wherein the AAV capsid variant comprises an amino acid modification, e.g., a conservative substitution, of any of the aforesaid amino acids in (i) and/or (ii); and further optionally wherein [N2]-[N3] is present immediately subsequent to position 576, numbered relative to SEQ ID NO: 138 and
- the amino acid sequence of [N2] consists of YPAEV (SEQ ID NO: 1). In some embodiments, the amino acid sequence of [N3] consists of VQK. In some embodiments, [N2]- [N3] replaces position 577 (e.g., T577) of wild-type AAV5, e.g., SEQ ID NO: 138. In some embodiments, [N2]-[N3] replaces the threonine (T) at position 577 of wild-type AAV5, e.g., SEQ ID NO: 138, and the amino acid sequence of [N2] consists of YPAEV (SEQ ID NO: 1), and the amino acid sequence of [N3] consists of VQK.
- [N2]- [N3] replaces position 577 (e.g., T577) of wild-type AAV5, e.g., SEQ ID NO: 138.
- [N2]-[N3] replaces the threonine (T)
- X1 of [N2] is present at position 577
- X2 of [N2] is present at position 578
- X3 of [N2] is present at position 579
- X4 of [N2] is present at position 580
- X5 of [N2] is present at position 581, numbered according to SEQ ID NO: 982.
- [N2] is present at positions 577-581, numbered according to SEQ ID NO: 982.
- [N3] is present at positions 582-584, numbered according to SEQ ID NO: 982.
- [N2]-[N3] is present at positions 577-584, numbered according to SEQ ID NO: 982.
- an AAV capsid variant comprising one, two, three, four, or all of: (i) an [N0], wherein [N0] comprises the amino acid sequence of TNN, TNS, TNT, or TNK; (ii) an [N1], wherein [N1] comprises the amino acid of QSS, SLS, SLY, SAT, or QTS; (iii) an [N2] wherein [N2] comprises the amino acid sequence of YPAEV (SEQ ID NO: 1), YQAEV (SEQ ID NO: 6), YTAEV (SEQ ID NO: 4), YPAEE (SEQ ID NO: 5), TEAEV (SEQ ID NO: 12), or YPADV (SEQ ID NO: 13); (iv) an [N3] wherein [N3] comprises the amino acid sequence of VQK or VQN; and/or (v) an [N4] wherein [
- [N0] is present immediately subsequent to position 570, numbered relative to SEQ ID NO: 138. In any of these embodiments, [N0] replaces positions 571-573 (e.g., T571, N572, and N573), numbered relative to SEQ ID NO: 138. In any of these embodiments, [N0] is present immediately subsequent to position 570, and [N0] replaces positions 571-573 (e.g., T571, N572, and N573), numbered relative to SEQ ID NO: 138. In any of these embodiments, [N1] is present immediately subsequent to position 573, numbered relative to SEQ ID NO: 138.
- [N0] is present immediately subsequent to position 573, numbered relative to SEQ ID NO: 138.
- [N1] replaces positions 574-576 (e.g., Q574, S575, and S576), numbered relative to SEQ ID NO: 138.
- [N1] is present immediately subsequent to position 573, and [N1] replaces positions 574-576 (e.g., Q574, S575, and S576), numbered relative to SEQ ID NO: 138.
- [N2] is present immediately subsequent to position 576, numbered relative to SEQ ID NO: 138.
- [N2] replaces position 577 (e.g., T577), numbered relative to SEQ ID NO: 138.
- [N2] is present immediately subsequent to position 576, and [N2] replaces position 577 (e.g., T577), numbered relative to SEQ ID NO: 138.
- [N2]- [N3] is present immediately subsequent to position 576, numbered relative to SEQ ID NO: 138.
- [N2]-[N3] replaces position 577 (e.g., T577), numbered relative to SEQ ID NO: 138.
- [N2]-[N3] is present immediately subsequent to position 576, and [N2]-[N3] replaces position 577 (e.g., T577), numbered relative to SEQ ID NO: 138.
- [N2]-[N3]-[N4] replaces positions 577-579 (e.g., T577, T578, and A579), numbered relative to SEQ ID NO: 138.
- [N2]-[N3]-[N4] is present immediately subsequent to position 576, and [N2]-[N3]-[N4] replaces positions 577-579 (e.g., T577, T578, and A579), numbered relative to SEQ ID NO: 138.
- [N0]-[N1]- [N2]-[N3]-[N4] is present immediately subsequent to position 570, numbered relative to SEQ ID NO: 138.
- [N0]-[N1]-[N2]-[N3]-[N4] replaces positions 571-579 (e.g., T571, N572, N573, Q574, S575, S576, T577, T578, and A579), relative to a reference sequence numbered according to SEQ ID NO: 138.
- [N0]-[N1]-[N2]-[N3]-[N4] is present immediately subsequent to position 570, and [N0]-[N1]-[N2]-[N3]-[N4] replaces positions 571-579 (e.g., T571, N572, N573, Q574, S575, S576, T577, T578, and A579), relative to a reference sequence numbered according to SEQ ID NO: 138.
- [N0] is present at positions 571-573, numbered according to SEQ ID NO: 982.
- [N1] is present at positions 574- 576, numbered according to SEQ ID NO: 982.
- [N2] is present at positions 577-581, numbered according to SEQ ID NO: 982.
- [N3] is present at positions 582-584, numbered according to SEQ ID NO: 982.
- [N4] is present at positions 585-586, numbered according to SEQ ID NO: 982.
- [N2]-[N3] is present at positions 577-584, numbered according to SEQ ID NO: 982.
- [N0]- [N1]-[N2]-[N3]-[N4] is present at positions 571-586, numbered according to SEQ ID NO: 982.
- the amino acid sequence of [N0] is TNN, the amino acid sequence of [N1] is QSS, the amino acid sequence of [N2] is YPAEV (SEQ ID NO: 1), the amino acid sequence of [N3] is VQK, and/or the amino acid sequence of [N4] is TA.
- the amino acid sequence of [N0] is TNN, the amino acid sequence of [N1] is QSS, the amino acid sequence of [N2] is YPAEV (SEQ ID NO: 1), the amino acid sequence of [N3] is VQK, and the amino acid sequence of [N4] is TA.
- [N0]-[N1]-[N2]-[N3]-[N4] is present immediately subsequent to position 570, numbered relative to SEQ ID NO: 138.
- the amino acid sequence of [N2]-[N3] replaces position 577, numbered relative to SEQ ID NO: 138.
- [N0]-[N1]-[N2]-[N3]-[N4] is TNNQSSYPAEVVQKTA (SEQ ID NO: 1533) and is present immediately subsequent to position 570, numbered relative to SEQ ID NO: 138, wherein [N2]-[N3] (YPAEVVQK (SEQ ID NO: 943)) replaces position 577 (e.g., replaces T577) numbered relative to SEQ ID NO: 138.
- [N0] is present at positions 571-573, numbered according to SEQ ID NO: 982.
- [N1] is present at positions 574-576, numbered according to SEQ ID NO: 982.
- [N2] is present at positions 577-581, numbered according to SEQ ID NO: 982.
- [N3] is present at positions 582-584, numbered according to SEQ ID NO: 982.
- [N4] is present at positions 585-586, numbered according to SEQ ID NO: 982.
- [N2]-[N3] is present at positions 577-584, numbered according to SEQ ID NO: 982.
- [N0]-[N1]-[N2]-[N3]-[N4] is present at positions 571-586, numbered according to SEQ ID NO: 982.
- an AAV capsid variant (e.g., an AAV5 capsid variant) comprising [B]-[C], wherein: (i) [B] comprises positions X1, X2, and X3, wherein (a) position X1 is Q or S; (b) position X2 is S, L, or A; and (c) position X3 is S, Y, or T; and (ii) [C] comprises the amino acid sequence of YPAEVVQK (SEQ ID NO: 943); and optionally wherein the AAV capsid variant comprises an amino acid modification, e.g., a conservative substitution, of any of the aforesaid amino acids in (i) and/or (ii); and further optionally wherein [B] is present immediately subsequent to position 573, numbered relative to SEQ ID NO: 138, and [C] replaces position 577, numbered relative to SEQ ID NO: 138.
- AAV capsid variant e.g., an AAV5 capsid variant
- [B] is QSS.
- [C] consists of YPAEVVQK (SEQ ID NO: 943), is present immediately subsequent to position 576, numbered relative to SEQ ID NO: 138, and replaces position 577, numbered relative to SEQ ID NO: 138.
- [B] is present immediately subsequent to position 573, relative to a reference sequence numbered according to SEQ ID NO: 138.
- [B] replaces positions 574-576 (e.g., Q574, S575, and S576), relative to a reference sequence numbered according to SEQ ID NO: 138.
- [B] is present immediately subsequent to position 573, and [B] replaces positions 574-576 (e.g., Q574, S575, and S576), relative to a reference sequence numbered according to SEQ ID NO: 138.
- [C] is present immediately subsequent to position 576, relative to a reference sequence numbered according to SEQ ID NO: 138.
- [C] replaces position 577 (e.g., T577), relative to a reference sequence numbered according to SEQ ID NO: 138.
- [C] is present immediately subsequent to position 576, and [C] replaces position 577 (e.g., T577), relative to a reference sequence numbered according to SEQ ID NO: 138.
- [B]-[C] is present immediately subsequent to position 573, relative to a reference sequence numbered according to SEQ ID NO: 138.
- [B]-[C] replaces positions 574-577 (e.g., Q574, S575, S576, and T577), relative to a reference sequence numbered according to SEQ ID NO: 138.
- [B]-[C] is present immediately subsequent to position 573, and [B]-[C] replaces positions 574-577 (e.g., Q574, S575, S576, and T577), relative to a reference sequence numbered according to SEQ ID NO: 138.
- X1 of [B] is present at position 574
- X2 of [B] is present at position 575
- X3 of [B] is present at position 576, numbered according to SEQ ID NO: 982.
- [B] is present at positions 574-576, numbered according to SEQ ID NO: 982.
- [C] is present at positions 577-584, numbered according to SEQ ID NO: 982.
- [B]-[C] is present at positions 574-584, numbered according to SEQ ID NO: 982.
- the present disclosure provides an AAV capsid variant (e.g., an AAV5 capsid variant) comprising one, two, three, four, or all of: (i) an [A], wherein [A] comprises the amino acid sequence of TNN, TNS, TNT, or TNK; (ii) a [B], wherein [B] comprises the amino acid sequence of QSS, SLY, SAT, or SLS; (iii) a [C], wherein [C] comprises the amino acid sequence of YPAEVVQK (SEQ ID NO: 943); and (iv) a [D], wherein [D] comprises the amino acid sequence of TA, TD, NA, or PA; and optionally wherein the AAV capsid variant comprises an amino acid modification, e.g., a conservative substitution, of any of the aforesaid amino
- [A] is present immediately subsequent to position 570, numbered relative to SEQ ID NO: 138. In any of these embodiments, [A] replaces positions 571-573 (e.g., T571, N572, and N573) numbered relative to SEQ ID NO: 138. In any of these embodiments, [A] is present immediately subsequent to position 570, and [A] replaces positions 571-573 (e.g., T571, N572, and N573) numbered relative to SEQ ID NO: 138. In any of these embodiments, [B] is present immediately subsequent to position 573, relative to a reference sequence numbered according to SEQ ID NO: 138.
- [B] replaces positions 574-576 (e.g., Q574, S575, and S576), relative to a reference sequence numbered according to SEQ ID NO: 138.
- [B] is present immediately subsequent to position 573, and [B] replaces positions 574- 576 (e.g., Q574, S575, and S576), relative to a reference sequence numbered according to SEQ ID NO: 138.
- [C] is present immediately subsequent to position 576, relative to a reference sequence numbered according to SEQ ID NO: 138.
- [C] replaces position 577 (e.g., T577), relative to a reference sequence numbered according to SEQ ID NO: 138.
- [C] is present immediately subsequent to position 576, and [C] replaces position 577 (e.g., T577), relative to a reference sequence numbered according to SEQ ID NO: 138.
- [B]-[C] is present immediately subsequent to position 573, relative to a reference sequence numbered according to SEQ ID NO: 138.
- [B]-[C] replaces positions 574-577 (e.g., Q574, S575, S576, and T577), relative to a reference sequence numbered according to SEQ ID NO: 138.
- [B]-[C] is present immediately subsequent to position 573
- [B]-[C] replaces positions 574-577 (e.g., Q574, S575, S576, and T577), relative to a reference sequence numbered according to SEQ ID NO: 138.
- [C]-[D] is present immediately subsequent to position 576, relative to a reference sequence numbered according to SEQ ID NO: 138.
- [C]-[D] replaces positions 577-579 (e.g., T577, T578, and A579), relative to a reference sequence numbered according to SEQ ID NO: 138.
- [C]-[D] is present immediately subsequent to position 576, and [C]-[D] replaces positions 577-579 (e.g., T577, T578, and A579), relative to a reference sequence numbered according to SEQ ID NO: 138.
- [A] is present at positions 571-573, numbered according to SEQ ID NO: 982.
- [B] is present at positions 574-576, numbered according to SEQ ID NO: 982.
- [C] is present at positions 577-584, numbered according to SEQ ID NO: 982.
- [D] is present at positions 585-586, numbered according to SEQ ID NO: 982.
- [A]-[B]-[C]-[D] is present at positions 571-586, numbered according to SEQ ID NO: 982.
- an AAV capsid variant (e.g., an AAV5 capsid variant) comprising [K1]-[K2], wherein: (i) [K1] comprises LSY or LYY, and (ii) [K2] comprises positions X1, X2, X3, and X4, wherein (a) position X1 is Q, T, or P; (b) position X2 is A; (c) position X3 is E or D; and (d) position X4 is V or E; and optionally wherein the AAV capsid variant comprises an amino acid modification, e.g., a conservative substitution, of any of the aforesaid amino acids in (i) and/or (ii).
- an amino acid modification e.g., a conservative substitution, of any of the aforesaid amino acids in (i) and/or (ii).
- [K1]-[K2] is present immediately subsequent to position 574, relative to a reference sequence numbered according to SEQ ID NO: 138.
- [K1]-[K2] replaces positions 575-577 (e.g., S575, S576, and T577), relative to a reference sequence numbered according to SEQ ID NO: 138.
- [K1]-[K2] is present immediately subsequent to position 574, and [K1]-[K2] replaces positions 575-577 (e.g., S575, S576, and T577), relative to a reference sequence numbered according to SEQ ID NO: 138.
- an AAV capsid variant (e.g., an AAV5 capsid variant) comprising one, two, three, four, or all of: (i) a [K0], which comprises TNNS (SEQ ID NO: 14); (ii) a [K1], which comprises LSY or LYY; (iii) a [K2], which comprises QAEV (SEQ ID NO: 15), TAEV (SEQ ID NO: 16), PAEV (SEQ ID NO: 17), PAEE (SEQ ID NO: 18), or PADV (SEQ ID NO: 19); (iv) a [K3], which comprise VQK or VQN; and (v) a [K4], which comprises TA, TD, NA, or PA; and optionally wherein the AAV capsid variant comprises an amino acid modification, e.g., a conservative substitution, of any of the aforesaid amino acids in (i)-(v).
- the AAV capsid variant comprises an amino acid modification, e.
- [K0] is present immediately subsequent to position 570, relative to a reference sequence numbered according to SEQ ID NO: 138. In some embodiments, [K0] replaces positions 571-574 (e.g., T571, N572, N573, and Q574), relative to a reference sequence numbered according to SEQ ID NO: 138. In some embodiments, [K0] is present immediately subsequent to position 570, and [K0] replaces positions 571-574 (e.g., T571, N572, N573, and Q574), relative to a reference sequence numbered according to SEQ ID NO: 138.
- positions 571-574 e.g., T571, N572, N573, and Q574
- [K1] is present immediately subsequent to position 574, relative to a reference sequence numbered according to SEQ ID NO: 138. In some embodiments, [K1] replaces positions 575-577 (e.g., S575, S576, and T577), relative to a reference sequence numbered according to SEQ ID NO: 138. In some embodiments, [K1] is present immediately subsequent to position 574, and [K1] replaces positions 575-577 (e.g., S575, S576, and T577), relative to a reference sequence numbered according to SEQ ID NO: 138.
- [K1]-[K2]-[K3] is present immediately subsequent to position 574, relative to a reference sequence numbered according to SEQ ID NO: 138.
- [K1]-[K2]-[K3] replaces positions 575-577 (e.g., S575, S576, and T577), relative to a reference sequence numbered according to SEQ ID NO: 138.
- [K1]-[K2]-[K3] is present immediately subsequent to position 574, and [K1]-[K2]-[K3] replaces positions 575-577 (e.g., S575, S576, and T577), relative to a reference sequence numbered according to SEQ ID NO: 138.
- [K1]-[K2]-[K3]-[K4] is present immediately subsequent to position 574, relative to a reference sequence numbered according to SEQ ID NO: 138.
- [K1]-[K2]- [K3]-[K4] replaces positions 575-579 (e.g., S575, S576, T577, T578, and A579), relative to a reference sequence numbered according to SEQ ID NO: 138.
- [K1]-[K2]-[K3]- [K4] is present immediately subsequent to position 574, and [K1]-[K2]-[K3]-[K4] replaces positions 575-579 (e.g., S575, S576, T577, T578, and A579), relative to a reference sequence numbered according to SEQ ID NO: 138.
- [K0]-[K1]-[K2]-[K3]-[K4] is present immediately subsequent to position 570, relative to a reference sequence numbered according to SEQ ID NO 138.
- [K0]-[K1]-[K2]-[K3]-[K4] replaces positions 571-579 (e.g., T571, N572, N573, Q574, S575, S576, T577, T578, and T579), relative to a reference sequence numbered according to SEQ ID NO 138.
- [K0]-[K1]-[K2]-[K3]-[K4] is present immediately subsequent to position 570, and [K0]-[K1]-[K2]-[K3]-[K4] replaces positions 571-579 (e.g., T571, N572, N573, Q574, S575, S576, T577, T578, and T579), relative to a reference sequence numbered according to SEQ ID NO 138.
- an AAV capsid variant (e.g., an AAV5 capsid variant) comprising: (a) the amino acid sequence of any of the sequences provided in Tables 1, 2A, 2B, 9, or 15-20; (b) an amino acid sequence comprising at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 consecutive amino acids from any one of the sequences provided in Tables 1, 2A, 2B, 9, or 15-20; (c) an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to the amino acid sequence of any one of the amino acid sequences provided in Tables 1, 2A, 2B, 9, or 15-20; or (d) an amino sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to the amino acid sequence of any one of the amino acid sequences provided in Tables 1, 2A, 2B, 9, or 15-20.
- substitutions e.g., conservative substitutions
- an AAV capsid variant (e.g., an AAV5 capsid variant) comprising: (a) the amino acid sequence of any of SEQ ID NOs: 943, 1021, 1024, 1027, 1112, 1142, 1214, 1232, 1254, 1300, 1310, 1327, 1331, 1342, 1419, 1453, 1533, 1538, 1539, 1575, 1578, 1583- 1587, 1590, 1591-1593, 1598-1608, or 1610-1624; (b) an amino acid sequence comprising at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 consecutive amino acids from any one of SEQ ID NOs: 943, 1021, 1024, 1027, 1112, 1142, 1214, 1232, 1254, 1300, 1310, 1327, 1331, 1342, 1419, 1453, 1533, 1538, 1539, 1575, 1578, 1583- 1587, 1590, 1591-15
- an AAV capsid variant (e.g., an AAV5 capsid variant) comprising (a) the amino acid sequence of any of SEQ ID NOs: 943 or 2064-2080; (b) an amino acid sequence comprising at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 consecutive amino acids from any one of SEQ ID NOs: 943 or 2064-2080; (c) an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to the amino acid sequence of any one of SEQ ID NOs: 943 or 2064-2080; or (d) an amino sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to the amino acid sequence of any one of SEQ ID NOs: 943 or 2064-2080.
- substitutions e.g., conservative substitutions
- insertions, or deletions relative to the amino acid sequence of any one of SEQ ID NOs: 943
- present disclosure provides an AAV capsid variant (e.g., an AAV5 capsid variant) comprising the amino acid sequence of SEQ ID NO: 943.
- the amino acid sequence of SEQ ID NO: 943 is present immediately subsequent to position 576, relative to a reference sequence numbered according to SEQ ID NO: 138 or 982.
- the amino acid sequence of SEQ ID NO: 943 replaces position 577 (e.g., replaces T577), relative to a reference sequence numbered according to SEQ ID NO: 138.
- the amino acid sequence of SEQ ID NO: 943 is present immediately subsequent to position 576, wherein the amino acid sequence of SEQ ID NO: 943 replaces position 577 (e.g., replaces T577), relative to a reference sequence numbered according to SEQ ID NO: 138.
- the present disclosure provides an AAV capsid variant (e.g., an AAV5 capsid variant) comprising YPAEVVQK (SEQ ID NO: 943), which is present immediately subsequent to position 576, numbered relative to SEQ ID NO: 138 or 982.
- the amino acid sequence of YPAEVVQK replaces position 577 (e.g., replaces T577), numbered relative to SEQ ID NO: 138.
- the present disclosure provides an AAV capsid variant (e.g., an AAV5 capsid variant) comprising YPAEVVQK (SEQ ID NO: 943), wherein YPAEVVQK (SEQ ID NO: 943) replaces position 577 (e.g., replaces T577), numbered relative to SEQ ID NO: 138.
- an AAV capsid variant e.g., an AAV5 capsid variant
- YPAEVVQK SEQ ID NO: 943
- YPAEVVQK replaces position 577 (e.g., replaces T577), numbered relative to SEQ ID NO: 138.
- the present disclosure provides an AAV capsid variant (e.g., an AAV5 capsid variant) which comprises the amino acid Y at position 577, and further comprises the amino acid sequence of PAEVVQK (SEQ ID NO: 20), which is present immediately subsequent to position 577, numbered relative to SEQ ID NO: 138.
- an AAV capsid variant e.g., an AAV5 capsid variant
- the present disclosure provides an AAV capsid variant (e.g., an AAV5 capsid variant) which comprises the amino acid Y at position 577, and comprises the amino acid sequence of PAEVVQK (SEQ ID NO: 20), which is present immediately subsequent to position 577, numbered relative to SEQ ID NO: 982.
- the AAV capsid variant further comprises the amino acid sequence of SEQ ID NO: 739, or an amino acid sequence at least 95% (e.g., at least 96, 97, 98, or 99%) identical thereto. In some embodiments, the AAV capsid variant further comprises the amino acid sequence of SEQ ID NO: 738, or an amino acid sequence at least 95% (e.g., at least 96, 97, 98, or 99%) identical thereto. In some embodiments, the AAV capsid variant further comprises the amino acid sequence of SEQ ID NO: 982, or an amino acid sequence at least 95% (e.g., at least 96, 97, 98, or 99%) identical thereto.
- the present disclosure provides an AAV capsid variant (e.g., an AAV5 capsid variant) comprising the amino acid Y at position 577 and the amino acid sequence of PAEVVQK (SEQ ID NO: 20) at positions 578-584, numbered relative to SEQ ID NO: 982.
- the AAV capsid variant further comprises the amino acid sequence of SEQ ID NO: 739, or an amino acid sequence at least 95% (e.g., at least 96, 97, 98, or 99%) identical thereto.
- the AAV capsid variant further comprises the amino acid sequence of SEQ ID NO: 738, or an amino acid sequence at least 95% (e.g., at least 96, 97, 98, or 99%) identical thereto. In some embodiments, the AAV capsid variant further comprises the amino acid sequence of SEQ ID NO: 982, or an amino acid sequence at least 95% (e.g., at least 96, 97, 98, or 99%) identical thereto.
- an AAV capsid variant e.g., an AAV5 capsid variant
- TNNQSSYPAEVVQKTA SEQ ID NO: 1533
- the amino acid sequence of YPAEVVQK replaces position 577 (e.g., replaces T577) numbered relative to SEQ ID NO: 138.
- an AAV capsid variant e.g., an AAV5 capsid variant
- TNNQSSYPAEVVQKTA SEQ ID NO: 1533
- YPAEVVQK SEQ ID NO: 943 replaces position 577 (e.g., replaces T577), numbered relative to SEQ ID NO: 138.
- an AAV capsid variant e.g., an AAV5 capsid variant
- TNNQSSYPAEVVQKTA SEQ ID NO: 1533
- YPAEVVQK SEQ ID NO: 943
- position 577 e.g., replaces T577
- the present disclosure provides an AAV capsid variant (e.g., an AAV5 capsid variant) comprising TNNQSSYPAEVVQKTA (SEQ ID NO: 1533), which is present at positions 571-586, numbered according to SEQ ID NO: 982.
- an AAV capsid variant e.g., an AAV5 capsid variant
- an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 982.
- the present disclosure provides an AAV capsid variant that consists of the amino acid sequence of SEQ ID NO: 982.
- the present disclosure provides an AAV capsid variant (e.g., an AAV5 capsid variant) comprising an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 984.
- an AAV capsid variant comprising an amino acid sequence encoded by a nucleotide sequence having at least 95% identity to SEQ ID NO: 984.
- the present disclosure provides an AAV capsid variant (e.g., an AAV5 capsid variant) comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence of positions 193-731 of SEQ ID NO: 982, wherein the AAV capsid variant comprises the amino acid sequence of YPAEVVQK (SEQ ID NO: 943).
- the AAV capsid variant comprises the amino acid sequence of positions 193-731 of SEQ ID NO: 982.
- the present disclosure provides an AAV capsid variant (e.g., an AAV5 capsid variant) comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence of SEQ ID NO: 739, wherein the AAV capsid variant comprises the amino acid sequence of YPAEVVQK (SEQ ID NO: 943).
- the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 739.
- the present disclosure provides a peptide comprising: (a) the amino acid sequence of any of the sequences provided in Tables 1, 2A, 2B, 9, or 15-20; (b) an amino acid sequence comprising at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 consecutive amino acids from any one of the sequences provided in Tables 1, 2A, 2B, 9, or 15-20; or (c) an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to the amino acid sequence of any one of the amino acid sequences provided in Tables 1, 2A, 2B, 9, or 15-20; or (d) an amino sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to the amino acid sequence of any one of the amino acid sequences provided in Tables 1, 2A, 2B, 9, or 15-20.
- substitutions e.g., conservative substitutions
- insertions, or deletions relative to the amino acid sequence of any one
- the present disclosure provides a peptide comprising the amino acid sequence of YPAEVVQK (SEQ ID NO: 943).
- the present disclosure provides a peptide comprising (i) an amino acid sequence comprising one, two, or three, but no more than four different amino acids relative to the amino acid sequence of YPAEVVQK (SEQ ID NO: 943); (ii) an amino acid sequence comprising one, two, or three modifications, e.g., substitutions (e.g., conservative substitutions), but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), relative to the amino acid sequence of YPAEVVQK (SEQ ID NO: 943); or (iii) at least 3, 4, 5, 6, or 7 consecutive amino acids from the amino acid sequence of YPAEVVQK (SEQ ID NO: 943).
- the present disclosure provides a peptide encoded by the nucleotide sequence of SEQ ID NO: 944, or a nucleotide sequence substantially identical (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity) thereto.
- the present disclosure provides a peptide encoded by (i) a nucleotide sequence comprising one, two, three, four, five, six, or seven, but no more than ten different nucleotides, relative to the nucleotide sequence of SEQ ID NO: 944; or (ii) a nucleotide sequence comprising one, two, three, four, five, six, or seven modifications, e.g., substitutions, insertions or deletions, but no more than ten modifications, e.g., substitutions, insertions or deletions, relative to the nucleotide sequence of SEQ ID NO: 944.
- the present disclosure provides a peptide, wherein the nucleotide sequence encoding the peptide comprises (i) the nucleotide sequence of SEQ ID NO: 944, or a nucleotide sequence substantially identical (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity) thereto; (ii) a nucleotide sequence comprising one, two, three, four, five, six, or seven, but no more than ten different nucleotides relative to the nucleotide sequence of SEQ ID NO: 944; or (iii) a nucleotide sequence comprising one, two, three, four, five, six, or seven modifications, e.g., substitutions, insertions or deletions, but no more than ten modifications, e.g., substitutions, insertions or deletions, relative to the nucleotide sequence of SEQ ID NO:
- the present disclosure provides a polynucleotide encoding an AAV capsid variant (e.g., an AAV5 capsid variant), wherein the encoded AAV capsid variant comprises: (a) the amino acid sequence of any of the sequences provided in Tables 1, 2A, 2B, 9, or 15-20; (b) an amino acid sequence comprising at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 consecutive amino acids from any one of the sequences provided in Tables 1, 2A, 2B, 9, or 15-20; or (c) an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to the amino acid sequence of any one of the amino acid sequences provided in Tables 1, 2A, 2B, 9, or 15- 20; or (d) an amino sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to the amino acid sequence of any one of the amino acid
- the present disclosure provides a polynucleotide encoding an AAV capsid variant (e.g., an AAV5 capsid variant), wherein the encoded AAV capsid variant comprises the amino acid sequence of YPAEVVQK (SEQ ID NO: 943).
- the present disclosure provides a polynucleotide encoding an AAV capsid variant, wherein the encoded AAV capsid variant comprises (i) an amino acid sequence comprising one, two, or three, but no more than four different amino acids relative to the amino acid sequence of YPAEVVQK (SEQ ID NO: 943); (ii) an amino acid sequence comprising one, two, or three modifications, e.g., substitutions (e.g., conservative substitutions), but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), relative to the amino acid sequence of YPAEVVQK (SEQ ID NO: 943); or (iii) at least 3, 4, 5, 6, or 7 consecutive amino acids from the amino acid sequence of YPAEVVQK (SEQ ID NO: 943).
- the encoded AAV capsid variant comprises (i) an amino acid sequence comprising one, two, or three, but no more than four different amino acids relative to the amino acid sequence of YPAEV
- the present disclosure provides an AAV particle comprising an AAV capsid polypeptide, e.g., an AAV capsid variant (e.g., an AAV5 capsid variant), described herein.
- the AAV particle comprises a nucleic acid sequence encoding a payload.
- the AAV particle further comprises a viral genome comprising a promoter operably linked to the nucleic acid sequence encoding the payload.
- the present disclosure provides a method of making an AAV particle comprising an AAV capsid polypeptide, e.g., an AAV capsid variant (e.g., an AAV5 capsid variant), described herein.
- the method comprises providing a host cell comprising a viral genome and incubating the host cell under conditions suitable to enclose the viral genome in the AAV capsid variant, e.g., an AAV capsid variant described herein, thereby making the AAV particle.
- the present disclosure provides a method of delivering a payload to a cell or tissue (e.g., a CNS cell, a CNS tissue, a muscle cell, or a muscle tissue). The method comprising administering an effective amount of an AAV particle comprising an AAV capsid variant described herein (e.g., an AAV5 capsid variant).
- the present disclosure provides a method of treating a subject having or diagnosed with having a genetic disorder e.g., a monogenic disorder or a polygenic disorder.
- the method comprising administering an effective amount of an AAV particle comprising an AAV capsid variant described herein (e.g., an AAV5 capsid variant).
- the present disclosure provides a method of treating a subject having or diagnosed with having a neurological, e.g., a neurodegenerative, disorder.
- the method comprising administering an effective amount of an AAV particle comprising an AAV capsid variant described herein (e.g., an AAV5 capsid variant).
- the present disclosure provides a method of treating a subject having or diagnosed with having a muscular disorder or a neuromuscular disorder.
- the method comprising administering an effective amount of an AAV particle comprising an AAV capsid variant described herein (e.g., an AAV5 capsid variant).
- the present disclosure provides a method of treating a subject having or diagnosed with having a cardiac disorder, e.g., a cardiac disorder as described herein (e.g., a cardiomyopathy (e.g., arrhythmogenic right ventricular cardiomyopathy, dilated cardiomyopathy, or hypertrophic cardiomyopathy), congestive heart failure, tachycardia (e.g., catecholaminergic polymorphic ventricular tachycardia), ischemic heart disease, and/or myocardial infarction).
- a cardiac disorder as described herein e.g., a cardiomyopathy (e.g., arrhythmogenic right ventricular cardiomyopathy, dilated cardiomyopathy, or hypertrophic cardiomyopathy), congestive heart failure, tachycardia (e.g., catecholaminergic polymorphic ventricular tachycardia), ischemic heart disease, and/or myocardial infarction).
- the method comprising administering an effective amount of an AAV particle comprising an A
- the present disclosure provides a method of treating a subject having or diagnosed with having a neuro-oncological disorder.
- the method comprising administering an effective amount of an AAV particle comprising an AAV capsid variant described herein (e.g., an AAV5 capsid variant).
- an AAV particle comprising an AAV capsid variant described herein (e.g., an AAV5 capsid variant).
- An AAV capsid variant (e.g., an AAV5 capsid variant), comprising an amino sequence comprising the following formula: [N2]-[N3], wherein: (i) [N2] comprises positions X1, X2, X3, X4, and X5, wherein: (a) position X1 is Y, N, C, or T; (b) position X2 is P, E, K, T, or Q; (c) position X3 is A or P; (d) position X4 is E, S, D, or A; and (e) position X5 is V, L, or E; and (ii) [N3] comprises the amino acid sequence of VQK, VQN, EQK, VKK, VHK, VQQ, or LQK; or wherein the AAV capsid variant comprises an amino acid modification, e.g., a conservative substitution, of any of the aforesaid amino acids in (i) and/or (ii).
- [N2] comprises
- An AAV capsid variant (e.g., an AAV5 capsid variant), comprising an amino sequence comprising the following formula: [N2]-[N3], wherein: (i) [N2] comprises positions X1, X2, X3, X4, and X5, wherein: (a) position X1 is Y, N, or C; (b) position X2 is P, K, T, or Q; (c) position X3 is A or P; (d) position X4 is E, S, or A; and (e) position X5 is V, L, or E; and (ii) [N3] comprises the amino acid sequence of VQK, EQK, VKK, VHK, VQQ, or LQK; or wherein the AAV capsid variant comprises an amino acid modification, e.g., a conservative substitution, of any of the aforesaid amino acids in (i) and/or (ii).
- [N2] comprises positions X1, X2, X3,
- An AAV capsid variant (e.g., an AAV5 capsid variant) comprising one, two, three, four, or all of: (i) an [N0] comprising TNN, TNT, INN, TNS, NNN, or TNK; (ii) an [N1] comprising QSS, QSK, TSL, SSS, QSR, AGA, IGS, QAS, ASS, LGS, QST, HSS, LSS, or QRS; (iii) an [N2] comprising YPAEV (SEQ ID NO: 1), YPPSL (SEQ ID NO: 2), NKAEV (SEQ ID NO: 3), YTAEV (SEQ ID NO: 4), YPAEE (SEQ ID NO: 5), YQAEV (SEQ ID NO: 6), YTPSL (SEQ ID NO: 7), YPAAV (SEQ ID NO: 8), NPAEV (SEQ ID NO: 9), CPAEV (SEQ ID NO: 10), or YQAEE (
- [N2] comprises YP, NK, YT, YQ, NP, CP, TH, AE, PS, AA, AS, PA, PP, KA, TA, QA, TP, HA, EV, SL, EE, AV, or SH. 6.
- YPAE SEQ ID NO: 21
- [N2] is or comprises YPAEV (SEQ ID NO: 1), YPPSL (SEQ ID NO: 2), NKAEV (SEQ ID NO: 3), YTAEV (SEQ ID NO: 4), YPAEE (SEQ ID NO: 5), YQAEV (SEQ ID NO: 6), YTPSL (SEQ ID NO: 7), YPAAV (SEQ ID NO: 8), NPAEV (SEQ ID NO: 9), CPAEV (SEQ ID NO: 10), or YQAEE (SEQ ID NO: 11).
- YPAEV SEQ ID NO: 1
- YPPSL SEQ ID NO: 2
- NKAEV SEQ ID NO: 3
- YTAEV SEQ ID NO: 4
- YPAEE SEQ ID NO: 5
- YQAEV SEQ ID NO: 6
- YTPSL SEQ ID NO: 7
- YPAAV SEQ ID NO: 8
- NPAEV SEQ ID NO: 9
- CPAEV SEQ ID NO: 10
- AAV capsid variant of any one of embodiments 1-2 or 4-14, wherein [N2]-[N3] comprises: (i) AEVVQK (SEQ ID NO: 36), PSLVQK (SEQ ID NO: 37), AEVEQK (SEQ ID NO: 38), AEEVQK (SEQ ID NO: 39), PSLEQK (SEQ ID NO: 40), PSLVKK (SEQ ID NO: 41), AEVVKK (SEQ ID NO: 42), AEVVHK (SEQ ID NO: 43), AAVVQK (SEQ ID NO: 44), AEVVQQ (SEQ ID NO: 45), or AEVLQK (SEQ ID NO: 46); (ii) an amino acid sequence comprising any portion of an amino acid sequence in (i), e.g., any 2, 3, 4, or 5 amino acids, e.g., consecutive amino acids, thereof; (iii) an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e
- [N2]-[N3] comprises: (i) PAEVVQK (SEQ ID NO: 20), PPSLVQK (SEQ ID NO: 47), KAEVVQK (SEQ ID NO: 48), TAEVVQK (SEQ ID NO: 49), PAEVEQK (SEQ ID NO: 50), PAEEVQK (SEQ ID NO: 51), QAEVVQK (SEQ ID NO: 52), TPSLVQK (SEQ ID NO: 53), PPSLEQK (SEQ ID NO: 54), PPSLVKK (SEQ ID NO: 55), PAEVVKK (SEQ ID NO: 56), PAEVVHK (SEQ ID NO: 57), PAAVVQK (SEQ ID NO: 58), PAEVVQQ (SEQ ID NO: 59), TAEVVKK (SEQ ID NO: 60), PAEVLQK (SEQ ID NO: 61), or QAEEVQK (SEQ ID NO: 20), PPSLVQK (SEQ ID NO: 47), KA
- [N2]-[N3] is or comprises: (i) YPAEVVQK (SEQ ID NO: 943), YPPSLVQK (SEQ ID NO: 946), NKAEVVQK (SEQ ID NO: 947), YTAEVVQK (SEQ ID NO: 948), YPAEVEQK (SEQ ID NO: 949), YPAEEVQK (SEQ ID NO: 950), YQAEVVQK (SEQ ID NO: 951), YTPSLVQK (SEQ ID NO: 952), YPPSLEQK (SEQ ID NO: 953), YPPSLVKK (SEQ ID NO: 954), YPAEVVKK (SEQ ID NO: 955), YPAEVVHK (SEQ ID NO: 956), YPAAVVQK (SEQ ID NO: 957), NPAEVVQK (SEQ ID NO: 958), Y
- AAV capsid variant of any one of embodiments 1-17 which further comprises one, two, three or all of an amino acid other than Q at position 574 (e.g., T, S, A, I, L, or H), an amino acid other than S at position 575 (e.g., G, A, or R), and/or an amino acid other than S at position 576 (e.g., K, L, R, A, or T), relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138 or 982. 19.
- an amino acid other than Q at position 574 e.g., T, S, A, I, L, or H
- an amino acid other than S at position 575 e.g., G, A, or R
- an amino acid other than S at position 576 e.g., K, L, R, A, or T
- the AAV capsid variant of any one of embodiments 1-17 which further comprises: (i) a Q at position 574, an S at position 575, and/or an S at position 576, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138 or 982; (ii) a T at position 574, an S at position 575, and/or a L at position 576, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138 or 982; (iii) an S at position 574, an S at position 575, and/or an S at position 576, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138 or 982; (iv) a Q at position 574, an S at position 575, and/or an R at position 576, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138 or 982; (v) a Q at position 574, an S at position
- AAV capsid variant of any one of embodiments 1-19 which further comprises [N1], wherein [N1] comprises positions X D , X E , and X F , wherein: (a) position X D is Q, T, S, A, I, L, or H; (b) position X E is S, G, A, or R; and (c) position X F is S, K, L, R, A, or T; and optionally wherein the AAV capsid variant comprises an amino acid modification, e.g., a conservative substitution, of any of the aforesaid amino acids in (a)-(c). 21.
- [N1] comprises positions X D , X E , and X F , wherein: (a) position X D is Q, T, S, A, I, L, or H; (b) position X E is S, G, A, or R; and (c) position X F is S, K, L, R, A, or T; and optionally where
- AAV capsid variant of any one of embodiments 20-22, wherein [N1]-[N2] comprises: (i) SSYPA (SEQ ID NO: 63), SKYPA (SEQ ID NO: 64), SLYPA (SEQ ID NO: 65), SRYPA (SEQ ID NO: 66), SSYPP (SEQ ID NO: 67), GAYPA (SEQ ID NO: 68), GSYPA (SEQ ID NO: 69), ASYPA (SEQ ID NO: 70), STNKA (SEQ ID NO: 71), SSYTA (SEQ ID NO: 72), SSYQA (SEQ ID NO: 73), SSYTP (SEQ ID NO: 74), SSNPA (SEQ ID NO: 75), SLCPA (SEQ ID NO: 76), RSYTA (SEQ ID NO: 77), or SSTHA (SEQ ID NO: 78); (ii) an amino acid sequence comprising any portion of an amino acid sequence in (i), e.g.,
- AAV capsid variant of any one of embodiments 20-23, wherein [N1]-[N2] comprises: (i) SSYPAE (SEQ ID NO: 79), SKYPAE (SEQ ID NO: 80), SLYPAE (SEQ ID NO: 81), SRYPAE (SEQ ID NO: 82), SSYPPS (SEQ ID NO: 83), GAYPAE (SEQ ID NO: 84), GSYPAE (SEQ ID NO: 85), ASYPAE (SEQ ID NO: 86), STNKAE (SEQ ID NO: 87), SSYTAE (SEQ ID NO: 88), SSYQAE (SEQ ID NO: 89), SSYTPS (SEQ ID NO: 90), SSYPAA (SEQ ID NO: 91), SSNPAE (SEQ ID NO: 92), SLCPAE (SEQ ID NO: 93), RSYTAE (SEQ ID NO: 94), SSTHAS (SEQ ID NO
- [N1]-[N2] is or comprises: (i) QSSYPAEV (SEQ ID NO: 96), QSKYPAEV (SEQ ID NO: 97), TSLYPAEV (SEQ ID NO: 98), SSSYPAEV (SEQ ID NO: 99), QSRYPAEV (SEQ ID NO: 100), QSSYPPSL (SEQ ID NO: 101), AGAYPAEV (SEQ ID NO: 102), IGSYPAEV (SEQ ID NO: 103), QASYPAEV (SEQ ID NO: 104), ASSYPAEV (SEQ ID NO: 105), LGSYPAEV (SEQ ID NO: 106), QSTNKAEV (SEQ ID NO: 107), HSSYPAEV (SEQ ID NO: 108), SSSYTAEV (SEQ ID NO: 109), TSLYPAEE (SEQ ID NO: 110), ASSYQAEV (SEQ ID NO: 96), QSKYPAEV (SEQ ID NO: 97), TSLYPAEV
- [N1]-[N2]-[N3] comprises: (i) SSYPAEVVQ (SEQ ID NO: 121), SKYPAEVVQ (SEQ ID NO: 122), SLYPAEVVQ (SEQ ID NO: 123), SRYPAEVVQ (SEQ ID NO: 124), SSYPPSLVQ (SEQ ID NO: 125), GAYPAEVVQ (SEQ ID NO: 126), GSYPAEVVQ (SEQ ID NO: 127), ASYPAEVVQ (SEQ ID NO: 128), STNKAEVVQ (SEQ ID NO: 129), SSYTAEVVQ (SEQ ID NO: 130), SKYPAEVEQ (SEQ ID NO: 131), SLYPAEEVQ (SEQ ID NO: 132), SSYQAEVVQ (SEQ ID NO: 133), SSYTPSLVQ (SEQ ID NO: 134),
- [N1]-[N2]-[N3] is or comprises: (i) QSSYPAEVVQK (SEQ ID NO: 150), QSKYPAEVVQK (SEQ ID NO: 151), TSLYPAEVVQK (SEQ ID NO: 152), SSSYPAEVVQK (SEQ ID NO: 153), QSRYPAEVVQK (SEQ ID NO: 154), QSSYPPSLVQK (SEQ ID NO: 155), AGAYPAEVVQK (SEQ ID NO: 156), IGSYPAEVVQK (SEQ ID NO: 157), QASYPAEVVQK (SEQ ID NO: 158), ASSYPAEVVQK (SEQ ID NO: 159), LGSYPAEVVQK (SEQ ID NO: 160), QSTNKAEVVQK (SEQ ID NO: 161), HSSYPAEVVQK (SEQ ID NO: 150), QSKYPAEVVQK (SEQ ID NO: 151
- [N0]-[N1]-[N2]-[N3] is or comprises: (i) TNNQSSYPAEVVQK (SEQ ID NO: 500), TNNQSKYPAEVVQK (SEQ ID NO: 503), TNNTSLYPAEVVQK (SEQ ID NO: 506), TNNSSSYPAEVVQK (SEQ ID NO: 508), TNNQSRYPAEVVQK (SEQ ID NO: 510), TNNQSSYPPSLVQK (SEQ ID NO: 512), TNNAGAYPAEVVQK (SEQ ID NO: 513), TNNIGSYPAEVVQK (SEQ ID NO: 514), TNNQASYPAEVVQK (SEQ ID NO: 517), TNTASSYPAEVVQK (SEQ ID NO: 520), TNNLGSYPAEVVQK (SEQ ID NO: 523),
- [N0]-[N1]-[N2]-[N3] is or comprises TNNAGAYPAEVVQK (SEQ ID NO: 513), TNNTSLYPAEVVQK (SEQ ID NO: 506), TNNQSKYPAEVVQK (SEQ ID NO: 503), TNNQSSYTPSLVQK (SEQ ID NO: 533), TNNQSSYPPSLVQK (SEQ ID NO: 512), TNNQSRYPAEVVQK (SEQ ID NO: 510), TNNQSSYPPSLEQK (SEQ ID NO: 535), TNNQSSYPPSLVKK (SEQ ID NO: 536), or INNQSSYPAEVVQK
- AAV capsid variant of any one of embodiments 3 or 35-37, wherein [N0]-[N1]-[N2]-[N3]- [N4] is or comprises: (i) TNNQSSYPAEVVQKTA (SEQ ID NO: 1533), TNNQSKYPAEVVQKTA (SEQ ID NO: 1538), TNNTSLYPAEVVQKTA (SEQ ID NO: 1232), TNNSSSYPAEVVQKTA (SEQ ID NO: 1539), TNNQSRYPAEVVQKTA (SEQ ID NO: 1327), TNNQSSYPPSLVQKTA (SEQ ID NO: 1300), TNNAGAYPAEVVQKTA (SEQ ID NO: 1021), TNNIGSYPAEVVQKTA (SEQ ID NO: 1112), TNNQASYPAEVVQKTA (SEQ ID NO: 1194), TNTASSYPAEVVQKTA (SEQ ID NO: 1575), TNNL
- AAV capsid variant of embodiment 3 or 35-38 wherein [N0]-[N1]-[N2]-[N3]-[N4] is or comprises TNNAGAYPAEVVQKTA (SEQ ID NO: 1021), TNNTSLYPAEVVQKTA (SEQ ID NO: 1232), TNNQSKYPAEVVQKTA (SEQ ID NO: 1538), TNNQSSYTPSLVQKTA (SEQ ID NO: 1585), TNNQSSYPPSLVQKTA (SEQ ID NO: 1300), TNNQSRYPAEVVQKTA (SEQ ID NO: 1327), TNNQSSYPPSLEQKTA (SEQ ID NO: 1590), TNNQSSYPPSLVKKTA (SEQ ID NO: 1591), or INNQSSYPAEVVQKTA (SEQ ID NO: 1024).
- An AAV capsid variant (e.g., an AAV5 capsid variant) comprising an amino sequence comprising the following formula: [B]-[C], wherein (i) [B] comprises positions X1, X2, and X3, wherein: (a) position X1 is Q, T, S, A, I, L, or H; (b) position X2 is S, G, or A; and (c) position X3 is S, K, L, R, or A; and (ii) [C] comprises the amino acid sequence of YPAEVVQK (SEQ ID NO: 943); and optionally wherein the AAV capsid variant comprises an amino acid modification, e.g., a conservative substitution, of any of the aforesaid amino acids in (i) and/or (ii).
- an amino acid modification e.g., a conservative substitution, of any of the aforesaid amino acids in (i) and/or (ii).
- An AAV capsid variant (e.g., an AAV5 capsid variant) comprising one, two, three, four, or all of: (i) an [A], wherein [A] comprises the amino acid sequence of TNN, TNT, INN, NNN, TNS, or TNK; (ii) a [B], wherein [B] comprises the amino acid sequence of QSS, TSL, SSS, QSR, QSK, AGA, IGS, QAS, ASS, LGS, or HSS; (iii) a [C], wherein [C] comprises the amino acid sequence of YPAEVVQK (SEQ ID NO: 943); and (iv) a [D], wherein [D] comprises the amino acid sequence of TA or PA; and optionally wherein the AAV capsid variant comprises an amino acid modification, e.g., a conservative substitution, of any of the aforesaid amino acids in (i)-(v); and further optionally wherein [C] replaces position 577
- AAV capsid variant of embodiment 41 wherein: (a) position X1 is Q, T, S, A, or H; (b) position X2 is S or G; and (c) position X3 is S, K, L, or R. 44.
- AAV capsid variant of any one of embodiments 41 or 43-45, wherein [B]-[C] comprises: (i) SSYPAEVVQK (SEQ ID NO: 572), SKYPAEVVQK (SEQ ID NO: 573), SLYPAEVVQK (SEQ ID NO: 574), SRYPAEVVQK (SEQ ID NO: 575), GAYPAEVVQK (SEQ ID NO: 576), GSYPAEVVQK (SEQ ID NO: 580), or ASYPAEVVQK (SEQ ID NO: 582); (ii) an amino acid sequence comprising any portion of an amino acid sequence in (i), e.g., any 2, 3, 4, 5, 6, 7, 8, or 9 amino acids, e.g., consecutive amino acids, thereof; (iii) an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of
- AAV capsid variant of any one of embodiments 41-46, wherein [B]-[C] is or comprises: (i) QSSYPAEVVQK (SEQ ID NO: 150), QSKYPAEVVQK (SEQ ID NO: 151), TSLYPAEVVQK (SEQ ID NO: 152), SSSYPAEVVQK (SEQ ID NO: 153), QSRYPAEVVQK (SEQ ID NO: 154), AGAYPAEVVQK (SEQ ID NO: 156), IGSYPAEVVQK (SEQ ID NO: 157), QASYPAEVVQK (SEQ ID NO: 158), ASSYPAEVVQK (SEQ ID NO: 159), LGSYPAEVVQK (SEQ ID NO: 160), or HSSYPAEVVQK (SEQ ID NO: 162); (ii) an amino acid sequence comprising any portion of an amino acid sequence in (i), e.g., any 2, 3, 4, 5, 6, 7, 8,
- AAV capsid variant of any one of embodiments 1-49 which further comprises one or both of an amino acid other than T at position 571 (e.g., I or N), and/or an amino acid other than N at position 573 (e.g., T, S, or K), relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138 or 982. 51.
- the AAV capsid variant of any one of embodiments 1-49 which further comprises: (i) a T at position 571, an N at position 572, and/or an N at position 573, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138 or 982; (ii) a T at position 571, an N at position 572, and/or a T at position 573, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138 or 982; (iii) an I at position 571, an N at position 572, and/or an N at position 573, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138 or 982; (iv) a T at position 571, an N at position 572, and/or an S at position 573, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138 or 982; (v) an N at position 571, an N at position 5
- AAV capsid variant of any one of embodiments 41-51 which further comprises [A], wherein [A] comprises positions X A , X B , and X C , wherein: (a) position X A is T, I, or N; (b) position X B is N; and (c) position X C is N, T, S, or K; and optionally wherein the AAV capsid variant comprises an amino acid modification, e.g., a conservative substitution, of any of the aforesaid amino acids in (a)-(c).
- [A] comprises TN, IN, NN, NT, NS, or NK. 54.
- [A]-[B]-[C] is or comprises: (i) TNNQSSYPAEVVQK (SEQ ID NO: 500), TNNQSKYPAEVVQK (SEQ ID NO: 503), TNNTSLYPAEVVQK (SEQ ID NO: 506), TNNSSSYPAEVVQK (SEQ ID NO: 508), TNNQSRYPAEVVQK (SEQ ID NO: 510), TNNAGAYPAEVVQK (SEQ ID NO: 513), TNNIGSYPAEVVQK (SEQ ID NO: 514), TNNQASYPAEVVQK (SEQ ID NO: 517), TNTASSYPAEVVQK (SEQ ID NO: 520), TNNLGSYPAEVVQK (SEQ ID NO: 523), TNNHSSYPAEVVQK (SEQ ID NO: 525), INNQSSYPAEVVQK (SEQ ID NO: 500), TNNQSKYPAEVVQK (S
- [A]-[B]-[C] is or comprises TNNAGAYPAEVVQK (SEQ ID NO: 513), TNNTSLYPAEVVQK (SEQ ID NO: 506), TNNQSKYPAEVVQK (SEQ ID NO: 503), TNNQSRYPAEVVQK (SEQ ID NO: 510), or INNQSSYPAEVVQK (SEQ ID NO: 543).
- AAV capsid variant of any one of embodiments 1-58 which further comprises: (i) an amino acid other than T at position 578 (e.g., P or N), relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138; or an (ii) an amino acid other than T at position 585 (e.g., P or N), relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 982. 60.
- the AAV capsid variant of any one of embodiments 1-58 which further comprises: (i) a T at position 578 and/or an A at position 579, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138; or a T at position 585 and/or an A at position 586 relative to a reference sequence numbered according to SEQ ID NO: 982; (ii) a P at position 578 and/or an A at position 579, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138; or a P at position 585 and/or an A at position 586 relative to a reference sequence numbered according to SEQ ID NO: 982; or (iii) an N at position 578 and/or an A at position 579, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138; or an N at position 585 and/or an A at position 586 relative to a reference sequence numbered according to SEQ ID NO: 982
- [A]-[B]-[C]-[D] is or comprises: (i) TNNQSSYPAEVVQKTA (SEQ ID NO: 1533), TNNQSKYPAEVVQKTA (SEQ ID NO: 1538), TNNTSLYPAEVVQKTA (SEQ ID NO: 1232), TNNSSSYPAEVVQKTA (SEQ ID NO: 1539), TNNQSRYPAEVVQKTA (SEQ ID NO: 1327), TNNAGAYPAEVVQKTA (SEQ ID NO: 1021), TNNIGSYPAEVVQKTA (SEQ ID NO: 1112), TNNQASYPAEVVQKTA (SEQ ID NO: 1194), TNTASSYPAEVVQKTA (SEQ ID NO: 1575), TNNLGSYPAEVVQKTA (SEQ ID NO: 1027), TNNHSSYPAEVVQKTA
- [A]-[B]-[C]-[D] is or comprises TNNAGAYPAEVVQKTA (SEQ ID NO: 1021), TNNTSLYPAEVVQKTA (SEQ ID NO: 1232), TNNQSKYPAEVVQKTA (SEQ ID NO: 1538), TNNQSRYPAEVVQKTA (SEQ ID NO: 1327), or INNQSSYPAEVVQKTA (SEQ ID NO: 1024).
- An AAV capsid variant (e.g., an AAV5 capsid variant), comprising an amino sequence comprising the formula [N2]-[N3], wherein: (i) [N2] comprises positions X1, X2, X3, X4, and X5, wherein: (a) position X1 is Y or T; (b) position X2 is Q, T, P, or E; (c) position X3 is A; (d) position X4 is E or D; and (e) position X5 is V or E; and (ii) [N3] comprises the amino acid sequence of VQK or VQN; or wherein the AAV capsid variant comprises an amino acid modification, e.g., a conservative substitution, of any of the aforesaid amino acids in (i) and/or (ii).
