WO2023144263A1 - Allele specific splice switching oligonucleotides targeting pseudoexons - Google Patents

Allele specific splice switching oligonucleotides targeting pseudoexons Download PDF

Info

Publication number
WO2023144263A1
WO2023144263A1 PCT/EP2023/051916 EP2023051916W WO2023144263A1 WO 2023144263 A1 WO2023144263 A1 WO 2023144263A1 EP 2023051916 W EP2023051916 W EP 2023051916W WO 2023144263 A1 WO2023144263 A1 WO 2023144263A1
Authority
WO
WIPO (PCT)
Prior art keywords
sso
pseudoexon
splice site
mrna
allele
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2023/051916
Other languages
English (en)
French (fr)
Inventor
Brage Storstein Andresen
Thomas Koed Doktor
Lise Lolle Holm
Ulrika Simone Spangsberg PETERSEN
Gitte Hoffmann Bruun
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Syddansk Universitet
Original Assignee
Syddansk Universitet
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from PCT/EP2022/051790 external-priority patent/WO2022162020A2/en
Application filed by Syddansk Universitet filed Critical Syddansk Universitet
Priority to US18/728,263 priority Critical patent/US20250101419A1/en
Priority to CN202380030631.5A priority patent/CN119013399A/zh
Priority to CA3247528A priority patent/CA3247528A1/en
Priority to JP2024544641A priority patent/JP2025504661A/ja
Priority to EP23702114.2A priority patent/EP4469572A1/en
Priority to AU2023210747A priority patent/AU2023210747A1/en
Publication of WO2023144263A1 publication Critical patent/WO2023144263A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111General methods applicable to biologically active non-coding nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/33Alteration of splicing

