WO2023143609A1

WO2023143609A1 - Methods for nucleic acid editing to alter apoe4 function

Info

Publication number: WO2023143609A1
Application number: PCT/CN2023/073848
Authority: WO
Inventors: Pengfei YUAN; Ming Jin; Hongyan Shen; Yaru Zheng; Meihua SU; Yonglin Zhou; XinHe PANG
Original assignee: Edigene Therapeutics Beijing Inc
Current assignee: Edigene Therapeutics Beijing Inc
Priority date: 2022-01-30
Filing date: 2023-01-30
Publication date: 2023-08-03
Anticipated expiration: 2024-07-30
Also published as: WO2023143609A9

Abstract

The present application provides methods of altering ApoE4 in a cell comprising a nucleic acid encoding ApoE4 by introduction of components of a nucleic acid editing system, thereby producing an ApoE4 with altered function. Also provided are methods of ameliorating a symptom of a neurodegenerative disorder in an individual, comprising altering ApoE4 in the individual by use of a nucleic acid editing system. Also provided are ApoE4 mutants having ApoE3-like functions.

Description

Methods for Nucleic Acid Editing to Alter ApoE4 function

CROSS REFERENCE TO RELATED APPLICATIONS

This patent application claims priority benefit to International Application No. PCT/CN2022/075215 filed January 30, 2022, and International Application No. PCT/CN2022/076481 filed February 16, 2022, the contents of each of which are incorporated herein by reference in their entirety.

REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

The contents of the electronic sequence listing (792642001346SEQLIST. xml; Size: 11, 339 bytes; and Date of Creation: January 19, 2023) is herein incorporated by reference in its entirety.

FIELD OF THE INVENTION

The present invention is related to methods and compositions for editing nucleic acids encoding ApoE4 protein for ameliorating symptoms of neurodegenerative diseases, and ApoE4 variant proteins with altered properties.

BACKGROUND OF THE INVENTION

Alzheimer's disease (Alzheimer's disease, AD) is a common neurodegenerative disease that frequently occurs in the elderly population. The main pathological manifestation is β-amyloid protein deposition (amyloid-beta, Aβ) forming senile plaques, abnormal phosphorylation of tau protein, resulting in formation of neurofibrillary tangles (NFTs) and neuronal deaths. Currently there is a lack of effective therapeutic drugs in clinical practice.

Alzheimer disease (AD) is generally divided into three categories: early-onset familial disease (occurring before 60 years of age; late-onset familial disease; and sporadic late-onset disease. Both types of late-onset disease have recently been linked to chromosome 19 at the apoE locus. Apolipoprotein E (APOE) is a member of fat-binding apolipoprotein family that supports lipid transport and injury repair in the brain. The APOE gene is on chromosome 19 and exists in three major isoforms designated APOE2 (ε2) , APOE3 (ε3) , and APOE4 (ε4) . APOE polymorphic alleles are the main genetic determinants of sporadic Alzheimer disease (AD) risk: individuals carrying the ε4 allele are at increased risk of AD compared with those carrying the more common ε3 allele, whereas the ε2 allele decreases risk. Other results suggest that APOE4 is directly linked to the severity of the disease in late-onset families (Roses et. al., 1994) . In general, APOE plays important roles not only on lipid and Aβ metabolism, but tau pathology, inflammation, neurite morphology and etc. Therefore, APOE can be a powerful target to moderate the AD patients in the late stage.

Apolipoprotein E (APOE) is the main cholesterol carrier in the brain. It is related to various biological processes in the nervous system, including neuron growth, synapse formation, Aβ amyloid clearance, and neuroinflammation. Among them, stimulating the degradation of Aβ through a variety of signal pathways and reducing the aggregation of Aβ in brain cells can reduce the incidence and progression of AD to a certain extent.

