WO2023153805A1 - Infectious disease model and drug screening method using same - Google Patents

Abstract

The present invention relates to a transformant into which a luciferase gene is introduced, an animal model infected therewith, and a method for screening for a drug by using same. A recombinant vector, a transformant thereof, and an animal model infected with the transformant, according to the present invention, can be effectively used in drug screening and the like in that these can provide in vitro and in vivo general-purpose evaluation of the efficacy of novel drug candidate materials for the treatment of infectious diseases, in a non-invasive and real-time manner.

Description

Infectious disease model and drug screening method using it

The present invention relates to a transformant into which a luciferase gene has been introduced, an animal model infected therewith, and a method for screening a drug using the same.

BACKGROUND OF THE INVENTION Infectious diseases caused by bacterial infections of the gastrointestinal tract are very common. Specifically, an infectious gastrointestinal disease may occur as a cause such as bacteria or parasites is transmitted through contact with food or people. Common causative bacteria include E. coli , Salmonella , Shigella , Pseudomonas , and the like. Infectious diseases occurring in the gastrointestinal tract cause diarrhea and vomiting due to inflammation of the stomach and intestines. Diarrhea causes the anus to leak, and vomiting and diarrhea cause gas to build up in the abdomen, causing abdominal distension. In addition, there is no energy due to dehydration, severe pain in the abdomen, and headache due to high fever.

Bacteria that cause these infectious gastrointestinal diseases include Escherichia coli, Bacillus cereus, Campylobacter jejuni, Clostridium perfringens, and Salmonella species. species), Shigella species, Staphylococcus aureus, Vibrio parahaemolyticus, etc. are known, and recently, the existence of super bacteria has been confirmed, and the severity of diseases related to them is significantly increasing. .

In addition, infectious diseases caused by bacterial infections in the respiratory tract are also very common diseases, and depending on the degree of infection, severe or more severe diseases are caused. In the process of stimulating the release of various cytokines, toxin production caused during infection causes excessive inflammatory reactions in the bronchi and lungs, and also inhibits phagocytosis by white blood cells, producing leukotoxin as a by-product in the lower respiratory tract. It often causes infectious bronchopneumonia. Symptoms of this infectious respiratory disease include sudden fever, initial high fever, dry cough accompanied by purulent sputum, severe chills, chest pain, and muscle pain.

Causative bacteria causing common infectious respiratory diseases are, for example, Acinetobacter baumannii , Pasteurella multocida , Haemophilus parasuis , Bordetella bronchiseptica ( Bordetella bronchiseptica ), Actinobacillus pleuropneumoniae , Streptococcus suis , and Mycoplasma spp.

Cefdinir, Azithromycin, Clarithromycin, Dirithromycin, Erythromycin for the treatment of infectious diseases including gastric infectious gastrointestinal diseases and infectious respiratory diseases ), Roxithromycin, Telithromycin, Carbomicin A, Josamycin, Kitasamycin, Midecamycin/Midecamycin acetate, Antibiotic drugs such as Oleandomycin, Spiramycin, Troleandomycin, and Tylosin are used for treatment.

Although the use of antibiotics as described above usually exhibits a sufficient effect in treating diseases, it causes an ironic situation in that the incidence of infectious diseases increases due to the frequent use of antibiotics. It is very common that the increase in the incidence of such an infectious disease occurs when a drug does not exhibit sufficient efficacy due to the development of drug resistance or the like.

Due to the above problems, in recent years, infectious diseases have become more and more difficult to treat due to the acquisition of resistance due to the use of antibiotics, and increase the treatment failure and mortality of patients, thereby posing a threat to the health field such as medical sites.

Under this background, it is urgent to develop new therapeutic agents, especially antibiotic drugs, that can solve the above problems, and to overcome the problems of existing treatment methods, understanding of host-microorganism interactions and evaluating the effectiveness and safety of antibacterial agents It is necessary to develop a new infection model for

However, since the evaluation method that can reduce the time and cost required in the research stage for in vivo evaluation for the efficacy and stability evaluation of the above antibiotic preparations is very limited, it is not easy to screen related substances in the early stage of research and development. state is not

A method of detecting the reporter gene by inserting a reporter gene into chromosomal DNA for the above screening can be considered as one method. Stable expression is possible when a reporter gene is inserted on the chromosome, but it has a low gene expression due to the number of copies of 1 copy, is more difficult to manufacture than using a plasmid, and takes a lot of time. In addition, it is very difficult to develop a screening method for the above method in that the phenotype can change when a gene is inserted into chromosomal DNA.

In order to overcome the above technical limitations, the present inventors prepared a transformant stably transfected with an optical reporter gene and an animal model infected with the transformant. Then, the present invention was completed by enabling non-invasive, real-time monitoring of drug screening along with tracking and quantification of in vitro and in vivo distribution of bacteria over time.

An object of the present invention is a recombinant expression vector comprising a lacI-deleted trc promoter and a Firefly luciferase gene operably linked thereto; Transformants transformed with the recombinant expression vector; And to provide an animal model infected with the above transformant.

Another object of the present invention is (a) processing a drug candidate to a transformant transformed with the recombinant expression vector;

(b) measuring the change in luminescence of the transformant after treatment with luciferin;

Another object of the present invention is (a) infecting a transformant transformed with the recombinant expression vector to a disease-causing site of an animal other than human;

(b) treating an infected animal with a drug candidate;

(c) processing luciferin and measuring a change in luminescence at a disease-causing site of an animal;

The T7 promoter and lac promoter, which are generally known as high-efficiency gene expression systems, are IPTG inducible promoters and can be highly induced. However, the expression level is not sufficient in terms of overexpression due to the high price of IPTG and the suppression of gene expression by the lacI repressor.

In the present invention, the lacI-deleted trc promoter was used and firefly luciferase with high luminescence level was used to more strongly and specifically confirm the change in luminescence level.

Accordingly, the present invention provides a recombinant expression vector comprising a lacI-deleted trc promoter and a firefly luciferase gene operably linked thereto.

In the present invention, "vector" refers to a genetic construct comprising a nucleotide sequence of a gene operably linked to a suitable control sequence so as to express a target gene in a suitable host, and the control sequence is capable of initiating transcription. promoters capable of controlling transcription, optional operator sequences for regulating such transcription, and sequences regulating termination of transcription and translation.

As used herein, the term "recombinant expression vector" is a vector capable of expressing a target protein or target RNA in a suitable host cell, and refers to a genetic construct containing essential regulatory elements operably linked to express a gene insert. As used herein, the term "operably linked" refers to functional linkage between a nucleic acid expression control sequence and a nucleic acid sequence encoding a protein or RNA of interest so as to perform a general function. For example, a promoter and a nucleic acid sequence encoding a protein or RNA may be operably linked to affect expression of the encoding nucleic acid sequence. Operational linkage with a recombinant vector can be prepared using genetic recombination techniques well known in the art, and site-specific DNA cutting and linking uses enzymes generally known in the art.

The recombinant expression vector of the present invention contains the firefly luciferase gene of SEQ ID NO: 1.

