WO2023153805A1 - Infectious disease model and drug screening method using same - Google Patents
Infectious disease model and drug screening method using same Download PDFInfo
- Publication number
- WO2023153805A1 WO2023153805A1 PCT/KR2023/001859 KR2023001859W WO2023153805A1 WO 2023153805 A1 WO2023153805 A1 WO 2023153805A1 KR 2023001859 W KR2023001859 W KR 2023001859W WO 2023153805 A1 WO2023153805 A1 WO 2023153805A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- mycoplasma
- infectious
- disease
- recombinant expression
- expression vector
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New breeds of animals
- A01K67/027—New breeds of vertebrates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0069—Oxidoreductases (1.) acting on single donors with incorporation of molecular oxygen, i.e. oxygenases (1.13)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/66—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving luciferase
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2207/00—Modified animals
- A01K2207/12—Animals modified by administration of exogenous cells
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/10—Mammal
- A01K2227/105—Murine
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/03—Animal model, e.g. for test or diseases
- A01K2267/0337—Animal models for infectious diseases
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2304/00—Chemical means of detecting microorganisms
- C12Q2304/60—Chemiluminescent detection using ATP-luciferin-luciferase system
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/136—Screening for pharmacological compounds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y113/00—Oxidoreductases acting on single donors with incorporation of molecular oxygen (oxygenases) (1.13)
- C12Y113/12—Oxidoreductases acting on single donors with incorporation of molecular oxygen (oxygenases) (1.13) with incorporation of one atom of oxygen (internal monooxygenases or internal mixed function oxidases)(1.13.12)
- C12Y113/12007—Photinus-luciferin 4-monooxygenase (ATP-hydrolysing) (1.13.12.7), i.e. firefly-luciferase
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biophysics (AREA)
- Medicinal Chemistry (AREA)
- Analytical Chemistry (AREA)
- Hematology (AREA)
- Environmental Sciences (AREA)
- Urology & Nephrology (AREA)
- Plant Pathology (AREA)
- Pathology (AREA)
- Toxicology (AREA)
- General Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Animal Behavior & Ethology (AREA)
- Animal Husbandry (AREA)
- Biodiversity & Conservation Biology (AREA)
- Food Science & Technology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to a transformant into which a luciferase gene is introduced, an animal model infected therewith, and a method for screening for a drug by using same. A recombinant vector, a transformant thereof, and an animal model infected with the transformant, according to the present invention, can be effectively used in drug screening and the like in that these can provide in vitro and in vivo general-purpose evaluation of the efficacy of novel drug candidate materials for the treatment of infectious diseases, in a non-invasive and real-time manner.
Description
본 발명은 루시퍼라아제 유전자가 도입된 형질전환체, 이에 감염된 동물 모델 및 이를 이용한 약물의 스크리닝 방법에 관한 것이다.The present invention relates to a transformant into which a luciferase gene has been introduced, an animal model infected therewith, and a method for screening a drug using the same.
위장관계에서 발생하는 박테리아 감염에 의한 감염성 질환은 매우 흔한 질환이다. 구체적으로, 박테리아, 기생충과 같은 원인체가 음식이나 사람과 접촉하여 전염되면서 감염성 위장관 질환이 발생할 수 있다. 흔한 원인균으로는 대장균(E. coli), 살모넬라(Salmonella), 이질균(Shigella), 농녹균(Pseudomonas) 등이 있다. 이러한 위장관에서 발생하는 감염성 질환은 위와 장의 염증으로 인해 설사와 구토를 유발한다. 설사로 인해 항문이 헐고, 구토와 설사로 인해 복부에 가스가 차서 복부 팽만감이 생긴다. 또한, 탈수 증상으로 인해 기운이 없으며, 복부에 심한 통증이 생기며 고열로 인해 두통이 발생하기도 한다. BACKGROUND OF THE INVENTION Infectious diseases caused by bacterial infections of the gastrointestinal tract are very common. Specifically, an infectious gastrointestinal disease may occur as a cause such as bacteria or parasites is transmitted through contact with food or people. Common causative bacteria include E. coli , Salmonella , Shigella , Pseudomonas , and the like. Infectious diseases occurring in the gastrointestinal tract cause diarrhea and vomiting due to inflammation of the stomach and intestines. Diarrhea causes the anus to leak, and vomiting and diarrhea cause gas to build up in the abdomen, causing abdominal distension. In addition, there is no energy due to dehydration, severe pain in the abdomen, and headache due to high fever.
이러한 감염성 위장관 질환의 원인이 되는 박테리아로는 대장균(Escherichia coli), 바실러스 세레우스(Bacillus cereus), 캄필로박터 제주니(Campylobacter jejuni), 클로스트리듐 페르프린젠스(Clostridium perfringens), 살모넬라 종(Salmonella species), 시겔라 종(Shigella species), 황색포도상구균(Staphylococcus aureus), 장염 비브리오(Vibrio parahaemolyticus) 등이 알려져 있으며, 최근에는 슈퍼 박테리아 등의 존재가 확인되어 이와 관련된 질환의 심각도가 상당히 증가하고 있다. Bacteria that cause these infectious gastrointestinal diseases include Escherichia coli, Bacillus cereus, Campylobacter jejuni, Clostridium perfringens, and Salmonella species. species), Shigella species, Staphylococcus aureus, Vibrio parahaemolyticus, etc. are known, and recently, the existence of super bacteria has been confirmed, and the severity of diseases related to them is significantly increasing. .
또한, 호흡기에서 박테리아 감염에 의한 감염성 질환 역시 매우 흔한 질환이며, 감염 정도에 따라 심각한 중증 이상의 질환을 유발한다. 감염 시 유발되는 독소 생성이 각종 사이토킨의 방출을 자극하는 과정에서 기관지 및 폐에 과도한 염증 반응을 유발하고 또한 백혈구에 의한 식균작용을 억제함으로써 하단 기도에서 부산물로 류코톡신(leukotoxin)을 생산하기도 하며 이로 인해 종종 감염성 기관지 폐렴을 발병시킨다. 이러한 감염성 호흡기 질환의 증상은 갑작스러운 발열, 초기 고열, 화농성 객담을 동반한 마른 기침, 심한 오한, 흉통, 근육통 등을 들 수 있다. In addition, infectious diseases caused by bacterial infections in the respiratory tract are also very common diseases, and depending on the degree of infection, severe or more severe diseases are caused. In the process of stimulating the release of various cytokines, toxin production caused during infection causes excessive inflammatory reactions in the bronchi and lungs, and also inhibits phagocytosis by white blood cells, producing leukotoxin as a by-product in the lower respiratory tract. It often causes infectious bronchopneumonia. Symptoms of this infectious respiratory disease include sudden fever, initial high fever, dry cough accompanied by purulent sputum, severe chills, chest pain, and muscle pain.
흔한 감염성 호흡기 질환을 유발하는 원인균은 예를 들어 아시네토박터 바우마니(Acinetobacter baumannii), 파스튜렐라 멀토시다(Pasteurella multocida), 헤모필러스 파라수이스(Haemophilus parasuis), 보데텔라 브론키셉티카(Bordetella bronchiseptica), 액티노바실러스 플루로뉴모니애(Actinobacillus pleuropneumoniae), 스트렙토코커스 수이스(Streptococcus suis) 및 마이코플라스마 속(Mycoplasma spp.) 등을 고려할 수 있다. Causative bacteria causing common infectious respiratory diseases are, for example, Acinetobacter baumannii , Pasteurella multocida , Haemophilus parasuis , Bordetella bronchiseptica ( Bordetella bronchiseptica ), Actinobacillus pleuropneumoniae , Streptococcus suis , and Mycoplasma spp.
위 감염성 위장관 질환 및 감염성 호흡기 질환을 포함하는 감염성 질환의 치료에는 세프디니르(Cefdinir), 아지스로마이신(Azithromycin), 클래리스로마이신(Clarithromycin), 디리스로마이신(Dirithromycin), 에리스로마이신(Erythromycin), 록시스로마이신(Roxithromycin), 텔리스로마이신(Telithromycin), 카보마이신 A(Carbomicin A), 조사마이신(Josamycin), 키타사마이신(Kitasamycin), 미데카마이신/미데카마이신 아세테이트(Midecamycin acetate), 올렌안도마이신(Oleandomycin), 스피라마이신(Spiramycin), 트롤레안도마이신(Troleandomycin), 틸로신(Tylosin) 등의 항생제 계열 약물들이 치료에 사용되고 있다. Cefdinir, Azithromycin, Clarithromycin, Dirithromycin, Erythromycin for the treatment of infectious diseases including gastric infectious gastrointestinal diseases and infectious respiratory diseases ), Roxithromycin, Telithromycin, Carbomicin A, Josamycin, Kitasamycin, Midecamycin/Midecamycin acetate, Antibiotic drugs such as Oleandomycin, Spiramycin, Troleandomycin, and Tylosin are used for treatment.
위와 같은 항생제의 사용은 통상적으로 질환 치료에 충분한 효과를 나타내는 것이 일반적이지만, 빈번한 항생제의 사용으로 인하여 감염성 질환의 발생률이 증가하는 아이러니한 상황을 유발한다. 이러한 감염성 질환의 발생률 증가는 약물에 대한 내성 등의 발생으로 인하여 약물이 충분한 효능을 나타내지 못하여 발생하는 경우가 매우 일반적이다.Although the use of antibiotics as described above usually exhibits a sufficient effect in treating diseases, it causes an ironic situation in that the incidence of infectious diseases increases due to the frequent use of antibiotics. It is very common that the increase in the incidence of such an infectious disease occurs when a drug does not exhibit sufficient efficacy due to the development of drug resistance or the like.
위 문제로 인하여 최근 들어 감염성 질환은 항생제 사용에 따른 내성 획득으로 치료가 점점 더 어려워지고 있으며, 환자의 치료 실패 및 사망률을 증가시켜 의료현장 등 보건 분야에 위협이 되고 있다. Due to the above problems, in recent years, infectious diseases have become more and more difficult to treat due to the acquisition of resistance due to the use of antibiotics, and increase the treatment failure and mortality of patients, thereby posing a threat to the health field such as medical sites.
이러한 배경하에 위와 같은 문제를 해소할 수 있는 신규의 치료제, 특히 항생제 약물의 개발이 시급하며, 기존 치료 방법의 문제점을 극복하기 위해서 숙주-미생물간 상호작용의 이해 및 항박테리아 제제의 유효성 및 안정성 평가를 위한 신규의 감염 모델 개발이 필요한 상황이다. Under this background, it is urgent to develop new therapeutic agents, especially antibiotic drugs, that can solve the above problems, and to overcome the problems of existing treatment methods, understanding of host-microorganism interactions and evaluating the effectiveness and safety of antibacterial agents It is necessary to develop a new infection model for
그러나 위와 같은 항생제 제제의 유효성, 안정성 평가를 위한 생체 내 평가를 진행하는 연구단계에서 소요되는 시간과 비용을 줄일 수 있는 평가방법은 매우 제한적이기 때문에, 연구 개발 초기 단계에서 이와 관련된 물질의 스크리닝이 쉽지 않은 상태이다.However, since the evaluation method that can reduce the time and cost required in the research stage for in vivo evaluation for the efficacy and stability evaluation of the above antibiotic preparations is very limited, it is not easy to screen related substances in the early stage of research and development. state is not
위 스크리닝을 위하여 염색체 DNA (Chromosomal DNA)에 리포터 유전자를 삽입하여 이를 검출하는 방법은 하나의 방안으로 고려할 수 있다. 이는 염색체 상에 리포터 유전자를 삽입하면 안정적인 발현은 가능하나, 1 copy 수를 가져 낮은 유전자 발현을 보이며, 플라스미드를 이용하는 것보다 제작하는 방법이 어려우며, 많은 시간이 소요되는 단점이 있다. 또한, 염색체 DNA 내에 유전자가 끼어들어가게 되면 표현형이 변할 수 있다는 점에서 위 방안으로의 스크리닝 방법 개발은 매우 어렵다. A method of detecting the reporter gene by inserting a reporter gene into chromosomal DNA for the above screening can be considered as one method. Stable expression is possible when a reporter gene is inserted on the chromosome, but it has a low gene expression due to the number of copies of 1 copy, is more difficult to manufacture than using a plasmid, and takes a lot of time. In addition, it is very difficult to develop a screening method for the above method in that the phenotype can change when a gene is inserted into chromosomal DNA.
위와 같은 기술적 한계를 극복하고자, 본 발명자들은 광학리포터 유전자가 안정적으로 형질전환된 형질전환체 및 이러한 형질전환체로 감염된 동물 모델을 제조하였다. 그리고나서, 시간에 따른 박테리아의 시험관 및 생체 내 분포 추적 및 정량화와 함께 약물에 대한 스크리닝을 비침습적이고, 실시간적으로 모니터링 가능하도록 함으로써 본 발명을 완성하였다. In order to overcome the above technical limitations, the present inventors prepared a transformant stably transfected with an optical reporter gene and an animal model infected with the transformant. Then, the present invention was completed by enabling non-invasive, real-time monitoring of drug screening along with tracking and quantification of in vitro and in vivo distribution of bacteria over time.
본 발명의 목적은 lacI이 제거된 trc 프로모터 및 이에 작동 가능하게 연결된 Firefly 루시퍼레이즈 유전자를 포함하는 재조합 발현 벡터; 상기 재조합 발현 벡터로 형질전환된 형질전환체; 및 위 형질전환체로 감염된 동물 모델을 제공하는 데 있다. An object of the present invention is a recombinant expression vector comprising a lacI-deleted trc promoter and a Firefly luciferase gene operably linked thereto; Transformants transformed with the recombinant expression vector; And to provide an animal model infected with the above transformant.
본 발명의 다른 목적은 (a) 상기 재조합 발현 벡터로 형질전환된 형질전환체에 약물 후보 물질을 처리하는 단계;Another object of the present invention is (a) processing a drug candidate to a transformant transformed with the recombinant expression vector;
(b) 루시페린 처리 후 상기 형질전환체의 발광 변화를 측정하는 단계;를 포함하는 감염성 질환 약물 스크리닝 방법을 제공하는 데 있다. (b) measuring the change in luminescence of the transformant after treatment with luciferin;
본 발명의 또 다른 목적은 (a) 상기 재조합 발현 벡터로 형질전환된 형질전환체를 인간을 제외한 동물의 질환 유발 부위에 감염시키는 단계;Another object of the present invention is (a) infecting a transformant transformed with the recombinant expression vector to a disease-causing site of an animal other than human;
(b) 감염된 동물에 약물 후보 물질을 처리하는 단계;(b) treating an infected animal with a drug candidate;
(c) 루시페린을 처리하고 동물의 질환 유발 부위에서 발광 변화를 측정하는 단계;를 포함하는 감염성 질환 약물 스크리닝 방법을 제공하는 데 있다.(c) processing luciferin and measuring a change in luminescence at a disease-causing site of an animal;
일반적으로 고효율의 유전자 발현시스템으로 알려진 T7 프로모터 및 lac 프로모터 등은 IPTG 유도성 프로모터로서 높은 유도 발현이 가능하다. 다만, IPTG의 높은 가격과 lacI repressor에 의해 유전자 발현이 억제되는 문제 등으로 인하여 과발현 측면에서 발현 수준이 충분하지 못하다. The T7 promoter and lac promoter, which are generally known as high-efficiency gene expression systems, are IPTG inducible promoters and can be highly induced. However, the expression level is not sufficient in terms of overexpression due to the high price of IPTG and the suppression of gene expression by the lacI repressor.
본 발명은 lacI이 제거된 trc 프로모터를 사용하면서 발광 수준이 높은 반딧불이 발광효소(firefly luciferase)를 사용하여 발광 수준의 변화를 보다 강력하고 구체적으로 확인할 수 있게 하였다. In the present invention, the lacI-deleted trc promoter was used and firefly luciferase with high luminescence level was used to more strongly and specifically confirm the change in luminescence level.
이에 본 발명은 lacI이 제거된 trc 프로모터 및 이에 작동 가능하게 연결된 반딧불이 발광효소(firefly luciferase) 유전자를 포함하는 재조합 발현 벡터를 제공한다. Accordingly, the present invention provides a recombinant expression vector comprising a lacI-deleted trc promoter and a firefly luciferase gene operably linked thereto.
본 발명에 있어서 "벡터"는 적합한 숙주 내에서 목적 유전자를 발현시킬 수 있도록 적합한 조절 서열에 작동 가능하게 연결된 유전자의 염기서열을 포함하는 유전자 작제물을 의미하는 것으로, 상기 조절 서열은 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함할 수 있다. In the present invention, "vector" refers to a genetic construct comprising a nucleotide sequence of a gene operably linked to a suitable control sequence so as to express a target gene in a suitable host, and the control sequence is capable of initiating transcription. promoters capable of controlling transcription, optional operator sequences for regulating such transcription, and sequences regulating termination of transcription and translation.