There are three common allelic variants of human APOE gene, namely APOE2, APOE3 and APOE4 three subtypes, of which APOE3 is wild type. Different subtypes have significant differences in the accumulation and clearance of Aβ in the brain, and they also have different regulatory effects on the regulation of lipid transport, glucose metabolism, neuronal signal transduction, neuroinflammation and mitochondrial function in the brain. Compared with APOE3 and APOE2, APOE4 is significantly weaker in Aβ clearance and other aspects. When the proportion of APOE4 subtypes is higher, the risk of AD is relatively higher. Therefore, APOE4 is considered to be the strongest genetic risk factor for AD and an important target for AD treatment.

Differences between the three Apo-E isoforms are limited to amino acid residues 112 and 158 of the mature Apo-E sequence, where either cysteine or arginine is present: Apo-E2 (Cys112, Cys158) , Apo-E3 (Cys112, Arg158) , and Apo-E4 (Arg112, Arg158) . The single amino acid differences at these two positions affect the structure of Apo-E isoforms and influence their ability to bind lipids, receptors and Aβ. ApoE3 and ApoE4 bind normally to the low density lipoprotein (LDL) receptor, whereas ApoE2 does not. Human and animal studies also clearly indicated that Apo-E isoforms differentially affect Aβ aggregation and clearance.

There are currently no effective therapies for arresting (and, more importantly, reversing) the impairment of central and peripheral nervous system function once an irreversible degenerative cascade begins. Likewise, there is no current therapy for restoration of normal, central and peripheral nervous system function when the induced stress has a less catastrophic or partially reversible effect compared to the dementias.

Most therapeutic approaches for AD target the Aβ pathway. With the recent failure of clinical trials of drugs targeting solely Aβ, an urgent need exists to define new targets and develop alternative therapeutic strategies to treat AD. As APOE genotype determines AD risk, and ApoE has crucial roles in cognition, ApoE might offer an attractive alternative target for AD therapy.

Current therapeutic approaches targeting to ApoE include: 1) Small molecules that disrupt ApoE4 intramolecular domain interaction (Chen et al., 2011; Wang et al., 2018; 2) ApoE2 overexpression by viral vector (Dodart et al., 2005; Hu, Liu, Chen, Zhang, Xu &Bu, 2015; Zhao et al., 2016) ; 3) Aβ Antibody That Targets the ApoE Binding Site; 4) ApoE Antibody (Liao et al., 2018; Kim et al., 2012) ; and 5) ApoE Antisense Oligonucleotides (Huynh et al., 2017) .

Genome editing is a powerful tool for biomedical research and development of therapeutics for diseases. So far, the most popular gene editing technology is the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) -Cas system, which was developed from the adaptive immune system of bacteria and archaea. CRISPR-Cas can precisely target and cleave genome DNA, generating Double-Strand DNA Breaks (DSB) . DSB can be repaired through non-homologous end joining (NHEJ) pathways, resulting in an insertion or deletion (Indel) , which, in most cases, inactivates the gene. Alternatively, the homology-directed repair (HDR) pathway can repair the DSB using homologous templates dsDNA or ssDNA, and thus achieve precise genome editing.

The disclosures of all publications, patents, patent applications and published patent applications referred to herein are hereby incorporated herein by reference in their entirety.

SUMMARY OF THE INVENTION

The present application provides methods of altering ApoE4 in a cell comprising a nucleic acid encoding ApoE4. The present invention also provides a method of ameliorating a symptom of a neurodegenerative disorder in an individual, comprising altering ApoE4 in the individual. The present invention also provides a method of improving function of a nervous system in an individual having an impaired function in the nervous system, the method comprises altering ApoE4 in the individual. Also provided are ApoE4 mutants have ApoE3-like functions, as well as cells comprising such ApoE4 mutants.