The firefly luciferase gene of SEQ ID NO: 1 is a material used for visualization and is an enzyme that converts chemical energy into light energy by accelerating the oxidation of luciferin to emit light. It can be obtained directly from firefly or by expression or synthesis from a microorganism containing a recombinant DNA fragment encoding such an enzyme.

Unlike conventional prior art methods that generally use bacterial luminescent enzymes such as Photohabdus luminescens , firefly luciferase (Luc) is used in the present invention to express strong luminescence intensity in vitro and/or in vivo . Accordingly, by using this, the time for measuring a similar detection amount is greatly reduced, and the level of luminescence change is increased so that luminescence change due to drug treatment can be more clearly and clearly identified.

In particular, since firefly luciferase (Luc) emits light at a long wavelength of 600 nm, it can penetrate deeper tissues, which can show better action under in vivo imaging conditions.

The amino acid sequence of the firefly luciferase prepared from SEQ ID NO: 1 is shown in SEQ ID NO: 2. Any firefly luciferase gene sequence capable of synthesizing the sequence of SEQ ID NO: 2 is also included as a substantially homologous category of the firefly luciferase gene sequence of SEQ ID NO: 1 of the present invention.

As used herein, the term "promoter" refers to a polynucleotide sequence that allows and regulates the transcription of a gene operably linked thereto.

The recombinant expression vector of the present invention also contains a trc promoter from which lacI has been removed. In the present invention, the continuous expression of firefly luciferase is an object. Accordingly, constant expression of the firefly luciferase gene was ensured by using the trc promoter as the promoter sequence excluding the lac repressor (lacI) sequence. In particular, it shows an excellent effect in that it can bring the expression level to a high level with constant and high efficiency regardless of the presence or absence of IPTG (isopropyl-β-D-thiogalactoside, IPTG), an inducer for current induction.

Accordingly, the trc promoter sequence is represented by SEQ ID NO: 3. That is, the trc promoter sequence may be the nucleotide sequence of SEQ ID NO: 3.

The recombinant expression vector according to the present invention further includes an origin of replication (oriV) and an origin of migration (oriT).

The recombinant expression vector according to the present invention is intended to be expressed in various bacteria through a broad host range. Accordingly, the recombinant expression vector according to the present invention includes an origin of replication (oriV) and an origin of migration (oriT), and thus has the advantage of being universally applicable to various pathogenic strains. The replication origin (oriV) sequence is shown in SEQ ID NO: 4, and the migration origin (oriT) sequence is shown in SEQ ID NO: 5.

In addition, pRO1600 oriV (SEQ ID NO: 6) and pRO1600 Rep (SEQ ID NO: 7) may be further included.

The recombinant expression vector further comprises at least one antibiotic resistance gene selected from the group consisting of an ampicillin resistance gene, a kanamycin resistance gene and a chloramphenicol acetyl transferase gene. It may be a recombinant vector to. "Antibiotic resistance gene" is a gene having resistance to antibiotics, and since cells having this gene survive in an environment treated with the antibiotic, it is usefully used as a selection marker in the process of obtaining plasmids in large quantities from E. coli. In the present invention, since the antibiotic resistance gene is not a factor that greatly affects the expression efficiency according to the optimal combination of vectors, which is a key technology of the present invention, antibiotic resistance genes commonly used as selection markers can be used without limitation. As specific examples, resistance genes to ampicillin, tetracyclin, kanamycin, chloroamphenicol, streptomycin, or neomycin can be used, preferably It may be an ampicillin resistance gene.

The recombinant expression vector according to the present invention may preferably have a firefly luciferase (Luc) sequence of SEQ ID NO: 1 inserted at the insertion site of a vector known as pMF36.

More specifically, SEQ ID NO: 8 shows the full-length sequence of the recombinant vector into which the firefly luciferase (Luc) sequence of SEQ ID NO: 1 is inserted. That is, the recombinant expression vector may have the nucleotide sequence of SEQ ID NO: 8.

A cleavage map of the recombinant expression vector according to the present invention is shown in FIG. 1 .

A of FIG. 1 shows the pMF36 vector, and the recombinant vector into which the firefly luciferase (Luc) sequence of SEQ ID NO: 1 according to the present invention is inserted is shown in B of FIG. 1 (pJS-1).

In particular, according to the present invention, since in vivo screening measures the luminescent signal present in the skin, it must have a certain level of expression or higher to be detected, and a high luminescent expression level detects a small amount of luminescent bacteria following drug treatment. make it possible

According to one embodiment of the present invention, Xba I and Hind III of the recombinant vector The firefly luciferase gene represented by SEQ ID NO: 1 may be inserted in between.

The present invention also relates to a transformant (preferably a bacterium or the like) transformed with the recombinant expression vector described above.

As used herein, the term "transformation" refers to the transfer of a nucleic acid fragment into the genome of a host cell to cause genetically stable inheritance.

The method of transforming the vector of the present invention into the cell includes any method of introducing a base into the cell, and can be performed by selecting a suitable standard technique as known in the art. Electroporation, calcium phosphate co-precipitation, retroviral infection, microinjection, DEAE-dextran, cationic liposome laws, etc., but are not limited thereto. Preferably, a heat shock and/or electroporation method may be used.

As used herein, the term "transformant transformed with a recombinant vector" refers to a cell transformed with a vector having a gene encoding one or more target proteins. Transformants according to the present invention may be, for example, bacteria, viruses, parasites and the like.

Transformants according to the present invention are preferably bacteria. Such bacteria may in particular be pathogens.

For example, Salmonella enterica , Escherichia coli, Citrobacter rodentium , Bordetella bronchiseptica , Acinetobacter baumannii . _ _ _ _ typhimurium ), Shigella dysenteriae, Yersinia enterocolitica, Acinetobacter calcoaceticus, Francisella tularensis , Legionella pneumophila Phila ( Legionella pneumophila ), Proteus vulgaris ( Proteus vulgaris ), Proteus mirabilis ( Proteus mirabilis ), Stenotrophomonas maltophilia ( Stenotrophomonas maltophilia ), Pasteurella multocida ( Pasteurella multocida ), Haemophilus parasu Is ( Haemophilus parasuis ), Actinobacillus pluronicumoniae ( Actinobacillus pleuropneumoniae ), Streptococcus suis ( Streptococcus suis ), Mycoplasma pneumoniae ( Mycoplasma pneumoniae ), Mycoplasma hominis ( Mycoplasma hominis ), Mycoplasma genie Talium ( Mycoplasma genitalium ), Mycoplasma fermentans ( Mycoplasma fermentans ), Mycoplasma amphoriforme ( Mycoplasma amphoriforme ), Mycoplasma penetrans ( Mycoplasma penetrans ), Campylobacter jejuni (Campylobacter jejuni), Borrelia Burgdor Perry ( Borrelia burgdorferi ), Brucella abortus ( Brucella abortus ), Brucella canis ( Brucella canis ), Listeria monocytogenes ( Listeria monocytogenes ), Rickettsia ricketsii ( Rickettsia ricketsii ), Yersinia pestis ( Yersinia pestis ), etc. It may be any one of the strains of.