- the AAV capsid variant comprises an amino acid modification, e.g., a conservative substitution, of any of the aforesaid amino acids in (i) and/or
- An AAV capsid variant (e.g., an AAV5 capsid variant) comprising one, two, three, four, or all of: (i) an [N0] comprising TNN, TNS, TNT, or TNK; (ii) an [N1] comprising QSS, SLS, SLY, SAT, or QTS; (iii) an [N2] comprising YPAEV (SEQ ID NO: 1), YQAEV (SEQ ID NO: 6), YTAEV (SEQ ID NO: 4), YPAEE (SEQ ID NO: 5), TEAEV (SEQ ID NO: 12), or YPADV (SEQ ID NO: 13); (iv) an [N3] comprising VQK or VQN; and (v) an [N4] comprising TA, PA, TD, NA, or PA; and optionally wherein the AAV capsid variant comprises an amino acid modification, e.g., a conservative substitution, of any of the afores, or
- AAV capsid variant of embodiment 1 or 67, wherein [N2] comprises YP, YQ, YT, TE, QA, TA, PA, EA, EV, EE, DV, AE, or AD. 70.
- [N2] comprises YPAE (SEQ ID NO: 21), YQAE (SEQ ID NO: 25), YTAE (SEQ ID NO: 24), TEAE (SEQ ID NO: 587), YPAD (SEQ ID NO: 588), QAEV (SEQ ID NO: 15), TAEV (SEQ ID NO: 16), PAEV (SEQ ID NO: 17),
- [N2] is or comprises YPAEV (SEQ ID NO: 1), YQAEV (SEQ ID NO: 6), YTAEV (SEQ ID NO: 4), YPAEE (SEQ ID NO: 5), TEAEV (SEQ ID NO: 12), or YPADV (SEQ ID NO: 13).
- [N3] comprises the amino acid sequence of VQK.
- AAV capsid variant of any one of embodiments 1, 67, or 69-73, wherein [N2]-[N3] comprises: (i) AEVVQK (SEQ ID NO: 36), AEEVQK (SEQ ID NO: 39), AEVVQN (SEQ ID NO: 591), or ADVVQK (SEQ ID NO: 593); (ii) an amino acid sequence comprising any portion of an amino acid sequence in (i), e.g., any 2, 3, 4, or 5 amino acids, e.g., consecutive amino acids, thereof; (iii) an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the amino acid sequences in (i); or (iv) an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to any one of the amino acid sequences in (i).
- AEVVQK SEQ ID
- AAV capsid variant of any one of embodiments 1, 67, or 69-74, wherein [N2]-[N3] comprises: (i) PAEVVQN (SEQ ID NO: 594), QAEVVQK (SEQ ID NO: 52), TAEVVQK (SEQ ID NO: 49), PAEVVQK (SEQ ID NO: 20), PAEEVQK (SEQ ID NO: 51), EAEVVQK (SEQ ID NO: 595), or PADVVQK (SEQ ID NO: 596); (ii) an amino acid sequence comprising any portion of an amino acid sequence in (i), e.g., any 2, 3, 4, 5, or 6 amino acids, e.g., consecutive amino acids, thereof; (iii) an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the amino acid sequences in (i); or (iv
- AAV capsid variant of any one of embodiments 1 or 67-78 which further comprises one, two, three or all of an amino acid other than Q at position 574 (e.g., S), an amino acid other than S at position 575 (e.g., L, A, or T), and/or an amino acid other than S at position 576 (e.g., Y or T), relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138 or 982. 80.
- an amino acid other than Q at position 574 e.g., S
- an amino acid other than S at position 575 e.g., L, A, or T
- an amino acid other than S at position 576 e.g., Y or T
- the AAV capsid variant of any one of embodiments 1 or 67-78 which further comprises: (i) a Q at position 574, an S at position 575, and/or an S at position 576, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138 or 982; (ii) an S at position 574, an L at position 575, and/or an S at position 576, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138 or 982; (iii) an S at position 574, an L at position 575, and/or a Y at position 576, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138 or 982; (iv) an S at position 574, an A at position 575, and/or a T at position 576, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138 or 982; or (v) a Q at position 574
- AAV capsid variant of any one of embodiments 1 or 67-80 which further comprises [N1], wherein [N1] comprises positions X D , X E , and X F , wherein: (a) position X D is Q or S; (b) position X E is S, L, A, or T; and (c) position X F is S, Y, or T; and optionally wherein the AAV capsid variant comprises an amino acid modification, e.g., a conservative substitution, of any of the aforesaid amino acids in (a)-(c). 82.
- [N1] comprises positions X D , X E , and X F , wherein: (a) position X D is Q or S; (b) position X E is S, L, A, or T; and (c) position X F is S, Y, or T; and optionally wherein the AAV capsid variant comprises an amino acid modification, e.g., a conservative substitution, of any
- AAV capsid variant of any one of embodiments 81-83, wherein [N1]-[N2] comprises: (i) SSYPA (SEQ ID NO: 63), LSYQA (SEQ ID NO: 597), LSYTA (SEQ ID NO: 598), LYYPA (SEQ ID NO: 600), ATYPA (SEQ ID NO: 601), LSYPA (SEQ ID NO: 603), or TSTEA (SEQ ID NO: 605); (ii) an amino acid sequence comprising any portion of an amino acid sequence in (i), e.g., any 2, 3, or 4 amino acids, e.g., consecutive amino acids, thereof; (iii) an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the amino acid sequences in (i); or (iv) an amino acid sequence comprising one, two, or three but no more than four
- AAV capsid variant of any one of embodiments 81-84, wherein [N1]-[N2] comprises: (i) SSYPAE (SEQ ID NO: 79), LSYQAE (SEQ ID NO: 607), LSYTAE (SEQ ID NO: 610), LYYPAE (SEQ ID NO: 611), ATYPAE (SEQ ID NO: 613), LSYPAE (SEQ ID NO: 616), TSTEAE (SEQ ID NO: 619), or LSYPAD (SEQ ID NO: 621); (ii) an amino acid sequence comprising any portion of an amino acid sequence in (i), e.g., any 2, 3, 4, or 5 amino acids, e.g., consecutive amino acids, thereof; (iii) an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the amino acid sequences in (
- [N1]-[N2]-[N3] is or comprises: (i) QSSYPAEVVQK (SEQ ID NO: 150), SLSYQAEVVQK (SEQ ID NO: 635), SLSYTAEVVQK (SEQ ID NO: 637), SLYYPAEVVQK (SEQ ID NO: 639), SATYPAEVVQK (SEQ ID NO: 641), SLSYPAEVVQK (SEQ ID NO: 642), SLSYPAEEVQK (SEQ ID NO: 643), SLSYPAEVVQN (SEQ ID NO: 644), QTSTEAEVVQK (SEQ ID NO: 645), or SLSYPADVVQK (SEQ ID NO: 646); (ii) an amino acid sequence comprising any portion of an amino acid sequence in (i), e.g., any 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or
- AAV capsid variant of embodiment 89 wherein [N0]: (i) comprises TN, NS, NT, NN, or NK; and/or (ii) is or comprises TNS, TNT, TNN, or TNK. 91.
- AAV capsid variant of any one of embodiments 68 or 89-91, wherein [N0]-[N1]-[N2]-[N3] is or comprises: (i) TNNQSSYPAEVVQK (SEQ ID NO: 500), TNSSLSYQAEVVQK (SEQ ID NO: 652), TNSSLSYTAEVVQK (SEQ ID NO: 654), TNSSLYYPAEVVQK (SEQ ID NO: 655), TNTSATYPAEVVQK (SEQ ID NO: 656), TNSSLSYPAEVVQK (SEQ ID NO: 657), TNSSLSYPAEEVQK (SEQ ID NO: 658), TNSSLSYPAEVVQN (SEQ ID NO: 660), TNNQTSTEAEVVQK (SEQ ID NO: 662), TNKSATYPAEVVQK (SEQ ID NO: 663), or TNSSLSYPADVVQK (SEQ ID NO: 500),
- AAV capsid variant of any one of embodiments 68 or 94-96, wherein [N0]-[N1]-[N2]-[N3]- [N4] is or comprises: (i) TNNQSSYPAEVVQKTA (SEQ ID NO: 1533), TNSSLSYQAEVVQKTA (SEQ ID NO: 2064), TNSSLSYTAEVVQKTA (SEQ ID NO: 2065), TNSSLYYPAEVVQKTA (SEQ ID NO: 2066), TNTSATYPAEVVQKTA (SEQ ID NO: 2067), TNSSLSYPAEVVQKTA (SEQ ID NO: 2068), TNSSLSYPAEEVQKTA (SEQ ID NO: 2069), TNSSLSYPAEVVQKTD (SEQ ID NO: 2070), TNSSLSYPAEVVQNTA (SEQ ID NO: 2071), TNSSLSYPAEVVQKNA (SEQ ID NO: 2072
- An AAV capsid variant (e.g., an AAV5 capsid variant) comprises the formula [K1]-[K2], wherein: (i) [K1] comprises LSY or LYY; and (ii) [K2] comprises positions X1, X2, X3, and X4, wherein: (a) position X1 is Q, T, or P; (b) position X2 is A; (c) position X3 is E or D; and (d) position X4 is V or E; and optionally wherein the AAV capsid variant comprises an amino acid modification, e.g., a conservative substitution, of any of the aforesaid amino acids in (i) and/or (ii). 100.
- an amino acid modification e.g., a conservative substitution, of any of the aforesaid amino acids in (i) and/or (ii).
- An AAV capsid variant (e.g., an AAV5 capsid variant) comprising one, two, three, four, or all of: (i) an [K0], which comprises TNNS (SEQ ID NO: 14); (ii) an [K1], which comprises LSY or LYY; (iii) an [K2], which comprises QAEV (SEQ ID NO: 15), TAEV (SEQ ID NO: 16), PAEV (SEQ ID NO: 17), PAEE (SEQ ID NO: 18), or PADV (SEQ ID NO: 19); (iv) an [K3], which comprise VQK or VQN; and (v) an [K4], which comprises TA, TD, NA, or PA; and optionally wherein the AAV capsid variant comprises an amino acid modification, e.g., a conservative substitution, of any of the aforesaid amino acids in (i)-(v).
- an amino acid modification e.g., a conservative substitution, of any of the a
- AAV capsid variant of embodiment 99 or 100, wherein [K1] comprises LSY. 102.
- [K2] comprises QAE, TAE, PAE, PAD, AEV, AEE, or ADV. 104.
- [K1]-[K2] comprises LSYQA (SEQ ID NO: 597), LSYTA (SEQ ID NO: 598), LYYPA (SEQ ID NO: 600), or LSYPA (SEQ ID NO: 603).
- the AAV capsid variant of any one of embodiments 99 or 101-105, wherein [K1]-[K2] comprises: (i) LSYQAE (SEQ ID NO: 607), LSYTAE (SEQ ID NO: 610), LYYPAE (SEQ ID NO: 611), LSYPAE (SEQ ID NO: 616), or LSYPAD (SEQ ID NO: 621); (ii) an amino acid sequence comprising any portion of an amino acid sequence in (i), e.g., any 2, 3, 4, or 5 amino acids, e.g., consecutive amino acids, thereof; (iii) an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the amino acid sequences in (i); or (iv) an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to any one of the amino acid sequences in
- the AAV capsid variant of any one of embodiments 99-107 which further comprises an amino acid other than Q at position 574 (e.g., S), relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138. 109.
- the AAV capsid variant of any one of embodiments 99-108 which further comprises S at position 574, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138. 110.
- AAV capsid variant of any one of embodiments 99-109 which further comprises [K0], wherein [K0] is or comprises TNNS (SEQ ID NO: 14); an amino acid sequence comprising any portion of an amino acid sequence, e.g., any 2 or 3 amino acids, e.g., consecutive amino acids, thereof; an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to the amino acid sequence of TNNS (SEQ ID NO: 14); or an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to the amino acid sequence of TNNS (SEQ ID NO: 14).
- substitutions e.g., conservative substitutions
- insertions e.g., or deletions
- [K0]-[K1] comprises: (i) TNSSLS (SEQ ID NO: 647) or TNSSLY (SEQ ID NO: 648); (ii) an amino acid sequence comprising any portion of an amino acid sequence in (i), e.g., any 2, 3, 4, or 5 amino acids, e.g., consecutive amino acids, thereof; (iii) an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the amino acid sequences in (i); or (iv) an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to any one of the amino acid sequences in (i).
- [K0]-[K1]-[K2] comprises: (i) TNSSLSYQA (SEQ ID NO: 679), TNSSLSYTA (SEQ ID NO: 681), TNSSLYYPA (SEQ ID NO: 682), or TNSSLSYPA (SEQ ID NO: 683); (ii) an amino acid sequence comprising any portion of an amino acid sequence in (i), e.g., any 2, 3, 4, 5, 6, 7, or 8 amino acids, e.g., consecutive amino acids, thereof; (iii) an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the amino acid sequences in (i); or (iv) an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to any one of the amino acid sequences in (i).
- TNSSLSYQA SEQ ID NO: 679
- AAV capsid variant of any one of embodiments 110-113, wherein [K0]-[K1]-[K2] comprises: (i) TNSSLSYQAE (SEQ ID NO: 684), TNSSLSYTAE (SEQ ID NO: 685), TNSSLYYPAE (SEQ ID NO: 686), TNSSLSYPAE (SEQ ID NO: 687), or TNSSLSYPAD (SEQ ID NO: 689); (ii) an amino acid sequence comprising any portion of an amino acid sequence in (i), e.g., any 2, 3, 4, 5, 6, 7, 8, or 9 amino acids, e.g., consecutive amino acids, thereof; (iii) an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the amino acid sequences in (i); or (iv) an amino acid sequence comprising one, two, or three but
- AAV capsid variant of any one of embodiments 99-115 which further comprises [K3], wherein [K3] comprises positions X A , X B , and X C , wherein: (a) position X A is V; (b) position X B is Q; and (c) position X C is K or N; and optionally wherein the AAV capsid comprises an amino acid modification, e.g., a conservative substitution, of any of the aforesaid amino acids in (a)-(c).
- [K3] comprises VQ, QK, or QN; (ii) is or comprises VQK or VQN. 118.
- [K2]-[K3] is or comprises: (i) QAEVVQK (SEQ ID NO: 52), TAEVVQK (SEQ ID NO: 49), PAEVVQK (SEQ ID NO: 20), PAEEVQK (SEQ ID NO: 51), PAEVVQN (SEQ ID NO: 594), or PADVVQK (SEQ ID NO: 596); (ii) an amino acid sequence comprising any portion of an amino acid sequence in (i), e.g., any 2, 3, 4, 5, or 6 amino acids, e.g., consecutive amino acids, thereof; (iii) an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the amino acid sequences in (i); or (iv) an amino acid sequence comprising one, two, or three but no more than four different amino
- [K1]-[K2]-[K3] is or comprises: (i) LSYQAEVVQK (SEQ ID NO: 700), LSYTAEVVQK (SEQ ID NO: 701), LYYPAEVVQK (SEQ ID NO: 702), LSYPAEVVQK (SEQ ID NO: 703), LSYPAEEVQK (SEQ ID NO: 704), LSYPAEVVQN (SEQ ID NO: 706), or LSYPADVVQK (SEQ ID NO: 708); (ii) an amino acid sequence comprising any portion of an amino acid sequence in (i), e.g., any 2, 3, 4, 5, 6, 7, 8, or 9 amino acids, e.g., consecutive amino acids, thereof; (iii) an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions),
- [K0]-[K1]-[K2]-[K3] is or comprises: (i) TNSSLSYQAEVVQK (SEQ ID NO: 652), TNSSLSYTAEVVQK (SEQ ID NO: 654), TNSSLYYPAEVVQK (SEQ ID NO: 655), TNSSLSYPAEVVQK (SEQ ID NO: 657), TNSSLSYPAEEVQK (SEQ ID NO: 658), TNSSLSYPAEVVQN (SEQ ID NO: 660), or TNSSLSYPADVVQK (SEQ ID NO: 665); (ii) an amino acid sequence comprising any portion of an amino acid sequence in (i), e.g., any 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 amino acids, e.g., consecutive amino acids, thereof; (iii) an amino acid sequence comprising one, two, or three but no
- TNSSLSYQAEVVQKTA SEQ ID NO: 2064
- TNSSLSYTAEVVQKTA SEQ ID NO: 2065
- TNSSLYYPAEVVQKTA SEQ ID NO: 2066
- TNSSLSYPAEVVQKTA SEQ ID NO: 2068
- TNSSLSYPAEEVQKTA SEQ ID NO: 2069
- TNSSLSYPAEVVQKTD SEQ ID NO: 2070
- TNSSLSYPAEVVQNTA SEQ ID NO: 2071
- TNSSLSYPAEVVQKNA SEQ ID NO: 2072
- TNSSLSYPAEVVQKPA SEQ ID NO: 2073
- TNSSLSYPADVVQKTA SEQ ID NO: 20
- An AAV capsid variant (e.g., an AAV5 capsid variant) comprising [B]-[C], wherein: (i) [B] comprises positions X1, X2, and X3, wherein: (a) position X1 is Q or S; (b) position X2 is S, L, or A; and (c) position X3 is S, Y, or T; and (ii) [C] comprises the amino acid sequence of YPAEVVQK (SEQ ID NO: 943); and optionally wherein there AAV capsid variant comprises an amino acid modification, e.g., a conservative substitution, of any of the aforesaid amino acids in (i) and/or (ii). 126.
- AAV capsid variant comprises an amino acid modification, e.g., a conservative substitution, of any of the aforesaid amino acids in (i) and/or (ii).
- An AAV capsid variant (e.g., an AAV5 capsid variant) comprising one, two, three, four, or all of: (i) an [A] comprising TNN, TNS, TNT, or TNK; (ii) a [B] comprising QSS, SLY, SAT, or SLS; (iii) a [C] comprising YPAEVVQK (SEQ ID NO: 943); and (iv) a [D] comprising TA, TD, NA, or PA; and optionally wherein the AAV capsid variant comprises an amino acid modification, e.g., a conservative substitution, of any of the aforesaid amino acids in (i)-(v), and further optionally wherein [C] replaces position 577 relative to reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138.
- an amino acid modification e.g., a conservative substitution, of any of the aforesaid amino acids in (i)-(v)
- the AAV capsid variant of embodiment 125 comprising wherein [B] comprises QS, SL, SA, LY, AT, LS, or SS. 128.
- AAV capsid variant of any one of embodiments 125, 127, or 128, wherein [B]-[C] comprises: (i) SSYPAEVVQK (SEQ ID NO: 572), LYYPAEVVQK (SEQ ID NO: 702), ATYPAEVVQK (SEQ ID NO: 718), or LSYPAEVVQK (SEQ ID NO: 703); (ii) an amino acid sequence comprising any portion of an amino acid sequence in (i), e.g., any 2, 3, 4, 5, 6, 7, 8, or 9 amino acids, e.g., consecutive amino acids, thereof; (iii) an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the amino acid sequences in (i); or (iv) an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to any one of the amino acid sequences
- AAV capsid variant of any one of embodiments 125-129, wherein [B]-[C] is or comprises: (i) QSSYPAEVVQK (SEQ ID NO: 150), SLYYPAEVVQK (SEQ ID NO: 639), SATYPAEVVQK (SEQ ID NO: 641), or SLSYPAEVVQK (SEQ ID NO: 642); (ii) an amino acid sequence comprising any portion of an amino acid sequence in (i), e.g., any 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids, e.g., consecutive amino acids, thereof; (iii) an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the amino acid sequences in (i); or (iv) an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to any one of the amino acid sequences
- the AAV capsid variant of any one of embodiments 67-98 or 125-131 which further comprises: (i) a T at position 571, an N at position 572, and/or an N at position 573, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138; (ii) a T at position 571, an N at position 572, and/or a T at position 573, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138; (iii) a T at position 571, an N at position 572, and/or a S at position 573, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138; or (iv) a T at position 571, an N at position 572, and/or a K at position 573, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138.
- AAV capsid variant of any one of embodiments 125-133 which further comprises [A], wherein [A] comprises positions XA, XB, and XC, wherein: (a) position X A is T; (b) position X B is N; and (c) position X C is N, T, S, or K; and optionally wherein the AAV capsid variant comprises an amino acid modification, e.g., a conservative substitution, of any of the aforesaid amino acids in (a)-(c). 135.
- AAV capsid variant of embodiment 126 or 134 wherein [A]: (i) comprises TN, NS, NT, NK, or NN; (ii) is or comprises TNN, TNS, TNT, or TNK. 136.
- AAV capsid variant of any one of embodiments 126 or 134-136, wherein [A]-[B]-[C] is or comprises: (i) TNNQSSYPAEVVQK (SEQ ID NO: 500), TNSSLYYPAEVVQK (SEQ ID NO: 655), TNTSATYPAEVVQK (SEQ ID NO: 656), TNSSLSYPAEVVQK (SEQ ID NO: 657), or TNKSATYPAEVVQK (SEQ ID NO: 663); (ii) an amino acid sequence comprising any portion of an amino acid sequence in (i), e.g., any 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 amino acids, e.g., consecutive amino acids, thereof; (iii) an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the amino acid sequences in (i).
- the AAV capsid variant of any one of embodiments 67-98 or 125-138 which further comprises: (i) a T at position 578 and/or an A at position 579, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138; (ii) a T at position 578 and/or a D at position 579, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138; (iii) a P at position 578 and/or an A at position 579, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138; or (iv) an N at position 578 and/or an A at position 579, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138.
- [C]-[D] is or comprises: (i) YPAEVVQKTA (SEQ ID NO: 584), YPAEVVQKTD (SEQ ID NO: 719), YPAEVVQKNA (SEQ ID NO: 724), or YPAEVVQKPA (SEQ ID NO: 586); (ii) an amino acid sequence comprising any portion of an amino acid sequence in (i), e.g., any 2, 3, 4, 5, 6, 7, 8, or 9 amino acids, e.g., consecutive amino acids, thereof; (iii) an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the amino acid sequences in (i); or (iv) an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to any one of the amino acid sequences
- AAV capsid variant of any one of embodiments 126 or 141-143, wherein [A]-[B]-[C]-[D] is or comprises: (i) TNNQSSYPAEVVQKTA (SEQ ID NO: 1533), TNSSLYYPAEVVQKTA (SEQ ID NO: 2066), TNTSATYPAEVVQKTA (SEQ ID NO: 2067), TNSSLSYPAEVVQKTA (SEQ ID NO: 2068), TNSSLSYPAEVVQKTD (SEQ ID NO: 2070), TNSSLSYPAEVVQKNA (SEQ ID NO: 2072), TNSSLSYPAEVVQKPA (SEQ ID NO: 2073), or TNKSATYPAEVVQKTA (SEQ ID NO: 2075); (ii) (ii) an amino acid sequence comprising any portion of an amino acid sequence in (i), e.g., any 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 amino acids
- 146. The AAV capsid variant of any one of the embodiments 1-40, 59, 60, 67-98, 139, or 140, wherein [N2]-[N3] is present in loop VIII, optionally wherein loop VIII comprises positions 571-592 (e.g., amino acids TNNQSSTTAPATGTYNLQEIVP (SEQ ID NO: 736)) numbered according to SEQ ID NO: 138, or positions 571-599, numbered according to SEQ ID NO: 982.
- loop VIII comprises positions 571-592 (e.g., amino acids TNNQSSTTAPATGTYNLQEIVP (SEQ ID NO: 736)) numbered according to SEQ ID NO: 138, or positions 571-599, numbered according to SEQ
- loop VIII comprises positions 571-592 (e.g., amino acids TNNQSSTTAPATGTYNLQEIVP (SEQ ID NO: 736)) numbered according to SEQ ID NO: 138, or positions 571-599, numbered according to SEQ ID NO: 982. 148.
- loop VIII comprises positions 571-592 (e.g., amino acids TNNQSSTTAPATGTYNLQEIVP (SEQ ID NO: 736)) numbered according to SEQ ID NO: 138, or positions 571-599, numbered according to SEQ ID NO: 982. 149.
- the AAV capsid variant of any one of embodiments 1-152 which comprises an amino acid other than T at position 577, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138. 154.
- the AAV capsid variant of any one of embodiments 1-153 which comprises a Y at position 577, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138 or 982. 155.
- AAV capsid variant of any one of embodiments 1-40, 59, 60, 67-98, 139, 140, or 146-155 wherein X1 of [N2] corresponds to position 577 (e.g., Y577), X2 of [N2] corresponds to position 578 (e.g., P588), X3 of [N2] corresponds to position 579 (e.g., A579), X4 of [N2] corresponds to position 580 (e.g., E580), and X5 of [N2] corresponds to position 581 (e.g., V581) of SEQ ID NO: 982. 157.
- X1 of [N2] corresponds to position 577 (e.g., Y577)
- X2 of [N2] corresponds to position 578 (e.g., P588)
- X3 of [N2] corresponds to position 579 (e.g., A579)
- [N1]-[N2]-[N3]-[N4] replaces positions 574-579 (e.g., Q574, S575, S576, T577, T578, and A579), relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138. 173.
- [N1]-[N2]-[N3]-[N4] corresponds to positions 574-586 (e.g., Q574, S575, S576, Y577, P578, A579, E580, V581, V582, Q583, K584, T585, A586) of SEQ ID NO: 982. 175.
- [N0]-[N1]-[N2]-[N3]-[N4] replaces positions 571-579 (e.g., T571, N572, N573, Q574, S575, S576, T577, T578, and A579), relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138. 184.
- positions 571-579 e.g., T571, N572, N573, Q574, S575, S576, T577, T578, and A579
- [N0]-[N1]-[N2]-[N3]-[N4] corresponds to positions 571-586 (e.g., T571, N572, N573, Q574, S575, S576, Y577, P578, A579, E580, V581, V582, Q583, K584, T585, A586), of SEQ ID NO: 982.
- AAV capsid variant of any one of embodiments 3, 31-40, 68, 94-98, 139, 140, or 146-188 wherein: (i) X A of [N0] is present at position 571, X B of [N0] is present at position 572, and X C of [N0] is present at position 573, numbered according to SEQ ID NO: 982; (ii) X D of [N1] is present at position 574, X E of [N1] is present at position 575, and X F of [N1] is present at position 576, numbered according to SEQ ID NO: 982; (iii) X1 of [N2] is present at position 577, X2 of [N2] is present at position 578, X3 of [N2] is present at position 579, X4 of [N2] is present at position 580, and X5 of [N2] is present at position 581, numbered according to SEQ ID NO: 982;
- AAV capsid variant of any one of embodiments 3, 31-40, 68, 94-98, 139, 140, or 146-189 wherein: (i) [N0] is present at positions 571-573, numbered according to SEQ ID NO: 982; (ii) [N1] is present at positions 574-576, numbered according to SEQ ID NO: 982; (iii) [N2] is present at positions 577-581, numbered according to SEQ ID NO: 982; (iv) [N3] is present at positions 582-584, numbered according to SEQ ID NO: 982; (v) [N4] is present at positions 585-586, numbered according to SEQ ID NO: 982; (vi) [N2]-[N3] is present at positions 577-584, numbered according to SEQ ID NO: 982; and/or (vii) [N0]-[N1]-[N2]-[N3]-[N4] is present at positions 571
- the AAV capsid variant of any one of embodiments 3, 18, 19, 28-40, 59, 60, 68, 89-98, 139, 140, or 146-196 which comprises from N-terminus to C-terminus [N0]-[N1]-[N2]-[N3]-[N4].
- loop VIII comprises positions 571-592 (e.g., amino acids TNNQSSTTAPATGTYNLQEIVP (SEQ ID NO: 736)) numbered according to SEQ ID NO: 138, or positions 571-599, numbered according to SEQ ID NO: 982. 199.
- loop VIII comprises positions 571-592 (e.g., amino acids TNNQSSTTAPATGTYNLQEIVP (SEQ ID NO: 736)) numbered according to SEQ ID NO: 138, or positions 571-599, numbered according to SEQ ID NO: 982. 200.
- loop VIII comprises positions 571-592 (e.g., amino acids TNNQSSTTAPATGTYNLQEIVP (SEQ ID NO: 736)) numbered according to SEQ ID NO: 138, or positions 571-599, numbered according to SEQ ID NO: 982. 201.
- [B]- [C]-[D] replaces positions 574-579 (e.g., Q574, S575, S576, T577, T578, and A579), relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138. 214.
- positions 574-579 e.g., Q574, S575, S576, T577, T578, and A579
- [A]-[B]-[C]-[D] replaces positions 571-579 (e.g., T571, N572, N573, Q574, S575, S576, T577, T578, and A579), relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138. 232.
- positions 571-579 e.g., T571, N572, N573, Q574, S575, S576, T577, T578, and A579
- positions 571-586 e.g., T571, N572, N573, Q574, S575, S576, Y577, P578, A579, E580, V581, V582, Q583, K584, T585, A586) of SEQ ID NO: 982. 234.
- AAV capsid variant of any one of embodiments 42, 52-66, 126, 134-145, or 198-233 wherein: (i) X A of [A] is present at position 571, X B of [A] is present at position 572, and X C of [A] is present at position 573, numbered according to SEQ ID NO: 982; (ii) X1 of [B] is present at position 574, X2 of [B] is present at position 575, and X3 of [B] is present at position 576, numbered according to SEQ ID NO: 982; (iii) [C] is present at positions 577-584, numbered according to SEQ ID NO: 982; and/or (iv) X4 of [D] is present at position 585 and position X5 of [D] is present at position 586, numbered according to SEQ ID NO: 982.
- AAV capsid variant of any one of embodiments 42, 52-66, 126, 134-145, or 198-234 wherein: (i) [A] is present at positions 571-573, numbered according to SEQ ID NO: 982; (ii) [B] is present at positions 574-576, numbered according to SEQ ID NO: 982; (iii) [C] is present at positions 577-584, numbered according to SEQ ID NO: 982; (iv) [D] is present at positions 585-586, numbered according to SEQ ID NO: 982; and/or (v) [A]-[B]-[C]-[D] is present at positions 571-586, numbered according to SEQ ID NO: 982.
- the AAV capsid variant of any one of embodiments 41-66, 125-145, or 198-237 which comprises from N-terminus to C-terminus [B]-[C]. 239.
- loop VIII comprises positions 571- 592 (e.g., amino acids TNNQSSTTAPATGTYNLQEIVP (SEQ ID NO: 736)) numbered according to SEQ ID NO: 138, or positions 571-599, numbered according to SEQ ID NO: 982. 245.
- positions 575-579 e.g., S575, S576, T577, T578, and A579
- the AAV capsid variant of any one of embodiments 100, 110-124, or 242-255 wherein [K0] is present immediately subsequent to position 570, and wherein [K0] replaces positions 571 to 574 (e.g., T571, N572, N573, and Q574), relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138. 257.
- AAV capsid variant of any one of embodiments 100, 121-124, or 242-257 wherein [K0]- [K1]-[K2]-[K3]-[K4] replaces positions 571-579 (e.g., T571, N572, N573, Q574, S575, S576, T577, T578, and A579), relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138. 259.
- positions 571-579 e.g., T571, N572, N573, Q574, S575, S576, T577, T578, and A579
- the AAV capsid variant of any one of embodiments 100, 116-124, or 242-262 which comprises from N-terminus to C-terminus [K1]-[K2]-[K3]. 264.
- the AAV capsid variant of any one of embodiments 100, 116-124, or 242-263 which comprises from N-terminus to C-terminus [K0]-[K1]-[K2]-[K3]. 265.
- the AAV capsid variant of any one of embodiments 100, 121-124, or 242-264 which comprises from N-terminus to C-terminus [K1]-[K2]-[K3]-[K4].
- 266 The AAV capsid variant of any one of embodiments 100, 121-124, or 242-265, which comprises from N-terminus to C-terminus [K0]-[K1]-[K2]-[K3]-[K4]. 267.
- An AAV capsid variant (e.g., an AAV5 capsid variant) comprising: (a) the amino acid sequence of any of the sequences provided in Tables 1, 2A, 2B, 9, or 15- 20; (b) an amino acid sequence comprising at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 consecutive amino acids from any one of the sequences provided in Tables 1, 2A, 2B, 9, or 15-20; (c) an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to the amino acid sequence of any one of the amino acid sequences provided in Tables 1, 2A, 2B, 9, or 15-20; or (d) an amino sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to the amino acid sequence of any one of the amino acid sequences provided in Tables 1, 2A, 2B, 9, or 15-20.
- substitutions e.g., conservative substitutions
- An AAV capsid variant (e.g., an AAV5 capsid variant) comprising: (a) the amino acid sequence of any of SEQ ID NOs: 943, 1021, 1024, 1027, 1112, 1142, 1214, 1232, 1254, 1300, 1310, 1327, 1331, 1342, 1419, 1453, 1533, 1538, 1539, 1575, 1578, 1583- 1587, 1590, 1591-1593, 1598-1608, or 1610-1624; (b) an amino acid sequence comprising at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 consecutive amino acids from any one of SEQ ID NOs: 943, 1021, 1024, 1027, 1112, 1142, 1214, 1232, 1254, 1300, 1310, 1327, 1331, 1342, 1419, 1453, 1533, 1538, 1539, 1575, 1578, 1583-1587, 1590, 1591-1593, 1598-1608, or 1610-1610-16
- An AAV capsid variant (e.g., an AAV5 capsid variant) comprising: (a) the amino acid sequence of any of SEQ ID NOs: 943 or 2064-2080; (b) an amino acid sequence comprising at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 consecutive amino acids from any one of SEQ ID NOs: 943 or 2064-2080; (c) an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to the amino acid sequence of any one of SEQ ID NOs: 943 or 2064-2080; or (d) an amino sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to the amino acid sequence of any one of SEQ ID NOs: 943 or 2064-2080.
- substitutions e.g., conservative substitutions
- insertions, or deletions relative to the amino acid sequence of any one of SEQ ID NOs: 9
- An AAV capsid variant (e.g., an AAV5 capsid variant) comprising: (a) the amino acid sequence of any of SEQ ID NOs: 1021, 1024, 1232, 1300, 1327, 1533, 1538, 1585, 1590, or 1591; (b) an amino acid sequence comprising at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 consecutive amino acids from any one of SEQ ID NOs: 1021, 1024, 1232, 1300, 1327, 1533, 1538, 1585, 1590, or 1591; (c) an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to the amino acid sequence of any one of SEQ ID NOs: 1021, 1024, 1232, 1300, 1327, 1533, 1538, 1585, 1590, or 1591; or (d) an amino sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions),
- the AAV capsid variant of any one of embodiments 267-270 which comprises at least 3, 4, 5, 6, or 7 consecutive amino acids from of any one of SEQ ID NOs: 943 or 946-966. 272.
- the AAV capsid variant of embodiment 267-271, wherein the 3 consecutive amino acids comprise YPA. 273.
- the AAV capsid variant of embodiment 267-272, wherein the 4 consecutive amino acids comprise YPAE (SEQ ID NO: 21).
- the AAV capsid variant of embodiment 267-273, wherein the 5 consecutive amino acids comprise YPAEV (SEQ ID NO: 1).
- the AAV capsid variant of embodiment 267-274, wherein the 6 consecutive amino acids comprise YPAEVV (SEQ ID NO: 725).
- the AAV capsid variant of any one of embodiments 267-277 which comprises an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to the amino acid sequence of YPAEVVQK (SEQ ID NO: 943). 283.
- the AAV capsid variant of any one of embodiments 267, 268, 270, or 278-281 which comprises an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to the amino acid sequence of any of SEQ ID NOs: 1021, 1024, 1232, 1300, 1327, 1533, 1538, 1585, 1590, or 1591. 284.
- the AAV capsid variant of any one of embodiments 267, 268, 270, or 378-281 which comprises an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to the amino acid sequence of any of SEQ ID NOs: 946, 952, 953, or 954.
- the AAV capsid variant of any one of embodiments 267-277 or 282 which comprises an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to the amino acid sequence of YPAEVVQK (SEQ ID NO: 943). 286.
- nucleotide sequence encoding the amino acid sequence comprises: (i) a nucleotide sequence comprising at least one, two, three, four, five, six, or seven modifications, e.g., substitutions, but no more than ten modifications, e.g., substitutions, relative to the nucleotide sequence of SEQ ID NO: 944; or (ii) a nucleotide sequence comprising at least one, two, three, four, five, six, or seven, but no more than ten different nucleotides relative to the nucleotide sequence of SEQ ID NO: 944. 290.
- the AAV capsid variant of embodiment 267 which comprises: (a) the amino acid sequence of any of SEQ ID NOs: 2024-2063; (b) an amino acid sequence comprising at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 consecutive amino acids from any one of SEQ ID NOs: 2024-2063; (c) an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to the amino acid sequence of any one of SEQ ID NOs: 2024-2063; or (d) an amino sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to the amino acid sequence of any one of SEQ ID NOs: 2024-2063.
- substitutions e.g., conservative substitutions
- insertions, or deletions relative to the amino acid sequence of any one of SEQ ID NOs: 2024-2063.
- the AAV capsid variant of embodiment 267 or 290 wherein the different amino acids of the amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to the amino acid sequence of any one of SEQ ID NOs: 2024-2063, are present at one or more of the following positions: (i) position 1, wherein the different amino acid is T or L; (ii) position 2, wherein the different amino acid is N, L, K, A, T, or P; (iii) position 3, wherein the different amino acid is N, K, L, A, Y, or S; (iv) position 4, wherein the different amino acid is Q, L, T, S, F, Y, K, or A; (v) position 5, wherein the different amino acid is S, H, A, M, Q, T, V, or F; (vi) position 6, wherein the different amino acid is S, P, V, A, Q, L, T, N, or M; (vii) position 7, wherein the different amino acid is Y, H, H,
- the AAV capsid variant of embodiment 267 which comprises: (a) the amino acid sequence of any one of SEQ ID NOs: 1632-2023; (b) an amino acid sequence comprising at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 consecutive amino acids from any one of SEQ ID NOs: 1632-2023; (c) an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to the amino acid sequence of any one of SEQ ID NOs: 1632-2023; or (d) an amino sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to the amino acid sequence of any one of SEQ ID NOs: 1632-2023.
- substitutions e.g., conservative substitutions
- insertions, or deletions relative to the amino acid sequence of any one of SEQ ID NOs: 1632-2023.
- the AAV capsid variant of any one of embodiments 267-295 wherein the amino acid sequence replaces one, two, three, four, five or all of positions 571, 572, 573, 574, 575, and/or 576 (e.g., positions T571, N572, N573, Q574, S575, S576, T577, T578, and/or A579), relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138. 297.
- the AAV capsid variant of any one of embodiments 267-297 which comprises an amino acid residue other than T at position 577, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138. 299.
- the AAV capsid variant of any one of embodiments 267-298 which comprises the amino acid Y at position 577, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138 or 982. 300.
- the AAV capsid variant of any one of embodiments 267-299 which comprises the substitution T577Y, numbered according to SEQ ID NO: 138. 301.
- the AAV capsid variant of embodiment 298 or 299 wherein the amino acid sequence is or comprises YPAEVVQK (SEQ ID NO: 943), and starts at position 577, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138 or 982. 302.
- the AAV capsid variant of any one of embodiments 267-277, 282, 285, 288, 289, or 294-301 which comprises an amino acid other than T at position 577, and further comprises the amino acid sequence of PAEVVQK (SEQ ID NO: 20), which is present immediately subsequent to position 577, numbered relative to SEQ ID NO: 138. 303.
- the AAV capsid variant of any one of embodiments 267-277, 282, 285, 288, 289, or 294-303 which comprises the amino acid Y at position 577, and further comprises the amino acid sequence of PAEVVQK (SEQ ID NO: 20), which is present immediately subsequent to position 577 (e.g., at positions 578-584), numbered relative to SEQ ID NO: 982.
- AAV capsid variant of any one of embodiments 267-277, 282, 285, 288, 289, or 294-304 which comprises the amino acid sequence of YPAEVVQK (SEQ ID NO: 943), wherein the amino acid sequence replaces position 577 (e.g., T577), relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138. 306.
- AAV capsid variant of any one of embodiments 267-277, 282, 285, 288, 289, or 294-305 which comprises the amino acid sequence of YPAEVVQK (SEQ ID NO: 943), wherein the amino acid sequence: (i) is present immediately subsequent to position 576; and (ii) replaces position 577 (e.g., T577), wherein in (i) and (ii) are numbered relative to SEQ ID NO: 138. 307.
- an amino acid other than Q at position 574 (e.g., A or T)
- S at position 575 e.g., G
- S e.g., A, L, K, or R
- AAV capsid variant of any one of embodiments 267-277, 282, 285, 288, 289, or 294-309 which further comprises: (i) A at position 574, G at position 575, and A at position 576, numbered relative to SEQ ID NO: 138 or 982; or (ii) T at position 574 and L at position 576, numbered relative to SEQ ID NO: 138 or 982. 311.
- AAV capsid variant of any one of embodiments 267-277, 282, 285, 288, 289, or 294-309 which further comprises: (i) K at position 576, numbered relative to SEQ ID NO: 138 or 982; or (ii) R at position 576, numbered relative to SEQ ID NO: 138 or 982. 312.
- AAV capsid variant of any one of embodiments 267-277, 282, 285, 288, 289, or 294-310 which comprises: (i) A at position 574, G at position 575, A at position 576, and Y at position 577, numbered relative to SEQ ID NO: 138 or 982; and (ii) the amino acid sequence of PAEVVQK (SEQ ID NO: 20), which is present immediately subsequent to position 577, numbered according to SEQ ID NO: 138 or 982. 313.
- AAV capsid variant of any one of embodiments 267-277, 282, 285, 288, 289, or 294-310 which comprises: (i) T at position 574, L at position 576, and Y at position 577, numbered relative to SEQ ID NO: 138 or 982; and (ii) the amino acid sequence of PAEVVQK (SEQ ID NO: 20), which is present immediately subsequent to position 577, numbered according to SEQ ID NO: 138 or 982. 314.
- the AAV capsid variant of any one of embodiments 267, 268, 270, 278, 283, 284, 286, or 287 which comprises Y at position 577 and the amino acid sequence TPSLVQK (SEQ ID NO: 53), which is present immediately subsequent to position 577, all numbered according to SEQ ID NO: 138 or 982. 318.
- the AAV capsid variant of any one of embodiments 267, 268, 270, 279, 283, 284, 286, or 287 which comprises Y at position 577 and the amino acid sequence PPSLVQK (SEQ ID NO: 47), which is present immediately subsequent to position 577, all numbered according to SEQ ID NO: 138 or 982. 319.
- the AAV capsid variant of any one of embodiments 267, 268, 270, 280, 283, 284, 286, or 287 which comprises Y at position 577 and the amino acid sequence PPSLEQK (SEQ ID NO: 54), which is present immediately subsequent to position 577, all numbered according to SEQ ID NO: 138 or 982.
- the AAV capsid variant, of any one of the preceding embodiments which further comprises a modification, e.g., an insertion, substitution (e.g., conservative substitution), and/or deletion, in loop I, II, IV, and/or VI. 322.
- the AAV capsid variant of any one of the preceding embodiments which comprises an amino acid sequence comprising at least one, two or three modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, but not more than 30, 20 or 10 modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to the amino acid sequence of SEQ ID NO: 138. 323.
- the AAV capsid variant, of any one of the preceding embodiments which comprises an amino acid sequence comprising at least one, two or three, but no more than 30, 20 or 10 different amino acids relative to the amino acid sequence of SEQ ID NO: 138. 324.
- the AAV capsid variant, of any one of the preceding embodiments which comprises the amino acid sequence of SEQ ID NO: 138, or an amino acid sequence with at least 80% (e.g., at least about 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto. 325.
- the AAV capsid variant, of any one of the preceding embodiments which comprises the amino acid sequence of SEQ ID NO: 138. 326.
- the AAV capsid variant, of any one of the preceding embodiments which comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 137, or a sequence with at least 80% (e.g., at least about 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto. 327.
- the AAV capsid variant, of any one of the preceding embodiments, wherein the nucleotide sequence encoding the capsid variant comprises the nucleotide sequence of SEQ ID NO: 137, or a sequence with at least 80% (e.g., at least about 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto. 328.
- the AAV capsid variant of any one of embodiments 1-98, 125-242, 267-277, 282, 285, 288, 289, 294-306, or 321-329, which comprises the amino acid sequence corresponding to positions 193- 731, e.g., a VP3, of SEQ ID NO: 982, or a sequence with at least 80% (e.g., at least about 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto. 331.
- AAV capsid variant of any one of embodiments 1-321, which comprises the amino acid sequence corresponding to positions 137-724, e.g., a VP2, of SEQ ID NO: 138, or a sequence with at least 80% (e.g., at least about 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto. 332.
- AAV capsid variant of any one of embodiments 1-321, which comprises the amino acid sequence corresponding to positions 193-724, e.g., a VP3, of SEQ ID NO: 138, or a sequence with at least 80% (e.g., at least about 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto. 333.
- the AAV capsid variant of any one of embodiments 267-277, 282, 285, 288, 289, 294-306, or 321-328, comprising an amino acid sequence comprising at least 3, 4, 5, or 6 consecutive amino acids from the amino acid sequence of YPAEVVQK (SEQ ID NO: 943), wherein: (i) the 3 consecutive amino acids comprise YPA; (ii) the 4 consecutive amino acids comprise YPAE (SEQ ID NO: 21); (iii) the 5 consecutive amino acids comprise YPAEV (SEQ ID NO: 1); (iv) the 6 consecutive amino acids comprise YPAEVV (SEQ ID NO: 725); (v) the 7 consecutive amino acids comprise YPAEVVQ (SEQ ID NO: 726); wherein the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 739, or an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 739.
- the AAV capsid variant of any one of embodiments 267-277, 282, 285, 288, 289, 294-306, 321- 328, or 333, comprising an amino acid sequence comprising at least 3, 4, 5, or 6 consecutive amino acids from the amino acid sequence of YPAEVVQK (SEQ ID NO: 943), wherein: (i) the 3 consecutive amino acids comprise YPA; (ii) the 4 consecutive amino acids comprise YPAE (SEQ ID NO: 21); (iii) the 5 consecutive amino acids comprise YPAEV (SEQ ID NO: 1); (iv) the 6 consecutive amino acids comprise YPAEVV (SEQ ID NO: 725); (v) the 7 consecutive amino acids comprise YPAEVVQ (SEQ ID NO: 726); wherein the AAV capsid variant comprises: (a) a VP1 protein comprising the amino acid sequence of SEQ ID NO: 138 or SEQ ID NO: 982; (b) a VP2 protein comprising the amino acid sequence of positions
- the AAV capsid variant of any one of embodiments 267-277, 282, 285, 288, 289, 294-306, 321- 328, or 334, comprising one, two, or three but no more than four different amino acids, relative to the amino acid sequence of YPAEVVQK (SEQ ID NO: 943), wherein the AAV capsid variant comprises: (a) a VP1 protein comprising the amino acid sequence of SEQ ID NO: 138 or SEQ ID NO: 982; (b) a VP2 protein comprising the amino acid sequence of positions 137-724 of SEQ ID NO: 138 or positions 137-731 of SEQ ID NO: 982; (c) a VP3 protein comprising the amino acid sequence of positions 193-724 of SEQ ID NO: 138 or positions 193-731 of SEQ ID NO: 982; or (d) an amino acid sequence with at least 90% (e.g., at least about 95, 96, 97, 98, or 99%) sequence identity
- the AAV capsid variant of any one of embodiments 267-277, 282, 285, 288, 289, 294-306, 321- 328, or 333-335, comprising one, two, or three but no more than four different amino acids, relative to the amino acid sequence of YPAEVVQK (SEQ ID NO: 943), wherein the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 739; or an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the amino acid sequence of SEQ ID NO: 739. 337.
- the AAV capsid variant of any one of embodiments 267-277, 282, 285, 288, 289, 294-306, 321- 328, or 333-336, comprising one or two, but no more than three substitutions relative to the amino acid sequence of YPAEVVQK (SEQ ID NO: 943), wherein the AAV capsid variant comprises an amino acid sequence at least 90% (e.g., at least about 95, 96, 97, 98, or 99%) identical to the amino acid sequence of SEQ ID NO: 982. 338.
- the AAV capsid variant of any one of embodiments 1-98, 125-241, 267-277, 282, 285, 288, 289, 294-306, 321-328, or 333-337, which comprises the amino acid sequence of SEQ ID NO: 982, or an amino acid sequence with at least 80% (e.g., at least about 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto. 339.
- the AAV capsid variant, of any one of embodiments 1-98, 125-241, 267-277, 282, 285, 288, 289, 294-306, 321-328, or 333-338 which comprises the amino acid sequence of SEQ ID NO: 982 or an amino acid sequence with at least 95% identity thereto. 340.
- AAV capsid variant of any one of embodiments 1-98, 125-241, 267-277, 282, 285, 288, 289, 294-306, 321-328, or 333-339, which comprises the amino acid sequence of SEQ ID NO: 982 or an amino acid sequence with at least 98% identity thereto. 341.
- AAV capsid variant of any one of embodiments 1-98, 125-241, 267-277, 282, 285, 288, 289, 294-306, 321-328, or 333-340 which comprises an amino acid sequence comprising at least one, two or three modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, but not more than 30, 20 or 10 modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to the amino acid sequence of SEQ ID NO: 982. 342.
- AAV capsid variant of any one of embodiments 1-98, 125-241, 267-277, 282, 285, 288, 289, 294-306, 321-328, or 333-341, which comprises an amino acid sequence comprising at least one, two or three, but not more than 30, 20 or 10 different amino acids, relative to the amino acid sequence of SEQ ID NO: 982. 343.
- the AAV capsid variant of any one of the preceding embodiments 1-98, 125-241, 267-277, 282, 285, 288, 289, 294-306, 321-328, or 333-342, wherein the nucleotide sequence encoding the capsid variant comprises the nucleotide sequence of SEQ ID NO: 984, or a nucleotide sequence with at least 80% (e.g., at least about 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto. 344.
- An AAV capsid variant (e.g., an AAV5 capsid variant) comprising the amino acid sequence of any one of embodiments 267-277, 282, 285, 288, 289, 294-306, 321-328, or 333-342, and further comprising an amino acid sequence at least 80% (e.g., at least about 85, 90, 95, 96, 97, 98, or 99%) identical to SEQ ID NO: 982. 346.
- An AAV capsid variant (e.g., an AAV5 capsid variant) comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the amino acid sequence of SEQ ID NO: 739, wherein the AAV capsid variant comprises the amino acid sequence of YPAEVVQK (SEQ ID NO: 943). 347.
- An AAV capsid variant (e.g., an AAV5 capsid variant) comprising the amino acid sequence of SEQ ID NO: 982. 349.
- An AAV capsid variant (e.g., an AAV5 capsid variant) comprising an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 984, or a nucleotide sequence at least 95% identical thereto. 350.
- AAV capsid variant of any one embodiments 1-66, 139, 140, 146-241, 267, 268, 270-289, or 294-350 which has an increased tropism for a CNS cell or tissue, e.g., a brain cell, brain tissue, spinal cord cell, or spinal cord tissue, relative to the tropism of a reference sequence comprising the amino acid sequence of SEQ ID NO: 982. 352.
- AAV capsid variant of any one embodiments 1-66, 139, 140, 146-241, 267, 268, 270-289, or 294-351 which has an increased tropism for a CNS cell or tissue, e.g., a brain cell, brain tissue, spinal cord cell, or spinal cord tissue, relative to the tropism of a reference sequence comprising the amino acid sequence of SEQ ID NO: 139. 353.
- the AAV capsid variant of any one of embodiments 1-66, 139, 140, 146-241, 267, 268, 270-289, or 294-352 which transduces a brain region, e.g., a temporal cortex, perirhinal cortex, globus pallidus, putamen, caudate, thalamus, hippocampus, geniculate nucleus, Purkinje Layer, deep cerebellar nuclei, and/or cerebellum, optionally wherein the level of transduction is at least 1.5, 2.2, 2.4, 2.5, 2.6, 2.7, 3.0, 3.2, 3.5, 3.7, 4.0, 4.2, 4.5, 4.7, 4.9, 5, 10, 15, 20, 25, 30, 35-fold greater as compared to a reference sequence of SEQ ID NO: 139, e.g., when measured by an assay, e.g., an immunohistochemistry assay or a qPCR assay, e.g., as described in Example 2.
- an assay
- AAV capsid variant of any one of embodiments 1-66, 139, 140, 146-241, 267, 268, 270-289, or 294-353 which is enriched at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 17, 20, 25, 30, 35, 40, 45, 50, 55, 60, or 65-fold, in the brain compared to a reference sequence of SEQ ID NO: 138, e.g., when measured by an assay as described in Example 1. 355.
- AAV capsid variant of any one of embodiments 1-66, 139, 140, 146-241, 267, 268, 270-289, or 294-354 which is enriched at least about 10, 12, 15, 17, 20, 25, 30, 35, 40, 45, 50, 55, 60, 61, 62, 63, 64, or 65-fold, in the brain compared to a reference sequence of SEQ ID NO: 138, e.g., when measured by an assay as described in Example 1. 356.
- AAV capsid variant of any one of embodiments 1-66, 139, 140, 146-241, 267, 268, 270-289, or 294-355 which is enriched in the brain of at least two to three species, e.g., a non-human primate and rodent (e.g., rat and/or mouse), e.g., as compared to a reference sequence of SEQ ID NO: 138. 357.
- a non-human primate and rodent e.g., rat and/or mouse
- the AAV capsid variant, of any one of embodiments 1-66, 139, 140, 146-241, 267, 268, 270- 289, or 294-356 which is enriched at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 17, 20, 25, 30, 35, 40, 45-fold, in the brain of at least two to three species, e.g., a non-human primate and rodent (e.g., rat and/or mouse), compared to a reference sequence of SEQ ID NO: 138, e.g., when measured by an assay as described in Examples 1, 2, 4, and 5. 358.
- a non-human primate and rodent e.g., rat and/or mouse
- AAV capsid variant of embodiment 356 or 357 wherein the at least two to three species are Macaca fascicularis, Chlorocebus sabaeus, Callithrix jacchus, rat, and/or mouse (e.g., BALB/c mice). 359.
- AAV capsid variant of any one of embodiments 1-66, 139, 140, 146-241, 267, 268, 270-289, or 294-359 which delivers an increased level of a payload to a brain region, optionally wherein the level of the payload is increased by at least 20, 25, 30, 35-fold, as compared to a reference sequence of SEQ ID NO: 139, e.g., when measured by an assay, e.g., a qRT-PCR or a qPCR assay (e.g., as described in Example 2). 361.
- the AAV capsid variant of any one of embodiments 1-66, 139, 140, 146-241, 267, 268, 270-289, or 294-360 which delivers an increased level of viral genomes to a brain region, optionally wherein the level of viral genomes is increased by at least 1.5, 2.2, 2.4, 2.5, 2.6, 2.7, 3.0, 3.2, 3.5, 3.7, 4.0, 4.2, 4.5, 4.7, 4.9, or 5-fold, as compared to a reference sequence of SEQ ID NO: 139, e.g., when measured by an assay, e.g., a qRT-PCR or a qPCR assay (e.g., as described in Example 2). 362.
- an assay e.g., a qRT-PCR or a qPCR assay (e.g., as described in Example 2).
- the AAV capsid variant of any one of embodiments 1-66, 139, 140, 146-241, 267, 268, 270-289, or 294-362 which is enriched at least about 3, 3.5, 4.0, 4.5, 5, 5.0, 6.0, or 6.5-fold, in a spinal cord region compared to a reference sequence of SEQ ID NO: 139, e.g., when measured by an assay as described in Example 2.
- the AAV capsid variant of any one of the preceding embodiments which shows preferential transduction in a brain region relative to the transduction in the dorsal root ganglia (DRG).
- DDG dorsal root ganglia
- the AAV capsid variant of any one of embodiments 1-66, 139, 140, 146-241, 267, 268, 270-289, or 294-365 which is capable of transducing neuronal cells.
- non-neuronal cells e.g., glial cells (e.g., oligodendrocytes).