In some aspects, provided are methods of altering ApoE4 in a cell comprising a nucleic acid encoding ApoE4, the method comprising introducing into the cell one or more components of a nucleic acid editing system, wherein the nucleic acid editing system edits the nucleic acid encoding ApoE4 to mutate an amino acid at amino acid positions 225-294 of the ApoE4 encoded by the nucleic acid, wherein the amino acid positions are in reference to SEQ ID NO: 1, thereby producing an altered ApoE4 having an ApoE3-like function. In some aspects, provided are methods of ApoE4 in a cell comprising a nucleic acid encoding ApoE4, the method comprising introducing into the cell one or more components of a nucleic acid editing system, wherein the nucleic acid editing system edits the nucleic acid encoding ApoE4 to mutate an amino acid selected from the group consisting of: Q35, Q99, Q181, I195, Q219, E223, Q226, E230, M236, M239, S241, E249, K251, E252, Q253, E256, K260, E262, E263, Q264, Q266, Q267, I268, Q271, E273, K280, S281, E284, D289, Q302, and H317 of the ApoE4 encoded by the nucleic acid, in reference to SEQ ID NO: 1, thereby producing an altered ApoE having an ApoE3-like function. In some embodiments, the ApoE4 before mutation ( “unaltered ApoE4” ) comprises an amino acid sequence of SEQ ID NO: 1.

In some embodiments according to any of the methods described above, the ApoE3-like function comprises phospholipid binding capacity. In some embodiments, the altered ApoE4 displays decreased binding affinity to very-low-density lipoprotein (VLDL) as compared to unaltered ApoE4. In some embodiments, the altered ApoE4 displays increased (e.g., increasing at least about any of 10%, 20%, 30%, 40%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold, or more) binding affinity to high-density lipoprotein (HDL) as compared to unaltered ApoE4. In some embodiments, the altered ApoE4 exhibits increased (e.g., increasing at least about any of 10%, 20%, 30%, 40%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold, or more) amyloid β (Aβ) uptake as compared to unaltered ApoE4. In some embodiments, the altered ApoE4 facilitates an increased rate (e.g., increasing at least about any of 10%, 20%, 30%, 40%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold, or more) of Aβ clearance as compared to that facilitated by unaltered ApoE4. In some embodiments, the altered ApoE4 facilitates a decreased rate (e.g., decreasing at least about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%) of amyloid fibril formation as compared to that facilitated by unaltered ApoE4. In some embodiments, the altered ApoE4 facilitates a decreased rate (e.g., decreasing at least about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%) of amyloid plaque formation as compared to that facilitated by unaltered ApoE4.

In some embodiments according to any of the methods described above, the nucleic acid editing system edits the nucleic acid encoding ApoE4 to produce a mutation selected from the group consisting of: Q35R, Q99R, Q181R, I195V, Q219R, E223G, Q226R, E230G, M236V, M239V, S241G, E249G, K251E, K251R, E252G, Q253R, E256G, K260R, E262G, E263G, Q264R, Q266R, Q267R, I268V, Q271R, E273G, K280E, K280R, S281G, E284G, D289G, Q302R, and H317R, in reference to SEQ ID NO: 1. In some embodiments, the nucleic acid editing system edits the nucleic acid encoding ApoE4 to produce a mutation selected from the group consisting of: K251E, E252G, Q253R, E223G, M239V, and S241G, in reference to SEQ ID NO: 1.

In some embodiments according to any one of the methods described above, the nucleic acid encoding ApoE4 is a double stranded DNA. In some embodiments, the nucleic acid editing system comprises a DNA base editor. In some embodiments, the DNA base editor is a cytidine base editor (CBE) . In some embodiments, the CBE comprises: a fusion protein comprising: (i) a nucleic acid programmable DNA binding protein (napDNAbp) ; (ii) a cytidine deaminase domain; and (iii) an uracil glycosylase inhibitor (UGI) domain, wherein the napDNAbp is a CasX, CasY, Cpf1, C2c1, C2c2, C2c3, or Argonaute protein. In some embodiments, the DNA base editor is an adenosine base editor (ABE) . In some embodiments, the ABE comprises: an evolved Escherichia coli tRNAARG-modifying enzyme, TadA, covalently fused to a catalytically impaired Cas9 protein (D10A nickase Cas9, nCas9) ; wherein the ABE is complexed with a single guide RNA (sgRNA) , wherein the sgRNA directs the ABE to the DNA sequence encoding ApoE4, wherein the ABE catalyzes A·T to G·C transition mutation at defined base pairs.