Definitions

  • the present invention relates to allele specific splice switching oligonucleotides (SSOs) that can activate splicing of pseudoexons.
  • SSOs are able to promote inclusion of the pseudoexon in an mRNA transcript of a gene, such as in an allele specific manner, thereby inhibiting expression of a functional gene product.
  • the invention relates to a method for identifying pseudoexons for which it is possible to incorporate the pseudoexons in mature mRNAs using the SSOs.
  • Newly synthesized eukaryotic mRNA molecules also known as primary transcripts or pre-mRNA, made in the nucleus, are processed before or during transport to the cytoplasm for translation. Processing of the pre-mRNAs includes addition of a 5' methylated cap and an approximately 200-250 nucleotides poly(A) tail to the 3' end of the transcript.
  • Another step in mRNA processing is splicing of the pre-mRNA, which is part of the maturation of 90-95% of mammalian mRNAs.
  • Introns or intervening sequences
  • Exons are regions of a primary transcript that remain in the mature mRNA when it reaches the cytoplasm. The exons are spliced together to form the mature mRNA sequence. Splicing occurs between splice sites that together form a splice junction.
  • the splice site at the 5' end of the intron is often called the "5' splice site,” or “splice donor site” and the splice site at the 3' end of the intron is called the “3' splice site” or “splice acceptor site”.
  • the 3' end of an upstream exon is joined to the 5' end of the downstream exon.
  • the unspliced RNA (or pre-mRNA) has an exon/intron splice site at the 5' end of an intron and an intron/exon splice site at the 3' end of an intron.
  • the exons are contiguous at what is sometimes referred to as the exon/exon junction or boundary in the mature mRNA.
  • Alternative splicing defined as the splicing together of different combinations of exons or exon segments, often results in multiple mature mRNA transcripts expressed from a single gene.
  • pre-mRNA precursor mRNA
  • introns are removed through the activities of the spliceosome, and the coding parts of a gene are spliced together, resulting in a functional mRNA.
  • Pre-mRNA splicing is a highly controlled process, and it is well established that mutations can impact splicing and generate aberrant transcripts. Correct mRNA splicing depends on regulatory sequences, which are recognized by different factors of the spliceosome, as well as splicing regulatory factors.
  • the splicing regulatory factors either stimulate or repress recognition and splicing of exons by sequence specific binding to splicing regulatory sequences such as splicing enhancers and splicing silencers.
  • splicing regulatory sequences such as splicing enhancers and splicing silencers.
  • Pre-mRNA splicing in eukaryotes is often associated with extensive alternative splicing to enrich their proteome.
  • Alternative selection of splice sites permits eukaryotes to modulate cell type specific gene expression, contributing to their functional diversification.
  • Alternative splicing is a highly regulated process influenced by the splicing regulatory proteins, such as SR proteins or hnRNPs, which recognize splicing regulatory sequences, such as exonic splicing enhancers (ESEs) and exonic splicing silencers (ESSs) in exons, and intronic splicing enhancers (ISEs) and intronic splicing silencers (ISSs) in introns.
  • ESEs exonic splicing enhancers
  • ESSs exonic splicing silencers
  • ISEs intronic splicing enhancers
  • ISSs intronic splicing silencers
  • the present invention relates to the identification of sequence parameters in a gene comprising a pseudoexon, which can be used to determine if it is possible to get the pseudoexon incorporated into the mature mRNA using a splice switching oligonucleotide (SSO). Incorporation of pseudoexons can e.g. be used to inactivate, disrupt, or alter the function of the functional product expressed from a gene by incorporation of the pseudoexon in the mature mRNA (see also example 1 and corresponding figure and figure legend for further information). The invention also relates to (medical) uses of such SSOs.
  • SSO splice switching oligonucleotide
  • the inventing team has identified numerous SNPs within SSO binding regions allowing for allele specific targeting. Allele-specific SSOs can be used for preferentially targeting the disease-causing pre-mRNA (from the disease causing allele), whereas the pre-mRNA from the "normally functioning" allele is unaffected (or less affected), (see example 13).
  • the inventing team has identified SNPs within the splice site sequences of pseudoexons allowing for allele specific incorporation of the pseudoexon in the mature RNA in only the disease-causing gene (and not the other "normal" gene on the other allele). Phrased in another way, when the MaxEnt score of a splice site in the disease causing gene, is increased compared to the other allele, allele specific targeting is possible (see examples 15-16).
  • Example 2 shows that the identified parameters are essential for identifying activatable pseudoexons (Table 1) and non-activatable pseudoexons (Table 2).
  • Example 3 shows data in relation to SMAD2 (see also example 11).
  • Example 12 shows data in relation to RNF115.
  • Examples 4-11 and 13-14 show further examples for specific genes comprising pseudoexons where the pseudoexons can be activated (incorporated in the mature mRNA).
  • Example 13, 15 and 16 show allele specific targeting.
  • an object of the present invention relates to the provision of sequence parameters (criteria) which can identify binding sites for SSOs for incorporation of pseudoexons into mature mRNA.
  • Another object of the invention is to provide SSOs, which, in vivo, can promote incorporation of pseudoexons into mature mRNA, thereby inactivating, disrupting, or altering the natural function of genes.
  • one aspect of the invention relates to a method for identifying SSOs able to modulate expression and/or function of a target protein in a cell by promoting incorporation of a pseudoexon into the mature mRNA upon binding to the pre- mRNA in the region +9 to +39 downstream to the 5' splice site of said pseudoexon, the method comprising; a) providing one or more gene sequences comprising one or more identified pseudoexons, such as in the form of a database or other storage means; b) determining for the one or more gene sequences; if the pseudoexon meets the following criteria:
  • Donor splice site has a MaxEnt score ⁇ 10.06;
  • the present invention also relates to specifically identified SSO for use as medicaments.
  • another aspect of the invention relates to a composition comprising a splice switching oligonucleotide (SSO) for use as a medicament, said composition comprising
  • an SSO selected from the group consisting of: o a nucleic acid according to any of SEQ ID NO's: 127-136 and SEQ ID NO's: 202-216; or o a nucleic acid comprising 1 or 2 or 3 substitutions when compared to any of SEQ ID NO's: 127-136 and SEQ ID NO's: 202-216; or o a nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NO's: 127-136 and SEQ ID NO's: 202-216; wherein said SSO being complementary or substantially complementary to a target pre-mRNA (encoding a functional disorder-causing or disorder-influencing protein), said target pre-mRNA comprising:
  • a function-disabling pseudoexon comprising: o at the 5'-end a 3' splice site; and o at the 3'-end a 5' splice site; wherein said SSO is complementary or substantially complementary to the target pre-RNA at a region +9 to +39 downstream to the 5' splice site of said pseudoexon; wherein, when said SSO, in vivo, hybridizes to the pre-mRNA within the region +9 to +39 downstream to the 5' splice site of said pseudoexon; said pseudoexon becomes part of the mature mRNA to a greater extent compared to corresponding pre-mRNA not contacted with the SSO.
  • the invention relates to a
  • composition comprising an SSO complementary or substantially complementary to region within a nucleic acid selected from the group consisting of o a nucleic acid according to any of any of SEQ ID NO's: 106, 1-26, 79-105, 107-125 and 137-201; or o a nucleic acid comprising 1 or 2 or 3 substitutions when compared to any of any of SEQ ID NO's: 106, 1-26, 79-105, 107-125 and 137- 201; or o a nucleic acid sequence having at least 90% sequence identity to any of any of SEQ ID NO's: 106, 1-26, 79-105, 107-125 and 137- 201; or
  • composition comprising an SSO selected from the group consisting of:
  • nucleic acid according to any of SEQ ID NO's: 127-136 and SEQ ID NO's: 202-216; or
  • nucleic acid comprising 1 or 2 or 3 substitutions when compared to any of SEQ ID NO's: 127-136 and SEQ ID NO's: 202-216; or a nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NO's: 127-136 and SEQ ID NO's: 202-216.
  • a further aspect of the invention relates to a composition
  • a composition comprising a splice switching oligonucleotide (SSO) for use as a medicament, said composition comprising
  • an SSO selected from the group consisting of: o a nucleic acid according to any of SEQ ID NO's: 295-367; or o a nucleic acid comprising 1 or 2 or 3 substitutions when compared to any of SEQ ID NO's: 295-367; or o a nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NO's: 295-367; wherein said SSO being complementary or substantially complementary to a target pre-mRNA, said target pre-mRNA comprising:
  • a function-disabling pseudoexon comprising : o at the 5'-end a 3' splice site; and o at the 3'-end a 5' splice site; wherein said SSO is complementary or substantially complementary to the target pre-mRNA at a region +9 to +39 downstream to the 5' splice site of said pseudoexon.
  • an aspect of the invention relates to a method for identifying a subject who is likely eligible for allele-specific SSO-based pseudoexon inclusion treatment of a dysfunctional or disease-causing gene, the method comprising
  • Yet an aspect of the invention relates to a method for identifying a subject who is likely eligible for SSO-based pseudoexon inclusion treatment of a dysfunctional or disease-causing gene, the method comprising
  • SNP sequence variation
  • said subject has a sequence variation (SNP) in the 5' splice site and/or the 3' splice site, preferably the 5' splice site of the function-disabling pseudoexon, said subject is likely eligible for SSO-based pseudoexon inclusion treatment; or wherein if the subject does not have a sequence variation (SNP) in the 5' splice site and/or the 3' splice site of the function-disabling pseudoexon, said subject is likely not eligible for SSO-based pseudoexon inclusion treatment; o wherein said SSO is complementary or substantially complementary to a target pre-mRNA of the dysfunctional or disease-causing gene, said target pre-mRNA comprising:
  • Figure 1 shows a schematic overview of gene expression regulation by SSO according to the invention.
  • Fig 1A a Sweet Spot region is identified in the intron part of the pre-mRNA as a region +9 to +39 nucleotides downstream for the 5 'splice site of a pseudoexon that obeys the criteria according to the invention.
  • Fig IB Pseudoexon inclusion into the mRNA transcript can be activated and increased by employing SSOs complementary to the Sweet Spot region of pseudoexons fulfilling the criteria. Pseudoexon inclusion into the mRNA will modulate gene expression either at the mRNA level or protein level, by mislocalization, destabilization, degradation or alteration of mRNA or protein function.
  • Figure 2 shows a schematic demonstration of how RNA-sequencing data can be used in detection of in vivo spliced double junctions for empirical detection of pseudoexons, which are included into the endogenous transcript at low levels.
  • reads are filtered to retain only fragments containing at least two splicing junctions.
  • the splicing junctions of the entire fragment are then assembled into an exon structure, allowing for an unmapped gap between reads in the fragment of up to 100 bp.
  • Exons are then classified using known exon annotations to identify pseudoexons contained within introns. Novel pseudoexons that may be candidates for activation by SSOs binding to the Sweet Spot region can be identified by 14 criteria, after which highly therapeutically relevant pseudoexons can be identified in genes where a downregulation of expression or alteration of the functional gene product is medically relevant.
  • LINGO2 pseudoexon inclusion inhibits growth and proliferation of glioblastoma cells.
  • A RT-PCR analysis of LINGO2 pseudoexon splicing in U251 cells transfected with the LINGO2 pseudoexon +11 SSO and a nontargeting SSO control. The upper band includes the pseudoexon, which is activated by transfection of the +11 SSO.
  • B IncuCyte® cell proliferation assay showing growth curves of U251 cells transfected with the LINGO2 +11 SSO and a nontargeting SSO control at different concentrations (cell confluency relative to time after transfection). The growth is inhibited by transfection of the +11 SSO in a dose-dependent manner.
  • TAF2 pseudoexon inclusion inhibits growth and proliferation of lung cancer cells.
  • C Bar plots from IncuCyte® cell proliferation assay showing the relative cell count 68 hours after transfection of the TRPM7 pseudoexon +13 SSO and TRPM7 siRNA (KD), including controls; transfection of a nontargeting control SSO and untransfected cells with transfection reagent (RNAiMAX) or without (UTR). The growth is inhibited by transfection of the +13 SSO. Student's t test, *p ⁇ 0.05, **p ⁇ 0.01 and ***p ⁇ 0.001.
  • HIF1A SSOs targeting the Sweet Spot region (A) RT-PCR analysis of HIF1A pseudoexon splicing in U251 cells transfected with the HIF1A pseudoexon +9, +10, +11, +12 and +13 SSOs. The middle band includes the pseudoexon and the efficiency is highest by transfection with the +10 SSO. Pseudoexon inclusion levels were quantified using the Fragment Analyzer (Advanced Analytical Technologies).
  • RNF115 pseudoexon inclusion leads to reduced RNF115 proteins levels and inhibits growth of lung adenocarcinoma cells.
  • A RT-PCR analysis of RNF115 pseudoexon splicing in NCI-H23 cells transfected with the RNF115 pseudoexon + 11 SSO and a nontargeting SSO control. The upper band includes the pseudoexon, which is activated by transfection of the +11 SSO.
  • B WST-1 assay showing growth of NCI-H23 cells transfected with the RNF115 +11 SSO and a nontargeting SSO control at different. The growth is inhibited by transfection of the +11 SSO in a dose-dependent manner.
  • SMAD2 pseudoexon inclusion decreases fibrosis in hepatic stellate cells.
  • A RT- PCR analysis of SMAD2 pseudoexon splicing in HeLa cells transfected with the SMAD2 +11 SSO and a nontargeting SSO control. The upper band includes the pseudoexon which is activated by transfection with the +11 SSO.
  • B RT-PCR analysis of SMAD2 pseudoexon splicing in LX-2 hepatic stellate cells transfected with the SMAD2 +11 SSO and a nontargeting SSO control.
  • FIG. 9 SSO-mediated LRRK2 pseudoexon inclusion.
  • A Schematic representation of the consequences of induced LRRK2 pseudoexon inclusion. Inclusion of a 54 nt pseudoexon from LRRK2 intron 47 will introduce 18 amino acids to the WD40 domain of the translated LRRK2 protein, and inclusion of a 82 nt pseudoexon with the same 5' splice site will cause a frame-shift and insertion of a premature termination codon which is a target for transcript degradation by nonsense- mediated mRNA decay (NMD).
  • NMD nonsense- mediated mRNA decay
  • the pseudoexon 5' splice site (AGAgtaggt) (SEQ ID NO: 369) has a high MaxEnt score of 4.84.
  • the SSO treatment induces pseudoexon inclusion from the G allele and inclusion of the pseudoexon will introduce several in-frame premature termination codons (PTC) that will target the mRNA transcript for degradation by nonsense-mediated mRNA decay (NMD) and/or result in translation of truncated protein.
  • PTC in-frame premature termination codons
  • the G allele-specific pseudoexon activation allows downregulation of the hyperactivated LRRK2 disease allele with minimal or no effect on the wild type when the identified SNP (G) and dominant pathogenic mutation are located on the same allele.
  • Pseudoexon activation mediated by an SSO targeting the Sweet Spot region (+9 to +39 nt downstream of the 5' splice site) depends on the strength of the pseudoexon 3' and 5' splice sites.
  • SNPs that are located in the 23-mer 3' splice site (-20 to +3 nt of the intron-exon border) or in the 9-mer 5' splice site (-3 to +6 nt of the exon-intron border) affects the strength of the given splice site (changes the MaxEnt score) and can be exploited for allele-specific pseudoexon activation, since such SNPs can make otherwise non-responding pseudoexons functional targets for SSO treatment and thereby allow for allele-specific inclusion or increased inclusion of the given pseudoexon in mature mRNA.
  • a SNP variant in the pseudoexon 3' or 5' splice site SSO- mediated activation of the pseudoexon is not possible or only possible to a low degree. Normal mRNA transcript is produced and can be translated into functional protein.
  • B A SNP variant strengthens the pseudoexon 3' splice site (increases the MaxEnt score) and enables SSO-mediated activation of the pseudoexon from alleles with the specific 3' splice site high MaxEnt score SNP variant.
  • a SNP variant strengthens the pseudoexon 5' splice site (increases the MaxEnt score) and enables SSO-mediated activation of the pseudoexon from alleles with the specific 5' splice site high MaxEnt score SNP variant.
  • pseudoexon inclusion can target the mRNA transcript for degradation by nonsense-mediated mRNA decay (NMD) or result in translation of truncated, non-functional protein and will thereby modulate gene expression.
  • Allele-specific pseudoexon activation in heterozygotes can allow downregulation of the disease allele with minimal or no effect on the wild type when the identified high MaxEnt score SNP variant and a pathogenic mutation are located on the same allele.
  • the pseudoexon will be activated from both alleles in homozygotes for the high MaxEnt score SNP variant. * indicates possible location of SNPs affecting the strength of the pseudoexon 3' or 5' splice site. MJ; pseudoexon, WT; wild-type, MUT; mutant.
  • pseudoexon or "PE” relate to exonic-like sequences that are present within intronic regions but are normally ignored by the spliceosomal machinery.
  • pseudoexons do not, under normal splicing conditions, become part of the mature mRNA or only become part of the mature mRNA at low levels.
  • pseudoexons are intronic sequences flanked by 3' and 5' splice sites, but pseudoexons are often not annotated due to the normally low inclusion into the mRNA transcript.
  • pseudoexons will either disrupt or significantly alter the function of the normal transcript or protein.
  • the term "function-disabling pseudoexon” relates to the situation that the presence of the pseudoexon in the mature mRNA results in inactivation, reduced activity, reduced transcription and/or altered function of the protein expressed from the mRNA (compared to mature mRNA without the pseudoexon).
  • Exonic Splicing Enhancer or “Exon Splicing Enhancer” or “ESE” means a nucleotide sequence, which when present in the exon and accessible for binding of nuclear splicing regulatory proteins and/or by forming a secondary structure or a part thereof of the pre-mRNA stimulates inclusion of this exon into the final spliced mRNA during pre-mRNA splicing.
  • Exonic Splicing Silencer or “Exon Splicing Silencer” or “ESS” mean a nucleotide sequence, which when present in the exon and accessible for binding of nuclear splicing regulatory proteins and/or by forming a secondary structure or a part thereof of the pre-mRNA inhibits inclusion of this exon into the final spliced mRNA during pre-mRNA splicing.
  • Intronic Splicing Enhancer ISE
  • Intronic Splicing Enhancer or “Intron Splicing Enhancer” or “ISE” mean a nucleotide sequence, which when present in the intron and accessible for binding of nuclear splicing regulatory proteins and/or by forming a secondary structure or a part thereof of the pre-mRNA stimulates inclusion of an exon into the final spliced mRNA during pre-mRNA splicing.
  • Intronic Splicing Silencer or “Intron Splicing Silencer” or “ISS” mean a nucleotide sequence, which when present in the intron and accessible for binding of nuclear splicing regulatory proteins and/or by forming a secondary structure or a part thereof of the pre-mRNA inhibits inclusion of an exon into the final spliced mRNA during pre-mRNA splicing.
  • Splice sites at the 5' end of the intron are often called the “5' splice site,” or “splice donor site” and the splice site at the 3' end of the intron are often called the “3' splice site” or “splice acceptor site”.
  • NTD Nonsense-mediated mRNA decay
  • NMD Nonsense-mediated mRNA decay
  • PTCs premature termination codons
  • the introduction of the pseudoexon may induce NMD if a PTC is present in the introduced pseudoexon or when the pseudoexon changes the reading frame of the mature transcript.
  • nucleotide means a nucleoside further comprising a phosphate linking group.
  • linked nucleosides may or may not be linked by phosphate linkages and thus includes, but is not limited to “linked nucleotides”.
  • linked nucleosides are nucleosides that are connected in a continuous sequence (i.e., no additional nucleosides are present between those that are linked).
  • nucleobase means a group of atoms that can be linked to a sugar moiety to create a nucleoside that is capable of incorporation into an oligonucleotide, and wherein the group of atoms is capable of bonding with a complementary naturally occurring nucleobase of another oligonucleotide or nucleic acid. Nucleobases may be naturally occurring or may be modified.
  • unmodified nucleobase or “naturally occurring nucleobase” mean the naturally occurring heterocyclic nucleobases of RNA or DNA: the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) (including 5-methyl C), and uracil (U).
  • modified nucleobase means any nucleobase that is not a naturally occurring nucleobase.
  • modified nucleoside means a nucleoside comprising at least one chemical modification compared to naturally occurring RNA or DNA nucleosides. Modified nucleosides comprise a modified sugar moiety and/or a modified nucleobase.
  • constrained ethyl nucleoside or “cEt” means a nucleoside comprising a bicyclic sugar moiety comprising a 4'-CH(CH3)-0-2'bridge.
  • locked nucleic acid nucleoside or "LNA” means a nucleoside comprising a bicyclic sugar moiety comprising a 4'-CH2-0-2'bridge.
  • 2'-substituted nucleoside means a nucleoside comprising a substituent at the 2'-position other than H or OH. Unless otherwise indicated, a 2 '-substituted nucleoside is not a bicyclic nucleoside.
  • 2'-deoxynucleoside means a nucleoside comprising 2'-H furanosyl sugar moiety, as found in naturally occurring deoxyribonucleosides (DNA).
  • a 2'-deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (e.g., uracil).
  • oligonucleotide means a compound comprising a plurality of linked nucleosides.
  • an oligonucleotide comprises one or more unmodified ribonucleosides (RNA) and/or unmodified deoxyribonucleosides (DNA) and/or one or more modified nucleosides.
  • terminal group means one or more atoms attached to either, or both, the 3' end or the 5' end of an oligonucleotide. In certain embodiments a terminal group is a conjugate group. In certain embodiments, a terminal group comprises one or more terminal group nucleosides.
  • conjugate means an atom or group of atoms bound to an oligonucleotide or oligomeric compound.
  • conjugate groups modify one or more properties of the compound to which they are attached, including, but not limited to pharmacodynamic, pharmacokinetic, binding, absorption, cellular distribution, cellular uptake, charge and/or clearance properties.
  • conjugate linking group means any atom or group of atoms used to attach a conjugate to an oligonucleotide or oligomeric compound.
  • splice switching oligonucleotide or “SSO” means a compound comprising or consisting of an oligonucleotide at least a portion of which is complementary to a target nucleic acid to which it is capable of hybridizing, resulting in at least one change in the splicing pattern of the targeted pre-mRNA.
  • a splice switching oligonucleotide could also be termed splice switching antisense oligomer (SSO).
  • SSO splice switching antisense oligomer
  • mRNA means an RNA molecule that encodes a protein.
  • pre-mRNA means an RNA transcript that has not been fully processed into mRNA. Pre-mRNA includes one or more introns.
  • target pre-mRNA means a nucleic acid molecule to which an SSO hybridizes.
  • a change in the splicing pattern of the targeted pre-mRNA means a change in the pre-mRNA splicing process resulting in insertion of a proportion, for instance corresponding to a pseudoexon or a proportion thereof, into the produced mRNA when compared to the reference nucleotide sequence of the targeted pre-mRNA.
  • transcript means an RNA molecule transcribed from DNA.
  • Transcripts include, but are not limited to mRNA, pre-mRNA, and partially processed RNA.
  • targeting means the association of an SSO to a particular target nucleic acid molecule or a particular region of a target nucleic acid molecule.
  • An SSO targets a target nucleic acid if it is sufficiently complementary to the target nucleic acid to allow hybridization under physiological conditions.
  • nucleobase complementarity or “complementarity” when in reference to nucleobases means a nucleobase that is capable of base pairing with another nucleobase.
  • adenine (A) is complementary to thymine (T).
  • adenine (A) is complementary to uracil (U).
  • complementary nucleobase means a nucleobase of an SSO that is capable of base pairing with a nucleobase of its target nucleic acid.
  • nucleobases at a certain position of an SSO are capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid
  • the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered complementary at that nucleobase pair.
  • Nucleobases comprising certain modifications may maintain the ability to pair with a counterpart nucleobase and thus, are still capable of nucleobase complementarity.
  • complementary in reference to oligomeric compounds (e.g., linked nucleosides, oligonucleotides, or nucleic acids) means the capacity of such oligomeric compounds or regions thereof to hybridize to another oligomeric compound or region thereof through nucleobase complementarity under stringent conditions.
  • Complementary oligomeric compounds need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated.
  • complementary oligomeric compounds or regions are complementary at 70% of the nucleobases (70% complementary).
  • complementary oligomeric compounds or regions are 80% complementary.
  • complementary oligomeric compounds or regions are 90% complementary.
  • complementary oligomeric compounds or regions are 95% complementary. In certain embodiments, complementary oligomeric compounds or regions are 100% complementary. In another embodiment, the oligomeric compounds comprise up to 3 mismatches, such as up to 2 or 1 mismatches. Preferably, no mismatches are present.
  • hybridization means the pairing of complementary oligomeric compounds (e.g., an SSO and its target nucleic acid). While not limited to a particular mechanism, the most common mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.
  • motif means a pattern of chemical modifications in an oligomeric compound or a region thereof. Motifs may be defined by modifications at certain nucleosides and/or at certain linking groups of an oligomeric compound.
  • nucleoside motif means a pattern of nucleoside modifications in an oligomeric compound or a region thereof.
  • the linkages of such an oligomeric compound may be modified or unmodified.
  • motifs herein describing only nucleosides are intended to be nucleoside motifs. Thus, in such instances, the linkages are not limited.
  • sugar motif means a pattern of sugar modifications in an oligomeric compound or a region thereof.
  • linkage motif means a pattern of linkage modifications in an oligomeric compound or region thereof.
  • the nucleosides of such an oligomeric compound may be modified or unmodified.
  • motifs herein describing only linkages are intended to be linkage motifs. Thus, in such instances, the nucleosides are not limited.
  • nucleoside having a modification of a first type may be an unmodified nucleoside.
  • nucleosides that are the same but comprise different nucleobases are not differently modified. For example, a nucleoside comprising a 2'-OMe modified sugar and an unmodified adenine nucleobase and a nucleoside comprising a 2'-OMe modified sugar and an unmodified thymine nucleobase are not differently modified.
  • the MaxEnt score is a score known to the skilled person that accounts for adjacent as well as non-adjacent dependencies between positions within the splice site, using a maximum entropy principle to identify optimal splice sites.
  • a high score indicates a high probability of a functionally strong splice site, but splice sites with lower scores may be functional through activation by splicing factors bound to the pre-mRNA at ESE or ISE motifs.
  • a splice site with a high score may be functionally repressed by nearby or overlapping ESS or ISS motifs binding inhibitory splicing factors.