- the AAV capsid variant of any one of embodiments 1-66, 139, 140, 146-241, 267, 268, 270-289, or 294-367 which shows preferential transduction in a brain region relative to the transduction in the liver. 369.
- the AAV capsid variant of any one of embodiments 67-267, 269, 271-277, 282, 285, 288, 289, 294-306, 321-349, 369, or 370 which delivers an increased level of a payload to a heart region, optionally wherein the level of the payload is increased by at least 1.5, 2, or 2.5-fold, as compared to a reference sequence of SEQ ID NO: 139, e.g., when measured by an assay, e.g., an IHC assay or a RT- ddPCR assay (e.g., as described in Example 2). 372.
- the AAV capsid variant of any one of embodiments 267, 290, 291, 321-328, 331, 332, 344, or 374, which is enriched at least about 2, 3, 4, 5, 10, 15, 20, 25, 30, or 35-fold, in the muscle compared to a reference sequence of SEQ ID NO: 982, e.g., when measured by an assay as described in Example 4.
- 376 The AAV capsid variant embodiment 374 or 375, wherein the muscle cell or tissue is a heart muscle (e.g., a heart ventricle or a heart atrium, or both), a quadriceps muscle, or both. 377.
- AAV capsid variant of any one embodiments 267, 292, 293, 321-328, 331, 332, or 344 which has an increased tropism for a liver cell or tissue, relative to the tropism of a reference sequence comprising the amino acid sequence of SEQ ID NO: 982. 378.
- the AAV capsid variant, of any one of embodiments 267, 292, 293, 321-328, 331, 332, 344, or 377 which is enriched at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 115, 120, 130, 140, 150, 160, 170, 180, 185, or 190-fold, in the liver compared to a reference sequence of SEQ ID NO: 982, e.g., when measured by an assay as described in Example 4.
- the polynucleotide of embodiment 379 which comprises: (i) a nucleotide sequence comprising at least one, two, three, four, five, six, or seven modifications, e.g., substitutions, but no more than ten modifications, e.g., substitutions, relative to the nucleotide sequences of SEQ ID NO: 944; (ii) a nucleotide sequence comprising at least one, two, three, four, five, six, or seven, but no more than ten different nucleotides, relative to the nucleotide sequences of SEQ ID NO: 944; or (iii) the nucleotide sequence of SEQ ID NO: 944, or nucleotide sequence substantially identical (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity) thereto.
- the polynucleotide of embodiment 379 or 380 which comprises the nucleotide sequence of SEQ ID NO: 984, or a nucleotide sequence with at least 80% (e.g., at least about 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto. 382.
- a polynucleotide encoding an AAV capsid variant e.g., an AAV5 capsid variant
- the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 984.
- a polynucleotide encoding an AAV capsid variant (e.g., an AAV5 capsid variant), wherein the encoded AAV capsid variant comprise the amino acid sequence of SEQ ID NO: 982. 384.
- a polynucleotide encoding an AAV capsid variant (e.g., an AAV5 capsid variant), wherein the encoded AAV capsid variant comprises: (a) the amino acid sequence of any one of the sequences provided in Tables 1, 2A, 2B, 9, or 15-20; (b) an amino acid sequence comprising at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 consecutive amino acids from any one of the sequences provided in Tables 1, 2A, 2B, 9, or 15-20; or (c) an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to the amino acid sequence of any one of the amino acid sequences provided in Tables 1, 2A, 2B, 9, or 15-20; or (d) an amino sequence comprising one,
- a polynucleotide encoding an AAV capsid variant (e.g., an AAV5 capsid variant), wherein the encoded AAV capsid variant comprises: (i) the amino acid sequence of YPAEVVQK (SEQ ID NO: 943); (ii) an amino acid sequence comprising one, two, or three, but no more than four different amino acids relative to the amino acid sequence of YPAEVVQK (SEQ ID NO: 943); (iii) an amino acid sequence comprising one, two, or three modifications, e.g., substitutions (e.g., conservative substitutions), but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), relative to the amino acid sequence of YPAEVVQK (SEQ ID NO: 943); or (iv) at least 3, 4, 5, 6, or 7 consecutive amino acids from the amino acid sequence of YPAEVVQK (SEQ ID NO: 943).
- the polynucleotide of any one of embodiments 384 or 385 which comprises: (i) the nucleotide sequence of SEQ ID NO: 944, or a nucleotide sequence substantially identical (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity) thereto; (ii) a nucleotide sequence comprising at least one, two, three, four, five, six, or seven, but no more than ten different nucleotides, relative to the nucleotide sequence of SEQ ID NO: 944; or (iii) a nucleotide sequence comprising at least one, two, three, four, five, six, or seven modifications, e.g., substitutions, insertions, or deletions, but no more than ten modifications, e.g., substitutions, insertions, or deletions, relative to the nucleotide sequence of SEQ ID NO: 944.
- polynucleotide of any one of embodiments 384-386, wherein the AAV capsid variant comprises: (i) the amino acid sequence of SEQ ID NO: 982, or an amino acid sequence with at least 80% (e.g., at least about 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto; (ii) an amino acid sequence comprising one, two or three, but no more than four different amino acids, relative to the amino acid sequence of SEQ ID NO: 982; or (iii) an amino acid sequence comprising one, two or three modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, but not more than 30, 20 or 10 modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to the amino acid sequence of SEQ ID NO: 982.
- substitutions e.g., conservative substitutions
- insertions, or deletions relative to the amino acid sequence of S
- polynucleotide of any one of embodiments 384-387 comprising the nucleotide sequence of SEQ ID NO: 984, or a nucleotide sequence with at least 80% (e.g., at least about 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto. 389.
- the polynucleotide of any one of embodiments 384-388 which comprises a nucleotide sequence that is codon optimized. 390.
- a peptide comprising: (a) the amino acid sequence of any one of the sequences provided in Tables 1, 2A, 2B, 9, or 15-20; (b) an amino acid sequence comprising at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 consecutive amino acids from any one of the sequences provided in Tables 1, 2A, 2B, 9, or 15-20; or (c) an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to the amino acid sequence of any one of the amino acid sequences provided in Tables 1, 2A, 2B, 9, or 15-20; or (d) an amino sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to the amino acid sequence of any one of the amino acid sequences provided in Tables 1, 2A, 2B, 9, or 15-20.
- substitutions e.g., conservative substitutions
- insertions, or deletions relative to the amino acid sequence of any one of the amino acid
- a peptide comprising: (i) the amino acid sequence of YPAEVVQK (SEQ ID NO: 943); (ii) an amino acid sequence comprising one, two, or three, but no more than four different amino acids relative to the amino acid sequence of YPAEVVQK (SEQ ID NO: 943); (iii) an amino acid sequence comprising one, two, or three modifications, e.g., substitutions (e.g., conservative substitutions), but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), relative to the amino acid sequence of YPAEVVQK (SEQ ID NO: 943); or (iv) at least 3, 4, 5, 6, or 7 consecutive amino acids from the amino acid sequence of YPAEVVQK (SEQ ID NO: 943).
- a peptide comprising the amino acid sequence of YPAEVVQK (SEQ ID NO: 943). 393.
- a peptide wherein the nucleotide sequence encoding the peptide comprises: (i) the nucleotide sequence of SEQ ID NO: 944, or a nucleotide sequence substantially identical (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity) thereto; (ii) a nucleotide sequence comprising at least one, two, three, four, five, six, or seven, but no more than ten different nucleotides relative to the nucleotide sequence of SEQ ID NO: 944; or (iii) a nucleotide sequence comprising at least one, two, three, four, five, six, or seven modifications, e.g., substitutions, insertions, or deletions, but no more than ten modifications, e.g., substitutions, insertions, or deletions, relative to the nucleotide sequence of SEQ ID NO: 944.
- An AAV capsid variant (e.g., an AAV5 capsid variant) comprising the peptide of any one of embodiments 390-394. 396.
- An AAV capsid variant (e.g., an AAV5 capsid variant) encoded by the polynucleotide of any one of embodiments 382-389. 397.
- An AAV particle comprising the AAV capsid variant of any one of embodiments 1-378, 395, or 396. 398.
- the AAV particle of embodiment 399 which comprises a nucleotide sequence encoding a payload. 399.
- the AAV particle of embodiment 398 wherein the encoded payload comprises a therapeutic protein or functional variant thereof; an antibody or antibody fragment; an enzyme; a component of a gene editing system; an RNAi agent (e.g., a dsRNA, siRNA, shRNA, pre-miRNA, pri-miRNA, miRNA, stRNA, lncRNA, piRNA, or snoRNA); or a combination thereof.
- an RNAi agent e.g., a dsRNA, siRNA, shRNA, pre-miRNA, pri-miRNA, miRNA, stRNA, lncRNA, piRNA, or snoRNA
- the therapeutic protein or functional variant thereof e.g., a recombinant protein, is associated with (e.g., aberrantly expressed in) a neurological or neurodegenerative disorder, a muscular or neuromuscular disorder, or a neuro-oncological disorder.
- the AAV particle of embodiment 399 or 400, the therapeutic protein or functional variant thereof is chosen from apolipoprotein E (APOE) (e.g., ApoE2, ApoE3 and/or ApoE4); human survival of motor neuron (SMN) 1 or SMN2; glucocerebrosidase (GBA1); aromatic L-amino acid decarboxylase (AADC); aspartoacylase (ASPA); tripeptidyl peptidase I (CLN2); beta-galactosidase (GLB1); N-sulphoglucosamine sulphohydrolase (SGSH); N-acetyl-alpha-glucosaminidase (NAGLU); iduronate 2-sulfatase (IDS); intracellular cholesterol transporter (NPC1); gigaxonin (GAN); or a combination thereof.
- APOE apolipoprotein E
- GAA1 glucocerebrosidase
- the AAV particle of embodiment 399, wherein the antibody or antibody binding fragment binds to: (i) a CNS related target, e.g., an antigen associated with a neurological or neurodegenerative disorder, e.g., ⁇ -amyloid, APOE, tau, SOD1, TDP-43, huntingtin (HTT), and/or synuclein; (ii) a muscular or neuromuscular related target, e.g., an antigen associated with a muscular or neuromuscular disorder; or (iii) a neuro-oncology related target, e.g., an antigen associated with a neuro-oncological disorder, e.g., HER2, or EGFR (e.g., EGFRvIII).
- a CNS related target e.g., an antigen associated with a neurological or neurodegenerative disorder, e.g., ⁇ -amyloid, APOE, tau, SOD1, TDP-43, huntingtin (HTT), and/or
- the AAV particle of embodiment 399, wherein the enzyme comprises a meganuclease, a zinc finger nuclease, a TALEN, a recombinase, integrase, a base editor, a Cas9, or a fragment thereof.
- the component of a gene editing system comprises one or more components of a CRISPR-Cas system. 405.
- the AAV particle of embodiment 404 wherein the one or more components of the CRISPR-Cas system comprises a Cas9, e.g., a Cas9 ortholog or a Cpf1, and a single guide RNA (sgRNA), optionally wherein: (i) the sgRNA is located upstream (5’) of the Cas9 enzyme; or (ii) the sgRNA is located downstream (3’) of the Cas9 enzyme. 406.
- a Cas9 e.g., a Cas9 ortholog or a Cpf1
- sgRNA single guide RNA
- RNAi agent e.g., a dsRNA, siRNA, shRNA, pre-miRNA, pri-miRNA, miRNA, stRNA, lncRNA, piRNA, or snoRNA
- modulates e.g., inhibits, expression of, a CNS related gene, mRNA, and/or protein. 407.
- the AAV particle of embodiment 408 or 409, wherein the promoter is an EF-1a promoter variant, e.g., a truncated EF-1a promoter. 411.
- the AAV particle of any one of embodiments 408-410, wherein the promoter comprises the nucleotide sequence of any one of SEQ ID NOs: 2100, 2101, 2103, 2104, 2108, 2109, 2111-2120, or any one of the nucleotide sequences provided in Table 8, a nucleotide sequence comprising at least one, two, three, four, five, six, or seven but no more than ten modifications, e.g., substitutions, insertions, or deletions, relative to the nucleotide sequence of SEQ ID NOs: 2100, 2101, 2103, 2104, 2108, 2109, 2111-2120, or any one of the nucleotide sequences provided in Table 8, or a nucleotide sequence with at least 80% (e.g.,
- the AAV particle of any one of embodiments 408-411 wherein the viral genome further comprises a polyA signal sequence. 413.
- the AAV particle of any one of embodiments 408-412, wherein the viral genome further comprises an inverted terminal repeat (ITR) sequence.
- ITR inverted terminal repeat
- the AAV particle of any one of embodiments 408-413, wherein the viral genome comprises an ITR sequence positioned 5’ relative to the nucleic acid sequence encoding the payload.
- 415 The AAV particle of any one of embodiments 408-414, wherein the viral genome comprises an ITR sequence positioned 3’ relative to the nucleic acid sequence encoding the payload. 416.
- a miR binding site e.g., a miR binding site that modulates, e.g., reduces, expression of payload encoded by the viral genome in a cell or tissue where the corresponding miRNA is expressed.
- the encoded miRNA binding site is complementary, e.g., fully complementary or partially complementary, to a miRNA expressed in a cell or tissue of the DRG, liver, heart, hematopoietic, or a combination thereof.
- the encoded miR binding site comprises a miR122 binding site, a miR183 binding site, a miR-1 binding site, a miR-142-3p, or a combination thereof, optionally wherein: (i) the encoded miR122 binding site comprises the nucleotide sequence of SEQ ID NO: 4673, or a nucleotide sequence substantially identical (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity) thereto; or a nucleotide sequence comprising at least one, two, three, four, five, six, or seven modifications, e.g., substitutions, insertions, or deletions, but no more than ten modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4673; (ii) the encoded miR183 binding site comprises the nucleotide sequence of SEQ ID NO: 4673;
- the AAV particle of embodiment 429 or 430, wherein the encoded miR122 binding site comprises the nucleotide sequence of SEQ ID NO: 4673, or a nucleotide sequence substantially identical (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity) thereto; or a nucleotide sequence comprising at least one, two, three, four, five, six, or seven modifications, e.g., substitutions, insertions, or deletions, but no more than ten modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4673. 432.
- the AAV particle of embodiment 433 or 434, wherein the encoded miR183 binding site comprises the nucleotide sequence of SEQ ID NO: 4673, or a nucleotide sequence substantially identical (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity) thereto; or a nucleotide sequence comprising at least one, two, three, four, five, six, or seven modifications, e.g., substitutions, insertions, or deletions, but no more than ten modifications, e.g., substitutions, insertions, or deletions, relative to SEQ ID NO: 4673. 436.
- the AAV particle of any one of embodiments 408-436, wherein the viral genome comprises an encoded miR122 binding site and a miR-1 binding site. 438.
- the AAV particle of any one of embodiments 408-437, wherein the viral genome is single stranded or self-complementary. 439.
- the AAV particle of any one of embodiments 408-438, wherein the viral genome further comprises a nucleotide sequence encoding a Rep protein, e.g., a non-structural protein, wherein the Rep protein comprises a Rep78 protein, a Rep68, Rep52 protein, and/or a Rep40 protein (e.g., a Rep78 and a Rep52 protein).
- a Rep protein e.g., a non-structural protein
- the Rep protein comprises a Rep78 protein, a Rep68, Rep52 protein, and/or a Rep40 protein (e.g., a Rep78 and a Rep52 protein).
- a Rep protein e.g., a non-structural protein
- the Rep protein comprises a Rep78 protein, a Rep68, Rep52 protein, and/or a Rep40 protein (e.g., a Rep78 and a Rep52 protein).
- a vector comprising a polynucleotide encoding the AAV capsid variant of any one of embodiments 1-378, 395, 396, or 444, the polynucleotide of any one of embodiments 379-389 or 444, or a polynucleotide encoding the peptide of any one of embodiments 390-394 or 444. 446.
- a cell e.g., a host cell, comprising the AAV capsid variant of any one of embodiments 1-378, 395, 396, or 444, the polynucleotide of any one of embodiments 379-389 or 444, the peptide of any one of embodiments 390-394 or 444, the AAV particle of any one of embodiments 397-444, or the vector of embodiment 445. 447.
- the cell of embodiment 446, wherein the cell is a mammalian cell or an insect cell. 448.
- the cell of embodiment 446 or 447 wherein the cell is a cell of a brain region or a spinal cord region, optionally a cell of the temporal cortex, perirhinal cortex, globus pallidus, putamen, caudate, thalamus, hippocampus, geniculate nucleus, Purkinje Layer, deep cerebellar nuclei, cerebellum, cervical spinal cord, thoracic spinal cord, lumbar spinal cord, or a combination thereof. 449.
- a method of making an AAV particle comprising (i) providing a host cell comprising a viral genome; and (ii) incubating the host cell under conditions suitable to enclose the viral genome in the AAV capsid variant of any one of embodiments 1-378, 395, 396, or 444, or an AAV capsid variant encoded by the polynucleotide of any one of embodiments 379-389 or 444; thereby making the AAV particle. 451.
- the method of embodiment 450 further comprising, prior to step (i), introducing a first nucleic acid molecule comprising the viral genome into the host cell. 452.
- the method of embodiment 450 or 451, wherein the host cell comprises a second nucleic acid encoding the capsid variant. 453.
- a pharmaceutical composition comprising the AAV particle of any one of embodiments 397- 444, an AAV particle comprising the capsid variant of any one of embodiments 1-378, 395, 396, or 444, or an AAV particle comprising the peptide of any one of embodiments 390-394 or 444, and a pharmaceutically acceptable excipient. 455.
- a method of delivering a payload to a cell or tissue comprising administering an effective amount of the pharmaceutical composition of embodiment 454, the AAV particle of any one of embodiments 397-444, an AAV particle comprising the capsid variant of any one of embodiments 1-378, 395, 396, or 444, or an AAV particle comprising the peptide of any one of embodiments 390- 394 or 444. 456.
- a cell or tissue e.g., a CNS cell, a CNS tissue, a heart cell, a heart tissue, a muscle cell, a muscle tissue, a liver cell, or a liver tissue
- the cell is a cell of a brain region or a spinal cord region, optionally a cell of the temporal cortex, perirhinal cortex, globus pallidus, putamen, caudate, thalamus, hippocampus, geniculate nucleus, Purkinje Layer, deep cerebellar nuclei, cerebellum, cervical spinal cord region, thoracic spinal cord region, lumbar spinal cord region, or a combination thereof. 457.
- the method of embodiment 455, wherein the cell is a cell of the heart, e.g., a heart atrium or a heart ventricle. 458.
- a method of treating a subject having or diagnosed with having a genetic disorder comprising administering to the subject an effective amount of the pharmaceutical composition of embodiment 454, the AAV particle of any one of embodiments 397-444, an AAV particle comprising the capsid variant of any one of embodiments 1- 378, 395, 396, or 444, or an AAV particle comprising the peptide of any one of embodiments 390-394 or 444. 466.
- a method of treating a subject having or diagnosed with having a neurological disorder comprising administering to the subject an effective amount of the pharmaceutical composition of embodiment 454, the AAV particle of any one of embodiments 397- 444, an AAV particle comprising the capsid variant of any one of embodiments 1-378, 395, 396, or 444, or an AAV particle comprising the peptide of any one of embodiments 390-394 or 444. 467.
- a method of treating a subject having or diagnosed with having a muscular disorder or a neuromuscular disorder comprising administering to the subject an effective amount of the pharmaceutical composition of embodiment 454, the AAV particle of any one of embodiments 397- 444, an AAV particle comprising the capsid variant of any one of embodiments 1-378, 395, 396, or 444, or an AAV particle comprising the peptide of any one of embodiments 390-394 or 444. 468.
- a method of treating a subject having or diagnosed with having a neuro-oncological disorder comprising administering to the subject an effective amount of the pharmaceutical composition of embodiment 454, the AAV particle of any one of embodiments 397-444, an AAV particle comprising the capsid variant of any one of embodiments 1-378, 395, 396, or 444, or an AAV particle comprising the peptide of any one of embodiments 390-394 or 444. 469.
- the genetic disorder, neurological disorder, neurodegenerative disorder, muscular disorder, neuromuscular disorder, or neuro- oncological disorder is Huntington’s Disease, Amyotrophic Lateral Sclerosis (ALS), Gaucher Disease, Dementia with Lewy Bodies, Parkinson’s disease, Spinal Muscular Atrophy, Alzheimer’s Disease, a leukodystrophy (e.g., Alexander disease, autosomal dominant leukodystrophy with autonomic diseases (ADLD), Canavan disease, cerebrotendinous xanthomatosis (CTX), metachromatic leukodystrophy (MLD), Pelizaeus-Merzbacher disease, or Refsum disease), or a cancer (e.g., a HER2/neu positive cancer or a glioblastoma).
- a leukodystrophy e.g., Alexander disease, autosomal dominant leukodystrophy with autonomic diseases (ADLD), Canavan disease, cerebrotendinous xanthomatosis (CTX), meta
- any one of embodiments 465-469, wherein treating comprises prevention of progression of the disease or disorder in the subject.
- 471 The method of any one of embodiments 460-470, wherein the subject is a human. 472.
- ICM intra-cisterna magna injection
- AAV particle is administered to the subject via focused ultrasound (FUS), e.g., coupled with the intravenous administration of microbubbles (FUS-MB), or MRI-guided FUS coupled with intravenous administration.
- FUS focused ultrasound
- FUS-MB microbubbles
- MRI-guided FUS coupled with intravenous administration.
- 474 The method of any one of embodiments 465-472, wherein the AAV particle is administered to the subject intravenously.
- administration of the AAV particle results in a decreased presence, level, and/or activity of a gene, mRNA, protein, or combination thereof.
- any one of embodiments 465-475 wherein administration of the AAV particle results in an increased presence, level, and/or activity of a gene, mRNA, protein, or a combination thereof. 477.
- composition of embodiment 454 Use of the pharmaceutical composition of embodiment 454, the AAV particle of any one of embodiments 397-444, an AAV particle comprising the capsid variant of any one of embodiments 1- 378, 395, 396, or 444, or an AAV particle comprising the peptide of any one of embodiments 390-394 or 444, in the manufacture of a medicament. 481.
- composition of embodiment 454 Use of the pharmaceutical composition of embodiment 454, the AAV particle of any one of embodiments 397-444, an AAV particle comprising the capsid variant of any one of embodiments 1- 378, 395, 396, or 444, or an AAV particle comprising the peptide of any one of embodiments 390-394 or 444, in the manufacture of a medicament for treating a genetic disorder, a neurological disorder, a neurodegenerative disorder, a muscular disorder, a neuromuscular disorder, or a neuro-oncological disorder.
- a genetic disorder a neurological disorder, a neurodegenerative disorder, a muscular disorder, a neuromuscular disorder, or a neuro-oncological disorder.
- FIGs.1A-1D show immunohistochemistry images from various CNS and peripheral tissues isolated from NHPs (cynomolgus macaques) at 28 days post intravenous administration of AAV particles comprising the TTN-002 capsid variant (top panels) or AAV9 control capsid (bottom panels) and a self-complementary genome encoding a payload fused to an HA tag driven by a heterologous constitutive promoter.
- FIG 1A shows, from left to right, the cerebellum (Purkinje layer), spinal cord (cervical), cortex (temporal), and the brainstem.
- FIG.1B shows, from left to right, the globus pallidus, the hippocampus, the thalamus, the putamen, and the dentate.
- FIG.1C shows, from left to right, the whole brain (level H), the whole brain (level K), and the cerebellum.
- FIG.1D shows, from left to right, the spinal cord (thoracic), the DRG (thoracic), the liver, and the heart.
- DETAILED DESCRIPTION OF THE DISCLOSURE [057] Described herein, inter alia, are compositions comprising an AAV capsid variant, e.g., an AAV capsid variant described herein, and methods of making and using the same.
- the AAV capsid variant has enhanced tropism for a cell or tissue, e.g., for the delivery of a payload to said cell or tissue, for example, a CNS tissue, a CNS cell, a heart cell, a heart tissue, a muscle cell, a muscle tissue, a liver cell, or a liver tissue.
- certain AAV capsid variants described herein show multiple advantages over wild-type AAV5 and/or wild-type AAV9, including (i) increased penetrance through the blood brain barrier following intravenous administration, (ii) wider distribution throughout the multiple brain regions, e.g., frontal cortex, sensory cortex, motor cortex, putamen, thalamus, cerebellar cortex, dentate nucleus, caudate, and/or hippocampus, (iii) elevated payload expression in multiple brain regions, (iv) wider distribution in one or more peripheral tissues, e.g., the heart, muscle, and/or liver, and/or (v) elevated payload expression in one or more peripheral tissues.
- AAV capsid variants described herein show multiple advantages over wild-type AAV5 and/or wild-type AAV9, including (i) increased penetrance through the blood brain barrier following intravenous administration, (ii) wider distribution throughout the multiple brain regions, e.g., frontal cortex, sensory cortex, motor cortex, putamen,
- the AAV capsids described herein enhance the delivery of a payload to multiple regions of the brain including, for example, the frontal cortex, sensory cortex, motor cortex, putamen, thalamus, cerebellar cortex, dentate nucleus, caudate, and/or hippocampus. In some embodiments, the AAV capsids described herein enhance the delivery of a payload to the heart, the muscle, and/or the liver.
- AAV capsid variants disclosed herein comprise a modification in loop VIII of AAV5, e.g., at positions between 571-579, e.g., at position 577, numbered relative to SEQ ID NO: 138.
- the aforesaid region e.g., positions between 571-579, e.g., at position 577
- the AAV5 capsid protrudes above the 3-fold axis of symmetry, e.g., is a surface-exposed location in the AAV5 capsid, e.g., as described in Govindasamy et al.
- loop e.g., loop VIII
- variable region e.g., variable region VIII
- VR e.g., VR-VIII
- loop VIII comprises positions 571-592 (e.g., amino acids TNNQSSTTAPATGTYNLQEIVP (SEQ ID NO: 736)), numbered according to SEQ ID NO: 138.
- loop VIII (e.g., VR-VIII) comprises positions 571-599 (e.g., amino acids TNNQSSYPAEVVQKTAPATGTYNLQEIVP (SEQ ID NO: 756)), numbered according to SEQ ID NO: 982.
- loop VIII or variable region VIII (VR-VIII) is as described in Govindasamy et al. (supra) (the contents of which are hereby incorporated by reference in their entirety).
- Several approaches have been used to produce AAV capsids with enhanced tropism for a cell or tissue, e.g., a CNS cell or tissue.
- One approach used co-infection of cultured cells (Grimm et al.
- the capsid gene is placed under the control of a cell type-specific promoter to drive capsid mRNA expression in the absence of helper virus co-infection.
- this RNA-driven screen increases the selective pressure in favor of capsid variants which transduce a specific cell type.
- the TRACER platform allows for generation of AAV capsid libraries whereby specific recovery and subcloning of capsid mRNA expressed in transduced cells is achieved with no need for transgenic animals or helper virus co-infection.
- the methods disclosed herein allow identification of fully infectious AAV capsid mutants, and in addition to its higher stringency, this method allows identification of capsids with high tropism for particular cell types using libraries designed to express CAP mRNA under the control of any cell-specific promoter such as, but not limited to, synapsin-1 promoter (neurons), GFAP promoter (astrocytes), TBG promoter (liver), CAMK promoter (skeletal muscle), MYH6 promoter (cardiomyocytes).
- AAV capsid variants generated using the TRACER method which demonstrate enhance tropism in for example a CNS cell, a CNS tissue, a muscle cell, or a muscle tissue.
- the AAV particles and payloads of the disclosure may be delivered to one or more target cells, tissues, organs, or organisms.
- the AAV particles of the disclosure demonstrate enhanced tropism for a target cell type, tissue, or organ.
- the AAV particle may have enhanced tropism for cells and tissues of the central or peripheral nervous systems (CNS and PNS, respectively).
- an AAV particle of the disclosure may, in addition, or alternatively, have decreased tropism for a cell-type, tissue, or organ.
- an AAV particle is used as a biological tool due to a relatively simple structure, their ability to infect a wide range of cells (including quiescent and dividing cells) without integration into the host genome and without replicating, and their relatively benign immunogenic profile.
- the genome of the virus may be manipulated to contain a minimum of components for the assembly of a functional recombinant virus, or viral particle, which is loaded with or engineered to target a particular tissue and express or deliver a desired payload.
- the AAV particle is a naturally occurring (e.g., wild-type) AAV or a recombinant AAV.
- the wild-type AAV viral genome is a linear, single- stranded DNA (ssDNA) molecule approximately 5,000 nucleotides (nt) in length.
- inverted terminal repeats cap the viral genome at both the 5’ and the 3’ end, providing origins of replication for the viral genome.
- an AAV viral genome typically comprises two ITR sequences. These ITRs have a characteristic T-shaped hairpin structure defined by a self-complementary region (145nt in wild-type AAV) at the 5’ and 3’ ends of the ssDNA which form an energetically stable double stranded region.
- the double stranded hairpin structures comprise multiple functions including, but not limited to, acting as an origin for DNA replication by functioning as primers for the endogenous DNA polymerase complex of the host viral replication cell.
- the wild-type AAV viral genome further comprises nucleotide sequences for two open reading frames, one for the four non-structural Rep proteins (Rep78, Rep68, Rep52, Rep40, encoded by Rep genes) and one for the three capsid, or structural, proteins (VP1, VP2, VP3, encoded by capsid genes or Cap genes).
- the Rep proteins are used for replication and packaging, while the capsid proteins are assembled to create the protein shell of the AAV, or AAV capsid polypeptide, e.g., an AAV capsid variant.
- Alternative splicing and alternate initiation codons and promoters result in the generation of four different Rep proteins from a single open reading frame and the generation of three capsid proteins from a single open reading frame.
- AAV serotype as a non-limiting example, for AAV5 (SEQ ID NO: 138 and 137)
- VP1 refers to amino acids 1-724
- VP2 refers to amino acids 137-724
- VP3 refers to amino acids 193-724.
- VP1 comprises amino acids 1-731
- VP2 comprises amino acids 137-731
- VP3 comprises amino acids 193-731.
- VP1 is the full-length capsid sequence
- VP2 and VP3 are shorter components of the whole.
- changes in the sequence in the VP3 region are also changes to VP1 and VP2, however, the percent difference as compared to the parent sequence will be greatest for VP3 since it is the shortest sequence of the three.
- the nucleic acid sequence encoding these proteins can be similarly described. Together, the three capsid proteins assemble to create the AAV capsid protein.
- AAV capsid protein typically comprises a molar ratio of 1:1:10 of VP1:VP2:VP3.
- AAV particles of the present disclosure may be produced recombinantly and may be based on adeno-associated virus (AAV) reference sequences.
- AAV adeno-associated virus
- the present disclosure also provides for self-complementary AAV (scAAVs) viral genomes.
- scAAV viral genomes contain DNA strands which anneal together to form double stranded DNA. By skipping second strand synthesis, scAAVs allow for rapid expression in the transduced cell.
- the AAV particle of the present disclosure is an scAAV. In some embodiments, the AAV particle of the present disclosure is an ssAAV.
- Methods for producing and/or modifying AAV particles are disclosed in the art such as pseudotyped AAV particles (PCT Patent Publication Nos. WO200028004; WO200123001; WO2004112727; WO2005005610; and WO2005072364, the content of each of which is incorporated herein by reference in its entirety).
- the AAV particles of the disclosure comprising an AAV capsid variant, and a viral genome, have enhanced tropism for a cell-type or a tissue, e.g., a CNS cell-type, region, or tissue.
- Peptides Disclosed herein are peptides, and associated AAV particles comprising an AAV capsid variant and a peptide for enhanced or improved transduction of a target tissue (e.g., cells of the CNS or PNS).
- the peptide is an isolated, e.g., recombinant, peptide.
- the nucleic acid encoding the peptide is an isolated, e.g., recombinant, nucleic acid.
- the peptide may increase distribution of an AAV particle to a cell, region, or tissue of the CNS.
- the cell of the CNS may be, but is not limited to, neurons (e.g., excitatory, inhibitory, motor, sensory, autonomic, sympathetic, parasympathetic, Purkinje, Betz, etc.), glial cells (e.g., microglia, astrocytes, oligodendrocytes) and/or supporting cells of the brain such as immune cells (e.g., T cells).
- the tissue of the CNS may be, but is not limited to, the cortex (e.g., frontal, parietal, occipital, temporal), thalamus, hypothalamus, striatum, putamen, caudate nucleus, hippocampus, entorhinal cortex, basal ganglia, or deep cerebellar nuclei.
- the tissue of the CNS is a temporal cortex, perirhinal cortex, globus pallidus, putamen, caudate, thalamus, hippocampus, geniculate nucleus, Purkinje Layer, deep cerebellar nuclei, cerebellum, cervical spinal cord, thoracic spinal cord, or lumbar spinal cord.
- the peptide may increase distribution of an AAV particle to a cell, region, or tissue of the PNS.
- the cell or tissue of the PNS may be, but is not limited to, a dorsal root ganglion (DRG).
- the peptide may increase distribution of an AAV particle to the CNS (e.g., the cortex) after intravenous administration.
- the peptide may increase distribution of an AAV particle to the CNS (e.g., the cortex) following focused ultrasound (FUS), e.g., coupled with the intravenous administration of microbubbles (FUS-MB), or MRI-guided FUS coupled with intravenous administration.
- FUS focused ultrasound
- FUS-MB microbubbles
- MRI-guided FUS coupled with intravenous administration.
- the peptide may increase distribution of an AAV particle to the PNS (e.g., DRG) after intravenous administration.
- the peptide may increase distribution of an AAV particle to the PNS (e.g., DRG) following focused ultrasound (FUS), e.g., coupled with the intravenous administration of microbubbles (FUS-MB), or MRI-guided FUS coupled with intravenous administration.
- FUS focused ultrasound
- the peptide may increase distribution of an AAV particle to a cell, region, or tissue of a heart, e.g., a heart atrium or a heart ventricle.
- the peptide may increase distribution of an AAV particle to a heart cell, region, or tissue after intravenous administration.
- the peptide may increase distribution of an AAV particle to a cell, region, or tissue of a muscle.
- the muscle is a heart muscle (e.g., a heart atrium or a heart ventricle) or a quadriceps.
- the peptide may increase distribution of an AAV particle to a muscle cell, region, or tissue after intravenous administration.
- the peptide may increase distribution of an AAV particle to a cell, region, or tissue of a liver.
- the peptide may increase distribution of an AAV particle to a liver cell, region, or tissue after intravenous administration.
- a peptide may vary in length. In some embodiments, the peptide is about 3 to about 20 amino acids in length. As non-limiting examples, the peptide may be 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 3-5, 3-8, 3-10, 3-12, 3-15, 3-18, 3-20, 5-10, 5-15, 5-20, 10-12, 10-15, 10- 20, 12-20, or 15-20 amino acids in length. In some embodiments, a peptide comprises about 6 to 12 amino acids in length, e.g., about 9 amino acids in length.
- a peptide comprises about 7 to 11 amino acids in length, e.g., about 8 amino acids in length. In some embodiments, a peptide comprises about 5 to 10 amino acids in length, e.g., about 7 amino acids in length. In some embodiments, a peptide comprises about 4 to 9 amino acids in length, e.g., about 6 amino acids in length.
- a peptide may comprise a sequence as set forth in Table 1 (e.g., comprising the amino acid sequence of any of SEQ ID NOs: 1021, 1024, 1027, 1112, 1142, 1214, 1232, 1254, 1300, 1310, 1327, 1331, 1342, 1419, 1453, 1533, 1538, 1539, 1575, 1578, 1583-1587, 1590-1593, 1598-1624, or 2064-2079).
- a peptide may comprise a sequence as set forth in Table 2A or 2B.
- the peptide may comprise a sequence set forth in Tables 9 or 15-20.
- the peptide is isolated, e.g., recombinant.
- Table 1 Exemplary Peptide Sequences Table 2A.
- Exemplary Peptide Sequences Table 2B Exemplary Peptide Sequences [080]
- a peptide described herein comprises an amino acid sequence having the formula [N2]-[N3], wherein [N2] comprises positions X1, X2, X3, X4, and X5 and [N3] comprises the amino acid sequence of VQK, VQN, EQK, VKK, VHK, VQQ, or LQK.
- position X1 of [N2] is Y, N, C, or T.
- position X2 of [N2] is P, E, K, T, or Q.
- position X3 of [N2] is A or P.
- position X4 of [N2] is E, S, D, or A.
- position X5 of [N2] is V, L, or E.
- [N2] comprises Y at position X1.
- [N2] comprises P at position X2.
- [N2] comprises A at position X3.
- [N2] comprises E at position X4.
- [N2] comprises V at position X5.
- the amino acid sequence of [N3] comprises VQK.
- the amino acid sequence of [N3] consists of VQK.
- a peptide described herein comprises an amino acid sequence having the formula [N2]-[N3], wherein [N2] comprises positions X1, X2, X3, X4, and X5 and [N3] comprises the amino acid sequence of VQK, EQK, VKK, VHK, VQQ, or LQK.
- [N3] comprises the amino acid sequence of VQK, EQK, or VKK.
- [N3] comprises the amino acid sequence VQK.
- [N3] consists of the amino acid sequence VQK.
- position X1 of [N2] is Y, N, or C. In some embodiments position X1 of [N2] is Y or N. In some embodiments, position X2 of [N2] is P, K, T, or Q. In some embodiments position X2 of [N2] is P, T, or Q. In some embodiments, position X3 of [N2] is A or P. In some embodiments, position X3 of [N2] is A. In some embodiments, position X4 of [N2] is E, S, or A. In some embodiments, position X5 of [N2] is V, L, or E. In some embodiments, position X5 of [N2] is V or L.
- [N2] comprises Y at position X1. In some embodiments, [N2] comprises P at position X2. In some embodiments, [N2] comprises A at position X3. In some embodiments, [N2] comprises E at position X4. In some embodiments, [N2] comprises V at position X5. In some embodiments, [N2] comprises YPA, YPP, NKA, YTA, YQA, YTP, NPA, CPA, THA, PAE, PPS, KAE, TAE, QAE, TPS, PAA, HAS, AEV, PSL, AEE, or AAV.
- [N2] comprises YPAE (SEQ ID NO: 21), YPPS (SEQ ID NO: 22), NKAE (SEQ ID NO: 23), YTAE (SEQ ID NO: 24), YQAE (SEQ ID NO: 25), YTPS (SEQ ID NO: 26), YPAA (SEQ ID NO: 27), NPAE (SEQ ID NO: 28), CPAE (SEQ ID NO: 29), THAS (SEQ ID NO: 30), PAEV (SEQ ID NO: 17), PPSL (SEQ ID NO: 31), KAEV (SEQ ID NO: 32), TAEV (SEQ ID NO: 16), PAEE (SEQ ID NO: 18), QAEV (SEQ ID NO: 15), TPSL (SEQ ID NO: 33), PAAV (SEQ ID NO: 34), or QAEE (SEQ ID NO: 35).
- [N2] is or comprises YPAEV (SEQ ID NO: 1), YPPSL (SEQ ID NO: 2), NKAEV (SEQ ID NO: 3), YTAEV (SEQ ID NO: 4), YPAEE (SEQ ID NO: 5), YQAEV (SEQ ID NO: 6), YTPSL (SEQ ID NO: 7), YPAAV (SEQ ID NO: 8), NPAEV (SEQ ID NO: 9), CPAEV (SEQ ID NO: 10), or YQAEE (SEQ ID NO: 11).
- [N2] comprises the amino acid sequence of YPAEV (SEQ ID NO: 1).
- the amino acid sequence of [N2] consists of YPAEV (SEQ ID NO: 1).
- [N2]-[N3] comprises the amino acid sequence of AEVVQK (SEQ ID NO: 36), PSLVQK (SEQ ID NO: 37), AEVEQK (SEQ ID NO: 38), AEEVQK (SEQ ID NO: 39), PSLEQK (SEQ ID NO: 40), PSLVKK (SEQ ID NO: 41), AEVVKK (SEQ ID NO: 42), AEVVHK (SEQ ID NO: 43), AAVVQK (SEQ ID NO: 44), AEVVQQ (SEQ ID NO: 45), or AEVLQK (SEQ ID NO: 46).
- [N2]-[N3] comprises the amino acid sequence PAEVVQK (SEQ ID NO: 20), PPSLVQK (SEQ ID NO: 47), KAEVVQK (SEQ ID NO: 48), TAEVVQK (SEQ ID NO: 49), PAEVEQK (SEQ ID NO: 50), PAEEVQK (SEQ ID NO: 51), QAEVVQK (SEQ ID NO: 52), TPSLVQK (SEQ ID NO: 53), PPSLEQK (SEQ ID NO: 54), PPSLVKK (SEQ ID NO: 55), PAEVVKK (SEQ ID NO: 56), PAEVVHK (SEQ ID NO: 57), PAAVVQK (SEQ ID NO: 58), PAEVVQQ (SEQ ID NO: 59), TAEVVKK (SEQ ID NO: 60), PAEVLQK (SEQ ID NO: 61), or QAEEVQK (SEQ ID NO: 62).
- [N2]-[N3] is or comprises YPAEVVQK (SEQ ID NO: 943), YPPSLVQK (SEQ ID NO: 946), NKAEVVQK (SEQ ID NO: 947), YTAEVVQK (SEQ ID NO: 948), YPAEVEQK (SEQ ID NO: 949), YPAEEVQK (SEQ ID NO: 950), YQAEVVQK (SEQ ID NO: 951), YTPSLVQK (SEQ ID NO: 952), YPPSLEQK (SEQ ID NO: 953), YPPSLVKK (SEQ ID NO: 954), YPAEVVKK (SEQ ID NO: 955), YPAEVVHK (SEQ ID NO: 956), YPAAVVQK (SEQ ID NO: 957), NPAEVVQK (SEQ ID NO: 958), YPAEVVQQ (SEQ ID NO: 959), CPAEVVQK (S
- [N2]-[N3] is YPAEVVQK (SEQ ID NO: 943). In some embodiments, [N2]-[N3] comprises the amino acid sequence YPAEVVQK (SEQ ID NO: 943). [082] In some embodiments, the peptide comprising the amino acid sequence comprising the formula of [N2]-[N3], further comprises [N1], which comprises positions X D , X E , and X F . In some embodiments, position X D of [N1] is Q, T, S, A, I, L, or H. In some embodiments, position X E of [N1] is S, G, A, or R.
- position X F of [N1] is S, K, L, R, A, or T.
- [N1] comprises SK, SL, SS, SR, GA, GS, AS, ST, RS, QS, TS, AG, IG, QA, LG, HS, LS, or QR.
- [N1] is or comprises QSS, QSK, TSL, SSS, QSR, AGA, IGS, QAS, ASS, LGS, QST, HSS, LSS, or QRS.
- the amino acid sequence of [N1] is QSS.
- [N1]-[N2] comprises SSYPA (SEQ ID NO: 63), SKYPA (SEQ ID NO: 64), SLYPA (SEQ ID NO: 65), SRYPA (SEQ ID NO: 66), SSYPP (SEQ ID NO: 67), GAYPA (SEQ ID NO: 68), GSYPA (SEQ ID NO: 69), ASYPA (SEQ ID NO: 70), STNKA (SEQ ID NO: 71), SSYTA (SEQ ID NO: 72), SSYQA (SEQ ID NO: 73), SSYTP (SEQ ID NO: 74), SSNPA (SEQ ID NO: 75), SLCPA (SEQ ID NO: 76), RSYTA (SEQ ID NO: 77), or SSTHA (SEQ ID NO: 78).
- [N1]-[N2] comprises SSYPAE (SEQ ID NO: 79), SKYPAE (SEQ ID NO: 80), SLYPAE (SEQ ID NO: 81), SRYPAE (SEQ ID NO: 82), SSYPPS (SEQ ID NO: 83), GAYPAE (SEQ ID NO: 84), GSYPAE (SEQ ID NO: 85), ASYPAE (SEQ ID NO: 86), STNKAE (SEQ ID NO: 87), SSYTAE (SEQ ID NO: 88), SSYQAE (SEQ ID NO: 89), SSYTPS (SEQ ID NO: 90), SSYPAA (SEQ ID NO: 91), SSNPAE (SEQ ID NO: 92), SLCPAE (SEQ ID NO: 93), RSYTAE (SEQ ID NO: 94), SSTHAS (SEQ ID NO: 95).
- [N1]-[N2] is or comprises QSSYPAEV (SEQ ID NO: 96), QSKYPAEV (SEQ ID NO: 97), TSLYPAEV (SEQ ID NO: 98), SSSYPAEV (SEQ ID NO: 99), QSRYPAEV (SEQ ID NO: 100), QSSYPPSL (SEQ ID NO: 101), AGAYPAEV (SEQ ID NO: 102), IGSYPAEV (SEQ ID NO: 103), QASYPAEV (SEQ ID NO: 104), ASSYPAEV (SEQ ID NO: 105), LGSYPAEV (SEQ ID NO: 106), QSTNKAEV (SEQ ID NO: 107), HSSYPAEV (SEQ ID NO: 108), SSSYTAEV (SEQ ID NO: 109), TSLYPAEE (SEQ ID NO: 110), ASSYQAEV (SEQ ID NO: 111), QSSYTPSL (SEQ ID NO: 112), QSRYPAEE
- the amino acid sequence of [N1]-[N2] is QSSYPAEV (SEQ ID NO: 96).
- [N1]-[N2]-[N3] comprises SSYPAEVVQ (SEQ ID NO: 121), SKYPAEVVQ (SEQ ID NO: 122), SLYPAEVVQ (SEQ ID NO: 123), SRYPAEVVQ (SEQ ID NO: 124), SSYPPSLVQ (SEQ ID NO: 125), GAYPAEVVQ (SEQ ID NO: 126), GSYPAEVVQ (SEQ ID NO: 127), ASYPAEVVQ (SEQ ID NO: 128), STNKAEVVQ (SEQ ID NO: 129), SSYTAEVVQ (SEQ ID NO: 130), SKYPAEVEQ (SEQ ID NO: 131), SLYPAEEVQ (SEQ ID NO: 132), SSYQAEVVQ (SEQ ID NO: 133),
- [N1]-[N2]-[N3] is or comprises QSSYPAEVVQK (SEQ ID NO: 150), QSKYPAEVVQK (SEQ ID NO: 151), TSLYPAEVVQK (SEQ ID NO: 152), SSSYPAEVVQK (SEQ ID NO: 153), QSRYPAEVVQK (SEQ ID NO: 154), QSSYPPSLVQK (SEQ ID NO: 155), AGAYPAEVVQK (SEQ ID NO: 156), IGSYPAEVVQK (SEQ ID NO: 157), QASYPAEVVQK (SEQ ID NO: 158), ASSYPAEVVQK (SEQ ID NO: 159), LGSYPAEVVQK (SEQ ID NO: 160), QSTNKAEVVQK (SEQ ID NO: 161), HSSYPAEVVQK (SEQ ID NO: 162), SSSYTAEVVQK (SEQ ID NO: 16
- the amino acid sequence of [N1]-[N2]-[N3] is QSSYPAEVVQK (SEQ ID NO: 150).
- the peptide comprising the amino acid sequence comprising the formula [N2]-[N3] further comprises [N0], wherein [N0] comprises positions X A , X B , and X C .
- position X A of [N0] is T, I, or N.
- positions X B of [N0] is N.
- position XC of [N0] is N, T, S, or K.
- [N0] comprises TN, IN, NN, NT, NS, or NK. In some embodiments, [N0] is or comprises TNN, TNT, INN, TNS, NNN, or TNK. In some embodiments, the amino acid sequence of [N0] is TNN.
- [N0]-[N1] is or comprises TNNQSS (SEQ ID NO: 183), TNNQSK (SEQ ID NO: 184), TNNTSL (SEQ ID NO: 185), TNNSSS (SEQ ID NO: 186), TNNQSR (SEQ ID NO: 187), TNNAGA (SEQ ID NO: 188), TNNIGS (SEQ ID NO: 189), TNNQAS (SEQ ID NO: 190), TNTASS (SEQ ID NO: 191), TNNLGS (SEQ ID NO: 192), TNNQST (SEQ ID NO: 193), TNNHSS (SEQ ID NO: 194), TNNQSK (SEQ ID NO: 184), TNNLSS (SEQ ID NO: 195), INNQSS (SEQ ID NO: 196), TNSQSS (SEQ ID NO: 197), NNNQSR (SEQ ID NO: 198), TNSTSL (SEQ ID NO: 199), TNNQRS
- [N0]-[N1] is TNNQSS (SEQ ID NO: 183).
- [N0]-[N1]-[N2]- [N3] is or comprises TNNQSSYPAEVVQK (SEQ ID NO: 500), TNNQSKYPAEVVQK (SEQ ID NO: 503), TNNTSLYPAEVVQK (SEQ ID NO: 506), TNNSSSYPAEVVQK (SEQ ID NO: 508), TNNQSRYPAEVVQK (SEQ ID NO: 510), TNNQSSYPPSLVQK (SEQ ID NO: 512), TNNAGAYPAEVVQK (SEQ ID NO: 513), TNNIGSYPAEVVQK (SEQ ID NO: 514), TNNQASYPAEVVQK (SEQ ID NO: 517), TNTASSYPAEVVQK (SEQ ID NO: 520), TNNLGSYPAEVVQK (SEQ ID NO: 500), TNN
- [N0]-[N1]-[N2]-[N3] is TNNQSSYPAEVVQK (SEQ ID NO: 500).
- the peptide comprising the amino acid sequence comprising the formula [N2]-[N3], further comprises [N4], which comprises positions X G and X H .
- position XG of [N4] is T, P, or N.
- position XG of [N4] is T.
- position X H of [N4] is A.
- [N4] is or comprises TA, PA, or NA.
- [N4] is TA.
- [N3]-[N4] is or comprises VQKTA (SEQ ID NO: 564), EQKTA (SEQ ID NO: 565), VKKTA (SEQ ID NO: 566), VQKPA (SEQ ID NO: 567), VHKTA (SEQ ID NO: 568), VQQTA (SEQ ID NO: 569), VQKNA (SEQ ID NO: 570), or LQKTA (SEQ ID NO: 571); an amino acid sequence comprising any portion of any of the aforesaid amino acid sequences (e.g., any 2, 3, or 4 amino acids, e.g., consecutive amino acids) thereof; an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the aforesaid amino acid sequences; or an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to any one
- [N3]-[N4] is VQKTA (SEQ ID NO: 564).
- [N0]-[N1]-[N2]- [N3]-[N4] is or comprises TNNQSSYPAEVVQKTA (SEQ ID NO: 1533), TNNQSKYPAEVVQKTA (SEQ ID NO: 1538), TNNTSLYPAEVVQKTA (SEQ ID NO: 1232), TNNSSSYPAEVVQKTA (SEQ ID NO: 1539), TNNQSRYPAEVVQKTA (SEQ ID NO: 1327), TNNQSSYPPSLVQKTA (SEQ ID NO: 1300), TNNAGAYPAEVVQKTA (SEQ ID NO: 1021), TNNIGSYPAEVVQKTA (SEQ ID NO: 1112), TNNQASYPAEVVQKTA (SEQ ID NO: 1194), TNTASSYPAEVVQKTA (SEQ ID NO:
- [N0]-[N1]-[N2]-[N3]-[N4] is TNNQSSYPAEVVQKTA (SEQ ID NO: 1533).
- a peptide described herein comprises the formula [N2]-[N3], wherein [N2] comprises positions X1, X2, X3, X4, and X5 and [N3] comprises the amino acid sequence of VQK or VQN.
- [N3] comprises the amino acid sequence VQK.
- position X1 of [N2] is Y or T.
- position X2 of [N2] is Q, T, P, or E.
- position X3 of [N2] is A.
- position X4 of [N2] is E or D.
- position X4 of [N2] is E or D.
- position X5 of [N2] is V or E.
- [N2] comprises Y at position X1.
- [N2] comprises P at position X2.
- [N2] comprises A at position X3.
- [N2] comprises E at position X4.
- [N2] comprises V at position X5.
- [N2] comprises YP, YQ, YT, TE, QA, TA, PA, EA, EV, EE, DV, AE, or AD. In some embodiments, [N2] comprises YPA, YQA, YTA, TEA, QAE, TAE, PAE, EAE, PAD, AEV, AEE, or ADV.
- [N2] comprises YPAE (SEQ ID NO: 21), YQAE (SEQ ID NO: 25), YTAE (SEQ ID NO: 24), TEAE (SEQ ID NO: 587), YPAD (SEQ ID NO: 588), QAEV (SEQ ID NO: 15), TAEV (SEQ ID NO: 16), PAEV (SEQ ID NO: 17), PAEE (SEQ ID NO: 18), EAEV (SEQ ID NO: 590), or PADV (SEQ ID NO: 19).
- [N2] is or comprises YPAEV (SEQ ID NO: 1), YQAEV (SEQ ID NO: 6), YTAEV (SEQ ID NO: 4), YPAEE (SEQ ID NO: 5), TEAEV (SEQ ID NO: 12), or YPADV (SEQ ID NO: 13).
- [N2] is YPAEV (SEQ ID NO: 1).
- [N2]-[N3] comprises AEVVQK (SEQ ID NO: 36), AEEVQK (SEQ ID NO: 39), AEVVQN (SEQ ID NO: 591), or ADVVQK (SEQ ID NO: 593).
- [N2]-[N3] comprises PAEVVQN (SEQ ID NO: 594), QAEVVQK (SEQ ID NO: 52), TAEVVQK (SEQ ID NO: 49), PAEVVQK (SEQ ID NO: 20), PAEEVQK (SEQ ID NO: 51), EAEVVQK (SEQ ID NO: 595), or PADVVQK (SEQ ID NO: 596).
- [N2]-[N3] is or comprises YPAEVVQK (SEQ ID NO: 943), YQAEVVQK (SEQ ID NO: 951), YTAEVVQK (SEQ ID NO: 948), YPAEEVQK (SEQ ID NO: 950), YPAEVVQN (SEQ ID NO: 964), TEAEVVQK (SEQ ID NO: 965), or YPADVVQK (SEQ ID NO: 966); an amino acid sequence comprising any portion of any of the aforesaid amino acid sequences (e.g., any 2, 3, 4, 5, 6, or 7 amino acids, e.g., consecutive amino acids) thereof; an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the aforesaid amino acid sequences; or an amino acid sequence comprising one, two,
- [N2]-[N3] is YPAEVVQK (SEQ ID NO: 943).
- the peptide comprising the amino acid sequence comprising the formula of [N2]-[N3], further comprises [N1], which comprises positions X D , X E , and X F .
- position XD of [N1] is Q or S.
- position XE of [N1] is S, L, A, or T.
- position X F of [N1] is S, Y, or T.
- [N1] comprises QS, SL, SA, QT, LS, LY, AT, TS, or SS.
- [N1] is or comprises QSS, SLS, SLY, SAT, or QTS. In some embodiments, [N1] is QSS. In some embodiments, [N1]-[N2] comprises SSYPA (SEQ ID NO: 63), LSYQA (SEQ ID NO: 597), LSYTA (SEQ ID NO: 598), LYYPA (SEQ ID NO: 600), ATYPA (SEQ ID NO: 601), LSYPA (SEQ ID NO: 603), or TSTEA (SEQ ID NO: 605).
- SSYPA SEQ ID NO: 63
- LSYQA SEQ ID NO: 597
- LSYTA SEQ ID NO: 598
- LYYPA SEQ ID NO: 600
- ATYPA SEQ ID NO: 601
- LSYPA SEQ ID NO: 603
- TSTEA SEQ ID NO: 605
- [N1]-[N2] comprises SSYPAE (SEQ ID NO: 79), LSYQAE (SEQ ID NO: 607), LSYTAE (SEQ ID NO: 610), LYYPAE (SEQ ID NO: 611), ATYPAE (SEQ ID NO: 613), LSYPAE (SEQ ID NO: 616), TSTEAE (SEQ ID NO: 619), or LSYPAD (SEQ ID NO: 621).