The present invention also provides animals infected with the transformants disclosed above.

Such animals may be mammals such as mice, rats, rabbits, beagles, goats, pigs, sheep, mice, and cows. Preferably, the animal infected with the transformant may be a mouse or a rat. In this animal model, the amount of the transformant infected may vary depending on the type of organism, severity of infectious disease, age, sex, drug activity, administration time, administration route, and excretion rate.

For example, mice and/or rats may be infected with 1 x 10 ⁶ to 1 x 10 ⁹ CFU, but it varies depending on the type of bacteria, route of administration, age and weight of the mouse, and so is not limited thereto.

The administration or infection may vary depending on the desired disease site. For example, oral administration, intragastric administration, intratracheal administration, inner ear administration, intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intrauterine intrathecal administration, intracardiovascular administration, etc. may be administered differently depending on the target disease inducing site. .

Preferably, it may be administration by intragastric or intratracheal administration or infection. This makes it possible to assess the level of disease following infection, for example in the gastrointestinal or respiratory tract.

The present invention also includes (a) processing a drug candidate into a transformant transformed with the recombinant expression vector; and

(b) measuring the change in luminescence of the transformant after treatment with luciferin;

Infectious diseases according to the present invention refer to diseases caused by disease-causing pathogens, such as viruses, bacteria, fungi, and parasites, spreading to or invading animals or humans, and for the purpose of the present invention, it means all infectious diseases caused by bacteria. do. Specifically, such infections may be infections of the gastrointestinal tract, respiratory tract, skin or cardiovascular system.

The gastrointestinal tract refers to all organs of the digestive system from the mouth to the anus, including the esophagus, stomach, large intestine, small intestine, and the like.

The respiratory tract refers to all organs involved in the mechanical exchange of inhaling oxygen and exhaling carbon dioxide through the mouth, including the nose, pharynx, larynx, trachea, bronchi, lungs, and the like.

The cardiovascular system refers to related organs that play a major role in transporting blood in the body, including the aortic valve, pulmonary valve, mitral valve, tricuspid valve, heart muscle, epicardium, and endocardium.

The skin refers to an external tissue of the body including subcutaneous tissue, dermis, epidermis, hair follicles, and the like.

Accordingly, the infectious disease may be an infectious gastrointestinal disease, an infectious respiratory disease, an infectious skin disease, or an infectious cardiovascular disease caused by infection.

An infectious gastrointestinal disease according to the present invention is a disease caused by infection of the gastrointestinal tract, such as bacteria, viruses, and parasites. Symptoms may include anorexia, nausea, vomiting, flatulence and abdominal cramps. Also, diarrhea is the most common symptom and may be accompanied by blood and mucus. It can also cause fever, nausea, muscle pain and exhaustion. Infectious gastrointestinal diseases according to the present invention include, for example, infectious gastroenteritis, infectious colitis, infectious colitis, inflammatory bowel disease and the like.

Bacteria that cause gastric infectious diseases of the gastrointestinal tract can produce enterotoxins while remaining attached without invading the intestinal wall. These toxins cause the intestines to secrete water and electrolytes, which can lead to watery diarrhea. Some bacteria can invade the walls of the small intestine or colon and damage cells, forming small ulcers (ulceration) that cause bleeding and large leaks of fluids containing proteins, electrolytes, and water. Accordingly, diarrhea contains white blood cells and red blood cells, and sometimes blood is visible.

Strains that can cause these diseases include, for example , E. coli, C. rodentium, Campylobacter spp., Salmonella spp., Listeria spp., Shigella spp., Trichinella spp. etc. can be considered.

An infectious respiratory disease according to the present invention is a disease caused by infection of the respiratory tract by bacteria, viruses, parasites, and the like. Symptoms such as fever, initial high fever, dry cough with purulent sputum, severe chills, chest pain, and muscle pain may appear. Infectious respiratory diseases according to the present invention include, for example, infectious pneumonia, lung abscess, sepsis , upper respiratory tract infection, and the like.

Strains that can cause these diseases include, for example , Yersinia pestis, Streptococcus spp., Pateurella spp., B. bronchiseptica, A. baumannii, Mycoplasma spp. etc. can be considered.

An infectious skin disease according to the present invention is a disease caused by infection of the skin by bacteria, viruses, parasites, and the like. Symptoms accompanying skin inflammation are commonly present. Infectious skin diseases according to the present invention include, for example, impetigo, folliculitis, excision, erysipelas, cellulitis, and acute gastritis.

Strains that can cause these diseases include, for example, Staphylococcus spp., Micrococcus spp., Corynebacterium spp., Streptococcus spp. etc. can be considered.

Infectious cardiovascular diseases according to the present invention are diseases caused by infections of the cardiovascular system such as bacteria, viruses, parasites, and the like. Its main feature is inflammation that occurs in the cardiovascular system, and serious symptoms can occur when blood clots accumulate in the inflamed area. Infectious cardiovascular diseases according to the present invention include, for example, endocarditis, myocarditis, pericarditis, suppurative thrombophlebitis, endoarteritis and the like.

Strains that can cause these diseases include Streptococcus spp. and Stapylococcus spp. etc. can be considered as common causative bacteria, but is not limited to a specific strain.

A specific infectious disease according to the present invention is an infectious gastrointestinal disease or an infectious respiratory disease.

The infectious gastrointestinal disease drug screening method according to the present invention includes the step of treating a drug candidate to a transformant transformed with a recombinant expression vector.

The transformant according to the present invention is preferably a bacterium as mentioned above.

The drug candidate may be, for example, any one selected from the group consisting of antibodies, proteins, antigens, peptides, nucleic acids, enzymes, cells, bioactive polymers, bioactive inorganic substances, and drugs (eg, compounds). .

In the present invention, the term "luciferin" is a generic term for luminescent substrates of luminescence reaction that exhibit luciferin-luciferase reaction (LL reaction) in bioluminescence. , ratiaru cipherin, and coelenterazine. It is oxidized by oxygen molecules in the presence of a luminescent enzyme, and an oxidation product (oxyluciferin) is produced in an excited state, and when it becomes a ground state, visible light is generated. To summarize the process, luciferin + O ₂ → oxyluciferin + light do. The luciferin may be, but is not limited to, D-luciferin, native coelenterazine, or h-coelenterazine, which is a 2-deoxy derivative. More specifically, D-luciferin can be used.

Transformants transformed with the recombinant expression vector exhibit luminescent properties by luciferin. Treatment of luciferin according to the present invention means placing a transformant transformed with a recombinant expression vector in the same reaction system, for example, adding luciferin to a container containing a transformant, adding a transformant to a container containing luciferin, or mixing the transformant and luciferin.

Accordingly, treatment of the above-mentioned drug candidates may change the luminous efficiency.

The infectious disease drug screening method according to the present invention includes (b) measuring the change in luminescence of the transformant after treatment with luciferin.

The measurement of the luminous properties refers to detecting the level of light generated in the step (a), quantitatively or qualitatively. Luminescence can be detected by any means known in the art, for example, by luminescence microscopes, photometers, luminescence plate readers, multiplier tube detectors, and the like.