본 발명에서 용어, "재조합 발현 벡터"란 적당한 숙주세포에서 목적 단백질 또는 목적 RNA을 발현할 수 있는 벡터로서, 유전자 삽입물이 발현되도록 작동가능하게 연결된 필수적인 조절 요소를 포함하는 유전자 작제물을 말한다. 본 발명에서 용어, "작동가능하게 연결된(operably linked)"은 일반적 기능을 수행하도록 핵산 발현조절 서열과 목적하는 단백질 또는 RNA를 코딩하는 핵산 서열이 기능적으로 연결(functional linkage)되어 있는 것을 말한다. 예를 들어, 프로모터와 단백질 또는 RNA를 코딩하는 핵산 서열이 작동가능하게 연결되어 코딩하는 핵산 서열의 발현에 영향을 미칠 수 있다. 재조합 벡터와의 작동적 연결은 당해 기술분야에서 잘 알려진 유전자 재조합 기술을 이용하여 제조할 수 있으며, 부위-특이적 DNA 절단 및 연결은 당해 기술 분야에서 일반적으로 알려진 효소 등을 사용한다.As used herein, the term "recombinant expression vector" is a vector capable of expressing a target protein or target RNA in a suitable host cell, and refers to a genetic construct containing essential regulatory elements operably linked to express a gene insert. As used herein, the term "operably linked" refers to functional linkage between a nucleic acid expression control sequence and a nucleic acid sequence encoding a protein or RNA of interest so as to perform a general function. For example, a promoter and a nucleic acid sequence encoding a protein or RNA may be operably linked to affect expression of the encoding nucleic acid sequence. Operational linkage with a recombinant vector can be prepared using genetic recombination techniques well known in the art, and site-specific DNA cutting and linking uses enzymes generally known in the art.
본 발명의 재조합 발현 벡터는 서열번호 1의 반딧불이 발광효소(firefly luciferase) 유전자를 포함한다. The recombinant expression vector of the present invention contains the firefly luciferase gene of SEQ ID NO: 1.
서열번호 1의 반딧불이 발광효소(firefly luciferase) 유전자는 시각화하기 위하여 사용되는 물질로 루시페린의 산화를 촉진하여 화학에너지를 빛에너지로 전환시켜 광을 발산하게 하는 효소이다. 반딧불이(firefly)로부터 직접 수득하거나 이러한 효소를 암호화하는 재조합 DNA 절편을 포함하는 미생물로부터의 발현 또는 합성에 의해 수득할 수 있다.The firefly luciferase gene of SEQ ID NO: 1 is a material used for visualization and is an enzyme that converts chemical energy into light energy by accelerating the oxidation of luciferin to emit light. It can be obtained directly from firefly or by expression or synthesis from a microorganism containing a recombinant DNA fragment encoding such an enzyme.
기존 선행기술들에서 일반적으로 Photohabdus luminescens와 같은 세균성 발광 효소를 사용하는 것과 달리, 본 발명에서는 firefly luciferase (Luc)를 사용하여 in vitro 및/또는 in vivo 상에서 강한 발광 세기의 발현을 목적하였다. 이에 따라, 이를 사용함으로써 유사한 검출량을 측정하기 위한 시간을 크게 감소시키고 또한 발광 변화의 수준을 크게 하여 약물 처리 등에 의한 발광 변화를 보다 선명하고 명확히 확인할 수 있도록 하였다. Unlike conventional prior art methods that generally use bacterial luminescent enzymes such as Photohabdus luminescens , firefly luciferase (Luc) is used in the present invention to express strong luminescence intensity in vitro and/or in vivo . Accordingly, by using this, the time for measuring a similar detection amount is greatly reduced, and the level of luminescence change is increased so that luminescence change due to drug treatment can be more clearly and clearly identified.
특히, firefly luciferase (Luc)는 600 nm의 긴 파장에서 빛을 방출하기 때문에 더 깊은 조직에 침투가 가능하다는 점에서 in vivo 이미징 촬영 조건에서 보다 우수한 작용을 나타낼 수 있다. In particular, since firefly luciferase (Luc) emits light at a long wavelength of 600 nm, it can penetrate deeper tissues, which can show better action under in vivo imaging conditions.
상기 서열번호 1로부터 제조된 반딧불이 발광효소의 아미노산 서열을 서열번호 2에 나타내었다. 서열번호 2의 서열을 합성할 수 있는 임의의 반딧불이 발광효소(firefly luciferase) 유전자 서열을 본 발명의 서열번호 1의 반딧불이 발광효소(firefly luciferase) 유전자 서열의 실질적인 상동 범주로 또한 포함한다. The amino acid sequence of the firefly luciferase prepared from SEQ ID NO: 1 is shown in SEQ ID NO: 2. Any firefly luciferase gene sequence capable of synthesizing the sequence of SEQ ID NO: 2 is also included as a substantially homologous category of the firefly luciferase gene sequence of SEQ ID NO: 1 of the present invention.
본 발명에서 용어, "프로모터"는 이에 작동 가능하게 연결된 유전자의 전사를 허용하고 조절하는 폴리뉴클레오티드 서열을 나타낸다.As used herein, the term "promoter" refers to a polynucleotide sequence that allows and regulates the transcription of a gene operably linked thereto.
본 발명의 재조합 발현 벡터는 또한 lacI이 제거된 trc 프로모터를 포함한다. 본 발명에 있어서는 반딧불이 발광효소(firefly luciferase)의 지속적 발현을 그 목적으로 한다. 이에 따라, lac repressor(lacⅠ) 서열이 제외된 프로모터 서열로 trc 프로모터를 사용함으로써 firefly luciferase 유전자를 항상 일정하게 발현할 수 있게 하였다. 특히, 현 유도를 위한 inducer인 IPTG (isopropyl-β-D-thiogalactoside, IPTG)의 유무에 관계없이 일정하고 높은 효율로 발현 수준을 높게 가져갈 수 있는 점에서 우수한 효과를 나타낸다. The recombinant expression vector of the present invention also contains a trc promoter from which lacI has been removed. In the present invention, the continuous expression of firefly luciferase is an object. Accordingly, constant expression of the firefly luciferase gene was ensured by using the trc promoter as the promoter sequence excluding the lac repressor (lacI) sequence. In particular, it shows an excellent effect in that it can bring the expression level to a high level with constant and high efficiency regardless of the presence or absence of IPTG (isopropyl-β-D-thiogalactoside, IPTG), an inducer for current induction.
이에 상기 trc 프로모터 서열을 서열번호 3으로 나타내었다. 즉, trc 프로모터 서열은 서열번호 3의 염기서열일 수 있다.Accordingly, the trc promoter sequence is represented by SEQ ID NO: 3. That is, the trc promoter sequence may be the nucleotide sequence of SEQ ID NO: 3.
본 발명에 따른 재조합 발현 벡터는 또한 복제원점(oriV)와 이동원점(oriT)를 추가로 더 포함한다. The recombinant expression vector according to the present invention further includes an origin of replication (oriV) and an origin of migration (oriT).
본 발명에 따른 재조합 발현 벡터는 broad host range를 통하여 다양한 박테리아에서 발현을 목적한다. 이에 따라, 본 발명에 따른 재조합 발현 벡터는 복제원점(oriV)와 이동원점(oriT)를 포함함으로써 범용적으로 다양한 병원 균체에 이를 적용하여 사용할 수 있는 장점을 가진다. 상기 복제원점(oriV) 서열을 서열번호 4에 나타내었고, 이동원점(oriT) 서열을 서열번호 5에 나타내었다. The recombinant expression vector according to the present invention is intended to be expressed in various bacteria through a broad host range. Accordingly, the recombinant expression vector according to the present invention includes an origin of replication (oriV) and an origin of migration (oriT), and thus has the advantage of being universally applicable to various pathogenic strains. The replication origin (oriV) sequence is shown in SEQ ID NO: 4, and the migration origin (oriT) sequence is shown in SEQ ID NO: 5.
또한, 추가로 pRO1600 oriV (서열번호 6) 및 pRO1600 Rep (서열번호 7)을 더 포함할 수도 있다.In addition, pRO1600 oriV (SEQ ID NO: 6) and pRO1600 Rep (SEQ ID NO: 7) may be further included.
상기 재조합 발현 벡터는 또한 암피실린(ampicillin) 저항성 유전자, 가나마이신(kanamycin) 저항성 유전자 및 클로람페니콜 아세틸 트랜스퍼라아제(chloramphenicol acetyl transferase) 유전자로 이루어진 군에서 선택되는 하나 이상의 항생제 저항성 유전자를 추가로 포함하는 것을 특징으로 하는 재조합 벡터일 수 있다. "항생제 저항성 유전자"는 항생제에 대하여 저항성을 가지는 유전자로서, 이것을 가지고 있는 세포는 해당 항생제를 처리한 환경에서도 생존하므로, 대장균에서 대량으로 플라스미드를 얻는 과정에 선별 마커로서 유용하게 사용된다. 본 발명에서 항생제 저항성 유전자는 본 발명의 핵심적 기술인 벡터의 최적의 조합에 따른 발현 효율에 크게 영향을 미치는 요소가 아니므로, 선별 마커로서 일반적으로 사용되는 항생제 저항성 유전자를 제한 없이 사용할 수 있다. 구체적인 예로는, 암피실린(ampicilin), 테트라사이클린(tetracyclin), 카나마이신(kanamycin), 클로람페니콜(chloroamphenicol), 스트렙토마이신 (streptomycin), 또는 네오마이신(neomycin)에 대한 저항 유전자 등을 사용할 수 있고, 바람직하게는 암피실린 저항 유전자일 수 있다.The recombinant expression vector further comprises at least one antibiotic resistance gene selected from the group consisting of an ampicillin resistance gene, a kanamycin resistance gene and a chloramphenicol acetyl transferase gene. It may be a recombinant vector to. "Antibiotic resistance gene" is a gene having resistance to antibiotics, and since cells having this gene survive in an environment treated with the antibiotic, it is usefully used as a selection marker in the process of obtaining plasmids in large quantities from E. coli. In the present invention, since the antibiotic resistance gene is not a factor that greatly affects the expression efficiency according to the optimal combination of vectors, which is a key technology of the present invention, antibiotic resistance genes commonly used as selection markers can be used without limitation. As specific examples, resistance genes to ampicillin, tetracyclin, kanamycin, chloroamphenicol, streptomycin, or neomycin can be used, preferably It may be an ampicillin resistance gene.
본 발명에 따른 재조합 발현 벡터는 바람직하게 pMF36로 알려진 벡터의 삽입 위치에 서열번호 1의 firefly luciferase (Luc) 서열이 삽입된 것일 수 있다. The recombinant expression vector according to the present invention may preferably have a firefly luciferase (Luc) sequence of SEQ ID NO: 1 inserted at the insertion site of a vector known as pMF36.
보다 구체적으로, 상기 서열번호 1의 firefly luciferase (Luc) 서열이 삽입된 재조합 벡터의 전장 서열을 서열번호 8에 나타내었다. 즉, 상기 재조합 발현 벡터는 서열번호 8의 염기 서열을 가지는 것일 수 있다. More specifically, SEQ ID NO: 8 shows the full-length sequence of the recombinant vector into which the firefly luciferase (Luc) sequence of SEQ ID NO: 1 is inserted. That is, the recombinant expression vector may have the nucleotide sequence of SEQ ID NO: 8.
이러한 본 발명에 따른 재조합 발현 벡터의 개열 지도를 도 1에 나타내었다. A cleavage map of the recombinant expression vector according to the present invention is shown in FIG. 1 .
도 1의 A는 pMF36 벡터를 나타내며, 이에 본 발명에 따른 서열번호 1의 firefly luciferase (Luc) 서열이 삽입된 재조합 벡터를 도 1의 B에 나타내었다(pJS-1). A of FIG. 1 shows the pMF36 vector, and the recombinant vector into which the firefly luciferase (Luc) sequence of SEQ ID NO: 1 according to the present invention is inserted is shown in B of FIG. 1 (pJS-1).
특히, 본 발명에 따르면, in vivo 상의 스크리닝은 피하에 존재하는 발광 신호를 측정하기 때문에 일정 수준 이상의 발현을 가져야 감지할 수 있는바, 높은 발광 발현 수준은 약물 처리에 따른 적은 양의 발광 박테리아를 검출 가능하게 한다. In particular, according to the present invention, since in vivo screening measures the luminescent signal present in the skin, it must have a certain level of expression or higher to be detected, and a high luminescent expression level detects a small amount of luminescent bacteria following drug treatment. make it possible
본 발명의 일실시양태에 따르면, 상기 재조합 벡터의 XbaⅠ 및 HindⅢ 사이에 상기 서열번호 1로 표시되는 firefly luciferase 유전자를 삽입한 것일 수 있다. According to one embodiment of the present invention, Xba I and Hind III of the recombinant vector The firefly luciferase gene represented by SEQ ID NO: 1 may be inserted in between.
본 발명은 또한 상기에서 개시된 재조합 발현 벡터로 형질전환된 형질전환체(바람직하게 박테리아 등)에 관한 것이다.The present invention also relates to a transformant (preferably a bacterium or the like) transformed with the recombinant expression vector described above.
본 발명에서 용어, "형질전환" 은 핵산 단편이 숙주세포의 게놈 안으로 이동하여 유전적으로 안정한 유전을 일으키는 것을 말한다.As used herein, the term "transformation" refers to the transfer of a nucleic acid fragment into the genome of a host cell to cause genetically stable inheritance.
상기 세포 내로 본 발명의 벡터를 형질전환시키는 방법은 염기를 세포 내로 도입하는 어떤 방법도 포함되며, 당 분야에서 공지된 바와 같이 적합한 표준 기술을 선택하여 수행할 수 있다. 일렉트로포레이션(electroporation), 칼슘 포스페이트 공동-침전 (calcium phosphate co-precipitation), 레트로바이러스 감염(retroviral infection), 미세주입법 (microinjection), DEAE-덱스트란 (DEAE-dextran), 양이온 리포좀(cationic liposome) 법 등이 있고, 이로 제한되지 않는다. 바람직하게, 열충격법(heat shock) 및/또는 일렉트로포레이션 방법을 사용할 수 있다. The method of transforming the vector of the present invention into the cell includes any method of introducing a base into the cell, and can be performed by selecting a suitable standard technique as known in the art. Electroporation, calcium phosphate co-precipitation, retroviral infection, microinjection, DEAE-dextran, cationic liposome laws, etc., but are not limited thereto. Preferably, a heat shock and/or electroporation method may be used.
본 발명에서 용어, "재조합 벡터로 형질전환된 형질전환체"는 하나 이상의 목적 단백질을 암호화하는 유전자를 갖는 벡터로 형질전환된 세포를 말한다. 본 발명에 따른 형질전환체는 예를 들어 박테리아, 바이러스, 기생충 등일 수 있다. As used herein, the term "transformant transformed with a recombinant vector" refers to a cell transformed with a vector having a gene encoding one or more target proteins. Transformants according to the present invention may be, for example, bacteria, viruses, parasites and the like.
본 발명에 따른 형질전환체는 바람직하게 박테리아이다. 이러한 박테리아는 특히, 병원균일 수 있다. Transformants according to the present invention are preferably bacteria. Such bacteria may in particular be pathogens.
예를 들어, 살모넬라 엔테리카 (Salmonella enterica), 에스케리키아 콜라이(Escherichia coli), 시트로박터 로덴티움(Citrobacter rodentium), 보데텔라 브론키셉티카 (Bordetella bronchiseptica), 아시네토박터 바우만니이 (Acinetobacter baumannii), 슈도모나스 아에루기노사(Pseudomonas aeruginosa), 엔테로박터 클로아카에(Enterobacter cloacae), 클레브시엘라 뉴모니아에(Klebsiella pneumoniae), 모르가넬라 모르가니이(Morganella morganii), 살모넬라 티피뮤리움(Salmonella typhimurium), 시겔라 디센테리아에(Shigella dysenteriae), 예르시니아 엔테로콜리티카(Yersinia enterocolitica), 아시네토박터 칼코아세티쿠스(Acinetobacter calcoaceticus), 프란시셀라 툴라렌시스(Francisella tularensis), 레지오넬라 뉴모필라(Legionella pneumophila), 프로테우스 불가리스(Proteus vulgaris), 프로테우스 미라빌리스(Proteus mirabilis), 스테노트로포모나스 말토필리아(Stenotrophomonas maltophilia), 파스튜렐라 멀토시다(Pasteurella multocida), 헤모필러스 파라수이스(Haemophilus parasuis), 액티노바실러스 플루로뉴모니애(Actinobacillus pleuropneumoniae), 스트렙토코커스 수이스(Streptococcus suis), 마이코플라스마 뉴모니애(Mycoplasma pneumoniae), 마이코플라스마 호미니스(Mycoplasma hominis), 마이코플라스마 제니탈리움(Mycoplasma genitalium), 마이코플라스마 퍼멘탄스(Mycoplasma fermentans), 마이코플라스마 암포리포르메(Mycoplasma amphoriforme), 마이코플라스마페네트란스(Mycoplasma penetrans), 캄필로박터 제주니(Campylobacter jejuni), 보렐리아 부르그도르페리 (Borrelia burgdorferi), 브루셀라 아보터스(Brucella abortus), 브루셀라 카니스(Brucella canis), 리스테리아 모노키토게네스(Listeria monocytogenes), 리케차 리케치 (Rickettsia ricketsii), 예르시니아 페스티스(Yersinia pestis) 등의 균주 중 어느 하나일 수 있다.