- [N1]-[N2] is or comprises QSSYPAEV (SEQ ID NO: 96), SLSYQAEV (SEQ ID NO: 622), SLSYTAEV (SEQ ID NO: 623), SLYYPAEV (SEQ ID NO: 624), SATYPAEV (SEQ ID NO: 625), SLSYPAEV (SEQ ID NO: 629), SLSYPAEE (SEQ ID NO: 632), QTSTEAEV (SEQ ID NO: 633), or SLSYPADV (SEQ ID NO: 634); an amino acid sequence comprising any portion of any of the aforesaid amino acid sequences (e.g., any 2, 3, 4, 5, 6, or 7 amino acids, e.g., consecutive amino acids) thereof; an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the aforesaid amino acid sequences;
- substitutions
- [N1]-[N2] is QSSYPAEV (SEQ ID NO: 96).
- [N1]-[N2]-[N3] is or comprises QSSYPAEVVQK (SEQ ID NO: 150), SLSYQAEVVQK (SEQ ID NO: 635), SLSYTAEVVQK (SEQ ID NO: 637), SLYYPAEVVQK (SEQ ID NO: 639), SATYPAEVVQK (SEQ ID NO: 641), SLSYPAEVVQK (SEQ ID NO: 642), SLSYPAEEVQK (SEQ ID NO: 643), SLSYPAEVVQN (SEQ ID NO: 644), QTSTEAEVVQK (SEQ ID NO: 645), or SLSYPADVVQK (SEQ ID NO: 646); an amino acid sequence comprising any portion of any of the aforesaid amino acid sequences (e.g., any 2, 3, 4, 5, 6, 7,
- [N1]-[N2]-[N3] is QSSYPAEVVQK (SEQ ID NO: 150).
- the peptide comprising the amino acid sequence comprising the formula [N2]-[N3], further comprises [N0], wherein [N0] comprises positions X A , X B , and X C .
- position X A of [N0] is T.
- positions X B of [N0] is N.
- position X C of [N0] is N, T, S, or K.
- [N0] comprises TN, NS, NT, NN, or NK.
- [N0] is or comprises TNS, TNT, TNN, or TNK. In some embodiment, [N0] is TNN. In some embodiments, [N0]-[N1] is or comprises TNNQSS (SEQ ID NO: 183), TNSSLS (SEQ ID NO: 647), TNSSLY (SEQ ID NO: 648), TNTSAT (SEQ ID NO: 649), TNNQTS (SEQ ID NO: 650), or TNKSAT (SEQ ID NO: 651); an amino acid sequence comprising any portion of any of the aforesaid amino acid sequences (e.g., any 2, 3, 4, or 5 amino acids, e.g., consecutive amino acids) thereof; an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the aforesaid amino acid sequences; or an amino acid sequence comprising one, two, or three but
- [N0]-[N1] is TNNQSS (SEQ ID NO: 183).
- [N0]-[N1]-[N2]-[N3] is or comprises TNNQSSYPAEVVQK (SEQ ID NO: 500), TNSSLSYQAEVVQK (SEQ ID NO: 652), TNSSLSYTAEVVQK (SEQ ID NO: 654), TNSSLYYPAEVVQK (SEQ ID NO: 655), TNTSATYPAEVVQK (SEQ ID NO: 656), TNSSLSYPAEVVQK (SEQ ID NO: 657), TNSSLSYPAEEVQK (SEQ ID NO: 658), TNSSLSYPAEVVQN (SEQ ID NO: 660), TNNQTSTEAEVVQK (SEQ ID NO: 662), TNKSATYPAEVVQK (SEQ ID NO: 663), or TNSSLSYPADVVQK (SEQ ID NO: 500),
- [N0]- [N1]-[N2]-[N3] is TNNQSSYPAEVVQK (SEQ ID NO: 500).
- the peptide comprising the amino acid sequence comprising the formula [N2]-[N3], further comprises [N4], which comprises positions X G and X H .
- position X G of [N4] is T, P, or N.
- position X H of [N4] is A or D.
- [N4] is or comprises TA, TD, PA, or NA.
- [N4] is TA.
- [N3]-[N4] is or comprises VQKTA (SEQ ID NO: 564), EQKTA (SEQ ID NO: 565), VKKTA (SEQ ID NO: 566), VQKPA (SEQ ID NO: 567), VHKTA (SEQ ID NO: 568), VQQTA (SEQ ID NO: 569), VQKNA (SEQ ID NO: 570), or LQKTA (SEQ ID NO: 571); an amino acid sequence comprising any portion of any of the aforesaid amino acid sequences (e.g., any 2, 3, or 4 amino acids, e.g., consecutive amino acids) thereof; an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the aforesaid amino acid sequences; or an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to any one
- [N3]-[N4] is VQKTA (SEQ ID NO: 564).
- [N0]-[N1]-[N2]-[N3]-[N4] is or comprises TNNQSSYPAEVVQKTA (SEQ ID NO: 1533), TNSSLSYQAEVVQKTA (SEQ ID NO: 2064), TNSSLSYTAEVVQKTA (SEQ ID NO: 2065), TNSSLYYPAEVVQKTA (SEQ ID NO: 2066), TNTSATYPAEVVQKTA (SEQ ID NO: 2067), TNSSLSYPAEVVQKTA (SEQ ID NO: 2068), TNSSLSYPAEEVQKTA (SEQ ID NO: 2069), TNSSLSYPAEVVQKTD (SEQ ID NO: 2070), TNSSLSYPAEVVQNTA (SEQ ID NO: 2071), TNSSLSYPAEVVQKNA (SEQ ID NO:
- [N0]-[N1]-[N2]-[N3]-[N4] is TNNQSSYPAEVVQKTA (SEQ ID NO: 1533). [089] In some embodiments, [N1] is present immediately subsequent to [N0]. In some embodiments, [N2] is present immediately subsequent to [N1]. In some embodiments, [N3] is present immediately subsequent to [N2]. In some embodiments, [N4] is present immediately subsequent to [N3]. In some embodiments, the peptide comprises from N-terminus to C-terminus, [N2]-[N3]. In some embodiments, the peptide comprises from N-terminus to C-terminus, [N1]-[N2]-[N3].
- the peptide comprises from N-terminus to C-terminus, [N1]-[N2]-[N3]-[N4]. In some embodiments, the peptide comprises from N-terminus to C-terminus, [N0]-[N1]-[N2]-[N3]. In some embodiments, the peptide comprises from N-terminus to C-terminus, [N0]-[N1]-[N2]-[N3]-[N4].
- a peptide described herein comprises an amino acid sequence having the formula [B]-[C], wherein [B] comprises positions X1, X2, and X3, and [C] comprises the amino acid sequence YPAEVVQK (SEQ ID NO: 943).
- position X1 of [B] X1 is Q, T, S, A, I, L, or H.
- position X1 of [B] X1 is Q, T, S, A, or H.
- position X2 of [B] is S, G, or A.
- position X2 of [B] is S or G.
- position X3 of [B] is S, K, L, R, or A. In some embodiments, position X3 of [B] is S, K, L, or R. In some embodiments, [B] comprises Q at position X1. In some embodiments, [B] comprises S at position X2. In some embodiments, [B] comprises S at position X3. In some embodiments, [B] comprises QS, TS, SS, AG, IG, QA, AS, LG, HS, SK, SL, SR, GA, or GS. In some embodiments, [B] is or comprises QSS, TSL, SSS, QSR, QSK, AGA, IGS, QAS, ASS, LGS, or HSS.
- the amino acid sequence of [B] is QSS.
- [B]-[C] comprises SSYPAEVVQK (SEQ ID NO: 572), SKYPAEVVQK (SEQ ID NO: 573), SLYPAEVVQK (SEQ ID NO: 574), SRYPAEVVQK (SEQ ID NO: 575), GAYPAEVVQK (SEQ ID NO: 576), GSYPAEVVQK (SEQ ID NO: 580), or ASYPAEVVQK (SEQ ID NO: 582).
- [B]-[C] is or comprises QSSYPAEVVQK (SEQ ID NO: 150), QSKYPAEVVQK (SEQ ID NO: 151), TSLYPAEVVQK (SEQ ID NO: 152), SSSYPAEVVQK (SEQ ID NO: 153), QSRYPAEVVQK (SEQ ID NO: 154), AGAYPAEVVQK (SEQ ID NO: 156), IGSYPAEVVQK (SEQ ID NO: 157), QASYPAEVVQK (SEQ ID NO: 158), ASSYPAEVVQK (SEQ ID NO: 159), LGSYPAEVVQK (SEQ ID NO: 160), or HSSYPAEVVQK (SEQ ID NO: 162); an amino acid sequence comprising any portion of any of the aforesaid amino acid sequences (e.g., any 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids, e.g., consecutive amino acids) thereof; an amino acid sequence compris
- [B]-[C] is QSSYPAEVVQK (SEQ ID NO: 150).
- a peptide comprising the formula [B]-[C] further comprises [A], which comprises positions X A , X B , and X C .
- position X A of [A] is T, I, or N.
- position X B of [A] is N.
- position X C of [A] is N, T, S, or K.
- [A] comprises TN, IN, NN, NT, NS, or NK.
- [A] is or comprises TNN, TNT, INN, NNN, TNS, or TNK. In some embodiments, [A] is TNN. In some embodiments, [A]-[B] is or comprises TNNQSS (SEQ ID NO: 183), TNNQSK (SEQ ID NO: 184), TNNTSL (SEQ ID NO: 185), TNNSSS (SEQ ID NO: 186), TNNQSR (SEQ ID NO: 187), TNNAGA (SEQ ID NO: 188), TNNIGS (SEQ ID NO: 189), TNNQAS (SEQ ID NO: 190), TNTASS (SEQ ID NO: 191), TNNLGS (SEQ ID NO: 192), TNNHSS (SEQ ID NO: 194), INNQSS (SEQ ID NO: 196), NNNQSR (SEQ ID NO: 198), TNSTSL (SEQ ID NO: 199), or TNKQAS (SEQ ID NO: 201); an amino acids, SEQ
- the amino acid sequence of [A]-[B] is TNNQSS (SEQ ID NO: 183).
- [A]-[B]-[C] is or comprises TNNQSSYPAEVVQK (SEQ ID NO: 500), TNNQSKYPAEVVQK (SEQ ID NO: 503), TNNTSLYPAEVVQK (SEQ ID NO: 506), TNNSSSYPAEVVQK (SEQ ID NO: 508), TNNQSRYPAEVVQK (SEQ ID NO: 510), TNNAGAYPAEVVQK (SEQ ID NO: 513), TNNIGSYPAEVVQK (SEQ ID NO: 514), TNNQASYPAEVVQK (SEQ ID NO: 517), TNTASSYPAEVVQK (SEQ ID NO: 520), TNNLGSYPAEVVQK (SEQ ID NO: 523), TNNHSSYPAEVVQK (SEQ ID NO: 525
- [A]-[B] is TNNQSS (SEQ ID NO: 183). In some embodiments, [A]-[B]-[C] is TNNQSSYPAEVVQK (SEQ ID NO: 500).
- a peptide comprising the formula [B]-[C], further comprises [D], wherein [D] comprises position X4 and X5. In some embodiments, position X4 of [D] is T or N. In some embodiments, position X5 of [D] is A. In some embodiments [D] is or comprises TA or PA. In some embodiments, the amino acid sequence of [D] is TA.
- [C]-[D] is or comprises YPAEVVQKTA (SEQ ID NO: 584) or YPAEVVQKPA (SEQ ID NO: 586); an amino acid sequence comprising any portion of any of the aforesaid amino acid sequences (e.g., any 2, 3, 4, 5, 6, 7, 8, or 9 amino acids, e.g., consecutive amino acids) thereof; an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the aforesaid amino acid sequences; or an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to any one of the aforesaid amino acid sequences.
- substitutions e.g., conservative substitutions
- the amino acid sequence of [C]-[D] is YPAEVVQKTA (SEQ ID NO: 584).
- [A]- [B]-[C]-[D] is or comprises TNNQSSYPAEVVQKTA (SEQ ID NO: 1533), TNNQSKYPAEVVQKTA (SEQ ID NO: 1538), TNNTSLYPAEVVQKTA (SEQ ID NO: 1232), TNNSSSYPAEVVQKTA (SEQ ID NO: 1539), TNNQSRYPAEVVQKTA (SEQ ID NO: 1327), TNNAGAYPAEVVQKTA (SEQ ID NO: 1021), TNNIGSYPAEVVQKTA (SEQ ID NO: 1112), TNNQASYPAEVVQKTA (SEQ ID NO: 1194), TNTASSYPAEVVQKTA (SEQ ID NO: 1575), TNNLGSYPAEVVQKTA (SEQ ID NO: 1027
- [C]-[D] is YPAEVVQKTA (SEQ ID NO: 584).
- [A]-[B]-[C]-[D] is TNNQSSYPAEVVQKTA (SEQ ID NO: 1533).
- a peptide described herein comprises an amino acid sequence having the formula [B]-[C], wherein [B] comprises positions X1, X2, and X3, and [C] comprises the amino acid sequence YPAEVVQK (SEQ ID NO: 943).
- position X1 of [B] is Q or S.
- position X2 of [B] is S, L, or A.
- position X3 of [B] is S, Y, or T.
- [B] comprises Q at position X1.
- [B] comprises S at position X2.
- [B] comprises S at position X3.
- [B] comprises QS, SL, SA, LY, AT, LS, or SS.
- [B] is or comprises QSS, SLY, SAT, or SLS.
- [B] is QSS.
- [B]- [C] comprises SSYPAEVVQK (SEQ ID NO: 572), LYYPAEVVQK (SEQ ID NO: 702), ATYPAEVVQK (SEQ ID NO: 718), or LSYPAEVVQK (SEQ ID NO: 703).
- [B]-[C] is or comprises QSSYPAEVVQK (SEQ ID NO: 150), SLYYPAEVVQK (SEQ ID NO: 639), SATYPAEVVQK (SEQ ID NO: 641), or SLSYPAEVVQK (SEQ ID NO: 642); an amino acid sequence comprising any portion of any of the aforesaid amino acid sequences (e.g., any 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids, e.g., consecutive amino acids) thereof; an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the aforesaid amino acid sequences; or an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to any one of the aforesaid amino acid sequences.
- an amino acid sequence comprising any portion of any of the aforesaid amino acid sequence
- [B]-[C] is QSSYPAEVVQK (SEQ ID NO: 150).
- a peptide comprising the formula [B]-[C] further comprises [A], which comprises positions X A , X B , and X C .
- position X A of [A] is T.
- position X B of [A] is N.
- position X C of [A] is N, T, S, or K.
- [A] comprises TN, NS, NT, NK, or NN.
- [A] is or comprises TNN, TNS, TNT, or TNK.
- the amino acid sequence of [A] is TNN.
- [A]-[B] is or comprises TNNQSS (SEQ ID NO: 183), TNSSLY (SEQ ID NO: 648), TNTSAT (SEQ ID NO: 649), TNSSLS (SEQ ID NO: 647), or TNKSAT (SEQ ID NO: 651); an amino acid sequence comprising any portion of any of the aforesaid amino acid sequences (e.g., any 2, 3, 4, or 5 amino acids, e.g., consecutive amino acids) thereof; an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the aforesaid amino acid sequences; or an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to any one of the aforesaid amino acid sequences.
- TNNQSS SEQ ID NO: 183
- [A]-[B] is TNNQSS (SEQ ID NO: 183).
- [A]-[B]-[C] is or comprises TNNQSSYPAEVVQK (SEQ ID NO: 500), TNSSLYYPAEVVQK (SEQ ID NO: 655), TNTSATYPAEVVQK (SEQ ID NO: 656), TNSSLSYPAEVVQK (SEQ ID NO: 657), or TNKSATYPAEVVQK (SEQ ID NO: 663); an amino acid sequence comprising any portion of any of the aforesaid amino acid sequences (e.g., any 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 amino acids, e.g., consecutive amino acids) thereof; an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the aforesaid amino acid sequences
- [A]- [B] is TNNQSS (SEQ ID NO: 183). In some embodiments, [A]-[B]-[C] is TNNQSSYPAEVVQK (SEQ ID NO: 500).
- a peptide comprising the formula [B]-[C], further comprises [D], wherein [D] comprises position X4 and X5.
- position X4 of [D] is T, N, or P.
- position X5 of [D] is A or D.
- [D] is or comprises TA, TD, NA, or PA.
- the amino acid sequence of [D] is TA.
- [C]-[D] is or comprises YPAEVVQKTA (SEQ ID NO: 584), YPAEVVQKTD (SEQ ID NO: 719), YPAEVVQKNA (SEQ ID NO: 724), or YPAEVVQKPA (SEQ ID NO: 586); an amino acid sequence comprising any portion of any of the aforesaid amino acid sequences (e.g., any 2, 3, 4, 5, 6, 7, 8, or 9 amino acids, e.g., consecutive amino acids) thereof; an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the aforesaid amino acid sequences; or an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to any one of the aforesaid amino acid sequences.
- amino acid sequence comprising any portion of any of the aforesaid amino acid sequence
- [C]-[D] is YPAEVVQKTA (SEQ ID NO: 584).
- [A]-[B]-[C]-[D] is or comprises TNNQSSYPAEVVQKTA (SEQ ID NO: 1533), TNSSLYYPAEVVQKTA (SEQ ID NO: 2066), TNTSATYPAEVVQKTA (SEQ ID NO: 2067), TNSSLSYPAEVVQKTA (SEQ ID NO: 2068), TNSSLSYPAEVVQKTD (SEQ ID NO: 2070), TNSSLSYPAEVVQKNA (SEQ ID NO: 2072), TNSSLSYPAEVVQKPA (SEQ ID NO: 2073), or TNKSATYPAEVVQKTA (SEQ ID NO: 2075); an amino acid sequence comprising any portion of any of the aforesaid amino acid sequences (e.g., any 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, or 15
- [A]-[B]-[C]-[D] is TNNQSSYPAEVVQKTA (SEQ ID NO: 1533). [096] In some embodiments, [B] is present immediately subsequent to [A]. In some embodiments, [C] is present immediately subsequent to [B]. In some embodiments, [D] is present immediately subsequent to [C]. In some embodiments, the peptide comprises from N-terminus to C- terminus, [B]-[C]. In some embodiments, the peptide comprises from N-terminus to C-terminus, [A]-[B]-[C].
- the peptide comprises from N-terminus to C-terminus, [B]-[C]-[D]. In some embodiments, the peptide comprises from N-terminus to C-terminus, [A]-[B]-[C]-[D].
- a peptide described herein comprises the formula [K1]-[K2], wherein, [K1] comprises LSY or LYY, and [K2] comprises positions X1, X2, X3, and X4. In some embodiments, [K1] comprises LSY. In some embodiments, position X1 of [K2] is Q, T or P.
- position X2 of [K2] is A, in some embodiments, position X3 of [K2] is E or D. In some embodiments, position X4 of [K2] is V or E. In some embodiments, [K2] comprises QA, TA, PA, EV, EE, DV, AE, or AD. In some embodiments, [K2] comprises QAE, TAE, PAE, PAD, AEV, AEE, or ADV. In some embodiments, [K2] is or comprises QAEV (SEQ ID NO: 15), TAEV (SEQ ID NO: 16), PAEV (SEQ ID NO: 17), PAEE (SEQ ID NO: 18), or PADV (SEQ ID NO: 19).
- [K1]-[K2] comprises LSYQA (SEQ ID NO: 597), LSYTA (SEQ ID NO: 598), LYYPA (SEQ ID NO: 600), or LSYPA (SEQ ID NO: 603).
- [K1]-[K2] comprises LSYQAE (SEQ ID NO: 607), LSYTAE (SEQ ID NO: 610), LYYPAE (SEQ ID NO: 611), LSYPAE (SEQ ID NO: 616), or LSYPAD (SEQ ID NO: 621).
- [K1]-[K2] is or comprises LSYQAEV (SEQ ID NO: 667), LSYTAEV (SEQ ID NO: 668), LYYPAEV (SEQ ID NO: 669), LSYPAEV (SEQ ID NO: 671), LSYPAEE (SEQ ID NO: 673), or LSYPADV (SEQ ID NO: 674); an amino acid sequence comprising any portion of any of the aforesaid amino acid sequences (e.g., any 2, 3, 4, 5, or 6 amino acids, e.g., consecutive amino acids) thereof; an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the aforesaid amino acid sequences; or an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to any one of the aforesaid amino acid sequences.
- the peptide comprising the amino acid sequence comprising the formula of [K1]-[K2], further comprises [K0], which comprises TNNS (SEQ ID NO: 14).
- [K0]-[K1] comprises TNSSLS (SEQ ID NO: 647) or TNSSLY (SEQ ID NO: 648).
- [K0]-[K1] is or comprises TNSSLSY (SEQ ID NO: 676) or TNSSLYY (SEQ ID NO: 678); an amino acid sequence comprising any portion of any of the aforesaid amino acid sequences (e.g., any 2, 3, 4, 5, or 6 amino acids, e.g., consecutive amino acids) thereof; an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the aforesaid amino acid sequences; or an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to any one of the aforesaid amino acid sequences.
- substitutions e.g., conservative substitutions
- [K0]- [K1]-[K2] comprises TNSSLSYQA (SEQ ID NO: 679), TNSSLSYTA (SEQ ID NO: 681), TNSSLYYPA (SEQ ID NO: 682), or TNSSLSYPA (SEQ ID NO: 683).
- [K0]- [K1]-[K2] comprises TNSSLSYQAE (SEQ ID NO: 684), TNSSLSYTAE (SEQ ID NO: 685), TNSSLYYPAE (SEQ ID NO: 686), TNSSLSYPAE (SEQ ID NO: 687), or TNSSLSYPAD (SEQ ID NO: 689).
- [K0]-[K1]-[K2] is or comprises TNSSLSYQAEV (SEQ ID NO: 692), TNSSLSYTAEV (SEQ ID NO: 693), TNSSLYYPAEV (SEQ ID NO: 696), TNSSLSYPAEV (SEQ ID NO: 697), TNSSLSYPAEE (SEQ ID NO: 698), or TNSSLSYPADV (SEQ ID NO: 699); an amino acid sequence comprising any portion of any of the aforesaid amino acid sequences (e.g., any 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids, e.g., consecutive amino acids) thereof; an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the aforesaid amino acid sequences; or an amino acid sequence comprising one, two, or three but no more than four different amino acids
- peptide comprising the amino acid sequence comprising the formula of [K1]-[K2], further comprises [K3], wherein [K3] comprises positions X A , X B , and X C .
- position X A of [K3] is V.
- position X B of [K3] is Q.
- position X C of [K3] is K or N.
- [K3] comprises VQ, QK, or QN.
- [K3] is or comprises VQK or VQN.
- K2]-[K3] is or comprises QAEVVQK (SEQ ID NO: 52), TAEVVQK (SEQ ID NO: 49), PAEVVQK (SEQ ID NO: 20), PAEEVQK (SEQ ID NO: 51) ,PAEVVQN (SEQ ID NO: 594), or PADVVQK (SEQ ID NO: 596); an amino acid sequence comprising any portion of any of the aforesaid amino acid sequences (e.g., any 2, 3, 4, 5, or 6 amino acids, e.g., consecutive amino acids) thereof; an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the aforesaid amino acid sequences; or an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to any one of the aforesaid amino acid sequences.
- amino acid sequence comprising any
- [K1]- [K2]-[K3] is or comprises LSYQAEVVQK (SEQ ID NO: 700), LSYTAEVVQK (SEQ ID NO: 701), LYYPAEVVQK (SEQ ID NO: 702), LSYPAEVVQK (SEQ ID NO: 703), LSYPAEEVQK (SEQ ID NO: 704), LSYPAEVVQN (SEQ ID NO: 706), or LSYPADVVQK (SEQ ID NO: 708); an amino acid sequence comprising any portion of any of the aforesaid amino acid sequences (e.g., any 2, 3, 4, 5, 6, 7, 8, or 9 amino acids, e.g., consecutive amino acids) thereof; an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the aforesaid amino acid sequences;
- [K0]- [K1]-[K2]-[K3] is or comprises TNSSLSYQAEVVQK (SEQ ID NO: 652), TNSSLSYTAEVVQK (SEQ ID NO: 654), TNSSLYYPAEVVQK (SEQ ID NO: 655), TNSSLSYPAEVVQK (SEQ ID NO: 657), TNSSLSYPAEEVQK (SEQ ID NO: 658), TNSSLSYPAEVVQN (SEQ ID NO: 660), or TNSSLSYPADVVQK (SEQ ID NO: 665); an amino acid sequence comprising any portion of any of the aforesaid amino acid sequences (e.g., any 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 amino acids, e.g., consecutive amino acids) thereof; an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions),
- position X D of [K4] is T, P, or N.
- position X E of [K4] is A or D.
- [K4] is or comprises TA, TD, PA, or NA.
- [K3]-[K4] is or comprises VQKTA (SEQ ID NO: 564), VQKTD (SEQ ID NO: 714), VQNTA (SEQ ID NO: 715), VQKNA (SEQ ID NO: 570), or VQKPA (SEQ ID NO: 567); an amino acid sequence comprising any portion of any of the aforesaid amino acid sequences (e.g., any 2, 3, or 4 amino acids, e.g., consecutive amino acids) thereof; an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the aforesaid amino acid sequences; or an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to any one of the aforesaid amino acid sequences.
- VQKTA SEQ ID NO: 564
- VQKTD SEQ ID NO: 714
- [N0]-[N1]-[N2]-[N3]-[N4] is or comprises TNSSLSYQAEVVQKTA (SEQ ID NO: 2064), TNSSLSYTAEVVQKTA (SEQ ID NO: 2065), TNSSLYYPAEVVQKTA (SEQ ID NO: 2066), TNSSLSYPAEVVQKTA (SEQ ID NO: 2068), TNSSLSYPAEEVQKTA (SEQ ID NO: 2069), TNSSLSYPAEVVQKTD (SEQ ID NO: 2070), TNSSLSYPAEVVQNTA (SEQ ID NO: 2071), TNSSLSYPAEVVQKNA (SEQ ID NO: 2072), TNSSLSYPAEVVQKPA (SEQ ID NO: 2073), or TNSSLSYPADVVQKTA (SEQ ID NO: 2076); an amino acid sequence comprising any portion of any of the aforesaid amino acid sequences
- [K2] is present immediately subsequent to [K1]. In some embodiments, [K1] is present immediately subsequent to [K0]. In some embodiments, [K3] is present immediately subsequent to [K2]. In some embodiments, [K4] is present immediately subsequent to [K3]. In some embodiments, the peptide comprises from N-terminus to C-terminus, [K1]-[K2]. In some embodiments, the peptide comprises from N-terminus to C-terminus, [K1]-[K2]-[K3].
- the peptide comprises from N-terminus to C-terminus, [K0]-[K1]-[K2]-[K3]. In some embodiments, the peptide comprises from N-terminus to C-terminus, [K1]-[K2]-[K3]-[K4]. In some embodiments, the peptide comprises from N-terminus to C-terminus, [K0]-[K1]-[K2]-[K3]-[K4]. [0102] In some embodiments, a peptide described herein comprises an amino acid sequence comprising at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 consecutive amino acids from any one of the sequences provided in Tables 1, 2A, 2B, 9, and 15-20.
- the peptide comprises an amino acid sequence comprising at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 consecutive amino acids from any one of SEQ ID NOs: 943, 1021, 1024, 1027, 1112, 1142, 1214, 1232, 1254, 1300, 1310, 1327, 1331, 1342, 1419, 1453, 1533, 1538, 1539, 1575, 1578, 1583- 1587, 1590, 1591-1593, 1598-1608, or 1610-1624.
- the peptide comprises an amino acid sequence comprising at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 consecutive amino acids from any one of SEQ ID NOs: 943 or 2064-2080.
- the peptide comprises at least 3, 4, 5, 6, or 7 consecutive amino acids from any one of SEQ ID NOs: 943 or 946-966.
- the 3 consecutive amino acids comprise YPA.
- the 4 consecutive amino acids comprise YPAE (SEQ ID NO: 21).
- the 5 consecutive amino acids comprise YPAEV (SEQ ID NO: 1).
- the 6 consecutive amino acids comprise YPAEVV (SEQ ID NO: 725).
- the 7 consecutive amino acids comprise YPAEVVQ (SEQ ID NO: 726).
- the amino acid sequence comprises YPAEVVQK (SEQ ID NO: 943).
- the amino acid sequence consists of YPAEVVQK (SEQ ID NO: 943).
- a peptide described herein comprises an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to the amino acid sequence of any one of the sequences provided in Tables 1, 2A, 2B, 9, and 15-20.
- the peptide comprises an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to the amino acid sequence of any one of the sequences provided in Tables 1, 2A, 2B, 9, and 15-20.
- the peptide comprises an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to the amino acid sequence of any one of SEQ ID NOs: 943, 1021, 1024, 1027, 1112, 1142, 1214, 1232, 1254, 1300, 1310, 1327, 1331, 1342, 1419, 1453, 1533, 1538, 1539, 1575, 1578, 1583- 1587, 1590, 1591-1593, 1598-1608, or 1610-1624.
- substitutions e.g., conservative substitutions
- the peptide comprises an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to the amino acid sequence of any one of SEQ ID NOs: 943, 1021, 1024, 1027, 1112, 1142, 1214, 1232, 1254, 1300, 1310, 1327, 1331, 1342, 1419, 1453, 1533, 1538, 1539, 1575, 1578, 1583- 1587, 1590, 1591-1593, 1598-1608, or 1610-1624.
- the peptide comprises an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to the amino acid sequence of any one of SEQ ID NOs: 943 or 2064-2080.
- the peptide comprises an amino acid sequence comprising one, two, or three but no more than four different amino acids relative to the amino acid sequence of any one of SEQ ID NOs: 943 or 2064-2080.
- the peptide comprises an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to the amino acid sequence of YPAEVVQK (SEQ ID NO: 943). In some embodiments, the peptide comprises an amino acid sequence comprising one, two, or three but no more than four different amino acids relative to the amino acid sequence of YPAEVVQK (SEQ ID NO: 943).
- the peptide comprises an amino sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to the amino acid sequence of any one of SEQ ID NOs: 2024-2063.
- the peptide comprises an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to the amino acid sequence of any one of SEQ ID NOs: 2024-2063.
- the different amino acids of the amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to the amino acid sequence of any one of SEQ ID NOs: 2024-2063, are present at one or more of the following positions: (i) position 1, wherein the different amino acid is T or L; (ii) position 2, wherein the different amino acid is N, L, K, A, T, or P; (iii) position 3, wherein the different amino acid is N, K, L, A, Y, or S; (iv) position 4, wherein the different amino acid is Q, L, T, S, F, Y, K, or A; (v) position 5, wherein the different amino acid is S, H, A, M, Q, T, V, or F; (vi) position 6, wherein the different amino acid is S, P, V, A, Q, L, T, N, or M; (vii) position 7, wherein the different amino acid is Y, H, S, V, A, L, or T; (viii
- the peptide comprises an amino sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to the amino acid sequence of any one of SEQ ID NOs: 1632-2023.
- the peptide comprises an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to the amino acid sequence of any one of SEQ ID NOs: 1632-2023.
- the different amino acids of the amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to the amino acid sequence of any one of SEQ ID NOs: 1623-2023, are present at one or more of the following positions: (i) position 1, wherein the different amino acid is T, G, N, S, E, L, Y, V, or I; (ii) position 2, wherein the different amino acid is D, N, K, E, V, G, R, L, H, F, P, T, A, S, I, or Y; (iii) position 3, wherein the different amino acid is Y, N, K, T, W, Q, M, V, C, A, L, F, H, G, R, S, or P; (iv) position 4, wherein the different amino acid is H, Q, P, E, R, K, A, S, V, L, T, D, I, G, M, or N; (v) position 5, wherein the different amino acid is R, S, K
- the peptide comprises the amino acid sequence of any of the sequences provided in Tables 1, 2A, 2B, 9, and 15-20.
- the peptide comprises the amino acid sequence of any of SEQ ID NOs: 943, 1021, 1024, 1027, 1112, 1142, 1214, 1232, 1254, 1300, 1310, 1327, 1331, 1342, 1419, 1453, 1533, 1538, 1539, 1575, 1578, 1583- 1587, 1590, 1591-1593, 1598-1608, or 1610-1624.
- the peptide comprises the amino acid sequence of any of SEQ ID NOs: 943 or 2064-2080.
- the peptide comprises the amino acid sequence of any of SEQ ID NOs: 2024-2063. In some embodiments, the peptide comprises the amino acid sequence of any of SEQ ID NOs: 1632-2023. In some embodiments, the peptide comprises the amino acid sequence of SEQ ID NO: 943. [0109] In some embodiments, the peptide comprises an amino acid sequence encoded by a nucleotide sequence described herein, e.g., a nucleotide sequence of Table 2A.
- the peptide comprises an amino acid sequence encoded by a nucleotide sequence comprising at least one, two, three, four, five, six, or seven modifications, e.g., substitutions, insertions, or deletions, but no more than ten modifications, e.g., substitutions, insertions, or deletions, relative to the nucleotide sequence of SEQ ID NO: 944.
- the peptide comprises an amino acid sequence encoded by a nucleotide sequence comprising at least one, two, three, four, five, six, or seven, but no more than ten different nucleotides, relative to the nucleotide sequence of SEQ ID NO: 944.
- the peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 944, or a nucleotide sequence substantially identical (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity) thereto.
- the nucleotide sequence encoding a peptide described herein comprises a nucleotide sequence described herein, e.g., as described in Table 2A.
- the nucleotide sequence encoding a peptide described herein is codon optimized.
- the nucleotide sequence encoding a peptide described herein is isolated, e.g., recombinant.
- the nucleotide sequence encoding a peptide described herein comprises the nucleotide sequence of SEQ ID NO: 944, or a nucleotide sequence comprising at least one, two, three, four, five, six, or seven modifications, e.g., substitutions, insertions, or deletions, but no more than ten modifications, e.g., substitutions, insertions, or deletions, relative to the nucleotide sequence of SEQ ID NO: 944.
- the nucleotide sequence encoding a peptide described herein comprises a nucleotide sequence comprising at least one, two, three, four, five, six, or seven, but no more than ten different nucleotides, relative to the nucleotide sequence of SEQ ID NO: 944.
- the nucleic acid encoding a peptide described herein comprises a nucleotide sequence comprising the nucleotide sequence of SEQ ID NO: 944, or a nucleotide sequence substantially identical (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity) thereto.
- a peptide described herein is fused or coupled, e.g., conjugated, to an active agent.
- the active agent is a therapeutic agent.
- the active agent comprises a therapeutic protein, an antibody molecule, an enzyme, one or more components of a genome editing system, an Fc polypeptide fused or coupled (e.g., covalently or non covalently) to a therapeutic agent, and/or an RNAi agent (e.g., a dsRNA, antisense oligonucleotide (ASO), siRNA, shRNA, pre-miRNA, pri-miRNA, miRNA, stRNA, lncRNA, piRNA, or snoRNA).
- RNAi agent e.g., a dsRNA, antisense oligonucleotide (ASO), siRNA, shRNA, pre-miRNA, pri-miRNA, miRNA, stRNA, lncRNA, piRNA, or sno
- the therapeutic agent is an antibody.
- a peptide described herein is fused or coupled, e.g., conjugated (e.g., directly or indirectly) to the Fc region of the antibody, e.g., at the C-terminus of the Fc region or the N-terminus of the Fc region.
- the therapeutic agent is an RNAi agent.
- the RNAi agent is a siRNA or an ASO.
- the ASO or siRNA comprises at least one (e.g., one or more or all) modified nucleotides.
- a peptide described herein is fused or coupled, e.g., conjugated (e.g., directly or indirectly via a linker), to at least one strand of the RNAi agent.
- a peptide described herein is conjugated, e.g., directly or indirectly via a linker, to the C-terminus of at least one strand of the RNAi agent.
- a peptide described herein is conjugated, e.g., directly or indirectly via a linker, to an internal nucleotide of at least one strand of the RNAi agent.
- the at least one strand is the sense strand.
- the therapeutic agent modulates, e.g., inhibits, decreases, or increases, expression of a CNS related gene, mRNA, and/or protein.
- the active agent is a diagnostic agent.
- the diagnostic agent is or comprises an imaging agent (e.g., a protein or small molecule compound coupled to a detectable moiety).
- the imaging agent comprises a PET or MRI ligand, or an antibody molecule coupled to a detectable moiety.
- the detectable moiety is or comprises a radiolabel, a fluorophore, a chromophore, or an affinity tag.
- the radiolabel is or comprises tc99m, iodine-123, a spin label, iodine-131, indium-111, fluorine-19, carbon-13, nitrogen- 15, oxygen-17, gadolinium, manganese, or iron.
- the active agent is a small molecule.
- the active agent is a ribonucleic acid complex (e.g., a Cas9/gRNA complex), a plasmid, a closed-end DNA, a circ-RNA, or an mRNA.
- At least 1-5 e.g., at least 1, 2, 3, 4, or 5, peptides are fused or coupled, e.g., conjugated, to an active agent, e.g., a therapeutic agent or a diagnostic agent.
- the at least 1-5 e.g., at least 1, 2, 3, 4, or 5, peptides comprise the same amino acid sequence.
- the at least 1-5, e.g., at least 1, 2, 3, 4, or 5, peptides comprise different amino acid sequences.
- the at least 1-5 e.g., at least 1, 2, 3, 4, or 5, peptides are present in tandem (e.g., connected directly or indirectly via a linker) or in a multimeric configuration.
- the peptide comprises an amino acid sequence of at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 15, 20, 25, 30, or 35 amino acids in length.
- the peptide covalently linked, e.g., directly or indirectly via a linker, to the active agent.
- the peptide is conjugated to the active agent via a linker.
- the linker is a cleavable linker or a non-cleavable linker.
- the cleavable linker is a pH sensitive linker or an enzyme sensitive linker.
- the pH sensitive linker comprises a hydrazine/hydrazone linker or a disulfide linker.
- the enzyme sensitive linker comprises a peptide based linker, e.g., a peptide linker sensitive to a protease (e.g., a lysosomal protease); or a beta-glucuronide linker.
- the non-cleavable linker is a linker comprising a thioether group or a maleimidocaproyl group.
- the peptide and the active agent are fused or coupled post- translationally, e.g., using click chemistry. In some embodiments, the peptide and the active agent are fused or couple via chemically induced dimerization. In some embodiments, the peptide is present N- terminal relative to the active agent. In some embodiments, the peptide is present C-terminal relative to the active agent. [0116] In some embodiments, the peptide is present or coupled to a carrier. In some embodiments, the carrier comprises an exosome, a microvesicle, or a lipid nanoparticle (LNP).
- LNP lipid nanoparticle
- the carrier comprises a therapeutic agent (e.g., an RNAi agent (e.g., an dsRNA, a siRNA, a shRNA, a pre-miRNA, a pri-miRNA, a miRNA, a stRNA, a lncRNA, a piRNA, an antisense oligonucleotide agent (ASO), or a snoRNA), an mRNA, a ribonucleoprotein complex (e.g., a Cas9/gRNA complex), or a circRNA).
- a therapeutic agent e.g., an RNAi agent (e.g., an dsRNA, a siRNA, a shRNA, a pre-miRNA, a pri-miRNA, a miRNA, a stRNA, a lncRNA, a piRNA, an antisense oligonucleotide agent (ASO), or a snoRNA), an
- At least 10%, 20%, 30%, 40%, 50%, 60%, 70%, or 80% of the surface of the carrier comprises at least 1-5, e.g., at least 1, 2, 3, 4, or 5, peptides described herein.
- the present disclosure also provides a nucleic acid or polynucleotide encoding any of the peptides described herein and AAV capsid variants, AAV particles, vectors, and cells comprising the same.
- an AAV capsid variant described herein comprises an amino acid other than T at position 577 (e.g., Y, N, or C), numbered relative to SEQ ID NO: 138.
- the AAV capsid variant comprises Y at position 577, numbered relative to SEQ ID NO: 138.
- the AAV capsid variant comprises N at position 577, numbered relative to SEQ ID NO: 138.
- the AAV capsid variant comprises C at position 577, numbered relative to SEQ ID NO: 138.
- an AAV capsid variant described herein comprises more than one amino acid that replaces the threonine (T) at position 577, numbered relative to SEQ ID NO: 138.
- T threonine
- an insert of two, three, four, five, six, seven, eight, nine, or ten amino acids replaces the T at position 577, numbered relative to SEQ ID NO: 138.
- an insert of eight amino acids replaces the T at position 577, numbered relative to SEQ ID NO: 138.
- an AAV particle described herein comprises an AAV capsid variant, e.g., an AAV capsid variant described herein (e.g., an AAV capsid variant comprising a peptide or an amino acid sequence described herein).
- an AAV capsid variant comprises a peptide as set forth in any of Tables 1, 2A, 2B, 9, or 15-20.
- an AAV capsid variant described herein comprises an amino acid sequence having the formula [N2]-[N3], wherein [N2] comprises positions X1, X2, X3, X4, and X5 and [N3] comprises the amino acid sequence of VQK, VQN, EQK, VKK, VHK, VQQ, or LQK.
- position X1 of [N2] is Y, N, C, or T.
- position X2 of [N2] is P, E, K, T, or Q.
- position X3 of [N2] is A or P.
- position X4 of [N2] is E, S, D, or A.
- position X5 of [N2] is V, L, or E.
- [N2] comprises Y at position X1.
- [N2] comprises P at position X2.
- [N2] comprises A at position X3.
- [N2] comprises E at position X4.
- [N2] comprises V at position X5.
- the amino acid sequence of [N3] comprises VQK. In some embodiments, the amino acid sequence of [N3] is VQK.
- an AAV capsid variant described herein comprises an amino acid sequence having the formula [N2]-[N3], wherein [N2] comprises positions X1, X2, X3, X4, and X5 and [N3] comprises the amino acid sequence of VQK, EQK, VKK, VHK, VQQ, or LQK.
- [N3] comprises the amino acid sequence of VQK, EQK, or VKK.
- [N3] comprises the amino acid sequence VQK.
- position X1 of [N2] is Y, N, or C.
- position X1 of [N2] is Y or N.
- position X2 of [N2] is P, K, T, or Q. In some embodiments position X2 of [N2] is P, T, or Q. In some embodiments, position X3 of [N2] is A or P. In some embodiments, position X3 of [N2] is A. In some embodiments, position X4 of [N2] is E, S, or A. In some embodiments, position X5 of [N2] is V, L, or E. In some embodiments, position X5 of [N2] is V or L. In some embodiments, [N2] comprises Y at position X1. In some embodiments, [N2] comprises P at position X2.
- [N2] comprises A at position X3. In some embodiments, [N2] comprises E at position X4. In some embodiments, [N2] comprises V at position X5. In some embodiments, [N2] comprises YPA, YPP, NKA, YTA, YQA, YTP, NPA, CPA, THA, PAE, PPS, KAE, TAE, QAE, TPS, PAA, HAS, AEV, PSL, AEE, or AAV.
- [N2] comprises YPAE (SEQ ID NO: 21), YPPS (SEQ ID NO: 22), NKAE (SEQ ID NO: 23), YTAE (SEQ ID NO: 24), YQAE (SEQ ID NO: 25), YTPS (SEQ ID NO: 26), YPAA (SEQ ID NO: 27), NPAE (SEQ ID NO: 28), CPAE (SEQ ID NO: 29), THAS (SEQ ID NO: 30), PAEV (SEQ ID NO: 17), PPSL (SEQ ID NO: 31), KAEV (SEQ ID NO: 32), TAEV (SEQ ID NO: 16), PAEE (SEQ ID NO: 18), QAEV (SEQ ID NO: 15), TPSL (SEQ ID NO: 33), PAAV (SEQ ID NO: 34), or QAEE (SEQ ID NO: 35).
- [N2] is or comprises YPAEV (SEQ ID NO: 1), YPPSL (SEQ ID NO: 2), NKAEV (SEQ ID NO: 3), YTAEV (SEQ ID NO: 4), YPAEE (SEQ ID NO: 5), YQAEV (SEQ ID NO: 6), YTPSL (SEQ ID NO: 7), YPAAV (SEQ ID NO: 8), NPAEV (SEQ ID NO: 9), CPAEV (SEQ ID NO: 10), or YQAEE (SEQ ID NO: 11).
- [N2] is YPAEV (SEQ ID NO: 1).
- [N2]- [N3] comprises the amino acid sequence of AEVVQK (SEQ ID NO: 36), PSLVQK (SEQ ID NO: 37), AEVEQK (SEQ ID NO: 38), AEEVQK (SEQ ID NO: 39), PSLEQK (SEQ ID NO: 40), PSLVKK (SEQ ID NO: 41), AEVVKK (SEQ ID NO: 42), AEVVHK (SEQ ID NO: 43), AAVVQK (SEQ ID NO: 44), AEVVQQ (SEQ ID NO: 45), or AEVLQK (SEQ ID NO: 46).
- [N2]-[N3] comprises the amino acid sequence PAEVVQK (SEQ ID NO: 20), PPSLVQK (SEQ ID NO: 47), KAEVVQK (SEQ ID NO: 48), TAEVVQK (SEQ ID NO: 49), PAEVEQK (SEQ ID NO: 50), PAEEVQK (SEQ ID NO: 51), QAEVVQK (SEQ ID NO: 52), TPSLVQK (SEQ ID NO: 53), PPSLEQK (SEQ ID NO: 54), PPSLVKK (SEQ ID NO: 55), PAEVVKK (SEQ ID NO: 56), PAEVVHK (SEQ ID NO: 57), PAAVVQK (SEQ ID NO: 58), PAEVVQQ (SEQ ID NO: 59), TAEVVKK (SEQ ID NO: 60), PAEVLQK (SEQ ID NO: 61), or QAEEVQK (SEQ ID NO: 62).
- [N2]-[N3] is or comprises YPAEVVQK (SEQ ID NO: 943), YPPSLVQK (SEQ ID NO: 946), NKAEVVQK (SEQ ID NO: 947), YTAEVVQK (SEQ ID NO: 948), YPAEVEQK (SEQ ID NO: 949), YPAEEVQK (SEQ ID NO: 950), YQAEVVQK (SEQ ID NO: 951), YTPSLVQK (SEQ ID NO: 952), YPPSLEQK (SEQ ID NO: 953), YPPSLVKK (SEQ ID NO: 954), YPAEVVKK (SEQ ID NO: 955), YPAEVVHK (SEQ ID NO: 956), YPAAVVQK (SEQ ID NO: 957), NPAEVVQK (SEQ ID NO: 958), YPAEVVQQ (SEQ ID NO: 959), CPAEVVQK (S
- [N2]-[N3] is YPAEVVQK (SEQ ID NO: 943).
- the AAV capsid variant comprising the amino acid sequence comprising the formula of [N2]-[N3], further comprises [N1], which comprises positions XD, XE, and X F .
- position X D of [N1] is Q, T, S, A, I, L, or H.
- position X E of [N1] is S, G, A, or R.
- position X F of [N1] is S, K, L, R, A, or T.
- [N1] comprises SK, SL, SS, SR, GA, GS, AS, ST, RS, QS, TS, AG, IG, QA, LG, HS, LS, or QR.
- [N1] is or comprises QSS, QSK, TSL, SSS, QSR, AGA, IGS, QAS, ASS, LGS, QST, HSS, LSS, or QRS.
- the amino acid sequence of [N1] is QSS.
- [N1]-[N2] comprises SSYPA (SEQ ID NO: 63), SKYPA (SEQ ID NO: 64), SLYPA (SEQ ID NO: 65), SRYPA (SEQ ID NO: 66), SSYPP (SEQ ID NO: 67), GAYPA (SEQ ID NO: 68), GSYPA (SEQ ID NO: 69), ASYPA (SEQ ID NO: 70), STNKA (SEQ ID NO: 71), SSYTA (SEQ ID NO: 72), SSYQA (SEQ ID NO: 73), SSYTP (SEQ ID NO: 74), SSNPA (SEQ ID NO: 75), SLCPA (SEQ ID NO: 76), RSYTA (SEQ ID NO: 77), or SSTHA (SEQ ID NO: 78).
- [N1]-[N2] comprises SSYPAE (SEQ ID NO: 79), SKYPAE (SEQ ID NO: 80), SLYPAE (SEQ ID NO: 81), SRYPAE (SEQ ID NO: 82), SSYPPS (SEQ ID NO: 83), GAYPAE (SEQ ID NO: 84), GSYPAE (SEQ ID NO: 85), ASYPAE (SEQ ID NO: 86), STNKAE (SEQ ID NO: 87), SSYTAE (SEQ ID NO: 88), SSYQAE (SEQ ID NO: 89), SSYTPS (SEQ ID NO: 90), SSYPAA (SEQ ID NO: 91), SSNPAE (SEQ ID NO: 92), SLCPAE (SEQ ID NO: 93), RSYTAE (SEQ ID NO: 94), SSTHAS (SEQ ID NO: 95).
- [N1]-[N2] is or comprises QSSYPAEV (SEQ ID NO: 96), QSKYPAEV (SEQ ID NO: 97), TSLYPAEV (SEQ ID NO: 98), SSSYPAEV (SEQ ID NO: 99), QSRYPAEV (SEQ ID NO: 100), QSSYPPSL (SEQ ID NO: 101), AGAYPAEV (SEQ ID NO: 102), IGSYPAEV (SEQ ID NO: 103), QASYPAEV (SEQ ID NO: 104), ASSYPAEV (SEQ ID NO: 105), LGSYPAEV (SEQ ID NO: 106), QSTNKAEV (SEQ ID NO: 107), HSSYPAEV (SEQ ID NO: 108), SSSYTAEV (SEQ ID NO: 109), TSLYPAEE (SEQ ID NO: 110), ASSYQAEV (SEQ ID NO: 111), QSSYTPSL (SEQ ID NO: 112), QSRYPAEE
- [N1]-[N2] is QSSYPAEV (SEQ ID NO: 96).
- [N1]-[N2]-[N3] comprises SSYPAEVVQ (SEQ ID NO: 121), SKYPAEVVQ (SEQ ID NO: 122), SLYPAEVVQ (SEQ ID NO: 123), SRYPAEVVQ (SEQ ID NO: 124), SSYPPSLVQ (SEQ ID NO: 125), GAYPAEVVQ (SEQ ID NO: 126), GSYPAEVVQ (SEQ ID NO: 127), ASYPAEVVQ (SEQ ID NO: 128), STNKAEVVQ (SEQ ID NO: 129), SSYTAEVVQ (SEQ ID NO: 130), SKYPAEVEQ (SEQ ID NO: 131), SLYPAEEVQ (SEQ ID NO: 132), SSYQAEVVQ (SEQ ID NO: 133), SSYTPSLV
- [N1]-[N2]-[N3] is or comprises QSSYPAEVVQK (SEQ ID NO: 150), QSKYPAEVVQK (SEQ ID NO: 151), TSLYPAEVVQK (SEQ ID NO: 152), SSSYPAEVVQK (SEQ ID NO: 153), QSRYPAEVVQK (SEQ ID NO: 154), QSSYPPSLVQK (SEQ ID NO: 155), AGAYPAEVVQK (SEQ ID NO: 156), IGSYPAEVVQK (SEQ ID NO: 157), QASYPAEVVQK (SEQ ID NO: 158), ASSYPAEVVQK (SEQ ID NO: 159), LGSYPAEVVQK (SEQ ID NO: 160), QSTNKAEVVQK (SEQ ID NO: 161), HSSYPAEVVQK (SEQ ID NO: 162), SSSYTAEVVQK (SEQ ID NO: 16
- [N1]-[N2]-[N3] is QSSYPAEVVQK (SEQ ID NO: 150).
- the AAV capsid variant comprising the amino acid sequence comprising the formula [N2]-[N3], further comprises [N0], wherein [N0] comprises positions X A , X B , and X C .
- position X A of [N0] is T, I, or N.
- positions X B of [N0] is N.
- position X C of [N0] is N, T, S, or K.
- [N0] comprises TN, IN, NN, NT, NS, or NK.
- [N0] is or comprises TNN, TNT, INN, TNS, NNN, or TNK. In some embodiments, [N0] is TNN. In some embodiments, [N0]-[N1] is or comprises TNNQSS (SEQ ID NO: 183), TNNQSK (SEQ ID NO: 184), TNNTSL (SEQ ID NO: 185), TNNSSS (SEQ ID NO: 186), TNNQSR (SEQ ID NO: 187), TNNAGA (SEQ ID NO: 188), TNNIGS (SEQ ID NO: 189), TNNQAS (SEQ ID NO: 190), TNTASS (SEQ ID NO: 191), TNNLGS (SEQ ID NO: 192), TNNQST (SEQ ID NO: 193), TNNHSS (SEQ ID NO: 194), TNNQSK (SEQ ID NO: 184), TNNLSS (SEQ ID NO: 195), INNQSS (SEQ ID NO: 196
- [N0]-[N1] is TNNQSS (SEQ ID NO: 183).
- [N0]-[N1]-[N2]- [N3] is or comprises TNNQSSYPAEVVQK (SEQ ID NO: 500), TNNQSKYPAEVVQK (SEQ ID NO: 503), TNNTSLYPAEVVQK (SEQ ID NO: 506), TNNSSSYPAEVVQK (SEQ ID NO: 508), TNNQSRYPAEVVQK (SEQ ID NO: 510), TNNQSSYPPSLVQK (SEQ ID NO: 512), TNNAGAYPAEVVQK (SEQ ID NO: 513), TNNIGSYPAEVVQK (SEQ ID NO: 514), TNNQASYPAEVVQK (SEQ ID NO: 517), TNTASSYPAEVVQK (SEQ ID NO: 520), TNNLGSYPAEVVQK (SEQ ID NO: 500), TNN
- [N0]-[N1]-[N2]-[N3] is TNNQSSYPAEVVQK (SEQ ID NO: 500).
- the AAV capsid variant comprising the amino acid sequence comprising the formula [N2]-[N3], further comprises [N4], which comprises positions X G and X H .
- position X G of [N4] is T, P, or N.
- position X H of [N4] is A.
- [N4] is or comprises TA, PA, or NA.
- [N4] is TA.
- [N3]-[N4] is or comprises VQKTA (SEQ ID NO: 564), EQKTA (SEQ ID NO: 565), VKKTA (SEQ ID NO: 566), VQKPA (SEQ ID NO: 567), VHKTA (SEQ ID NO: 568), VQQTA (SEQ ID NO: 569), VQKNA (SEQ ID NO: 570), or LQKTA (SEQ ID NO: 571); an amino acid sequence comprising any portion of any of the aforesaid amino acid sequences (e.g., any 2, 3, or 4 amino acids, e.g., consecutive amino acids) thereof; an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the aforesaid amino acid sequences; or an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to any one
- [N3]-[N4] is VQKTA (SEQ ID NO: 564).
- [N0]-[N1]-[N2]-[N3]-[N4] is or comprises TNNQSSYPAEVVQKTA (SEQ ID NO: 1533), TNNQSKYPAEVVQKTA (SEQ ID NO: 1538), TNNTSLYPAEVVQKTA (SEQ ID NO: 1232), TNNSSSYPAEVVQKTA (SEQ ID NO: 1539), TNNQSRYPAEVVQKTA (SEQ ID NO: 1327), TNNQSSYPPSLVQKTA (SEQ ID NO: 1300), TNNAGAYPAEVVQKTA (SEQ ID NO: 1021), TNNIGSYPAEVVQKTA (SEQ ID NO: 1112), TNNQASYPAEVVQKTA (SEQ ID NO: 1194), TNTASSYPAEVVQKTA (SEQ ID NO:
- [N0]-[N1]-[N2]-[N3]-[N4] is TNNQSSYPAEVVQKTA (SEQ ID NO: 1533).
- the AAV capsid variant described herein comprises the formula [N2]-[N3], wherein [N2] comprises positions X1, X2, X3, X4, and X5 and [N3] comprises the amino acid sequence of VQK or VQN.
- [N3] comprises the amino acid sequence VQK.
- [N3] is the amino acid sequence VQK.
- position X1 of [N2] is Y or T.