If the luminescence level is reduced compared to the control group not treated with the drug candidate by the detection of the luminescence level, it can be considered as the drug candidate material.

Accordingly, the present invention may further include (c) selecting a drug candidate having a reduced emission level compared to a control group not treated with the drug candidate.

The present invention also provides (a) infecting a disease-causing site of an animal other than human with a transformant transformed with the recombinant expression vector;

(b) treating an infected animal with a drug candidate;

(c) treating luciferin and measuring the change in luminescence at the disease-causing site of the animal;

The infectious disease drug screening method according to the present invention includes the step of (a) infecting a transformant transformed with the recombinant expression vector into a disease-causing site of an animal other than human.

The disease-causing site may be, for example, any site in the gastrointestinal tract, respiratory tract, skin, or cardiovascular system mentioned above. Oral administration, intragastric administration, intratracheal administration, inner ear administration, intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intrauterine intrathecal administration, intracardiovascular administration, as necessary for infection of the desired transformant at the disease-causing site. Administration can produce an appropriate infectious disease model.

The transformant may preferably be a bacterium capable of causing an infectious disease, as described above.

Such animals may be mammals such as mice, rats, rabbits, beagles, goats, pigs, sheep, mice, and cows. Infectious diseases can be induced through infection of animals through the above transformants.

The number of bacteria administered or infected for causing such an infectious disease may vary depending on the severity of the desired disease, the disease-causing strain, the type of animal to be administered, and the like. Preferably, the administration or infection may be administration or infection by intragastric administration or intratracheal administration. Through this, it is possible to evaluate the level of the disease according to the infection at the disease-causing site.

Preferably, the disease-causing site may be the gastrointestinal system. More specifically, it may be the stomach, small intestine, large intestine or esophagus.

Preferably, the disease-causing site may be the respiratory tract. More specifically, it may be the nose, trachea, bronchi or lungs.

The drug screening method for infectious diseases according to the present invention also includes the step of treating an infected animal with a drug candidate.

Treatment of the drug candidate to the infected animal may proceed through various administration routes. For example, the presence or absence of drug efficacy can be confirmed under various administration routes such as oral administration, intragastric administration, intratracheal administration, inner ear administration, intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intrauterine intrathecal administration, and intracardiovascular administration. It can be administered in an appropriate amount. Such administration and treatment of the drug candidate may vary depending on the severity of the target disease, the disease-causing strain, and the type of animal to be administered.

The infectious disease drug screening method according to the present invention also includes the step of (c) treating luciferin and measuring the change in luminescence at the site of infection of the animal.

Treatment of luciferin according to the present invention means placing a transformant transformed with a recombinant expression vector in the same reaction system, and accordingly, luciferin is administered orally, intragastrically, intratracheally, inner ear, or intraperitoneally. It may include administration through administration, intravenous administration, intramuscular administration, subcutaneous administration, intrauterine intrathecal administration, intracardiovascular administration, and the like.

Such treatment with luciferin may be considered differently depending on the number of transformants administered , the body weight of the animal, and the like.

Specifically, the method according to the present invention can be used as a practical means for screening drug efficacy by confirming the efficacy of drug candidates in vivo without sacrificing animals or fixing biological specimens.

In general, in order to develop a therapeutic agent for an infectious disease, an animal model for infection is prepared in vivo , then the drug candidate is treated, and then the animal is sacrificed over time to perform various experiments (using molecular biological methods, histopathological methods, or target organs). Bacteria count, etc.) is required to confirm the potential as a drug candidate.

However, this process has problems in that many animals are sacrificed and time and money are consuming for evaluation. In addition, in vitro , there is a problem in that an experiment using a molecular biological method or confirmation of the number of bacteria is required after processing a drug candidate and sampling by time.

From this point of view, the method according to the present invention has a great advantage in evaluating the possibility of a drug candidate because it can non-invasively evaluate the in vivo response in real time.

In particular, in the case of the recombinant vector containing the FireFly luciferase gene according to the present invention, the superiority is also recognized in that drug changes can be confirmed over a long period of time through high expression levels.

If the luminescence level is reduced compared to the control group not treated with the drug candidate by the detection of the luminescence level, it can be considered as the drug candidate material.

Accordingly, the present invention may further include (d) selecting a drug candidate having a reduced luminescence level compared to a control group not treated with the drug candidate.

The recombinant vector according to the present invention, its transformants, and animal models infected with these transformants can provide universal, non-invasive and real-time evaluation of the efficacy of drug candidates for the treatment of novel infectious diseases in vitro and in vivo. It can be usefully used for drug screening in that it exists.

Figure 1 shows the vector structure of pMF36 and the structure of the recombinant vector pJS-1 prepared in the present invention.

Figure 2 shows the result of confirming stable luminescence in vitro of P. aeruginosa transformed with a recombinant vector containing a FireFly luciferase gene in a solid medium.

Figure 3 shows the result of confirming the stable light emission of P. aeruginosa transformed with the recombinant vector containing the FireFly luciferase gene in a liquid medium in vitro .

Figure 4 shows the result of confirming the stable luminescence of B. bronchiseptica transformed with the recombinant vector containing the FireFly luciferase gene in a solid medium in vitro .

5 shows the result of confirming the stable luminescence efficacy of P. aeruginosa transformed with the recombinant vector containing the FireFly luciferase gene in an experimental animal (or mouse) in vivo .

Figure 6 is a comparative example of a recombinant vector (pJS-2) in which the FireFly luciferase gene was inserted into pLI50, a recombinant vector (pJS-3) in which the FireFly luciferase gene was inserted in pCN60, and a pAKlux2 vector (pJS-4). , and a schematic diagram of a recombinant vector (pJS-5) in which the FireFly luciferase gene is inserted into pRMC2.

7 shows the results of drug efficacy evaluation by treating P. aeruginosa transformed with a recombinant vector containing a FireFly luciferase gene in vitro with an antibiotic.

8 shows the results of drug efficacy evaluation by treating B. bronchiseptica transformed with a recombinant vector containing a FireFly luciferase gene in vitro with an antibiotic.

Figure 9 The results of drug efficacy evaluation according to antibiotic treatment on an animal model of an infectious gastrointestinal disease are shown.

Figure 10 shows the result of confirming the difference in luminescence efficacy according to the type of recombinant vector (left: S. Typhimurium/pJS-2), right: S. Typhimurium/pJS-1).

Figure 11 is The results of drug efficacy evaluation according to antibiotic treatment on an animal model of infectious respiratory disease are shown.

Figure 12 shows the difference in luminescence efficacy according to the type of recombinant vector containing the FireFly luciferase gene. The results confirmed in vitro are shown ((a): negative control, (b): pJS-3, (c): pJS-4, (d): pJS-2, (e): pJS-5, (f) :pJS-1).

13 shows the result of confirming the stable light emission of S. Typhimurium and P. aeruginosa transformed with the recombinant vector containing the FireFly luciferase gene in vitro .

14 shows the result of confirming the stable light emission of S. Typhimurium, A. baumannii and C. rodentium transformed with the recombinant vector containing the FireFly luciferase gene in a solid medium in vitro .