For example, Salmonella enterica , Escherichia coli, Citrobacter rodentium , Bordetella bronchiseptica , Acinetobacter baumannii . _ _ _ _ typhimurium ), Shigella dysenteriae, Yersinia enterocolitica, Acinetobacter calcoaceticus, Francisella tularensis , Legionella pneumophila Phila ( Legionella pneumophila ), Proteus vulgaris ( Proteus vulgaris ), Proteus mirabilis ( Proteus mirabilis ), Stenotrophomonas maltophilia ( Stenotrophomonas maltophilia ), Pasteurella multocida ( Pasteurella multocida ), Haemophilus parasu Is ( Haemophilus parasuis ), Actinobacillus pluronicumoniae ( Actinobacillus pleuropneumoniae ), Streptococcus suis ( Streptococcus suis ), Mycoplasma pneumoniae ( Mycoplasma pneumoniae ), Mycoplasma hominis ( Mycoplasma hominis ), Mycoplasma genie Talium ( Mycoplasma genitalium ), Mycoplasma fermentans ( Mycoplasma fermentans ), Mycoplasma amphoriforme ( Mycoplasma amphoriforme ), Mycoplasma penetrans ( Mycoplasma penetrans ), Campylobacter jejuni (Campylobacter jejuni), Borrelia Burgdor Perry ( Borrelia burgdorferi ), Brucella abortus ( Brucella abortus ), Brucella canis ( Brucella canis ), Listeria monocytogenes ( Listeria monocytogenes ), Rickettsia ricketsii ( Rickettsia ricketsii ), Yersinia pestis ( Yersinia pestis ), etc. It may be any one of the strains of.
본 발명은 또한 상기에서 개시된 형질전환체로 감염된 동물을 제공한다. The present invention also provides animals infected with the transformants disclosed above.
이러한 동물은 포유류동물로서는, 마우스, 랫드, 토끼, 비글, 염소, 돼지, 양, 마우스, 소 등일 수 있다. 바람직하게는 상기 형질전환체로 감염된 동물은 마우스 또는 랫드일 수 있다. 이러한 동물 모델에 있어서 감염되는 상기 형질전환체의 양은 개체 종류, 감염성 질환의 중증도, 연령, 성별, 약물의 활성, 투여 시간, 투여 경로, 및 배출 비율 등에 따라 달라질 수 있다. Such animals may be mammals such as mice, rats, rabbits, beagles, goats, pigs, sheep, mice, and cows. Preferably, the animal infected with the transformant may be a mouse or a rat. In this animal model, the amount of the transformant infected may vary depending on the type of organism, severity of infectious disease, age, sex, drug activity, administration time, administration route, and excretion rate.
예를 들어, 마우스 및/또는 랫드에 있어서 1 x 106 내지 1 x 109 CFU로 감염될 수 있으나, 박테리아 종류, 투여 경로, 마우스 연령 및 체중 등에 따라 달라지므로 이에 제한되는 것은 아니다. For example, mice and/or rats may be infected with 1 x 10 6 to 1 x 10 9 CFU, but it varies depending on the type of bacteria, route of administration, age and weight of the mouse, and so is not limited thereto.
상기 투여 혹은 감염은 목적하는 질환 부위에 따라 달라질 수 있다. 예를 들어, 경구 투여, 위내 투여, 기도 내 투여, 내이 투여, 복강 투여, 정맥 투여, 근육 투여, 피하 투여, 자궁 내 경막 투여, 심혈관 내 투여 등 목적하는 질환 유발 부위에 따라 달리 투여될 수 있다. The administration or infection may vary depending on the desired disease site. For example, oral administration, intragastric administration, intratracheal administration, inner ear administration, intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intrauterine intrathecal administration, intracardiovascular administration, etc. may be administered differently depending on the target disease inducing site. .
바람직하게, 위내 또는 기도내 투여에 의한 투여 또는 감염일 수 있다. 이를 통해서 예를 들어 위장관계 또는 호흡기관에서의 감염에 따른 질환 수준에 대한 평가가 가능하다. Preferably, it may be administration by intragastric or intratracheal administration or infection. This makes it possible to assess the level of disease following infection, for example in the gastrointestinal or respiratory tract.
본 발명은 또한, (a) 상기 재조합 발현 벡터로 형질전환된 형질전환체에 약물 후보 물질을 처리하는 단계; 및 The present invention also includes (a) processing a drug candidate into a transformant transformed with the recombinant expression vector; and
(b) 루시페린 처리 후 상기 형질전환체의 발광 변화를 측정하는 단계;를 포함하는 감염성 질환 약물 스크리닝 방법을 제공한다. (b) measuring the change in luminescence of the transformant after treatment with luciferin;
본 발명에 따른 감염성 질환은 바이러스, 세균, 곰팡이, 기생충과 같이 질병을 일으키는 병원체가 동물이나 인간에게 전파, 침입하여 일으킨 질환을 의미하며, 본 발명의 목적상 박테리아에 의해 유발되는 모든 감염성 질환을 의미한다. 구체적으로, 이러한 감염은 위장관, 호흡기, 피부 또는 심혈관계에서의 감염일 수 있다. Infectious diseases according to the present invention refer to diseases caused by disease-causing pathogens, such as viruses, bacteria, fungi, and parasites, spreading to or invading animals or humans, and for the purpose of the present invention, it means all infectious diseases caused by bacteria. do. Specifically, such infections may be infections of the gastrointestinal tract, respiratory tract, skin or cardiovascular system.
상기 위장관은 식도, 위, 대장, 소장 등을 포함하여 입으로부터 항문까지 있는 모든 소화계통의 기관을 언급한다. The gastrointestinal tract refers to all organs of the digestive system from the mouth to the anus, including the esophagus, stomach, large intestine, small intestine, and the like.
상기 호흡기는 코, 인두, 후두, 기관, 기관지, 폐 등을 포함하여 입을 통해 산소를 들이마시고 이산화탄소를 뱉는 기계적 교환에 연관된 모든 기관을 언급한다. The respiratory tract refers to all organs involved in the mechanical exchange of inhaling oxygen and exhaling carbon dioxide through the mouth, including the nose, pharynx, larynx, trachea, bronchi, lungs, and the like.
상기 심혈관계는 대동맥판, 폐동맥판, 승모판, 삼천판막, 심장근육, 심외막, 심근내막 등을 포함하여 신체에서 혈액을 운반하는데 주된 작용을 하는 관련 기관을 언급한다. The cardiovascular system refers to related organs that play a major role in transporting blood in the body, including the aortic valve, pulmonary valve, mitral valve, tricuspid valve, heart muscle, epicardium, and endocardium.
상기 피부는 피하조직, 진피, 표피, 모낭 등을 포함하는 몸의 외부 조직을 의미한다. The skin refers to an external tissue of the body including subcutaneous tissue, dermis, epidermis, hair follicles, and the like.
이에 따라 상기 감염성 질환은 감염에 의해 유발되는 감염성 위장관 질환, 감염성 호흡기 질환, 감염성 피부 질환 또는 감염성 심혈관계 질환일 수 있다. Accordingly, the infectious disease may be an infectious gastrointestinal disease, an infectious respiratory disease, an infectious skin disease, or an infectious cardiovascular disease caused by infection.
본 발명에 따른 감염성 위장관 질환이란 박테리아, 바이러스, 기생충 등의 위장관계의 감염에 의한 질환이다. 식욕 부진이나 메스꺼움, 구토 증상을 포함할 수 있고, 복명과 복부의 경련이 나타날 수 있다. 또한, 설사가 가장 공통된 증상이며 혈액과 점액이 동반될 수 있다. 또한, 고열이 있고 구역질이 나며 근육통과 탈진 증상을 발생시킬 수 있다. 본 발명에 따른 감염성 위장관 질환은 예를 들어 감염성 위장염, 감염성 결장염, 감염성 대장염, 염증성 장질환 등을 포함한다. An infectious gastrointestinal disease according to the present invention is a disease caused by infection of the gastrointestinal tract, such as bacteria, viruses, and parasites. Symptoms may include anorexia, nausea, vomiting, flatulence and abdominal cramps. Also, diarrhea is the most common symptom and may be accompanied by blood and mucus. It can also cause fever, nausea, muscle pain and exhaustion. Infectious gastrointestinal diseases according to the present invention include, for example, infectious gastroenteritis, infectious colitis, infectious colitis, inflammatory bowel disease and the like.
위 감염성 위장관 질환을 유발하는 박테리아는 장벽을 침습하지 않고 부착된 채로 장독소를 생산할 수 있다. 이러한 독소 때문에 장은 물과 전해질을 분비하게 되고 이 때문에 장액성 설사가 나올 수 있다. 일부 박테리아는 소장이나 결장벽을 침습하고, 세포를 손상시켜 소형 궤양을 형성하여(궤양화) 출혈을 일으킬 뿐 아니라 단백질과 전해질, 물이 함유된 수액이 대량 누출되게 만들 수 있다. 이에 따라, 설사에는 백혈구와 적혈구가 포함되며 간혹 피가 보이기도 한다.Bacteria that cause gastric infectious diseases of the gastrointestinal tract can produce enterotoxins while remaining attached without invading the intestinal wall. These toxins cause the intestines to secrete water and electrolytes, which can lead to watery diarrhea. Some bacteria can invade the walls of the small intestine or colon and damage cells, forming small ulcers (ulceration) that cause bleeding and large leaks of fluids containing proteins, electrolytes, and water. Accordingly, diarrhea contains white blood cells and red blood cells, and sometimes blood is visible.
이러한 질환을 일으킬 수 있는 균주로는 예를 들어 E. coli, C. rodentium, Campylobacter spp., Salmonella spp., Listeria spp., Shigella spp., Trichinella spp. 등을 고려할 수 있다. Strains that can cause these diseases include, for example , E. coli, C. rodentium, Campylobacter spp., Salmonella spp., Listeria spp., Shigella spp., Trichinella spp. etc. can be considered.
본 발명에 따른 감염성 호흡기 질환이란 박테리아, 바이러스, 기생충 등의 호흡기의 감염에 의한 질환이다. 발열, 초기 고열, 화농성 객담을 동반한 마른 기침, 심한 오한, 흉통, 근육통 등의 증상을 나타낼 수 있다. 본 발명에 따른 감염성 호흡기 질환은 예를 들어 감염성 폐렴, 폐 농양, 패혈증, 상기도 감염 등을 들 수 있다. An infectious respiratory disease according to the present invention is a disease caused by infection of the respiratory tract by bacteria, viruses, parasites, and the like. Symptoms such as fever, initial high fever, dry cough with purulent sputum, severe chills, chest pain, and muscle pain may appear. Infectious respiratory diseases according to the present invention include, for example, infectious pneumonia, lung abscess, sepsis , upper respiratory tract infection, and the like.
이러한 질환을 일으킬 수 있는 균주로는 예를 들어 Yersinia pestis, Streptococcus spp., Pateurella spp., B. bronchiseptica, A. baumannii, Mycoplasma spp. 등을 고려할 수 있다. Strains that can cause these diseases include, for example , Yersinia pestis, Streptococcus spp., Pateurella spp., B. bronchiseptica, A. baumannii, Mycoplasma spp. etc. can be considered.
본 발명에 따른 감염성 피부 질환은 박테리아, 바이러스, 기생충 등의 피부의 감염에 의한 질환이다. 피부 염증을 수반하는 증상이 일반적으로 나타낸다. 본 발명에 따른 감염성 피부 질환은 예를 들어, 농가진, 모낭염, 절종, 단독, 봉와직염, 급성 조위염 증을 들 수 있다. An infectious skin disease according to the present invention is a disease caused by infection of the skin by bacteria, viruses, parasites, and the like. Symptoms accompanying skin inflammation are commonly present. Infectious skin diseases according to the present invention include, for example, impetigo, folliculitis, excision, erysipelas, cellulitis, and acute gastritis.
이러한 질환을 일으킬 수 있는 균주로는 예를 들어 Staphylococcus spp., Micrococcus spp., Corynebacterium spp., Streptococcus spp. 등을 고려할 수 있다. Strains that can cause these diseases include, for example, Staphylococcus spp., Micrococcus spp., Corynebacterium spp., Streptococcus spp. etc. can be considered.
본 발명에 따른 감염성 심혈관계 질환은 박테리아, 바이러스, 기생충 등의 심혈관계의 감염에 의한 질환이다. 심혈관계에 발생하는 염증을 주된 특징으로 하며 염증이 생긴 부위에 혈전 등이 쌓이는 경우 위중한 증상을 나타낼 수 있다. 본 발명에 따른 감염성 심혈관계 질환은 예를 들어, 심내막염, 심근염, 심장막염, 화농성혈전정맥염, 동맥내막염 등을 포함한다. Infectious cardiovascular diseases according to the present invention are diseases caused by infections of the cardiovascular system such as bacteria, viruses, parasites, and the like. Its main feature is inflammation that occurs in the cardiovascular system, and serious symptoms can occur when blood clots accumulate in the inflamed area. Infectious cardiovascular diseases according to the present invention include, for example, endocarditis, myocarditis, pericarditis, suppurative thrombophlebitis, endoarteritis and the like.
이러한 질환을 일으킬 수 있는 균주로는 Streptococcus spp. 및 Stapylococcus spp. 등이 흔한 원인균으로 고려될 수 있지만, 특정 균주에 국한되는 것은 아니다.Strains that can cause these diseases include Streptococcus spp. and Stapylococcus spp. etc. can be considered as common causative bacteria, but is not limited to a specific strain.
본 발명에 따른 구체적인 감염성 질환은 감염성 위장관 질환 또는 감염성 호흡기 질환이다. A specific infectious disease according to the present invention is an infectious gastrointestinal disease or an infectious respiratory disease.
본 발명에 따른 감염성 위장관 질환 약물 스크리닝 방법은 재조합 발현 벡터로 형질전환된 형질전환체에 약물 후보 물질을 처리하는 단계를 포함한다. The infectious gastrointestinal disease drug screening method according to the present invention includes the step of treating a drug candidate to a transformant transformed with a recombinant expression vector.
본 발명에 따른 상기 형질전환체는 바람직하게 박테리아로 상기 언급된 바와 같다. The transformant according to the present invention is preferably a bacterium as mentioned above.
상기 약물 후보 물질은 예를 들어 항체, 단백질, 항원, 펩타이드, 핵산, 효소, 세포, 생리활성 고분자, 생리활성 무기 물질 및 약물(예를 들어 화합물 등)으로 이루어진 군으로부터 선택되는 어느 하나 일 수 있다. The drug candidate may be, for example, any one selected from the group consisting of antibodies, proteins, antigens, peptides, nucleic acids, enzymes, cells, bioactive polymers, bioactive inorganic substances, and drugs (eg, compounds). .
본 발명에서 용어 "루시페린(luciferin)"은 생물발광에 있어 루시페린(luciferin)-발광효소(luciferase)반응 (L-L반응)을 나타내는 발광반응의 발광성 기질을 총칭하며, 종류로는 갯반디루시페린, 반디루시페린, 라티아루 시페린, 코엘렌테라진 등이 있다. 발광성 효소 존재 하에서 산소분자에 의해 산화되어 산화생성물(옥시루시페린)이 들뜬 상태에서 생성되며, 그것이 기저상태가 될 때에 가시광을 발생하는데 그 과정을 요약하면 루시페린+O2→ 옥시루시페린+광(光)이 된다. 상기 루시페린은, 이에 제한되지는 않으나, D-루시페린, 천연형(native) 코엘렌테라진 또는 천연형의 2-디옥시 유도체(2-deoxy derivative)인 h-코엘렌테라진일 수 있다. 보다 구체적으로, D-루시페린을 사용할 수 있다. In the present invention, the term "luciferin" is a generic term for luminescent substrates of luminescence reaction that exhibit luciferin-luciferase reaction (LL reaction) in bioluminescence. , ratiaru cipherin, and coelenterazine. It is oxidized by oxygen molecules in the presence of a luminescent enzyme, and an oxidation product (oxyluciferin) is produced in an excited state, and when it becomes a ground state, visible light is generated. To summarize the process, luciferin + O 2 → oxyluciferin + light do. The luciferin may be, but is not limited to, D-luciferin, native coelenterazine, or h-coelenterazine, which is a 2-deoxy derivative. More specifically, D-luciferin can be used.
상기 재조합 발현 벡터로 형질전환된 형질전환체의 경우 루시페린에 의해 발광특성을 나타낸다. 본 발명에 따른 루시페린의 처리는 동일한 반응계(reaction system)에 재조합 발현 벡터로 형질전환된 형질전환체를 위치시키는 것을 의미하며, 예를 들어, 형질전환체를 포함하는 용기에 루시페린을 첨가하는 것, 루시페린을 포함하는 용기에 형질전환체를 첨가하는 것, 또는 상기 형질전환체와 루시페린을 혼합하는 것을 포함한다.Transformants transformed with the recombinant expression vector exhibit luminescent properties by luciferin. Treatment of luciferin according to the present invention means placing a transformant transformed with a recombinant expression vector in the same reaction system, for example, adding luciferin to a container containing a transformant, adding a transformant to a container containing luciferin, or mixing the transformant and luciferin.
이에 상기 언급된 약물 후보 물질의 처리는 발광 효율에 변화를 줄 수 있다. Accordingly, treatment of the above-mentioned drug candidates may change the luminous efficiency.
본 발명에 따른 감염성 질환 약물 스크리닝 방법은 (b)루시페린 처리 후 상기 형질전환체의 발광 변화를 측정하는 단계를 포함한다. The infectious disease drug screening method according to the present invention includes (b) measuring the change in luminescence of the transformant after treatment with luciferin.