- position X2 of [N2] is Q, T, P, or E.
- position X3 of [N2] is A.
- position X4 of [N2] is E or D.
- position X4 of [N2] is E or D.
- position X5 of [N2] is V or E.
- position X2 of [N2] is P, E, K, T, or Q.
- position X3 of [N2] is A or P.
- position X4 of [N2] is E, S, D, or A.
- position X5 of [N2] is V, L, or E.
- [N2] comprises Y at position X1. In some embodiments, [N2] comprises P at position X2. In some embodiments, [N2] comprises A at position X3. In some embodiments, [N2] comprises E at position X4. In some embodiments, [N2] comprises V at position X5. In some embodiments, [N2] comprises YP, YQ, YT, TE, QA, TA, PA, EA, EV, EE, DV, AE, or AD. In some embodiments, [N2] comprises YPA, YQA, YTA, TEA, QAE, TAE, PAE, EAE, PAD, AEV, AEE, or ADV.
- [N2] comprises YPAE (SEQ ID NO: 21), YQAE (SEQ ID NO: 25), YTAE (SEQ ID NO: 24), TEAE (SEQ ID NO: 587), YPAD (SEQ ID NO: 588), QAEV (SEQ ID NO: 15), TAEV (SEQ ID NO: 16), PAEV (SEQ ID NO: 17), PAEE (SEQ ID NO: 18), EAEV (SEQ ID NO: 590), or PADV (SEQ ID NO: 19).
- [N2] is or comprises YPAEV (SEQ ID NO: 1), YQAEV (SEQ ID NO: 6), YTAEV (SEQ ID NO: 4), YPAEE (SEQ ID NO: 5), TEAEV (SEQ ID NO: 12), or YPADV (SEQ ID NO: 13).
- [N2] is YPAEV (SEQ ID NO: 1).
- [N2]-[N3] comprises AEVVQK (SEQ ID NO: 36), AEEVQK (SEQ ID NO: 39), AEVVQN (SEQ ID NO: 591), or ADVVQK (SEQ ID NO: 593).
- [N2]-[N3] comprises PAEVVQN (SEQ ID NO: 594), QAEVVQK (SEQ ID NO: 52), TAEVVQK (SEQ ID NO: 49), PAEVVQK (SEQ ID NO: 20), PAEEVQK (SEQ ID NO: 51), EAEVVQK (SEQ ID NO: 595), or PADVVQK (SEQ ID NO: 596).
- [N2]- [N3] is or comprises YPAEVVQK (SEQ ID NO: 943), YQAEVVQK (SEQ ID NO: 951), YTAEVVQK (SEQ ID NO: 948), YPAEEVQK (SEQ ID NO: 950), YPAEVVQN (SEQ ID NO: 964), TEAEVVQK (SEQ ID NO: 965), or YPADVVQK (SEQ ID NO: 966); an amino acid sequence comprising any portion of any of the aforesaid amino acid sequences (e.g., any 2, 3, 4, 5, 6, or 7 amino acids, e.g., consecutive amino acids) thereof; an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the aforesaid amino acid sequences; or an amino acid sequence comprising one, two,
- [N2]-[N3] is YPAEVVQK (SEQ ID NO: 943).
- the AAV capsid variant comprising the amino acid sequence comprising the formula of [N2]-[N3], further comprises [N1], which comprises positions XD, XE, and X F .
- position X D of [N1] is Q or S.
- position X E of [N1] is S, L, A, or T.
- position X F of [N1] is S, Y, or T.
- [N1] comprises QS, SL, SA, QT, LS, LY, AT, TS, or SS.
- [N1] is or comprises QSS, SLS, SLY, SAT, or QTS.
- [N1] is QSS.
- [N1]-[N2] comprises SSYPA (SEQ ID NO: 63), LSYQA (SEQ ID NO: 597), LSYTA (SEQ ID NO: 598), LYYPA (SEQ ID NO: 600), ATYPA (SEQ ID NO: 601), LSYPA (SEQ ID NO: 603), or TSTEA (SEQ ID NO: 605).
- [N1]-[N2] comprises SSYPAE (SEQ ID NO: 79), LSYQAE (SEQ ID NO: 607), LSYTAE (SEQ ID NO: 610), LYYPAE (SEQ ID NO: 611), ATYPAE (SEQ ID NO: 613), LSYPAE (SEQ ID NO: 616), TSTEAE (SEQ ID NO: 619), or LSYPAD (SEQ ID NO: 621).
- [N1]-[N2] is or comprises QSSYPAEV (SEQ ID NO: 96), SLSYQAEV (SEQ ID NO: 622), SLSYTAEV (SEQ ID NO: 623), SLYYPAEV (SEQ ID NO: 624), SATYPAEV (SEQ ID NO: 625), SLSYPAEV (SEQ ID NO: 629), SLSYPAEE (SEQ ID NO: 632), QTSTEAEV (SEQ ID NO: 633), or SLSYPADV (SEQ ID NO: 634); an amino acid sequence comprising any portion of any of the aforesaid amino acid sequences (e.g., any 2, 3, 4, 5, 6, or 7 amino acids, e.g., consecutive amino acids) thereof; an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the aforesaid amino acid sequences;
- substitutions
- [N1]-[N2] is QSSYPAEV (SEQ ID NO: 96).
- [N1]-[N2]-[N3] is or comprises QSSYPAEVVQK (SEQ ID NO: 150), SLSYQAEVVQK (SEQ ID NO: 635), SLSYTAEVVQK (SEQ ID NO: 637), SLYYPAEVVQK (SEQ ID NO: 639), SATYPAEVVQK (SEQ ID NO: 641), SLSYPAEVVQK (SEQ ID NO: 642), SLSYPAEEVQK (SEQ ID NO: 643), SLSYPAEVVQN (SEQ ID NO: 644), QTSTEAEVVQK (SEQ ID NO: 645), or SLSYPADVVQK (SEQ ID NO: 646); an amino acid sequence comprising any portion of any of the aforesaid amino acid sequences (e.g., any 2, 3, 4, 5, 6, 7,
- [N1]-[N2]-[N3] is QSSYPAEVVQK (SEQ ID NO: 150).
- the AAV capsid variant comprising the amino acid sequence comprising the formula [N2]-[N3], further comprises [N0], wherein [N0] comprises positions X A , X B , and X C .
- position X A of [N0] is T.
- positions X B of [N0] is N.
- position X C of [N0] is N, T, S, or K.
- [N0] comprises TN, NS, NT, NN, or NK.
- [N0] is or comprises TNS, TNT, TNN, or TNK. In some embodiments, [N0] is TNN. In some embodiments, [N0]-[N1] is or comprises TNNQSS (SEQ ID NO: 183), TNSSLS (SEQ ID NO: 647), TNSSLY (SEQ ID NO: 648), TNTSAT (SEQ ID NO: 649), TNNQTS (SEQ ID NO: 650), or TNKSAT (SEQ ID NO: 651); an amino acid sequence comprising any portion of any of the aforesaid amino acid sequences (e.g., any 2, 3, 4, or 5 amino acids, e.g., consecutive amino acids) thereof; an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the aforesaid amino acid sequences; or an amino acid sequence comprising one, two, or three
- [N0]-[N1] is TNNQSS (SEQ ID NO: 183).
- [N0]-[N1]-[N2]-[N3] is or comprises TNNQSSYPAEVVQK (SEQ ID NO: 500), TNSSLSYQAEVVQK (SEQ ID NO: 652), TNSSLSYTAEVVQK (SEQ ID NO: 654), TNSSLYYPAEVVQK (SEQ ID NO: 655), TNTSATYPAEVVQK (SEQ ID NO: 656), TNSSLSYPAEVVQK (SEQ ID NO: 657), TNSSLSYPAEEVQK (SEQ ID NO: 658), TNSSLSYPAEVVQN (SEQ ID NO: 660), TNNQTSTEAEVVQK (SEQ ID NO: 662), TNKSATYPAEVVQK (SEQ ID NO: 663), or TNSSLSYPADVVQK (SEQ ID NO: 500),
- [N0]- [N1]-[N2]-[N3] is TNNQSSYPAEVVQK (SEQ ID NO: 500).
- the AAV capsid variant comprising the amino acid sequence comprising the formula [N2]-[N3], further comprises [N4], which comprises positions X G and X H .
- position X G of [N4] is T, P, or N.
- position X H of [N4] is A or D.
- [N4] is or comprises TA, TD, PA, or NA.
- [N4] is TA.
- [N3]-[N4] is or comprises VQKTA (SEQ ID NO: 564), EQKTA (SEQ ID NO: 565), VKKTA (SEQ ID NO: 566), VQKPA (SEQ ID NO: 567), VHKTA (SEQ ID NO: 568), VQQTA (SEQ ID NO: 569), VQKNA (SEQ ID NO: 570), or LQKTA (SEQ ID NO: 571); an amino acid sequence comprising any portion of any of the aforesaid amino acid sequences (e.g., any 2, 3, or 4 amino acids, e.g., consecutive amino acids) thereof; an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the aforesaid amino acid sequences; or an amino acid sequence comprising at least one, two, or three but no more than four different amino acids, relative to
- [N3]-[N4] is VQKTA (SEQ ID NO: 564).
- [N0]-[N1]-[N2]-[N3]-[N4] is or comprises TNNQSSYPAEVVQKTA (SEQ ID NO: 1533), TNSSLSYQAEVVQKTA (SEQ ID NO: 2064), TNSSLSYTAEVVQKTA (SEQ ID NO: 2065), TNSSLYYPAEVVQKTA (SEQ ID NO: 2066), TNTSATYPAEVVQKTA (SEQ ID NO: 2067), TNSSLSYPAEVVQKTA (SEQ ID NO: 2068), TNSSLSYPAEEVQKTA (SEQ ID NO: 2069), TNSSLSYPAEVVQKTD (SEQ ID NO: 2070), TNSSLSYPAEVVQNTA (SEQ ID NO: 2071), TNSSLSYPAEVVQKNA (SEQ ID NO:
- [N0]-[N1]-[N2]-[N3]-[N4] is TNNQSSYPAEVVQKT (SEQ ID NO: 737). [0130] In some embodiments, [N2]-[N3] is present in loop VIII of the AAV capsid variant. In some embodiments [N0], [N1], and/or [N4] are present in loop VIII of the AAV capsid variant. In some embodiments, [N0]-[N1]-[N2]-[N3]-[N4] is present in loop VIII of the AAV capsid variant.
- loop VIII comprises positions 571-592 numbered according to SEQ ID NO: 138, or positions 571-599, numbered according to SEQ ID NO: 982.
- [N0] is present immediately subsequent to position 570, numbered relative to SEQ ID NO: 138.
- [N0] replaces positions 571-573 (e.g., T571, N572, and N573), numbered relative to SEQ ID NO: 138.
- [N0] is present immediately subsequent to position 570, and [N0] replaces positions 571-573 (e.g., amino acids T571, N572, and N573), numbered relative to SEQ ID NO: 138.
- [N1] is present immediately subsequent to position 573, numbered relative to SEQ ID NO: 138. In some embodiments, [N1] replaces positions 574-576 (e.g., Q574, S575, and S576), numbered relative to SEQ ID NO: 138. In some embodiments, [N1] is present immediately subsequent to position 573, and [N1] replaces positions 574-576 (e.g., Q574, S575, and S576), numbered relative to SEQ ID NO: 138. In some embodiments, [N2] is present immediately subsequent to position 576, numbered relative to SEQ ID NO: 138.
- [N2] replaces position 577 (e.g., T577), numbered relative to SEQ ID NO: 138. In some embodiments, [N2] is present immediately subsequent to position 576, and [N2] replaces position 577 (e.g., T577), numbered relative to SEQ ID NO: 138. In some embodiments, [N2]-[N3] is present immediately subsequent to position 576, numbered relative to SEQ ID NO: 138. In some embodiments, [N2]-[N3] replaces position 577 (e.g., T577), numbered relative to SEQ ID NO: 138.
- [N2]-[N3] is present immediately subsequent to position 576, and [N2]-[N3] replaces position 577 (e.g., T577), numbered relative to SEQ ID NO: 138.
- [N2]-[N3]-[N4] is present immediately subsequent to position 576, numbered relative to SEQ ID NO: 138.
- [N2]-[N3]-[N4] replaces positions 577-579 (e.g., T577, T578, and A579), numbered relative to SEQ ID NO: 138.
- [N2]-[N3]-[N4] is present immediately subsequent to position 576, and [N2]-[N3]-[N4] replaces positions 577-579 (e.g., T577, T578, and A579), numbered relative to SEQ ID NO: 138.
- [N1]-[N2]-[N3]-[N4] is present immediately subsequent to position 573, numbered relative to SEQ ID NO: 138.
- [N1]-[N2]-[N3]-[N4] replaces positions 574-579 (e.g., Q574, S575, S576, T577, T578, and A579), numbered relative to SEQ ID NO: 138.
- [N1]-[N2]-[N3]-[N4] is present immediately subsequent to position 573, and [N1]-[N2]-[N3]-[N4] replaces positions 574-579 (e.g., Q574, S575, S576, T577, T578, and A579), numbered relative to SEQ ID NO: 138.
- [N0]-[N1]-[N2]-[N3]-[N4] is present immediately subsequent to position 570.
- [N0]-[N1]-[N2]-[N3]-[N4] replaces positions 571-579 (e.g., T571, N572, N573, Q574, S575, S576, T577, T578, and A579), numbered relative to SEQ ID NO: 138.
- [N0]-[N1]-[N2]-[N3]-[N4] is present immediately subsequent to position 570, and [N0]-[N1]-[N2]-[N3]-[N4] replaces positions 571-579 (e.g., T571, N572, N573, Q574, S575, S576, T577, T578, and A579), numbered relative to SEQ ID NO: 138.
- [N0]-[N1]-[N2]-[N3]-[N4] is present immediately subsequent to position 570, numbered relative to SEQ ID NO: 138, wherein [N2]-[N3] replaces position 577 (e.g., T577), numbered relative to SEQ ID NO: 138.
- the AAV capsid variant comprises an amino acid other than T at position 577, relative to a reference sequence numbered according to SEQ ID NO: 138.
- the AAV capsid variant comprises Y at position 577, relative to a reference sequence numbered according to SEQ ID NO: 138.
- X1 of [N2] is present at position 577 (e.g., T577), and positions X2 and X3 of [N2] are present immediately subsequent to position 577, relative to a reference sequence numbered according to SEQ ID NO: 138. In some embodiments, [N3] is present immediately subsequent to [N2]. [0133] In some embodiments, X A of [N0] is present at position 571, X B of [N0] is present at position 572, and X C of [N0] is present at position 573, numbered according to SEQ ID NO: 982.
- X D of [N1] is present at position 574
- X E of [N1] is present at position 575
- X F of [N1] is present at position 576, numbered according to SEQ ID NO: 982.
- X1 of [N2] is present at position 577
- X2 of [N2] is present at position 578
- X3 of [N2] is present at position 579
- X4 of [N2] is present at position 580
- of X5 of [N2] is present at position 581, numbered according to SEQ ID NO: 982.
- [N3] is present at positions 582-584, numbered according to SEQ ID NO: 982.
- X G of [N4] is present at position 585 and X H of [N4] is present at position 586, numbered according to SEQ ID NO: 982.
- [N0] is present at positions 571-573, numbered according to SEQ ID NO: 982.
- [N1] is present at positions 574-576, numbered according to SEQ ID NO: 982.
- [N2] is present at positions 577-581, numbered according to SEQ ID NO: 982.
- [N3] is present at positions 582-584, numbered according to SEQ ID NO: 982.
- [N4] is present at positions 585-586, numbered according to SEQ ID NO: 982. In some embodiments, [N2]-[N3] is present at positions 577-584, numbered according to SEQ ID NO: 982. In some embodiments, [N0]-[N1]-[N2]-[N3]- [N4] is present at positions 571-586, numbered according to SEQ ID NO: 982. [0135] In some embodiments, [N1] is present immediately subsequent to [N0]. In some embodiments, [N2] is present immediately subsequent to [N1]. In some embodiments, [N3] is present immediately subsequent to [N2]. In some embodiments, [N4] is present immediately subsequent to [N3].
- the AAV capsid variant comprises from N-terminus to C-terminus, [N2]-[N3]. In some embodiments, the AAV capsid variant comprises from N-terminus to C-terminus, [N1]-[N2]-[N3]. In some embodiments, the AAV capsid variant comprises from N-terminus to C- terminus, [N1]-[N2]-[N3]-[N4]. In some embodiments, the AAV capsid variant comprises from N- terminus to C-terminus, [N0]-[N1]-[N2]-[N3].
- the AAV capsid variant comprises from N-terminus to C-terminus, [N0]-[N1]-[N2]-[N3]-[N4]. [0137]
- [N2]-[N3] is YPAEVVQK (SEQ ID NO: 943), wherein YPAEVVQK (SEQ ID NO: 943) replaces position 577, numbered relative to SEQ ID NO: 138.
- [N0]-[N1]-[N2]-[N3]-[N4] is TNNQSSYPAEVVQKTA (SEQ ID NO: 1533) and is present immediately subsequent to position 570, numbered relative to SEQ ID NO: 138, wherein [N2]-[N3] (YPAEVVQK (SEQ ID NO: 943)) replaces position 577 (e.g., replaces T577) numbered relative to SEQ ID NO: 138.
- [N2]-[N3] is YPAEVVQK, wherein [N2]-[N3] is present at positions 577-584, numbered according to SEQ ID NO: 982.
- an AAV capsid variant described herein comprises an amino acid sequence having the formula [B]-[C], wherein [B] comprises positions X1, X2, and X3, and [C] comprises the amino acid sequence YPAEVVQK (SEQ ID NO: 943).
- position X1 of [B] is Q, T, S, A, I, L, or H.
- position X1 of [B] is Q, T, S, A, or H.
- position X2 of [B] is S, G, or A.
- position X2 of [B] is S or G.
- position X3 of [B] is S, K, L, R, or A. In some embodiments, position X3 of [B] is S, K, L, or R. In some embodiments, [B] comprises Q at position X1. In some embodiments, [B] comprises S at position X2. In some embodiments, [B] comprises S at position X3. In some embodiments, [B] comprises QS, TS, SS, AG, IG, QA, AS, LG, HS, SK, SL, SR, GA, or GS. In some embodiments, [B] is or comprises QSS, TSL, SSS, QSR, QSK, AGA, IGS, QAS, ASS, LGS, or HSS.
- [B] is QSS.
- [B]-[C] comprises SSYPAEVVQK (SEQ ID NO: 572), SKYPAEVVQK (SEQ ID NO: 573), SLYPAEVVQK (SEQ ID NO: 574), SRYPAEVVQK (SEQ ID NO: 575), GAYPAEVVQK (SEQ ID NO: 576), GSYPAEVVQK (SEQ ID NO: 580), or ASYPAEVVQK (SEQ ID NO: 582).
- [B]-[C] is or comprises QSSYPAEVVQK (SEQ ID NO: 150), QSKYPAEVVQK (SEQ ID NO: 151), TSLYPAEVVQK (SEQ ID NO: 152), SSSYPAEVVQK (SEQ ID NO: 153), QSRYPAEVVQK (SEQ ID NO: 154), AGAYPAEVVQK (SEQ ID NO: 156), IGSYPAEVVQK (SEQ ID NO: 157), QASYPAEVVQK (SEQ ID NO: 158), ASSYPAEVVQK (SEQ ID NO: 159), LGSYPAEVVQK (SEQ ID NO: 160), or HSSYPAEVVQK (SEQ ID NO: 162); an amino acid sequence comprising any portion of any of the aforesaid amino acid sequences (e.g., any 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids, e.g., consecutive amino acids) thereof; an amino acid sequence compris
- [B]-[C] is QSSYPAEVVQK (SEQ ID NO: 150).
- an AAV capsid variant comprising the formula [B]-[C] further comprises [A], which comprises positions X A , X B , and X C .
- position X A of [A] is T, I, or N.
- position X B of [A] is N.
- position X C of [A] is N, T, S, or K.
- [A] comprises TN, IN, NN, NT, NS, or NK.
- [A] is or comprises TNN, TNT, INN, NNN, TNS, or TNK. In some embodiments, [A] is TNN. In some embodiments, [A]-[B] is or comprises TNNQSS (SEQ ID NO: 183), TNNQSK (SEQ ID NO: 184), TNNTSL (SEQ ID NO: 185), TNNSSS (SEQ ID NO: 186), TNNQSR (SEQ ID NO: 187), TNNAGA (SEQ ID NO: 188), TNNIGS (SEQ ID NO: 189), TNNQAS (SEQ ID NO: 190), TNTASS (SEQ ID NO: 191), TNNLGS (SEQ ID NO: 192), TNNHSS (SEQ ID NO: 194), INNQSS (SEQ ID NO: 196), NNNQSR (SEQ ID NO: 198), TNSTSL (SEQ ID NO: 199), or TNKQAS (SEQ ID NO: 201); an amino acids, SEQ
- [A]- [B] is TNNQSS (SEQ ID NO: 183).
- [A]-[B]-[C] is or comprises TNNQSSYPAEVVQK (SEQ ID NO: 500), TNNQSKYPAEVVQK (SEQ ID NO: 503), TNNTSLYPAEVVQK (SEQ ID NO: 506), TNNSSSYPAEVVQK (SEQ ID NO: 508), TNNQSRYPAEVVQK (SEQ ID NO: 510), TNNAGAYPAEVVQK (SEQ ID NO: 513), TNNIGSYPAEVVQK (SEQ ID NO: 514), TNNQASYPAEVVQK (SEQ ID NO: 517), TNTASSYPAEVVQK (SEQ ID NO: 520), TNNLGSYPAEVVQK (SEQ ID NO: 523), TNNHSSYPAEVVQK (SEQ ID NO: 525), INNQSS (SEQ ID NO: 500
- [A]-[B]-[C] is TNNQSSYPAEVVQK (SEQ ID NO: 500).
- an AAV capsid variant comprising the formula [B]-[C], further comprises [D], wherein [D] comprises position X4 and X5.
- position X4 of [D] is T or N.
- position X5 of [D] is A.
- [D] is or comprises TA or PA.
- [D] is TA.
- [C]-[D] is or comprises YPAEVVQKTA (SEQ ID NO: 584) or YPAEVVQKPA (SEQ ID NO: 586); an amino acid sequence comprising any portion of any of the aforesaid amino acid sequences (e.g., any 2, 3, 4, 5, 6, 7, 8, or 9 amino acids, e.g., consecutive amino acids) thereof; an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the aforesaid amino acid sequences; or an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to any one of the aforesaid amino acid sequences.
- substitutions e.g., conservative substitutions
- [C]-[D] is YPAEVVQKTA (SEQ ID NO: 584).
- [A]-[B]-[C]-[D] is or comprises TNNQSSYPAEVVQKTA (SEQ ID NO: 1533), TNNQSKYPAEVVQKTA (SEQ ID NO: 1538), TNNTSLYPAEVVQKTA (SEQ ID NO: 1232), TNNSSSYPAEVVQKTA (SEQ ID NO: 1539), TNNQSRYPAEVVQKTA (SEQ ID NO: 1327), TNNAGAYPAEVVQKTA (SEQ ID NO: 1021), TNNIGSYPAEVVQKTA (SEQ ID NO: 1112), TNNQASYPAEVVQKTA (SEQ ID NO: 1194), TNTASSYPAEVVQKTA (SEQ ID NO: 1575), TNNLGSYPAEVVQKTA (SEQ ID NO: 1027), TNNHSS
- [A]-[B]-[C]-[D] is TNNQSSYPAEVVQKTA (SEQ ID NO: 1533).
- an AAV capsid variant described herein comprises an amino acid sequence having the formula [B]-[C], wherein [B] comprises positions X1, X2, and X3, and [C] comprises the amino acid sequence YPAEVVQK (SEQ ID NO: 943).
- position X1 of [B] is Q or S.
- position X2 of [B] is S, L, or A.
- position X3 of [B] is S, Y, or T.
- [B] comprises Q at position X1. In some embodiments, [B] comprises S at position X2. In some embodiments, [B] comprises S at position X3. In some embodiments, [B] comprises QS, SL, SA, LY, AT, LS, or SS. In some embodiments, [B] is or comprises QSS, SLY, SAT, or SLS. In some embodiments, [B] is QSS. In some embodiments, [B]- [C] comprises SSYPAEVVQK (SEQ ID NO: 572), LYYPAEVVQK (SEQ ID NO: 702), ATYPAEVVQK (SEQ ID NO: 718), or LSYPAEVVQK (SEQ ID NO: 703).
- [B]-[C] is or comprises QSSYPAEVVQK (SEQ ID NO: 150), SLYYPAEVVQK (SEQ ID NO: 639), SATYPAEVVQK (SEQ ID NO: 641), or SLSYPAEVVQK (SEQ ID NO: 642); an amino acid sequence comprising any portion of any of the aforesaid amino acid sequences (e.g., any 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids, e.g., consecutive amino acids) thereof; an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the aforesaid amino acid sequences; or an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to any one of the aforesaid amino acid sequences.
- amino acid sequence comprising any portion of any of the aforesaid amino acid sequences
- an AAV capsid variant comprising the formula [B]-[C], further comprises [A], which comprises positions X A , X B , and X C .
- position X A of [A] is T.
- position X B of [A] is N.
- position X C of [A] is N, T, S, or K.
- [A] comprises TN, NS, NT, NK, or NN.
- [A] is or comprises TNN, TNS, TNT, or TNK.
- [A] is TNN.
- [A]-[B] is or comprises TNNQSS (SEQ ID NO: 183), TNSSLY (SEQ ID NO: 648), TNTSAT (SEQ ID NO: 649), TNSSLS (SEQ ID NO: 647), or TNKSAT (SEQ ID NO: 651); an amino acid sequence comprising any portion of any of the aforesaid amino acid sequences (e.g., any 2, 3, 4, or 5 amino acids, e.g., consecutive amino acids) thereof; an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the aforesaid amino acid sequences; or an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to any one of the aforesaid amino acid sequences.
- TNNQSS SEQ ID NO: 183
- TNSSLY SEQ ID
- [A]-[B] is TNNQSS (SEQ ID NO: 183).
- [A]-[B]-[C] is or comprises TNNQSSYPAEVVQK (SEQ ID NO: 500), TNSSLYYPAEVVQK (SEQ ID NO: 655), TNTSATYPAEVVQK (SEQ ID NO: 656), TNSSLSYPAEVVQK (SEQ ID NO: 657), or TNKSATYPAEVVQK (SEQ ID NO: 663); an amino acid sequence comprising any portion of any of the aforesaid amino acid sequences (e.g., any 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 amino acids, e.g., consecutive amino acids) thereof; an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the aforesaid amino acid sequences
- [A]- [B]-[C] is TNNQSSYPAEVVQK (SEQ ID NO: 500).
- an AAV capsid variant comprising the formula [B]-[C], further comprises [D], wherein [D] comprises position X4 and X5.
- position X4 of [D] is T, N, or P.
- position X5 of [D] is A or D.
- [D] is or comprises TA, TD, NA, or PA.
- [D] is TA.
- [C]-[D] is or comprises YPAEVVQKTA (SEQ ID NO: 584), YPAEVVQKTD (SEQ ID NO: 719), YPAEVVQKNA (SEQ ID NO: 724), or YPAEVVQKPA (SEQ ID NO: 586); an amino acid sequence comprising any portion of any of the aforesaid amino acid sequences (e.g., any 2, 3, 4, 5, 6, 7, 8, or 9 amino acids, e.g., consecutive amino acids) thereof; an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the aforesaid amino acid sequences; or an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to any one of the aforesaid amino acid sequences.
- amino acid sequence comprising any portion of any of the aforesaid amino acid sequence
- [C]-[D] is YPAEVVQKTA (SEQ ID NO: 584).
- [A]-[B]-[C]-[D] is or comprises TNNQSSYPAEVVQKTA (SEQ ID NO: 1533), TNSSLYYPAEVVQKTA (SEQ ID NO: 2066), TNTSATYPAEVVQKTA (SEQ ID NO: 2067), TNSSLSYPAEVVQKTA (SEQ ID NO: 2068), TNSSLSYPAEVVQKTD (SEQ ID NO: 2070), TNSSLSYPAEVVQKNA (SEQ ID NO: 2072), TNSSLSYPAEVVQKPA (SEQ ID NO: 2073), or TNKSATYPAEVVQKTA (SEQ ID NO: 2075); an amino acid sequence comprising any portion of any of the aforesaid amino acid sequences (e.g., any 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, or 15
- [A]-[B]-[C]-[D] is TNNQSSYPAEVVQKTA (SEQ ID NO: 1533). [0144] In some embodiments, [B]-[C] is present in loop VIII of the AAV capsid variant. In some embodiments, [A] and/or [D] is present in loop VIII of the AAV capsid variant. In some embodiments, [A]-[B]-[C]-[D] is present in loop VIII of the AAV capsid variant. In some embodiments, loop VIII comprises positions 571-592 numbered according to SEQ ID NO: 138. In some embodiments, loop VIII comprises positions 571-599, numbered according to SEQ ID NO: 982.
- [A] is present immediately subsequent to position 570, numbered relative to SEQ ID NO: 138. In any of these embodiments, [A] replaces positions 571-573 (e.g., T571, N572, and N573) numbered relative to SEQ ID NO: 138. In some embodiments, [A] is present immediately subsequent to position 570, and [A] replaces positions 571-573 (e.g., T571, N572, and N573) numbered relative to SEQ ID NO: 138. In some embodiments, [B] is present immediately subsequent to position 573, relative to a reference sequence numbered according to SEQ ID NO: 138.
- [B] replaces positions 574-576 (e.g., Q574, S575, and S576), relative to a reference sequence numbered according to SEQ ID NO: 138. In some embodiments, [B] is present immediately subsequent to position 573, and [B] replaces positions 574-576 (e.g., Q574, S575, and S576), relative to a reference sequence numbered according to SEQ ID NO: 138. In some embodiments, [C] is present immediately subsequent to position 576, relative to a reference sequence numbered according to SEQ ID NO: 138. In some embodiments, [C] replaces position 577 (e.g., T577), relative to a reference sequence numbered according to SEQ ID NO: 138.
- position 577 e.g., T577
- [C] is present immediately subsequent to position 576, wherein [C] replaces position 577 (e.g., T577), relative to a reference sequence numbered according to SEQ ID NO: 138.
- [B]-[C] is present immediately subsequent to position 573, relative to a reference sequence numbered according to SEQ ID NO: 138.
- [B]-[C] replaces positions 574-577 (e.g., Q574, S575, S576, and T577), relative to a reference sequence numbered according to SEQ ID NO: 138.
- [B]-[C] is present immediately subsequent to position 573, and [B]-[C] replaces positions 574-577 (e.g., Q574, S575, S576, and T577), relative to a reference sequence numbered according to SEQ ID NO: 138.
- [C]-[D] is present immediately subsequent to position 576, relative to a reference sequence numbered according to SEQ ID NO: 138.
- [C]-[D] replaces positions 577-579 (e.g., T577, T578, and A579), relative to a reference sequence numbered according to SEQ ID NO: 138.
- [C]-[D] is present immediately subsequent to position 576, and [C]-[D] replaces positions 577-579 (e.g., T577, T578, and A579), relative to a reference sequence numbered according to SEQ ID NO: 138.
- [B]-[C]-[D] is present immediately subsequent to position 573, numbered relative to SEQ ID NO: 138.
- [B]-[C]-[D] replaces positions 574-579 (e.g., Q574, S575, S576, T577, T578, and A579), numbered relative to SEQ ID NO: 138.
- [B]-[C]-[D] is present immediately subsequent to position 573, and [B]-[C]-[D] replaces positions 574-579 (e.g., Q574, S575, S576, T577, T578, and A579), numbered relative to SEQ ID NO: 138.
- [A]-[B]-[C]-[D] is present immediately subsequent to position 570, numbered relative to SEQ ID NO: 138.
- [A]-[B]- [C]-[D] replaces positions 571-579 (e.g., T571, N572, N573, Q574, S575, S576, T577, T578, and A579), numbered relative to SEQ ID NO: 138.
- [A]-[B]-[C]-[D] is present immediately subsequent to position 570, and [A]-[B]-[C]-[D] replaces positions 571-579 (e.g., T571, N572, N573, Q574, S575, S576, T577, T578, and A579), numbered relative to SEQ ID NO: 138.
- X A of [A] is present at position 571
- X B of [A] is present at position 572
- X C of [A] is present at position 573, numbered according to SEQ ID NO: 982.
- X1 of [B] is present at position 574
- X2 of [B] is present at position 575
- X3 of [B] is present at position 576, numbered according to SEQ ID NO: 982.
- [C] is present at positions 577-584, numbered according to SEQ ID NO: 982.
- X4 of [D] is present at position 585 and position X5 of [D] is present at position 586, numbered according to SEQ ID NO: 982.
- [A] is present at positions 571-573, numbered according to SEQ ID NO: 982.
- [B] is present at positions 574-576, numbered according to SEQ ID NO: 982.
- [C] is present at positions 577-584, numbered according to SEQ ID NO: 982.
- [D] is present at positions 585-586, numbered according to SEQ ID NO: 982.
- [A]-[B]-[C]-[D] is present at positions 571-586, numbered according to SEQ ID NO: 982. [0148] In some embodiments, [B] is present immediately subsequent to [A]. In some embodiments, [C] is present immediately subsequent to [B]. In some embodiments, [D] is present immediately subsequent to [C]. In some embodiments, the AAV capsid variant comprises from N- terminus to C-terminus, [B]-[C]. In some embodiments, the AAV capsid variant comprises from N- terminus to C-terminus, [A]-[B]-[C].
- the AAV capsid variant comprises from N-terminus to C-terminus, [B]-[C]-[D]. In some embodiments, the AAV capsid variant comprises from N-terminus to C-terminus, [A]-[B]-[C]-[D]. [0149] In some embodiments, [C] is YPAEVVQK (SEQ ID NO: 943), wherein YPAEVVQK (SEQ ID NO: 943) replaces position 577 (e.g., T577), numbered relative to SEQ ID NO: 138.
- [A]-[B]-[C]-[D] is TNNQSSYPAEVVQKTA (SEQ ID NO: 1533) and is present immediately subsequent to position 570, numbered relative to SEQ ID NO: 138, wherein [C] (YPAEVVQK (SEQ ID NO: 943)) replaces position 577 (e.g., replaces T577) numbered relative to SEQ ID NO: 138.
- [C] is YPAEVVQK, wherein [C] is present at positions 577- 584, numbered according to SEQ ID NO: 982.
- an AAV capsid variant described herein comprises the formula [K1]-[K2], wherein, [K1] comprises LSY or LYY, and [K2] comprises positions X1, X2, X3, and X4.
- [K1] comprises LSY.
- position X1 of [K2] is Q, T or P.
- position X2 of [K2] is A, in some embodiments, position X3 of [K2] is E or D.
- position X4 of [K2] is V or E.
- [K2] comprises QA, TA, PA, EV, EE, DV, AE, or AD.
- [K2] comprises QAE, TAE, PAE, PAD, AEV, AEE, or ADV.
- [K2] is or comprises QAEV (SEQ ID NO: 15), TAEV (SEQ ID NO: 16), PAEV (SEQ ID NO: 17), PAEE (SEQ ID NO: 18), or PADV (SEQ ID NO: 19).
- [K1]-[K2] comprises LSYQA (SEQ ID NO: 597), LSYTA (SEQ ID NO: 598), LYYPA (SEQ ID NO: 600), or LSYPA (SEQ ID NO: 603).
- [K1]-[K2] comprises LSYQAE (SEQ ID NO: 607), LSYTAE (SEQ ID NO: 610), LYYPAE (SEQ ID NO: 611), LSYPAE (SEQ ID NO: 616), or LSYPAD (SEQ ID NO: 621).
- [K1]-[K2] is or comprises LSYQAEV (SEQ ID NO: 667), LSYTAEV (SEQ ID NO: 668), LYYPAEV (SEQ ID NO: 669), LSYPAEV (SEQ ID NO: 671), LSYPAEE (SEQ ID NO: 673), or LSYPADV (SEQ ID NO: 674); an amino acid sequence comprising any portion of any of the aforesaid amino acid sequences (e.g., any 2, 3, 4, 5, or 6 amino acids, e.g., consecutive amino acids) thereof; an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the aforesaid amino acid sequences; or an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to any one of the aforesaid amino acid sequences.
- [K0]-[K1] comprises TNSSLS (SEQ ID NO: 647) or TNSSLY (SEQ ID NO: 648).
- [K0]-[K1] is or comprises TNSSLSY (SEQ ID NO: 676) or TNSSLYY (SEQ ID NO: 678); an amino acid sequence comprising any portion of any of the aforesaid amino acid sequences (e.g., any 2, 3, 4, 5, or 6 amino acids, e.g., consecutive amino acids) thereof; an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the aforesaid amino acid sequences; or an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to any one of the aforesaid amino acid sequences.
- substitutions e.g., conservative substitutions
- [K0]-[K1]-[K2] comprises TNSSLSYQA (SEQ ID NO: 679), TNSSLSYTA (SEQ ID NO: 681), TNSSLYYPA (SEQ ID NO: 682), or TNSSLSYPA (SEQ ID NO: 683).
- [K0]-[K1]-[K2] comprises TNSSLSYQAE (SEQ ID NO: 684), TNSSLSYTAE (SEQ ID NO: 685), TNSSLYYPAE (SEQ ID NO: 686), TNSSLSYPAE (SEQ ID NO: 687), or TNSSLSYPAD (SEQ ID NO: 689).
- [K0]-[K1]-[K2] is or comprises TNSSLSYQAEV (SEQ ID NO: 692), TNSSLSYTAEV (SEQ ID NO: 693), TNSSLYYPAEV (SEQ ID NO: 696), TNSSLSYPAEV (SEQ ID NO: 697), TNSSLSYPAEE (SEQ ID NO: 698), or TNSSLSYPADV (SEQ ID NO: 699); an amino acid sequence comprising any portion of any of the aforesaid amino acid sequences (e.g., any 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids, e.g., consecutive amino acids) thereof; an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the aforesaid amino acid sequences; or an amino acid sequence comprising one, two, or three but no more than four different amino acids
- AAV capsid variant comprising the amino acid sequence comprising the formula of [K1]-[K2], further comprises [K3], wherein [K3] comprises positions X A , X B , and X C .
- position X A of [K3] is V.
- position X B of [K3] is Q.
- position X C of [K3] is K or N.
- [K3] comprises VQ, QK, or QN.
- [K3] is or comprises VQK or VQN.
- K2]-[K3] is or comprises QAEVVQK (SEQ ID NO: 52), TAEVVQK (SEQ ID NO: 49), PAEVVQK (SEQ ID NO: 20), PAEEVQK (SEQ ID NO: 51) ,PAEVVQN (SEQ ID NO: 594), or PADVVQK (SEQ ID NO: 596); an amino acid sequence comprising any portion of any of the aforesaid amino acid sequences (e.g., any 2, 3, 4, 5, or 6 amino acids, e.g., consecutive amino acids) thereof; an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the aforesaid amino acid sequences; or an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to any one of the aforesaid amino acid sequences.
- amino acid sequence comprising any
- [K1]-[K2]-[K3] is or comprises LSYQAEVVQK (SEQ ID NO: 700), LSYTAEVVQK (SEQ ID NO: 701), LYYPAEVVQK (SEQ ID NO: 702), LSYPAEVVQK (SEQ ID NO: 703), LSYPAEEVQK (SEQ ID NO: 704), LSYPAEVVQN (SEQ ID NO: 706), or LSYPADVVQK (SEQ ID NO: 708); an amino acid sequence comprising any portion of any of the aforesaid amino acid sequences (e.g., any 2, 3, 4, 5, 6, 7, 8, or 9 amino acids, e.g., consecutive amino acids) thereof; an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the aforesaid amino acid sequences;
- [K0]-[K1]-[K2]-[K3] is or comprises TNSSLSYQAEVVQK (SEQ ID NO: 652), TNSSLSYTAEVVQK (SEQ ID NO: 654), TNSSLYYPAEVVQK (SEQ ID NO: 655), TNSSLSYPAEVVQK (SEQ ID NO: 657), TNSSLSYPAEEVQK (SEQ ID NO: 658), TNSSLSYPAEVVQN (SEQ ID NO: 660), or TNSSLSYPADVVQK (SEQ ID NO: 665); an amino acid sequence comprising any portion of any of the aforesaid amino acid sequences (e.g., any 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 amino acids, e.g., consecutive amino acids) thereof; an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions),
- position X D of [K4] is T, P, or N.
- position X E of [K4] is A or D.
- [K4] is or comprises TA, TD, PA, or NA.
- [K3]-[K4] is or comprises VQKTA (SEQ ID NO: 564), VQKTD (SEQ ID NO: 714), VQNTA (SEQ ID NO: 715), VQKNA (SEQ ID NO: 570), or VQKPA (SEQ ID NO: 567); an amino acid sequence comprising any portion of any of the aforesaid amino acid sequences (e.g., any 2, 3, or 4 amino acids, e.g., consecutive amino acids) thereof; an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the aforesaid amino acid sequences; or an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to any one of the aforesaid amino acid sequences.
- VQKTA SEQ ID NO: 564
- VQKTD SEQ ID NO: 714
- [K0]-[K1]-[K2]-[K3]-[K4] is or comprises TNSSLSYQAEVVQKTA (SEQ ID NO: 2064), TNSSLSYTAEVVQKTA (SEQ ID NO: 2065), TNSSLYYPAEVVQKTA (SEQ ID NO: 2066), TNSSLSYPAEVVQKTA (SEQ ID NO: 2068), TNSSLSYPAEEVQKTA (SEQ ID NO: 2069), TNSSLSYPAEVVQKTD (SEQ ID NO: 2070), TNSSLSYPAEVVQNTA (SEQ ID NO: 2071), TNSSLSYPAEVVQKNA (SEQ ID NO: 2072), TNSSLSYPAEVVQKPA (SEQ ID NO: 2073), or TNSSLSYPADVVQKTA (SEQ ID NO: 2076); an amino acid sequence comprising any portion of any of the aforesaid amino acid sequences
- [K1]-[K2] is present in loop VIII of the AAV capsid variant.
- [K0], [K3], and/or [K4] are present in loop VIII of the AAV capsid variant.
- [K0]-[K1]-[K2]-[K3]-[K4] is present in loop VIII of the AAV capsid variant.
- loop VIII comprises positions 571-592 numbered according to SEQ ID NO: 138.
- loop VIII comprises positions 571-599, numbered according to SEQ ID NO: 982.
- [K0] is present immediately subsequent to position 570, numbered relative to SEQ ID NO: 138.
- [K0] replaces positions 571-574 (e.g., T571, N572, N573, and Q574), numbered relative to SEQ ID NO: 138.
- [K0] is present immediately subsequent to position 570, and [K0] replaces positions 571-574 (e.g., T571, N572, N573, and Q574), numbered relative to SEQ ID NO: 138.
- [K1] is present immediately subsequent to position 574, numbered relative to SEQ ID NO: 138.
- [K1] replaces positions 575-577 (e.g., S575, S576, and T577), sequence relative to SEQ ID NO: 138. In some embodiments, [K1] is present immediately subsequent to position 574, wherein [K1] replaces positions 575-577 (e.g., S575, S576, and T577), numbered relative to SEQ ID NO: 138. In some embodiments, [K1]-[K2]-[K3] is present immediately subsequent to position 574, numbered relative to SEQ ID NO: 138.
- [K1]-[K2]-[K3] replaces positions 575-577 (e.g., S575, S576, and T577), numbered relative to SEQ ID NO: 138.
- [K1]-[K2]-[K3] is present immediately subsequent to position 574, wherein [K1]-[K2]-[K3] replaces positions 575-577 (e.g., S575, S576, and T577), numbered relative to SEQ ID NO: 138.
- [K1]-[K2]-[K3]-[K4] is present immediately subsequent to position 574, numbered relative to SEQ ID NO: 138.
- [K1]-[K2]-[K3]-[K4] replaces positions 575- 579 (e.g., S575, S576, T577, T578, and A579), numbered relative to SEQ ID NO: 138.
- [K1]-[K2]-[K3]-[K4] is present immediately subsequent to position 574, wherein [K1]- [K2]-[K3]-[K4] replaces positions 575-579 (e.g., S575, S576, T577, T578, and A579), numbered relative to SEQ ID NO: 138.
- [K0]-[K1]-[K2]-[K3]-[K4] is present immediately subsequent to position 570, numbered relative to SEQ ID NO 138.
- [K0]-[K1]-[K2]-[K3]-[K4] replaces positions 571-579 (e.g., T571, N572, N573, Q574, S575, S576, T577, T578, and T579), numbered relative to SEQ ID NO 138.
- [K0]-[K1]-[K2]-[K3]-[K4] is present immediately subsequent to position 570, and [K0]-[K1]-[K2]- [K3]-[K4] replaces positions 571-579 (e.g., T571, N572, N573, Q574, S575, S576, T577, T578, and T579), numbered relative to SEQ ID NO 138.
- AAV capsid variant comprises from N-terminus to C-terminus, [K1]-[K2]. In some embodiments, the AAV capsid variant comprises from N-terminus to C-terminus, [K0]-[K1]-[K2].
- the AAV capsid variant comprises from N-terminus to C- terminus, [K1]-[K2]-[K3]. In some embodiments, the AAV capsid variant comprises from N- terminus to C-terminus, [K0]-[K1]-[K2]-[K3]. In some embodiments, the AAV capsid variant comprises from N-terminus to C-terminus, [K1]-[K2]-[K3]-[K4]. In some embodiments, the AAV capsid variant comprises from N-terminus to C-terminus, [K0]-[K1]-[K2]-[K3]-[K4].
- an AAV capsid variant described herein comprises an amino acid sequence comprising at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 consecutive amino acids from any one of the sequences provided in Tables 1, 2A, 2B, 9, and 15-20.
- the AAV capsid variant comprises an amino acid sequence comprising at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 consecutive amino acids from any one of SEQ ID NOs: 943, 1021, 1024, 1027, 1112, 1142, 1214, 1232, 1254, 1300, 1310, 1327, 1331, 1342, 1419, 1453, 1533, 1538, 1539, 1575, 1578, 1583- 1587, 1590, 1591-1593, 1598-1608, or 1610-1624.
- the AAV capsid variant comprises an amino acid sequence comprising at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 consecutive amino acids from any one of SEQ ID NOs: 943 or 2064-2080.
- the AAV capsid variant comprises at least 3, 4, 5, 6, or 7 consecutive amino acids from any one of SEQ ID NOs: 943 or 946-966.
- the amino acid sequence is present in loop VIII.
- the amino acid sequence is present immediately subsequent to position 570, 571, 572, 573, 574, 575, or 576, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138.
- the 3 consecutive amino acids comprise YPA.
- the 4 consecutive amino acids comprise YPAE (SEQ ID NO: 21).
- the 5 consecutive amino acids comprise YPAEV (SEQ ID NO: 1).
- the 6 consecutive amino acids comprise YPAEVV (SEQ ID NO: 725). In some embodiments, the 7 consecutive amino acids comprise YPAEVVQ (SEQ ID NO: 726). In some embodiments, the amino acid sequence comprises YPAEVVQK (SEQ ID NO: 943). In some embodiments, the amino acid sequence consists of YPAEVVQK (SEQ ID NO: 943).
- an AAV capsid variant described herein comprises an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to the amino acid sequence of any one of the sequences provided in Tables 1, 2A, 2B, 9, and 15-20.
- the AAV capsid variant comprises an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to the amino acid sequence of any one of the sequences provided in Tables 1, 2A, 2B, 9, and 15-20.
- the AAV capsid variant comprises an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to the amino acid sequence of any one of SEQ ID NOs: 943, 1021, 1024, 1027, 1112, 1142, 1214, 1232, 1254, 1300, 1310, 1327, 1331, 1342, 1419, 1453, 1533, 1538, 1539, 1575, 1578, 1583- 1587, 1590, 1591-1593, 1598-1608, or 1610- 1624.
- substitutions e.g., conservative substitutions
- the AAV capsid variant comprises an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to the amino acid sequence of any one of SEQ ID NOs: 943, 1021, 1024, 1027, 1112, 1142, 1214, 1232, 1254, 1300, 1310, 1327, 1331, 1342, 1419, 1453, 1533, 1538, 1539, 1575, 1578, 1583- 1587, 1590, 1591-1593, 1598-1608, or 1610-1624.
- the AAV capsid variant comprises an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to the amino acid sequence of any one of SEQ ID NOs: 943 or 2064-2080.
- the AAV capsid variant comprises an amino acid sequence comprising one, two, or three but no more than four different amino acids relative to the amino acid sequence of any one of SEQ ID NOs: 943 or 2064-2080.
- the amino acid sequence is present in loop VIII.
- loop VIII comprises positions 571-592 numbered according to SEQ ID NO: 138.
- loop VIII comprises positions 571-599, numbered according to SEQ ID NO: 982.
- the amino acid sequence is present immediately subsequent to position 570, 571, 572, 573, 574, 575, or 576, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138.
- the amino acid sequence replaces position 577 (e.g., T577), relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138.
- the AAV capsid variant comprises an amino acid sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to the amino acid sequence of YPAEVVQK (SEQ ID NO: 943).
- the AAV capsid variant comprises an amino acid sequence comprising one, two, or three, but no more than four different amino acids that relative to the amino acid sequence of YPAEVVQK (SEQ ID NO: 943).
- the AAV capsid variant comprises an amino sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to the amino acid sequence of any one of SEQ ID NOs: 2024-2063.
- the AAV capsid variant comprises an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to the amino acid sequence of any one of SEQ ID NOs: 2024-2063.
- the different amino acids of the amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to the amino acid sequence of any one of SEQ ID NOs: 2024-2063, are present at one or more of the following positions: (i) position 1, wherein the different amino acid is T or L; (ii) position 2, wherein the different amino acid is N, L, K, A, T, or P; (iii) position 3, wherein the different amino acid N, K, L, A, Y, or S; (iv) position 4, wherein the different amino acid is Q, L, T, S, F, Y, K, or A; (v) position 5, wherein the different amino acid is S, H, A, M, Q, T, V, or F; (vi) position 6, wherein the different amino acid is S, P, V, A, Q, L, T, N, or M; (vii) position 7, wherein the different amino acid is Y, H, S, V, A, L, or T; (viii)
- the amino acid sequence is present in loop VIII. In some embodiments, the amino acid sequence is present immediately subsequent to position 570, 571, 572, 573, 574, 575, or 576, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138.
- the AAV capsid variant comprises an amino sequence comprising one, two, or three but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to the amino acid sequence of any one of SEQ ID NOs: 1632-2023.
- the AAV capsid variant comprises an amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to the amino acid sequence of any one of SEQ ID NOs: 1632-2023.
- the different amino acids of the amino acid sequence comprising one, two, or three but no more than four different amino acids, relative to the amino acid sequence of any one of SEQ ID NOs: 1623-2023 are present at one or more of the following positions: (i) position 1, wherein the different amino acid is T, G, N, S, E, L, Y, V, or I; (ii) position 2, wherein the different amino acid is D, N, K, E, V, G, R, L, H, F, P, T, A, S, I, or Y; (iii) position 3, wherein the different amino acid is Y, N, K, T, W, Q, M, V, C, A, L, F, H, G, R, S, or P; (iv) position 4, wherein
- the amino acid sequence is present in loop VIII. In some embodiments, the amino acid sequence is present immediately subsequent to position 570, 571, 572, 573, 574, 575, or 576, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138. [0163] In some embodiments, the AAV capsid variant comprises the amino acid sequence of any of the sequences provided in Tables 1, 2A, 2B, 9, and 15-20.
- the AAV capsid variant comprises the amino acid sequence of any of SEQ ID NOs: 943, 1021, 1024, 1027, 1112, 1142, 1214, 1232, 1254, 1300, 1310, 1327, 1331, 1342, 1419, 1453, 1533, 1538, 1539, 1575, 1578, 1583- 1587, 1590, 1591-1593, 1598-1608, or 1610-1624.
- the AAV capsid variant comprises the amino acid sequence of any of SEQ ID NOs: 943 or 2064-2080.
- the AAV capsid variant comprises the amino acid sequence of any of SEQ ID NOs: 2024-2063.
- the AAV capsid variant comprises the amino acid sequence of any of SEQ ID NOs: 1632-2023. In some embodiments, the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 943. In some embodiments, the amino acid sequence is present in loop VIII. In some embodiments, the amino acid sequence is present immediately subsequent to position 570, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138. In some embodiments, the amino acid sequence replaces positions 571-579 (e.g., T571, N572, N573, Q574, S575, S576, T577, T578, and T579), relative to a reference sequence numbered according to SEQ ID NO 138.
- positions 571-579 e.g., T571, N572, N573, Q574, S575, S576, T577, T578, and T579
- the amino acid sequence is present immediately subsequent to position 570, and the amino acid sequence replaces positions 571-579 (e.g., T571, N572, N573, Q574, S575, S576, T577, T578, and T579), relative to a reference sequence numbered according to SEQ ID NO 138.
- the amino acid sequence is present immediately subsequent to position 571, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138.
- the amino acid sequence replaces positions 572-579 (e.g., N572, N573, Q574, S575, S576, T577, T578, and T579), relative to a reference sequence numbered according to SEQ ID NO 138.
- the amino acid sequence is present immediately subsequent to position 571, and the amino acid sequence replaces positions 572-579 (e.g., N572, N573, Q574, S575, S576, T577, T578, and T579), relative to a reference sequence numbered according to SEQ ID NO 138.
- the amino acid sequence is present immediately subsequent to position 572, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138.
- the amino acid sequence replaces positions 573-579 (e.g., N573, Q574, S575, S576, T577, T578, and T579), relative to a reference sequence numbered according to SEQ ID NO 138.
- the amino acid sequence is present immediately subsequent to position 572, and the amino acid sequence replaces positions 573-579 (e.g., N573, Q574, S575, S576, T577, T578, and T579), relative to a reference sequence numbered according to SEQ ID NO 138.
- the amino acid sequence is present immediately subsequent to position 573, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138.
- the amino acid sequence replaces positions 574-579 (e.g., Q574, S575, S576, T577, T578, and T579), relative to a reference sequence numbered according to SEQ ID NO 138.
- the amino acid sequence is present immediately subsequent to position 573, and the amino acid sequence replaces positions 574-579 (e.g., Q574, S575, S576, T577, T578, and T579), relative to a reference sequence numbered according to SEQ ID NO 138.
- the amino acid sequence is present immediately subsequent to position 574, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138.
- the amino acid sequence replaces positions 575-579 (e.g., S575, S576, T577, T578, and T579), relative to a reference sequence numbered according to SEQ ID NO 138.
- the amino acid sequence is present immediately subsequent to position 574, and the amino acid sequence replaces positions 575-579 (e.g., S575, S576, T577, T578, and T579), relative to a reference sequence numbered according to SEQ ID NO 138. In some embodiments, the amino acid sequence is present immediately subsequent to position 575, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138. In some embodiments, the amino acid sequence replaces positions 576-579 (e.g., S576, T577, T578, and T579), relative to a reference sequence numbered according to SEQ ID NO 138.
- positions 575-579 e.g., S575, S576, T577, T578, and T579
- the amino acid sequence is present immediately subsequent to position 575, and the amino acid sequence replaces positions 576-579 (e.g., S575, S576, T577, T578, and T579), relative to a reference sequence numbered according to SEQ ID NO 138. In some embodiments, the amino acid sequence is present immediately subsequent to position 576, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138. In some embodiments, the amino acid sequence replaces position 577 (e.g., T577), numbered relative to SEQ ID NO: 138.
- the amino acid sequence replaces positions 577-579 (e.g., T577, T578, and T579), relative to a reference sequence numbered according to SEQ ID NO 138. In some embodiments, the amino acid sequence is present immediately subsequent to position 576, and the amino acid sequence replaces position 577 (e.g., T577), relative to a reference sequence numbered according to SEQ ID NO 138. In some embodiments, the amino acid sequence is present immediately subsequent to position 576, and the amino acid sequence replaces positions 577-579 (e.g., T577, T578, and T579), relative to a reference sequence numbered according to SEQ ID NO 138.