Figure 15 shows the results of in vitro growth experiments monitoring changes in OD (A), luminescence value (B), and bacterial count (C) of the transformed P. aeruginosa strain and the wild type.

16 shows the results of in vitro growth experiments monitoring changes in OD (A), luminescence values (B), and bacterial counts (C) of transformed S. Typhimurium strains and wild type.

17 is a result of confirming the stable luminescence efficacy of B. bronchiseptica , A. baumannii, and P. aeruginosa transformed with a recombinant vector containing the FireFly luciferase gene in an infected animal model (infectious respiratory disease model) in vivo . .

18 is a result confirming the stable luminescence efficacy of B. bronchiseptica , A. baumannii, and P. aeruginosa transformed with a recombinant vector containing the FireFly luciferase gene in lung tissue of an infected animal model (infectious respiratory disease model). .

19 shows C. rodentium , S. This is the result of confirming the stable luminescence efficacy of Typhimurium and P. aeruginosa in vivo .

20 is S. transformed with a recombinant vector containing the FireFly luciferase gene in vitro . The results of drug efficacy evaluation by treating Typhimurium with antibiotics are shown.

Figure 21 is The results of drug efficacy evaluation according to antibiotic treatment on an animal model of an infectious gastrointestinal disease are shown.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as being limited by these examples.

Example 1. Construction of a recombinant vector containing the FireFly luciferase gene

To prepare a recombinant vector containing the Firefly luciferase gene, pMF36, a broad host range plasmid, was selected. pMF36 contains an ampicillin sequence and a trc promoter, which are selectable factors, but does not contain a LacI sequence.

In this example, the following experiment was performed using pMF230 (purchased from Addgene), which is known to have a backbone of pMF36, from which the GFP sequence was removed.

In order to insert the luciferase gene, Xba Ⅰ, Hind Ⅲ restriction enzymes present in MCS (Multiple Cloning Site) were selected, and a primer set containing Xba Ⅰ and Hind Ⅲ was used with the luciferase gene (SEQ ID NO: 1) as a template. PCR was performed using

-Forward primer ( Xba I, SEQ ID NO: 9): GC TCTAGA GCATGGAAAATATGGAAAACGACGAG

-Reverse primer ( Hind Ⅲ, SEQ ID NO: 10): CCC AAGCTT GGGTCACATCTTGGCCACGGG

PCR was performed under the following conditions; Initial denaturation process at 98 °C for 2 minutes; Denaturation at 95 ℃ for 10 seconds, Primer Annealing at 58 ℃ for 10 seconds, Extension at 72 ℃ for 35 cycles; And the final extension process was carried out at 72 ℃ for 5 minutes.

The amplification products were digested with Xba I and Hind III restriction enzymes and then purified using a Purification Kit. A sequence to be inserted into the vector is shown in SEQ ID NO: 11.

Then, pMF36 was also digested with Xba I and Hind III restriction enzymes in the same way, and pMF36 and luciferase genes were reacted overnight at 16 ° C with T4 ligase (Takara) to construct a recombinant vector, which was named pJS-1.

The constructed luciferase labeled plasmid was transformed into E. coli DH5a strain using heat shock.

The specific configuration of the recombinant vector prepared above is shown in B of FIG. 1 below.

Then, in order to select a strain containing the recombinant vector, a selection process was performed through LB medium supplemented with ampicillin antibiotic.

A recombinant vector was purified from the selected strain and used in the experiment.

Example 2. Production of transformants (luminescent microorganisms) into which the recombinant vector was introduced

In order to insert the recombinant vector prepared in Example 1 into E. coli DH5a, A. baumannii, C. rodentium , B. bronchiseptica , P. aeruginosa, and S. Typhimurium, respectively, the DNA is competent for transformation. made of cells.

First, E. coli DH5a , S. Typhimurium, and P. aeruginosa were cultured in Luria Bertani (LB) while A. baumannii , C. redentium, and B. bronchiseptica were cultured in Brain Heart Infusion (BHI) liquid medium with shaking at 200 rpm or 1.5 % (w/v) was cultured at 37 °C using a solid medium supplemented with agar. The antibiotic ampicillin was added at a concentration of 100 μg/ml.

In order to produce a transforming competent cell, the overnight bacterial solution was inoculated into this culture medium and O.D. It was cultured to about 0.5. The cultured bacterial solution was left cold on ice for 30 minutes, and then centrifuged at 2,500 g at 4 ° C. for 10 minutes, and the supernatant was removed. The bacterial cell pellet was washed several times with 10% glycerol, and finally suspended in 1/50 of the culture medium in 10% glycerol and stored at -80 °C until transformation.

After adding 1 μg of the pJS-1 DNA prepared in Example 1 to each competent cell prepared, it was introduced into the cells through electroporation.

Next, ampicillin medium was used to select bacteria into which the recombinant plasmid was introduced, and the substrate D-luciferin Potassium Salt Bioluminescent Substrate (XenoLight) was added to a final concentration of 0.3 mg/ml using a microplate reader, and the luminescence value was measured. Confirmed.

The list of prepared bacteria was named as shown in Table 1 below.

The results of confirming the stable expression of P. aeruginosa/ pJS-1 among the prepared transformants are shown in FIGS. 2 and 3 .

Figure 2 shows the result of comparing the luminescence change of the transformed P. aeruginosa strain and Wild type . As can be seen from Figure 2, it was confirmed that the transformed P. aeruginosa strain stably emits light.

3 and 13 show the result of confirming the same stable expression level on the E-tube. 3 A shows a high concentration of P. aeruginosa , B shows a low concentration of P. aeruginosa, and C shows a Wild type. Figure 13 shows the remarkable luminescence efficacy of transformed S. Typhimurium and P. aeruginosa .

As can be seen in Figures 3 and 13, the strain transformed according to the present invention stably exhibited luminescent efficacy.

Similarly, the luminescent efficacy was confirmed for B. bronchiseptica and is shown in FIG. 4 . As can be seen in Figure 4, the strain transformed according to the present invention showed stable luminescence efficacy.

The same light emitting efficiency was confirmed for the remaining transformants of Table 1, including the P. aeruginosa strain, B. bronchiseptica strain and S. Typhimurium strain in FIGS. 2 to 4 and FIG. 14 above.

Example 3. Production of infection animal model (infectious colitis model)

The transformed bacteria prepared in Example 2 and the negative control bacteria were cultured in a suitable medium to an appropriate O.D, centrifuged to remove the supernatant, and washed with PBS to prepare.

E. coli DH5a, C. rodentium , B. bronchiseptica , P. aeruginosa, S. Typhimurium strains or negative control bacteria prepared in Example 2 were prepared using 7- to 8-week-old ICR or C57BL/6 mice. Depending on the species, 200 μl of 1 x 10 ⁸ CFU or 1 x 10 ⁹ CFU was intragastricly administered. Prior to imaging, mice were inoculated with 100 μl of 0.3 mg/ml D-luciferin Potassium Salt Bioluminescent Substrate (XenoLight) by intragastric administration. Mice were anesthetized with isoflurane/Oxygen and luminescence imaging images were taken using IVIS® Lumina K (Perkin Elmer). The intensity of the luminescence signal was quantified as photon counts per second (p/s).