상기 발광 특성의 측정은 상기 (a) 단계에서 생성된 광의 수준을 검출하고, 정량적으로 또는 정성적으로 검출하는 것을 지칭한다. 발광은 당해 분야에 공지된 임의의 수단에 의해, 예를 들어, 발광 현미경, 광도계, 발광 플레이트 판독기, 증배관 검출기 등에 의해 검출될 수 있다.The measurement of the luminous properties refers to detecting the level of light generated in the step (a), quantitatively or qualitatively. Luminescence can be detected by any means known in the art, for example, by luminescence microscopes, photometers, luminescence plate readers, multiplier tube detectors, and the like.
상기 발광 수준의 검출에 의해 약물 후보 물질이 처리되지 않은 대조군에 대비하여 발광 수준이 감소되면 이를 약물 후보 물질로 고려할 수 있다. If the luminescence level is reduced compared to the control group not treated with the drug candidate by the detection of the luminescence level, it can be considered as the drug candidate material.
이에 따라, 본 발명은 추가로 (c) 약물 후보 물질이 처리되지 않은 대조군에 대비하여 발광 수준이 감소된 약물 후보 물질을 선별하는 단계;를 추가로 포함할 수 있다. Accordingly, the present invention may further include (c) selecting a drug candidate having a reduced emission level compared to a control group not treated with the drug candidate.
본 발명은 또한 (a) 상기 재조합 발현 벡터로 형질전환된 형질전환체를 인간을 제외한 동물의 질환 유발 부위에 감염시키는 단계;The present invention also provides (a) infecting a disease-causing site of an animal other than human with a transformant transformed with the recombinant expression vector;
(b) 감염된 동물에 약물 후보 물질을 처리하는 단계;(b) treating an infected animal with a drug candidate;
(c) 루시페린을 처리하고 동물의 질환 유발 부위에서 발광 변화를 측정하는 단계;를 포함하는 감염성 질환 약물 스크리닝 방법을 제공한다. (c) treating luciferin and measuring the change in luminescence at the disease-causing site of the animal;
본 발명에 따른 감염성 질환 약물 스크리닝 방법은 (a) 상기 재조합 발현 벡터로 형질전환된 형질전환체를 인간을 제외한 동물의 질환 유발 부위에 감염시키는 단계를 포함한다. The infectious disease drug screening method according to the present invention includes the step of (a) infecting a transformant transformed with the recombinant expression vector into a disease-causing site of an animal other than human.
상기 질환 유발 부위는 예를 들어 앞서 언급된 위장관, 호흡기, 피부 또는 심혈관계의 임의의 부위일 수 있다. 이러한 질환 유발 부위에 목적하는 형질전환체의 감염을 위해 필요에 따라, 경구 투여, 위내 투여, 기도 내 투여, 내이 투여, 복강 투여, 정맥 투여, 근육 투여, 피하 투여, 자궁 내 경막 투여, 심혈관 내 투여를 통해 적절한 감염성 질환 모델을 제조할 수 있다. The disease-causing site may be, for example, any site in the gastrointestinal tract, respiratory tract, skin, or cardiovascular system mentioned above. Oral administration, intragastric administration, intratracheal administration, inner ear administration, intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intrauterine intrathecal administration, intracardiovascular administration, as necessary for infection of the desired transformant at the disease-causing site. Administration can produce an appropriate infectious disease model.
상기 형질전환체는 바람직하게 앞서 살핀 바와 같이, 감염성 질환을 일으킬 수 있는 박테리아일 수 있다. The transformant may preferably be a bacterium capable of causing an infectious disease, as described above.
이러한 동물은 포유류 동물로서는, 마우스, 랫드, 토끼, 비글, 염소, 돼지, 양, 마우스, 소 등일 수 있다. 위 형질전환체를 통한 동물에 대한 감염을 통하여 감염성 질환을 유발할 수 있다. Such animals may be mammals such as mice, rats, rabbits, beagles, goats, pigs, sheep, mice, and cows. Infectious diseases can be induced through infection of animals through the above transformants.
이러한 감염성 질환 유발을 위한 박테리아의 투여 또는 감염 수는 목적하는 질환의 중증도, 질환 유발 균주, 투여되는 동물의 종류 등에 따라 달라질 수 있다. 바람직하게 상기 투여 또는 감염은 위내 투여 또는 기도내 투여에 의한 투여 또는 감염일 수 있다. 이를 통해서 질환 유발 부위에서의 감염에 따른 질환 수준에 대한 평가가 가능하다. The number of bacteria administered or infected for causing such an infectious disease may vary depending on the severity of the desired disease, the disease-causing strain, the type of animal to be administered, and the like. Preferably, the administration or infection may be administration or infection by intragastric administration or intratracheal administration. Through this, it is possible to evaluate the level of the disease according to the infection at the disease-causing site.
바람직하게 상기 질환 유발 부위는 위장관계일 수 있다. 보다 구체적으로, 위, 소장, 대장 또는 식도일 수 있다. Preferably, the disease-causing site may be the gastrointestinal system. More specifically, it may be the stomach, small intestine, large intestine or esophagus.
바람직하게 상기 질환 유발 부위는 호흡기일 수 있다. 보다 구체적으로, 코, 기관, 기관지 또는 폐일 수 있다. Preferably, the disease-causing site may be the respiratory tract. More specifically, it may be the nose, trachea, bronchi or lungs.
본 발명에 따른 감염성 질환의 약물 스크리닝 방법은 또한 감염된 동물에 약물 후보 물질을 처리하는 단계를 포함한다. The drug screening method for infectious diseases according to the present invention also includes the step of treating an infected animal with a drug candidate.
상기 감염된 동물에 약물 후보 물질의 처리는 다양한 투여 경로를 통해 진행될 수 있다. 예를 들어, 경구 투여, 위내 투여, 기도 내 투여, 내이 투여, 복강 투여, 정맥 투여, 근육 투여, 피하 투여, 자궁 내 경막 투여, 심혈관 내 투여 등 다양한 투여 경로 하에 약물의 약효의 유무를 확인할 수 있는 적절한 함량으로 투여될 수 있다. 이러한 투여는 약물 후보 물질의 처리는 목적하는 질환의 중증도, 질환 유발 균주, 투여되는 동물의 종류 등에 따라 달라질 수 있다.Treatment of the drug candidate to the infected animal may proceed through various administration routes. For example, the presence or absence of drug efficacy can be confirmed under various administration routes such as oral administration, intragastric administration, intratracheal administration, inner ear administration, intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intrauterine intrathecal administration, and intracardiovascular administration. It can be administered in an appropriate amount. Such administration and treatment of the drug candidate may vary depending on the severity of the target disease, the disease-causing strain, and the type of animal to be administered.
본 발명에 따른 감염성 질환 약물 스크리닝 방법은 또한 (c) 루시페린을 처리하고 동물의 감염 유발 부위에서 발광 변화를 측정하는 단계를 포함한다. The infectious disease drug screening method according to the present invention also includes the step of (c) treating luciferin and measuring the change in luminescence at the site of infection of the animal.
본 발명에 따른 루시페린의 처리는 동일한 반응계(reaction system)에 재조합 발현 벡터로 형질전환된 형질전환체를 위치시키는 것을 의미하며, 이에 따라 루시페린을 경구 투여, 위내 투여, 기도 내 투여, 내이 투여, 복강 투여, 정맥 투여, 근육 투여, 피하 투여, 자궁 내 경막 투여, 심혈관 내 투여 등을 통하여 투여하는 것을 포함할 수 있다. Treatment of luciferin according to the present invention means placing a transformant transformed with a recombinant expression vector in the same reaction system, and accordingly, luciferin is administered orally, intragastrically, intratracheally, inner ear, or intraperitoneally. It may include administration through administration, intravenous administration, intramuscular administration, subcutaneous administration, intrauterine intrathecal administration, intracardiovascular administration, and the like.
이러한 루시페린의 처리는 투여되는 형질전환체의 수, 동물의 체중 등에 따라 달리 고려될 수 있다. Such treatment with luciferin may be considered differently depending on the number of transformants administered , the body weight of the animal, and the like.
구체적으로, 본 발명에 따른 방법을 이용하면 동물의 희생이나 생체 표본 고정 없이 생체 내 약물 후보 물질의 효능을 확인하여, 약물 효능을 스크리닝하는데 실용적인 수단으로 제시할 수 있다. Specifically, the method according to the present invention can be used as a practical means for screening drug efficacy by confirming the efficacy of drug candidates in vivo without sacrificing animals or fixing biological specimens.
통상적으로 감염성 질환 치료제 개발을 위해서 In vivo 상에서는 감염동물모델을 제작한 뒤 약물 후보 물질을 처리 후 시간대별로 동물을 희생시켜 다양한 실험방법(분자생물학적 방법 이용, 또는 조직병리학적 방법 이용, 또는 타켓 장기에서 박테리아 수 카운트 등)을 적용하여 약물 후보 물질로서의 가능성을 확인하는 과정을 필요로 한다. In general, in order to develop a therapeutic agent for an infectious disease, an animal model for infection is prepared in vivo , then the drug candidate is treated, and then the animal is sacrificed over time to perform various experiments (using molecular biological methods, histopathological methods, or target organs). Bacteria count, etc.) is required to confirm the potential as a drug candidate.
그런데, 이 과정은 많은 동물의 희생이 불가피하고, 평가를 위해 시간과 비용이 많이 소요되는 문제가 있다. 또한, In vitro 상에서는 약물 후보 물질을 처리, 시간대별 샘플링을 한 후 박테리아 수 확인 또는 분자생물학적 방법을 이용한 실험이 필요한 문제가 있다. However, this process has problems in that many animals are sacrificed and time and money are consuming for evaluation. In addition, in vitro , there is a problem in that an experiment using a molecular biological method or confirmation of the number of bacteria is required after processing a drug candidate and sampling by time.
이러한 관점에서, 본 발명에 따른 방법은 생체내 반응을 비침습적으로 실시간 평가할 수 있기 때문에 약물 후보 물질의 가능성 평가에 큰 장점을 가진다. From this point of view, the method according to the present invention has a great advantage in evaluating the possibility of a drug candidate because it can non-invasively evaluate the in vivo response in real time.
특히, 본원 발명에 따른 FireFly 루시퍼라아제 유전자를 포함하는 재조합 벡터의 경우 높은 발현량을 통하여 장시간에 걸친 약물 변화의 확인이 가능하다는 점에서 우수성이 또한 인정된다.In particular, in the case of the recombinant vector containing the FireFly luciferase gene according to the present invention, the superiority is also recognized in that drug changes can be confirmed over a long period of time through high expression levels.
상기 발광 수준의 검출에 의해 약물 후보 물질이 처리되지 않은 대조군에 대비하여 발광 수준이 감소되면 이를 약물 후보 물질로 고려할 수 있다. If the luminescence level is reduced compared to the control group not treated with the drug candidate by the detection of the luminescence level, it can be considered as the drug candidate material.
이에 따라, 본 발명은 추가로 (d) 약물 후보 물질이 처리되지 않은 대조군에 대비하여 발광 수준이 감소된 약물 후보 물질을 선별하는 단계;를 추가로 포함할 수 있다. Accordingly, the present invention may further include (d) selecting a drug candidate having a reduced luminescence level compared to a control group not treated with the drug candidate.
본 발명에 따른 재조합 벡터, 이의 형질전환체 및 이러한 형질전환체로 감염된 동물모델은 In vitro 및 In vivo 상에서 범용적으로 신규의 감염성 질환 치료의 약물 후보 물질의 유효성 평가를 비침습적 및 실시간으로 제공할 수 있다는 점에서 약물 스크리닝 등에 유용하게 이용될 수 있다.The recombinant vector according to the present invention, its transformants, and animal models infected with these transformants can provide universal, non-invasive and real-time evaluation of the efficacy of drug candidates for the treatment of novel infectious diseases in vitro and in vivo. It can be usefully used for drug screening in that it exists.
도 1은 pMF36의 벡터 구조 및 본 발명에서 제조된 재조합 벡터 pJS-1의 구조를 나타낸다.Figure 1 shows the vector structure of pMF36 and the structure of the recombinant vector pJS-1 prepared in the present invention.
도 2는 고체배지에서 FireFly 루시퍼라아제 유전자를 포함하는 재조합 벡터로 형질전환된 P. aeruginosa의 안정적 발광을 In vitro 상에서 확인한 결과를 나타낸다. Figure 2 shows the result of confirming stable luminescence in vitro of P. aeruginosa transformed with a recombinant vector containing a FireFly luciferase gene in a solid medium.
도 3은 액체배지에서 FireFly 루시퍼라아제 유전자를 포함하는 재조합 벡터로 형질전환된 P. aeruginosa의 안정적 발광을 In vitro 상에서 확인한 결과를 나타낸다. Figure 3 shows the result of confirming the stable light emission of P. aeruginosa transformed with the recombinant vector containing the FireFly luciferase gene in a liquid medium in vitro .
도 4는 고체배지에서 FireFly 루시퍼라아제 유전자를 포함하는 재조합 벡터로 형질전환된 B. bronchiseptica의 안정적 발광을 In vitro 상에서 확인한 결과를 나타낸다. Figure 4 shows the result of confirming the stable luminescence of B. bronchiseptica transformed with the recombinant vector containing the FireFly luciferase gene in a solid medium in vitro .
도 5는 실험동물 (또는 마우스)에서 FireFly 루시퍼라아제 유전자를 포함하는 재조합 벡터로 형질전환된 P. aeruginosa의 안정적 발광 효능을 In vivo 상에서 확인한 결과이다.
5 shows the result of confirming the stable luminescence efficacy of P. aeruginosa transformed with the recombinant vector containing the FireFly luciferase gene in an experimental animal (or mouse) in vivo .
도 6은 비교예들로 pLI50에 FireFly 루시퍼라아제 유전자를 삽입한 재조합 벡터(pJS-2), pCN60에 FireFly 루시퍼라아제 유전자를 삽입한 재조합 벡터(pJS-3), pAKlux2 벡터(pJS-4), 및 pRMC2에 FireFly 루시퍼라아제 유전자를 삽입한 재조합 벡터(pJS-5)의 모식도를 나타낸다. Figure 6 is a comparative example of a recombinant vector (pJS-2) in which the FireFly luciferase gene was inserted into pLI50, a recombinant vector (pJS-3) in which the FireFly luciferase gene was inserted in pCN60, and a pAKlux2 vector (pJS-4). , and a schematic diagram of a recombinant vector (pJS-5) in which the FireFly luciferase gene is inserted into pRMC2.
도 7은 In vitro 상에서 FireFly 루시퍼라아제 유전자를 포함하는 재조합 벡터로 형질전환된 P. aeruginosa에 항생제를 처리하여 약물 유효성 평가를 수행한 결과를 나타낸다.7 shows the results of drug efficacy evaluation by treating P. aeruginosa transformed with a recombinant vector containing a FireFly luciferase gene in vitro with an antibiotic.
도 8은 In vitro 상에서 FireFly 루시퍼라아제 유전자를 포함하는 재조합 벡터로 형질전환된 B. bronchiseptica에 항생제를 처리하여 약물 유효성 평가를 수행한 결과를 나타낸다.8 shows the results of drug efficacy evaluation by treating B. bronchiseptica transformed with a recombinant vector containing a FireFly luciferase gene in vitro with an antibiotic.
도 9는 감염성 위장관 질환 동물 모델 상에서 항생제 처리에 따른 약물 유효성 평가를 수행한 결과를 나타낸다.Figure 9 The results of drug efficacy evaluation according to antibiotic treatment on an animal model of an infectious gastrointestinal disease are shown.
도 10은 재조합 벡터 종류에 따른 발광 효능 차이를 확인한 결과를 나타낸다(왼쪽: S. Typhimurium/pJS-2), 오른쪽: S. Typhimurium/pJS-1).Figure 10 shows the result of confirming the difference in luminescence efficacy according to the type of recombinant vector (left: S. Typhimurium/pJS-2), right: S. Typhimurium/pJS-1).
도 11은 감염성 호흡기 질환 동물모델 상에서 항생제 처리에 따른 약물 유효성 평가를 수행한 결과를 나타낸다.Figure 11 is The results of drug efficacy evaluation according to antibiotic treatment on an animal model of infectious respiratory disease are shown.
도 12는 FireFly 루시퍼라아제 유전자를 포함하는 재조합 벡터 종류에 따른 발광 효능 차이를. In vitro 상에서 확인한 결과를 나타낸다((a): 음성 대조군, (b): pJS-3, (c): pJS-4, (d): pJS-2, (e): pJS-5, (f): pJS-1).Figure 12 shows the difference in luminescence efficacy according to the type of recombinant vector containing the FireFly luciferase gene. The results confirmed in vitro are shown ((a): negative control, (b): pJS-3, (c): pJS-4, (d): pJS-2, (e): pJS-5, (f) :pJS-1).
도 13은 FireFly 루시퍼라아제 유전자를 포함하는 재조합 벡터로 형질전환된 S. Typhimurium 및 P. aeruginosa의 안정적 발광을 In vitro 상에서 확인한 결과를 나타낸다.13 shows the result of confirming the stable light emission of S. Typhimurium and P. aeruginosa transformed with the recombinant vector containing the FireFly luciferase gene in vitro .
도 14는 고체배지에서 FireFly 루시퍼라아제 유전자를 포함하는 재조합 벡터로 형질전환된 S. Typhimurium, A. baumannii 및 C. rodentium의 안정적 발광을 In vitro 상에서 확인한 결과를 나타낸다. 14 shows the result of confirming the stable light emission of S. Typhimurium, A. baumannii and C. rodentium transformed with the recombinant vector containing the FireFly luciferase gene in a solid medium in vitro .