In some embodiments according to any one of the methods described above, the nucleic acid encoding ApoE4 is a double stranded DNA, and the nucleic acid editing system functions through a homology directed repair pathway. In some embodiments, said cell is an induced pluripotent stem cell (iPSC) . In some embodiments, the nucleic acid editing system comprises a DNA nuclease selected from the group consisting of CRISPR/Cas9, TALE nuclease, and zinc finger nuclease.

In some embodiments according to any one of the methods described above, the nucleic acid encoding ApoE4 is an mRNA. In some embodiments, the nucleic acid editing system comprises an RNA base editor. In some embodiments, the RNA base editing system comprises an antisense oligonucleotide (AON) capable of forming a double stranded complex with a target RNA sequence in the cell, for the deamination of a target adenosine in the target RNA sequence by an adenosine deaminases acting on RNA (ADAR) , said AON comprising a Central Triplet of 3 sequential nucleotides, wherein the nucleotide directly opposite the target adenosine is the middle nucleotide of the Central Triplet, wherein 1 , 2 or 3 nucleotides in said Central Triplet comprise a sugar modification and/or a base modification to render the AON more stable and/or more effective in inducing deamination of the target adenosine; further wherein the middle nucleotide does not have a 2’-O-methyl modification; wherein the target RNA is an mRNA encoding ApoE4.

In some embodiments according to any one of the methods described above, the RNA based editing system is a composition comprising: i) a Cas13b effector protein; and ii) a CRISPR RNA (crRNA) , wherein the crRNA comprises a) a guide sequence that is capable of hybridizing to a target RNA sequence, and b) a direct repeat sequence, wherein there is formed a CRISPR complex comprising the Cas13b effector protein complexed with the guide sequence that is hybridized to the target RNA sequence, wherein the target RNA is an mRNA encoding ApoE4. In some embodiments, the composition comprises an accessory protein that enhances Cas13b effector protein activity. In some embodiments, the accessory protein is a Csx28 protein or a Csx27 protein.

In some embodiments according to any one of the methods described above, the RNA based editing system comprises a vector encoding one or more tRNAs having an anticodon sequence that recognizes the mRNA encoding ApoE4. In some embodiments, the tRNA is an endogenous tRNA with a modified anticodon stem recognizing the mRNA encoding ApoE4. In some embodiments, the RNA based editing system comprise engineered antisense oligonucleotides (ASO) , wherein each ASO comprises (i) specificity domain that determines programmed to target binding to the mRNA encoding ApoE4 and (ii) an invariant ADAR-recruiting domain to steer endogenous ADAR to an ASO: mRNA hybrid.

In some embodiments according to any one of the methods described above, the one or more components of the nucleic acid editing system is introduced into the cell via lipid nanoparticles. In some embodiments, the one or more components of the nucleic acid editing system is introduced into the cell via a vector, such as a viral vector.

In some embodiments according to any one of the methods described above, the cell is present in an individual, such as a human. In some embodiments, the individual has a neurodegenerative disorder.

One aspect of the present application provides a method of ameliorating a symptom of a neurodegenerative disorder in an individual (e.g., human) , comprising altering ApoE4 in the individual according to any one of the methods described herein. In some embodiments, the individual with altered ApoE4 exhibits an increased rate (e.g., increasing at least about any of 10%, 20%, 30%, 40%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold, or more) of Aβ clearance as compared to the same individual before the altering of ApoE4. In some embodiments, the individual with altered ApoE4 exhibits a decreased rate (e.g., decreasing at least about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%) of amyloid fibril formation as compared to the same individual before the altering of ApoE4. In some embodiments, the individual with altered ApoE4 exhibits a decreased rate (e.g., decreasing at least about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%) of amyloid plaque formation as compared to the same individual before the altering of ApoE4. In some embodiments, the neurodegenerative disorder is an early-onset familial disease, a late-onset familial disease, or a sporadic late-onset disease. In some embodiments, the neurodegenerative disorder is Alzheimer’s disease (AD) .