In animal models infected with the transformed P. aeruginosa strain, C. rodentium strain, and S. Typhimurium strain, the results of confirming stable luminescence 2 hours after infection with the strain are shown in FIGS. 5 and 19 .

As can be seen in Figures 5 and 19, it was confirmed that the luminescence change can be confirmed in real time and stably through infection of the transformed P. aeruginosa strain, C. rodentium strain, and S. Typhimurium.

Comparative Example 1. Preparation of pJS-2 vector, transformant and infected animal model

Comparative Example 1.1 Preparation of pJS-2 Vector

A pJS-2 vector was prepared in the same manner as in the pJS-1 production method.

Specifically, pLI50 contains the ampicillin sequence, which is a selective factor, and was purchased from Addgene.

In order to insert the luciferase gene, select Bam HI, Hind Ⅲ restriction enzymes present in the MCS (Multiple Cloning Site) of pLI50, and use the luciferase gene (SEQ ID NO: 1) as a template and primers containing Bam HI, Hind Ⅲ PCR was performed using the set.

-Forward primer ( Bam HI, SEQ ID NO: 12): CGGGATCCCGATGGAAAATATGGAAAACGACGAG

-Reverse primer ( Hind Ⅲ, SEQ ID NO: 13): CCCAAGCTTGGGTCACATCTTGGCCACGGG

PCR conditions were the same as in Example 1.

The amplification product was digested with Bam HI and Hind Ⅲ restriction enzymes and then purified using a Purification Kit.

Then, the vector was also digested with Bam HI and Hind Ⅲ restriction enzymes in the same way, and pLI50 and luciferase genes were reacted overnight at 16 ° C with T4 ligase (Takara) to construct a recombinant vector, which was named pJS-2.

The constructed luciferase labeled plasmid was transformed into E. coli DH5a strain by electroporation.

Then, in order to select a strain containing the recombinant vector, a selection process was performed through LB medium supplemented with ampicillin antibiotic.

A recombinant vector was isolated from the selected strain, and after confirmation of plasmid insertion, the vector was purified from an E. coli strain containing the recombinant vector and used for the experiment.

Comparative Example 1.2. Production of transformants into which the recombinant vector was introduced

pJS-2 recombinant vector to S. Typhimurium In order to insert the strain, competent cells for transformation were prepared similarly to Example 2 so that the DNA could enter well. Then, after adding 1 μg of pJS-2 DNA to the prepared competent cells, it was introduced into the cells through electroporation.

Next, ampicillin medium was used to screen strains into which the recombinant plasmid was introduced, and the substrate D-luciferin Potassium Salt Bioluminescent Substrate (XenoLight) was added to a final concentration of 0.3 mg/ml using a microplate reader, and the luminescence value was measured. Confirmed.

Comparative Example 1.3. Production of infection animal model (infectious colitis model)

The transformed bacteria prepared in Comparative Example 1.2 were cultured in a suitable medium to an appropriate O.D., centrifuged to remove the supernatant, and washed with PBS to prepare.

7- to 8-week-old ICR or C57BL/6 mice were intragastricly administered with 200 μl of gastric bacteria at 1×10 ⁸ CFU or 1×10 ⁹ CFU using a gastric bypass.

Prior to imaging, mice were inoculated with 100 μl of 0.3 mg/ml D-luciferin Potassium Salt Bioluminescent Substrate (XenoLight) by intragastric administration. Mice were anesthetized with isoflurane/Oxygen and luminescence imaging images were taken using IVIS® Lumina K (Perkin Elmer). The intensity of the luminescence signal was quantified as photon counts per second (p/s).

Comparative Example 2. Production of transformants using pJS-3 vector

The pJS-3 vector was prepared by inserting the luciferase gene into pCN60, a commercial vector, in the same manner as the pJS-1 production method ( Bam HI, Hind Ⅲ restriction enzyme selection).

Transformants into which pJS-3 was introduced were prepared in the same manner as in Example 2.

Comparative Example 3. Construction of transformants using pJS-4 vector

Transformants into which pJS-4 was introduced (expressing luxCDABE) were prepared in the same manner as in Example 2.

Comparative Example 4. Production of transformants using pJS-5 vector

The pJS-5 vector was prepared by inserting the luciferase gene into pRMC2, a commercial vector, in the same manner as the pJS-1 production method ( Bam HI, Xba Ⅰ restriction enzyme selection).

Transformants into which pJS-5 was introduced were prepared in the same manner as in Example 2.

Example 4. Infectious animal model (infectious respiratory disease model) production

B. bronchiseptica /pJS-1 prepared in Example 2, A. baumannii /pJS-1 , and P. aeruginosa /pJS-1 and the negative control B. bronchiseptica were cultured in a suitable medium to an appropriate OD, and then centrifuged to remove the supernatant. It was prepared by removing and washing with PBS.

7 to 8 weeks old ICR or C57BL/6 mice were intratracheally administered with a mixture of bacterial solution and luciferin (Intratracheal infection), and an animal model was constructed. To confirm the in vivo luminescence signal, images were taken using the IVIS imaging system (PerkinElmer) after anesthesia with isoflurane/oxygen. The intensity of the luminescence signal was quantified as photon counts per second (p/s).

Transformed B. bronchiseptica , A. baumannii , and P. aeruginosa strains are shown in FIG. 17 to confirm the stable luminescence 2 hours after strain infection in an animal model infected, and the transformed B. bronchiseptica , A. baumannii, and The result of confirming the luminescence of the lung isolated from the animal model infected with the P. aeruginosa strain is shown in FIG. 18 .

As can be seen in Figures 17 and 18, it was confirmed that the luminescence change can be confirmed in real time and stably through infection of the transformed B. bronchiseptica , A. baumannii, and P. aeruginosa strains.

Experimental example 1. In vitro Evaluate antibiotic and antimicrobial efficacy

For in vitro drug efficacy evaluation, the reaction was performed by diluting each antibiotic and bacterial solution by concentration.

Specifically, after dispensing 100 μl of P. aeruginosa of Example 2 at OD 2.0, 1.5, 1.0, 0.5, 0.1, respectively, into a 96 well plate, 100 μl of the antibiotic clerithromycin (0.05, 0.1, 0.5, 1, 2.5 or 5 mg/ml) was added and reacted. For in vitro luminescence analysis, D-luciferin Potassium Salt Bioluminescent Substrate (XenoLight) was added to a final concentration of 0.3 mg/ml, and color change was measured using an IVIS 100 imaging system including a charge-couple-device (CCD) camera ( In vivo Imaging System, Xenogen, PerkinElmer, Hopkiton, MA, USA). The intensity of the luminescence signal was quantified as photon counts per second (p/s).

The results are shown in FIG. 7 .

As can be seen in FIG. 7 , treatment with the antibiotic clarithromycin greatly reduced the luminescence level in a concentration-dependent manner.

Through the above results, it was confirmed that the effectiveness of antibacterial agents or antibiotics can be evaluated using the transformed bacteria according to the present invention.