도 15는 형질전환된 P. aeruginosa 균주와 Wild type의 O.D 변화(A), 발광값(B) 및 박테리아 카운트(C)의 변화를 모니터링한 In vitro 생장 실험 결과를 나타낸 것이다.Figure 15 shows the results of in vitro growth experiments monitoring changes in OD (A), luminescence value (B), and bacterial count (C) of the transformed P. aeruginosa strain and the wild type.
도 16은 형질전환된 S. Typhimurium 균주와 Wild type의 O.D 변화(A), 발광값(B) 및 박테리아 카운트(C)의 변화를 모니터링한 In vitro 생장 실험 결과를 나타낸 것이다.16 shows the results of in vitro growth experiments monitoring changes in OD (A), luminescence values (B), and bacterial counts (C) of transformed S. Typhimurium strains and wild type.
도 17은 감염 동물 모델(감염성 호흡기 질환 모델)에서 FireFly 루시퍼라아제 유전자를 포함하는 재조합 벡터로 형질전환된 B. bronchiseptica, A. baumannii, 및 P. aeruginosa의 안정적 발광 효능을 In vivo 상에서 확인한 결과이다.
17 is a result of confirming the stable luminescence efficacy of B. bronchiseptica , A. baumannii, and P. aeruginosa transformed with a recombinant vector containing the FireFly luciferase gene in an infected animal model (infectious respiratory disease model) in vivo . .
도 18은 감염 동물 모델(감염성 호흡기 질환 모델)의 폐 조직에서 FireFly 루시퍼라아제 유전자를 포함하는 재조합 벡터로 형질전환된 B. bronchiseptica, A. baumannii, 및 P. aeruginosa의 안정적 발광 효능을 확인한 결과이다.
18 is a result confirming the stable luminescence efficacy of B. bronchiseptica , A. baumannii, and P. aeruginosa transformed with a recombinant vector containing the FireFly luciferase gene in lung tissue of an infected animal model (infectious respiratory disease model). .
도 19는 감염 동물 모델(감염성 대장염 모델)에서 FireFly 루시퍼라아제 유전자를 포함하는 재조합 벡터로 형질전환된 C. rodentium, S.
Typhimurium, 및 P. aeruginosa의 안정적 발광 효능을 In vivo 상에서 확인한 결과이다.
19 shows C. rodentium , S. This is the result of confirming the stable luminescence efficacy of Typhimurium and P. aeruginosa in vivo .
도 20은 In vitro 상에서 FireFly 루시퍼라아제 유전자를 포함하는 재조합 벡터로 형질전환된 S.
Typhimurium에 항생제를 처리하여 약물 유효성 평가를 수행한 결과를 나타낸다.20 is S. transformed with a recombinant vector containing the FireFly luciferase gene in vitro . The results of drug efficacy evaluation by treating Typhimurium with antibiotics are shown.
도 21은 감염성 위장관 질환 동물 모델 상에서 항생제 처리에 따른 약물 유효성 평가를 수행한 결과를 나타낸다.Figure 21 is The results of drug efficacy evaluation according to antibiotic treatment on an animal model of an infectious gastrointestinal disease are shown.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지는 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as being limited by these examples.
실시예 1. FireFly 루시퍼라아제 유전자를 포함하는 재조합 벡터의 제조 Example 1. Construction of a recombinant vector containing the FireFly luciferase gene
Firefly 루시퍼라아제 유전자를 포함하는 재조합 벡터를 제조를 위하여 broad host range 플라스미드인 pMF36를 선정하였다. pMF36는 선별적 인자인 암피실린(Ampicillin) 서열과 trc 프로모터를 포함하고 있으며, LacI 서열을 포함하지 않는다.To prepare a recombinant vector containing the Firefly luciferase gene, pMF36, a broad host range plasmid, was selected. pMF36 contains an ampicillin sequence and a trc promoter, which are selectable factors, but does not contain a LacI sequence.
본 실시예에서는 pMF36의 backbone을 가지는 것으로 알려진 pMF230(Addgene 제조사로부터 구매)의 GFP 서열을 제거한 것을 이용하여 아래 실험을 수행하였다. In this example, the following experiment was performed using pMF230 (purchased from Addgene), which is known to have a backbone of pMF36, from which the GFP sequence was removed.
루시퍼라아제 유전자를 삽입시키기 위해 MCS (Multiple Cloning Site)에 존재하는 XbaⅠ, HindⅢ 제한효소 선정하고 루시퍼라아제 유전자(서열번호 1)를 주형으로 하여 XbaⅠ, HindⅢ 가 포함된 프라이머 세트를 이용하여 PCR을 수행하였다. In order to insert the luciferase gene, Xba Ⅰ, Hind Ⅲ restriction enzymes present in MCS (Multiple Cloning Site) were selected, and a primer set containing Xba Ⅰ and Hind Ⅲ was used with the luciferase gene (SEQ ID NO: 1) as a template. PCR was performed using
-Forward primer (XbaⅠ, 서열번호 9): GCTCTAGAGCATGGAAAATATGGAAAACGACGAG-Forward primer ( Xba I, SEQ ID NO: 9): GC TCTAGA GCATGGAAAATATGGAAAACGACGAG
-Reverse primer (HindⅢ, 서열번호 10): CCCAAGCTTGGGTCACATCTTGGCCACGGG-Reverse primer ( Hind Ⅲ, SEQ ID NO: 10): CCC AAGCTT GGGTCACATCTTGGCCACGGG
PCR은 다음과 같은 조건으로 진행하였다; 초기 Denaturation 과정 98 ℃에서 2분; Denaturation 95 ℃에서 10초, 프라이머 Annealing 과정 58 ℃에서 10초, Extension과정 72 ℃에서 35cycle; 그리고 최종 extension 과정 72 ℃에서 5분간으로 하였다.PCR was performed under the following conditions; Initial denaturation process at 98 °C for 2 minutes; Denaturation at 95 ℃ for 10 seconds, Primer Annealing at 58 ℃ for 10 seconds, Extension at 72 ℃ for 35 cycles; And the final extension process was carried out at 72 ℃ for 5 minutes.
증폭 산물은 XbaⅠ, HindⅢ 제한효소로 절단한 후 Purification Kit를 이용하여 정제하였다. 벡터 내 삽입을 목적하는 서열을 서열번호 11에 나타내었다. The amplification products were digested with Xba I and Hind III restriction enzymes and then purified using a Purification Kit. A sequence to be inserted into the vector is shown in SEQ ID NO: 11.
그리고 나서 pMF36도 동일하게 XbaⅠ과 HindⅢ 제한효소로 절단하고, pMF36과 luciferase 유전자는 T4 ligase (Takara)로 16 ℃에서 overnight 반응하여 재조합 벡터를 구축하고 이를 pJS-1로 명명하였다. Then, pMF36 was also digested with Xba I and Hind III restriction enzymes in the same way, and pMF36 and luciferase genes were reacted overnight at 16 ° C with T4 ligase (Takara) to construct a recombinant vector, which was named pJS-1.
구축된 luciferase labeled 플라스미드는 열충격법(Heat shock)을 이용하여 E. coli DH5a 균주에 형질전환하였다. The constructed luciferase labeled plasmid was transformed into E. coli DH5a strain using heat shock.
위 제조된 재조합 벡터의 구체적 구성은 아래 도 1의 B와 같다. The specific configuration of the recombinant vector prepared above is shown in B of FIG. 1 below.
그리고 나서, 재조합 벡터를 포함하는 균주를 선별하기 위해 암피실린 항생제가 첨가된 LB 배지를 통해 선별과정을 수행하였다. Then, in order to select a strain containing the recombinant vector, a selection process was performed through LB medium supplemented with ampicillin antibiotic.
선별된 균주로부터 재조합 벡터를 정제하여 실험에 이용하였다.A recombinant vector was purified from the selected strain and used in the experiment.
실시예 2. 재조합 벡터가 도입된 형질전환체 (발광 미생물) 제작Example 2. Production of transformants (luminescent microorganisms) into which the recombinant vector was introduced
상기 실시예 1에서 제조한 재조합 벡터를 E. coli DH5a, A. baumannii, C. rodentium, B. bronchiseptica, P. aeruginosa, S.Typhimurium에 각각 삽입하기 위해 DNA가 잘 들어갈 수 있도록 형질전환용 컴피턴트 세포로 제작하였다. In order to insert the recombinant vector prepared in Example 1 into E. coli DH5a, A. baumannii, C. rodentium , B. bronchiseptica , P. aeruginosa, and S. Typhimurium, respectively, the DNA is competent for transformation. made of cells.
우선 E. coli DH5a, S. Typhimurium 및 P. aeruginosa는 Luria Bertani (LB)에서 A. baumannii, C. redentium, B. bronchiseptica는 Brain Heart Infusion (BHI) 액체 배지를 사용하여 200 rpm에서 진탕배양하거나 1.5% (w/v) 한천을 첨가한 고체배지를 사용하여 37 ℃에서 배양하였다. 항생제 ampicillin은 100 ㎍/ml 농도로 첨가하였다.First, E. coli DH5a , S. Typhimurium, and P. aeruginosa were cultured in Luria Bertani (LB) while A. baumannii , C. redentium, and B. bronchiseptica were cultured in Brain Heart Infusion (BHI) liquid medium with shaking at 200 rpm or 1.5 % (w/v) was cultured at 37 °C using a solid medium supplemented with agar. The antibiotic ampicillin was added at a concentration of 100 μg/ml.
형질 전환 competent cell을 제작하기 위해 overnight한 균액을 본 배양 배지에 접종하여 O.D. 약 0.5까지 배양하였다. 배양된 균액은 30분간 아이스에서 차갑게 방치한 후 2,500g, 4 ℃ 10 분간 원심분리한 후 상층액을 제거하였다. 박테리아 세포 펠렛은 10% glycerol로 여러 번 수세하였고, 최종적으로 배양액의 1/50 양의 10% glycerol로 현탁하여 형질전환 전까지 -80 ℃에 보관하였다.In order to produce a transforming competent cell, the overnight bacterial solution was inoculated into this culture medium and O.D. It was cultured to about 0.5. The cultured bacterial solution was left cold on ice for 30 minutes, and then centrifuged at 2,500 g at 4 ° C. for 10 minutes, and the supernatant was removed. The bacterial cell pellet was washed several times with 10% glycerol, and finally suspended in 1/50 of the culture medium in 10% glycerol and stored at -80 °C until transformation.
제조된 각각의 컴피던트 세포에 상기 실시예 1에서 제조된 pJS-1 DNA를 1 ㎍ 첨가한 후 전기천공법 (Electroporation)을 통해 세포 내로 도입하였다. After adding 1 μg of the pJS-1 DNA prepared in Example 1 to each competent cell prepared, it was introduced into the cells through electroporation.
다음으로, 재조합 플라스미드가 도입된 박테리아를 선별을 위해 암피실린 배지를 사용하였고, 마이크로플레이트 리더를 이용하여 기질 D-luciferin Potassium Salt Bioluminescent Substrate (XenoLight)를 최종 농도 0.3 ㎎/㎖이 되도록 첨가 후 발광 값을 확인하였다. Next, ampicillin medium was used to select bacteria into which the recombinant plasmid was introduced, and the substrate D-luciferin Potassium Salt Bioluminescent Substrate (XenoLight) was added to a final concentration of 0.3 mg/ml using a microplate reader, and the luminescence value was measured. Confirmed.
제조된 박테리아 리스트를 아래 표 1과 같이 명명하였다.The list of prepared bacteria was named as shown in Table 1 below.
상기 제조된 형질전환체 중 P. aeruginosa/pJS-1의 안정적 발현을 확인한 결과를 도 2 및 도 3에 나타내었다. The results of confirming the stable expression of P. aeruginosa/ pJS-1 among the prepared transformants are shown in FIGS. 2 and 3 .
도 2는 형질전환된 P. aeruginosa 균주와 Wild type의 발광 변화를 비교한 결과를 나타낸다. 도 2를 통해 확인할 수 있는 바와 같이, 형질전환된 P. aeruginosa 균주의 경우 안정적으로 발광을 나타내는 것을 확인하였다. Figure 2 shows the result of comparing the luminescence change of the transformed P. aeruginosa strain and Wild type . As can be seen from Figure 2, it was confirmed that the transformed P. aeruginosa strain stably emits light.
또한, 도 3 및 도 13은 E-tube 상에서 동일하게 안정한 발현 수준을 확인한 결과를 나타낸다. 도 3의 A는 고농도의 P. aeruginosa, B는 저농도의 P. aeruginosa, C는 Wild type을 나타낸다. 도 13은 형질전환된 S. Typhimurium 및 P. aeruginosa의 현저한 발광 효능을 나타낸다. 3 and 13 show the result of confirming the same stable expression level on the E-tube. 3 A shows a high concentration of P. aeruginosa , B shows a low concentration of P. aeruginosa, and C shows a Wild type. Figure 13 shows the remarkable luminescence efficacy of transformed S. Typhimurium and P. aeruginosa .
도 3 및 도 13을 통해 확인할 수 있는 바와 같이, 본 발명에 따라 형질 전환된 균주의 경우 안정적으로 발광 효능을 나타내었다. As can be seen in Figures 3 and 13, the strain transformed according to the present invention stably exhibited luminescent efficacy.
마찬가지로 B. bronchiseptica에 대해서도 발광 효능을 확인하여 이를 도 4에 나타내었다. 도 4를 통해 확인할 수 있는 바와 같이, 본 발명에 따라 형질 전환된 균주의 경우 안정적으로 발광 효능을 나타내었다Similarly, the luminescent efficacy was confirmed for B. bronchiseptica and is shown in FIG. 4 . As can be seen in Figure 4, the strain transformed according to the present invention showed stable luminescence efficacy.
위 도 2 내지 4, 및 도 14에서 P. aeruginosa 균주, B. bronchiseptica 균주 및 S. Typhimurium 균주를 포함한 나머지 표 1의 형질전환체에 대해서도 동일 발광 효능을 확인하였다. The same light emitting efficiency was confirmed for the remaining transformants of Table 1, including the P. aeruginosa strain, B. bronchiseptica strain and S. Typhimurium strain in FIGS. 2 to 4 and FIG. 14 above.
실시예 3. 감염동물모델(감염성 대장염 모델) 제작Example 3. Production of infection animal model (infectious colitis model)
실시예 2에서 제조된 형질전환된 박테리아 및 음성 대조군 박테리아는 적합 배지에서 적정 O.D까지 배양한 후 원심분리하여 상등액을 제거하고 PBS로 세척하여 준비하였다. The transformed bacteria prepared in Example 2 and the negative control bacteria were cultured in a suitable medium to an appropriate O.D, centrifuged to remove the supernatant, and washed with PBS to prepare.
7주령 내지 8주령 ICR 또는 C57BL/6 마우스에 존대를 이용하여 상기 실시예 2를 통해 제조한 E. coli DH5a, C. rodentium, B. bronchiseptica, P. aeruginosa, S.Typhimurium 균주 또는 음성 대조군 박테리아를 균종에 따라 각각 1 x 108 CFU 또는 1 x 109 CFU으로 하여 200 ㎕씩 위내 투여하였다. 이미징 촬영 전 기질 0.3 mg/ml D-luciferin Potassium Salt Bioluminescent Substrate (XenoLight) 100 ㎕를 위내 투여로 마우스에 접종하였다. 마우스는 isoflurane/Oxygen으로 마취하고 IVIS® Lumina K (Perkin Elmer)를 이용하여 발광 이미징 영상을 촬영하였다. 발광 신호의 강도는 photon counts per second (p/s)로 정량화하였다. E. coli DH5a, C. rodentium , B. bronchiseptica , P. aeruginosa, S. Typhimurium strains or negative control bacteria prepared in Example 2 were prepared using 7- to 8-week-old ICR or C57BL/6 mice. Depending on the species, 200 μl of 1 x 10 8 CFU or 1 x 10 9 CFU was intragastricly administered. Prior to imaging, mice were inoculated with 100 μl of 0.3 mg/ml D-luciferin Potassium Salt Bioluminescent Substrate (XenoLight) by intragastric administration. Mice were anesthetized with isoflurane/Oxygen and luminescence imaging images were taken using IVIS® Lumina K (Perkin Elmer). The intensity of the luminescence signal was quantified as photon counts per second (p/s).
형질전환된 P. aeruginosa 균주, C. rodentium 균주 및 S. Typhimurium 균주가 감염된 동물 모델에서 균주 감염 2시간 후 안정적 발광을 확인한 결과를 도 5 및 도 19에 나타내었다. In animal models infected with the transformed P. aeruginosa strain, C. rodentium strain, and S. Typhimurium strain, the results of confirming stable luminescence 2 hours after infection with the strain are shown in FIGS. 5 and 19 .
도 5 및 19에서 확인할 수 있는 바와 같이, 형질전환된 P. aeruginosa 균주, C. rodentium 균주 및 S. Typhimurium의 감염을 통해 발광 변화를 실시간 및 안정적으로 확인할 수 있음을 확인하였다. As can be seen in Figures 5 and 19, it was confirmed that the luminescence change can be confirmed in real time and stably through infection of the transformed P. aeruginosa strain, C. rodentium strain, and S. Typhimurium.