  • MaxEnt score is determined using the program "MaxEntScan" version 20-04-2004. The same software can be used to determine: 5' splice site scores: (http: //hollvwood. mit.edu/buraelab/maxent/Xmaxentscan scoresea.htm I): and 3' splice site scores: (http://hollvwood.mit.edu/buraelab/maxent/Xmaxentscan scoresea acc.ht ml)
  • MaxEnt score is further described in Gene Yeo and Christopher B Burge (J Comput Biol. 2004; ll(2-3):377-94).
  • the MaxEnt score is a specific value which can only be determined in one way.
  • MaxEnt score is optional.
  • Pseudoexons are identified with precise genomic coordinates of the 3' splice site and the 5' splice site using a double-junction approach.
  • RNA sequencing fragments are filtered to retain only those with evidence of at least two splicing junctions.
  • Exon coordinates can be extracted from the mapped reads, allowing for a gap of a certain length in the middle of the fragment where there is no direct sequence.
  • the exons which are supported by a splicing junction at both ends in the same fragment are classified by comparing to a known gene annotation, and novel pseudoexons can be identified as exons that overlap introns, but not any existing exons.
  • the "Sweet Spot region” is defined as the region from +9 to +39 downstream of the 5' splice site of a pseudoexon, both positions included. Pseudoexons that can be activated by an SSO binding to a region within the Sweet Spot region is identified by the following parameters:
  • Donor splice site has a MaxEnt score ⁇ 10.06;
  • the presence of a uracil may be considered equivalent to the presence of a thymidine at the same position in the corresponding DNA sequence.
  • the presence of a thymidine in the DNA sequence may also be considered equivalent to a uracil in the same position in the corresponding RNA sequence.
  • the criteria covering sequences with thymidines and pyrimidines are therefore identical to equivalent criteria for sequences with uracil and pyrimidines when the analyzed sequence is an RNA sequence.
  • the present invention relates to the identification of sequence parameters in a gene comprising a pseudoexon, which can be used to determine if it is possible (with high probability) to get the pseudoexon incorporated in the mature mRNA using a splice switching oligonucleotide (SSO) (see also example 1 and corresponding figures).
  • SSO splice switching oligonucleotide
  • an aspect of the invention relates to a method for identifying SSOs able to modulate expression of a target protein in a cell by promoting incorporation of a pseudoexon into the mature mRNA upon binding to the pre-mRNA in the region +9 to +39 downstream to the 5' splice site of said pseudoexon, the method comprising; a) providing one or more gene sequences comprising one or more identified pseudoexons; b) determining for the one or more gene sequences; if the pseudoexon meets the following criteria:
  • said region +9 to +39 downstream to the 5' splice site of said pseudoexon is considered a target for an SSO able to, in vivo, hybridize to the pre-mRNA (2) of said gene within the region +9 to +39 downstream to the 5' splice site of said pseudoexon (3); and resulting in said pseudoexon (3) becoming part of the mature mRNA to a greater extent compared to corresponding pre- mRNA not contacted with the SSO (1); and optionally, producing said SSO, optionally for use as a medicament.
  • the included selection parameters can discriminate between genes where SSOs can be used (Table 1 in example 2) and genes where the SSOs will not be able to incorporate the pseudoexon (Table 2 in example 2).
  • the invention is computer-implemented (except for the optional step of producing said SSO, optionally for use as a medicament).
  • the one or more gene sequences comprising one or more identified pseudoexons are provided in the form of a database or on another digital storage mean.
  • the one or more gene sequences comprising one or more identified pseudoexons are gene sequences, which contains disease-causing genes, such as genes encoding dominant negative proteins, such as characterized by increased expression or altered function of the gene, or genes.
  • the pseudoexons is in a gene where decreased level of normal functional gene product has a therapeutic benefit, such as genes associated with cancer, diabetes, inflammation, neurodegenerative or neurological disorders, tissue degeneration, tissue fibrosis and chirosis, metabolic conditions, chronic liver disease and inherited retinal dystrophies (IRDs).
  • a therapeutic benefit such as genes associated with cancer, diabetes, inflammation, neurodegenerative or neurological disorders, tissue degeneration, tissue fibrosis and chirosis, metabolic conditions, chronic liver disease and inherited retinal dystrophies (IRDs).
  • the one or more gene sequences comprising one or more identified pseudoexons are gene sequences, which contains disease-causing genes, such as genes encoding proteins causing/enhancing/influencing diseases such as cancer, diabetes, inflammation, neurodegenerative or neurological disorders, tissue degeneration, tissue fibrosis and chirosis, metabolic conditions, chronic liver disease and inherited retinal dystrophies (IRDs).
  • disease-causing genes such as genes encoding proteins causing/enhancing/influencing diseases such as cancer, diabetes, inflammation, neurodegenerative or neurological disorders, tissue degeneration, tissue fibrosis and chirosis, metabolic conditions, chronic liver disease and inherited retinal dystrophies (IRDs).
  • the disease may be due to enhanced expression.
  • the one or more gene sequences comprising one or more identified pseudoexons are gene sequences, which are not only known to cause inherited disease(s).
  • SSOs are produced against an identified region +9 to +39 downstream to the 5' splice site of said pseudoexon, which region meets the above outlined criteria. Examples 3-10 show specific examples of the effect of SSOs against identified target sequences.
  • said produced SSO comprises a sequence, which is complementary or substantially complementary to a region +9 to +39 downstream to the 5' splice site of said pseudoexon (3), such as within the region + 11 to +35 downstream to the 5' splice site.
  • SSOs which are complementary to position +11 to +35 have been used (25 nt long).
  • specific optimization of the target region for the SSO has been further optimized for the two genes HIF1A and TRPM7.
  • examples 3 and 13 specific optimization of the target region for the SSO has been further optimized for the two genes SMAD2 and LRRK2.
  • said produced SSO comprises a sequence which is substantially complementary to the region +9 to +39 downstream to the 5' splice site of said pseudoexon (3), and comprises at the most 3 mismatches, such as at the most 2 mismatches or such as at the most 1 mismatch.
  • said produced SSO comprises a sequence which is complementary to a region +9 to +39 downstream to the 5' splice site of said pseudoexon (3) such as within the region +11 to +35 downstream to the 5' splice site.
  • SSOs targeting position +11 to +35 were tested.
  • the complementary region being in the range 9-31 nucleotides, such as 15-30, such as 15-25 or such as 9-15, or such as 15-30, such as 20-25. If e.g. LNA are used or other high-binding nucleotides, the length of the SSO may be in the shorter ranges.
  • the SSOs may be able to modulate expression of the target protein in different ways.
  • hybridization of the SSO to the pre-mRNA in vivo results in: decreasing the level of mRNA encoding the functional protein (4); and/or decreasing expression of the functional protein (6); and/or - loss of function of the functional protein (5); and/or
  • the one or more gene sequences from step a) causes a disorder or condition characterized by increased expression or altered function of the gene.
  • the disorder or condition is an autosomal dominant negative disorder.
  • the one or more gene sequences from step a) is therapeutically beneficial when the level of normal functional gene product is decreased.
  • the disorder or condition is not directly associated with a disease-causing gene.
  • said SSO has a length in the range 9-100 nucleotides, such as 9-50 nucleotides, preferably in the range 9-40 nucleotides and more preferably in the range 15-31 nucleotides or 15-25 nucleotides.
  • said SSO comprises a sequence which is complementary or substantially complementary to a polynucleotide in the pre-mRNA, wherein said sequence has a length in the range 9-31 nucleotides, such as 15-25 nucleotides, preferably the sequence is complementary at a range of 9-31 nucleotides, such as 9-20, or such as 20-31 nucleotides, such as 25-31 nucleotides.
  • said produced SSO comprises one or more artificial nucleotides, such as sugar-modified nucleotides.
  • the SSO does not mediate RNAse H mediated degradation of the mRNA in vivo.
  • At least one modified sugar moiety is a 2'-substituted sugar moiety.
  • said 2'-substituted sugar moiety has a 2'-substitution selected from the group consisting of 2'-O-Methyl (2'-OMe), 2'-fluoro (2'-F), and 2'-O- methoxyethyl (2'-MOE).
  • said 2'-substitution of said at least one 2'-substituted sugar moiety is a 2'-O-methoxyethyl (2'-MOE).
  • At least one modified sugar moiety is a bicyclic sugar moiety.
  • At least one bicyclic sugar moiety is a locked nucleic acid (LNA) or constrained ethyl (cEt) nucleoside.
  • LNA locked nucleic acid
  • cEt constrained ethyl
  • At least one sugar moiety is a sugar surrogate.
  • At least one sugar surrogate is a morpholino.
  • At least one morpholino is a modified morpholino.
  • the SSO comprises at least one internucleoside N3' to P5' phosphoramidate diester linkage.
  • the modified oligonucleotide comprises at least one internucleoside phosphorothioate linkage.
  • all internucleoside linkages are phosphorothioate.
  • the SSO is conjugated to delivery elements, such as selected from the group consisting of Gal-Nac, (poly-)unsaturated fatty acids (such as oleoyl and linolenoyl), anisamide, anandamide, folic acid (FolA), carbachol, estrone, Retro-1, phospholipids, o-tocopherol (o-TP), cholesterol, squalene (SQ), unbranched fatty acids (such as lauroyl, myristoyl, palmitoyl, stearoyl, and docosanoyl), and cell penetrating peptides.
  • delivery elements such as selected from the group consisting of Gal-Nac, (poly-)unsaturated fatty acids (such as oleoyl and linolenoyl), anisamide, anandamide, folic acid (FolA), carbachol, estrone, Retro-1, phospholipids, o-to
  • the one or more gene sequences comprising one or more identified pseudoexons are involved in a disease or disorder selected from the group consisting of cancer, Inflammatory diseases, Neurodegenerative or neurological diseases, Metabolic conditions, Chronic liver disease and Inherited retinal dystrophies (IRDs).
  • a disease or disorder selected from the group consisting of cancer, Inflammatory diseases, Neurodegenerative or neurological diseases, Metabolic conditions, Chronic liver disease and Inherited retinal dystrophies (IRDs).
  • the Chronic liver disease is nonalcoholic fatty liver disease.
  • said cancer is selected from the group consisting of, brain cancer, glioblastoma, lung cancer, colorectal cancer, skin cancer, pancreas cancer, bladder cancer, liver cancer, breast cancer, eye cancer and prostate cancer.
  • said cancer is a haematological cancer, such as selected from the group consisting of multiple myeloma, acute myeloblastic leukemia, chronic myelogenic leukemia, acute lymphoblastic leukemia and chronic lymphocytic leukemia.
  • the inventing team has identified a number of clinical relevant genes comprising pseudoexons, which can be incorporated in the mature mRNA, thereby inactivating/inhibiting/altering the function of the expressed (disease-causing) protein).
  • said SSO is complementary or substantially complementary to region within a nucleic acid selected from the group consisting of
  • nucleic acid according to any of any of SEQ ID NO's: 106 (RNF115), 1-26, 79-105, 107-125 and 137-201; or
  • nucleic acid comprising 1 or 2 or 3 substitutions when compared to any of any of SEQ ID NO's: 106, 1-26, 79-105, 107-125 and 137-201; or
  • nucleic acid sequence having at least 90% sequence identity to any of any of SEQ ID NO's: 106, 1-26, 79-105, 107-125 and 137-201.
  • said produced SSO is complementary or substantially complementary to region within a nucleic acid selected from the group consisting of a nucleic acid according to any of SEQ ID NO's: 79-100; or - a nucleic acid comprising 1 or 2 or 3 substitutions when compared to any of SEQ ID NO's: 79-100; or
  • nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NO's: 79-100.
  • said produced SSO is complementary or substantially complementary to region within a nucleic acid selected from the group consisting of
  • nucleic acid according to any of SEQ ID NO's: 79-85; or
  • nucleic acid comprising 1 or 2 or 3 substitutions when compared to any of SEQ ID NO's: 79-85; or
  • nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NO's: 79-85.
  • the skilled person could easily translate this information into specific SSO sequences, e.g. by using the sections underlined in the tables and designing SSOs complementary thereto.
  • the SSO is selected from the group consisting of:
  • nucleic acid according to any of SEQ ID NO's: 127-136; or
  • nucleic acid comprising 1 or 2 or 3 substitutions when compared to any of SEQ ID NO's: 127-136; or
  • the nucleic acid is SEQ ID NO: 127 or 128 or 133 or 136. As shown in examples 9 and 10, these SSOs have been optimized within the Sweet Spot region. Thus, by moving the binding region e.g. just 1 or 2 positions the efficiency can surprisingly be increased even further. More preferably, the nucleic acid is SEQ ID NO: 128 or 136.
  • the SSO is complementary or substantially complementary to region within a nucleic acid selected from the group consisting of o a nucleic acid according to any of SEQ ID NO: 21 (targeting SMAD2), SEQ ID NO: 106 (targeting RNF115) and any of SEQ ID No's: 141, 142, 158, and 159 (targeting LRRK2); o a nucleic acid comprising 1 or 2 or 3 substitutions when compared to any of SEQ ID NO's: 21, 106, 141, 142, 158, and 159; or o a nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NO's: 21, 106, 141, 142, 158, and 159.
  • Example 3 shows data on SMAD2 targeting (see also example 11).
  • Example 12 shows data in RNF115 targeting.
  • Example 13 shows data on LRRK2 targeting, including allele specific targeting.
  • the SSO is complementary or substantially complementary to region within a nucleic acid selected from the group consisting of o a nucleic acid according to any of SEQ ID NO: 100, 114, 118, 150 and 151; o a nucleic acid comprising 1 or 2 or 3 substitutions when compared to any of SEQ ID NO's: 100, 114, 118, 150 and 151; or o a nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NO's: 100, 114, 118, 150 and 151.
  • the SSO is complementary or substantially complementary to region within a nucleic acid selected from the group consisting of o a nucleic acid according to any of SEQ ID NO: 12, 24 og 26; o a nucleic acid comprising 1 or 2 or 3 substitutions when compared to any of SEQ ID NO's: 12, 24 og 26; or o a nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NO's: 12, 24 og 26.
  • the produced SSO is complementary or substantially complementary to a SEQ ID NO as outlined in Table 1, Table 3, Table 6 and Table 7 (Sweet Spot region).
  • the genes listed in Table 1 or Table 3 or Table 6-7 may be specifically preferred in relation to certain diseases, as outlined below.
  • Sweet Spots for the SSOs are outlined in Table 1 and Table 3 and Tables 6-7.
  • Table 2 shows pseudoexon sequences for which the criteria according to the invention is not fulfilled and which are not functional sites for SSOs.
  • genes could be relevant to target in relation to cancer treatment: TXNRD1, SLC7A11, STAT5B, MAPKAPK5, ZYG11A, ROCK1, MCCC2, SMYD2, DIAPH3, COPS3, SNX5, YBX1, CHD1L, PTPN11, UBAP2L, RNF115, HGS, TLK1, WWTR1, HMGCS1, SND1, THOC2, ORC1, TAF2, HIF1A, TRPM7, CPPS1, LRP6, MELK, TTBK2, TTK, ITGBL1, ROCK2, TASP1, FLT1, KNTC1, SMC1A, ZNF558, PMPCB and DBI.
  • the produced SSO is complementary or substantially complementary to a SEQ ID NO as outlined in Table 1 and Table 3 and Tables 6-7, wherein the gene is selected from the group consisting of TXNRD1, SLC7A11, STAT5B, MAPKAPK5, ZYG11A, ROCK1, MCCC2, SMYD2, DIAPH3, COPS3, SNX5, YBX1, CHD1L, PTPN11, UBAP2L, RNF115, HGS, TLK1, WWTR1, HMGCS1, SND1, THOC2, ORC1, TAF2, HIF1A, TRPM7, CPPS1, LRP6, MELK, TTBK2, TTK, ITGBL1, ROCK2, TASP1, FLT1, KNTC1, SMC1A, ZNF558, PMPCB and DBI; for use in the treatment of cancer.
  • the gene is RNF115 (see example 12).
  • genes could be relevant to target in relation to cancer treatment: ROCK1, E2F3, LRIG2, HSPG2, SLC2A1, KNTC1, DIAPH3, FDFT1, THOC2 and SMC1A, DDR2, STAG2, TRPM7, LINGO2, RAP1GDS, BUD1, CD44, CDKL5, RNF115, UBAP2L, ZNF558, RBPJ, EFEMP1, and FLT1.
  • the produced SSO is complementary or substantially complementary to a SEQ ID NO as outlined in Table 1 and Table 3 and Tables 6-7, wherein the gene is selected from the group consisting of ROCK1, E2F3, LRIG2, HSPG2, SLC2A1, KNTC1, DIAPH3, FDFT1, THOC2, DDR2, STAG2, TRPM7, LINGO2, SMC1A, RAP1GDS, BUD1, CD44, CDKL5, RNF115, UBAP2L, ZNF558, RBPJ, EFEMP1, and FLT1; for use in the treatment of cancer.
  • the gene is selected from the group consisting of ROCK1, E2F3, LRIG2, HSPG2, SLC2A1, KNTC1, DIAPH3, FDFT1, THOC2, DDR2, STAG2, TRPM7, LINGO2, SMC1A, RAP1GDS, BUD1, CD44, CDKL5, RNF115, UBAP2L, ZNF558, RBPJ, EFEMP1,
  • the produced SSO is complementary or substantially complementary to a SEQ ID NO as outlined in Table 1 and Table 3 and Tables 6-7, wherein the gene is selected from the group consisting of ROCK1, HTT, OGA, TMEM97, PICALM, LRRK2, UBAP2L, SMC1A and TTBK2; for use in the treatment of a neurological disease.
  • the gene is LRRK2 (see example 13).
  • the neurological disease is selected from the group consisting of Alzheimer's disease, Amyotrophic lateral sclerosis, Friedreich's ataxia, Huntington's disease, Lewy body disease, Parkinson's disease and Spinal muscular atrophy.
  • Neurodegeneration is the progressive loss of structure or function of neurons, including death of neurons.
  • Many neurodegenerative diseases including amyotrophic lateral sclerosis, Parkinson's disease, Alzheimer's disease, Huntington's disease, and prion diseases - occur as a result of neurodegenerative processes.
  • genes could be relevant to target in relation to Neurological diseases: ROCK1, E2F3, SLC2A13, ASIC1, TRPM7, LINGO2, LRIG2, LRRK2, UBAP2L, SMC1A, ATXN7, and CLCN1.
  • the produced SSO is complementary or substantially complementary to a SEQ ID NO as outlined in Table 1 and Table 3 and Tables 6-7, wherein the gene is selected from the group consisting of ROCK1, E2F3, SLC2A13, TRPM7, LINGO2, ASIC1, LRIG2, LRRK2, UBAP2L, SMC1A, ATXN7, and CLCN1; for use in the treatment of a neurological disease.
  • the neurological disease is selected from the group consisting of Alzheimer's disease, Amyotrophic lateral sclerosis, Friedreich's ataxia, Huntington's disease, Lewy body disease, Parkinson's disease and Spinal muscular atrophy.
  • TXNRD1 Diabetes
  • DYRK1A Diabetes
  • TRPM7 Diabetes
  • PHLPP1 Diabetes and obesity
  • the produced SSO is complementary or substantially complementary to a SEQ ID NO as outlined in Table 1 and Table 3 and Tables 6-7, wherein the gene is selected from the group consisting of TXNRD1, DYRK1A, TRPM7 and PHLPP1; for use in the treatment of a diabetes.
  • diabetes is selected from type 1 diabetes and type 2 diabetes.
  • the produced SSO is complementary or substantially complementary to a SEQ ID NO as outlined in Table 1, Table 3 and Tables 6-7, wherein the gene is selected from the group consisting of LINGO2, SMAD2, ORC1, DDR2, STAG2, TRPM7, HIF1A, HTT, TAF2, CSPP1, RN115, LRRK2, UBAB2L, LRP6, MELK, and KNTC1.
  • These 16 genes all comprise pseudoexons matching all criteria, all activated by SSO located within the Sweet Spot region (see Table 1 and Table 3 and Tables 6-7) and with high therapeutic potential.
  • the method is computer-implemented.
  • the invention can be implemented by means of hardware, software, firmware or any combination of these.
  • the invention or some of the features thereof can also be implemented as software running on one or more data processors and/or digital signal processors.
  • the individual elements of an embodiment of the invention may be physically, functionally and logically implemented in any suitable way such as in a single unit, in a plurality of units or as part of separate functional units.
  • the invention may be implemented in a single unit, or be both physically and functionally distributed between different units and processors.
  • the SSO may comprise one or more mismatches.
  • An advantage of introducing such mismatches is that allele-specific targeting is possible. This may be relevant when you only want to target one allele of a gene.
  • SSOs are listed in Table 4, 5 and 8 targeting the genes (pre-mRNA) of the listed genes.
  • the SSO is selected from the SSOs listed in Tables 4, 5 and 8.
  • SSOs identified by the method of the invention can be used as medicaments for the treatment of different diseases.
  • another aspect of the invention relates to a composition comprising a splice switching oligonucleotide (SSO) being complementary or substantially complementary to a target pre-mRNA (e.g. encoding a functional disorder-causing or disorder-influencing protein), said target pre-mRNA (2) comprising:
  • a function-disabling pseudoexon comprising: o at the 5'-end a 3' splice site; and o at the 3'-end a 5' splice site; wherein said SSO is complementary or substantially complementary to the target pre-mRNA at a region +9 to +39 downstream to the 5' splice site of said pseudoexon; wherein, when said SSO, in vivo, hybridizes to the pre-mRNA within the region +9 to +39 downstream to the 5' splice site of said pseudoexon; said pseudoexon becomes part of the mature mRNA to a greater extent compared to corresponding pre-mRNA not contacted with the SSO; for use as a medicament.
  • the SSOs modulate expression of a target protein by promoting incorporation of a pseudoexon into the mature mRNA.
  • the modulation induced by the SSOs may influence the target protein in different ways.
  • hybridization of the SSO to the pre-mRNA results in:
  • the composition is for use in the treatment of a human subject having a disease or condition characterized by increased expression or altered function of the disorder-causing or disorder-influencing functional protein, or where decreased expression of the functional gene product is therapeutically beneficial.
  • said SSO comprises a sequence which is complementary or substantially complementary to a polynucleotide in the pre-mRNA characterized by the parameters according to this invention.
  • said SSO comprising a sequence which is substantially complementary to the polynucleotide in the pre-mRNA, comprises at the most 3 mismatches, such as at the most 2 mismatches or such as at the most 1 mismatch.
  • said SSO comprises a sequence, which is complementary to a polynucleotide in the pre-mRNA according to the defined criteria.
  • the region +9 to +39 relative to the 5' splice site of said pseudoexon comprises a splicing regulatory site.
  • the splicing regulatory site is an Intronic Splicing Silencer (ISS) site.
  • said SSO has a length in the range 9-100 nucleotides, such as 9-50 nucleotides, preferably in the range 9-40 nucleotides and more preferably in the range 9-31 nucleotides or 9-25 nucleotides.
  • said SSO comprises a sequence which is complementary or substantially complementary to a polynucleotide in the pre-mRNA as defined above, wherein said sequence has a length in the range 9-31 nucleotides, such as 9-20 nucleotides, preferably the sequence is complementary at a range of 9-31 nucleotides, such as 9-20, or such as 20-31 nucleotides, such as 25-31 nucleotides.
  • said SSO comprises one or more artificial nucleotides, such as sugar-modified nucleotides.
  • the oligonucleotide does not mediate RNAse H mediated degradation of the mRNA.
  • At least one modified sugar moiety is a 2'-substituted sugar moiety.
  • said 2'-substituted sugar moiety has a 2'-substitution selected from the group consisting of 2'-O-Methyl (2'-OMe), 2'-fluoro (2'-F), and 2'-O- methoxyethyl (2'-MOE).
  • said 2'-substitution of said at least one 2'-substituted sugar moiety is a 2'-O-methoxyethyl (2'-MOE).
  • the at least one modified sugar moiety is a bicyclic sugar moiety.
  • the at least one bicyclic sugar moiety is a locked nucleic acid (LNA) or constrained ethyl (cEt) nucleoside.
  • LNA locked nucleic acid
  • cEt constrained ethyl
  • the at least one sugar moiety is a sugar surrogate.
  • said at least one sugar surrogate is a morpholino.
  • said at least one morpholino is a modified morpholino.
  • the SSO comprises at least one internucleoside N3' to P5' phosphoramidate diester linkage.
  • the modified oligonucleotide comprises at least one internucleoside phosphorothioate linkages.
  • all internucleoside linkages are phosphorothioate.
  • the tested SSOs were 25 nt long phosphorothioate RNA oligonucleotides with 2'-O-methyl modification on each sugar moiety.
  • the SSO is conjugated to delivery elements, such as selected from the group consisting of Gal-Nac, (poly-)unsaturated fatty acids (such as oleoyl and linolenoyl), anisamide, anandamide, folic acid (FolA), carbachol, estrone, Retro-1, phospholipids, o-tocopherol (o-TP), cholesterol, squalene (SQ), unbranched fatty acids (such as lauroyl, myristoyl, palmitoyl, stearoyl, and docosanoyl), and cell penetrating peptides.
  • delivery elements such as selected from the group consisting of Gal-Nac, (poly-)unsaturated fatty acids (such as oleoyl and linolenoyl), anisamide, anandamide, folic acid (FolA), carbachol, estrone, Retro-1, phospholipids, o-to
  • composition can be used in the treatment of specific diseases.
  • a disease selected from the group consisting of cancer, Inflammatory diseases, Neurodegenerative or neurological diseases, Metabolic conditions, Chronic liver disease and Inherited retinal dystrophies (IRDs).
  • the disease is cancer and the gene sequence is selected from the group consisting Of ROCK1, TXNRD1, SLC7A11, STAT5B, MAPKAPK5, ZYG11A, MCCC2, SMYD2, DIAPH3, COPS3, SNX5, YBX1, CHD1L, PTPN11, UBAP2L, RNF115, HGS, TLK1, WWTR1, HMGCS1, SND1, THOC2, E2F3, LRIG2, HSPG2, SLC2A1, KNTC1, FDFT1, SMC1A, HIF1A, CSPP1, TRPM7, DDR2, STAG2, ORC1, TAF2, LRP6, MELK, TTBK2, TTK, ITGBL1, ROCK2, TASP1, FLT1, ZNF558, PMPCB, DBI, RAP1GDS, BUD1, CD44, CDKL5, ZNF558, RBPJ, EFEMP1, and FLT1.
  • the disease is an inflammatory disease and the gene sequence is selected from the group consisting of DDR2 TRPM7, SMAD2, and LRP6; or the disease is a neurodegenerative or neurological disease and the gene sequence is selected from the group consisting of ROCK1, OGA, TMEM97, PICALM, E2F3, SLC2A13, ASIC1, TRPM7, LRIG2, LRRK2, UBAP2L, SMC1A, TTBK2, ATXN7, CLCN1; or
  • the disease is Chronic liver disease and the gene sequence is selected from the group consisting of SMAD2 and TRPM7, DDR2, HIF1A, and ROCK1, RAP1GDS1; or
  • the disease is Diabetes and the gene sequence is selected from the group consisting of TXNRD1, DYRK1A, TRPM7 and PHLPP1.
  • said composition for use comprises an SSO complementary or substantially complementary to region within a nucleic acid selected from the group consisting of o a nucleic acid according to any of any of SEQ ID NO's: 106, 1-26, 79-105, 107-125 and 137-201; or o a nucleic acid comprising 1 or 2 or 3 substitutions when compared to any of any of SEQ ID NO's: 106, 1-26, 79-105, 107-125 and 137- 201; or o a nucleic acid sequence having at least 90% sequence identity to any of any of SEQ ID NO's: 106, 1-26, 79-105, 107-125 and 137- 201;
  • said composition for use comprises an SSO complementary or substantially complementary to region within a nucleic acid selected from the group consisting of:
  • nucleic acid according to any of SEQ ID NO's: 79-100; or
  • nucleic acid comprising 1 or 2 or 3 substitutions when compared to any of SEQ ID NO's: 79-100; or
  • nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NO's: 79-100.
  • composition for use comprises an SSO complementary or substantially complementary to region within a nucleic acid selected from the group consisting of:
  • nucleic acid according to any of SEQ ID NO's: 79-85; or
  • nucleic acid comprising 1 or 2 or 3 substitutions when compared to any of SEQ ID NO's: 79-85; or
  • nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NO's: 79-85.
  • the SSO is selected from the group consisting of:
  • nucleic acid according to any of SEQ ID NO's: 127-136; or
  • nucleic acid comprising 1 or 2 or 3 substitutions when compared to any of SEQ ID NO's: 127-136; or
  • the SSO is complementary or substantially complementary to region within a nucleic acid selected from the group consisting of o a nucleic acid according to any of SEQ ID NO: 100, 114, 118, 150 and 151; o a nucleic acid comprising 1 or 2 or 3 substitutions when compared to any of SEQ ID NO's: 100, 114, 118, 150 and 151; or o a nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NO's: 100, 114, 118, 150 and 151.