Similar to the above method , in vitro drug efficacy was evaluated using the transformed B. bronchiseptica prepared in Example 2.

Specifically, after dispensing 100 μl of each OD 2.0, 1.0, 0.5 into a 96 well plate, 100 μl of the antibiotic clerithromycin or loxithromycin (0.05, 0.1, 0.5, 1, 2.5 or 5 mg/ml) was added to reacted For in vitro luminescence analysis, D-luciferin Potassium Salt Bioluminescent Substrate (XenoLight) was added to a final concentration of 0.3 mg/ml, and color change was measured using an IVIS 100 imaging system including a charge-couple-device (CCD) camera ( In vivo Imaging System, Xenogen, PerkinElmer, Hopkiton, MA, USA). The intensity of the luminescence signal was quantified as photon counts per second (p/s).

The results are shown in FIG. 8 .

As can be seen through FIG. 8 , treatment with the antibiotic clerithromycin or loxithromycin greatly reduced the luminescence level in a concentration-dependent manner.

Similar to the above method , in vitro drug efficacy was evaluated using the transformed S. Typhimurium prepared in Example 2.

Specifically, after dispensing 100 μl of OD 2.0, 1.5, 1.0, 0.5, 0.1 into each 96 well plate, 100 μl of the antibiotic clerithromycin (0.05, 0.1, 0.5, 1, 2.5 or 5 mg/ml) was added to reacted After 24 hours, for in vitro luminescence analysis, D-luciferin Potassium Salt Bioluminescent Substrate (XenoLight) was added to a final concentration of 0.3 mg/ml, and color change was measured using an IVIS 100 imaging system including a charge-couple-device (CCD) camera ( In vivo Imaging System, Xenogen, PerkinElmer, Hopkiton, MA, USA) was used. The intensity of the luminescence signal was quantified as photon counts per second (p/s).

The results are shown in FIG. 20 .

As can be seen through FIG. 20 , treatment with the antibiotic clerithromycin greatly reduced the luminescence level in a concentration-dependent manner.

Experimental example 2. In vivo Evaluation of antibiotic and antibacterial efficacy (infectious gastrointestinal disease model)

For the in vivo efficacy evaluation, antibiotics were intragastricly administered to the infected animal models prepared in Example 3, and changes in the in vivo drug over time were confirmed.

Specifically, the experiment was performed using the infected animal model prepared in Example 3 above.

After infecting P. aeruginosa through intragastric administration, 5 mg/ml of clarithromycin was intragastricly administered after confirming whether or not the luminescent phenomenon settled in the intestine. Then, 100 μl of 0.3 mg/ml D-luciferin was intragastrically administered to confirm the in vivo luminescence signal after 1 hour, and images were taken using an IVIS imaging system (PerkinElmer) after anesthesia with isoflurane/oxygen. The intensity of the luminescence signal was quantified as photon counts per second (p/s).

The results are shown in FIG. 9 .

In addition, after infecting S. Typhimurium through intragastric administration, 0.3 mg/ml loxithromycin was intragastricly administered after confirming whether the luminescence was established in the intestine. After 3 days, 100 μl of 0.3 mg/ml D-luciferin was intragastrically administered to confirm the in vivo luminescence signal, and images were taken using an IVIS imaging system (PerkinElmer) after anesthesia with isoflurane/oxygen. The intensity of the luminescence signal was quantified as photon counts per second (p/s).

The results are shown in FIG. 21 .

As can be seen through FIGS. 9 and 21 , treatment with antibiotics greatly reduced the luminescence level in a concentration-dependent manner. In particular, these results were confirmed while monitoring the luminescence phenomenon in real time, confirming the advantage in that it was possible to confirm it directly without sacrificing the mouse.

Through the above results, it was confirmed that the effectiveness of antibacterial agents or antibiotics can be evaluated using the transformed bacteria according to the present invention.

Experimental Example 3. Comparison between vectors used (infectious gastrointestinal disease model)

P. aeruginosa transformed with the recombinant vector of Example 1 and the recombinant vector of Comparative Example 1 were treated in the same manner as in Experimental Example 2 to confirm changes in luminescence efficiency.

The confirmation results are shown in FIG. 10 .

As can be seen in FIG. 10, it was confirmed that the animal model (right) transformed with P. aeruginosa/ pJS-1 prepared in Example 2 showed excellent luminescence efficacy. On the other hand, in the case of Comparative Example 1, the expression level was significantly lower, and it was confirmed that the use for drug efficacy evaluation was quite limited.

Experimental example 4. In vivo Evaluation of antibiotic and antibacterial efficacy (infectious respiratory disease model)

In vivo efficacy was evaluated through an animal model of pneumonia using the intratracheal infection prepared in Example 4 above.

Specifically, the antibiotic clarithromycin was administered to an animal model of pneumonia by intranasal administration. To confirm the in vivo luminescence signal, images were taken using the IVIS imaging system (PerkinElmer) after anesthesia with isoflurane/oxygen. The intensity of the luminescence signal was quantified as photon counts per second (p/s).

The results are shown in FIG. 11 .

As can be seen in Figure 11, treatment with the antibiotic clarithromycin significantly reduced the level of luminescence. In particular, these results were confirmed while monitoring the luminescence phenomenon in real time, confirming the advantage in that it was possible to confirm it directly without sacrificing the mouse.

Experimental Example 5. In vitro award Analysis of differences in luminescence efficiency according to the type of recombinant vector

Figure 12 shows the result of confirming the significantly superior expression level of the pJS-1 recombinant vector (Example 1) compared to the pJS-2 recombinant vector (Comparative Example 1) on the E-tube. 12 (a) is a negative control, (b) to (e) are pJS-2, pJS-3, pJS-4 and pJS-5 recombinant vectors, (f) is a pJS-1 recombinant vector indicate

As can be seen from FIG. 12 , the pJS-1 recombinant vector prepared according to the present invention exhibited significantly higher luminescent efficiency compared to other recombinant vectors.

Experimental Example 6. In vitro growth experiment

P. aeruginosa strain and S. Typhimurium strain transformed with the recombinant vector of Example 1 and Changes in OD (A), luminescence value (B), and bacterial count (C) of the wild type were confirmed, and the results are shown in FIGS. 15 and 16 .

As can be seen through FIGS. 15 and 16, the O.D. (concentration) and bacterial count values were maintained the same as those of the Wild type, and the luminescence value was maintained continuously.

Through the above results, it was confirmed that the transformed bacteria according to the present invention can maximize the expression (luminescence) of the target gene without affecting the basic characteristics or functionality of the pathogen, such as interference. It was confirmed that the understanding of and the evaluation of the efficacy and stability of treatment candidates are possible in real time and noninvasively.