비교예 1. pJS-2 벡터, 형질전환체 및 감염 동물 모델의 제조Comparative Example 1. Preparation of pJS-2 vector, transformant and infected animal model
비교예 1.1 pJS-2 벡터의 제조 Comparative Example 1.1 Preparation of pJS-2 Vector
pJS-1제조방법과 동일하게 하여, pJS-2벡터를 제조하였다.
A pJS-2 vector was prepared in the same manner as in the pJS-1 production method.
구체적으로, pLI50는 선별적 인자인 암피실린(Ampicillin) 서열을 포함하며, Addgene 제조사로부터 구매하였다. Specifically, pLI50 contains the ampicillin sequence, which is a selective factor, and was purchased from Addgene.
루시퍼라아제 유전자를 삽입시키기 위해 pLI50의 MCS (Multiple Cloning Site)에 존재하는 BamHⅠ, HindⅢ 제한효소 선정하고 루시퍼라아제 유전자(서열번호 1)를 주형으로 하여 BamHⅠ, HindⅢ가 포함된 프라이머 세트를 이용하여 PCR을 수행하였다. In order to insert the luciferase gene, select Bam HI, Hind Ⅲ restriction enzymes present in the MCS (Multiple Cloning Site) of pLI50, and use the luciferase gene (SEQ ID NO: 1) as a template and primers containing Bam HI, Hind Ⅲ PCR was performed using the set.
-Forward primer (BamHⅠ, 서열번호 12): CGGGATCCCGATGGAAAATATGGAAAACGACGAG-Forward primer ( Bam HI, SEQ ID NO: 12): CGGGATCCCGATGGAAAATATGGAAAACGACGAG
-Reverse primer (HindⅢ, 서열번호 13): CCCAAGCTTGGGTCACATCTTGGCCACGGG-Reverse primer ( Hind Ⅲ, SEQ ID NO: 13): CCCAAGCTTGGGTCACATCTTGGCCACGGG
PCR 조건은 실시예 1과 동일하게 하였다. PCR conditions were the same as in Example 1.
증폭 산물은 BamHⅠ, HindⅢ 제한효소로 절단한 후 Purification Kit를 이용하여 정제하였다.The amplification product was digested with Bam HI and Hind Ⅲ restriction enzymes and then purified using a Purification Kit.
그리고 나서 벡터도 동일하게 BamHⅠ과 HindⅢ제한효소로 절단하고, pLI50과 luciferase 유전자는 T4 ligase (Takara)로 16 ℃에서 overnight 반응하여 재조합 벡터를 구축하고 이를 pJS-2로 명명하였다.Then, the vector was also digested with Bam HI and Hind Ⅲ restriction enzymes in the same way, and pLI50 and luciferase genes were reacted overnight at 16 ° C with T4 ligase (Takara) to construct a recombinant vector, which was named pJS-2.
구축된 luciferase labeled 플라스미드는 전기천공법을 이용하여 E. coli DH5a 균주에 형질전환하였다. The constructed luciferase labeled plasmid was transformed into E. coli DH5a strain by electroporation.
그리고 나서, 재조합 벡터를 포함하는 균주를 선별하기 위해 암피실린 항생제가 첨가된 LB 배지를 통해 선별과정을 수행하였다. Then, in order to select a strain containing the recombinant vector, a selection process was performed through LB medium supplemented with ampicillin antibiotic.
선별된 균주로부터 재조합 벡터를 분리하고 플라스미드 삽입 확인 후 재조합 벡터를 포함하는 대장균 균주에서 벡터를 정제하여 실험에 이용하였다.A recombinant vector was isolated from the selected strain, and after confirmation of plasmid insertion, the vector was purified from an E. coli strain containing the recombinant vector and used for the experiment.
비교예 1.2. 재조합 벡터가 도입된 형질전환체 제작Comparative Example 1.2. Production of transformants into which the recombinant vector was introduced
pJS-2 재조합 벡터를 S. Typhimurium에 삽입하기 위해 균주를 DNA가 잘 들어갈 수 있도록 형질전환용 컴피턴트 세포를 앞서는 실시예 2와 유사하게 제작하였다. 그리고 나서, 제조된 컴피던트 세포에 pJS-2 DNA를 1 ㎍ 첨가한 후 전기천공법 (Electroporation)을 통해 세포 내로 도입하였다. pJS-2 recombinant vector to S. Typhimurium In order to insert the strain, competent cells for transformation were prepared similarly to Example 2 so that the DNA could enter well. Then, after adding 1 μg of pJS-2 DNA to the prepared competent cells, it was introduced into the cells through electroporation.
다음으로, 재조합 플라스미드가 도입된 균주를 선별을 위해 암피실린 배지를 사용하였고, 마이크로플레이트 리더를 이용하여 기질 D-luciferin Potassium Salt Bioluminescent Substrate (XenoLight)를 최종 농도 0.3 ㎎/㎖ 이 되도록 첨가 후 발광 값을 확인하였다. Next, ampicillin medium was used to screen strains into which the recombinant plasmid was introduced, and the substrate D-luciferin Potassium Salt Bioluminescent Substrate (XenoLight) was added to a final concentration of 0.3 mg/ml using a microplate reader, and the luminescence value was measured. Confirmed.
비교예 1.3. 감염동물모델(감염성 대장염 모델) 제작Comparative Example 1.3. Production of infection animal model (infectious colitis model)
비교예 1.2에서 제조된 형질전환된 박테리아는 적합 배지에서 적정 O.D까지 배양한 후 원심분리하여 상등액을 제거하고 PBS로 세척하여 준비하였다. The transformed bacteria prepared in Comparative Example 1.2 were cultured in a suitable medium to an appropriate O.D., centrifuged to remove the supernatant, and washed with PBS to prepare.
7주령 내지 8주령 ICR 또는 C57BL/6 마우스에 존대를 이용하여 위 박테리아를 1 x 108 CFU 또는 1 x 109 CFU으로 하여 200 ㎕씩 위내 투여하였다.7- to 8-week-old ICR or C57BL/6 mice were intragastricly administered with 200 μl of gastric bacteria at 1×10 8 CFU or 1×10 9 CFU using a gastric bypass.
이미징 촬영 전 기질 0.3 ㎎/㎖ D-luciferin Potassium Salt Bioluminescent Substrate (XenoLight) 100 ㎕를 위내 투여로 마우스에 접종하였다. 마우스는 isoflurane/Oxygen으로 마취하고 IVIS® Lumina K (Perkin Elmer)를 이용하여 발광 이미징 영상을 촬영하였다. 발광 신호의 강도는 photon counts per second (p/s)로 정량화하였다.Prior to imaging, mice were inoculated with 100 μl of 0.3 mg/ml D-luciferin Potassium Salt Bioluminescent Substrate (XenoLight) by intragastric administration. Mice were anesthetized with isoflurane/Oxygen and luminescence imaging images were taken using IVIS® Lumina K (Perkin Elmer). The intensity of the luminescence signal was quantified as photon counts per second (p/s).
비교예 2. pJS-3 벡터를 이용한 형질전환체 제작Comparative Example 2. Production of transformants using pJS-3 vector
pJS-1 제조방법과 동일한 방법으로 상용화 벡터인 pCN60에 루시퍼라아제 유전자를 삽입하여 pJS-3 벡터를 제조하였다(BamHⅠ, HindⅢ 제한효소 선정).
The pJS-3 vector was prepared by inserting the luciferase gene into pCN60, a commercial vector, in the same manner as the pJS-1 production method ( Bam HI, Hind Ⅲ restriction enzyme selection).
실시예 2와 동일한 방법으로 pJS-3가 도입된 형질전환체를 제작하였다.Transformants into which pJS-3 was introduced were prepared in the same manner as in Example 2.
비교예 3. pJS-4 벡터를 이용한 형질전환체 제작Comparative Example 3. Construction of transformants using pJS-4 vector
실시예 2와 동일한 방법으로 pJS-4가 도입된 형질전환체(luxCDABE 발현)를 제작하였다.Transformants into which pJS-4 was introduced (expressing luxCDABE) were prepared in the same manner as in Example 2.
비교예 4. pJS-5 벡터를 이용한 형질전환체 제작Comparative Example 4. Production of transformants using pJS-5 vector
pJS-1 제조방법과 동일한 방법으로 상용화 벡터인 pRMC2에 루시퍼라아제 유전자를 삽입하여 pJS-5 벡터를 제조하였다(BamHⅠ, XbaⅠ제한효소 선정).
The pJS-5 vector was prepared by inserting the luciferase gene into pRMC2, a commercial vector, in the same manner as the pJS-1 production method ( Bam HI, Xba Ⅰ restriction enzyme selection).
실시예 2와 동일한 방법으로 pJS-5가 도입된 형질전환체를 제작하였다.Transformants into which pJS-5 was introduced were prepared in the same manner as in Example 2.
실시예 4. 감염동물모델(감염성 호흡기 질환 모델) 제작Example 4. Infectious animal model (infectious respiratory disease model) production
실시예 2에서 제조된 B. bronchiseptica/pJS-1, A. baumannii/pJS-1, 및 P. aeruginosa/pJS-1 및 음성 대조군 B. bronchiseptica는 적합 배지에서 적정 O.D까지 배양한 후 원심분리하여 상등액을 제거하고 PBS로 세척하여 준비하였다. B. bronchiseptica /pJS-1 prepared in Example 2, A. baumannii /pJS-1 , and P. aeruginosa /pJS-1 and the negative control B. bronchiseptica were cultured in a suitable medium to an appropriate OD, and then centrifuged to remove the supernatant. It was prepared by removing and washing with PBS.
7에서 8주의 ICR 또는 C57BL/6 마우스는 기관지 내로 균액과 luciferin을 섞어 투여(Intratracheal infection)하여 동물모델을 구축하였다. In vivo 발광 신호를 확인하기 위해 isoflurane/oxygen으로 마취한 후 IVIS imaging system (PerkinElmer)을 사용하여 촬영하였다. 발광 신호의 강도는 photon counts per second (p/s)로 정량화하였다.7 to 8 weeks old ICR or C57BL/6 mice were intratracheally administered with a mixture of bacterial solution and luciferin (Intratracheal infection), and an animal model was constructed. To confirm the in vivo luminescence signal, images were taken using the IVIS imaging system (PerkinElmer) after anesthesia with isoflurane/oxygen. The intensity of the luminescence signal was quantified as photon counts per second (p/s).
형질전환된 B. bronchiseptica, A. baumannii, 및 P. aeruginosa 균주가 감염된 동물 모델에서 균주 감염 2시간 후 안정적 발광을 확인한 결과를 도 17에 나타내었고, 형질전환된 B. bronchiseptica, A. baumannii, 및 P. aeruginosa 균주가 감염된 동물 모델로부터 분리한 폐의 발광을 확인한 결과를 도 18에 나타내었다. Transformed B. bronchiseptica , A. baumannii , and P. aeruginosa strains are shown in FIG. 17 to confirm the stable luminescence 2 hours after strain infection in an animal model infected, and the transformed B. bronchiseptica , A. baumannii, and The result of confirming the luminescence of the lung isolated from the animal model infected with the P. aeruginosa strain is shown in FIG. 18 .
도 17 및 18에서 확인할 수 있는 바와 같이, 형질전환된 B. bronchiseptica, A. baumannii, 및 P. aeruginosa 균주의 감염을 통해 발광 변화를 실시간 및 안정적으로 확인할 수 있음을 확인하였다.As can be seen in Figures 17 and 18, it was confirmed that the luminescence change can be confirmed in real time and stably through infection of the transformed B. bronchiseptica , A. baumannii, and P. aeruginosa strains.
실험예 1. Experimental example 1.
In vitroIn vitro
상 항생제 및 항균제 유효성 평가 Evaluate antibiotic and antimicrobial efficacy
In vitro 약물 유효성 평가를 위하여, 각 항생제와 균액를 농도별로 희석하여 반응을 수행하였다. For in vitro drug efficacy evaluation, the reaction was performed by diluting each antibiotic and bacterial solution by concentration.
구체적으로, 상기 실시예 2의 P. aeruginosa를 96 well plate에 각각 O.D 2.0, 1.5, 1.0, 0.5, 0.1 로 100 ㎕씩 분주한 후 항생제 클레리트로마이신을 100 ㎕ (0.05, 0.1, 0.5, 1, 2.5 또는 5 ㎎/㎖)첨가하여 반응시켰다. In vitro 발광 분석을 위해 D-luciferin Potassium Salt Bioluminescent Substrate (XenoLight)를 최종 농도 0.3 ㎎/㎖이 되도록 첨가하고 발색 변화를 charge-couple-device (CCD) 카메라를 포함하는 IVIS 100 imaging system (In vivo Imaging System, Xenogen, PerkinElmer, Hopkiton, MA, USA)를 이용하여 확인하였다. 발광 신호의 강도는 photon counts per second (p/s)로 정량화하였다. Specifically, after dispensing 100 μl of P. aeruginosa of Example 2 at OD 2.0, 1.5, 1.0, 0.5, 0.1, respectively, into a 96 well plate, 100 μl of the antibiotic clerithromycin (0.05, 0.1, 0.5, 1, 2.5 or 5 mg/ml) was added and reacted. For in vitro luminescence analysis, D-luciferin Potassium Salt Bioluminescent Substrate (XenoLight) was added to a final concentration of 0.3 mg/ml, and color change was measured using an IVIS 100 imaging system including a charge-couple-device (CCD) camera ( In vivo Imaging System, Xenogen, PerkinElmer, Hopkiton, MA, USA). The intensity of the luminescence signal was quantified as photon counts per second (p/s).
그 결과를 도 7에 나타내었다. The results are shown in FIG. 7 .
도 7을 통해 확인할 수 있는 바와 같이, 항생제인 클래리스로마이신의 처리는 발광 수준을 농도 의존적으로 크게 감소시켰다. As can be seen in FIG. 7 , treatment with the antibiotic clarithromycin greatly reduced the luminescence level in a concentration-dependent manner.
위 결과를 통해서 본 발명에 따른 형질전환된 박테리아를 이용하여 항균제 또는 항생제에 대한 유효성 평가가 가능함을 확인하였다. Through the above results, it was confirmed that the effectiveness of antibacterial agents or antibiotics can be evaluated using the transformed bacteria according to the present invention.
위 방법과 유사하게 실시예 2에서 제조된 형질전환된 B. bronchiseptica를 이용하여 In vitro 약물 유효성 평가를 수행하였다. Similar to the above method , in vitro drug efficacy was evaluated using the transformed B. bronchiseptica prepared in Example 2.
구체적으로, 96 well plate에 각각 O.D 2.0, 1.0, 0.5 로 100 ㎕씩 분주한 후 항생제 클레리트로마이신 또는 록시스로마이신을 100 ㎕ (0.05, 0.1, 0.5, 1, 2.5 또는 5 ㎎/㎖)첨가하여 반응시켰다. In vitro 발광 분석을 위해 D-luciferin Potassium Salt Bioluminescent Substrate (XenoLight)를 최종 농도 0.3 ㎎/㎖이 되도록 첨가하고 발색 변화를 charge-couple-device (CCD) 카메라를 포함하는 IVIS 100 imaging system (In vivo Imaging System, Xenogen, PerkinElmer, Hopkiton, MA, USA)를 이용하여 확인하였다. 발광 신호의 강도는 photon counts per second (p/s)로 정량화하였다. Specifically, after dispensing 100 μl of each OD 2.0, 1.0, 0.5 into a 96 well plate, 100 μl of the antibiotic clerithromycin or loxithromycin (0.05, 0.1, 0.5, 1, 2.5 or 5 mg/ml) was added to reacted For in vitro luminescence analysis, D-luciferin Potassium Salt Bioluminescent Substrate (XenoLight) was added to a final concentration of 0.3 mg/ml, and color change was measured using an IVIS 100 imaging system including a charge-couple-device (CCD) camera ( In vivo Imaging System, Xenogen, PerkinElmer, Hopkiton, MA, USA). The intensity of the luminescence signal was quantified as photon counts per second (p/s).
그 결과를 도 8에 나타내었다. The results are shown in FIG. 8 .
도 8을 통해 확인할 수 있는 바와 같이, 항생제인 클레리트로마이신 또는 록시스로마이신의 처리는 발광 수준을 농도 의존적으로 크게 감소시켰다.As can be seen through FIG. 8 , treatment with the antibiotic clerithromycin or loxithromycin greatly reduced the luminescence level in a concentration-dependent manner.
위 방법과 유사하게 실시예 2에서 제조된 형질전환된 S. Typhimurium를 이용하여 In vitro 약물 유효성 평가를 수행하였다. Similar to the above method , in vitro drug efficacy was evaluated using the transformed S. Typhimurium prepared in Example 2.
구체적으로, 96 well plate에 각각 O.D 2.0, 1.5, 1.0, 0.5, 0.1로 100 ㎕씩 분주한 후 항생제 클레리트로마이신을 100 ㎕ (0.05, 0.1, 0.5, 1, 2.5 또는 5 ㎎/㎖)첨가하여 반응시켰다. 24시간 후 In vitro 발광 분석을 위해 D-luciferin Potassium Salt Bioluminescent Substrate (XenoLight)를 최종 농도 0.3 ㎎/㎖이 되도록 첨가하고 발색 변화를 charge-couple-device (CCD) 카메라를 포함하는 IVIS 100 imaging system (In vivo Imaging System, Xenogen, PerkinElmer, Hopkiton, MA, USA)를 이용하여 확인하였다. 발광 신호의 강도는 photon counts per second (p/s)로 정량화하였다. Specifically, after dispensing 100 μl of OD 2.0, 1.5, 1.0, 0.5, 0.1 into each 96 well plate, 100 μl of the antibiotic clerithromycin (0.05, 0.1, 0.5, 1, 2.5 or 5 mg/ml) was added to reacted After 24 hours, for in vitro luminescence analysis, D-luciferin Potassium Salt Bioluminescent Substrate (XenoLight) was added to a final concentration of 0.3 mg/ml, and color change was measured using an IVIS 100 imaging system including a charge-couple-device (CCD) camera ( In vivo Imaging System, Xenogen, PerkinElmer, Hopkiton, MA, USA) was used. The intensity of the luminescence signal was quantified as photon counts per second (p/s).