  • the SSO is complementary or substantially complementary to region within a nucleic acid selected from the group consisting of o a nucleic acid according to any of SEQ ID NO: 12, 24 og 26; o a nucleic acid comprising 1 or 2 or 3 substitutions when compared to any of SEQ ID NO's: 12, 24 og 26; or o a nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NO's: 12, 24 og 26.
  • the SSO is SEQ ID NO: 128 or 136.
  • these SSOs have been optimized within the Sweet Spot region.
  • the efficiency can surprisingly be increased even further.
  • the invention relates to a composition for use as a medicament, said composition comprising
  • an SSO complementary or substantially complementary to region within a nucleic acid selected from the group consisting of o a nucleic acid according to any of SEQ ID NO's: 79, or 1-26 or SO- 125; or o a nucleic acid comprising 1 or 2 or 3 substitutions when compared to any of SEQ ID NO's: 79, or 1-26 or 80-125; or o a nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NO's: 79, or 1-26 or 80-125; or
  • an SSO selected from the group consisting of: o a nucleic acid according to any of SEQ ID NO's: 127-136; or o a nucleic acid comprising 1 or 2 or 3 substitutions when compared to any of SEQ ID NO's: 127-136; or o a nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NO's: 127-136.
  • the SSO is SEQ ID NO: 128 or 136.
  • these SSOs have been optimized within the Sweet Spot region. Thus, by moving the binding region e.g. just 1 or 2 positions the efficiency can surprisingly be increased even further.
  • the SSOs targeting TRPM7 and HIF1A have been optimized within the Sweet Spot region.
  • the SSO is complementary or substantially complementary to region within a nucleic acid to a SEQ ID NO as outlined in Table 1, Table 3, Table 6 and Table 7 (Sweet Spot region).
  • the SSO is complementary or substantially complementary to a SEQ ID NO as outlined in Table 1 and Table 3, wherein the gene is selected from the group consisting of TXNRD1, SLC7A11, STAT5B, MAPKAPK5, ZYG11A, ROCK1, MCCC2, SMYD2, DIAPH3, COPS3, SNX5, YBX1, CHD1L, PTPN11, UBAP2L, RNF115, HGS, TLK1, WWTR1, HMGCS1, SND1, HIF1A, CSPP1, TAF2, ORC1, THOC2, LRP6, MELK, TTBK2, TTK, ITGBL1, ROCK2, TASP1, FLT1, KNTC1, SMC1A, ZNF558, PMPCB and DBI; for use in the treatment of cancer.
  • the gene is selected from the group consisting of TXNRD1, SLC7A11, STAT5B, MAPKAPK5, ZYG11A, ROCK1, MCCC2, SMYD2, DIAPH
  • the SSO is complementary or substantially complementary to a SEQ ID NO as outlined in Table 1 and Table 3 and Table 6 and Table 7, wherein the gene is selected from the group consisting of ROCK1, E2F3, LRIG2, HSPG2, SLC2A1, KNTC1, DIAPH3, FDFT1, THOC2, SMC1A, DDR2, LINGO2, TRPM7, STAG2, RAP1GDS, BUD1, CD44, CDKL5, RNF115, UBAP2L, ZNF558, RBPJ, EFEMP1, FLT1; for use in the treatment of cancer.
  • the gene is selected from the group consisting of ROCK1, E2F3, LRIG2, HSPG2, SLC2A1, KNTC1, DIAPH3, FDFT1, THOC2, SMC1A, DDR2, LINGO2, TRPM7, STAG2, RAP1GDS, BUD1, CD44, CDKL5, RNF115, UBAP2L, ZNF558, RBPJ, EFEMP1, FLT
  • the SSO is complementary or substantially complementary to a SEQ ID NO as outlined in Table 1 and Table 3 and Table 6 and Table 7, wherein the gene is selected from the group consisting of ROCK1, OGA, TMEM97, PICALM, LRRK2, UBAP2L, SMC1A, and TTBK2; for use in the treatment of a neurological disease.
  • the neurological disease is selected from the group consisting of Alzheimer's disease, Amyotrophic lateral sclerosis, Friedreich's ataxia, Huntington's disease, Lewy body disease, Parkinson's disease and Spinal muscular atrophy.
  • Neurodegeneration is the progressive loss of structure or function of neurons, including death of neurons.
  • Many neurodegenerative diseases including amyotrophic lateral sclerosis, Parkinson's disease, Alzheimer's disease, Huntington's disease, and prion diseases - occur as a result of neurodegenerative processes.
  • the SSO is complementary or substantially complementary to a SEQ ID NO as outlined in Table 1 and Table 3 and Table 6 and Table 7, wherein the gene is selected from the group consisting of ROCK1, E2F3, SLC2A13, LINGO2, TRPM7, ASIC1, LRIG2, LRRK2, UBAP2L, SMC1A, ATXN7, and CLCN1; for use in the treatment of a neurological disease.
  • the neurological disease is selected from the group consisting of Alzheimer's disease, Amyotrophic lateral sclerosis, Friedreich's ataxia, Huntington's disease, Lewy body disease, Parkinson's disease and Spinal muscular atrophy.
  • the SSO is complementary or substantially complementary to a SEQ ID NO as outlined in Table 1 and Table 3 and Table 6 and Table 7, wherein the gene is selected from the group consisting of TXNRD1, DYRK1A, TRPM7 and PHLPP1; for use in the treatment of a diabetes.
  • diabetes is selected from type 1 diabetes and type 2 diabetes.
  • the SSO is complementary or substantially complementary to a SEQ ID NO as outlined in Table 1 and Table 3 and Table 6 and Table 7, wherein the gene is selected from the group consisting of LINGO2, SMAD2, ORC1, DDR2, STAG2, TRPM7, HIF1A, HTT, TAF2, CSPP1, RN115, LRRK2, UBAB2L, LRP6, MELK, and KNTC1.
  • These 16 genes all comprise pseudoexons matching all criteria, all activated by SSO located within the Sweet Spot region (see Table 1 and Table 3 and Table 6 and Table 7) and with high therapeutic potential.
  • the invention relates to a
  • composition comprising an SSO complementary or substantially complementary to region within a nucleic acid selected from the group consisting of o a nucleic acid according to any of SEQ ID NO's: 106, 1-26, 79-105, 107-125 and 137-201; or o a nucleic acid comprising 1 or 2 or 3 substitutions when compared to any of SEQ ID NO's: 106, 1-26, 79-105, 107-125 and 137-201; or o a nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NO's: 106, 1-26, 79-105, 107-125 and 137-201; or
  • composition comprising an SSO selected from the group consisting of:
  • nucleic acid according to any of SEQ ID NO's: 127-136 and SEQ ID NO's: 202-216; or
  • nucleic acid comprising 1 or 2 or 3 substitutions when compared to any of SEQ ID NO's: 127-136 and SEQ ID NO's: 202-216; or
  • nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NO's: 127-136 and SEQ ID NO's: 202-216.
  • the SSO is selected from the group of SSOs listed in table 4 (see example 9), Table 5 (see example 10) and Table 8 (see example 11).
  • Such compositions may be used as medicaments as outlined above, e.g. for the treatment of the list of diseases outlined above.
  • the invention in another aspect relates to a composition
  • a composition comprising a splice switching oligonucleotide (SSO) said composition comprising
  • an SSO selected from the group consisting of: o a nucleic acid according to any of SEQ ID NO's: 295-367; or o a nucleic acid comprising 1 or 2 or 3 substitutions when compared to any of SEQ ID NO's: 295-367; or o a nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NO's: 295-367;
  • the inventing team has identified SNPs inside a Sweet Spot region in the LRRK2 pre-mRNA (see also example 13).
  • SEQ ID NO's: 141 and 142 will target one SNP specific allele, whereas SEQ ID NO's: 158 and 159 will target another SNP specific allele.
  • composition according to the invention is administered to a subject who is heterozygous in the pre-mRNA region targeted by the SSO, resulting in the SSO having an increased binding affinity to pre-mRNA of one of the alleles, such as to provide an increased splice switching activity in said allele.
  • the pre-mRNA encodes for LRRK2.
  • the pre-mRNA encodes for LRRK2 and the subject is heterozygous at the rsl7444202 position.
  • the pre-mRNA encodes for LRRK2 and the subject is heterozygous for a disease causing mutation in LRRK2.
  • the SSO is complementary or substantially complementary to a region within a nucleic acid selected from the group consisting of o a nucleic acid according to any of SEQ ID NO's: 141, 142, 158 and 159; or o a nucleic acid comprising 1 or 2 or 3 substitutions when compared to any of SEQ ID NO's: 141, 142, 158 and 159; or o a nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NO's: 141, 142, 158 and 159; or
  • the SSO is selected from the group consisting of: o a nucleic acid according to any of SEQ ID NO's: 208-216; or o a nucleic acid comprising 1 or 2 or 3 substitutions when compared to any of SEQ ID NO's: 208-216; or o a nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NO's: 208-216;
  • the SSO promotes inclusion of a pseudo-exon to a greater extent of disease-causing allele compared to the other allele. Again, this allows for the presence of the normal mRNA to a higher extent.
  • the SSO has an increased binding affinity to pre-mRNA of a disease-causing allele.
  • Yet an aspect of the invention relates to a method for identifying a subject who is likely eligible for allele-specific targeting of a dysfunctional LRRK2 allele, the method comprising
  • the subject may also be homozygous for the SNP, thus comprising the SNP on both alleles, which can promote pseudoexon inclusion. This may not be preferred, but it can be a better option if the alternative is no treatment.
  • Allelic status may be determined by Sanger or Next Generation (NGS) sequencing or by mutation specific assay, like ARMS or Taq-man.
  • NGS Next Generation
  • an aspect of the invention relates to a composition comprising a splice switching oligonucleotide (SSO) for use as a medicament, said composition comprising
  • an SSO selected from the group consisting of: o a nucleic acid according to any of SEQ ID NO's: 295-367; or o a nucleic acid comprising 1 or 2 or 3 substitutions when compared to any of SEQ ID NO's: 295-367; or o a nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NO's: 295-367; wherein said SSO being complementary or substantially complementary to a target pre-mRNA, said target pre-mRNA comprising:
  • a function-disabling pseudoexon comprising : o at the 5'-end a 3' splice site; and o at the 3'-end a 5' splice site; wherein said SSO is complementary or substantially complementary to the target pre-RNA at a region +9 to +39 downstream to the 5' splice site of said pseudoexon.
  • the SSO is complementary or substantially complementary to a region within a nucleic acid selected from the group consisting of o a nucleic acid according to any of SEQ ID NO: 217; o a nucleic acid comprising 1 or 2 or 3 substitutions when compared to any of SEQ ID NO's: 217; or o a nucleic acid sequence having at least 90% sequence identity to any of SEQ ID NO's: 217.
  • Example 15 shows that when a specific SNP is present, an SSO targeting SEQ ID NO: 217 is able to direct inclusion of the pseudoexon into the mature mRNA.
  • the composition is for use in the treatment of a human subject having a disease or condition characterized by increased expression or altered function of the disorder-causing or disorder-influencing functional protein, or where decreased expression of the functional gene product is therapeutically beneficial.
  • said SSO comprises a sequence, which is substantially complementary to the polynucleotide in the pre-mRNA, comprises at the most 3 mismatches, such as at the most 2 mismatches or such as at the most 1 mismatch.
  • said SSO has a length in the range 9-100 nucleotides, such as 9-50 nucleotides, preferably in the range 9-40 nucleotides and more preferably in the range 9-31 nucleotides or 9-25 nucleotides.
  • said SSO comprises a sequence which is complementary or substantially complementary to a polynucleotide in the pre-mRNA as defined above, wherein said sequence has a length in the range 9-31 nucleotides, such as 9-20 nucleotides, preferably the sequence is complementary at a range of 9-31 nucleotides, such as 9-20, or such as 20-31 nucleotides, such as 25-31 nucleotides.
  • said SSO comprises one or more artificial nucleotides, such as sugar-modified nucleotides.
  • the oligonucleotide does not mediate RNAse H mediated degradation of the mRNA.
  • at least one modified sugar moiety is a 2'-substituted sugar moiety.
  • said 2'-substituted sugar moiety has a 2'-substitution selected from the group consisting of 2'-O-Methyl (2'-OMe), 2'-fluoro (2'-F), and 2'-O- methoxyethyl (2'-MOE).
  • the composition is for use in the treatment or alleviation of a disease selected from the group consisting of cancer, inflammatory diseases, Neurodegenerative or neurological diseases, Metabolic conditions, Chronic liver disease and Inherited retinal dystrophies (IRDs).
  • a disease selected from the group consisting of cancer, inflammatory diseases, Neurodegenerative or neurological diseases, Metabolic conditions, Chronic liver disease and Inherited retinal dystrophies (IRDs).
  • the presence of the SNP allows for the SSO to promote inclusion of a function-disabling pseudoexon to a greater extent in a diseasecausing allele compared to the other allele.
  • the composition is administered to a subject who is heterozygous for a sequence variation (SNP) in the pre-mRNA targeted by the SSO, whereby the SSO promotes inclusion of a function-disabling pseudoexon to a greater extent in a diseasecausing allele compared to the other allele.
  • SNP sequence variation
  • the subject may also be homozygous. In such as case both the "healthy gene” and the diseased gene will be subject to pseudoexon inclusion.
  • the subject may of course also harbour two diseased genes (one on each allele).
  • the composition is administered to a subject who is homozygous for the SNP variation (SNP) in the pre-mRNA targeted by the SSO.
  • SNP SNP variation
  • the subject is heterozygous for a sequence variation (SNP) in the 5' splice site and/or the 3' splice site, preferably the 5' splice site of the function-disabling pseudoexon.
  • SNP sequence variation
  • the SNP is a point mutation, an insertion, such as of 1-20 nucleotides at the SNP position or a deletion, such as of 1-20 nucleotides at the SNP position.
  • the insertion is 1-10 nucleotides, such as 1-5 nucleotides such as 2-4 nucleotides or 2-3 nucleotides.
  • the deletion is 1- 10 nucleotides, such as 1-5 nucleotides such as 2-4 nucleotides or 2-3 nucleotides.
  • the SNP is located in the (23-mer) 3' splice site (-20 to +3 nt of the intron-exon border) or in the (9-mer) 5' splice site (-3 to +6 nt of the exon-intron border).
  • the heterozygosity in the disease-causing gene increases inclusion of the pseudoexon into the mature mRNA to a larger extent from one allele than in the corresponding (normally functioning) gene on the other allele, when brought in contact with the SSO.
  • the heterozygosity in the disease-causing gene increases the MaxEnt score of a splice site of a pseudoexon in the disease-causing gene compared to the corresponding (normally functioning) gene on the other allele.
  • the MaxEnt score is a defined number, calculated by a specific algorithm.
  • the heterozygosity in the disease-causing gene results in a higher MaxEnt score of a splice site of a pseudoexon in the disease-causing gene compared to the corresponding (normally functioning) gene on the other allele.
  • a splice site of the pseudoexon in the disease-causing gene allele has a higher MaxEnt score compared to the corresponding splice site of the (normally functioning) gene on the other allele.
  • the subject harbours a SNP in the disease-causing allele selected from the group of SNP IDs according to Table 9.
  • the SNP may also be present on both alleles.
  • the subject harbours a SNP on both alleles selected from the group of SNP IDs according to Table 9.
  • the subject harbours a SNP in the disease-causing allele selected from the group of SNPs according to Table 9 and the SSO targets a corresponding Sweet Spot Seq according to Table 9.
  • the corresponding SSO is selected from Table 10.
  • the pre-mRNA encodes for LRRK2. See also example 15 and 16.
  • the pre-mRNA encodes for LRRK2 and the subject harbors the high MaxEnt score "G allele" of SNP rsl0878372 in the disease causing LRRK2 allele.
  • the pre-mRNA encodes for LRRK2 and the subject is heterozygous for a disease causing mutation in LRRK2.
  • the targeted pseudoexon may be positioned in a gene, which is located on the X or the Y chromosome, in which case a male subject cannot be considered to be either heterozygous or homozygous, since they will only contain a single X and Y chromosome.
  • a male subject cannot be considered to be either heterozygous or homozygous, since they will only contain a single X and Y chromosome.
  • such subjects may also be treated according to the invention.
  • the invention also relates to a composition comprising an SSO according to the invention, such as a pharmaceutical composition.
  • an aspect of the invention relates to a method for identifying a subject who is likely eligible for allele-specific SSO-based pseudoexon inclusion treatment of a dysfunctional or disease-causing gene, the method comprising determining in a biological sample from said subject the presence of absence of heterozygosity in a pseudoexon of the dysfunctional or diseasecausing gene; wherein if the subject is heterozygous for a sequence variation (SNP) in the 5' splice site and/or the 3' splice site, preferably the 5' splice site of the functiondisabling pseudoexon, said subject is likely eligible for allele-specific SSO-based pseudoexon inclusion treatment; or wherein if the subject is not heterozygous for a sequence variation (SNP) in the 5' splice site and/or the 3' splice site of the function-disabling pseudoexon, said subject is
  • said allele-specific SSO-based pseudoexon inclusion treatment results in said SSO, in vivo, hybridizes to the pre-mRNA, and said pseudoexon of the dysfunctional or disease-causing gene becomes part of the mature mRNA to a greater extent compared to a corresponding pre-mRNA not contacted with the SSO.
  • said allele-specific SSO-based pseudoexon inclusion treatment results in said SSO, in vivo, hybridizes to the pre-mRNA, and said pseudoexon becomes part of the mature mRNA to a greater extent in the allele harbouring the dysfunctional or disease-causing gene compared to corresponding pre-mRNA not contacted with the SSO.
  • the heterozygosity for a sequence variation (SNP) in the 5' splice site and/or the 3' splice site of the pseudoexon in the pre-mRNA targeted by the SSO will promote inclusion of the function-disabling pseudoexon to a greater extent of the disease-causing allele compared to the other allele, when/if brought in contact with the SSO.
  • SNP sequence variation
  • the heterozygosity for a sequence variation is in the 5' splice site and/or the 3' splice site, preferably the 5' splice site of the functiondisabling pseudoexon.
  • the heterozygosity for a sequence variation (SNP) in the disease-causing gene is a point mutation (SNP), an insertion of 1-20 nucleotides, or a deletion of 1-20 nucleotides, preferably a point mutation.
  • the disease-causing gene increases inclusion of the pseudoexon to a larger extent than in the corresponding (normally functioning) gene on the other allele, when/if brought in contact with the SSO.
  • the heterozygosity for a sequence variation (SNP) in the disease-causing gene increases the MaxEnt score of the splice site compared to the corresponding splice site in the (normally functioning) gene on the other allele.
  • SNP sequence variation
  • the heterozygosity for a sequence variation (SNP) in the disease-causing gene results in a higher MaxEnt score of the splice site compared to the corresponding splice site in the (normally functioning) gene on the other allele.
  • SNP sequence variation
  • the heterozygosity for a sequence variation (SNP) in the disease-causing gene is in a splice site of the pseudoexon in the disease-causing gene, resulting in a higher MaxEnt score compared to the corresponding splice site of the (normally functioning) gene on the other allele.
  • allelespecific SSO-based pseudoexon inclusion treatment includes treatment using an SSO which, in vivo, hybridizes to the pre-mRNA of the allele harbouring the disease-causing allele to a greater extent compared to the allele not harbouring the disease-causing allele.
  • said SSO is complementary or substantially complementary to the target pre-RNA at a region +9 to +39 downstream to the 5' splice site of said pseudoexon.
  • said target sequence for the SSO is positioned in a gene selected from the group consisting of LRRK2, LMN1B and ATXN2.
  • the subject harbours a SNP in a disease-causing allele selected from the group of SNP IDs according to Table 9.
  • the subject harbours a SNP in both alleles selected from the group of SNP IDs according to Table 9.
  • the allelic status is determined by a method selected from the group consisting of such as Sanger sequencing, Next Generation sequencing (NGS) and by mutation specific assays, such as ARMS and Taq-man.
  • NGS Next Generation sequencing
  • ARMS ARMS and Taq-man.
  • the skilled person may find other methods suitable for determining the allelic status.
  • a subject may be homozygous or heterozygous for a SNP (or the SNP may be X or Y chromosome associated).
  • a method for identifying a subject who is likely eligible for SSO-based pseudoexon inclusion treatment of a dysfunctional or disease-causing gene comprising
  • the subject is either heterozygous for the SNP or homozygous for the SNP, or the SNP being X or Y chromosome associated, preferably heterozygous.
  • the invention relates to a computer program product being adapted to enable a computer system comprising at least one computer having data storage means in connection therewith to control a method according to the one or more aspects of the invention, such as a computer program product comprising instructions which, when the program is executed by a computer, cause the computer to carry out [the steps of] the method of the invention.
  • This aspect of the invention is particularly, but not exclusively, advantageous in that the present invention may be accomplished by a computer program product enabling a computer system to carry out the operations of the apparatus/ system of the aspects of the invention when down- or uploaded into the computer system.
  • a computer program product may be provided on any kind of computer readable medium, or through a network.
  • the individual aspects of the present invention may each be combined with any of the other aspects and embodiments.
  • FIG. 1 Figure 1 and the corresponding figure legend outlines the basic principle behind the invention.
  • Pseudoexons are intronic sequences flanked by a 3' and a 5' splice site. Pseudoexons are usually not recognized due to the normally low amounts of inclusion into the mRNA transcript and because the pseudoexon containing mRNA is often degraded by the nonsense mediated decay of mRNA (NMD) system.
  • NMD nonsense mediated decay of mRNA
  • the Sweet Spot region is defined as the region +9 to +39 nucleotides downstream of the 5' splice site of a pseudoexon that obeys the criteria described (see e.g. example 2) in this application.
  • Pseudoexon inclusion into the mRNA transcript can be activated and increased by employing SSOs complementary to the Sweet Spot region of pseudoexons fulfilling the criteria. Pseudoexon inclusion into the mRNA will modulate gene expression either at the mRNA level or protein level, by mislocalization, destabilization and degradation or alteration of protein function. 5'ss; 5' splice site, 3'ss; 3' splice site, SSO; splice shifting oligonucleotide.
  • Figure 2 demonstrates how RNA-sequencing data can be used in detection of in vivo spliced double junctions for empirical detection of pseudoexons, which are included into the endogenous transcript at low levels.
  • reads are filtered to retain only fragments containing at least two splicing junctions.
  • the splicing junctions of the entire fragment are then assembled into an exon structure, allowing for an unmapped gap between reads in the fragment of up to 100 bp.
  • Exons are then classified using known exon annotations to identify pseudoexons contained within introns.
  • Pseudoexons that may be candidates for activation by SSOs binding to the Sweet Spot region can be identified by the criteria according to the present invention, after which highly therapeutically relevant pseudoexons can be identified in genes where a downregulation of expression or alteration of the functional gene product is medically relevant. Subsequently, SSO can be produced using standard synthesis.
  • SSOs Splice-switching antisense oligonucleotides
  • pseudoexons that can be activated, so that they are spliced into the mRNA by employing SSOs that bind in the +9 to +39 region (coined the Sweet Spot region) downstream of the pseudoexon donor site (5'-splice site), and to establish the criteria delineating these pseudoexons from non-activated pseudoexons.
  • RNA-sequencing data (Geuvadis, E-MTAB-2836, E-MTAB-513, GSE52946, and GSE124439) and mapped them with STAR after trimming for adapter contamination and poorquality bases with bbduk.
  • HeLa cells were seeded in 12-well plates and forward transfected at 60% confluence with 20 or 40 nM 2'- O-methyl SSOs with full phosphorothioate backbone using Lipofectamine RNAiMAX (invitrogen).
  • a non-binding Ctrl SSO (5'GCUCAAUAUGCUACUGCCAUGCUUG3') (SEQ ID NO: 126) was used as control.
  • Complementary DNA cDNA was synthesized from 500 ng RNA using the High capacity cDNA kit (Applied Biosystems). Primers were designed to span at least one exon-exon junction of the neighboring exons flanking the pseudoexons of interest. PCR was carried out using TEMPase Hot Start DNA polymerase (ampliqon) and 1 pl cDNA per reaction. 0.5 pmol/pl of each primer was used. The PCR products were separated on a 2% Seakem LE (Lonza) TBE agarose gel, for 1 hour at 80V.
  • the Sweet Spot region is located +9 to +39 of the 5' splice site of the pseudoexon.
  • All SSOs were 25 nt long phosphorothioate RNA oligonucleotides with 2'-O-methyl modification on each sugar moiety (Produced by LGC Biosearch Technologies). SSOs were used targeting position +11 to +35 inside the Sweet Spot region for that gene (relative to the 5' splice site of the pseudoexon). Thus, the SSOs binds inside the Sweet Spot.
  • RNA- sequencing data representing many different cell types. After mapping to the human genome, we filtered all reads for fragments containing at least two splicing junctions. We then mapped the splicing junctions of the entire fragment, allowing for an unmapped gap between reads in the fragment of up to 100 bp. From this we compiled a non-degenerate list of fully spliced exons from which we extracted the unknown exons contained within introns. Using this double-junction approach, we were able to identify fully spliced pseudoexons even when expressed at very low levels.
  • Underlining indicates tested or preferred binding sequence of the SSO. Binding is to the corresponding pre-m RNA. hg38 Genome coordinates follow BED format; zerobased start co-ordinate and one-based end coordinate. Table 2: 52 pseudoexons not matching all criteria, and not activated by SSO located within the Sweet Spot region.
  • Underlining indicates tested or preferred binding sequence of the SSO. Binding is to the corresponding pre-mRNA. hg38 Genome coordinates follow GFF/GTF format; one-based start and end coordinates.
  • Donor splice site has a MaxEnt score ⁇ 10.06;
  • Chronic liver disease is characterized by inflammation and fibrosis of the liver.
  • TGF-p/Smad signaling pathway which is important for tissue fibrosis.
  • the SSO is complementary to position +11 to +35 inside the Sweet Spot region for the SMAD2 gene (relative to the 5' splice site of the pseudoexon) (SEQ ID NO: 21). Thus, the SSOs binds inside the Sweet Spot.
  • SSOs employing 25 nt long SSOs targeting the Sweet Spot region from +9 to +14 position downstream of the 5'ss of the PE (SEQ ID NO: 202-207 listed in table 8 in example 11).
  • a non-binding SSO (5'-GCUCAAUAUGCUACUGCCAUGCUUG-3') (SEQ ID NO: 126) with similar modifications was used as a negative control.
  • the cells were stimulated with 10 ng/ml TGF[3 (R&D systems) for 16 hours before RNA and protein harvest.
  • RNA was harvested after 48 hours using Trizol (Invitrogen) and chloroform to isolate the RNA, followed by precipitation with isopropanol.
  • Complementary DNA (cDNA) was synthesized from 500 ng RNA using the High capacity cDNA kit (Applied Biosystems). Primers were designed to span at least one exon-exon junction of the neighboring exons flanking the pseudoexons of interest.
  • PCR was carried out using TEMPase Hot Start DNA polymerase (ampliqon) and 1 pl cDNA per reaction. 0.5 pmol/pl of each primer was used.
  • the PCR products were separated on a 2% Seakem LE (Lonza) TBE agarose gel, for 1 hour at 80V. Proteins were extracted by lysing the cells with okaidic acid to preserve phosphorylated proteins, benzonase treated, and the denatured proteins were separated on a 4-12% NuPage SDS-Page gel and analyzed by western blotting using antibodies against SMAD2, phosphoSMAD2 and actin for control.
  • LX-2 cells were grown in 96 well plates transfected with 20 nM SSO and incubated in the Incucyte instrument with images takes every 4 hours. The images were analyzed in Image! by making a mask for spherical (differentiated) cells.
  • the normal function of the SMAD2 gene may be decreased by up to 90% using a specific SSO to increase inclusion of a pseudoexon thereby disrupting the function of the normal gene product, either through degradation of the transcript or expression of a truncated and non-functional protein. This has relevance in hepatic fibrosis and other disorders associated with increased TGF-g activity, of which SMAD2 is a positive regulator (Sysa et al, 2009). Additionally, SMAD2 downregulation may reduce growth of gliomas (Papachristodoulou et al, 2019)