In the above, specific parts of the present invention have been described in detail, and for those skilled in the art, it is clear that these specific descriptions are only preferred embodiments, and the scope of the present invention is not limited thereby. something to do. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

Claims (20)

1. A recombinant expression vector comprising a trc promoter from which lacI has been removed and a firefly luciferase gene operably linked thereto.
2. The recombinant expression vector according to claim 1, wherein the firefly luciferase gene comprises the firefly luciferase gene of SEQ ID NO: 1.
3. The recombinant expression vector according to claim 1, wherein the lacI-deleted trc promoter has the nucleotide sequence of SEQ ID NO: 3.
4. The recombinant expression vector according to claim 1, further comprising an origin of replication (oriV) and an origin of migration (oriT).
5. The recombinant expression vector according to claim 4, wherein the origin of replication (oriV) sequence is SEQ ID NO: 4 and the origin of migration (oriT) sequence is SEQ ID NO: 5.
6. The method of claim 1, further comprising at least one antibiotic resistance gene selected from the group consisting of an ampicillin resistance gene, a kanamycin resistance gene, and a chloramphenicol acetyl transferase gene. Recombinant Expression Vectors.
7. The recombinant expression vector according to claim 1, wherein the recombinant expression vector has the nucleotide sequence of SEQ ID NO: 8.
8. A transformant transformed with the recombinant expression vector according to any one of claims 1 to 7.
9. The transformant according to claim 8, wherein the transformant is a bacterium.
10. 10. The method of claim 9, wherein the bacteria are Salmonella enterica , Escherichia coli, Citrobacter rodentium , Bordetella bronchiseptica , Acinetobacter Bauman Nii ( Acinetobacter baumannii ), Pseudomonas aeruginosa ( Pseudomonas aeruginosa ), Enterobacter cloacae ( Enterobacter cloacae ), Klebsiella pneumoniae ( Klebsiella pneumoniae ), Morganella morganii ( Morganella morganii ), Salmonella Typhimurium ( Salmonella typhimurium ), Shigella dysenteriae ( Shigella dysenteriae ), Yersinia enterocolitica ( Yersinia enterocolitica ), Acinetobacter calcoaceticus ( Acinetobacter calcoaceticus ), Francisella tularensis ( Francisella tularensis ), Legionella pneumophila, Proteus vulgaris , Proteus mirabilis, Proteus mirabilis , Stenotrophomonas maltophilia , Campylobacter jejuni, Pasteurella multocida , Haemophilus parasuis, Actinobacillus pleuropneumoniae , Streptococcus suis ( Streptococcus suis ), Mycoplasma pneumoniae ( Mycoplasma pneumoniae ), Mycoplasma hominis ( Mycoplasma hominis ), Mycoplasma genitalium ( Mycoplasma genitalium ), Mycoplasma fermentans ( Mycoplasma fermentans ), Mycoplasma amphoriforme ( Mycoplasma amphoriforme ), Mycoplasma penetrans, Borrelia burgdorferi , Brucella abortus , Brucella canis , Listeria monocytogenes , Rickettsia Ketchi ( Rickettsia ricketsii ) And Yersinia pestis ( Yersinia pestis ) Any one of the transformed transformants selected from the group consisting of.
11. Animals other than humans infected with the transformed transformant according to claim 10.
12. The animal according to claim 11, wherein the animal is a mouse or a rat.
13. (a) treating bacteria transformed with the recombinant expression vector according to any one of claims 1 to 7 with a drug candidate; and

    (b) measuring the change in luminescence of the transformant after treatment with luciferin; Infectious disease drug screening method comprising the.
14. The method of claim 13, wherein the bacteria are Salmonella enterica , Escherichia coli, Citrobacter rodentium , Bordetella bronchiseptica , Acinetobacter Bauman Nii ( Acinetobacter baumannii ), Pseudomonas aeruginosa ( Pseudomonas aeruginosa ), Enterobacter cloacae ( Enterobacter cloacae ), Klebsiella pneumoniae ( Klebsiella pneumoniae ), Morganella morganii ( Morganella morganii ), Salmonella Typhimurium ( Salmonella typhimurium ), Shigella dysenteriae ( Shigella dysenteriae ), Yersinia enterocolitica ( Yersinia enterocolitica ), Acinetobacter calcoaceticus ( Acinetobacter calcoaceticus ), Francisella tularensis ( Francisella tularensis ), Legionella pneumophila, Proteus vulgaris, Proteus vulgaris, Proteus mirabilis, Stenotrophomonas maltophilia , Pasteurella multocida , Haemophilus parasuis , Actinobacillus pleuropneumoniae , Streptococcus suis , Mycoplasma pneumoniae , Mycoplasma hominis ), Mycoplasma genitalium , Mycoplasma fermentans, Mycoplasma amphoriforme , Mycoplasma penetrans , Campylobacter jejuni , Borrelia burgdorferi , Brucella abortus , Brucella canis, Listeria monocytogenes , Rickettsia ricketsii and Yersinia pestis ( Yersinia pestis ) Any one infectious disease drug screening method selected from the group consisting of.
15. The method of claim 13, wherein the infectious disease is any one selected from the group consisting of infectious gastrointestinal diseases, infectious respiratory diseases, infectious skin diseases, and infectious cardiovascular diseases.
16. (a) infecting a disease-causing site of an animal other than human with a bacterium transformed with the recombinant expression vector according to any one of claims 1 to 7;

    (b) treating an infected animal with a drug candidate;

    (c) treating luciferin and measuring a change in luminescence at a disease-causing site of an animal;
17. 17. The method of claim 16, wherein the bacteria are Salmonella enterica , Escherichia coli, Citrobacter rodentium , Bordetella bronchiseptica , Acinetobacter Bauman Nii ( Acinetobacter baumannii ), Pseudomonas aeruginosa ( Pseudomonas aeruginosa ), Enterobacter cloacae ( Enterobacter cloacae ), Klebsiella pneumoniae ( Klebsiella pneumoniae ), Morganella morganii ( Morganella morganii ), Salmonella Typhimurium ( Salmonella typhimurium ), Shigella dysenteriae ( Shigella dysenteriae ), Yersinia enterocolitica ( Yersinia enterocolitica ), Acinetobacter calcoaceticus ( Acinetobacter calcoaceticus ), Francisella tularensis ( Francisella tularensis ), Legionella pneumophila, Proteus vulgaris, Proteus vulgaris, Proteus mirabilis, Stenotrophomonas maltophilia , Pasteurella multocida , Haemophilus parasuis , Actinobacillus pleuropneumoniae , Streptococcus suis , Mycoplasma pneumoniae , Mycoplasma hominis ), Mycoplasma genitalium , Mycoplasma fermentans, Mycoplasma amphoriforme , Mycoplasma penetrans , Campylobacter jejuni, Borrelia burgdorferi , Brucella abortus , Brucella canis, Listeria monocytogenes , Rickettsia ricketsii and Yersinia pestis ( Yersinia pestis ) Any one infectious disease drug screening method selected from the group consisting of.
18. The method of claim 16, wherein the infectious disease is any one selected from the group consisting of an infectious gastrointestinal disease, an infectious respiratory disease, an infectious skin disease, and an infectious cardiovascular disease.
19. 17. The method of claim 16, wherein the disease-causing site is the esophagus, stomach, large intestine, or small intestine.
20. 17. The method of claim 16, wherein the disease-causing site is the nose, pharynx, larynx, trachea, bronchi, or lung.

Images