- positions 577-579 e.g., T577, T578, and T579
- the AAV capsid variant comprises the amino acid sequence of any of SEQ ID NOs: 943 or 946-966, wherein the amino acid sequence replaces position 577 (e.g., T577), numbered relative to SEQ ID NO: 138.
- the AAV capsid variant comprises the amino acid sequence of any of SEQ ID NOs: 943 or 946-966, wherein the amino acid sequence is present immediately subsequent to position 576, numbered relative to SEQ ID NO: 138.
- the AAV capsid variant comprises the amino acid sequence of any of SEQ ID NOs: 943 or 946-966, wherein the amino acid sequence is present immediately subsequent to position 576, and wherein the amino acid sequence replaces position 577 (e.g., T577), numbered relative to SEQ ID NO: 138.
- the AAV capsid variant (e.g., an AAV capsid variant described herein), comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 944, or a nucleotide sequence substantially identical (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity) thereto.
- the AAV capsid variant described herein comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 944, or a nucleotide sequence comprising at least one, two, three, four, five, six, or seven modifications, e.g., substitutions, insertions, or deletions, but no more than ten modifications, e.g., substitutions, insertions, or deletions, relative to the nucleotide sequence of SEQ ID NO: 944.
- the AAV capsid variant comprises an amino acid sequence encoded by a nucleotide sequence comprising at least one, two, three, four, five, six, or seven, but no more than ten different nucleotides relative to the nucleotide sequence of SEQ ID NO: 944.
- the nucleotide sequence encoding the AAV capsid variant (e.g., an AAV capsid variant described herein), comprises the nucleotide sequence of SEQ ID NO: 944, or a nucleotide sequence substantially identical (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity) thereto.
- the nucleic acid sequence encoding the AAV capsid variant comprises a nucleotide sequence comprising at least one, two, three, four, five, six, or seven modifications, e.g., substitutions, insertions, or deletions, but no more than ten modifications, e.g., substitutions, insertions, or deletions, relative to the nucleotide sequences of SEQ ID NO: 944.
- the nucleotide sequence encoding an AAV capsid variant described herein comprises a nucleotide sequence comprising at least one, two, three, four, five, six, or seven, but no more than ten different nucleotides relative to the nucleotide sequence of SEQ ID NO: 944.
- an AAV capsid variant described herein comprises the amino acid sequence of YPAEVVQK (SEQ ID NO: 943), wherein the amino acid sequence is present in loop VIII.
- an AAV capsid variant described herein comprises the amino acid sequence of YPAEVVQK (SEQ ID NO: 943), wherein the amino acid sequence is present immediately subsequent to position 576, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138.
- an AAV capsid variant described herein comprises the amino acid sequence of YPAEVVQK (SEQ ID NO: 943), wherein the amino acid sequence of YPAEVVQK (SEQ ID NO: 943) replaces position 577 (e.g., T577), relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138.
- an AAV capsid variant described herein comprises the amino acid sequence of YPAEVVQK (SEQ ID NO: 943), wherein the amino acid sequence of YPAEVVQK (SEQ ID NO: 943) is present immediately subsequent to position 576, and wherein the amino acid sequence of YPAEVVQK (SEQ ID NO: 943) replaces position 577 (e.g., T577), relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138.
- an AAV capsid variant described herein comprises the amino acid Y at position 577, and further comprises the amino acid sequence of PAEVVQK (SEQ ID NO: 20), which is present immediately subsequent to position 577, numbered relative to SEQ ID NO: 138.
- an AAV capsid variant described herein comprises the amino acid Y at position 577 and the amino acid sequence of PAEVVQK (SEQ ID NO: 20) at positions 578-584, numbered relative to SEQ ID NO: 982.
- an AAV capsid variant described herein comprises the amino acid sequence of TNNQSSYPAEVVQKTA (SEQ ID NO: 1533), wherein the amino acid sequence is present in loop VIII.
- the AAV capsid variant comprises TNNQSSYPAEVVQKTA (SEQ ID NO: 1533) and is present immediately subsequent to position 570, numbered relative to SEQ ID NO: 138, wherein YPAEVVQK (SEQ ID NO: 943) replaces position 577 (e.g., replaces T577) numbered relative to SEQ ID NO: 138.
- the AAV capsid variant further one, two, three or all of an amino acid other than Q at position 574 (e.g., T, S, A, I, L, or H), an amino acid other than S at position 575 (e.g., G, A, L, T, or R), and/or an amino acid other than S at position 576 (e.g., K, L, R, A, Y, or T), relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138.
- an amino acid other than Q at position 574 e.g., T, S, A, I, L, or H
- an amino acid other than S at position 575 e.g., G, A, L, T, or R
- an amino acid other than S at position 576 e.g., K, L, R, A, Y, or T
- the AAV capsid variant further comprises a Q at position 574, an S at position 575, and/or an S at position 576, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138. In some embodiments, the AAV capsid variant further comprises a T at position 574, an S at position 575, and/or a L at position 576, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138. In some embodiments, the AAV capsid variant further comprises an S at position 574, an S at position 575, and/or an S at position 576, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138.
- the AAV capsid variant further comprises a Q at position 574, an S at position 575, and/or an R at position 576, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138. In some embodiments, the AAV capsid variant further comprises Q at position 574, an S at position 575, and/or a K at position 576, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138. In some embodiments, the AAV capsid variant further comprises an A at position 574, a G at position 575, and/or an A at position 576, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138.
- the AAV capsid variant further comprises an I at position 574, a G at position 575, and/or an S at position 576, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138. In some embodiments, the AAV capsid variant further comprises a Q at position 574, an A at position 575, and/or an S at position 576, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138. In some embodiments, the AAV capsid variant further comprises an A at position 574, an S at position 575, and/or an S at position 576, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138.
- the AAV capsid variant further comprises an L at position 574, a G at position 575, and/or an S at position 576, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138. In some embodiments, the AAV capsid variant further comprises a Q at position 574, an S at position 575, and/or a T at position 576, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138. In some embodiments, the AAV capsid variant further comprises an H at position 574, an S at position 575, and/or an S at position 576, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138.
- the AAV capsid variant further comprises an L at position 574, an S at position 575, and/or an S at position 576, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138. In some embodiments, the AAV capsid variant further comprises a Q at position 574, an R at position 575, and/or an S at position 576, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138. In some embodiments, the AAV capsid variant further comprises an S at position 574, an L at position 575, and/or an S at position 576, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138.
- the AAV capsid variant further comprises an S at position 574, an L at position 575, and/or a Y at position 576, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138. In some embodiments, the AAV capsid variant further comprises an S at position 574, an A at position 575, and/or a T at position 576, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138. In some embodiments, the AAV capsid variant further comprises a Q at position 574, a T at position 575, and/or an S at position 576, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138.
- the AAV capsid variant comprises amino acid other than Q at position 574 (e.g., S), relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138. In some embodiments, the AAV capsid variant comprises S at position 574, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138. [0173] In some embodiments, the AAV capsid variant further comprises one or both of an amino acid other than T at position 571 (e.g., I or N), and/or an amino acid other than N at position 573 (e.g., T, S, or K), relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138.
- an amino acid other than T at position 571 e.g., I or N
- an amino acid other than N at position 573 e.g., T, S, or K
- the AAV capsid variant further comprises an R at position 456, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138. In some embodiments, the AAV capsid variant further comprises a T at position 571, an N at position 572, and/or an N at position 573, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138. In some embodiments, the AAV capsid variant further comprises a T at position 571, an N at position 572, and/or a T at position 573, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138.
- the AAV capsid variant further comprises an I at position 571, an N at position 572, and/or an N at position 573, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138. In some embodiments, the AAV capsid variant further comprises a T at position 571, an N at position 572, and/or an S at position 573, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138. In some embodiments, the AAV capsid variant further comprises an N at position 571, an N at position 572, and/or an N at position 573, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138.
- the AAV capsid variant further comprises a T at position 571, an N at position 572, and/or a K at position 573, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138.
- the AAV capsid variant further comprises an amino acid other than T at position 578 (e.g., P or N), relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138.
- the AAV capsid variant further comprises one or both of an amino acid other than T at position 578 (e.g., P or N), and/or an amino acid other than A at position 589 (e.g., D), relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138.
- the AAV capsid variant further comprises a T at position 578 and/or an A at position 588, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138.
- the AAV capsid variant further comprises a P at position 578 and/or an A at position 588, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138.
- the AAV capsid variant further comprises an N at position 578 and/or an A at position 588, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138. In some embodiments, the AAV capsid variant further comprises a T at position 578 and/or a D at position 579, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138. [0175] In some embodiments, the AAV capsid variant further comprises an amino acid other than T (e.g., Y) at position 577, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138.
- T e.g., Y
- the AAV capsid variant comprises Y at position 577, relative to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138.
- the AAV capsid variant further comprises a modification, e.g., an insertion, substitution, and/or deletion in loop I, II, IV, and/or VI.
- loop I, II, IV, VI, and VIII can be identified as described in Govindasamy et al. Structurally Mapping the Diverse Phenotype of Adeno-Associated Virus Serotype 4. Journal of Virology.2006 Dec. 80(23):11556-11570; and Govindasamy et al.
- an AAV capsid variant described herein comprises a modification as described in Jose et al.
- the AAV capsid variant further comprises an amino acid sequence comprising at least one, two or three modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, but not more than 30, 20 or 10 modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, of the amino acid sequence of SEQ ID NO: 138.
- the AAV capsid variant further comprises an amino acid sequence comprising at least one, two or three, but not more than 30, 20 or 10 different amino acids relative to the amino acid sequence of SEQ ID NO: 138.
- the AAV capsid variant further comprises the amino acid sequence of SEQ ID NO: 138, or an amino acid sequence with at least 70% (e.g., at least about 80, 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto.
- the AAV capsid variant further comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 137, or a sequence with at least 70% (e.g., at least about 80, 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto.
- the AAV capsid variant further comprises an amino acid sequence encoded by a nucleotide sequence comprising at least one, two or three modifications, e.g., substitutions, insertions, or deletions, but not more than 30, 20 or 10 modifications, e.g., substitutions, insertions, or deletions, relative to the nucleotide sequence of SEQ ID NO: 137.
- the AAV capsid variant further comprises an amino acid sequence encoded by a nucleotide sequence comprising at least one, two or three, but not more than 30, 20 or 10 different nucleotides, relative to the amino acid sequence of SEQ ID NO: 137.
- the nucleotide sequence encoding the AAV capsid variant further comprises the nucleotide sequence of SEQ ID NO: 137, or a sequence with at least 70% (e.g., at least about 80, 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto.
- the nucleotide sequence encoding the AAV capsid variant further comprises a nucleotide sequence comprising at least one, two or three modifications, e.g., substitutions, insertions, or deletions, but not more than 30, 20 or 10 modifications, e.g., substitutions, insertions, or deletions, relative to the nucleotide sequence of SEQ ID NO: 137.
- the nucleotide sequence encoding the AAV capsid variant further comprises a nucleotide sequence comprising at least one, two or three, but not more than 30, 20 or 10 different nucleotides, relative to the amino acid sequence of SEQ ID NO: 137.
- an AAV capsid variant of the present disclosure comprises an amino acid sequence as described herein, e.g., an amino acid sequence of an AAV capsid variant of TTN-002, TTN-003, TTN-004, TTN-005, or TTN-006, e.g., as described in Tables 3 and 4.
- an AAV capsid variant of the present disclosure comprises an amino acid sequence as described herein, e.g., an amino acid sequence of an AAV capsid variant of TTN-002, e.g., as described in Tables 3 and 4.
- an AAV capsid variant described herein comprises a VP1, VP2, and/or VP3 protein comprising an amino acid sequence described herein, e.g., an amino acid sequence of an AAV capsid variant of TTN-002, TTN-003, TTN-004, TTN-005, or TTN-006, e.g., as described in Tables 3 and 4.
- an AAV capsid variant described herein comprises a VP1, VP2, and/or VP3 protein comprising an amino acid sequence described herein, e.g., an amino acid sequence of an AAV capsid variant of TTN-002, e.g., as described in Tables 3 and 4.
- an AAV capsid variant described herein comprises an amino acid sequence encoded by a nucleotide sequence as described herein, e.g., a nucleotide sequence of an AAV capsid variant of TTN-002, e.g., as described in Tables 3 and 5.
- a polynucleotide or nucleic acid encoding an AAV capsid variant, of the present disclosure comprises a nucleotide sequence described herein, e.g., a nucleotide sequence of an AAV capsid variant of TTN-002, e.g., as described in Tables 3 and 5.
- Exemplary full length capsid sequences Table 4.
- an AAV capsid variant described herein comprises the amino acid sequence of SEQ ID NO: 982, or an amino acid sequence with at least 70% (e.g., at least about 80, 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto.
- an AAV capsid variant described herein comprises the amino acid sequence of SEQ ID NO: 982 or an amino acid sequence with at least 90% sequence identity thereto.
- an AAV capsid variant described herein comprises the amino acid sequence of SEQ ID NO: 982 or an amino acid sequence with at least 95% sequence identity thereto.
- an AAV capsid variant described herein comprises the amino acid sequence of SEQ ID NO: 982 or an amino acid sequence with at least 96% sequence identity thereto. In some embodiments, an AAV capsid variant described herein comprises the amino acid sequence of SEQ ID NO: 982 or an amino acid sequence with at least 97% sequence identity thereto. In some embodiments, an AAV capsid variant described herein comprises the amino acid sequence of SEQ ID NO: 982 or an amino acid sequence with at least 98% sequence identity thereto. In some embodiments, an AAV capsid variant described herein comprises the amino acid sequence of SEQ ID NO: 982 or an amino acid sequence with at least 99% sequence identity thereto.
- an AAV capsid variant described herein comprises an amino acid sequence comprising at least one, two, or three modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, but not more than 30, 20 or 10 modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to the amino acid sequence of SEQ ID NO: 982.
- the AAV capsid variant comprises an amino acid sequence comprising at least one, two or three, but not more than 30, 20 or 10 different amino acids, relative to the amino acid sequence of SEQ ID NO: 982.
- an AAV capsid variant described herein comprises the amino acid sequence of any one of SEQ ID NOs: 740-743, or an amino acid sequence with at least 70% (e.g., at least about 80, 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto.
- an AAV capsid variant described herein comprises an amino acid sequence comprising at least one, two, or three modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, but not more than 30, 20 or 10 modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to the amino acid sequence of any one of SEQ ID NOs: 740-743.
- the AAV capsid variant comprises an amino acid sequence comprising at least one, two or three, but not more than 30, 20 or 10 different amino acids, relative to the amino acid sequence of any one of SEQ ID NOs: 740-743.
- an AAV capsid variant described herein comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 984, or a nucleotide sequence with at least 70% (e.g., at least about 80, 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto.
- an AAV capsid variant described herein comprises an amino acid sequence encoded by a nucleotide sequence comprising at least one, two or three, but not more than 30, 20 or 10 different nucleotides, relative to the amino acid sequence of SEQ ID NO: 984.
- an AAV capsid variant described herein comprises an amino acid sequence encoded by a nucleotide sequence comprising at least one, two or three modifications, e.g., substitutions, insertions, or deletions, but not more than 30, 20 or 10 modifications, e.g., substitutions, insertions, or deletions, relative to the nucleotide sequence of SEQ ID NO: 984.
- the nucleotide sequence encoding an AAV capsid variant, described herein comprises the nucleotide sequence of SEQ ID NO: 984, or a nucleotide sequence with at least 70% (e.g., at least about 80, 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto.
- the nucleotide sequence encoding an AAV capsid variant described herein comprises the nucleotide sequence of SEQ ID NO: 984, or a nucleotide sequence with at least 70% (e.g., at least about 80, 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto.
- the nucleotide sequence encoding an AAV capsid variant described herein comprises a nucleotide sequence comprising at least one, two or three modifications, e.g., substitutions, insertions, or deletions, but not more than 30, 20 or 10 modifications, e.g., substitutions, insertions, or deletions, relative to the nucleotide sequence of SEQ ID NO: 984.
- the nucleotide sequence encoding an AAV capsid variant described herein comprises a nucleotide sequence comprising at least one, two or three, but not more than 30, 20 or 10 different nucleotides, relative to the amino acid sequence of SEQ ID NO: 984.
- an AAV capsid variant described herein comprises a VP1, VP2, VP3 protein, or a combination thereof.
- an AAV capsid variant comprises the amino acid sequence corresponding to positions 137-731, e.g., a VP2, of SEQ ID NO: 982, or a sequence with at least 70% (e.g., at least about 80, 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto.
- the AAV capsid protein comprises the amino acid sequence corresponding to positions 193-731, e.g., a VP3, of SEQ ID NO: 982, or a sequence with at least 70% (e.g., at least about 80, 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto.
- the AAV capsid variant comprises the amino acid sequence corresponding to positions 1-731, e.g., a VP1, of SEQ ID NO: 982, or an amino acid sequence with at least 70% (e.g., at least about 80, 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto.
- an AAV capsid variant described herein comprises the amino acid sequence of SEQ ID NO: 739, or an amino acid sequence at least 95% (e.g., at least 96, 97, 98, or 99%) identical thereto.
- the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 738, or an amino acid sequence at least 95% (e.g., at least 96, 97, 98, or 99%) identical thereto.
- the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 982, or an amino acid sequence at least 95% (e.g., at least 96, 97, 98, or 99%) identical thereto.
- an AAV capsid variant described herein comprises the amino acid sequence of SEQ ID NO: 739 (e.g., VP3). In some embodiments, the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 738 (e.g., VP2). In some embodiments, the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 982 (e.g., VP1).
- an AAV capsid variant, described herein has an increased tropism for a CNS cell or tissue, e.g., a brain cell, brain tissue, spinal cord cell, or spinal cord tissue, relative to the tropism of a reference sequence comprising the amino acid sequence of SEQ ID NO: 138.
- an AAV capsid variant described herein has an increased tropism for a CNS cell or tissue, e.g., a brain cell, brain tissue, spinal cord cell, or spinal cord tissue, relative to the tropism of a reference sequence comprising the amino acid sequence of SEQ ID NO: 982.
- an AAV capsid variant described herein has an increased tropism for a CNS cell or tissue, e.g., a brain cell, brain tissue, spinal cord cell, or spinal cord tissue, relative to the tropism of a reference sequence comprising the amino acid sequence of SEQ ID NO: 139.
- an AAV capsid variant described herein transduces a brain region, e.g., a temporal cortex, perirhinal cortex, globus pallidus, putamen, caudate, thalamus, hippocampus, geniculate nucleus, Purkinje Layer, deep cerebellar nuclei, and/or cerebellum.
- the level of transduction is at least .5, 2.2, 2.4, 2.5, 2.6, 2.7, 3.0, 3.2, 3.5, 3.7, 4.0, 4.2, 4.5, 4.7, 4.9, 5, 10, 15, 20, 25, 30, or 35-fold greater as compared to a reference sequence of SEQ ID NO: 139.
- an AAV capsid variant described herein is enriched at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 17, 20, 25, 30, 35, 40, 45, 50, 55, 60, or 65-fold in the brain compared to a reference sequence of SEQ ID NO: 138.
- an AAV capsid variant described herein is enriched at least about 10, 12, 15, 17, 20, 25, 30, 35, 40, 45, 50, 55, 60, 61, 62, 63, 64, or 65- fold in the brain compared to a reference sequence of SEQ ID NO: 138.
- an AAV capsid variant described herein is enriched in the brain of at least two to three species, e.g., a non-human primate and rodent (e.g., mouse and/or rat) species, compared to a reference sequence of SEQ ID NO: 138.
- an AAV capsid variant described herein is enriched at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 17, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, or 100-fold in the brain of at least two to three species, e.g., a non-human primate and rodent (e.g., mouse and/or rat) species, compared to a reference sequence of SEQ ID NO: 138 or 982.
- the at least two to three species are Macaca fascicularis, Chlorocebus sabaeus, Callithrix jacchus, rat and/or mouse (e.g., BALB/c mice).
- an AAV capsid variant described herein is enriched about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 100, 125, 150, 175, 200, or 225-fold in the brain compared to a reference sequence of SEQ ID NO: 982.
- an AAV capsid variant described herein delivers an increased level of viral genomes to a brain region.
- the level of viral genomes is increased by at least 1.5, 2.2, 2.4, 2.5, 2.6, 2.7, 3.0, 3.2, 3.5, 3.7, 4.0, 4.2, 4.5, 4.7, 4.9, or 5-fold, as compared to a reference sequence of SEQ ID NO: 139.
- the brain region comprises a midbrain region (e.g., the hippocampus or thalamus) and/or the brainstem.
- an AAV capsid variant described herein delivers an increased level of a payload to a brain region.
- the level of the payload is increased by at least 20, 25, 30, 35-fold, as compared to a reference sequence of SEQ ID NO: 139.
- the brain region comprises a temporal cortex, perirhinal cortex, globus pallidus, putamen, caudate, thalamus, hippocampus, geniculate nucleus, Purkinje Layer, deep cerebellar nuclei, cerebellum, or a combination thereof.
- an AAV capsid variant described herein is enriched at least about 3, 3.5, 4.0, 4.5, 5, 5.0, 6.0, or 6.5-fold, in a spinal cord region compared to a reference sequence of SEQ ID NO: 139.
- the spinal cord region comprises a cervical spinal cord region, a lumbar spinal cord region, a thoracic spinal cord region, or a combination thereof
- an AAV capsid variant described herein shows preferential transduction in a brain region relative to the transduction in the dorsal root ganglia (DRG).
- an AAV capsid variant described herein shows preferential transduction in a brain region relative to the transduction in the liver.
- an AAV capsid variant described herein is capable of transducing neuronal cells.
- an AAV capsid variant described herein is capable of transducing non-neuronal cells, e.g., glial cells (e.g., oligodendrocytes or astrocytes).
- the AAV capsid variant is capable of transducing neuronal cells and non-neuronal cells, e.g., glial cells (e.g., oligodendrocytes or astrocytes).
- the non-neuronal cells are glial cells (e.g., oligodendrocytes or astrocytes).
- an AAV capsid variant described herein has an increased tropism for a heart cell or heart tissue, e.g., a heart cell or a heart tissue of a heart atrium or a heart ventricle relative to the tropism of a reference sequence comprising the amino acid sequence of SEQ ID NO: 138.
- an AAV capsid variant described herein has an increased tropism for a heart cell or heart tissue, e.g., a heart cell or a heart tissue of a heart atrium or a heart ventricle relative to the tropism of a reference sequence comprising the amino acid sequence of SEQ ID NO: 139.
- an AAV capsid variant described herein delivers an increased level of a payload to a heart region. In some embodiments, the level of the payload is increased by at least 1.5, 2, or 2.5-fold, as compared to a reference sequence of SEQ ID NO: 139. [0208] In some embodiments, an AAV capsid variant described herein has an increased tropism for a heart cell or heart tissue, e.g., a heart cell or a heart tissue of a heart atrium or a heart ventricle relative to the tropism of a reference sequence comprising the amino acid sequence of SEQ ID NO: 982.
- the AAV capsid variant is enriched about 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50-fold, in the heart compared to a reference sequence of SEQ ID NO: 982.
- an AAV capsid variant described herein has an increased tropism for a muscle cell or tissue, relative to the tropism of a reference sequence comprising the amino acid sequence of SEQ ID NO: 982.
- the muscle region comprises a quadriceps muscle, and/or a diaphragm muscle region.
- the AAV capsid variant is enriched at least about 2, 3, 4, 5, 10, 15, 20, 25, 30, or 35-fold, in the muscle compared to a reference sequence of SEQ ID NO: 982.
- an AAV capsid variant described herein has increased tropism for a liver cell or liver tissue, relative to the tropism of a reference sequence comprising the amino acid sequence of SEQ ID NO: 982.
- the AAV capsid variant is enriched at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 115, 120, 130, 140, 150, 160, 170, 180, 185, or 190-fold, in the liver, compared to a reference sequence of SEQ ID NO: 982.
- an AAV capsid variant described herein has decreased tropism for the liver.
- an AAV capsid variant comprises a modification, e.g., substitution, insertion, or deletion, that results in reduced tropism (e.g., de-targeting) and/or activity in the liver.
- the reduced tropism in the liver is compared to an otherwise similar capsid that does not comprise the modification, e.g., a wild-type capsid polypeptide.
- an AAV capsid variant described comprises a modification, e.g., substitution, insertion, or deletion, that results in one or more of the following properties: (1) reduced tropism in the liver; (2) de-targeted expression in the liver; (3) reduced activity in the liver; and/or (4) reduced binding to galactose.
- the reduction in any one, or all of properties (1)-(3) is compared to an otherwise similar AAV capsid variant that does not comprise the modification.
- the AAV capsid variant e.g., the AAV capsid variant having reduced tropism in the liver, comprises one or more of: an amino acid other than A, G, K, M, N, Q, R, S, and/or T at position 581; an amino acid other than A, C, H, I, K, S, T, and/or V at position 582; an amino acid other than A, G, H, K, M, N, Q, R, S, T, and/or V at position 583; an amino acid other than L, M, P, Q, R.
- T and/or W at position 584; an amino acid other than F, H, I, K, M, T and/or Y at position 585; an amino acid other than E, G, H, L, M, N, Q, T, and/or W at position 586; an amino acid other than A, C, G, H, L, M, R, and/or S at position 587; an amino acid other than A, C, D, F, G, H, M, Q, S, V, W, and/or Y at position 588; and/or an amino acid other than A, C, E, G, H, M, N, P, Q, S, V, and/or W at position 589, all numbered relative to SEQ ID NO: 138.
- an AAV capsid variant of the present disclosure is isolated, e.g., recombinant.
- a polynucleotide encoding an AAV capsid polypeptide, e.g., an AAV capsid variant, of the present disclosure is isolated, e.g., recombinant.
- Also provided herein are polynucleotide sequences encoding any of the AAV capsid variants described above and AAV particles, vectors, and cells comprising the same.
- an AAV particle of the present disclosure may comprise a capsid protein or variant thereof any natural or recombinant AAV serotype.
- AAV serotypes may differ in characteristics such as, but not limited to, packaging, tropism, transduction and immunogenic profiles. While not wishing to be bound by theory, it is believed in some embodiments, that the AAV capsid protein, e.g., an AAV capsid variant, can modulate AAV particle tropism in a particular tissue.
- an AAV capsid variant described herein allows for blood brain barrier penetration following intravenous administration.
- the AAV capsid variant allows for blood brain barrier penetration following intravenous administration, focused ultrasound (FUS), e.g., coupled with the intravenous administration of microbubbles (FUS-MB), or MRI-guided FUS coupled with intravenous administration.
- FUS focused ultrasound
- FUS-MB microbubbles
- MRI-guided FUS coupled with intravenous administration.
- the AAV capsid variant allows for increased distribution to a brain region.
- the brain region comprises a temporal cortex, perirhinal cortex, globus pallidus, putamen, caudate, thalamus, hippocampus, geniculate nucleus, Purkinje Layer, deep cerebellar nuclei, cerebellum, frontal cortex, sensory cortex, motor cortex, dentate nucleus, cerebellar cortex, cerebral cortex, brain stem, or a combination thereof.
- the AAV capsid variant allows for preferential transduction in a brain region relative to the transduction in the dorsal root ganglia (DRG).
- DDG dorsal root ganglia
- the AAV capsid variant allows for preferential transduction in a brain region relative to the transduction in the liver.
- the AAV capsid variant allows for transduction in neuronal cells. In some embodiments, the AAV capsid variant allows for transduction in a non- neuronal cell, e.g., a glial cell (e.g., an astrocyte, an oligodendrocyte, or a combination thereof). In some embodiments, the AAV capsid variant allows for transduction in both neuronal cells and non- neuronal cell, e.g., a glial cell (e.g., an astrocyte, an oligodendrocyte, or a combination thereof). [0216] In some embodiments, an AAV capsid variant allows for increased distribution to a spinal cord region.
- a non- neuronal cell e.g., a glial cell (e.g., an astrocyte, an oligodendrocyte, or a combination thereof).
- a glial cell e.g., an astrocyte, an oligodendrocyte, or
- the spinal region comprises a cervical spinal cord region, thoracic spinal cord region, and/or lumbar spinal cord region.
- the AAV capsid variant allows for increased distribution to a heart region.
- the AAV capsid variant is suitable for intramuscular administration and/or transduction of muscle fibers.
- the AAV capsid variant allows for increased distribution to a muscle region.
- the muscle region comprises a heart muscle, quadriceps muscle, a diaphragm muscle region, or a combination thereof.
- the AAV capsid variant allows for increased distribution to a liver region.
- an AAV capsid described herein comprises a modification as described in Jose et al. High-Resolution Structural Characterization of a New Adenoassociated Virus Serotype 5 Antibody Epitope toward Engineering Antibody-Resistant Recombinant Gene Delivery Vectors. Journal of Virology.2019 Jan.93(1):e01394-18; Qian et al. Directed Evolution of AAV Serotype 5 for Increased Hepatocyte Transduction and Retained Low Humoral Seroreactivity. Molecular Therapy: Methods & Clinical Development.2020 Oct.20:122-132; Afione et al. Identification and Mutagenesis of the Adeno-Associated Virus 5 Sialic Binding Region.
- the initiation codon for translation of the AAV VP1 capsid protein e.g., a capsid variant, described herein may be CTG, TTG, or GTG as described in US Patent No. US8163543, the contents of which are herein incorporated by reference in its entirety.
- the present disclosure refers to structural capsid proteins (including VP1, VP2 and VP3) which are encoded by capsid (Cap) genes. These capsid proteins form an outer protein structural shell (e.g. capsid) of a viral vector such as AAV.
- VP capsid proteins synthesized from Cap polynucleotides generally include a methionine as the first amino acid in the peptide sequence (Met1), which is associated with the start codon (AUG or ATG) in the corresponding Cap nucleotide sequence.
- a first-methionine (Met1) residue or generally any first amino acid (AA1) to be cleaved off after or during polypeptide synthesis by protein processing enzymes such as Met- aminopeptidases.
- This “Met/AA-clipping” process often correlates with a corresponding acetylation of the second amino acid in the polypeptide sequence (e.g., alanine, valine, serine, threonine, etc.).
- Met-clipping commonly occurs with VP1 and VP3 capsid proteins but can also occur with VP2 capsid proteins.
- Met/AA-clipping is incomplete, a mixture of one or more (one, two or three) VP capsid proteins comprising the viral capsid may be produced, some of which may include a Met1/AA1 amino acid (Met+/AA+) and some of which may lack a Met1/AA1 amino acid as a result of Met/AA-clipping (Met-/AA-).
- Met/AA-clipping in capsid proteins see Jin, et al. Direct Liquid Chromatography/Mass Spectrometry Analysis for Complete Characterization of Recombinant Adeno-Associated Virus Capsid Proteins.
- references to capsid proteins is not limited to either clipped (Met-/AA-) or unclipped (Met+/AA+) and may, in context, refer to independent capsid proteins, viral capsids comprised of a mixture of capsid proteins, and/or polynucleotide sequences (or fragments thereof) which encode, describe, produce or result in capsid proteins of the present disclosure.
- a direct reference to a capsid protein or capsid polypeptide may also comprise VP capsid proteins which include a Met1/AA1 amino acid (Met+/AA+) as well as corresponding VP capsid proteins which lack the Met1/AA1 amino acid as a result of Met/AA-clipping (Met-/AA-).
- a reference to a specific SEQ ID NO: (whether a protein or nucleic acid) which comprises or encodes, respectively, one or more capsid proteins which include a Met1/AA1 amino acid (Met+/AA+) should be understood to teach the VP capsid proteins which lack the Met1/AA1 amino acid as upon review of the sequence, it is readily apparent any sequence which merely lacks the first listed amino acid (whether or not Met1/AA1).
- VP1 polypeptide sequence which is 736 amino acids in length and which includes a “Met1” amino acid (Met+) encoded by the AUG/ATG start codon may also be understood to teach a VP1 polypeptide sequence which is 735 amino acids in length and which does not include the “Met1” amino acid (Met-) of the 736 amino acid Met+ sequence.
- VP1 polypeptide sequence which is 736 amino acids in length and which includes an “AA1” amino acid (AA1+) encoded by any NNN initiator codon may also be understood to teach a VP1 polypeptide sequence which is 735 amino acids in length and which does not include the “AA1” amino acid (AA1-) of the 736 amino acid AA1+ sequence.
- references to viral capsids formed from VP capsid proteins can incorporate VP capsid proteins which include a Met1/AA1 amino acid (Met+/AA1+), corresponding VP capsid proteins which lack the Met1/AA1 amino acid as a result of Met/AA1-clipping (Met-/AA1-), and combinations thereof (Met+/AA1+ and Met-/AA1-).
- an AAV capsid serotype can include VP1 (Met+/AA1+), VP1 (Met-/AA1-), or a combination of VP1 (Met+/AA1+) and VP1 (Met-/AA1-).
- An AAV capsid serotype can also include VP3 (Met+/AA1+), VP3 (Met-/AA1-), or a combination of VP3 (Met+/AA1+) and VP3 (Met-/AA1-); and can also include similar optional combinations of VP2 (Met+/AA1) and VP2 (Met-/AA1-).
- the AAV capsid variant comprises immediately subsequent to position 570, 571, 572, 573, 574, 575, or 576, numbered relative to SEQ ID NO: 138, at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive amino acids of any of amino acid sequence provided in Tables 1, 2A, 2B, 9, or 15-20.
- the AAV capsid variant comprises immediately subsequent to position 570, 571, 572, 573, 574, 575, 576, or 577, numbered relative to SEQ ID NO: 138 or corresponding to equivalent positions in any other AAV serotype (e.g., AAV1, AAV2, AAV3, AAV3b, AAV4, AAV6, AAV7, AAV8, AAV9, AAVrh8, AAVrh10, AAVrh32.33, AAVrh74, SEQ ID NO: 139, PHP.N, PHP.B, or an AAV serotype as provided in Table 6 of WO 2021/230987 (the contents of which are hereby incorporated by reference in their entirety)), at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive amino acids of any of amino acid sequence provided in Tables 1, 2A, 2B, 9, or 15-22.
- AAV serotype e.g., AAV1, AAV2, AAV3, AAV3b, AAV4, AAV6, A
- the at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive amino acids of any of amino acid sequence provided in Tables 1, 2A, 2B, 9, or 15-22 replaces at least one, two, three, four, five, six, seven, eight, or all of positions T571, N572, N573, Q574, S575, S576, T577, T578, and/or A579, numbered according to SEQ ID NO: 138 or corresponding to equivalent positions in any other AAV serotype (e.g., AAV1, AAV2, AAV3, AAV3b, AAV4, AAV6, AAV7, AAV8, AAV9, AAVrh8, AAVrh10, AAVrh32.33, AAVrh74, SEQ ID NO: 139, PHP.N, PHP.B, or an AAV serotype as provided in Table 6 of WO 2021/230987 (the contents of which are hereby incorporated by reference in their entirety)).
- AAV serotype e.g., AAV
- the at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive amino acids of any of amino acid sequence provided in Tables 1, 2A, 2B, 9, or 15-22 replaces positions T577, numbered according to SEQ ID NO: 138 or corresponding to equivalent positions in any other AAV serotype (e.g., AAV1, AAV2, AAV3, AAV3b, AAV4, AAV6, AAV7, AAV8, AAV9, AAVrh8, AAVrh10, AAVrh32.33, AAVrh74, SEQ ID NO: 139, PHP.N, PHP.B, or an AAV serotype as provided in Table 6 of WO 2021/230987 (the contents of which are hereby incorporated by reference in their entirety)).
- AAV serotype e.g., AAV1, AAV2, AAV3, AAV3b, AAV4, AAV6, AAV7, AAV8, AAV9, AAVrh8, AAVrh10, AAVrh32.33, A
- the AAV capsid variant comprises an amino acid other than the wild-type, e.g., native, amino acid, at one, two, three, four, five, six, seven, eight, or all of positions T571, N572, N573, Q574, S575, S576, T577, T578, and/or A579, numbered according to SEQ ID NO: 138 or corresponding to equivalent positions in any other AAV serotype (e.g., AAV1, AAV2, AAV3, AAV3b, AAV4, AAV6, AAV7, AAV8, AAV9, AAVrh8, AAVrh10, AAVrh32.33, AAVrh74, SEQ ID NO: 139, PHP.N, PHP.B, or an AAV serotype as provided in Table 6 of WO 2021/230987 (the contents of which are hereby incorporated by reference in their entirety)).
- AAV serotype e.g., native, amino acid, at one, two, three, four, five, six,
- the AAV capsid variant comprises an amino acid other than the wild-type, e.g., native, amino acid, at position T577, numbered according to SEQ ID NO: 138 or corresponding to equivalent positions in any other AAV serotype (e.g., AAV1, AAV2, AAV3, AAV3b, AAV4, AAV6, AAV7, AAV8, AAV9, AAVrh8, AAVrh10, AAVrh32.33, AAVrh74, SEQ ID NO: 139, PHP.N, PHP.B, or an AAV serotype as provided in Table 6 of WO 2021/230987 (the contents of which are hereby incorporated by reference in their entirety)).
- AAV serotype e.g., AAV1, AAV2, AAV3, AAV3b, AAV4, AAV6, AAV7, AAV8, AAV9, AAVrh8, AAVrh10, AAVrh32.33, AAVrh74, SEQ ID NO: 139, PHP
- the AAV capsid variant comprises a modification, e.g., substitution, at one, two, three, four, five, six, seven, eight, or all of positions T571, N572, N573, Q574, S575, S576, T577, T578, and/or A579, numbered according to SEQ ID NO: 138 or corresponding to equivalent positions in any other AAV serotype (e.g., AAV1, AAV2, AAV3, AAV3b, AAV4, AAV6, AAV7, AAV8, AAV9, AAVrh8, AAVrh10, AAVrh32.33, AAVrh74, SEQ ID NO: 139, PHP.N, PHP.B, or an AAV serotype as provided in Table 6 of WO 2021/230987 (the contents of which are hereby incorporated by reference in their entirety).
- substitution at one, two, three, four, five, six, seven, eight, or all of positions T571, N572, N573, Q574, S575, S57
- the AAV capsid variant comprises a modification, e.g., substitution, at position T577, numbered according to SEQ ID NO: 138 or corresponding to equivalent positions in any other AAV serotype (e.g., AAV1, AAV2, AAV3, AAV3b, AAV4, AAV6, AAV7, AAV8, AAV9, AAVrh8, AAVrh10, AAVrh32.33, AAVrh74, SEQ ID NO: 139, PHP.N, PHP.B, or an AAV serotype as provided in Table 6 of WO 2021/230987 (the contents of which are hereby incorporated by reference in their entirety).
- AAV serotype e.g., substitution, at position T577, numbered according to SEQ ID NO: 138 or corresponding to equivalent positions in any other AAV serotype (e.g., AAV1, AAV2, AAV3, AAV3b, AAV4, AAV6, AAV7, AAV8, AAV9, AAVrh8,
- an AAV capsid variant described herein comprises the amino acid sequence of SEQ ID NO: 138 or an amino acid sequence substantially identical (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity) thereto.
- an AAV capsid variant described herein comprises the amino acid sequence of SEQ ID NO: 138 or an amino acid sequence having at least 90% identity thereto.
- an AAV capsid variant described herein comprises the amino acid sequence of SEQ ID NO: 138 or an amino acid sequence having at least 95% identity thereto.
- an AAV capsid variant described herein comprises the amino acid sequence of SEQ ID NO: 138 or an amino acid sequence having at least 96% identity thereto. In some embodiments, an AAV capsid variant described herein comprises the amino acid sequence of SEQ ID NO: 138 or an amino acid sequence having at least 97% identity thereto. In some embodiments, an AAV capsid variant described herein comprises the amino acid sequence of SEQ ID NO: 138 or an amino acid sequence having at least 98% identity thereto. In some embodiments, an AAV capsid variant described herein comprises the amino acid sequence of SEQ ID NO: 138 or an amino acid sequence having at least 99% identity thereto.
- the AAV capsid polypeptide or the AAV capsid variant comprises an amino acid sequence comprising at least one, two, or three modifications, e.g., substitutions (e.g., conservative substitutions), but no more than 30, 20, or 10 modifications, e.g., substitutions (e.g., conservative substitutions), relative to the amino acid sequence of SEQ ID NO: 138.
- the AAV capsid polypeptide or the AAV capsid variant comprises an amino acid sequence comprising at least one, two, or three, but no more than 30, 20, or 10 different amino acids, relative to the amino acid sequence of SEQ ID NO: 138.
- the AAV capsid polypeptide or the AAV capsid variant comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 137 or a nucleotide sequence substantially identical (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity) thereto.
- the nucleotide sequence encoding the AAV capsid polypeptide or the AAV capsid variant comprises the nucleotide sequence of SEQ ID NO: 137 or a nucleotide sequence substantially identical (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity) thereto.
- an AAV capsid variant described herein comprises the amino acid sequence or is encoded by the nucleotide sequence of any of SEQ ID NO: 1 or 2 of US7427396; SEQ ID NO: 114 of US20030138772; SEQ ID NO: 199 of US20150315612; or SEQ ID NOs: 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31, 32, 34, 35, 37, 38, 40, 41, 43, or 44 of US20160289275A1 (the contents of each are incorporated herein by reference in their entirety), or a sequence substantially identical (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity) thereto.
- the AAV capsid variant described herein comprises a modification, e.g., substitution, at position 569 (e.g., M569V), 652 (e.g., D652A), 362 (e.g., T362M), 359 (e.g., Q359D), 350 (e.g., E350Q), 533 (e.g., P533S), 585 (e.g., Y585V), 587 (e.g., L587T), 581 (e.g., A581T), 582 (e.g., T582A), 584 (e.g., T584A), or a combination thereof, all numbered relative to SEQ ID NO: 138.
- substitution at position 569 (e.g., M569V), 652 (e.g., D652A), 362 (e.g., T362M), 359 (e.g., Q359D), 350 (e.g., E350Q),
- an AAV capsid variant described herein comprises an amino acid from a wild-type AAV5 sequence, e.g., the amino acid sequence of SEQ ID NO: 138, at one or more of positions 581 to 589, numbered relative to SEQ ID NO: 138.
- the AAV capsid variant comprises 1, 2, 3, 4, 5, 6, 7, 8, or all of: the amino acid from a wild-type AAV5 sequence (e.g., SEQ ID NO: 138) at position 581 (e.g., comprises the amino acid A at position 581); the amino acid from a wild-type AAV5 sequence (e.g., SEQ ID NO: 138) at position 582 (e.g., comprises the amino acid T at position 582); the amino acid from a wild-type AAV5 sequence (e.g., SEQ ID NO: 138) at position 583 (e.g., comprises the amino acid G at position 583); the amino acid from a wild-type AAV5 sequence (e.g., SEQ ID NO: 138) at position 584 (e.g., comprises the amino acid T at position 584); the amino acid from a wild-type AAV5 sequence (e.g., SEQ ID NO: 138) at position 585 (e.g., comprises the amino acid from a wild-
- an AAV capsid described herein does not comprise a T at position 581, an A at position 582, an A at position 584, a V at position 585, a T at position 585, a V at position 569, an A at position 652, an M at position 362, a Q at position 359, a Q at position 350, an S at position 533, or a combination thereof, all numbered relative to SEQ ID NO: 138.
- an AAV capsid described herein does not comprise a modification, e.g., substitution, at positions 581-589 (numbered according to SEQ ID NO: 138), wherein the modification has the amino acid sequence of any of the sequences provided in Tables 2, 7, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, or 71-86 of WO 2021/242909.
- a position numbered relative to SEQ ID NO: 138 can be identified by providing an alignment of a reference sequence and a query sequence, wherein the reference sequence is SEQ ID NO: 138, and identifying the residues corresponding to the positions in the query sequence that correspond to positions in the reference sequence.
- Table 6 AAV Sequences
- an AAV particle as described herein comprising an AAV capsid variant described herein may be used for the delivery of a viral genome to a tissue (e.g., CNS, heart, liver, and/or muscle).
- a tissue or cell e.g., CNS, DRG, heart, liver, or muscle cell or tissue.
- an AAV particle of the present disclosure is a recombinant AAV particle.
- an AAV particle of the present disclosure is an isolated AAV particle.
- the viral genome may encode any payload, such as but not limited to a polypeptide (e.g., a therapeutic polypeptide), an antibody, an enzyme, an RNAi agent and/or components of a gene editing system.
- the AAV particles described herein are used to deliver a payload to cells of the CNS, after intravenous delivery.
- the AAV particles described herein are used to deliver a payload to cells of the DRG, after intravenous delivery.
- the AAV particles described herein are used to deliver a payload to cells of a heart, after intravenous delivery.
- the AAV particles described herein are used to deliver a payload to cells of a muscle, e.g., a heart muscle, after intravenous delivery. In some embodiments, the AAV particles described herein are used to deliver a payload to cells of a liver after intravenous delivery.
- a viral genome of an AAV particle comprising an AAV capsid variant, as described herein comprises a nucleotide sequence comprising a transgene encoding a payload. In some embodiments, the viral genome comprises an inverted terminal repeat sequence (ITR).
- the viral genome comprises two ITR sequences, one at the 5’ end of the viral genome (e.g., 5’ relative to the encoded payload) and one at the 3’ end of the viral genome (e.g., 3’ relative to the encoded payload).
- a viral genome of an AAV particle e.g., an AAV particle comprising an AAV capsid variant described herein, may comprise a regulatory element (e.g., promoter), untranslated regions (UTR), a miR binding site, a polyadenylation sequence (polyA), a filler or stuffer sequence, an intron, and/or a linker sequence, e.g., for enhancing transgene expression.
- the viral genome components are selected and/or engineered for expression of the payload in a target tissue (e.g., CNS (e.g., brain, spinal cord, or both), heart, liver, and/or muscle tissue).
- a target tissue e.g., CNS (e.g., brain, spinal cord, or both), heart, liver, and/or muscle tissue).
- Viral Genome Component Inverted Terminal Repeats (ITRs)
- the AAV particle comprising an AAV capsid variant described herein comprises a viral genome comprising an ITR and a transgene encoding a payload.
- the viral genome comprises two ITRs.
- the two ITRs flank the nucleotide sequence encoding the payload at the 5’ and 3’ ends.
- the ITRs function as origins of replication comprising recognition sites for replication.
- the ITRs comprise sequence regions which can be complementary and symmetrically arranged.
- the ITRs incorporated into viral genomes as described herein may be comprised of naturally occurring polynucleotide sequences or recombinantly derived polynucleotide sequences.
- the ITR may be from the same serotype as the capsid polypeptide, e.g., capsid variant, selected from any of the known serotypes, or a variant thereof.
- the ITR may be of a different serotype than the capsid.
- the viral genome comprises two ITR sequence regions, wherein the ITRs are of the same serotype as one another. In some embodiments, the viral genome comprises two ITR sequence regions, wherein the ITRs are of different serotypes. Non-limiting examples include zero, one, or both of the ITRs having the same serotype as the capsid. In some embodiments, both ITRs of the viral genome of the AAV particle are AAV2 ITRs. [0244] Independently, each ITR may be about 100 to about 150 nucleotides in length.
- An ITR may be about 100-105 nucleotides in length, 106-110 nucleotides in length, 111-115 nucleotides in length, 116-120 nucleotides in length, 121-125 nucleotides in length, 126-130 nucleotides in length, 131-135 nucleotides in length, 136-140 nucleotides in length, 141-145 nucleotides in length or 146- 150 nucleotides in length.
- the ITRs are 140-142 nucleotides in length.
- Non- limiting examples of ITR length are 102, 105, 130, 140, 141, 142, 145 nucleotides in length.
- viral genome of an AAV particle described herein comprises at least one element to enhance the payload target specificity and expression (See e.g., Powell et al. Viral Expression Cassette Elements to Enhance Transgene Target Specificity and Expression in Gene Therapy, 2015; the contents of which are herein incorporated by reference in their entirety).
- elements to enhance payload target specificity and expression include promoters, endogenous miRNAs, post-transcriptional regulatory elements (PREs), polyadenylation (PolyA) signal sequences and upstream enhancers (USEs), CMV enhancers and introns.
- an AAV particle comprising an AAV capsid variant described herein comprises a viral genome comprising a nucleic acid comprising a transgene encoding a payload, wherein the transgene is operably linked to a promoter.
- the promoter is a species-specific promoter, an inducible promoter, a tissue-specific promoter, or a cell cycle- specific promoter (e.g., a promoter as described in Parr et al., Nat. Med.3:1145-9 (1997); the contents of which are herein incorporated by reference in their entirety).
- the promoter may be naturally occurring or non-naturally occurring.
- Non-limiting examples of promoters include those derived from viruses, plants, mammals, or humans.
- the promoters may be those derived from human cells or systems.
- the promoter may be truncated or mutated, e.g., a promoter variant.
- the promoter is a ubiquitous promoter, e.g., capable of expression in multiple tissues.
- the promoter is a human elongation factor 1 ⁇ -subunit (EF1 ⁇ ) promoter, the cytomegalovirus (CMV) immediate-early enhancer and/or promoter, the chicken ⁇ -actin (CBA) promoter and its derivative CAG, ⁇ glucuronidase (GUSB) promoter, or ubiquitin C (UBC) promoter.
- the promoter is a cell or tissue specific promoter, e.g., capable of expression in tissues or cells of the central or peripheral nervous systems, targeted regions within (e.g., frontal cortex), and/or sub-sets of cells therein (e.g., excitatory neurons).
- the promoter is a cell-type specific promoters capable of expression of a payload in excitatory neurons (e.g., glutamatergic), inhibitory neurons (e.g., GABA-ergic), neurons of the sympathetic or parasympathetic nervous system, sensory neurons, neurons of the dorsal root ganglia, motor neurons, or supportive cells of the nervous systems such as microglia, glial cells, astrocytes, oligodendrocytes, and/or Schwann cells.
- excitatory neurons e.g., glutamatergic
- inhibitory neurons e.g., GABA-ergic
- the promoter is a liver specific promoter (e.g., hAAT, TBG), skeletal muscle specific promoter (e.g., desmin, MCK, C512), B cell promoter, monocyte promoter, leukocyte promoter, macrophage promoter, pancreatic acinar cell promoter, endothelial cell promoter, lung tissue promoter, and/or cardiac or cardiovascular promoter (e.g., ⁇ MHC, cTnT, and CMV- MLC2k).
- the promoter is a tissue-specific promoter for payload expression in a tissue or cell of the central nervous system.
- the promoter is a synapsin (Syn) promoter, glutamate vesicular transporter (VGLUT) promoter, vesicular GABA transporter (VGAT) promoter, parvalbumin (PV) promoter, sodium channel Na v 1.8 promoter, tyrosine hydroxylase (TH) promoter, choline acetyltransferase (ChaT) promoter, methyl-CpG binding protein 2 (MeCP2) promoter, Ca 2+ /calmodulin-dependent protein kinase II (CaMKII) promoter, metabotropic glutamate receptor 2 (mGluR2) promoter, neurofilament light chain (NFL) or heavy chain (NFH) promoter, neuron-specific enolase (NSE) promoter, ⁇ -globin minigene n ⁇ 2 promoter, preproenkephalin (PPE) promoter, enkephalin (Enk) promoter, and excitatory amino acid
- the promoter is a cell-type specific promoter capable of expression in an astrocyte, e.g., a glial fibrillary acidic protein (GFAP) promoter and a EAAT2 promoter, or a fragment thereof.
- the promoter is a cell-type specific promoter capable of expression in an oligodendrocyte, e.g., a myelin basic protein (MBP) promoter or a fragment thereof.
- MBP myelin basic protein
- the promoter is a GFAP promoter.
- the promoter is a synapsin (syn or syn1) promoter, or a fragment thereof.
- the promoter comprises an insulin promoter or a fragment thereof.
- the promoter of the viral genome described herein e.g., comprised within an AAV particle comprising an AAV capsid variant described herein
- the EF-1 ⁇ promoter comprises the nucleotide sequence of any one of SEQ ID NOs: 2100, 2101, 2103, 2104, 2108, 2109, 2111-2120, or any one of the nucleotide sequences provided in Table 8, a nucleotide sequence comprising at least one, two, three, four, five, six or seven but no more than ten modifications, e.g., substitutions, insertions, or deletions, relative to the nucleotide sequence of SEQ ID NOs: 2100, 2101, 2103, 2104, 2108, 2109, 2111-2120, or any one of the nucleotide sequences provided in Table 8, or a nucleotide sequence with at least 70% (e.g., 80, 85%, 90%, 95%, 96%, 97%, 98%, or 99%) sequence identity to any one of SEQ ID NOs: 2100, 2101, 2103, 2104, 2108, 2109, 2111-2120, or any one of
- UTRs Untranslated Regions
- wild type untranslated regions (UTRs) of a gene are transcribed but not translated. Generally, the 5’ UTR starts at the transcription start site and ends at the start codon and the 3’ UTR starts immediately following the stop codon and continues until the termination signal for transcription.
- UTRs Untranslated Regions
- a 5’ UTR from mRNA normally expressed in the brain may be used in the viral genomes of the AAV particles described herein to enhance expression in neuronal cells or other cells of the central nervous system.
- wild-type 5′ untranslated regions include features which play roles in translation initiation. Kozak sequences, which are commonly known to be involved in the process by which the ribosome initiates translation of many genes, are usually included in 5’ UTRs.
- Kozak sequences have the consensus CCR(A/G)CCAUGG, where R is a purine (adenine or guanine) three bases upstream of the start codon (ATG), which is followed by another ‘G’.
- R is a purine (adenine or guanine) three bases upstream of the start codon (ATG), which is followed by another ‘G’.
- the 5’UTR in the viral genome includes a Kozak sequence.
- the 5’UTR in the viral genome does not include a Kozak sequence.
- wild-type 3′ UTRs are known to have stretches of Adenosines and Uridines embedded therein. These AU rich signatures are particularly prevalent in genes with high rates of turnover.
- AU rich elements can be separated into three classes (Chen et al, 1995, the contents of which are herein incorporated by reference in its entirety): Class I AREs, such as, but not limited to, c-Myc and MyoD, contain several dispersed copies of an AUUUA motif within U-rich regions. Class II AREs, such as, but not limited to, GM-CSF and TNF-a, possess two or more overlapping UUAUUUA(U/A)(U/A) nonamers. Class III ARES, such as, but not limited to, c-Jun and Myogenin, are less well defined. These U rich regions do not contain an AUUUA motif.
- AREs 3′ UTR AU rich elements
- the 3’ UTR of the viral genome may include an oligo(dT) sequence for templated addition of a poly-A tail.
- the viral genome may include at least one miRNA seed, binding site or full sequence.
- microRNAs are 19-25 nucleotide noncoding RNAs that bind to the sites of nucleic acid targets and down-regulate gene expression either by reducing nucleic acid molecule stability or by inhibiting translation.
- a microRNA sequence comprises a seed region, e.g., a sequence in the region of positions 2-8 of the mature microRNA, which has Watson-Crick sequence fully or partially complementarity to the miRNA target sequence of the nucleic acid.
- the viral genome may be engineered to include, alter or remove at least one miRNA binding site, full sequence or seed region.
- Any UTR from any gene known in the art may be incorporated into the viral genome of the AAV particle.
- UTRs may be placed in the same orientation as in the gene from which they were selected or they may be altered in orientation or location.
- the UTR used in the viral genome of the AAV particle may be inverted, shortened, lengthened, made with one or more other 5′ UTRs or 3′ UTRs known in the art.
- the term “altered” as it relates to a UTR means that the UTR has been changed in some way in relation to a reference sequence.
- a 3′ or 5′ UTR may be altered relative to a wild type or native UTR by the change in orientation or location as taught above or may be altered by the inclusion of additional nucleotides, deletion of nucleotides, swapping or transposition of nucleotides.