  • ORC recognition complex
  • SSO targeting SEQ ID NO: 18; specific target sequence is underlined in SEQ ID NO: 18 in table 1 was 25 nt long phosphorothioate RNA oligonucleotides with 2'- O-methyl modification on each sugar moiety (Produced by LGC Biosearch Technologies). (See also table from example 2).
  • the SSO is complementary to position +11 to +35 inside the Sweet Spot region for the ORC1 gene (relative to the 5' splice site of the pseudoexon). Thus, the SSOs binds inside the Sweet Spot.
  • the normal expression of the ORC1 gene product may be decreased by up to 45% using a specific SSO to increase inclusion of a pseudoexon disrupting function of the normal gene product.
  • SSO-mediated down-regulation of ORC1 expression might therefore work in enhancing the anti-cancer effect of other drugs.
  • LINGO2 (Leucine -rich repeat and immunoglobulin-like domain-containing nogo receptor-interacting protein 2) is highly expressed in many tissues including intestinal tissues, brain and neurons (such as cortical neurons and dorsal root ganglion (DRG) neurons) (Guillemain et al. 2020). LINGO2 expression is increased in gastric cancer and this is associated with a poor prognosis and down regulation of LINGO2 decreases proliferation of gastric cancer cells (Jo et al. 2019). LINGO2 also negatively regulates motor neuron survival and motor neuron axonal length. This suggests that knock down or alteration of LINGO2 expression could be a new therapy against neuronal disorders and cancer.
  • RNA-seq data was used the analysis pipeline (figure 2) to analyze publicly available RNA-seq data.
  • HeLa cells were grown in RPMI and transfected with 20 nM SSO using Lipofectamine. After 24 hours, cells were harvested and RNA purified. RT-PCR was performed and the resulting product visualized on 2% agarose gel.
  • U251 cells were grown in 96-well plates transfected with SSOs at 5, 10, 20 or 40 nM and incubated in the incucyte instrument with images taken every 4 th hour.
  • the TAF2 gene expresses the Tata-box binding protein associated factor 2, a subunit of the transcription factor II D complex involved in binding to promotor sequences to initiate transcription (Martinez et al. 1998). TAF2 exhibits copy number increases or mRNA overexpression in 73% of high-grade serous ovarian cancers (HGSC) (Ribeiro et al. 2014) and is important in cancer.
  • HGSC high-grade serous ovarian cancers
  • NCI-H358 lung cancer cells cells were grown in RPMI and transfected with 20 nM SSO using Lipofectamine. After 24 hours, cells were harvested and RNA purified. RT-PCR was performed and the resulting product visualized on 2% agarose gel. WST-1 assay of was performed 48 hours post transfection.
  • NCI-H358 lung cancer cells were grown in 96-well plates transfected with SSOs at 10 nM and incubated in the incucyte instrument with images taken every 4 th hour.
  • TAF2 pseudoexon will introduce 73 bp between exon 17 and 18 in the mRNA, resulting in a shifted reading frame with a premature stop codon in exon 18.
  • TAF2 mRNA transcripts with inclusion of this pseudoexon are targets for nonsense-mediated mRNA decay (NMD), and increased pseudoexon inclusion induced by SSO treatment will therefore result in a reduction of expression of TAF2 mRNA.
  • NMD nonsense-mediated mRNA decay
  • SSO treatment will therefore result in a reduction of expression of TAF2 mRNA.
  • the pseudoexon included transcript will result in production of a severely truncated protein without normal TAF2 function.
  • HTT encodes the huntingtin protein and is associated with the autosomal dominant neurodegenerative disorder, Huntington's disease, which is caused by unstable expansion of CAG trinucleotide repeats in the HTT gene that results in translation of a cytotoxic mutant protein with an abnormal polyglutamine tract.
  • Downregulation of HT has been studied as a potential strategy in treatment of Huntington's disease by reducing levels of mutant huntingtin.
  • Inclusion of the chr4: 3102605-3102748(+) HHT pseudoexon will introduce 143 bp between exon 3 and 4 in the mRNA, including an in-frame premature termination codon.
  • HTT mRNA transcripts with inclusion of this pseudoexon is a target for nonsense-mediated decay (NMD), and increased pseudoexon inclusion induced by SSO treatment will result in a reduction of expression of HTT mRNA.
  • NMD nonsense-mediated decay
  • Huntington disease is an autosomal dominant disease caused by a dominant negative tri-nucleotide repeat expansion in HTT mRNA. Inclusion of the PE will reduce levels of the dominant negative mRNA and may therefore be used as treatment.
  • Example 8 Further relevant targets The following additional Sweet Spot sequences were identified using the criteria according to the invention (see e.g. example 2). Thus, these targets will with very high plausibility be functional targets for SSOs, allowing for incorporation of the pseudoexon in the mature mRNA.
  • Table 3 Relevant target genes Underlinings indicate tested or preferred binding sequence of the SSO. Binding is to the corresponding pre-mRNA. hg38 Genome coordinates follow GFF/GTF format; one-based start and end coordinates.
  • ROCK1 encodes a Rho associated serine/threonine kinase.
  • the signaling pathway of ROCK1 has been associated with the pathogenesis of metabolic diseases and several neurodegenerative disorders, like Huntington's disease, Parkinson's disease, and Alzheimer's disease, and is a promising target for treatment of neurodegenerative disorders by suppression of its function Koch et al. 2018).
  • Inhibition of ROCK1 is a potent target for treatment of chronic ophthalmological diseases (Moshifar et al. 2018).
  • Hepatic ROCK1 is a suggested target for treatment of nonalcoholic fatty liver disease and hepatocellular carcinoma (Huang et al. 2018; Wu et al 2021).
  • Sweet Spots for ROCK1 SSO targeting are shown in Table 3 and Table 6.
  • O-GIcNAc glycosylation of proteins is an important post-translational regulatory modification.
  • the process is dynamic, and the protein O-GIcNAcase, encoded by the gene OGA, is responsible for removing the group again.
  • Inhibitors of OGA block cognitive decline and reduce number of amyloid plaques in animal models of Alzheimer's Disease (AD) (Yuzwa, Shan et al. 2014) and reduce amount of pathological Tau in the brain (Graham, Gray et al. 2014, Hastings, Wang et al. 2017). Furthermore, inhibition of OGA reduces cellular internalization of o-synuclein preformed fibrils and could be a strategy for Parkinson's Disease (PD) therapy (Tavassoly, Yue et al. 2021).
  • AD Alzheimer's Disease
  • PD Parkinson's Disease
  • Insertion of the chrlO: 101795374-101795480(-) and chrlO: 101795365- 101795480(-) pseudoexon located in OGA intron 10 introduces a premature stop codon targeting the resulting transcript for degradation by the NMD pathway.
  • SSO-mediated downregulation of OGA could be a promising approach for several neuropathies, including AD and PD.
  • Sweet Spots for OGA SSO targeting are shown in Table 3 and Table 6.
  • Transmembrane Protein 97 also known as Sigma-2 receptor, plays an important role in cholesterol homeostasis.
  • TMEM97 has been shown to be overexpressed in several cancers, and suppression of its expression inhibits glioma cancer cell growth and metastasis (Qiu, Sun et al. 2015).
  • TMEM97 is also involved in the pathology of neurodegenerative diseases such as Alzheimer's Disease and its inhibition may be a potential therapy (Riad, Lengyel-Zhand et al. 2020). Inhibition of TMEM97 has also been proposed as a potential therapy for Niemann-Pick type C disease (Ebrahimi-Fakhari, Wahlster et al. 2016).
  • Sweet Spot for TMEM97 SSO targeting are shown in Table 3 and Table 6.
  • Thioredoxin Reductase 1 is encoded by TXNRD1 and is associated with unfavorable prognosis in patients with hepatocellular carcinoma (HCC) (Fu et al. 2017). In HCC tissues and cells, TXNRD1 is overexpressed and correlates positively with increasing clinical stage and shorter survival time (Fu et al. 2107). It has also been found to be mutated in several cancers, including HCC Jia et al. 2020). It is therefore a promising therapeutic target for target down-regulation.
  • HCC hepatocellular carcinoma
  • Transcripts including the 158nt long pseudoexon located within intron 4 of the reference transcript are subject to degradation via the NMD system due to the introduction of a frame-shift and a resulting pre-mature termination codon. It may also lead to the production of a severely truncated protein lacking the active-site amino acids necessary for reductase activity. Both scenarios result in a complete loss of function of the gene product when the transcript includes the pseudoexon.
  • Sweet Spot for TXNRD1 targeting are shown in Table 3 and Table 6.
  • the solute-carrier SLC7A11 is a member of the cystine/glutamate transporter system Xc- and encodes xCT, which is overexpressed in many cancers, and is a marker of poor prognosis (reviewed in Lin et al. 2020). In glioblastoma this leads to increased glutamate secretion and neuronal death (Savaskan et al. 2008). Inhibition of xCT reduces neuronal death and edema, and prolongs survival in rats with gliomas (Savaskan et al. 2008). SLC7A11 upregulation also has an important cytoprotective effect in KRAS mutant cells by increasing intracellular antioxidant glutathione levels (Lim et al.
  • SLC7A11 is a candidate therapeutic target for both RAS- driven tumors that are typically highly therapy-resistant, and many other cancers including gliomas. While several xCT inhibitors exist, they are less specific than an SSO mediated downregulation of SLC7A11, and may lead to significantly more side effects when used in a clinical setting compared to an SSO based therapy.
  • Sweet Spot for SLC7A11 SSO targeting are shown in Table 3 and Table 6.
  • treatment with the SSO to knock down SLC7A11 is a promising therapy for several cancers, offering higher specificity than current protein inhibitors with fewer side effects.
  • Hypoxia inducible factor is a transcription factor that is activated when there is a decrease in oxygen levels, or as a response to other environmental changes.
  • HIF-lo contributes to tumor progression in cancer by promoting signalling for angiogenesis - the formation of new blood vessels forming from already exciting ones, invasiveness of the cells, metastasis and recruitment of immunosuppressive cells to the tumor environment (Tatrai et al 2014).
  • Previous studies have shown that knock down of HIF-lo was able to reduce tumor mass and migration of cancer cells, and activation of the oncogene is highly correlated with the risk of metastases, making HIF-lo a possible target for anti-cancer therapy (Dai et al. 2011).
  • All SSO were 25 nt long phosphorothioate RNA oligonucleotides with 2'-O-methyl modification on each sugar moiety (Produeced by LGC Biosearch Technologies). SSOs were used targeting position different positions inside the Sweet Spot region for that gene (relative to the 5' splice site of the pseudoexon). Thus, the SSOs binds inside the Sweet Spot.
  • TRPM7 belongs to the protein super family Transient Receptor Potential (TRP), which conducts the traffic of different ions across membranes.
  • TRP proteins work as sensors and transducers which, when activated, leads to a transmembrane flow of ions that regulate associated pathways and various physiological responses (Liu et al 2014).
  • TRPM7 can be cleaved by caspase, splitting the kinase domain from the pore in the membrane. Studies have shown that TRPM7 is highly expressed in brain tissue and deregulation of this channel is involved in neurodegenerative diseases such as amyotrophic lateral sclerosis (ALS), parkinsonism dementia and Alzheimer's disease.
  • ALS amyotrophic lateral sclerosis
  • ALS amyotrophic lateral sclerosis
  • Alzheimer's disease Alzheimer's disease.
  • TRPM7 plays a critical role in neuronal death in cases of ischemia by mediating a Ca2+ influx causing calcium overload resulting in oxidative stress, nitric oxide production and cell death (Leng et al 2015; Sun et al. 2009). Knock down of TRPM7 inhibit delayed neuronal cell death, which is characteristic in Alzheimer's, Huntington's, Parkinson's disease and stroke patients. This suggests that knock down of TRPM7 could be a new therapy against neuronal disorders.
  • TRPM7 also plays a significant role in several types of cancer including glioblastoma multiforme (GBM), retinoblastoma, nasopharyngeal carcinoma, leukemia, gastric, prostate, pancreatic, breast, head and neck cancers, and it is overexpressed in pancreatic and lung cancer cells. Finally, TRPM7 plays a role in diabetes, kidney disease, and inflammatory diseases.
  • GBM glioblastoma multiforme
  • retinoblastoma retinoblastoma
  • nasopharyngeal carcinoma nasopharyngeal carcinoma
  • leukemia gastric
  • prostate pancreatic
  • breast pancreatic
  • head and neck cancers pancreatic and lung cancer cells
  • TRPM7 plays a role in diabetes, kidney disease, and inflammatory diseases.
  • RNA-seq data was used to analyze publicly available RNA-seq data.
  • HeLa cells and U251 cells were grown in RPMI and transfected with 20 nM or 40 nM SSO using Lipofectamine. After 24 hours, cells were harvested and RNA purified. RT-PCR was performed and the resulting product visualized on 2% agarose gel.
  • U251 cells were grown in 96-well plates transfected with SSOs at 20 and 40 nM and incubated in the incucyte instrument with images taken every 4th hour.
  • a small SSO walk was performed employing 25 nt long SSOs targeting the Sweet Spot region from +9 to +13 position downstream of the 5'ss of the PE.
  • All SSO were 25 nt long phosphorothioate RNA oligonucleotides with 2'-O-methyl modification on each sugar moiety (Produeced by LGC Biosearch Technologies). SSOs were used targeting position different positions inside the Sweet Spot region for that gene (relative to the 5' splice site of the pseudoexon). Thus, the SSOs bind inside the Sweet Spot (see Table 5).
  • TRPM7 The normal expression of the TRPM7 protein is most efficiently decreased by using the SSO that binds from the +13 position and mediates a high level of pseudoexon inclusion.
  • Sweet Spot sequences were identified in disease associated genes using the criteria according to the invention (see e.g. example 2) and demonstrated by functional testing to be targets for SSOs, allowing for incorporation of the pseudoexon in the mature mRNA.
  • RNA-sequencing data (Geuvadis, E-MTAB-2836, E-MTAB-513, GSE52946, and GSE124439) and mapped them with STAR after trimming for adapter contamination and poor quality bases with bbduk.
  • HeLa cells were seeded in 12-well plates and forward transfected at 60% confluence with 20 or 40 nM 2'- O-methyl SSOs with full phosphorothioate backbone using Lipofectamine RNAiMAX (invitrogen).
  • a non-binding Ctrl SSO (5'GCUCAAUAUGCUACUGCCAUGCUUG3') (SEQ ID NO: 126) was used as control.
  • Complementary DNA cDNA was synthesized from 500 ng RNA using the High capacity cDNA kit (Applied Biosystems). Primers were designed to span at least one exon-exon junction of the neighboring exons flanking the pseudoexons of interest. PCR was carried out using TEMPase Hot Start DNA polymerase (ampliqon) and 1 pl cDNA per reaction. 0.5 pmol/pl of each primer was used. The PCR products were separated on a 2% Seakem LE (Lonza) TBE agarose gel, for 1 hour at 80V.
  • the Sweet Spot region is located +9 to +39 of the 5' splice site of the pseudoexon.
  • All SSOs were 25 nt long phosphorothioate RNA oligonucleotides with 2'-O-methyl modification on each sugar moiety (Produced by LGC Biosearch Technologies). SSOs were used targeting position +11 to +35 inside the Sweet Spot region for that gene (relative to the 5' splice site of the pseudoexon). Thus, the SSOs bind inside the Sweet Spot.
  • Table 6 46 pseudoexons matching all criteria, all activated by an SSO located within the Sweet Spot region. Sweet Spot region is annotated by its genomic sequence (DNA). Table 6: Targets functionally validated as responsive to SSO targeting the Sweet
  • Seq ID NO's: 160-180 in Table 7 are further pseudoexons in genes where at least one other pseudoexon has already been activated by a SSO targeting the Sweet
  • Seq ID NO's: 181-201 in Table 7 are additional Sweet Spot sequences identified using the criteria according to the invention (see e.g. example 2).
  • these targets will with very high plausibility be functional targets for SSOs, allowing for incorporation of the pseudoexon in the mature mRNA.
  • Table 7 relevant target pseudoexons.
  • RNF115 (Ring Finger Protein 115), previously named Breast Cancer Associated 2 (BCA2), is a RING-finger E3 ubiquitin that mediates polyubiquitination of substrates.
  • RNF115 causes ubiquitination and proteasomal degradation of the tumor suppressor p21 in breast cancer (Wang et al. 2013).
  • RNF115 also functions as an oncogene by regulating Wnt/p-catenin pathway via ubiquitination of adenomatous polyposis coli (APC) leading to increased proliferation (Wu et al. 2021).
  • APC adenomatous polyposis coli
  • RNF115 is associated with breast cancer. It is overexpressed in more than 50% of invasive breast cancers, and it's up-regulation correlates with estrogen receptor positive (ER+) status and poor prognosis.
  • inhibiting RNF115 activity will inhibit the 0-catenin and function to inhibit cancers, such as lung cancer and breast cancer.
  • RNA-seq data from the GEUVADIS consortium, E-MTAB-2836, E-MTAB-513, GSE52946, and GSE124439.
  • HeLa cells, NCI-H23 lung cancer cells and NCI-H23 lung cancer cells were seeded in 12-well plates and forward transfected at 60% confluence with 5nM, lOnM or 20 nM SSO using Lipofectamine RNAiMAX (invitrogen).
  • SSO targeting SEQ ID NO: 106; specific target sequence is underlined in SEQ ID NO: 106 in table 3 and table 6) was a 25 nt long phosphorothioate RNA oligonucleotides with 2'-O-methyl modification on each sugar moiety (Produced by LGC Biosearch Technologies).
  • the SSO is complementary to position +11 to +35 inside the Sweet Spot region for the RNF115 gene (relative to the 5' splice site of the pseudoexon). Thus, the SSOs binds inside the Sweet Spot.
  • PCR products were separated on a 2% Seakem LE (Lonza) TBE agarose gel, for 1 hour at 80V. Protein was harvested after 72 hours for western blotting and denatured proteins were separated on a 4- 12% NuPAGE SDS-gel. Western blot analysis was performed with antibodies directed towards RNF115 (abl87642, Abeam) p-catenin (#9587, Cell Signaling Technology), p-actin for control (ab8229, Abeam).
  • NCI-H23 cells were reverse transfected with SSOs in a concentration gradient, and WST-1 assay (Roche) was carried out on cells 48 hours after transfection.
  • NCI-H23 cancer cells Growth of NCI-H23 cancer cells is inhibited by treatment by SSO-mediated downregulation as shown by WST-1 assay ( Figure 7B). Furthermore, RNF115 protein levels are severely decreased following treatment of NCI-H23 lung cancer cells as shown by western blotting ( Figure 7C). The decreased levels of functional RNF115 caused decreased levels of p-catenin as shown by western blotting ( Figure 7C).
  • the normal expression of the RNF115 gene product is decreased by at least 90% using a specific SSO to increase inclusion of a pseudoexon, which disrupts the function of the normal gene product. This reduces p-actin expression and growth of lung cancer cells showing SSO based activation of the RNF115 pseudoexon works to inhibit cancer.
  • RNF115 pseudoexon introduces 146 bp between exon 4 and 5 in the mRNA. This will lead to a reading frame-shift after glycine 143 and a resulting pre-mature termination codon 94 codons downstream leading to degradation via the NMD system. It will also lead to the production of a severely truncated protein (of 226 amino acids) lacking the functional domains. This truncated protein could function as a decoy by binding to substrates and inhibit polyubiquitination and function to inhibit cancers (Table 7).
  • Parkinson's disease is a progressive neurodegenerative disorder characterized by loss of dopaminergic neurons that affects movement control. Mutations in the leucine-rich repeat kinase 2 LRRK2 gene account for common risk factors associated with Parkinson's disease (Alessi & Sammler, 2018). Dominantly inherited and sporadic pathogenic mutations in LRRK2 causes hyperactivation of the LRRK2 kinase, and downregulation of LRRK2 gene expression is a potential treatment strategy.
  • cDNA Complementary DNA
  • Applied Biosystems High-Capacity cDNA Reverse Transcription Kit
  • PCR was carried out using the TEMPase Hot Start DNA Polymerase (Ampliqon) with primers in LRRK2 exon 47 and 48.
  • the PCR products were separated on a 1.5% SeaKem LE (Lonza) TBE agarose gel.
  • the chrl2:40362438-40362491(+) LRRK2 pseudoexon is 54 nt long and pseudoexon inclusion will introduce 18 amino acids to the WD40 domain of the translated LRRK2 protein.
  • the chrl2:40362410-40362491(+) LRRK2 pseudoexon is 82 nt long and pseudoexon inclusion will cause a frame-shift and insertion of a premature termination codon, and target the transcript for degradation by nonsense-mediated mRNA decay.
  • the normal and hyper-activated function of LRRK2 will be decreased by using a specific SSO targeting the Sweet Spot to induce pseudoexon inclusion and thereby reduce the expression and activity of the normal LRRK2 gene product.
  • Pseudoexon inclusion that introduces amino acids to the translated sequence will potentially reduce gene expression by disruption of protein function or alter normal protein function.
  • Pseudoexon inclusion that causes frame-shift with insertion of a premature termination codon will reduce gene expression by degradation of the transcript or translation of a truncated and non-functional protein.
  • LRP6 LDL Receptor Related Protein 6
  • LRP6 functions as a receptor and co-receptor for Wnt in the Wnt/beta-catenin signaling cascade and plays a role in the regulation of cell differentiation, proliferation, and migration. It is also involved in glucose and lipid metabolism signaling. Inhibition of LRP6 can be a therapeutic option for cancers, such as breast-, liver- and colorectal-cancer, as well as metabolic and neurodegenerative disease (Reviewed by Jeong and Jho 2021).
  • chrl2: 12212260-12212305(-) LRP6 pseudoexon will introduce 46 bp between exon 1 and 2 in the mRNA. This will lead to a reading frame-shift and a resulting pre-mature termination codon leading to degradation via the NMD system. It will also lead to the production of a severely truncated protein lacking the transmembrane and cytosolic domains. This truncated protein could function as a decoy receptor for Wnt proteins and thereby inhibit Wnt signaling and function to inhibit cancers and other diseases (Table 7).
  • Parkinson's disease is a progressive neurodegenerative disorder characterized by loss of dopaminergic neurons that affects movement control. Mutations in the leucine-rich repeat kinase 2 LRRK2 gene account for common risk factors associated with Parkinson's disease (Alessi & Sammler, 2018). Dominantly inherited and sporadic pathogenic mutations in LRRK2 causes hyperactivation of the LRRK2 kinase, and downregulation of LRRK2 gene expression is a potential treatment strategy. Allele-specific targeting is particularly promising for downregulation of the hyperactivated disease allele with minimal or no effect on the wild type.
  • RNA-seq analysis was used to identify fragments with fully included pseudoexons in proprietary and publicly available RNA-seq data, and we used the dbSNP database (https://www.ncbi.nlm.nih.gov/SNP) to identify SNPs that strengthens the 3' or 5' splice sites (increases the MaxEnt scores).
  • SNPs can make otherwise non-responding pseudoexons functional targets for SSO treatment and allow for inclusion or increased inclusion of the given pseudoexons in mature mRNA.
  • A549 cells were reverse transfected and LX-2 cells were forward transfected with
  • the PCR products were separated on a 1.5% SeaKem LE (Lonza) TBE agarose gel.
  • LRRK2 The activity and function of LRRK2 will be decreased by using an SSO targeting the Sweet Spot region to induce pseudoexon inclusion and thereby reduce the expression of LRRK2 gene alleles that harbor the identified SNP (G) for allelespecific targeting. Pseudoexon inclusion that introduces in-frame premature termination codons will reduce gene expression by degradation of the transcript or translation of a truncated and non-functional protein.
  • allele-specific down-regulation of expression from only the disease-causing (mutant) allele is preferred, because the mutant allele produces a protein with dominant negative effect that interferes with the normal protein produced from the wild type allele.
  • allele specific down-regulation of only one allele is preferred. Activation of splicing of a pseudoexon that causes introduction of premature stop codons into the transcript from the mutant or overexpressed allele will reduce gene expression by degradation of the mutant transcript or translation of a truncated and nonfunctional protein.
  • SNPs that are located in the 23-mer 3' splice site (-20 to +3 nt of the intron-exon border) or in the 9-mer 5' splice site (-3 to +6 nt of the exon-intron border) affects the strength of the given splice site (changes the MaxEnt score). This can be exploited for allele-specific pseudoexon activation, since such high MaxEnt score SNP variants can make otherwise non-responding pseudoexons functional targets for SSO treatment and thereby allow for allele-specific inclusion or increased inclusion of the given pseudoexon in mature mRNA transcript.
  • the principle of this invention is illustrated in Figure 11. It is therefore possible to perform allele-specific targeting (or at least allelepreferred targeting), by screening for subjects that carry the specific high MaxEnt score SNP variant before initiating treatment with SSOs that bind to the sweet spot.
  • RNA-seq analysis to identify fragments with fully included pseudoexons in proprietary and publicly available RNA-seq data, and we used the dbSNP database (https://www.ncbi.nlm.nih.gov/SNP) to identify SNPs that strengthens the 3' or 5' splice sites (increases the MaxEnt scores).
  • dbSNP database https://www.ncbi.nlm.nih.gov/SNP
  • SNP variants make otherwise non-responding pseudoexons functional targets for SSO treatment and allow for inclusion or increased inclusion of the given pseudoexons in mature mRNA.
  • Table 9 Target pseudoexons where allele-specific activation is determined by SNP variants in splice site sequences.
  • SNP ID refers to SNP no. in dbSNP (https://www.ncbi.nlm.nih.gov/snp/). Underlining indicates tested binding sequence of the SSO. Binding is to the corresponding pre-mRNA. hg38 Genome coordinates follow GFF/GTF format; onebased start and end coordinates.
  • Gene name has in certain cases been extended with a sequence code.
  • Table 10 SSOs able to perform allele specific activation of pseudoexons.
  • Lamin Bl is encoded by the LMNB1 gene. Overexpression of lamin Bl causes progressive central nervous system demyelination, leading to autosomal dominant adult-onset demyelinating leukodystrophy (ADLD) (Giorgio et al. 2015; Giorgio et al. 2019). ADLD is an inherited, progressive and fatal disorder affecting myelin in the Central Nervous System (CNS). Allele-specific down regulation of one LMNB1 allele would be a suitable and promising therapeutic option for ADLD (Giorgio et al. 2019).
  • ADLD autosomal dominant adult-onset demyelinating leukodystrophy
  • LMNB1 low-density lipoprotein
  • chr5 126804263- 126804357(+).
  • the insTT variant changes the MaxEnt score of 7.10 for the — allele to -20.37 for the insTT allele (low MaxEnt score SNP variant).
  • LMNB1 pseudoexon will introduce 95 bp between exon 1 and exon 2 in the mRNA. This will introduce in-frame premature termination codons in the mRNA transcript. An LMNB1 mRNA transcript with inclusion of this pseudoexon is therefore predicted to be a target of nonsense-mediated decay, and increased pseudoexon inclusion will result in reduction of LMNB1 gene expression.
  • ATXN2 Ataxin-2 is encoded by the ATXN2 gene.
  • Spinocerebellar ataxia 2 (SCA2) is an autosomal dominant lethal disease caused by expansion to more than 32 CAG repeats in one ATXN2 allele (Laffita-Mesa et al. 2021). Alleles with intermediate (>29CAG/CAA repeats) expansions in ATXN2 increase the risk for many other neurological diseases. Lowering ATXN2 expression in Amyotrophic lateral sclerosis (ALS) mice prolongs their survival, suggesting that lowering of ATXN2 disease allele expression could be therapeutically relevant for both ALS and SCA2 (Laffita- Mesa et al. 2021).
  • ALS Amyotrophic lateral sclerosis
  • Allele-specific down-regulation of one ATXN2 disease-associated allele would therefore be a suitable therapeutic option for SCA2, ALS and other neurodegenerative diseases.
  • ATXN2 pseudoexon will introduce 102 bp between exon 14 and exon 15 in the mRNA. This will introduce an in-frame premature termination codon in the mRNA transcript. An ATXN2 mRNA transcript with inclusion of this pseudoexon is therefore predicted to be a target of nonsense-mediated decay, and increased pseudoexon inclusion will result in reduction of ATXN2 gene expression.
  • Sweet Spot for ATXN2 SSO targeting is shown in Table 9.