그 결과를 도 20에 나타내었다.The results are shown in FIG. 20 .
도 20을 통해 확인할 수 있는 바와 같이, 항생제인 클레리트로마이신의 처리는 발광 수준을 농도 의존적으로 크게 감소시켰다.As can be seen through FIG. 20 , treatment with the antibiotic clerithromycin greatly reduced the luminescence level in a concentration-dependent manner.
실험예 2. Experimental example 2.
In vivoIn vivo
상 항생제 및 항균제 유효성 평가 (감염성 위장관 질환 모델) Evaluation of antibiotic and antibacterial efficacy (infectious gastrointestinal disease model)
In vivo 유효성 평가를 위하여, 상기 실시예 3에서 제조된 감염 동물 모델들에 대하여 항생제를 위내로 투여하여 시간 별로 생체 내 약물의 변화를 확인하였다. For the in vivo efficacy evaluation, antibiotics were intragastricly administered to the infected animal models prepared in Example 3, and changes in the in vivo drug over time were confirmed.
구체적으로, 상기 실시예 3에서 제조된 감염 동물 모델을 이용하여 실험을 수행하였다. Specifically, the experiment was performed using the infected animal model prepared in Example 3 above.
앞서 P. aeruginosa를 위내 투여를 통해 감염시킨 후 장에 정착되었는지 발광 현상을 확인한 후, 5 ㎎/㎖의 클래리스로마이신을 위내 투여하였다. 그리고 나서, 1시간 후 In vivo 발광 신호를 확인하기 위해 0.3 ㎎/㎖ D-luciferin 100 ㎕를 위내투여하였고, isoflurane/oxygen으로 마취한 후 IVIS imaging system (PerkinElmer)을 사용하여 촬영하였다. 발광 신호의 강도는 photon counts per second (p/s)로 정량화하였다.After infecting P. aeruginosa through intragastric administration, 5 mg/ml of clarithromycin was intragastricly administered after confirming whether or not the luminescent phenomenon settled in the intestine. Then, 100 μl of 0.3 mg/ml D-luciferin was intragastrically administered to confirm the in vivo luminescence signal after 1 hour, and images were taken using an IVIS imaging system (PerkinElmer) after anesthesia with isoflurane/oxygen. The intensity of the luminescence signal was quantified as photon counts per second (p/s).
그 결과를 도 9에 나타내었다. The results are shown in FIG. 9 .
또한, 앞서 S. Typhimurium를 위내 투여를 통해 감염시킨 후 장에 정착되었는지 발광 현상을 확인한 후, 0.3 ㎎/㎖의 록시스로마이신을 위내 투여하였다. 그리고 나서, 3일 뒤 후 In vivo 발광 신호를 확인하기 위해 0.3 ㎎/㎖ D-luciferin 100 ㎕를 위내투여하였고, isoflurane/oxygen으로 마취한 후 IVIS imaging system (PerkinElmer)을 사용하여 촬영하였다. 발광 신호의 강도는 photon counts per second (p/s)로 정량화하였다.In addition, after infecting S. Typhimurium through intragastric administration, 0.3 mg/ml loxithromycin was intragastricly administered after confirming whether the luminescence was established in the intestine. After 3 days, 100 μl of 0.3 mg/ml D-luciferin was intragastrically administered to confirm the in vivo luminescence signal, and images were taken using an IVIS imaging system (PerkinElmer) after anesthesia with isoflurane/oxygen. The intensity of the luminescence signal was quantified as photon counts per second (p/s).
그 결과를 도 21에 나타내었다.The results are shown in FIG. 21 .
도 9 및 도 21을 통해 확인할 수 있는 바와 같이, 항생제의 처리는 발광 수준을 농도 의존적으로 크게 감소시켰다. 특히 이러한 결과는 실시간으로 발광 현상을 모니터링하면서 확인할 수 있어서 마우스의 희생 없이 직접적으로 이의 확인이 가능하다는 점에서 장점을 확인하였다. As can be seen through FIGS. 9 and 21 , treatment with antibiotics greatly reduced the luminescence level in a concentration-dependent manner. In particular, these results were confirmed while monitoring the luminescence phenomenon in real time, confirming the advantage in that it was possible to confirm it directly without sacrificing the mouse.
위 결과를 통해서 본 발명에 따른 형질전환된 박테리아를 이용하여 항균제 또는 항생제에 대한 유효성 평가가 가능함을 확인하였다. Through the above results, it was confirmed that the effectiveness of antibacterial agents or antibiotics can be evaluated using the transformed bacteria according to the present invention.
실험예 3. 사용된 벡터간 비교 결과 (감염성 위장관 질환 모델)Experimental Example 3. Comparison between vectors used (infectious gastrointestinal disease model)
상기 실시예 1의 재조합 벡터와 비교예 1의 재조합 벡터를 형질전환시킨 P. aeruginosa를 실험예 2와 유사하게 처리하여 발광 효능 변화를 확인하였다. P. aeruginosa transformed with the recombinant vector of Example 1 and the recombinant vector of Comparative Example 1 were treated in the same manner as in Experimental Example 2 to confirm changes in luminescence efficiency.
상기 확인 결과를 도 10에 나타내었다. The confirmation results are shown in FIG. 10 .
도 10에서 확인할 수 있는 바와 같이, 실시예 2에서 제조된 P. aeruginosa/pJS-1로 형질전환된 동물 모델(오른쪽)에서 우수한 발광 효능을 나타내는 것을 확인하였다. 반면, 비교예 1의 경우 발현 수준이 현저히 떨어져 약물 효능 평가에 이용하는 것이 상당히 제한적임을 확인하였다. As can be seen in FIG. 10, it was confirmed that the animal model (right) transformed with P. aeruginosa/ pJS-1 prepared in Example 2 showed excellent luminescence efficacy. On the other hand, in the case of Comparative Example 1, the expression level was significantly lower, and it was confirmed that the use for drug efficacy evaluation was quite limited.
실험예 4.Experimental example 4.
In vivo In vivo
상 항생제 및 항균제 유효성 평가 (감염성 호흡기 질환 모델) Evaluation of antibiotic and antibacterial efficacy (infectious respiratory disease model)
상기 실시예 4에서 제조된 기도내 감염(Intratracheal infection)을 이용한 폐렴동물모델을 통해 In vivo 유효성 평가를 진행하였다. In vivo efficacy was evaluated through an animal model of pneumonia using the intratracheal infection prepared in Example 4 above.
구체적으로, 폐렴동물모델에 클래리스로마이신 항생제를 비강내(intranasal administration)로 투여하였다. In vivo 발광 신호를 확인하기 위해 isoflurane/oxygen으로 마취한 후 IVIS imaging system (PerkinElmer)을 사용하여 촬영하였다. 발광 신호의 강도는 photon counts per second (p/s)로 정량화하였다.Specifically, the antibiotic clarithromycin was administered to an animal model of pneumonia by intranasal administration. To confirm the in vivo luminescence signal, images were taken using the IVIS imaging system (PerkinElmer) after anesthesia with isoflurane/oxygen. The intensity of the luminescence signal was quantified as photon counts per second (p/s).
그 결과를 도 11에 나타내었다. The results are shown in FIG. 11 .
도 11에서 확인할 수 있는 바와 같이, 항생제인 클래리스로마이신의 처리는 발광 수준을 크게 감소시켰다. 특히 이러한 결과는 실시간으로 발광 현상을 모니터링하면서 확인할 수 있어서 마우스의 희생 없이 직접적으로 이의 확인이 가능하다는 점에서 장점을 확인하였다. As can be seen in Figure 11, treatment with the antibiotic clarithromycin significantly reduced the level of luminescence. In particular, these results were confirmed while monitoring the luminescence phenomenon in real time, confirming the advantage in that it was possible to confirm it directly without sacrificing the mouse.
실험예 5.Experimental Example 5.
In vitro In vitro
상 award
재조합 벡터의 종류에 따른 발광 효능 차이 분석Analysis of differences in luminescence efficiency according to the type of recombinant vector
도 12는 E-tube 상에서 pJS-2 재조합 벡터(비교예 1) 대비 pJS-1 재조합 벡터(실시예 1)의 현저히 우수한 발현 수준을 확인한 결과를 나타낸다. 도 12의 (a)는 음성 대조군(negative control), (b)~(e)는 pJS-2, pJS-3, pJS-4 및 pJS-5 재조합 벡터, (f)는 pJS-1 재조합 벡터를 나타낸다. Figure 12 shows the result of confirming the significantly superior expression level of the pJS-1 recombinant vector (Example 1) compared to the pJS-2 recombinant vector (Comparative Example 1) on the E-tube. 12 (a) is a negative control, (b) to (e) are pJS-2, pJS-3, pJS-4 and pJS-5 recombinant vectors, (f) is a pJS-1 recombinant vector indicate
도 12를 통해 확인할 수 있는 바와 같이, 본 발명에 따라 제조된 pJS-1 재조합 벡터이 다른 재조합 벡터와 비교했을 때 현저히 높은 발광 효능을 나타내었다. As can be seen from FIG. 12 , the pJS-1 recombinant vector prepared according to the present invention exhibited significantly higher luminescent efficiency compared to other recombinant vectors.
실험예 6.Experimental Example 6.
In vitro In vitro
생장 실험 growth experiment
상기 실시예 1의 재조합 벡터를 형질전환시킨 P. aeruginosa 균주 및 S. Typhimurium 균주와 Wild type의 O.D 변화(A), 발광값(B) 및 박테리아 카운트(C)의 변화를 확인하였으며, 그 결과를 도 15 및 16에 나타내었다. P. aeruginosa strain and S. Typhimurium strain transformed with the recombinant vector of Example 1 and Changes in OD (A), luminescence value (B), and bacterial count (C) of the wild type were confirmed, and the results are shown in FIGS. 15 and 16 .
도 15 및 16을 통해 확인할 수 있는 바와 같이, O.D(농도) 및 박테리아 카운트 값은 Wild type과 동일하게 유지되었으며, 발광값은 지속적으로 유지되었다.As can be seen through FIGS. 15 and 16, the O.D. (concentration) and bacterial count values were maintained the same as those of the Wild type, and the luminescence value was maintained continuously.
위 결과를 통해서 본 발명에 따른 형질전환된 박테리아는 병원체의 기본적인 특성이나 기능성에 간섭현상 등의 영향을 주지 않고 타겟 유전자의 발현(발광)만을 극대화시킬 수 있음을 확인함으로써, 숙주-미생물간 상호작용의 이해 및 치료후보 물질의 유효성 및 안정성 평가가 실시간 및 비침습적으로 가능함을 확인하였다.Through the above results, it was confirmed that the transformed bacteria according to the present invention can maximize the expression (luminescence) of the target gene without affecting the basic characteristics or functionality of the pathogen, such as interference. It was confirmed that the understanding of and the evaluation of the efficacy and stability of treatment candidates are possible in real time and noninvasively.
이상, 본 발명 내용의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적인 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의해 정의된다고 할 것이다. In the above, specific parts of the present invention have been described in detail, and for those skilled in the art, it is clear that these specific descriptions are only preferred embodiments, and the scope of the present invention is not limited thereby. something to do. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.
Claims (20)
- lacI이 제거된 trc 프로모터 및 이에 작동 가능하게 연결된 반딧불이 발광효소(firefly luciferase) 유전자를 포함하는 재조합 발현 벡터.A recombinant expression vector comprising a trc promoter from which lacI has been removed and a firefly luciferase gene operably linked thereto.
- 제1항에 있어서, 반딧불이 발광효소(firefly luciferase) 유전자는 서열번호 1의 반딧불이 발광효소(firefly luciferase) 유전자를 포함하는 것인 재조합 발현 벡터.The recombinant expression vector according to claim 1, wherein the firefly luciferase gene comprises the firefly luciferase gene of SEQ ID NO: 1.
- 제1항에 있어서, lacI이 제거된 trc 프로모터는 서열번호 3의 염기서열인 재조합 발현 벡터.The recombinant expression vector according to claim 1, wherein the lacI-deleted trc promoter has the nucleotide sequence of SEQ ID NO: 3.
- 제1항에 있어서, 복제원점(oriV)와 이동원점(oriT)를 더 포함하는 재조합 발현 벡터.The recombinant expression vector according to claim 1, further comprising an origin of replication (oriV) and an origin of migration (oriT).
- 제4항에 있어서, 복제원점(oriV) 서열은 서열번호 4이고, 이동원점(oriT) 서열을 서열번호 5인 재조합 발현 벡터.The recombinant expression vector according to claim 4, wherein the origin of replication (oriV) sequence is SEQ ID NO: 4 and the origin of migration (oriT) sequence is SEQ ID NO: 5.
- 제1항에 있어서, 암피실린(ampicillin) 저항성 유전자, 가나마이신(kanamycin) 저항성 유전자 및 클로람페니콜 아세틸 트랜스퍼라아제(chloramphenicol acetyl transferase) 유전자로 이루어진 군에서 선택되는 하나 이상의 항생제 저항성 유전자를 추가로 포함하는 것인 재조합 발현 벡터. The method of claim 1, further comprising at least one antibiotic resistance gene selected from the group consisting of an ampicillin resistance gene, a kanamycin resistance gene, and a chloramphenicol acetyl transferase gene. Recombinant Expression Vectors.
- 제1항에 있어서, 상기 재조합 발현 벡터는 서열번호 8의 염기 서열을 가지는 것인 재조합 발현 벡터.The recombinant expression vector according to claim 1, wherein the recombinant expression vector has the nucleotide sequence of SEQ ID NO: 8.
- 제1항 내지 제7항 중 어느 한 항에 따른 재조합 발현 벡터로 형질전환된 형질전환체. A transformant transformed with the recombinant expression vector according to any one of claims 1 to 7.
- 제8항에 있어서, 상기 형질전환체는 박테리아인 형질전환체.The transformant according to claim 8, wherein the transformant is a bacterium.
- 제9항에 있어서, 상기 박테리아는 살모넬라 엔테리카 (Salmonella enterica), 에스케리키아 콜라이(Escherichia coli), 시트로박터 로덴티움(Citrobacter rodentium), 보데텔라 브론키셉티카 (Bordetella bronchiseptica), 아시네토박터 바우만니이 (Acinetobacter baumannii), 슈도모나스 아에루기노사(Pseudomonas aeruginosa), 엔테로박터 클로아카에(Enterobacter cloacae), 클레브시엘라 뉴모니아에(Klebsiella pneumoniae), 모르가넬라 모르가니이(Morganella morganii), 살모넬라 티피뮤리움(Salmonella typhimurium), 시겔라 디센테리아에(Shigella dysenteriae), 예르시니아 엔테로콜리티카(Yersinia enterocolitica), 아시네토박터 칼코아세티쿠스(Acinetobacter calcoaceticus), 프란시셀라 툴라렌시스(Francisella tularensis), 레지오넬라 뉴모필라(Legionella pneumophila), 프로테우스 불가리스(Proteus vulgaris), 프로테우스 미라빌리스(Proteus mirabilis), 스테노트로포모나스 말토필리아(Stenotrophomonas maltophilia), 캄필로박터 제주니(Campylobacter jejuni), 파스튜렐라 멀토시다(Pasteurella multocida), 헤모필러스 파라수이스(Haemophilus parasuis), 액티노바실러스 플루로뉴모니애(Actinobacillus pleuropneumoniae), 스트렙토코커스 수이스(Streptococcus suis), 마이코플라스마 뉴모니애(Mycoplasma pneumoniae), 마이코플라스마 호미니스(Mycoplasma hominis), 마이코플라스마 제니탈리움(Mycoplasma genitalium), 마이코플라스마 퍼멘탄스(Mycoplasma fermentans), 마이코플라스마 암포리포르메(Mycoplasma amphoriforme), 마이코플라스마페네트란스(Mycoplasma penetrans), 보렐리아 부르그도르페리 (Borrelia burgdorferi), 브루셀라 아보터스(Brucella abortus), 브루셀라 카니스(Brucella canis), 리스테리아 모노키토게네스(Listeria monocytogenes), 리케차 리케치 (Rickettsia ricketsii) 및 예르시니아 페스티스(Yersinia pestis)로 이루어진 군으로부터 선택되는 어느 하나인 형질전환된 형질전환체.10. The method of claim 9, wherein the bacteria are Salmonella enterica , Escherichia coli, Citrobacter rodentium , Bordetella bronchiseptica , Acinetobacter Bauman Nii ( Acinetobacter baumannii ), Pseudomonas aeruginosa ( Pseudomonas aeruginosa ), Enterobacter cloacae ( Enterobacter cloacae ), Klebsiella pneumoniae ( Klebsiella pneumoniae ), Morganella morganii ( Morganella morganii ), Salmonella Typhimurium ( Salmonella typhimurium ), Shigella dysenteriae ( Shigella dysenteriae ), Yersinia enterocolitica ( Yersinia enterocolitica ), Acinetobacter calcoaceticus ( Acinetobacter calcoaceticus ), Francisella tularensis ( Francisella tularensis ), Legionella pneumophila, Proteus vulgaris , Proteus mirabilis, Proteus mirabilis , Stenotrophomonas maltophilia , Campylobacter jejuni, Pasteurella multocida , Haemophilus parasuis, Actinobacillus pleuropneumoniae , Streptococcus suis ( Streptococcus suis ), Mycoplasma pneumoniae ( Mycoplasma pneumoniae ), Mycoplasma hominis ( Mycoplasma hominis ), Mycoplasma genitalium ( Mycoplasma genitalium ), Mycoplasma fermentans ( Mycoplasma fermentans ), Mycoplasma amphoriforme ( Mycoplasma amphoriforme ), Mycoplasma penetrans, Borrelia burgdorferi , Brucella abortus , Brucella canis , Listeria monocytogenes , Rickettsia Ketchi ( Rickettsia ricketsii ) And Yersinia pestis ( Yersinia pestis ) Any one of the transformed transformants selected from the group consisting of.