- the viral genome of the AAV particle comprises at least one artificial UTR which is not a variant of a wild type UTR.
- the viral genome of the AAV particle comprises UTRs which have been selected from a family of transcripts whose proteins share a common function, structure, feature or property.
- the viral genome of the AAV particle described herein may comprise a polyadenylation sequence.
- the viral genome of the AAV particle e.g., an AAV particle comprising an AAV capsid variant, described herein
- the viral genome of the AAV particle as described herein comprises an element to enhance the payload target specificity and expression (See e.g., Powell et al. Viral Expression Cassette Elements to Enhance Transgene Target Specificity and Expression in Gene Therapy, Discov. Med, 2015, 19(102): 49-57; the contents of which are herein incorporated by reference in their entirety), such as an intron.
- Non-limiting examples of introns include, MVM (67-97 bps), F.IX truncated intron 1 (300 bps), ⁇ - globin SD/immunoglobulin heavy chain splice acceptor (250 bps), adenovirus splice donor/immunoglobin splice acceptor (500 bps), SV40 late splice donor/splice acceptor (19S/16S) (180 bps) and hybrid adenovirus splice donor/IgG splice acceptor (230 bps).
- the viral genome of an AAV particle described herein comprises an element to improve packaging efficiency and expression, such as a stuffer or filler sequence.
- stuffer sequences include albumin and/or alpha-1 antitrypsin. Any known viral, mammalian, or plant sequence may be manipulated for use as a stuffer sequence.
- the stuffer or filler sequence may be from about 100-3500 nucleotides in length.
- the stuffer sequence may have a length of about 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, or 3000 nucleotides.
- Viral Genome Component miRNA [0272]
- the viral genome comprises a sequence encoding a miRNA to reduce the expression of the payload in a tissue or cell, e.g., the DRG (dorsal root ganglion), or neurons of other ganglia, such as those of the sympathetic or parasympathetic nervous system.
- a miRNA e.g., a miR183, a miR182, and/or miR96
- a miR-122 miRNA may be encoded in the viral genome to modulate, e.g., reduce, the expression of the viral genome in the liver.
- a miRNA e.g., a miR- 142-3p
- a miRNA, e.g., a miR-1 may be encoded in the viral genome to modulate, e.g., reduce, the expression, of the viral genome in a cell or tissue of the heart.
- Tissue- or cell-specific expression of the AAV viral particles disclosed herein can be enhanced by introducing tissue- or cell-specific regulatory sequences, e.g., promoters, enhancers, microRNA binding sites, e.g., a detargeting site.
- tissue- or cell-specific regulatory sequences e.g., promoters, enhancers, microRNA binding sites, e.g., a detargeting site.
- an encoded miR binding site can modulate, e.g., prevent, suppress, or otherwise inhibit, the expression of a gene of interest on the viral genome disclosed herein, based on the expression of the corresponding endogenous microRNA (miRNA) or a corresponding controlled exogenous miRNA in a tissue or cell, e.g., a non-targeting cell or tissue.
- miRNA microRNA binding site
- a miR binding site modulates, e.g., reduces, expression of the payload encoded by a viral genome of an AAV particle described herein in a cell or tissue where the corresponding mRNA is expressed.
- the viral genome of an AAV particle described herein comprises a nucleotide sequence encoding a microRNA binding site, e.g., a detargeting site.
- the viral genome of an AAV particle described herein comprises a nucleotide sequence encoding a miR binding site, a microRNA binding site series (miR BSs), or a reverse complement thereof.
- the nucleotide sequence encoding the miR binding site series or the miR binding site is located in the 3’-UTR region of the viral genome (e.g., 3’ relative to the nucleotide sequence encoding a payload), e.g., before the polyA sequence, 5’-UTR region of the viral genome (e.g., 5’ relative to the nucleotide sequence encoding a payload), or both.
- the encoded miR binding site series comprise at least 1-5 copies, e.g., at least 1-3, 2-4, 3-5, 1, 2, 3, 4, 5 or more copies of a miR binding site (miR BS).
- all copies are identical, e.g., comprise the same miR binding site.
- the miR binding sites within the encoded miR binding site series are continuous and not separated by a spacer.
- the miR binding sites within an encoded miR binding site series are separated by a spacer, e.g., a non-coding sequence.
- the spacer is about 1 to 6 nucleotides or about 5 to 10 nucleotides, e.g., about 7-8 nucleotides, nucleotides in length.
- the spacer coding sequence or reverse complement thereof comprises one or more of (i) GGAT; (ii) CACGTG; (iii) GCATGC, or a repeat of one or more of (i)- (iii).
- the spacer comprises the nucleotide sequence of GATAGTTA, or a nucleotide sequence having at least one, two, or three modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions relative to the nucleotide sequence of GATAGTTA.
- the encoded miR binding site series comprise at least 1-5 copies, e.g., at least 1-3, 2-4, 3-5, 1, 2, 3, 4, 5 or more copies of a miR binding site (miR BS). In some embodiments, at least 1, 2, 3, 4, 5, or all of the copies are different, e.g., comprise a different miR binding site.
- the miR binding sites within the encoded miR binding site series are continuous and not separated by a spacer. In some embodiments, the miR binding sites within an encoded miR binding site series are separated by a spacer, e.g., a non-coding sequence.
- the spacer is about 1 to 6 nucleotides or about 5 to 10 nucleotides, e.g., about 7-8 nucleotides, in length. In some embodiments, the spacer comprises one or more of (i) GGAT; (ii) CACGTG; (iii) GCATGC, or a repeat of one or more of (i)-(iii).
- the spacer comprises the nucleotide sequence of GATAGTTA, or a nucleotide sequence having at least one, two, or three modifications, e.g., substitutions (e.g., conservative substitutions), insertions, but no more than four modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions relative to the nucleotide sequence of GATAGTTA.
- the encoded miR binding site is substantially identical (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identical), to the miR in the host cell.
- the encoded miR binding site comprises at least 1, 2, 3, 4, or 5 mismatches or no more than 6, 7, 8, 9, or 10 mismatches to a miR in the host cell.
- the mismatched nucleotides are contiguous. In some embodiments, the mismatched nucleotides are non-contiguous. In some embodiments, the mismatched nucleotides occur outside the seed region-binding sequence of the miR binding site, such as at one or both ends of the miR binding site. In some embodiments, the miR binding site is 100% identical to the miR in the host cell.
- the nucleotide sequence encoding the miR binding site is substantially complementary (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% complementary), to the miR in the host cell.
- to complementary sequence of the nucleotide sequence encoding the miR binding site comprises at least 1, 2, 3, 4, or 5 mismatches or no more than 6, 7, 8, 9, or 10 mismatches to a miR in the host cell.
- the mismatched nucleotides are contiguous. In some embodiments, the mismatched nucleotides are non- contiguous.
- the mismatched nucleotides occur outside the seed region-binding sequence of the miR binding site, such as at one or both ends of the miR binding site.
- the encoded miR binding site is 100% complementary to the miR in the host cell.
- an encoded miR binding site or sequence region is at least about 10 to about 125 nucleotides in length, e.g., at least about 10 to 50 nucleotides, 10 to 100 nucleotides, 50 to 100 nucleotides, 50 to 125 nucleotides, or 100 to 125 nucleotides in length.
- an encoded miR binding site or sequence region is at least about 7 to about 28 nucleotides in length, e.g., at least about 8-28 nucleotides, 7-28 nucleotides, 8-18 nucleotides, 12-28 nucleotides, 20-26 nucleotides, 22 nucleotides, 24 nucleotides, or 26 nucleotides in length, and optionally comprises at least one consecutive region (e.g., 7 or 8 nucleotides) complementary (e.g., fully or partially complementary) to the seed sequence of a miRNA (e.g., a miR122, a miR142, a miR183, or a miR1).
- a miRNA e.g., a miR122, a miR142, a miR183, or a miR1.
- the encoded miR binding site is complementary (e.g., fully or partially complementary) to a miR expressed in liver or hepatocytes, such as miR122.
- the encoded miR binding site or encoded miR binding site series comprises a miR122 binding site sequence.
- the encoded miR122 binding site comprises the nucleotide sequence of ACAAACACCATTGTCACACTCCA (SEQ ID NO: 4673), or a nucleotide sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, at least 95%, at least 99%, or 100% sequence identity, or comprising at least one, two, three, four, five, six, or seven modifications, e.g., substitutions, insertions, or deletions, but no more than ten modifications, e.g., insertions, deletions, or substitutions, relative to the nucleotide sequence of SEQ ID NO: 4673, e.g., wherein the modification can result in a mismatch between the encoded miR binding site and the corresponding miRNA.
- SEQ ID NO: 4673 nucleotide sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, at least 95%, at least 99%, or 100% sequence
- the viral genome comprises at least 2, 3, 4, or 5 copies of the encoded miR122 binding site, e.g., an encoded miR122 binding site series, optionally wherein the encoded miR122 binding site series comprises the nucleotide sequence of: ACAAACACCATTGTCACACTCCACACAAACACCATTGTCACACTCCACACAAACACCATTGTCACACT CACACAAACACCATTGTCACACT CCA (SEQ ID NO: 4674), or a nucleotide sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, at least 95%, at least 99%, or 100% sequence identity, or comprising at least one, two, three, four, five, six, or seven modifications, e.g., substitutions, insertions, or deletions, but no more than ten modifications, e.g., substitutions, insertions, or deletions, relative to the nucleotide sequence of SEQ ID NO: 4674, e.g., wherein the
- At least two of the encoded miR122 binding sites are connected directly, e.g., without a spacer.
- at least two of the encoded miR122 binding sites are separated by a spacer, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length, which is located between two or more consecutive encoded miR122 binding site sequences.
- the spacer is about 1 to 6 nucleotides or about 5 to 10 nucleotides, e.g., about 7-8, in length.
- the spacer coding sequence or reverse complement thereof comprises one or more of (i) GGAT; (ii) CACGTG; (iii) GCATGC, or a repeat of one or more of (i)-(iii).
- an encoded miR binding site series comprises at least 3-5 copies (e.g., 4 copies) of a miR122 binding site, with or without a spacer, wherein the spacer is about 1 to 6 nucleotides or about 5 to 10 nucleotides, e.g., about 7-8 nucleotides or about 8 nucleotides, in length.
- the spacer comprises the nucleotide sequence of GATAGTTA, or a nucleotide sequence comprising one, two, or three modifications, e.g., substitutions, insertions, or deletions, but no more than four modifications, e.g., substitutions, insertions, or deletions relative to the nucleotide sequence of GATAGTTA.
- the encoded miR binding site is complementary (e.g., fully or partially complementary) to a miR expressed in the heart.
- the encoded miR binding site or encoded miR binding site series comprises a miR-1 binding site.
- the encoded miR-1 binding site comprises the nucleotide sequence of ATACATACTTCTTTACATTCCA (SEQ ID NO: 4679), a nucleotide sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, at least 95%, at least 99%, or 100% sequence identity, or having at least one, two, three, four, five, six, or seven modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, but no more than ten modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to the nucleotide sequence of SEQ ID NO: 4679, e.g., wherein the modification can result in a mismatch between the encoded miR binding site and the corresponding miRNA.
- SEQ ID NO: 4679 ATACATACTTCTTTACATTCCA
- the viral genome comprises at least 2, 3, 4, or 5 copies of the encoded miR-1 binding site, e.g., an encoded miR-1 binding site series.
- the at least 2, 3, 4, or 5 copies (e.g., 2 or 3 copies) of the encoded miR-1 binding site are continuous (e.g., not separated by a spacer) or separated by a spacer.
- the spacer is about 1 to 6 nucleotides or about 5 to 10 nucleotides, e.g., about 7-8 nucleotides or about 8 nucleotides, in length.
- the spacer sequence comprises one or more of (i) GGAT; (ii) CACGTG; (iii) GCATGC, or a repeat of one or more of (i)-(iii).
- the spacer comprises the nucleotide sequence of GATAGTTA, or a nucleotide sequence comprising one, two, or three modifications, e.g., substitutions, insertions, or deletions, but no more than four modifications, e.g., substitutions, insertions, or deletions, relative to the nucleotide sequence of GATAGTTA.
- the encoded miR binding site is complementary (e.g., fully or partially complementary) to a miR expressed in hematopoietic lineage, including immune cells (e.g., antigen presenting cells or APC, including dendritic cells (DCs), macrophages, and B-lymphocytes).
- the encoded miR binding site complementary to a miR expressed in hematopoietic lineage comprises a nucleotide sequence disclosed, e.g., in US 2018/0066279, the contents of which are incorporated by reference herein in its entirety.
- the encoded miR binding site or encoded miR binding site series comprises a miR-142-3p binding site sequence.
- the encoded miR-142-3p binding site comprises the nucleotide sequence of TCCATAAAGTAGGAAACACTACA (SEQ ID NO: 4675), a nucleotide sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, at least 95%, at least 99%, or 100% sequence identity, or comprising at least one, two, three, four, five, six, or seven modifications, e.g., substitutions, insertions, or deletions, but no more than ten modifications, e.g., substitutions, insertions, or deletions, relative to the nucleotide sequence of SEQ ID NO: 4675, e.g., wherein the modification can result in a mismatch between the encoded miR binding site and the corresponding miRNA.
- the viral genome comprises at least 2, 3, 4, or 5 copies of the encoded miR-142-3p binding site, e.g., an encoded miR-142-3p binding site series.
- the at least 2, 3, 4, or 5 copies (e.g., 2 or 3 copies) of the encoded miR-142-3p binding site are continuous (e.g., not separated by a spacer) or separated by a spacer.
- the spacer is about 1 to 6 nucleotides or about 5 to 10 nucleotides, e.g., about 7-8 nucleotides or about 8 nucleotides, in length.
- the spacer sequence comprises one or more of (i) GGAT; (ii) CACGTG; (iii) GCATGC, or a repeat of one or more of (i)- (iii).
- the spacer comprises the nucleotide sequence of GATAGTTA, or a nucleotide sequence comprising one, two, or three modifications, e.g., substitutions, insertions, or deletions, but no more than four modifications, e.g., substitutions, insertions, or deletions, relative to the nucleotide sequence of GATAGTTA.
- the encoded miR binding site is complementary (e.g., fully complementary or partially complementary) to a miR expressed in a DRG (dorsal root ganglion) neuron, e.g., a miR183, a miR182, and/or miR96 binding site.
- the encoded miR binding site is complementary to a miR expressed in expressed in a DRG neuron comprises a nucleotide sequence disclosed, e.g., in WO2020/132455, the contents of which are incorporated by reference herein in its entirety.
- the encoded miR binding site or encoded miR binding site series comprises a miR183 binding site sequence.
- the encoded miR183 binding site comprises the nucleotide sequence of AGTGAATTCTACCAGTGCCATA (SEQ ID NO: 4676), or a nucleotide sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, at least 95%, at least 99%, or 100% sequence identity, or comprising at least one, two, three, four, five, six, or seven modifications, e.g., substitutions, insertions, or deletions, but no more than ten modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to the nucleotide sequence of SEQ ID NO: 4676, e.g., wherein the modification can result in a mismatch between the encoded miR binding site and the corresponding miRNA.
- the sequence complementary to the seed sequence corresponds to the double underlined of the encoded miR-183 binding site sequence.
- the viral genome comprises at least comprises at least 2, 3, 4, or 5 copies (e.g., at least 2 or 3 copies) of the encoded miR183 binding site, e.g., an encoded miR183 binding site.
- the at least 2, 3, 4, or 5 copies (e.g., 2 or 3 copies) of the encoded miR183 binding site are continuous (e.g., not separated by a spacer) or separated by a spacer.
- the spacer is about 1 to 6 nucleotides or about 5 to 10 nucleotides, e.g., about 7-8 nucleotides or about 8 nucleotides, in length.
- the spacer comprises the nucleotide sequence of GATAGTTA, or a nucleotide sequence comprising one, two, or three modifications, e.g., substitutions, insertions, or deletions, but no more than four modifications, e.g., substitutions, insertions, or deletions, relative to the nucleotide sequence of GATAGTTA.
- the spacer sequence comprises one or more of (i) GGAT; (ii) CACGTG; (iii) GCATGC, or a repeat of one or more of (i)-(iii).
- the encoded miR binding site or the encoded miR binding site series comprises a miR182 binding site sequence.
- the encoded miR182 binding site comprises, the nucleotide sequence of AGTGTGAGTTCTACCATTGCCAAA (SEQ ID NO: 4677), a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, at least 95%, at least 99%, or 100% sequence identity, or comprising at least one, two, three, four, five, six, or seven modifications, e.g., substitutions, insertions, or deletions, but no more than ten modifications, e.g., substitutions, insertions, or deletions, relative to the nucleotide sequence of SEQ ID NO: 4677, e.g., wherein the modification can result in a mismatch between the encoded miR binding site and the corresponding miRNA.
- the viral genome comprises at least 2, 3, 4, or 5 copies of the encoded miR182 binding site, e.g., an encoded miR182 binding site series.
- the at least 2, 3, 4, or 5 copies (e.g., 2 or 3 copies) of the encoded miR182 binding site are continuous (e.g., not separated by a spacer) or separated by a spacer.
- the spacer is about 1 to 6 nucleotides or about 5 to 10 nucleotides, e.g., about 7-8 nucleotides or about 8 nucleotides, in length.
- the spacer comprises the nucleotide sequence of GATAGTTA, or a nucleotide sequence comprising one, two, or three modifications, e.g., substitutions, insertions, or deletions, but no more than four modifications, e.g., substitutions, insertions, or deletions, relative to the nucleotide sequence of GATAGTTA.
- the spacer sequence comprises one or more of (i) GGAT; (ii) CACGTG; (iii) GCATGC, or a repeat of one or more of (i)-(iii).
- the encoded miR binding site or the encoded miR binding site series comprises a miR96 binding site sequence.
- the encoded miR96 binding site comprises the nucleotide sequence of AGCAAAAATGTGCTAGTGCCAAA (SEQ ID NO: 4678), a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, at least 95%, at least 99%, or 100% sequence identity, or comprising at least one, two, three, four, five, six, or seven modifications, e.g., substitutions, insertions, or deletions, but no more than ten modifications, e.g., substitutions, insertions, or deletions, relative to the nucleotide sequence of SEQ ID NO: 4678, e.g., wherein the modification can result in a mismatch between the encoded miR binding site and the corresponding miRNA.
- the viral genome comprises at least 2, 3, 4, or 5 copies of the encoded miR96 binding site, e.g., an encoded miR96 binding site series.
- the at least 2, 3, 4, or 5 copies (e.g., 2 or 3 copies) of the encoded miR96 binding site are continuous (e.g., not separated by a spacer) or separated by a spacer.
- the spacer is about 1 to 6 nucleotides or about 5 to 10 nucleotides, e.g., about 7-8 nucleotides or about 8 nucleotides, in length.
- the spacer comprises the nucleotide sequence of GATAGTTA, or a nucleotide sequence comprising one, two, or three modifications, e.g., substitutions, insertions, or deletions, but no more than four modifications, e.g., substitutions, insertions, or deletions, relative to the nucleotide sequence of GATAGTTA.
- the spacer sequence comprises one or more of (i) GGAT; (ii) CACGTG; (iii) GCATGC, or a repeat of one or more of (i)-(iii).
- the encoded miR binding site series comprises a miR122 binding site, a miR-1, a miR142 binding site, a miR183 binding site, a miR182 binding site, a miR 96 binding site, or a combination thereof.
- the encoded miR binding site series comprises at least 2, 3, 4, or 5 copies of a miR122 binding site, a miR142 binding site, a miR183 binding site, a miR182 binding site, a miR 96 binding site, or a combination thereof.
- at least two of the encoded miR binding sites are connected directly, e.g., without a spacer.
- the spacer is at least about 5 to 10 nucleotides, e.g., about 7-8 nucleotides or about 8 nucleotides, in length.
- the spacer coding sequence or reverse complement thereof comprises one or more of (i) GGAT; (ii) CACGTG; (iii) GCATGC, or a repeat of one or more of (i)-(iii).
- the spacer comprises the nucleotide sequence of GATAGTTA, or a nucleotide sequence comprising one, two, or three modifications, e.g., substitutions, insertions, or deletions, but no more than four modifications, e.g., substitutions, insertions, or deletions, relative to the nucleotide sequence of GATAGTTA.
- an encoded miR binding site series comprises at least 2-5 copies (e.g., 2 or 3 copies) of a combination of at least two, three, four, five, or all of a miR-1, miR122 binding site, a miR142 binding site, a miR183 binding site, a miR182 binding site, a miR96 binding site, wherein each of the miR binding sites within the series are continuous (e.g., not separated by a spacer) or are separated by a spacer.
- the spacer is about 1 to 6 nucleotides or about 5 to 10 nucleotides, e.g., about 7-8 nucleotides or about 8 nucleotides, in length.
- the spacer sequence comprises one or more of (i) GGAT; (ii) CACGTG; (iii) GCATGC, or a repeat of one or more of (i)-(iii).
- the spacer comprises the nucleotide sequence of GATAGTTA, or a nucleotide sequence comprising at least one, two, or three modifications, e.g., substitutions, insertions, or deletions, but no more than four modifications, e.g., substitutions, insertions, or deletions, relative to the nucleotide sequence of GATAGTTA.
- an encoded miR binding site series comprises at least 2-5 copies (e.g., 2 or 3 copies) of a combination of a miR-122 binding site and a miR-1 binding site, wherein each of the miR binding sites within the series are continuous (e.g., not separated by a spacer) or are separated by a spacer.
- the spacer is about 1 to 6 nucleotides or about 5 to 10 nucleotides, e.g., about 7-8 nucleotides or about 8 nucleotides, in length.
- the spacer sequence comprises one or more of (i) GGAT; (ii) CACGTG; (iii) GCATGC, or a repeat of one or more of (i)-(iii).
- the spacer comprises the nucleotide sequence of GATAGTTA, or a nucleotide sequence comprising one, two, or three modifications, e.g., substitutions, insertions, or deletions, but no more than four modifications, e.g., substitutions, insertions, or deletions, relative to the nucleotide sequence of GATAGTTA.
- the AAV particle described herein may comprise a single-stranded or double-stranded viral genome.
- the size of the viral genome may be small, medium, large or the maximum size.
- the viral genome may comprise a promoter and a polyA tail.
- the viral genome may be a small single stranded viral genome.
- a small single stranded viral genome may be 2.1 to 3.5 kb in size such as, but not limited to, about 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, and 3.5 kb in size.
- the viral genome may be a small double stranded viral genome.
- a small double stranded viral genome may be 1.3 to 1.7 kb in size such as, but not limited to, about 1.3, 1.4, 1.5, 1.6, and 1.7 kb in size.
- the viral genome may be a medium single stranded viral genome.
- a medium single stranded viral genome may be 3.6 to 4.3 kb in size such as, but not limited to, about 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2 and 4.3 kb in size.
- the viral genome may be a medium double stranded viral genome.
- a medium double stranded viral genome may be 1.8 to 2.1 kb in size such as, but not limited to, about 1.8, 1.9, 2.0, and 2.1 kb in size.
- the viral genome may be a large single stranded viral genome.
- a large single stranded viral genome may be 4.4 to 6.0 kb in size such as, but not limited to, about 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9 and 6.0 kb in size.
- the viral genome may be a large double stranded viral genome.
- a large double stranded viral genome may be 2.2 to 3.0 kb in size such as, but not limited to, about 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9 and 3.0 kb in size.
- an AAV particle of the present disclosure (e.g., an AAV particle comprising an AAV capsid variant described herein) comprises a viral genome comprising a nucleic acid encoding a payload.
- the encoded payload is an RNAi agent or a polypeptide.
- a payload of the present disclosure may be, but is not limited to, a peptide, a polypeptide, a protein, an antibody, an RNAi agent, etc.
- the nucleotide sequence encoding a payload may comprise a combination of coding and non-coding nucleic acid sequences.
- the nucleotide sequence encoding the payload may encode a coding or non-coding RNA.
- the AAV particles described herein e.g., an AAV particle comprising an AAV capsid variant, comprises a nucleic acid encoding a payload.
- the encoded payload comprises a therapeutic protein, an antibody, an enzyme, one or more components of a genome editing system, and/or an RNAi agent (e.g., a dsRNA, siRNA, shRNA, pre-miRNA, pri-miRNA, miRNA, stRNA, lncRNA, piRNA, or snoRNA).
- the encoded payload modulates, e.g., increases or decreases, the presence, level, and/or activity of a gene, mRNA, protein, or a combination thereof, e.g., in a cell or a tissue.
- polypeptides [0302]
- the encoded payload of the AAV particle comprising an AAV capsid polypeptide, e.g., an AAV capsid variant, described herein comprises a polypeptide, protein, or peptide, e.g., a polypeptide, protein, or peptide described herein.
- the nucleic acid encoding the payload may encode a product of any known gene and/or a recombinant version thereof.
- the nucleic acid encoding the payload may encode at least one allele of apolipoprotein E (APOE) such as, but not limited to ApoE2, ApoE3 and/or ApoE4.
- APOE apolipoprotein E
- the nucleic acid encoding the payload encodes ApoE2 (cys112, cys158) protein or a fragment or variant thereof.
- the nucleic acid encoding the payload encodes an ApoE3 (cys112, arg158) protein or fragment or variant thereof.
- the nucleic acid encoding the payload encodes ApoE4 (arg112, arg158).
- the encoded payload comprises an aromatic L-amin acid decarboxylase (AADC) protein.
- the encoded payload comprises an antibody, or a fragment thereof.
- the encoded payload comprises a human survival of motor neuron (SMN) 1 or SMN2 protein, or fragments or variants thereof.
- the encoded payload region comprises a glucocerebrosidase (GBA1) protein, or a fragment or variant thereof.
- the encoded payload comprises a granulin precursor or progranulin (GRN) protein, or a fragment or variant thereof.
- the encoded payload comprises an aspartoacylase (ASPA) protein, or a fragment or variant thereof.
- ASPA aspartoacylase
- the encoded payload comprises a tripeptidyl peptidase I (CLN2) protein, or a fragment or variant thereof.
- the encoded payload comprises a beta-galactosidase (GLB1) protein, or a fragment or variant thereof.
- the encoded payload comprises a N-sulphoglucosamine sulphohydrolase (SGSH) protein, or a fragment or variant thereof.
- the encoded payload comprises an N-acetyl-alpha- glucosaminidase (NAGLU) protein, or a fragment or variant thereof.
- the encoded payload comprises an iduronate 2-sulfatase (IDS) protein, or a fragment or variant thereof.
- the encoded payload comprises an intracellular cholesterol transporter (NPC1) protein, or a fragment or variant thereof.
- the encoded payload comprises a gigaxonin (GAN) protein, or a fragment or variant thereof.
- the AAV viral genomes encoding polypeptides described herein may be useful in the fields of human disease, viruses, infections veterinary applications and a variety of in vivo and in vitro settings.
- Amino acid sequences of a payload polypeptide encoded by a viral genome described herein may be translated as a whole polypeptide, a plurality of polypeptides or fragments of polypeptides, which independently may be encoded by one or more nucleic acids, fragments of nucleic acids or variants of any of the aforementioned.
- Antibodies and Antibody Binding Fragments [0304]
- the encoded payload of AAV particle comprising an AAV capsid variant described herein comprises an antibody or antibody binding fragment.
- the antibody may be a full antibody, a fragment, or any functional variant thereof.
- an antibody may be a native antibody (e.g., with two heavy and two light chains), a heavy chain variable region, a light chain variable region, a heavy chain constant region, a light chain constant region, Fab, Fab’, F(ab’) 2 , Fv, or scFv fragments, a diabody, a linear antibody, a single-chain antibody, a multi-specific antibody, an intrabody, one or more heavy chain complementarity determining regions (CDR), one or more light chain CDRs, a bi-specific antibody, a monoclonal antibody, a polyclonal antibody, a humanized antibody, an antibody mimetic, an antibody variant, a miniaturized antibody, a unibody, a maxibody, and/or a chimeric antigen receptor.
- CDR heavy chain complementarity determining regions
- the encoded antibody or antibody binding fragment may be useful in the treatment of a neurological disease, a neurodegenerative disorder, a muscular disease, a neuromuscular disorder, a neuro-oncological disorder, or any disorder associated with the central and/or peripheral nervous systems.
- the viral genome of the AAV particle e.g., an AAV particle comprising an AAV capsid variant described herein
- the viral genome of the AAV particle may comprise a nucleic acid which has been engineered to enable or enhance the expression of an antibody, or antibody binding fragment thereof.
- the encoded antibody of the payload of an AAV particle comprising an AAV capsid variant, described herein comprises at least one immunoglobulin variable domain sequence.
- An antibody may include, for example, full-length, mature antibodies and antigen- binding fragments of an antibody.
- an antibody can include a heavy (H) chain variable domain sequence (VH), and a light (L) chain variable domain sequence (VL).
- an antibody includes two heavy (H) chain variable domain sequences and two light (L) chain variable domain sequence, thereby forming two antigen binding sites, such as Fab, Fab’, F(ab’) 2 , Fc, Fd, Fd’, Fv, single chain antibodies (scFv for example), single variable domain antibodies, diabodies (Dab) (bivalent and bispecific), and chimeric (e.g., humanized) antibodies, which may be produced by the modification of whole antibodies or those synthesized de novo using recombinant DNA technologies.
- the antibody binding fragment comprises at least one portion of an intact antibody, or recombinant variants thereof, and refers to the antigen binding domain, for example, an antigenic determining variable region of an intact antibody, that is sufficient to confer recognition and specific binding of the antibody fragment to a target, such as an antigen.
- antigen binding fragments include: (i) a Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CH1 domains; (ii) a F(ab’)2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a Fd fragment consisting of the VH and CH1 domains; (iv) a Fv fragment consisting of the VL and VH domains of a single arm of an antibody, (v) a diabody (dAb) fragment, which consists of a VH domain; (vi) a camelid or camelized variable domain; (vii) a single chain Fv (scFv), see e.g., Bird et al.
- a Fab fragment a monovalent fragment consisting of the VL, VH, CL and CH1 domains
- a F(ab’)2 fragment a bivalent fragment comprising two Fab fragments linked by a disul
- the encoded antibody of the payload of an AAV particle described herein comprises a multispecific antibody, e.g., it comprises a plurality of immunoglobulin variable domains sequences, wherein a first immunoglobulin variable domain sequence of the plurality has binding specificity for a first epitope and a second immunoglobulin variable domain sequence of the plurality has binding specificity for a second epitope.
- the first and second epitopes are on the same antigen, e.g., the same protein (or subunit of a multimeric protein).
- the first and second epitopes overlap. In some embodiments, the first and second epitopes do not overlap.
- the first and second epitopes are on different antigens, e.g., the different proteins (or different subunits of a multimeric protein).
- a multispecific antibody comprises a third, fourth or fifth immunoglobulin variable domain.
- a multispecific antibody is a bispecific antibody, a trispecific antibody, or tetraspecific antibody.
- an encoded multispecific antibody of the payload of an AAV particle described herein is an encoded bispecific antibody.
- a bispecific antibody has specificity for no more than two antigens.
- a bispecific antibody is characterized by a first immunoglobulin variable domain sequence which has binding specificity for a first epitope and a second immunoglobulin variable domain sequence that has binding specificity for a second epitope.
- the first and second epitopes are on the same antigen, e.g., the same protein (or subunit of a multimeric protein).
- the first and second epitopes overlap.
- the first and second epitopes do not overlap.
- the first and second epitopes are on different antigens, e.g., the different proteins (or different subunits of a multimeric protein).
- an antibody or an antibody binding fragment encoded by a viral genome of an AAV particle described herein may be, but is not limited to, an antibody or antibody fragment that binds to ⁇ -amyloid, APOE, tau, SOD1, TDP-43, huntingtin, and/or synuclein.
- the encoded payload comprises an antibody or antibody fragment that binds to a neuro-oncology related target, e.g., HER2, EGFR (e.g., EGFRvIII).
- the encoded payload comprises an antibody that binds to HER2/neu.
- the encoded payload comprises an antibody that binds to ⁇ -amyloid.
- the encoded payload comprises an antibody that binds to tau.
- Gene Editing System [0311]
- the encoded payload of AAV particle comprising an AAV capsid variant described herein comprises a gene editing system or one or more components thereof.
- the gene editing system comprises nucleic acid sequences that encode proteins having enzymatic activity to (i) selectively induce double or single stranded breaks in a DNA or RNA sequence, or (ii) substitute, insert or delete a particular base or set of bases of a DNA or RNA sequence in the absence of a double or single stranded break in the DNA or RNA.
- the gene editing system includes, but is not limited to a CRISPR-Cas system (including different Cas or Cas-related nucleases), a Zinc finger nuclease, a meganuclease, a TALEN or a base editors.
- the gene editing system comprises a chromosomal integration of a transgene, e.g., introduced by a parvovirus vector in the absence of an exogenous nuclease or an enzymatic entity.
- RNAi agents [0312]
- the encoded payload of AAV particle comprising an AAV capsid variant described herein comprises an RNAi agent, e.g., an RNAi agent described herein.
- the encoded payload of a viral genome of an AAV particle comprising an AAV capsid variant described herein comprises an RNAi agent, the RNAi, such as but not limited to, a dsRNA, a siRNA, a shRNA, a pre-miRNA, a pri-miRNA, a miRNA, a stRNA, a lncRNA, a piRNA, or a snoRNA.
- RNAi agent such as but not limited to, a dsRNA, a siRNA, a shRNA, a pre-miRNA, a pri-miRNA, a miRNA, a stRNA, a lncRNA, a piRNA, or a snoRNA.
- the encoded payload comprises an RNAi agent for inhibiting expression of a SOD1, MAPT, APOE, HTT, C9ORF72, TDP-43, APP, BACE, SNCA, ATXN1, ATXN3, ATXN7, SCN1A-SCN5A, or SCN8A-SCN11A gene, protein, and/or mRNA.
- the RNAi agent encoded by a viral genome described herein inhibits SOD1, MAPT, APOE, HTT, C9ORF72, TDP-43, APP, BACE, SNCA, ATXN1, ATXN3, ATXN7, SCN1A-SCN5A, or SCN8A-SCN11A.
- An AAV particle comprising an AAV capsid variant described herein may comprise a viral genome encoding an RNAi agent, which targets the mRNA of a gene to modulate, e.g., interfere with gene expression and/or protein production.
- the RNAi agent may target a gene at the location of a single- nucleotide polymorphism (SNP) or variant within the nucleotide sequence of the gene.
- SNP single- nucleotide polymorphism
- the RNAi agent may be an siRNA duplex, wherein the siRNA duplex contains an antisense strand (guide strand) and a sense strand (passenger strand) hybridized together forming a duplex structure, wherein the antisense strand is complementary to the nucleic acid sequence of the targeted gene, and wherein the sense strand is homologous to the nucleic acid sequence of the targeted gene.
- the 5’end of the antisense strand has a 5’ phosphate group and the 3’end of the sense strand contains a 3’hydroxyl group. In other aspects, there are none, one or 2 nucleotide overhangs at the 3’end of each strand.
- Each strand of an siRNA duplex targeting a gene of interest may be about 19 to 25, 19 to 24 or 19 to 21 nucleotides in length, preferably about 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, or 25 nucleotides in length.
- an siRNA or dsRNA includes at least two sequences that are complementary to each other.
- the dsRNA includes a sense strand having a first sequence and an antisense strand having a second sequence.
- the antisense strand includes a nucleotide sequence that is substantially complementary to at least part of an mRNA encoding the target gene, and the region of complementarity is 30 nucleotides or less, and at least 15 nucleotides in length.
- the dsRNA is 19 to 25, 19 to 24 or 19 to 21 nucleotides in length.
- the dsRNA is from about 15 to about 25 nucleotides in length, and in other embodiments the dsRNA is from about 25 to about 30 nucleotides in length.
- the dsRNA is about 15 nucleotides in length, 16 nucleotides in length, 17 nucleotides in length, 18 nucleotides in length, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides in length, 26 nucleotides in length, 27 nucleotides in length, 28 nucleotides in length, 29 nucleotides in length, or 30 nucleotides in length.
- the encoded RNAi agent is an siRNA.
- the RNAi agent e.g., an RNAi agent described herein inhibits the expression of the gene, mRNA, and/or protein by at least 10%, at least 20%, at least 25%, at least 30%, at least 35% or at least 40% or more, such as when assayed by a method known in the art.
- the RNAi agent inhibits expression of a gene, mRNA, and protein by 50-100%, e.g., by 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95% and 100%.
- the AAV particle described herein comprising a viral genome encoding an RNAi agent targeting a gene of interest is administered to a subject in need for treating and/or ameliorating a disease, e.g., a neurological disorder of any disease associated with the central or peripheral nervous systems.
- a disease e.g., a neurological disorder of any disease associated with the central or peripheral nervous systems.
- An AAV particle described herein e.g., an AAV particle comprising an AAV capsid variant described herein
- the siRNA molecules are designed and used to knock out target gene variants in cells, e.g., transcripts that are identified in neurological disease. In some aspects, the siRNA molecules are designed and used to knock down target gene variants in cells. [0322] Some guidelines for designing siRNAs (for insertion into a viral genome of the AAV particles described herein) have been proposed in the art. These guidelines generally recommend generating a 19-nucleotide duplexed region, symmetric 2-3 nucleotide 3’overhangs, 5-phosphate and 3-hydroxyl groups targeting a region in the gene to be silenced.
- siRNA sequence preference include, but are not limited to, (i) A/U at the 5′ end of the antisense strand; (ii) G/C at the 5′ end of the sense strand; (iii) at least five A/U residues in the 5′ terminal one ⁇ third of the antisense strand; and (iv) the absence of any GC stretch of more than 9 nucleotides in length.
- highly effective siRNA molecules essential for suppressing mammalian target gene expression may be readily designed.
- the sense and/or antisense strand is designed based on the method and rules outlined in European Patent Publication No.
- the 3’-terminal base of the sequence is adenine, thymine or uracil.
- the 5’-terminal base of the sequence is guanine or cytosine.
- the 3’-terminal sequence comprises seven bases rich in one or more bases of adenine, thymine and uracil.
- an siRNA molecule comprises a sense strand and a complementary antisense strand in which both strands are hybridized together to form a duplex structure.
- the antisense strand has sufficient complementarity to the target mRNA sequence to direct target-specific RNAi, e.g., the siRNA molecule has a sequence sufficient to trigger the destruction of the target mRNA by the RNAi machinery or process.
- the antisense strand and target mRNA sequences have 100% complementarity.
- the antisense strand may be complementary to any part of the target mRNA sequence. Neither the identity of the sense sequence nor the homology of the antisense sequence need be 100% complementary to the target.
- the antisense strand and target mRNA sequences comprise at least one mismatch.
- the antisense strand and the target mRNA sequence have at least 50-90%, 50-95%, 50-99%, 60-70%, 60-80%, 60-90%, 60-95%, 60-99%, 70-80%, 70-90%, 70-95%, 70-99%, 80-90%, 80-95%, 80-99%, 90-95%, 90-99% or 95-99% complementary.
- the siRNA molecule may have a length from about 10-50 or more nucleotides, e.g., each strand comprising 10-50 nucleotides (or nucleotide analogs).
- the siRNA molecule has a length from about 15-30, e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in each strand, wherein one of the strands is sufficiently complementary to a target region.
- the siRNA molecule has a length from about 19 to 25, 19 to 24 or 19 to 21 nucleotides.
- the siRNA molecule can be a synthetic RNA duplex comprising about 19 nucleotides to about 25 nucleotides, and two overhanging nucleotides at the 3’-end.
- the siRNA molecule may comprise an antisense sequence and a sense sequence, or a fragment or variant thereof.
- the antisense sequence and the sense sequence have at least 50-90%, 50-95%, 50-99%, 60-70%, 60-80%, 60-90%, 60-95%, 60-99%, 70- 80%, 70-90%, 70-95%, 70-99%, 80-90%, 80-95%, 80-99%, 90-95%, 90-99% or 95-99% complementary.
- the sense and antisense sequences may be completely complementary across a substantial portion of their length. In other embodiments, the sense sequence and antisense sequence may be at least 70, 80, 90, 95 or 99% complementary across independently at least 50, 60, 70, 80, 85, 90, 95, or 99% of the length of the strands.
- the sense and antisense strands of a siRNA duplex are linked by a short spacer sequence leading to the expression of a stem-loop structure termed short hairpin RNA (shRNA).
- shRNA short hairpin RNA
- the hairpin is recognized and cleaved by Dicer, thus generating mature siRNA molecules.
- the siRNA molecules, as well as associated spacer and/or flanking regions once designed can be encoded by the viral genome of the AAV particles described herein, for delivery to a cell.
- the siRNA molecules may be encoded in a modulatory polynucleotide which also comprises a molecular scaffold.
- the modulatory polynucleotide which comprises the payload includes a molecular scaffold which comprises a 5’ flanking sequence, a loop region, and/or a 3’ flanking region.
- a 5’ or 3’ flanking region may be of any length and may a wild type microRNA sequence or a portion thereof, or may be completely artificial.
- a 3’ flanking sequence may mirror the 5’ flanking sequence in size and origin. Either flanking sequence may be absent. In one embodiment, both the 5’ and 3’ flanking sequences are absent.
- the 3’ flanking sequence may optionally contain one or more CNNC motifs, where “N” represents any nucleotide.
- the loop comprises at least one UGUG motif.
- the UGUG motif is located at the 5’ terminus of the loop.
- the 5’ and 3’ flanking sequences are the same sequence. In some embodiments they differ by 2%, 3%, 4%, 5%, 10%, 20% or more than 30% when aligned to each other.
- modulatory polynucleotide comprises a stem loop structure.
- the modulatory polynucleotide comprises in 5’ to 3’ order: a 5’ flanking sequence, a guide strand sequence, a loop region, a passenger strand sequence, and a 3’ flanking sequence. In some embodiments, the modulatory polynucleotide comprises in 5’ to 3’ order: a 5’ flanking sequence, a passenger strand sequence, a loop region, a guide strand sequence, and a 3’ flanking sequence. [0336]
- the molecular scaffold comprises a dual-function targeting modulatory polynucleotide.
- the molecular scaffold may comprise one or more linkers known in the art. The linkers may separate regions or one molecular scaffold from another.
- the molecular scaffold may be polycistronic.
- the modulatory polynucleotide is designed using at least one of the following properties: loop variant, seed mismatch/bulge/wobble variant, stem mismatch, loop variant and basal stem mismatch variant, seed mismatch and basal stem mismatch variant, stem mismatch and basal stem mismatch variant, seed wobble and basal stem wobble variant, or a stem sequence variant.
- Viral production disclosed herein describes processes and methods for producing AAV particles (with enhanced, improved and/or increased tropism for a target tissue), e.g., an AAV particle comprising an AAV capsid variant that may be used to contact a target cell to deliver a payload.
- a method of making AAV particle of the present disclosure comprising: (i) providing a host cell comprising a viral genome described herein and (ii) incubating the host cell under conditions suitable to enclose the viral genome in an AAV capsid variant, e.g., an AAV capsid variant described herein (e.g., an AAV capsid variant listed in Tables 3, 4, or 5), thereby making the AAV particle.
- the method comprises prior to step (i), introducing a first nucleic acid comprising the viral genome into a cell.
- the host cell comprises a second nucleic acid encoding the AAV capsid variant.
- the second nucleic acid is introduced into the host cell prior to, concurrently with, or after the first nucleic acid molecule.
- the AAV particle described herein is an isolated AAV particle.
- the AAV particle described herein is a recombinant AAV particle. [0340] Any method known in the art may be used for the preparation of AAV particles.
- AAV particles are produced in mammalian cells (e.g., HEK293).
- AAV particles are produced in insect cells (e.g., Sf9).
- the AAV particles are made using the methods described in International Patent Publication WO2015191508, the contents of which are herein incorporated by reference in their entirety.
- the present disclosure provides a method for treating a disease, disorder and/or condition in a subject, including a human subject, comprising administering to the subject an AAV particle described herein, e.g., an AAV particle comprising an AAV capsid variant (e.g., an AAV capsid variant described herein), or administering to the subject any of the described compositions, including a pharmaceutical composition, described herein.
- an AAV particle of the present disclosure e.g., an AAV particle comprising an AAV capsid variant described herein, e.g., an AAV5 capsid variant
- the AAV particle (e.g., an AAV particle comprising an AAV capsid variant) of the present disclosure are administered to treat (e.g., lessen the effects of) a disease or symptoms thereof.
- the AAV particle of the present disclosure e.g., an AAV particle comprising an AAV capsid variant
- cure eliminate
- the AAV particle (e.g., an AAV particle comprising an AAV capsid variant) of the present disclosure are administered to prevent or slow progression of disease.
- the AAV particle (e.g., an AAV particle comprising an AAV capsid variant) of the present disclosure are used to reverse the deleterious effects of a disease.
- the AAV particle of the disclosure (e.g., an AAV particle comprising an AAV capsid variant) is useful for treatment, prophylaxis, palliation or amelioration of a genetic disorder, e.g., an autosomal dominant genetic disorder, an autosomal recessive disorder, X- linked dominant genetic disorder, an X-linked recessive genetic disorder, or a Y-linked genetic disorder.
- a genetic disorder e.g., an autosomal dominant genetic disorder, an autosomal recessive disorder, X- linked dominant genetic disorder, an X-linked recessive genetic disorder, or a Y-linked genetic disorder.
- the genetic disorder is a monogenetic disorder or a polygenic disorder.
- treatment of a genetic disorder comprises the use of an AAV particle described herein (e.g., an AAV particle comprising an AAV capsid variant described herein) for a gene replacement therapy.
- an AAV particle described herein e.g., an AAV particle comprising an AAV capsid variant described herein
- method for treating a neurological disorder and/or neurodegenerative disorder in a subject comprising administering to the subject an effective amount of a pharmaceutical composition described herein or an AAV particle, e.g., a plurality of particles, comprising an AAV capsid variant described herein.
- treatment of a neurological disorder and/or neurodegenerative disorder comprises prevention of said neurological disorder and/or neurological disorder.
- the AAV particle (e.g., an AAV particle comprising an AAV capsid variant) of the disclosure is useful for the treatment, prophylaxis, palliation or amelioration of neurological diseases and/or disorders.
- the AAV particle of the disclosure e.g., an AAV particle comprising an AAV capsid variant
- the AAV particle of the disclosure e.g., an AAV particle comprising an AAV capsid variant
- treatment of Alzheimer’s Disease comprises the use of an AAV particle described herein (e.g., an AAV particle comprising an AAV capsid variant described herein) for a gene replacement therapy.
- the payload encoded by an AAV particle comprising a capsid variant described herein comprises an ApoE2 protein, ApoE4 protein, an ApoE3 protein, BDNF protein, CYP46A1 protein, Klotho protein, fractalkine (FKN) protein, neprilysin protein (NEP), CD74 protein, caveolin-1, or a combination or variant thereof.
- treatment of Alzheimer’s Disease comprises the use of an AAV particle described herein (e.g., an AAV particle comprising an AAV capsid variant described herein) for a reduction in the expression of a tau gene and/or protein, a synuclein gene and/or protein, or a combination or variant thereof.
- the payload encoded by an AAV particle comprising a capsid variant described herein comprises an antibody that binds to tau or synuclein, an RNAi agent for inhibiting tau or synuclein, a gene editing system (e.g., a CRISPR-Cas system) for altering tau or synuclein expression, or a combination thereof.
- the AAV particle of the disclosure is for the treatment, prophylaxis, palliation or amelioration of frontal temporal dementia.
- treatment of frontal temporal dementia comprises the use of an AAV particle described herein (e.g., an AAV particle comprising an AAV capsid variant described herein) for a gene replacement therapy.
- the payload encoded by an AAV particle comprising a capsid variant described herein comprises a progranulin protein or variant thereof.
- the AAV particle of the disclosure is useful for the treatment, prophylaxis, palliation or amelioration of Parkinson’s Disease.
- treatment of Parkinson’s disease comprises the use of an AAV particle described herein (e.g., an AAV particle comprising an AAV capsid variant described herein) for a gene replacement therapy.
- the payload encoded by an AAV particle comprising a capsid variant described herein comprises an AADC protein, GAD protein, GDNF protein, TH-GCH1 protein, GBA protein, AIMP2-DX2 protein, or a combination or variant thereof.
- treatment of Parkinson’s disease comprises the use of an AAV particle described herein (e.g., an AAV particle comprising an AAV capsid variant described herein) for a gene knock-down therapy or a gene editing therapy (e.g., knock-out, repression, or correction).
- the payload encoded by an AAV particle comprising a capsid variant described herein comprises a modulator, e.g., an RNAi agent or a CRISPR-Cas system, for altering expression of an alpha-synuclein gene, mRNA, and/or protein, or variant thereof.
- the AAV particle of the disclosure is useful for the treatment, prophylaxis, palliation or amelioration of an AADC deficiency.
- treatment of AADC deficiency comprises the use of an AAV particle described herein (e.g., an AAV particle comprising an AAV capsid variant described herein) for a gene replacement therapy.
- the payload encoded by an AAV particle comprising a capsid variant described herein comprises an AADC protein or variant thereof.
- the AAV particle of the disclosure is useful for the treatment, prophylaxis, palliation or amelioration of Amyotrophic lateral sclerosis (ALS).
- treatment of ALS comprises the use of an AAV particle described herein (e.g., an AAV particle comprising an AAV capsid variant described herein) for a gene replacement therapy.
- the payload encoded by an AAV particle comprising a capsid variant described herein comprises an TDP-43 protein, UPF1 protein, C9orf72 protein, CCNF protein, HSF1 protein, Factor H protein, NGF protein, ADAR2 protein, GDNF protein, VEGF protein, HGF protein, NRTN protein, AIMP2-DX2 protein, or a combination or variant thereof.
- treatment of ALS comprises the use of an AAV particle described herein (e.g., an AAV particle comprising an AAV capsid variant described herein) for a gene knock-down therapy or a gene editing therapy (e.g., knock-out, repression, or correction).
- the payload encoded by an AAV particle comprising a capsid variant described herein comprises a modulator, e.g., an RNAi agent or a CRISPR-Cas system, for altering expression of a SOD1 or C9ORF72 gene, mRNA, and/or protein, or a combination or variant thereof.
- a modulator e.g., an RNAi agent or a CRISPR-Cas system
- the AAV particle of the disclosure is useful for the treatment, prophylaxis, palliation or amelioration of Huntington’s Disease.
- treatment of ALS comprises the use of an AAV particle described herein (e.g., an AAV particle comprising an AAV capsid variant described herein) for a gene knock-down (e.g., knock-out) therapy or a gene editing therapy (e.g., knock-out, repression, or correction).
- the payload encoded by an AAV particle comprising a capsid variant described herein comprises a modulator, e.g., an RNAi agent or a CRISPR-Cas system, for altering expression of an HTT gene, mRNA, and/or protein, or a variant thereof.
- the AAV particle of the disclosure is useful for the treatment, prophylaxis, palliation or amelioration of spinal muscular atrophy.
- treatment of spinal muscular atrophy comprises the use of an AAV particle described herein (e.g., an AAV particle comprising an AAV capsid variant described herein) for a gene replacement therapy.
- the payload encoded by an AAV particle comprising a capsid variant described herein comprises an SMN1 protein, an SMN2 protein, or a combination or variant thereof.
- the AAV particle of the disclosure is useful for the treatment, prophylaxis, palliation or amelioration of multiple system atrophy.
- treatment of multiple system atrophy comprises the use of an AAV particle described herein (e.g., an AAV particle comprising an AAV capsid variant described herein) for a gene replacement therapy.
- the AAV particle of the disclosure is useful for the treatment, prophylaxis, palliation or amelioration of Gaucher disease (GD) (e.g., Type 1 GD, Type 2 GD, or Type 3 GD).
- GD Gaucher disease
- the AAV particle of the disclosure is useful for the treatment, prophylaxis, palliation or amelioration of Parkinson’s disease associated with a GBA mutation.
- the AAV particle of the disclosure is useful for the treatment, prophylaxis, palliation or amelioration of dementia with Lewy Bodies (DLB).
- the AAV particle of the disclosure is useful for treatment, prophylaxis, palliation or amelioration of a leukodystrophy, e.g., Alexander disease, autosomal dominant leukodystrophy with autonomic diseases (ADLD), adrenoleukodystrophy (ALD), Canavan disease, cerebrotendinous xanthomatosis (CTX), metachromatic leukodystrophy (MLD), Pelizaeus-Merzbacher disease, or Refsum disease.
- a leukodystrophy e.g., Alexander disease, autosomal dominant leukodystrophy with autonomic diseases (ADLD), adrenoleukodystrophy (ALD), Canavan disease, cerebrotendinous xanthomatosis (CTX), metachromatic leukodystrophy (
- treatment of MLD comprises the use of an AAV particle described herein (e.g., an AAV particle comprising an AAV capsid variant described herein) for a gene replacement therapy.
- the payload encoded by an AAV particle comprising a capsid variant described herein comprises an ARSA protein or variant thereof.
- treatment of ALD comprises the use of an AAV particle described herein (e.g., an AAV particle comprising an AAV capsid variant described herein) for a gene replacement therapy.
- the payload encoded by an AAV particle comprising a capsid variant described herein comprises an ABCD-1 protein or variant thereof.
- the AAV particle of the disclosure is useful for the treatment, prophylaxis, palliation, or amelioration of megalencephalic leukoencephalopathy (MLC).
- treatment of MLC comprises the use of an AAV particle described herein (e.g., an AAV particle comprising an AAV capsid variant described herein) for a gene replacement therapy.
- the payload encoded by an AAV particle comprising a capsid variant described herein comprises an MLC1 protein or variant thereof.
- the AAV particle of the disclosure is useful for the treatment, prophylaxis, palliation, or amelioration of Krabbe disease.
- treatment of Krabbe disease comprises the use of an AAV particle described herein (e.g., an AAV particle comprising an AAV capsid variant described herein) for a gene replacement therapy.
- the payload encoded by an AAV particle comprising a capsid variant described herein comprises a GALC protein or variant thereof.
- the AAV particle of the disclosure is useful for the treatment, prophylaxis, palliation, or amelioration of Mucopolysaccharidosis, e.g., a Type I (MPS I), Type II (MPS II), Type IIIA (MPS IIIA), Type IIIB (MPS IIIB), or Type IIIC (MPS IIIC).
- treatment of Mucopolysaccharidosis comprises the use of an AAV particle described herein (e.g., an AAV particle comprising an AAV capsid variant described herein) for a gene replacement therapy or a gene editing therapy (e.g., enhancement or correction).
- the payload encoded or corrected by an AAV particle comprising a capsid variant described herein comprises an IDUA protein, IDS protein, SGSH protein, NAGLU protein, HGSNAT protein, or a combination or variant thereof.
- the AAV particle of the disclosure e.g., an AAV particle comprising an AAV capsid variant
- treatment of Batten/NCL comprises the use of an AAV particle described herein (e.g., an AAV particle comprising an AAV capsid variant described herein) for a gene replacement therapy.
- the payload encoded by an AAV particle comprising a capsid variant described herein comprises a CLN1 protein, CLN2 protein, CLN3 protein, CLN5 protein, CLN6 protein, CLN7 protein, CLN8 protein, or a combination or variant thereof.
- the AAV particle of the disclosure e.g., an AAV particle comprising an AAV capsid variant
- treatment of Rett Syndrome comprises the use of an AAV particle described herein (e.g., an AAV particle comprising an AAV capsid variant described herein) for a gene replacement therapy.
- the payload encoded by an AAV particle comprising a capsid variant described herein comprises an MeCP2 protein or variant thereof.
- the AAV particle of the disclosure e.g., an AAV particle comprising an AAV capsid variant
- treatment of Angelman Syndrome comprises the use of an AAV particle described herein (e.g., an AAV particle comprising an AAV capsid variant described herein) for a gene replacement therapy.
- the payload encoded by an AAV particle comprising a capsid variant described herein comprises a UBE3A protein or variant thereof.
- the AAV particle of the disclosure is useful for the treatment, prophylaxis, palliation, or amelioration of Fragile X Syndrome.