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
PCT/EP2023/051916 2022-01-26 2023-01-26 Allele specific splice switching oligonucleotides targeting pseudoexons Ceased WO2023144263A1 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
US18/728,263 US20250101419A1 (en) 2022-01-26 2023-01-26 Allele specific splice switching oligonucleotides targeting pseudoexons
CN202380030631.5A CN119013399A (zh) 2022-01-26 2023-01-26 靶向假外显子的等位基因特异性剪接转换寡核苷酸
CA3247528A CA3247528A1 (en) 2022-01-26 2023-01-26 SPLIT-SWITCHING ALLELE-SPECIFIC OLIGONUCLEOTIDES TARGETTING PSEUDOEXONS
JP2024544641A JP2025504661A (ja) 2022-01-26 2023-01-26 偽エクソンを標的とする対立遺伝子特異的スプライススイッチングオリゴヌクレオチド
EP23702114.2A EP4469572A1 (en) 2022-01-26 2023-01-26 Allele specific splice switching oligonucleotides targeting pseudoexons
AU2023210747A AU2023210747A1 (en) 2022-01-26 2023-01-26 Allele specific splice switching oligonucleotides targeting pseudoexons

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
EPPCT/EP2022/051790 2022-01-26
PCT/EP2022/051790 WO2022162020A2 (en) 2021-01-26 2022-01-26 Splice switching oligonucleotides targeting pseudoexons
DKPA202270346 2022-06-29
DKPA202270346 2022-06-29