- 제10항에 따른 형질전환된 형질전환체로 감염된 인간을 제외한 동물. Animals other than humans infected with the transformed transformant according to claim 10.
- 제11항에 있어서, 상기 동물은 마우스 또는 랫드인 동물. The animal according to claim 11, wherein the animal is a mouse or a rat.
- (a) 제1항 내지 제7항 중 어느 한 항에 따른 재조합 발현 벡터로 형질전환된 박테리아에 약물 후보 물질을 처리하는 단계; 및 (a) treating bacteria transformed with the recombinant expression vector according to any one of claims 1 to 7 with a drug candidate; and(b) 루시페린 처리 후 상기 형질전환체의 발광 변화를 측정하는 단계;를 포함하는 감염성 질환 약물 스크리닝 방법.(b) measuring the change in luminescence of the transformant after treatment with luciferin; Infectious disease drug screening method comprising the.
- 제13항에 있어서, 상기 박테리아는 살모넬라 엔테리카 (Salmonella enterica), 에스케리키아 콜라이(Escherichia coli), 시트로박터 로덴티움(Citrobacter rodentium), 보데텔라 브론키셉티카 (Bordetella bronchiseptica), 아시네토박터 바우만니이 (Acinetobacter baumannii), 슈도모나스 아에루기노사(Pseudomonas aeruginosa), 엔테로박터 클로아카에(Enterobacter cloacae), 클레브시엘라 뉴모니아에(Klebsiella pneumoniae), 모르가넬라 모르가니이(Morganella morganii), 살모넬라 티피뮤리움(Salmonella typhimurium), 시겔라 디센테리아에(Shigella dysenteriae), 예르시니아 엔테로콜리티카(Yersinia enterocolitica), 아시네토박터 칼코아세티쿠스(Acinetobacter calcoaceticus), 프란시셀라 툴라렌시스(Francisella tularensis), 레지오넬라 뉴모필라(Legionella pneumophila), 프로테우스 불가리스(Proteus vulgaris), 프로테우스 미라빌리스(Proteus mirabilis), 스테노트로포모나스 말토필리아(Stenotrophomonas maltophilia), 파스튜렐라 멀토시다(Pasteurella multocida), 헤모필러스 파라수이스(Haemophilus parasuis), 액티노바실러스 플루로뉴모니애(Actinobacillus pleuropneumoniae), 스트렙토코커스 수이스(Streptococcus suis), 마이코플라스마 뉴모니애(Mycoplasma pneumoniae), 마이코플라스마 호미니스(Mycoplasma hominis), 마이코플라스마 제니탈리움(Mycoplasma genitalium), 마이코플라스마 퍼멘탄스(Mycoplasma fermentans), 마이코플라스마 암포리포르메(Mycoplasma amphoriforme), 마이코플라스마페네트란스(Mycoplasma penetrans), 캄필로박터 제주니(Campylobacter jejuni), 보렐리아 부르그도르페리 (Borrelia burgdorferi), 브루셀라 아보터스(Brucella abortus), 브루셀라 카니스(Brucella canis), 리스테리아 모노키토게네스(Listeria monocytogenes), 리케차 리케치 (Rickettsia ricketsii) 및 예르시니아 페스티스(Yersinia pestis)로 이루어진 군으로부터 선택되는 어느 하나인 감염성 질환 약물 스크리닝 방법.The method of claim 13, wherein the bacteria are Salmonella enterica , Escherichia coli, Citrobacter rodentium , Bordetella bronchiseptica , Acinetobacter Bauman Nii ( Acinetobacter baumannii ), Pseudomonas aeruginosa ( Pseudomonas aeruginosa ), Enterobacter cloacae ( Enterobacter cloacae ), Klebsiella pneumoniae ( Klebsiella pneumoniae ), Morganella morganii ( Morganella morganii ), Salmonella Typhimurium ( Salmonella typhimurium ), Shigella dysenteriae ( Shigella dysenteriae ), Yersinia enterocolitica ( Yersinia enterocolitica ), Acinetobacter calcoaceticus ( Acinetobacter calcoaceticus ), Francisella tularensis ( Francisella tularensis ), Legionella pneumophila, Proteus vulgaris, Proteus vulgaris, Proteus mirabilis, Stenotrophomonas maltophilia , Pasteurella multocida , Haemophilus parasuis , Actinobacillus pleuropneumoniae , Streptococcus suis , Mycoplasma pneumoniae , Mycoplasma hominis ), Mycoplasma genitalium , Mycoplasma fermentans, Mycoplasma amphoriforme , Mycoplasma penetrans , Campylobacter jejuni , Borrelia burgdorferi , Brucella abortus , Brucella canis, Listeria monocytogenes , Rickettsia ricketsii and Yersinia pestis ( Yersinia pestis ) Any one infectious disease drug screening method selected from the group consisting of.
- 제13항에 있어서, 상기 감염성 질환은 감염성 위장관 질환, 감염성 호흡기 질환, 감염성 피부 질환 및 감염성 심혈관계 질환으로 이루어진 군으로부터 선택되는 어느 하나인 감염성 질환 약물 스크리닝 방법.The method of claim 13, wherein the infectious disease is any one selected from the group consisting of infectious gastrointestinal diseases, infectious respiratory diseases, infectious skin diseases, and infectious cardiovascular diseases.
- (a) 제1항 내지 제7항 중 어느 한 항에 따른 재조합 발현 벡터로 형질전환된 박테리아를 인간을 제외한 동물의 질환 유발 부위에 감염시키는 단계;(a) infecting a disease-causing site of an animal other than human with a bacterium transformed with the recombinant expression vector according to any one of claims 1 to 7;(b) 감염된 동물에 약물 후보 물질을 처리하는 단계;(b) treating an infected animal with a drug candidate;(c) 루시페린을 처리하고 동물의 질환 유발 부위에서 발광 변화를 측정하는 단계;를 포함하는 감염성 질환 약물 스크리닝 방법.(c) treating luciferin and measuring a change in luminescence at a disease-causing site of an animal;
- 제16항에 있어서, 상기 박테리아는 살모넬라 엔테리카 (Salmonella enterica), 에스케리키아 콜라이(Escherichia coli), 시트로박터 로덴티움(Citrobacter rodentium), 보데텔라 브론키셉티카 (Bordetella bronchiseptica), 아시네토박터 바우만니이 (Acinetobacter baumannii), 슈도모나스 아에루기노사(Pseudomonas aeruginosa), 엔테로박터 클로아카에(Enterobacter cloacae), 클레브시엘라 뉴모니아에(Klebsiella pneumoniae), 모르가넬라 모르가니이(Morganella morganii), 살모넬라 티피뮤리움(Salmonella typhimurium), 시겔라 디센테리아에(Shigella dysenteriae), 예르시니아 엔테로콜리티카(Yersinia enterocolitica), 아시네토박터 칼코아세티쿠스(Acinetobacter calcoaceticus), 프란시셀라 툴라렌시스(Francisella tularensis), 레지오넬라 뉴모필라(Legionella pneumophila), 프로테우스 불가리스(Proteus vulgaris), 프로테우스 미라빌리스(Proteus mirabilis), 스테노트로포모나스 말토필리아(Stenotrophomonas maltophilia), 파스튜렐라 멀토시다(Pasteurella multocida), 헤모필러스 파라수이스(Haemophilus parasuis), 액티노바실러스 플루로뉴모니애(Actinobacillus pleuropneumoniae), 스트렙토코커스 수이스(Streptococcus suis), 마이코플라스마 뉴모니애(Mycoplasma pneumoniae), 마이코플라스마 호미니스(Mycoplasma hominis), 마이코플라스마 제니탈리움(Mycoplasma genitalium), 마이코플라스마 퍼멘탄스(Mycoplasma fermentans), 마이코플라스마 암포리포르메(Mycoplasma amphoriforme) 마이코플라스마페네트란스(Mycoplasma penetrans), 캄필로박터 제주니(Campylobacter jejuni), 보렐리아 부르그도르페리 (Borrelia burgdorferi), 브루셀라 아보터스(Brucella abortus), 브루셀라 카니스(Brucella canis), 리스테리아 모노키토게네스(Listeria monocytogenes), 리케차 리케치 (Rickettsia ricketsii) 및 예르시니아 페스티스(Yersinia pestis)로 이루어진 군으로부터 선택되는 어느 하나인 감염성 질환 약물 스크리닝 방법.17. The method of claim 16, wherein the bacteria are Salmonella enterica , Escherichia coli, Citrobacter rodentium , Bordetella bronchiseptica , Acinetobacter Bauman Nii ( Acinetobacter baumannii ), Pseudomonas aeruginosa ( Pseudomonas aeruginosa ), Enterobacter cloacae ( Enterobacter cloacae ), Klebsiella pneumoniae ( Klebsiella pneumoniae ), Morganella morganii ( Morganella morganii ), Salmonella Typhimurium ( Salmonella typhimurium ), Shigella dysenteriae ( Shigella dysenteriae ), Yersinia enterocolitica ( Yersinia enterocolitica ), Acinetobacter calcoaceticus ( Acinetobacter calcoaceticus ), Francisella tularensis ( Francisella tularensis ), Legionella pneumophila, Proteus vulgaris, Proteus vulgaris, Proteus mirabilis, Stenotrophomonas maltophilia , Pasteurella multocida , Haemophilus parasuis , Actinobacillus pleuropneumoniae , Streptococcus suis , Mycoplasma pneumoniae , Mycoplasma hominis ), Mycoplasma genitalium , Mycoplasma fermentans, Mycoplasma amphoriforme , Mycoplasma penetrans , Campylobacter jejuni, Borrelia burgdorferi , Brucella abortus , Brucella canis, Listeria monocytogenes , Rickettsia ricketsii and Yersinia pestis ( Yersinia pestis ) Any one infectious disease drug screening method selected from the group consisting of.
- 제16항에 있어서, 상기 감염성 질환은 감염성 위장관 질환, 감염성 호흡기 질환, 감염성 피부 질환 또는 감염성 심혈관계 질환으로 이루어진 군으로부터 선택되는 어느 하나인 감염성 질환 약물 스크리닝 방법.The method of claim 16, wherein the infectious disease is any one selected from the group consisting of an infectious gastrointestinal disease, an infectious respiratory disease, an infectious skin disease, and an infectious cardiovascular disease.
- 제16항에 있어서, 상기 질환 유발 부위는 식도, 위, 대장 또는 소장인 감염성 질환 약물 스크리닝 방법.17. The method of claim 16, wherein the disease-causing site is the esophagus, stomach, large intestine, or small intestine.
- 제16항에 있어서, 상기 질환 유발 부위는 코, 인두, 후두, 기관, 기관지 또는 폐인 감염성 질환 약물 스크리닝 방법.17. The method of claim 16, wherein the disease-causing site is the nose, pharynx, larynx, trachea, bronchi, or lung.
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR20220016982 | 2022-02-09 | ||
KR10-2022-0016982 | 2022-02-09 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2023153805A1 true WO2023153805A1 (en) | 2023-08-17 |
Family
ID=87564700
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/KR2023/001859 WO2023153805A1 (en) | 2022-02-09 | 2023-02-08 | Infectious disease model and drug screening method using same |
Country Status (2)
Country | Link |
---|---|
KR (1) | KR20230121564A (en) |
WO (1) | WO2023153805A1 (en) |
Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5229285A (en) * | 1991-06-27 | 1993-07-20 | Kikkoman Corporation | Thermostable luciferase of firefly, thermostable luciferase gene of firefly, novel recombinant dna, and process for the preparation of thermostable luciferase of firefly |
US20030108483A1 (en) * | 1994-07-01 | 2003-06-12 | The Board Of Trustees Of The Leland Stanford Junior University | Non-invasive localization of a light-emitting conjugate in a mammal |
CN102876702A (en) * | 2012-10-15 | 2013-01-16 | 中国科学院微生物研究所 | Shuttle expression vector with broad hosts |
US20200063146A1 (en) * | 2014-06-18 | 2020-02-27 | Calysta, Inc. | Nucleic acids and vectors for use with methanotrophic bacteria |
KR20210034743A (en) * | 2019-09-20 | 2021-03-31 | 성균관대학교산학협력단 | Modified cyanobacterial gene expression system |
-
2023
- 2023-02-08 KR KR1020230017016A patent/KR20230121564A/en unknown
- 2023-02-08 WO PCT/KR2023/001859 patent/WO2023153805A1/en unknown
Patent Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5229285A (en) * | 1991-06-27 | 1993-07-20 | Kikkoman Corporation | Thermostable luciferase of firefly, thermostable luciferase gene of firefly, novel recombinant dna, and process for the preparation of thermostable luciferase of firefly |
US20030108483A1 (en) * | 1994-07-01 | 2003-06-12 | The Board Of Trustees Of The Leland Stanford Junior University | Non-invasive localization of a light-emitting conjugate in a mammal |
CN102876702A (en) * | 2012-10-15 | 2013-01-16 | 中国科学院微生物研究所 | Shuttle expression vector with broad hosts |
US20200063146A1 (en) * | 2014-06-18 | 2020-02-27 | Calysta, Inc. | Nucleic acids and vectors for use with methanotrophic bacteria |
KR20210034743A (en) * | 2019-09-20 | 2021-03-31 | 성균관대학교산학협력단 | Modified cyanobacterial gene expression system |
Also Published As
Publication number | Publication date |
---|---|
KR20230121564A (en) | 2023-08-18 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
JP6976351B2 (en) | Protein delivery based on attenuated bacteria | |
Hacker et al. | Spontaneous deletions and flanking regions of the chromosomally inherited hemolysin determinant of an Escherichia coli O6 strain | |
Sittka et al. | The RNA chaperone Hfq is essential for the virulence of Salmonella typhimurium | |
Ortiz-Martín et al. | Negative regulation of the Hrp type III secretion system in Pseudomonas syringae pv. phaseolicola | |
WO2019117398A1 (en) | Microorganism producing 5'-inosine monophosphate and method for producing 5'-inosine monophosphate by using same | |
WO2019135639A1 (en) | Novel polypeptide and method for producing imp using same | |
WO2010137900A2 (en) | Selective infracted-tissue-targeting bacteria and use thereof | |
WO2023153805A1 (en) | Infectious disease model and drug screening method using same | |
CN108472348A (en) | Attenuated bacteria for treating malignant entity tumor | |
Deacon et al. | Efa-1/LifA mediates intestinal colonization of calves by enterohaemorrhagic Escherichia coli O26: H–in a manner independent of glycosyltransferase and cysteine protease motifs or effects on type III secretion | |
WO2017179766A1 (en) | Method for preparing gram-positive bacterial ghosts by hydrochloric acid treatment | |
WO2018169317A1 (en) | Mutant gaussia princeps luciferase having amplified bioluminescence intensity | |
Wang et al. | Molecular analysis of the fur (ferric uptake regulator) gene of a pathogenic Edwardsiella tarda strain | |
WO2011055987A2 (en) | Method for screening of quorum sensing inhibitors | |
Wu et al. | Cytopathic effects observed upon expression of a repressed collagenase gene present in Salmonella and related pathogens: mimicry of a cytotoxin from multiple antibiotic-resistant Salmonella enterica serotype Typhimurium phagetype DT104 | |
US20230382956A1 (en) | Bacteria based protein delivery | |
Li et al. | Identification of Salmonella pullorum genomic sequences using suppression subtractive hybridization | |
WO2022092885A1 (en) | Construct for expressing monomeric streptavidin | |
Gupta et al. | Induction of mutations by N-acetoxy-acetyl-2-aminofluorene modified M13 viral DNA | |
WO2018169198A1 (en) | Method for producing animal model having colon polyp or colorectal cancer by using intestinal flora | |
WO2021086085A1 (en) | Tumor-targeting salmonella gallinarum strain and use thereof | |
WO2020139031A1 (en) | Crispr-cas-based composition for gene correction | |
WO2022231043A1 (en) | Attenuated salmonella gallinarum strain and use thereof | |
WO2020116941A2 (en) | Microorganism for producing dicarboxylic acid, and method for producing dicarboxylic acid using same | |
Hou et al. | Identification and characterization of the AcrR/AcrAB system of a pathogenic Edwardsiella tarda strain |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 23753153 Country of ref document: EP Kind code of ref document: A1 |