- treatment of Fragile X Syndrome comprises the use of an AAV particle described herein (e.g., an AAV particle comprising an AAV capsid variant described herein) for a gene replacement therapy.
- the payload encoded by an AAV particle comprising a capsid variant described herein comprises a Reelin protein, a DgkK protein, a FMR1 protein, or a combination or variant thereof.
- the AAV particle of the disclosure is useful for the treatment, prophylaxis, palliation, or amelioration of Canavan Disease.
- treatment of Canavan Disease comprises the use of an AAV particle described herein (e.g., an AAV particle comprising an AAV capsid variant described herein) for a gene replacement therapy.
- the payload encoded by an AAV particle comprising a capsid variant described herein comprises an ASPA protein or variant thereof.
- the AAV particle of the disclosure is useful for the treatment, prophylaxis, palliation, or amelioration of a Gangliosidosis, e.g., a GM1 Gangliosidosis or a GM2 Gangliosidosis (e.g., Tay Sachs Sandhoff).
- a Gangliosidosis e.g., a GM1 Gangliosidosis or a GM2 Gangliosidosis (e.g., Tay Sachs Sandhoff).
- treatment of a Gangliosidosis comprises the use of an AAV particle described herein (e.g., an AAV particle comprising an AAV capsid variant described herein) for a gene replacement therapy.
- an AAV particle described herein e.g., an AAV particle comprising an AAV capsid variant described herein
- the payload encoded by an AAV particle comprising a capsid variant described herein comprises a GLB1 protein, a HEXA protein, a HEXB protein, a GM2A protein, or a combination or variant thereof.
- the AAV particle of the disclosure is useful for the treatment, prophylaxis, palliation, or amelioration of GM3 Synthase Deficiency.
- treatment of GM3 Synthase Deficiency comprises the use of an AAV particle described herein (e.g., an AAV particle comprising an AAV capsid variant described herein) for a gene replacement therapy.
- the payload encoded by an AAV particle comprising a capsid variant described herein comprises an ST3GAL5 protein or variant thereof.
- the AAV particle of the disclosure is useful for the treatment, prophylaxis, palliation, or amelioration of a Niemann-Pick disorder, e.g., a Niemann-Pick A or a Niemann-Pick C1 (NPC-1).
- treatment of a Niemann-Pick disorder comprises the use of an AAV particle described herein (e.g., an AAV particle comprising an AAV capsid variant described herein) for a gene replacement therapy.
- the payload encoded by an AAV particle comprising a capsid variant described herein comprises an ASM protein, an NPC1 protein, or variant thereof.
- the AAV particle of the disclosure e.g., an AAV particle comprising an AAV capsid variant
- Schwannoma e.g., Neuroma
- treatment of Schwannoma comprises the use of an AAV particle described herein (e.g., an AAV particle comprising an AAV capsid variant described herein) for a gene replacement therapy.
- the payload encoded by an AAV particle comprising a capsid variant described herein comprises a Caspase-1 protein or variant thereof.
- the AAV particle of the disclosure e.g., an AAV particle comprising an AAV capsid variant
- the AAV particle of the disclosure is useful for the treatment, prophylaxis, palliation, or amelioration of a Tuberous Sclerosis, e.g., Tuberous Sclerosis Type 1 or Tuberous Sclerosis Type 2.
- treatment of Tuberous Sclerosis comprises the use of an AAV particle described herein (e.g., an AAV particle comprising an AAV capsid variant described herein) for a gene replacement therapy.
- the payload encoded by an AAV particle comprising a capsid variant described herein comprises a TSC1 protein, a TSC2 protein, or variant thereof.
- the AAV particle of the disclosure e.g., an AAV particle comprising an AAV capsid variant
- treatment of a CDKL5 Deficiency comprises the use of an AAV particle described herein (e.g., an AAV particle comprising an AAV capsid variant described herein) for a gene replacement therapy.
- the payload encoded by an AAV particle comprising a capsid variant described herein comprises a CDKL5 protein or variant thereof.
- the AAV particle of the disclosure is useful for the treatment, prophylaxis, palliation, or amelioration of a Charcot-Marie-Tooth disorder, e.g., a Charcot-Marie-Tooth Type 1X (CMT1X) disorder, a Charcot-Marie-Tooth Type 2A (CMT2A) disorder, or a Charcot-Marie-Tooth Type 4J (CMT4J) disorder.
- a Charcot-Marie-Tooth disorder e.g., a Charcot-Marie-Tooth Type 1X (CMT1X) disorder, a Charcot-Marie-Tooth Type 2A (CMT2A) disorder, or a Charcot-Marie-Tooth Type 4J (CMT4J) disorder.
- CMT1X Charcot-Marie-Tooth Type 1X
- CMT2A Charcot-Marie-Tooth Type 2A
- CMT4J Charcot-Marie-Tooth Type 4J
- treatment of a Charcot-Marie-Tooth disorder comprises the use of an AAV particle described herein (e.g., an AAV particle comprising an AAV capsid variant described herein) for a gene replacement therapy.
- the payload encoded by an AAV particle comprising a capsid variant described herein comprises a GJB1 protein, a MFN2 protein, a FIG4 protein, or variant thereof.
- the AAV particle of the disclosure is useful for the treatment, prophylaxis, palliation, or amelioration of an Aspartylglucosaminuria (AGU).
- treatment of an AGU comprises the use of an AAV particle described herein (e.g., an AAV particle comprising an AAV capsid variant described herein) for a gene replacement therapy.
- the payload encoded by an AAV particle comprising a capsid variant described herein comprises an AGA protein or variant thereof.
- the AAV particle of the disclosure is useful for the treatment, prophylaxis, palliation, or amelioration of a Leigh Syndrome.
- treatment of a Leigh Syndrome comprises the use of an AAV particle described herein (e.g., an AAV particle comprising an AAV capsid variant described herein) for a gene replacement therapy.
- the payload encoded by an AAV particle comprising a capsid variant described herein comprises a SURF1 protein or variant thereof.
- the AAV particle of the disclosure is useful for the treatment, prophylaxis, palliation, or amelioration of epilepsy.
- treatment of epilepsy comprises the use of an AAV particle described herein (e.g., an AAV particle comprising an AAV capsid variant described herein) for a gene replacement therapy.
- the payload encoded by an AAV particle comprising a capsid variant described herein comprises an NPY/Y2 protein, a Galanin protein, a Dynorphin protein, an AIMP2-DX2 protein, an SLC6A1 protein, an SLC13A5 protein, a KCNQ2 protein, or variant thereof.
- the AAV particle of the disclosure e.g., an AAV particle comprising an AAV capsid variant
- treatment of Dravet Syndrome comprises the use of an AAV particle described herein (e.g., an AAV particle comprising an AAV capsid variant described herein) for a gene replacement therapy.
- the payload encoded by an AAV particle comprising a capsid variant described herein comprises an SCN1a protein, or variant thereof.
- the AAV particle of the disclosure e.g., an AAV particle comprising an AAV capsid variant
- DMD Duchenne muscular dystrophy
- treatment of DMD comprises the use of an AAV particle described herein (e.g., an AAV particle comprising an AAV capsid variant described herein) for a gene replacement therapy or enhancement (e.g., correction of exon-skipping), or a gene editing therapy (e.g., enhancement or correction).
- the payload encoded or corrected by an AAV particle comprising a capsid variant described herein comprises a Dystrophin gene and/or protein, a Utrophin gene and/or protein, or a GALGT2 gene and/or protein, or a Follistatin gene and/or protein, or a combination or variant thereof.
- the AAV particle of the disclosure is useful for the treatment, prophylaxis, palliation, or amelioration of Pompe Disease.
- treatment of Pompe Disease comprises the use of an AAV particle described herein (e.g., an AAV particle comprising an AAV capsid variant described herein) for a gene replacement therapy.
- the payload encoded by an AAV particle comprising a capsid variant described herein comprises a GAA protein, or variant thereof.
- the AAV particle of the disclosure is useful for the treatment, prophylaxis, palliation, or amelioration of Limb-Girdle Muscular Dystrophy (LGMD2A).
- treatment of LGMD2A comprises the use of an AAV particle described herein (e.g., an AAV particle comprising an AAV capsid variant described herein) for a gene replacement therapy.
- the payload encoded by an AAV particle comprising a capsid variant described herein comprises a CAPN-3 protein, DYSF protein, a SGCG protein, a SGCA protein, a SGCB protein, a FKRP protein, a ANO5 protein, or a combination or variant thereof.
- the AAV particle of the disclosure e.g., an AAV particle comprising an AAV capsid variant
- the AAV particle of the disclosure (e.g., an AAV particle comprising AAV capsid variant) is useful for treatment, prophylaxis, palliation, or amelioration of a disease associated with the central nervous system.
- the AAV particle of the disclosure (e.g., an AAV particle comprising an AAV capsid variant) is useful for treatment, prophylaxis, palliation, or amelioration of a disease associated with the peripheral nervous system.
- the AAV particle of the disclosure is useful for treatment, prophylaxis, palliation, or amelioration of a neuro-oncological disorder in a subject.
- treatment of a neuro-oncological disorder comprises prevention of said neuro-oncological disorder.
- a neuro- oncological disorder comprises a cancer of a primary CNS origin (e.g., a CNS cell, a tissue, or a region), or a metastatic cancer in a CNS cell, tissue, or region.
- Examples of primary CNS cancers could be gliomas (which may include glioblastoma (also known as glioblastoma multiforme), astrocytomas, oligodendrogliomas, and ependymomas, and mixed gliomas), meningiomas, medulloblastomas, neuromas, and primary CNS lymphoma (in the brain, spinal cord, or meninges), among others.
- Examples of metastatic cancers include those originating in another tissue or organ, e.g., breast, lung, lymphoma, leukemia, melanoma (skin cancer), colon, kidney, prostate, or other types that metastasize to brain.
- the AAV particle of the disclosure is useful for the treatment, prophylaxis, palliation, or amelioration of a disease associated with expression of HER2, e.g., a disease associated with overexpression of HER2.
- the AAV particle of the disclosure e.g., an AAV particle comprising an AAV capsid variant
- the HER2-positive cancer is a HER2-positive solid tumor.
- the HER2-positive cancer may be a locally advanced or metastatic HER2-positive cancer.
- the HER2-positive cancer is a HER2-positive breast cancer or a HER2-positive gastric cancer.
- the HER2-positive cancer is selected from the group consisting of a HER2- positive gastroesophageal junction cancer, a HER2- positive colorectal cancer, a HER2-positive lung cancer (e.g., a HER2-positive non-small cell lung carcinoma), a HER2-positive pancreatic cancer, a HER2-positive colorectal cancer, a HER2-positive bladder cancer, a HER2-positive salivary duct cancer, a HER2-positive ovarian cancer (e.g., a HER2- positive epithelial ovarian cancer), or a HER2-positive endometrial cancer.
- the HER2-positive cancer is prostate cancer. In some embodiments, the HER2-positive cancer has metastasized to the central nervous system (CNS). In some instances, the metastasized HER2-cancer has formed CNS neoplasms.
- the AAV particle of the disclosure e.g., an AAV particle comprising an AAV capsid variant
- treatment of a muscular disorder and/or neuromuscular disorder comprises prevention of said muscular disorder and/or neuromuscular disorder.
- the AAV particle of the disclosure is useful for treatment, prophylaxis, palliation or amelioration of a cardiac disease or heart disease and/or method of improving (e.g., enhancing) cardiac function in a subject.
- the cardiac disease is a cardiomyopathy (e.g., arrhythmogenic right ventricular cardiomyopathy, dilated cardiomyopathy, or hypertrophic cardiomyopathy), congestive heart failure, tachycardia (e.g., catecholaminergic polymorphic ventricular tachycardia), ischemic heart disease, and/or myocardial infarction.
- the cardiac disease is a disease associated with expression, e.g., aberrant expression, of LAMP2B, MYBPC3, TNNI3, LMNA, BAG3, DWORF, PKP2, Cx43, TAZ, CASQ2, SERCA2a, I-1c, S100A1 and/or ARC, S100A1, ASCL1, miR133, Mydelta3, Sav, or a combination or variant thereof.
- treatment of a cardiac disorder described herein comprises the use of an AAV particle described herein (e.g., an AAV particle comprising an AAV capsid variant described herein) for a gene replacement therapy.
- the cardiac disease is a genetic disorder, e.g., an autosomal dominant genetic disorder, an autosomal recessive disorder, or an X-linked recessive genetic disorder.
- the cardiomyopathy is a genetic disorder, e.g., a genetic disorder associated with an abnormality (e.g., mutation, insertion, rearrangement and/or deletion) in a gene chosen from TTN, LMNA, MYH7, MYH6, SCN5A, TNNT2, RBM20, TNNI3, MYL2, MYL3, PKP2, DSP, DSG2, DSC2, JUP, or a combination thereof.
- the cardiac disorder is a dilated cardiomyopathy, e.g., a dilated cardiomyopathy associated with an abnormality (e.g., mutation, insertion, rearrangement and/or deletion) in a gene chosen from TTN, LMNA, MIH7, BAG3, MIPN, TNNT2, SCN5A, RBN20, TNPO, LAMA4, VCL, LDB3, TCAP, PSEN1/2, ACTN2, CRYAB, TPM1, ABCC9, ACTC1, PDLIM3, ILK, TNNC1, TNNI3, PLN, DES, SGCD, CSRP3, MIH6, EYA4, ANKRD1, DMD, GATAD1, TAZ/G4.5, or combination thereof.
- a dilated cardiomyopathy e.g., a dilated cardiomyopathy associated with an abnormality (e.g., mutation, insertion, rearrangement and/or deletion) in a gene chosen from TTN, LMNA, MIH7, BAG
- the cardiac disorder is a hypertrophic cardiomyopathy, e.g., a hypertrophic cardiomyopathy associated with an abnormality (e.g., mutation, insertion, rearrangement and/or deletion) in a gene chosen from MYH7, TNNT2, TNNI3, TPM1, MYL2, MYL3, ACTC1, CSRP3, TTN, ACTN2, MYH6, TCAP, TNNC1, or a combination thereof.
- an abnormality e.g., mutation, insertion, rearrangement and/or deletion
- the cardiac disorder is an arrhythmogenic ventricular cardiomyopathy, e.g., an arrhythmogenic ventricular cardiomyopathy associated with an abnormality (e.g., mutation, insertion, rearrangement and/or deletion) in a gene chosen from PKP2, DSG2, DSP, RYR2, DSC2, TGFB3, TMEM43, DES, TTN, LMNA, or a combination thereof.
- an abnormality e.g., mutation, insertion, rearrangement and/or deletion
- the AAV particle of the present disclosure e.g., an AAV particle comprising an AAV capsid polypeptide, e.g., an AAV capsid variant
- an AAV particle of the present disclosure is administered to a subject having or diagnosed with having a disease or disorder described herein.
- Any neurological disease or disorder, neurodegenerative disorder, muscular disorder, neuromuscular disorder, and/or neuro-oncological disorder may be treated with the AAV particles of the disclosure, or pharmaceutical compositions thereof.
- Pharmaceutical Composition and Formulations [0389] According to the present disclosure, an AAV particle comprising an AAV capsid variant described herein may be prepared as a pharmaceutical composition.
- the pharmaceutical composition comprises at least one active ingredients.
- the pharmaceutical composition comprises a pharmaceutically acceptable excipient.
- an AAV particle of the present disclosure can be formulated using an excipient to: (1) increase stability; (2) increase cell transfection or transduction; (3) permit the sustained or delayed expression of the payload; (4) alter the biodistribution (e.g., target the viral particle to specific tissues or cell types); (5) increase the translation of encoded protein; (6) alter the release profile of encoded protein; and/or (7) allow for regulatable expression of the payload.
- Formulations of the present disclosure can include, without limitation, saline, liposomes, lipid nanoparticles, polymers, peptides, proteins, cells transfected with viral vectors (e.g., for transfer or transplantation into a subject) and combinations thereof.
- the relative amount of the active ingredient e.g., an AAV particle comprising an AAV capsid variant described herein
- a pharmaceutically acceptable excipient e.g., any additional ingredients in a pharmaceutical composition in accordance with the present disclosure
- the composition may comprise between 0.1% and 99% (w/w) of the active ingredient.
- the composition may comprise between 0.1% and 100%, e.g., between .5 and 50%, between 1-30%, between 5-80%, at least 80% (w/w) active ingredient.
- the pharmaceutical composition comprising an AAV particle described herein may comprise an AAV capsid variant and a viral genome encoding a payload, e.g., a payload described herein, with or without a pharmaceutically acceptable excipient.
- a pharmaceutical composition suitable for administration to a subject e.g., a human.
- the pharmaceutical composition is administered to a subject, e.g., a human.
- an AAV particle disclosed herein may be administered by a to a subject by a delivery route, e.g., a localized delivery route or a systemic delivery route.
- a delivery route e.g., a localized delivery route or a systemic delivery route.
- an AAV particle described herein e.g., an AAV particle comprising an AAV capsid variant
- an AAV particle of the present disclosure may be administered in any suitable form, either as a liquid solution or suspension, as a solid form suitable for liquid solution or suspension in a liquid solution.
- an AAV particle e.g., an AAV particle comprising an AAV capsid variant
- the AAV particle described herein is administered intramuscularly, intravenously, intracerebrally, intrathecally, intracerebroventricularly, via intraparenchymal administration, or via intra-cisterna magna injection (ICM).
- an AAV particle of the present disclosure e.g., an AAV particle comprising an AAV capsid variant
- an AAV particle of the present disclosure may be delivered to a subject via a multi-site route of administration.
- a subject may be administered at 2, 3, 4, 5, or more than 5 sites.
- an AAV particle of the present disclosure is administered via a bolus infusion.
- an AAV particle of the present disclosure is administered via sustained delivery over a period of minutes, hours, or days.
- the infusion rate may be changed depending on the subject, distribution, formulation, and/or another delivery parameter.
- an AAV particle of the present disclosure is administered using a controlled release.
- an AAV particle of the present disclosure is administered using a sustained release, e.g., a release profile that conforms to a release rate over a specific period of time.
- an AAV particle (e.g., an AAV particle comprising an AAV capsid variant) may be delivered by more than one route of administration.
- an AAV particle may be delivered by intrathecal and intracerebroventricular, or by intravenous and intraparenchymal administration.
- Intravenous administration [0400]
- an AAV particle described herein e.g., an AAV particle comprising an AAV capsid polypeptide, e.g., an AAV capsid variant
- the systemic administration is intravenous administration.
- the systemic administration is intraarterial administration.
- an AAV particle of the present disclosure may be administered to a subject by intravenous administration.
- the intravenous administration may be achieved by subcutaneous delivery.
- the AAV particle is administered to the subject via focused ultrasound (FUS), e.g., coupled with the intravenous administration of microbubbles (FUS- MB) or MRI-guided FUS coupled with intravenous administration, e.g., as described in Terstappen et al. (Nat Rev Drug Discovery, doi.org/10.1038/s41573-021-00139-y (2021)), the contents of which are incorporated herein by reference in its entirety.
- FUS focused ultrasound
- FUS- MB microbubbles
- MRI-guided FUS coupled with intravenous administration
- the AAV particle e.g., an AAV particle described herein
- the subject is a human.
- Administration to the CNS [0401]
- an AAV particle described herein e.g., an AAV particle comprising an AAV capsid variant
- the brain delivery may be by intrahippocampal administration.
- an AAV particle of the present disclosure may be administered to a subject by intraparenchymal administration.
- the intraparenchymal administration is to tissue of the central nervous system.
- an AAV particle of the present disclosure may be administered to a subject by intracranial delivery (See, e.g., US Pat. No.8119611; the content of which is incorporated herein by reference in its entirety).
- an AAV particle described herein may be delivered by injection into the CSF pathway.
- Non-limiting examples of delivery to the CSF pathway include intrathecal and intracerebroventricular administration.
- an AAV particle described herein may be administered via intracisternal magna (ICM) injection.
- ICM intracisternal magna
- an AAV particle of the present disclosure e.g., an AAV particle comprising an AAV capsid variant
- the systemic delivery may be by intravascular administration.
- the systemic or intravascular administration may be intravenous.
- an AAV particle e.g., an AAV particle comprising an AAV capsid variant
- an intraocular delivery route e.g., an intraocular administration includes an intravitreal injection.
- Intramuscular administration e.g., an AAV particle described herein (e.g., an AAV particle comprising an AAV capsid variant) may be delivered by intramuscular administration.
- the multi-nucleated nature of muscle cells provides an advantage to gene transduction subsequent to AAV delivery.
- cells of the muscle are capable of expressing recombinant proteins with the appropriate post-translational modifications.
- the enrichment of muscle tissue with vascular structures allows for transfer to the blood stream and whole-body delivery.
- intramuscular administration include systemic (e.g., intravenous), subcutaneous or directly into the muscle.
- more than one injection is administered.
- an AAV particle of the present disclosure may be delivered by an intramuscular delivery route. (See, e.g., U. S. Pat.
- intramuscular administration examples include an intravenous injection or a subcutaneous injection.
- an AAV particle of the present disclosure e.g., an AAV particle comprising an AAV capsid variant
- an AAV particle is administered by intramuscular administration.
- an AAV particle of the present disclosure may be administered to a subject by subcutaneous administration.
- the intramuscular administration is via systemic delivery.
- the intramuscular administration is via intravenous delivery.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Medicinal Chemistry (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- Virology (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Epidemiology (AREA)
- Gastroenterology & Hepatology (AREA)
- Neurology (AREA)
- Neurosurgery (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Bioinformatics & Computational Biology (AREA)
- Ecology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Immunology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Priority Applications (9)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| MX2024009660A MX2024009660A (es) | 2022-02-08 | 2023-02-07 | Variantes de capside de aav y usos de las mismas. |
| US18/835,280 US20250161485A1 (en) | 2022-02-08 | 2023-02-07 | Aav capsid variants and uses thereof |
| CN202380031870.2A CN119072486A (zh) | 2022-02-08 | 2023-02-07 | Aav衣壳变体及其用途 |
| KR1020247026622A KR20240161976A (ko) | 2022-02-08 | 2023-02-07 | Aav 캡시드 변이체 및 이의 용도 |
| JP2024547150A JP2025507338A (ja) | 2022-02-08 | 2023-02-07 | Aavカプシドバリアント及びその使用 |
| EP23709560.9A EP4476241A1 (en) | 2022-02-08 | 2023-02-07 | Aav capsid variants and uses thereof |
| CA3249551A CA3249551A1 (en) | 2022-02-08 | 2023-02-07 | AAV Capsid Variants and Their Uses |
| AU2023217698A AU2023217698A1 (en) | 2022-02-08 | 2023-02-07 | Aav capsid variants and uses thereof |
| IL314156A IL314156A (en) | 2022-02-08 | 2023-02-07 | Adeno-associated virus capsid variants and their uses |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202263307742P | 2022-02-08 | 2022-02-08 | |
| US63/307,742 | 2022-02-08 | ||
| US202263339574P | 2022-05-09 | 2022-05-09 | |
| US63/339,574 | 2022-05-09 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2023154693A1 true WO2023154693A1 (en) | 2023-08-17 |
Family
ID=85505478
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2023/062101 Ceased WO2023154693A1 (en) | 2022-02-08 | 2023-02-07 | Aav capsid variants and uses thereof |
Country Status (11)
| Country | Link |
|---|---|
| US (1) | US20250161485A1 (https=) |
| EP (1) | EP4476241A1 (https=) |
| JP (1) | JP2025507338A (https=) |
| KR (1) | KR20240161976A (https=) |
| CN (1) | CN119072486A (https=) |
| AU (1) | AU2023217698A1 (https=) |
| CA (1) | CA3249551A1 (https=) |
| IL (1) | IL314156A (https=) |
| MX (1) | MX2024009660A (https=) |
| TW (1) | TW202346599A (https=) |
| WO (1) | WO2023154693A1 (https=) |
Cited By (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11859200B2 (en) | 2020-05-13 | 2024-01-02 | Voyager Therapeutics, Inc. | AAV capsids with increased tropism to brain tissue |
| CN117402222A (zh) * | 2023-11-17 | 2024-01-16 | 广州派真生物技术有限公司 | 腺相关病毒突变体及其应用 |
| WO2025038805A1 (en) * | 2023-08-16 | 2025-02-20 | Voyager Therapeutics, Inc. | Compositions and methods for the treatment of disorders related to glucosylceramidase beta 1 deficiency |
| WO2025038430A1 (en) * | 2023-08-16 | 2025-02-20 | Voyager Therapeutics, Inc. | Aav capsid variants and uses thereof |
| WO2025038795A1 (en) * | 2023-08-16 | 2025-02-20 | Voyager Therapeutics, Inc. | Compositions and methods for the treatment of disorders related to dystrophia myotonica protein kinase |
| WO2025038802A1 (en) * | 2023-08-16 | 2025-02-20 | Voyager Therapeutics, Inc. | Compositions and methods for the treatment of disorders related to ataxin-2 |
| WO2025038796A1 (en) * | 2023-08-16 | 2025-02-20 | Voyager Therapeutics, Inc. | Compositions and methods for the treatment of disorders related to cdkl5 deficiency |
| WO2025038800A1 (en) * | 2023-08-16 | 2025-02-20 | Voyager Therapeutics, Inc. | Compositions and methods for the treatment of disorders related to frataxin deficiency |
| CN119552222A (zh) * | 2025-01-24 | 2025-03-04 | 中国人民解放军军事科学院军事医学研究院 | 腺相关病毒视网膜细胞嗜性衣壳突变体及应用 |
| US12296025B2 (en) | 2021-11-02 | 2025-05-13 | Voyager Therapeutics, Inc. | AAV capsid variants and uses thereof |
| WO2025121957A1 (ko) * | 2023-12-06 | 2025-06-12 | 주식회사 글루진테라퓨틱스 | 뇌 성상교세포 특이적 유전자 전달이 가능한 아데노부속바이러스 변이체와 이의 응용 |
| EP4607196A3 (en) * | 2024-02-23 | 2025-10-29 | Tata Consultancy Services Limited | Insilico method and system for designing a baseline peptide bioreceptor for sensing a biomarker for dysglycemic disorders |
| US12467046B2 (en) | 2018-10-02 | 2025-11-11 | Voyager Therapeutics, Inc. | Redirection of tropism of AAV capsids |
Citations (40)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5064764A (en) | 1988-12-20 | 1991-11-12 | Commissariat A L'energie Atomique | Mineral hollow fiber bioreactor for the cultivation of animal cells |
| WO1996039530A2 (en) | 1995-06-05 | 1996-12-12 | The Trustees Of The University Of Pennsylvania | Recombinant adenovirus and adeno-associated virus, cell lines, and methods of production and use thereof |
| WO1998010088A1 (en) | 1996-09-06 | 1998-03-12 | Trustees Of The University Of Pennsylvania | An inducible method for production of recombinant adeno-associated viruses utilizing t7 polymerase |
| US5756283A (en) | 1995-06-05 | 1998-05-26 | The Trustees Of The University Of Pennsylvania | Method for improved production of recombinant adeno-associated viruses for gene therapy |
| WO1999014354A1 (en) | 1997-09-19 | 1999-03-25 | The Trustees Of The University Of The Pennsylvania | Methods and vector constructs useful for production of recombinant aav |
| WO1999015685A1 (en) | 1997-09-19 | 1999-04-01 | The Trustees Of The University Of Pennsylvania | Methods and cell line useful for production of recombinant adeno-associated viruses |
| WO1999047691A1 (en) | 1998-03-20 | 1999-09-23 | Trustees Of The University Of Pennsylvania | Compositions and methods for helper-free production of recombinant adeno-associated viruses |
| WO2000028004A1 (en) | 1998-11-10 | 2000-05-18 | The University Of North Carolina At Chapel Hill | Virus vectors and methods of making and administering the same |
| WO2000055342A1 (en) | 1999-03-18 | 2000-09-21 | The Trustees Of The University Of Pennsylvania | Compositions and methods for helper-free production of recombinant adeno-associated viruses |
| WO2000075353A1 (en) | 1999-06-02 | 2000-12-14 | Trustees Of The University Of Pennsylvania | Compositions and methods useful for production of recombinant viruses which require helper viruses |
| US6194191B1 (en) | 1996-11-20 | 2001-02-27 | Introgen Therapeutics, Inc. | Method for the production and purification of adenoviral vectors |
| US6204059B1 (en) | 1994-06-30 | 2001-03-20 | University Of Pittsburgh | AAV capsid vehicles for molecular transfer |
| WO2001023597A2 (en) | 1999-09-29 | 2001-04-05 | The Trustees Of The University Of Pennsylvania | Cell lines and constructs useful in production of e1-deleted adenoviruses in absence of replication competent adenovirus |
| WO2001023001A2 (en) | 1999-09-29 | 2001-04-05 | The Trustees Of The University Of Pennsylvania | Rapid peg-modification |
| US6485966B2 (en) | 1999-03-18 | 2002-11-26 | The Trustees Of The University Of Pennsylvania | Compositions and methods for helper-free production of recombinant adeno-associated viruses |
| US6506379B1 (en) | 1995-06-07 | 2003-01-14 | Ariad Gene Therapeutics, Inc. | Intramuscular delivery of recombinant AAV |
| US6566118B1 (en) | 1997-09-05 | 2003-05-20 | Targeted Genetics Corporation | Methods for generating high titer helper-free preparations of released recombinant AAV vectors |
| US20030138772A1 (en) | 2001-11-13 | 2003-07-24 | Guangping Gao | Method of detecting and/or identifying adeno-associated virus (AAV) sequences and isolating novel sequences identified thereby |
| WO2004112727A2 (en) | 2003-06-19 | 2004-12-29 | Avigen, Inc. | Aav virions with decreased immunoreactivity and uses therefor |
| WO2005005610A2 (en) | 2003-06-30 | 2005-01-20 | The Regents Of The University Of California | Mutant adeno-associated virus virions and methods of use thereof |
| WO2005072364A2 (en) | 2004-01-27 | 2005-08-11 | University Of Florida | A modified baculovirus expression system for production of pseudotyped raav vector |
| US6953690B1 (en) | 1998-03-20 | 2005-10-11 | The Trustees Of The University Of Pennsylvania | Compositions and methods for helper-free production of recombinant adeno-associated viruses |
| EP1752536A1 (en) | 2004-05-11 | 2007-02-14 | RNAi Co., Ltd. | Polynucleotide causing rna interfere and method of regulating gene expression with the use of the same |
| US7291498B2 (en) | 2003-06-20 | 2007-11-06 | The Trustees Of The University Of Pennsylvania | Methods of generating chimeric adenoviruses and uses for such chimeric adenoviruses |
| US7427396B2 (en) | 2004-06-03 | 2008-09-23 | Genzyme Corporation | AAV vectors for gene delivery to the lung |
| US7491508B2 (en) | 2003-06-20 | 2009-02-17 | The Trustees Of The University Of Pennsylvania | Methods of generating chimeric adenoviruses and uses for such chimeric adenoviruses |
| US20100130594A1 (en) | 2007-07-23 | 2010-05-27 | Martine Barkats | Cns gene delivery using peripheral administration of aav vectors |
| US20100240739A1 (en) | 2007-10-05 | 2010-09-23 | Martine Barkats | Widespread gene delivery to motor neurons using peripheral injection of aav vectors |
| US8119611B2 (en) | 2002-11-26 | 2012-02-21 | Medtronic, Inc. | Treatment of neurodegenerative disease through intracranial delivery of SIRNA |
| US8137948B2 (en) | 2003-05-21 | 2012-03-20 | Genzyme Corporation | Methods for producing preparations of recombinant AAV virions substantially free of empty capsids |
| US8163543B2 (en) | 2005-10-20 | 2012-04-24 | Amsterdam Molecular Therapeutics B.V. | AAV vectors produced in insect cells |
| US20150315612A1 (en) | 2003-09-30 | 2015-11-05 | The Trustees Of The University Of Pennsylvania | Adeno-associated virus (aav) clades, sequences, vectors containing same, and uses therefor |
| WO2015191508A1 (en) | 2014-06-09 | 2015-12-17 | Voyager Therapeutics, Inc. | Chimeric capsids |
| US20160289275A1 (en) | 2015-04-06 | 2016-10-06 | The Usa, As Represented By The Secretary, Dept. Of Health And Human Services | Adeno-Associated Vectors for Enhanced Transduction and Reduced Immunogenicity |
| US20180066279A9 (en) | 2014-04-25 | 2018-03-08 | University Of Massachusetts | Recombinant aav vectors useful for reducing immunity against transgene products |
| WO2020072683A1 (en) | 2018-10-02 | 2020-04-09 | Voyager Therapeutics, Inc. | Redirection of tropism of aav capsids |
| WO2020132455A1 (en) | 2018-12-21 | 2020-06-25 | The Trustees Of The University Of Pennsylvania | Compositions for drg-specific reduction of transgene expression |
| WO2021202651A1 (en) | 2020-04-01 | 2021-10-07 | Voyager Therapeutics, Inc. | Redirection of tropism of aav capsids |
| WO2021230987A1 (en) | 2020-05-13 | 2021-11-18 | Voyager Therapeutics, Inc. | Redirection of tropism of aav capsids |
| WO2021242909A1 (en) | 2020-05-26 | 2021-12-02 | Shape Therapeutics Inc. | High throughput engineering of functional aav capsids |
-
2023
- 2023-02-07 CA CA3249551A patent/CA3249551A1/en active Pending
- 2023-02-07 AU AU2023217698A patent/AU2023217698A1/en active Pending
- 2023-02-07 US US18/835,280 patent/US20250161485A1/en active Pending
- 2023-02-07 JP JP2024547150A patent/JP2025507338A/ja active Pending
- 2023-02-07 TW TW112104286A patent/TW202346599A/zh unknown
- 2023-02-07 EP EP23709560.9A patent/EP4476241A1/en active Pending
- 2023-02-07 MX MX2024009660A patent/MX2024009660A/es unknown
- 2023-02-07 IL IL314156A patent/IL314156A/en unknown
- 2023-02-07 CN CN202380031870.2A patent/CN119072486A/zh active Pending
- 2023-02-07 KR KR1020247026622A patent/KR20240161976A/ko active Pending
- 2023-02-07 WO PCT/US2023/062101 patent/WO2023154693A1/en not_active Ceased
Patent Citations (50)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5064764A (en) | 1988-12-20 | 1991-11-12 | Commissariat A L'energie Atomique | Mineral hollow fiber bioreactor for the cultivation of animal cells |
| US6204059B1 (en) | 1994-06-30 | 2001-03-20 | University Of Pittsburgh | AAV capsid vehicles for molecular transfer |
| US6270996B1 (en) | 1995-06-05 | 2001-08-07 | The Trustees Of The University Of Pennsylvania | Recombinant adenovirus and adeno-associated virus, cell lines and methods of production and use thereof |
| WO1996039530A2 (en) | 1995-06-05 | 1996-12-12 | The Trustees Of The University Of Pennsylvania | Recombinant adenovirus and adeno-associated virus, cell lines, and methods of production and use thereof |
| US5756283A (en) | 1995-06-05 | 1998-05-26 | The Trustees Of The University Of Pennsylvania | Method for improved production of recombinant adeno-associated viruses for gene therapy |
| US6261551B1 (en) | 1995-06-05 | 2001-07-17 | The Trustees Of The University Of Pennsylvania | Recombinant adenovirus and adeno-associated virus, cell lines, and methods of production and use thereof |
| US6281010B1 (en) | 1995-06-05 | 2001-08-28 | The Trustees Of The University Of Pennsylvania | Adenovirus gene therapy vehicle and cell line |
| US6506379B1 (en) | 1995-06-07 | 2003-01-14 | Ariad Gene Therapeutics, Inc. | Intramuscular delivery of recombinant AAV |
| WO1998010088A1 (en) | 1996-09-06 | 1998-03-12 | Trustees Of The University Of Pennsylvania | An inducible method for production of recombinant adeno-associated viruses utilizing t7 polymerase |
| US6194191B1 (en) | 1996-11-20 | 2001-02-27 | Introgen Therapeutics, Inc. | Method for the production and purification of adenoviral vectors |
| US6566118B1 (en) | 1997-09-05 | 2003-05-20 | Targeted Genetics Corporation | Methods for generating high titer helper-free preparations of released recombinant AAV vectors |
| WO1999014354A1 (en) | 1997-09-19 | 1999-03-25 | The Trustees Of The University Of The Pennsylvania | Methods and vector constructs useful for production of recombinant aav |
| US6943019B2 (en) | 1997-09-19 | 2005-09-13 | The Trustees Of The University Of Pennsylvania | Methods and vector constructs useful for production of recombinant AAV |
| US7238526B2 (en) | 1997-09-19 | 2007-07-03 | The Trustees Of The University Of Pennsylvania | Methods and cell line useful for production of recombinant adeno-associated viruses |
| WO1999015685A1 (en) | 1997-09-19 | 1999-04-01 | The Trustees Of The University Of Pennsylvania | Methods and cell line useful for production of recombinant adeno-associated viruses |
| US6482634B1 (en) | 1997-09-19 | 2002-11-19 | The Trustees Of The University Of Pennsylvania | Methods and vector constructs useful for production of recombinant AAV |
| US6475769B1 (en) | 1997-09-19 | 2002-11-05 | The Trustees Of The University Of Pennsylvania | Methods and cell line useful for production of recombinant adeno-associated viruses |
| WO1999047691A1 (en) | 1998-03-20 | 1999-09-23 | Trustees Of The University Of Pennsylvania | Compositions and methods for helper-free production of recombinant adeno-associated viruses |
| US6953690B1 (en) | 1998-03-20 | 2005-10-11 | The Trustees Of The University Of Pennsylvania | Compositions and methods for helper-free production of recombinant adeno-associated viruses |
| WO2000028004A1 (en) | 1998-11-10 | 2000-05-18 | The University Of North Carolina At Chapel Hill | Virus vectors and methods of making and administering the same |
| US6485966B2 (en) | 1999-03-18 | 2002-11-26 | The Trustees Of The University Of Pennsylvania | Compositions and methods for helper-free production of recombinant adeno-associated viruses |
| WO2000055342A1 (en) | 1999-03-18 | 2000-09-21 | The Trustees Of The University Of Pennsylvania | Compositions and methods for helper-free production of recombinant adeno-associated viruses |
| US6258595B1 (en) | 1999-03-18 | 2001-07-10 | The Trustees Of The University Of Pennsylvania | Compositions and methods for helper-free production of recombinant adeno-associated viruses |
| US7022519B2 (en) | 1999-03-18 | 2006-04-04 | The Trustees Of The University Of Pennsylvania | Compositions and methods for helper-free production of recombinant adeno-associated viruses |
| WO2000075353A1 (en) | 1999-06-02 | 2000-12-14 | Trustees Of The University Of Pennsylvania | Compositions and methods useful for production of recombinant viruses which require helper viruses |
| WO2001023001A2 (en) | 1999-09-29 | 2001-04-05 | The Trustees Of The University Of Pennsylvania | Rapid peg-modification |
| US6365394B1 (en) | 1999-09-29 | 2002-04-02 | The Trustees Of The University Of Pennsylvania | Cell lines and constructs useful in production of E1-deleted adenoviruses in absence of replication competent adenovirus |
| WO2001023597A2 (en) | 1999-09-29 | 2001-04-05 | The Trustees Of The University Of Pennsylvania | Cell lines and constructs useful in production of e1-deleted adenoviruses in absence of replication competent adenovirus |
| US20030138772A1 (en) | 2001-11-13 | 2003-07-24 | Guangping Gao | Method of detecting and/or identifying adeno-associated virus (AAV) sequences and isolating novel sequences identified thereby |
| US8119611B2 (en) | 2002-11-26 | 2012-02-21 | Medtronic, Inc. | Treatment of neurodegenerative disease through intracranial delivery of SIRNA |
| US8137948B2 (en) | 2003-05-21 | 2012-03-20 | Genzyme Corporation | Methods for producing preparations of recombinant AAV virions substantially free of empty capsids |
| WO2004112727A2 (en) | 2003-06-19 | 2004-12-29 | Avigen, Inc. | Aav virions with decreased immunoreactivity and uses therefor |
| US7291498B2 (en) | 2003-06-20 | 2007-11-06 | The Trustees Of The University Of Pennsylvania | Methods of generating chimeric adenoviruses and uses for such chimeric adenoviruses |
| US7491508B2 (en) | 2003-06-20 | 2009-02-17 | The Trustees Of The University Of Pennsylvania | Methods of generating chimeric adenoviruses and uses for such chimeric adenoviruses |
| WO2005005610A2 (en) | 2003-06-30 | 2005-01-20 | The Regents Of The University Of California | Mutant adeno-associated virus virions and methods of use thereof |
| US20150315612A1 (en) | 2003-09-30 | 2015-11-05 | The Trustees Of The University Of Pennsylvania | Adeno-associated virus (aav) clades, sequences, vectors containing same, and uses therefor |
| WO2005072364A2 (en) | 2004-01-27 | 2005-08-11 | University Of Florida | A modified baculovirus expression system for production of pseudotyped raav vector |
| EP1752536A1 (en) | 2004-05-11 | 2007-02-14 | RNAi Co., Ltd. | Polynucleotide causing rna interfere and method of regulating gene expression with the use of the same |
| US7427396B2 (en) | 2004-06-03 | 2008-09-23 | Genzyme Corporation | AAV vectors for gene delivery to the lung |
| US8163543B2 (en) | 2005-10-20 | 2012-04-24 | Amsterdam Molecular Therapeutics B.V. | AAV vectors produced in insect cells |
| US20100130594A1 (en) | 2007-07-23 | 2010-05-27 | Martine Barkats | Cns gene delivery using peripheral administration of aav vectors |
| US20100240739A1 (en) | 2007-10-05 | 2010-09-23 | Martine Barkats | Widespread gene delivery to motor neurons using peripheral injection of aav vectors |
| US20180066279A9 (en) | 2014-04-25 | 2018-03-08 | University Of Massachusetts | Recombinant aav vectors useful for reducing immunity against transgene products |
| WO2015191508A1 (en) | 2014-06-09 | 2015-12-17 | Voyager Therapeutics, Inc. | Chimeric capsids |
| US20160289275A1 (en) | 2015-04-06 | 2016-10-06 | The Usa, As Represented By The Secretary, Dept. Of Health And Human Services | Adeno-Associated Vectors for Enhanced Transduction and Reduced Immunogenicity |
| WO2020072683A1 (en) | 2018-10-02 | 2020-04-09 | Voyager Therapeutics, Inc. | Redirection of tropism of aav capsids |
| WO2020132455A1 (en) | 2018-12-21 | 2020-06-25 | The Trustees Of The University Of Pennsylvania | Compositions for drg-specific reduction of transgene expression |
| WO2021202651A1 (en) | 2020-04-01 | 2021-10-07 | Voyager Therapeutics, Inc. | Redirection of tropism of aav capsids |
| WO2021230987A1 (en) | 2020-05-13 | 2021-11-18 | Voyager Therapeutics, Inc. | Redirection of tropism of aav capsids |
| WO2021242909A1 (en) | 2020-05-26 | 2021-12-02 | Shape Therapeutics Inc. | High throughput engineering of functional aav capsids |
Non-Patent Citations (42)
| Title |
|---|
| "Biocomputing: Informatics and Genome Projects", 1993, ACADEMIC PRESS |
| "Computer Analysis of Sequence Data", 1994, HUMANA PRESS |
| "Methods In Molecular Biology", 1995, HUMANA PRESS |
| "Sequence Analysis in Molecular Biology", 1987, ACADEMIC PRESS |
| "Sequence Analysis Primer", 1991, M STOCKTON PRESS |
| AFIONE ET AL.: "Identification and Mutagenesis of the Adeno-Associated Virus 5 Sialic Acid Binding Region", JOURNAL OF VIROLOGY, vol. 89, no. 3, 2015, pages 1660 - 1672 |
| AFIONE ET AL.: "Identification and Mutagenesis of the Adeno-Associated Virus 5 Sialic Binding Region", JOURNAL OF VIROLOGY, vol. 89, no. 3, February 2015 (2015-02-01), pages 1660 - 1672 |
| BIRD ET AL., SCIENCE, vol. 242, 1988, pages 423 - 426 |
| BLASTPBLASTNFASTA ALTSCHUL, S. F. ET AL., J. MOLEC. BIOL., vol. 215, 1990, pages 403 |
| BRIGHT ET AL., NEUROBIOL AGING, vol. 36, no. 2, 2015, pages 693 - 709 |
| CARILLO, HLIPMAN, D, SIAM J APPLIED MATH, vol. 48, 1988, pages 1073 |
| DEVEREUX, J ET AL., NUCLEIC ACIDS RESEARCH, vol. 12, no. 1, 1984, pages 387 |
| DEVERMAN ET AL.: "Cre-dependent selection yields AAV variants for widespread gene transfer to the adult brain", NAT BIOTECHNOL., vol. 4, no. 2, 3 February 2016 (2016-02-03), pages 204 - 209, XP055328659, DOI: 10.1038/nbt.3440 |
| GOVINDASAMY ET AL.: "Structural Insights into Adeno-Associated Virus Serotype 5", JOURNAL OF VIROLOGY, vol. 87, no. 20, 2013, pages 11187 - 11199, XP055865805, DOI: 10.1128/JVI.00867-13 |
| GOVINDASAMY ET AL.: "Structural Insights into Adeno-Associated Virus Serotype 5", JOURNAL OF VIROLOGY, vol. 87, no. 20, October 2013 (2013-10-01), pages 11187 - 11199, XP055865805, DOI: 10.1128/JVI.00867-13 |
| GOVINDASAMY ET AL.: "Structurally Mapping the Diverse Phenotype of Adeno-Associated Virus Serotype 4", JOURNAL OF VIROLOGY, vol. 80, no. 23, December 2006 (2006-12-01), pages 11556 - 11570 |
| GRIMM ET AL.: "In vitro and in vivo gene therapy vector evolution via multispecies interbreeding and retargeting of adeno-associated viruses", J. VIROL., vol. 2, no. 12, 8 June 2008 (2008-06-08), pages 5887 - 5911, XP002610286, DOI: 10.1128/JVI.00254-08 |
| HOLLINGERHUDSON, NATURE BIOTECHNOLOGY, vol. 23, 2005, pages 1126 - 1136 |
| HUSTON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 5879 - 5883 |
| HWANG ET AL.: "N-Terminal Acetylation of Cellular Proteins Creates Specific Degradation Signals", SCIENCE, vol. 327, no. 5968, 19 February 2010 (2010-02-19), pages 973 - 977, XP055369420, DOI: 10.1126/science.1183147 |
| JIN ET AL.: "Direct Liquid Chromatography/Mass Spectrometry Analysis for Complete Characterization of Recombinant Adeno-Associated Virus Capsid Proteins", HUM GENE THER METHODS, vol. 28, no. 5, October 2017 (2017-10-01), pages 255 - 267 |
| JOSE ET AL.: "High-Resolution Structural Characterization of a New Adenoassociated Virus Serotype 5 Antibody Epitope toward Engineering Antibody-Resistant Recombinant Gene Delivery Vectors", JOURNAL OF VIROLOGY, vol. 93, no. 1, 2020, pages 01394 - 18 |
| JOSE ET AL.: "High-Resolution Structural Characterization of a New Adenoassociated Virus Serotype 5 Antibody Epitope toward Engineering Antibody-Resistant Recombinant Gene Delivery Vectors", JOURNAL OF VIROLOGY, vol. 93, no. 1, January 2019 (2019-01-01), pages 01394 - 18 |
| KAJIGAYA ET AL., PROC. NAT'L. ACAD. SCI. USA, vol. 88, 1991, pages 4646 - 50 |
| KIMBAUER ET AL., VIR, vol. 219, 1996, pages 37 - 44 |
| LISOWSKI ET AL.: "Selection and evaluation of clinically relevant AAV variants in a xenograft liver model", NATURE, vol. 506, 2014, pages 382 - 386, XP055573596, DOI: 10.1038/nature12875 |
| MEYERSMILLER, CABIOS, vol. 4, 1989, pages 11 - 17 |
| O'REILLY ET AL.: "A Laboratory Manual", 1994, OXFORD UNIV. PRESS, article "Baculovirus Expression Vectors" |
| PARR ET AL., NAT. MED., vol. 3, 1997, pages 1145 - 9 |
| POWELL ET AL., VIRAL EXPRESSION CASSETTE ELEMENTS TO ENHANCE TRANSGENE TARGET SPECIFICITY AND EXPRESSION IN GENE THERAPY, 2015 |
| POWELL ET AL.: "Viral Expression Cassette Elements to Enhance Transgene Target Specificity and Expression in Gene Therapy", DISCOV. MED, vol. 19, no. 102, 2015, pages 49 - 57, XP055272358 |
| QIAN ET AL.: "Directed Evolution of AAV Serotype 5 for Increased Hepatocyte Transduction and Retained Low Humoral Seroreactivity", MOLECULAR THERAPY: METHODS & CLINICAL DEVELOPMENT, vol. 20, October 2020 (2020-10-01), pages 122 - 132, XP055864144, DOI: 10.1016/j.omtm.2020.10.010 |
| QIAN ET AL.: "Directed Evolution of AAV Serotype 5 for Increased Hepatocyte Transduction and Retained Low Humoral Seroreactivity", MOLECULAR THERAPY: METHODS AND CLINICAL DEVELOPMENT, vol. 20, 2021, pages 122 - 132, XP055864144, DOI: 10.1016/j.omtm.2020.10.010 |
| RUFFING ET AL., J. VIR., vol. 66, 1992, pages 6922 - 30 |
| SAMULSKI ET AL., J. VIR., vol. 63, 1989, pages 3822 - 8 |
| SHEEHAN B, THER ADV NEUROL DISORD, vol. 5, no. 6, 2012, pages 349 - 358 |
| TERSTAPPEN ET AL., NAT REV DRUG DISCOVERY, DOI.ORG/10.1038/S41573-021-00139-Y, 2021 |
| VINCENT ET AL., NEUROMOLECULAR MEDICINE, vol. 6, 2004, pages 79 - 85 |
| WALTERS ET AL.: "Structure of Adeno-Associated Virus Serotype 5", JOURNAL OF VIROLOGY,, vol. 78, no. 7, 2004, pages 3361 - 3371, XP002297595 |
| WANG ET AL., J NEUROSCI, vol. 22, 2002, pages 6920 - 6928 |
| WANG ET AL.: "Directed evolution of adeno-associated virus 5 capsid enables specific liver tropism", MOL THER NUCLEIC ACIDS, vol. 28, 2022, pages 293 - 306, XP055980992, DOI: 10.1016/j.omtn.2022.03.017 |
| ZHAO ET AL., VIR, vol. 272, 2000, pages 382 - 93 |
Cited By (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12467046B2 (en) | 2018-10-02 | 2025-11-11 | Voyager Therapeutics, Inc. | Redirection of tropism of AAV capsids |
| US12577588B2 (en) | 2020-05-13 | 2026-03-17 | Voyager Therapeutics, Inc. | AAV capsids with increased tropism to brain tissue |
| US11859200B2 (en) | 2020-05-13 | 2024-01-02 | Voyager Therapeutics, Inc. | AAV capsids with increased tropism to brain tissue |
| US12296025B2 (en) | 2021-11-02 | 2025-05-13 | Voyager Therapeutics, Inc. | AAV capsid variants and uses thereof |
| US12419969B2 (en) | 2021-11-02 | 2025-09-23 | Voyager Therapeutics, Inc. | AAV capsid variants and uses thereof |
| WO2025038430A1 (en) * | 2023-08-16 | 2025-02-20 | Voyager Therapeutics, Inc. | Aav capsid variants and uses thereof |
| WO2025038802A1 (en) * | 2023-08-16 | 2025-02-20 | Voyager Therapeutics, Inc. | Compositions and methods for the treatment of disorders related to ataxin-2 |
| WO2025038796A1 (en) * | 2023-08-16 | 2025-02-20 | Voyager Therapeutics, Inc. | Compositions and methods for the treatment of disorders related to cdkl5 deficiency |
| WO2025038800A1 (en) * | 2023-08-16 | 2025-02-20 | Voyager Therapeutics, Inc. | Compositions and methods for the treatment of disorders related to frataxin deficiency |
| WO2025038795A1 (en) * | 2023-08-16 | 2025-02-20 | Voyager Therapeutics, Inc. | Compositions and methods for the treatment of disorders related to dystrophia myotonica protein kinase |
| WO2025038805A1 (en) * | 2023-08-16 | 2025-02-20 | Voyager Therapeutics, Inc. | Compositions and methods for the treatment of disorders related to glucosylceramidase beta 1 deficiency |
| CN117402222B (zh) * | 2023-11-17 | 2024-03-29 | 广州派真生物技术有限公司 | 腺相关病毒突变体及其应用 |
| CN117402222A (zh) * | 2023-11-17 | 2024-01-16 | 广州派真生物技术有限公司 | 腺相关病毒突变体及其应用 |
| WO2025121957A1 (ko) * | 2023-12-06 | 2025-06-12 | 주식회사 글루진테라퓨틱스 | 뇌 성상교세포 특이적 유전자 전달이 가능한 아데노부속바이러스 변이체와 이의 응용 |
| EP4607196A3 (en) * | 2024-02-23 | 2025-10-29 | Tata Consultancy Services Limited | Insilico method and system for designing a baseline peptide bioreceptor for sensing a biomarker for dysglycemic disorders |
| CN119552222A (zh) * | 2025-01-24 | 2025-03-04 | 中国人民解放军军事科学院军事医学研究院 | 腺相关病毒视网膜细胞嗜性衣壳突变体及应用 |
Also Published As
| Publication number | Publication date |
|---|---|
| KR20240161976A (ko) | 2024-11-13 |
| US20250161485A1 (en) | 2025-05-22 |
| MX2024009660A (es) | 2024-08-14 |
| JP2025507338A (ja) | 2025-03-18 |
| EP4476241A1 (en) | 2024-12-18 |
| IL314156A (en) | 2024-09-01 |
| CA3249551A1 (en) | 2023-08-17 |
| TW202346599A (zh) | 2023-12-01 |
| AU2023217698A1 (en) | 2024-07-25 |
| CN119072486A (zh) | 2024-12-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20250161485A1 (en) | Aav capsid variants and uses thereof | |
| US12296025B2 (en) | AAV capsid variants and uses thereof | |
| TW202417466A (zh) | Aav蛋白殼變異體及其用途 | |
| JP2025173511A (ja) | Aavカプシドの指向性の再指示 | |
| US20250215453A1 (en) | Aav capsid variants and uses thereof | |
| US20250388626A1 (en) | Aav capsid variants and uses thereof | |
| WO2025038430A1 (en) | Aav capsid variants and uses thereof | |
| WO2024226790A1 (en) | Aav capsid variants and uses thereof | |
| EP4705488A1 (en) | Aav capsid variants and uses thereof | |
| WO2025147436A1 (en) | Aav capsid variants and uses thereof | |
| HK40114438A (zh) | Aav衣壳变体及其用途 | |
| WO2025235734A9 (en) | Aav capsid variants and uses thereof | |
| HK40119210A (zh) | Aav衣壳变体及其用途 | |
| CN118632861A (zh) | Aav衣壳变体和其用途 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 23709560 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 314156 Country of ref document: IL |
|
| WWE | Wipo information: entry into national phase |
Ref document number: AU2023217698 Country of ref document: AU |
|
| ENP | Entry into the national phase |
Ref document number: 2023217698 Country of ref document: AU Date of ref document: 20230207 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 202417057991 Country of ref document: IN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2024/009660 Country of ref document: MX |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2024547150 Country of ref document: JP |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112024015997 Country of ref document: BR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2023709560 Country of ref document: EP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2023709560 Country of ref document: EP Effective date: 20240909 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 202380031870.2 Country of ref document: CN |
|
| ENP | Entry into the national phase |
Ref document number: 112024015997 Country of ref document: BR Kind code of ref document: A2 Effective date: 20240805 |
|
| WWP | Wipo information: published in national office |
Ref document number: 18835280 Country of ref document: US |