Publications (1)

Publication Number Publication Date
WO2023144263A1 true WO2023144263A1 (en) 2023-08-03

Family

ID=85108839

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2023/051916 Ceased WO2023144263A1 (en) 2022-01-26 2023-01-26 Allele specific splice switching oligonucleotides targeting pseudoexons

Country Status (7)

Country Link
US (1) US20250101419A1 (enExample)
EP (1) EP4469572A1 (enExample)
JP (1) JP2025504661A (enExample)
CN (1) CN119013399A (enExample)
AU (1) AU2023210747A1 (enExample)
CA (1) CA3247528A1 (enExample)
WO (1) WO2023144263A1 (enExample)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024243087A3 (en) * 2023-05-19 2025-01-16 Leverna Therapeutics Inc. Compositions and methods for regulating expression of atxn2

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017060731A1 (en) * 2015-10-09 2017-04-13 University Of Southampton Modulation of gene expression and screening for deregulated protein expression
WO2017087282A1 (en) * 2015-11-18 2017-05-26 Rosalind Franklin University Of Medicine And Science Antisense compounds targeting leucine-rich repeat kinase 2 (lrrk2) for the treatment of parkinsons disease
WO2019040923A1 (en) * 2017-08-25 2019-02-28 Stoke Therapeutics, Inc. ANTISENSE OLIGOMERS FOR THE TREATMENT OF DISEASE CONDITIONS AND OTHER DISEASES
WO2020006267A1 (en) * 2018-06-27 2020-01-02 Ionis Pharmaceuticals, Inc. Compounds and methods for reducing lrrk2 expression
WO2020191212A1 (en) * 2019-03-20 2020-09-24 President And Fellows Of Harvard College Antisense oligonucleotide-based progranulin augmentation therapy in neurodegenerative diseases
WO2022119881A1 (en) * 2020-12-01 2022-06-09 Emendobio Inc. Differential knockout of a heterozygous allele of lrrk2
WO2022162020A2 (en) * 2021-01-26 2022-08-04 Syddansk Universitet Splice switching oligonucleotides targeting pseudoexons

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017060731A1 (en) * 2015-10-09 2017-04-13 University Of Southampton Modulation of gene expression and screening for deregulated protein expression
WO2017087282A1 (en) * 2015-11-18 2017-05-26 Rosalind Franklin University Of Medicine And Science Antisense compounds targeting leucine-rich repeat kinase 2 (lrrk2) for the treatment of parkinsons disease
WO2019040923A1 (en) * 2017-08-25 2019-02-28 Stoke Therapeutics, Inc. ANTISENSE OLIGOMERS FOR THE TREATMENT OF DISEASE CONDITIONS AND OTHER DISEASES
WO2020006267A1 (en) * 2018-06-27 2020-01-02 Ionis Pharmaceuticals, Inc. Compounds and methods for reducing lrrk2 expression
WO2020191212A1 (en) * 2019-03-20 2020-09-24 President And Fellows Of Harvard College Antisense oligonucleotide-based progranulin augmentation therapy in neurodegenerative diseases
WO2022119881A1 (en) * 2020-12-01 2022-06-09 Emendobio Inc. Differential knockout of a heterozygous allele of lrrk2
WO2022162020A2 (en) * 2021-01-26 2022-08-04 Syddansk Universitet Splice switching oligonucleotides targeting pseudoexons

Non-Patent Citations (52)

* Cited by examiner, † Cited by third party
Title
ALESSI, D.R.SAMMLER E, SCIENCE, vol. 360, no. 6384, 2018, pages 36 - 37
BISKUP S ET AL: "Zeroing in on LRRK2-linked pathogenic mechanisms in Parkinson's disease", BIOCHIMICA ET BIOPHYSICA ACTA. MOLECULAR BASIS OF DISEASE, AMSTERDAM, NL, vol. 1792, no. 7, 10 October 2008 (2008-10-10), pages 625 - 633, XP026191873, ISSN: 0925-4439, [retrieved on 20081010], DOI: 10.1016/J.BBADIS.2008.09.015 *
BRUUN GITTE H. ET AL: "Global identification of hnRNP A1 binding sites for SSO-based splicing modulation", vol. 14, no. 1, 5 July 2016 (2016-07-05), XP055816845, Retrieved from the Internet <URL:https://bmcbiol.biomedcentral.com/track/pdf/10.1186/s12915-016-0279-9.pdf> DOI: 10.1186/s12915-016-0279-9 *
CHAN, G. ET AL., CANCER METASTASIS REV, vol. 27, no. 2, 2008, pages 179 - 192
CHEN ET AL., CANCER CELL INT, vol. 21, no. 1, 2021, pages 22
CORO PAISÁN-RUIZ ET AL: "Parkinson's Disease and Low Frequency Alleles Found Together Throughout LRRK2", ANNALS OF HUMAN GENETICS, WILEY-BLACKWELL PUBLISHING LTD, GB, vol. 73, no. 4, 21 May 2009 (2009-05-21), pages 391 - 403, XP071046629, ISSN: 0003-4800, DOI: 10.1111/J.1469-1809.2009.00524.X *
DAI Y ET AL., INTERNATIONAL JOURNAL OF RADIATION ONCOLOGY*BIOLOGY*PHYSICS, vol. 81, 2011, pages 521 - 528
DE ARAUJO, E. D. ET AL., NAT COMMUN, vol. 10, no. 1, 2019, pages 2517
EBRAHIMI-FAKHARI, D. ET AL., HUM MOL GENET, vol. 25, no. 16, 2016, pages 3588 - 3599
FU B ET AL., BIOMED RES INT, vol. 2017, 2017, pages 4698167
GIORGIO E, ROBYR D, SPIELMANN M, FERRERO E, DI GREGORIO E, IMPERIALE D, VAULA G, STAMOULIS G, SANTONI F, ATZORI C, GASPARINI L, FE: "A large genomic deletion leads to enhancer adoption by the lamin B1 gene: a second path to autosomal dominant adult-onset demyelinating leukodystrophy (ADLD", HUM MOL GENET, vol. 24, no. 11, 1 June 2015 (2015-06-01), pages 3143 - 54
GIORGIO ELORENZATI MRIVETTI DI VAL CERVO PBRUSSINO ACERNIGOJ MDELLA SALA EBARTOLETTI STELLA AFERRERO MCAIAZZO MCAPELLARI S: "Allele-specific silencing as treatment for gene duplication disorders: proof-of-principle in autosomal dominant leukodystrophy", BRAIN, vol. 142, no. 7, 1 July 2019 (2019-07-01), pages 1905 - 1920
GRAHAM, D. L. ET AL., 2 NEUROPHARMACOLOGY, vol. 79, pages 307 - 313
HASTINGS, N. B. ET AL., MOL NEURODEGENER, vol. 12, no. 1, 2017, pages 39
HUANG HLEE SHSOUSA-LIMA IKIM SSHWANG WMDAGON YYANG WMCHO SKANG MCSEO JA: "Rho-kinase/AMPK axis regulates hepatic lipogenesis during overnutrition", J CLIN INVEST, vol. 128, no. 12, 3 December 2018 (2018-12-03), pages 5335 - 5350, XP055731292, DOI: 10.1172/JCI63562
INAGAKI Y ET AL., GUT, vol. 56, no. 2, February 2007 (2007-02-01), pages 284 - 92
JIA Y ET AL., . MOL CLIN ONCOL, vol. 13, no. 6, December 2020 (2020-12-01), pages 83
KOCH JCTATENHORST LROSER AESAAL KATONGES LLINGOR P: "ROCK inhibition in models of neurodegeneration and its potential for clinical translation", PHARMACOL THER, vol. 189, September 2018 (2018-09-01), pages 1 - 21, XP085442703, DOI: 10.1016/j.pharmthera.2018.03.008
LAFFITA-MESA JMPAUCAR MSVENNINGSSON P: "Ataxin-2 gene: a powerful modulator of neurological disorders", CURR OPIN NEUROL, vol. 34, no. 4, 1 August 2021 (2021-08-01), pages 578 - 588
LENG TD ET AL., CNS NEUROSCI THER, vol. 21, 2015, pages 252 - 261
LI JSUN ZCUI YQIN LWU FLI YDU NLI X: "Knockdown of LMNB1 Inhibits the Proliferation of Lung Adenocarcinoma Cells by Inducing DNA Damage and Cell Senescence", FRONT ONCOL, vol. 12, 31 May 2022 (2022-05-31), pages 913740
LI, L. X. ET AL., CELL DEATH DIS, vol. 9, no. 3, 2018, pages 326
LI, Q. ET AL., MED SCI MONIT, vol. 24, 2018, pages 7109 - 7118
LIM JKM ET AL., MOL CELL ONCOL, vol. 7, no. 1, 10 November 2019 (2019-11-10), pages 1654814
LIM JKM ET AL., PROC NATL ACAD SCI USA, vol. 116, no. 19, 7 May 2019 (2019-05-07), pages 9433 - 9442
LIN W ET AL., AM J CANCER RES, vol. 10, no. 10, 1 October 2020 (2020-10-01), pages 3106 - 3126
LIU M ET AL., CELL SIGNAL, vol. 26, 2014, pages 2773 - 2781
MOSHIRFAR MPARKER LBIRDSONG OCRONQUILLO YCHOFSTEDT DSHAH TJGOMEZ ATHOOPES PCS: "Use of Rho kinase Inhibitors in Ophthalmology: A Review of the Literature", MED HYPOTHESIS DISCOV INNOV OPHTHALMOL, vol. 7, no. 3, 2018, pages 101 - 111
NAMOUR, F. ET AL., DRUGS R D, vol. 12, no. 3, 2012, pages 141 - 163
PAPACHRISTODOULOU A ET AL., CLIN CANCER RES, vol. 25, no. 23, 1 December 2019 (2019-12-01), pages 7189 - 7201
PETERSEN ULRIKA S. S. ET AL: "Pseudoexon activation in disease by non-splice site deep intronic sequence variation - wild type pseudoexons constitute high-risk sites in the human genome", HUMAN MUTATION, vol. 43, no. 2, 27 November 2021 (2021-11-27), US, pages 103 - 127, XP055920770, ISSN: 1059-7794, Retrieved from the Internet <URL:https://onlinelibrary.wiley.com/doi/full-xml/10.1002/humu.24306> DOI: 10.1002/humu.24306 *
PETERSEN ULRIKA: "Pseudoexon activation, an underreported disease mechanism with a unique potential for tailored therapy", PH. D. THESIS, 14 March 2023 (2023-03-14), XP093040720, Retrieved from the Internet <URL:https://findresearcher.sdu.dk/ws/portalfiles/portal/226583494/PhD_thesis_Ulrika_Petersen_e_pub.pdf> [retrieved on 20230420], DOI: 10.21996/0zmx-jz18 *
QIU, G. ET AL., TUMOUR BIOL, vol. 36, no. 10, 2015, pages 8231 - 8238
REBLE EMMA: "Investigation of Gene Splicing Variants Contributing Risk to Psychiatric Disorders", M. SC. THESIS, November 2017 (2017-11-01), XP093040726, ISBN: 978-0-355-45470-3, Retrieved from the Internet <URL:https://tspace.library.utoronto.ca/bitstream/1807/79394/3/Reble_Emma_C_201711_MSc_thesis.pdf> [retrieved on 20230420] *
RIAD, A. ET AL., MOL NEUROBIOL, vol. 57, no. 9, 2020, pages 3803 - 3813
RONG, Y. ET AL., J CELL MOL MED, 2020
SANAKER PETTER SCHANDL ET AL: "Antisense oligonucleotide corrects splice abnormality in hereditary myopathy with lactic acidosis", GENE, vol. 494, no. 2, 1 December 2011 (2011-12-01), pages 231 - 236, XP028888226, ISSN: 0378-1119, DOI: 10.1016/J.GENE.2011.11.021 *
SAVASKAN NE ET AL., NAT MED, vol. 14, no. 6, June 2008 (2008-06-01), pages 629 - 32
SHCHELKUNOVA ALEKSANDRA ET AL: "Tuning of Alternative Splicing - Switch From Proto-Oncogene to Tumor Suppressor", vol. 9, no. 1, 19 December 2012 (2012-12-19), Australia, pages 45 - 54, XP055817243, ISSN: 1449-2288, Retrieved from the Internet <URL:https://www.ijbs.com/v09p0045.pdf> DOI: 10.7150/ijbs.5194 *
SUN HS ET AL., NAT NEUROSCI, vol. 12, 2009, pages 1300 - 1307
SYSA P ET AL., 2009 SEP, vol. 28, no. 9, pages 425 - 34
TATRAI E ET AL., ONCOTARGET, vol. 8, 2017, pages 44498 - 44510
TAVASSOLY, O. ET AL., FEBS J, vol. 288, no. 2, 2021, pages 452 - 470
WANG XK ET AL., J CANCER, vol. 11, no. 7, 20 January 2020 (2020-01-20), pages 1869 - 1882
WANG ZNIE ZCHEN WZHOU ZKONG QSETH AK ET AL.: "RNF115/BCA2 E3 ubiquitin ligase promotes breast cancer cell proliferation through targeting p21Waf1/Cip1 for ubiquitin-mediated degradation", NEOPLASIA, vol. 15, no. 9, 2013, pages 1028 - 35
WANG, X. ET AL., ONCOTARGET, vol. 7, no. 7, 2016, pages 8029 - 8042
WU H ET AL., BIOCHEMICAL PHARMACOLOQY, vol. 184, February 2021 (2021-02-01), pages 114353, Retrieved from the Internet <URL:https://doi.org/10.1016/j.bcp.2020.114353>
WU XT, WANG YH, CAI XY, DONG Y, CUI Q, ZHOU YN, YANG XW, LU WF, ZHANG M: "RNF115 promotes lung adenocarcinoma through Wnt/β-catenin pathway activation by mediating APC ubiquitination", CANCER METAB, vol. 9, no. 1, 2021, pages 7
XU, L. ET AL., J EXP CLIN CANCER RES, vol. 37, no. 1, 2018, pages 135
YUZWA, S. A. ET AL., MOL NEURODEGENER, vol. 9, 2014, pages 42
ZHOU, Q. ET AL., ONCOGENE, vol. 39, no. 10, 2020, pages 2140 - 2155
ZIMMERMAN, K.M. ET AL., MOL CANCER RES, vol. 11, no. 4, 2013, pages 370 - 80

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024243087A3 (en) * 2023-05-19 2025-01-16 Leverna Therapeutics Inc. Compositions and methods for regulating expression of atxn2

Also Published As

Publication number Publication date
AU2023210747A1 (en) 2024-08-01
CA3247528A1 (en) 2023-08-03
CN119013399A (zh) 2024-11-22
EP4469572A1 (en) 2024-12-04
JP2025504661A (ja) 2025-02-14
US20250101419A1 (en) 2025-03-27

Similar Documents

Publication Publication Date Title
Fiori et al. miR-323a regulates ERBB4 and is involved in depression
Song et al. Long non-coding RNA PVT1 promotes glycolysis and tumor progression by regulating miR-497/HK2 axis in osteosarcoma
Hu et al. miR-501-3p mediates the activity-dependent regulation of the expression of AMPA receptor subunit GluA1
US10472627B2 (en) Natural antisense and non-coding RNA transcripts as drug targets
Kim et al. miR-126 contributes to Parkinson's disease by dysregulating the insulin-like growth factor/phosphoinositide 3-kinase signaling
Xu et al. miR-24-3p and miR-27a-3p promote cell proliferation in glioma cells via cooperative regulation of MXI1
Zongaro et al. The 3′ UTR of FMR1 mRNA is a target of miR-101, miR-129-5p and miR-221: implications for the molecular pathology of FXTAS at the synapse
TWI901675B (zh) 用於病症及疾病之治療的opa1反義寡聚物
Cui et al. miR-503 represses CUG-binding protein 1 translation by recruiting CUGBP1 mRNA to processing bodies
Maskey et al. MicroRNA-340 inhibits invasion and metastasis by downregulating ROCK1 in breast cancer cells
Saramago et al. The implication of mRNA degradation disorders on human DISease: focus on DIS3 and DIS3-like enzymes
US20210254163A1 (en) Exonic splicing enhancers and exonic splicing silencers
Zhou et al. Combinational treatment with microRNA‑133b and cetuximab has increased inhibitory effects on the growth and invasion of colorectal cancer cells by regulating EGFR
Chen et al. Tumor-associated intronic editing of HNRPLL generates a novel splicing variant linked to cell proliferation
Krauss et al. The role of microRNAs in spinocerebellar ataxia type 3
Xie et al. Inhibition of microRNA-30a prevents puromycin aminonucleoside-induced podocytic apoptosis by upregulating the glucocorticoid receptor α
AU2023210747A1 (en) Allele specific splice switching oligonucleotides targeting pseudoexons
Han et al. Long non-coding RNA NEAT1 promotes the malignancy of laryngeal squamous cell carcinoma by regulating the microRNA-204-5p/SEMA4B axis
WO2022162020A2 (en) Splice switching oligonucleotides targeting pseudoexons
US20250277214A1 (en) Splice switching oligonucleotides targeting pseudoexons
Chen et al. The long noncoding RNA LINC00200 promotes the malignant progression of MYCN-amplified neuroblastoma via binding to insulin like growth factor 2 mRNA binding protein 3 (IGF2BP3) to enhance the stability of Zic family member 2 (ZIC2) mRNA
US20230167447A1 (en) Compositions for FNIP1/FNIP2 Gene Modulation and Methods Thereof
Deshpande et al. Exploring the role of N-acetyltransferases in diseases: a focus on N-acetyltransferase 9 in neurodegeneration
Kim et al. miR-126 contributes to Parkinson disease by dysregulating IGF-1/PI3K signaling: miRNAs and IGF-1 signaling in Parkinson disease
Störchel Regulation of microRNA function in neuronal development by the transcription co-activator Ncoa3

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23702114

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 18728263

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: AU2023210747

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2024544641

Country of ref document: JP

ENP Entry into the national phase

Ref document number: 2023210747

Country of ref document: AU

Date of ref document: 20230126

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2023702114

Country of ref document: EP

Effective date: 20240826

WWE Wipo information: entry into national phase

Ref document number: 202380030631.5

Country of ref document: CN

WWP Wipo information: published in national office

Ref document number: 18728263

Country of ref document: US