One aspect of the present application provides a method of improving function of a nervous system in an individual (e.g., human) having an impaired function in the nervous system, the method comprises altering ApoE4 in the individual according to any one of the methods described herein. In some embodiments, the individual carries at least one APOE4 allele in at least 90%of the neural cells. In some embodiments, the individual does not carry an APOE2 allele in at least 90%of the neural cells. In some embodiments, the individual exhibits APOE4 expression that is higher (e.g., at least about any of 10%, 20%, 30%, 40%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold, or more higher) than the median APOE4 expression in a population. In some embodiments, the individual exhibits the same or comparable (e.g., within about 10%difference) APOE4 expression as the median APOE4 expression in a population. In some embodiments, the individual exhibits a plasma ApoE4 concentration that is higher than the median plasma ApoE4 concentration in a population by at least about any of 10%, 20%, 30%, 40%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold, or more. In some embodiments, the individual exhibits a plasma ApoE4: ApoE3 concentration ratio that is higher than the median plasma ApoE4: ApoE3 concentration ratio in a population by at least about any of 10%, 20%, 30%, 40%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold, or more. In some embodiments, the individual exhibits a plasma ApoE4: ApoE2 concentration ratio that is higher than the median plasma ApoE4: ApoE2 concentration ratio in a population by at least about any of 10%, 20%, 30%, 40%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold, or more. In some embodiments, the individual exhibits a cerebrospinal fluid (CSF) ApoE4 concentration that is higher than the median CSF ApoE4 concentration in a population by at least 10%, 20%, 30%, 40%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold, or more. In some embodiments, the individual exhibits a CSF ApoE4: ApoE3 concentration ratio that is higher than the median CSF ApoE4: ApoE3 concentration ratio in a population by at least about any of 10%, 20%, 30%, 40%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold, or more. In some embodiments, the individual exhibits a CSF ApoE4: ApoE2 concentration ratio that is higher than the median CSF ApoE4: ApoE2 concentration ratio in a population by at least about any of 10%, 20%, 30%, 40%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold, or more. In some embodiments, the individual is at higher risk of developing early-onset familial neurodegenerative disease than the average population, optionally wherein the risk of the individual developing early-onset familial neurodegenerative disease is at least about any of 10%, 20%, 30%, 40%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold higher than that of the average population. In some embodiments, the individual is at higher risk of developing late-onset familial neurodegenerative disease than the average population, optionally wherein the risk of the individual developing late-onset familial neurodegenerative disease is at least about any of 10%, 20%, 30%, 40%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold higher than that of the average population. In some embodiments, the individual is at higher risk of developing sporadic late-onset neurodegenerative disease than the average population, optionally wherein the risk of the individual developing sporadic late-onset neurodegenerative disease is at least about any of 10%, 20%, 30%, 40%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold higher than that of the average population.

Also provided are ApoE4 mutants having ApoE3-like function generated by any of the ApoE4 alteration methods described herein.

In another aspect, there are provided ApoE mutants having ApoE3-like function, wherein the ApoE4 mutant comprises a mutation within amino acid positions 225-294, wherein the amino acid positions are in reference to a wild-type ApoE4 (SEQ ID NO: 1) . In another aspect, there are provided ApoE4 mutants having ApoE3-like function, wherein the ApoE4 mutant comprises a mutation at an amino acid selected from the group consisting of: Q35, Q99, Q181, I195, Q219, E223, Q226, E230, M236, M239, S241, E249, K251, E252, Q253, E256, K260, E262, E263, Q264, Q266, Q267, I268, Q271, E273, K280, S281, E284, D289, Q302, and H317, in reference to a wild-type ApoE4 (SEQ ID NO: 1) .

In some embodiments according to any of the ApoE4 mutants described above, the ApoE3-like function comprises phospholipid binding capacity. In some embodiments, the ApoE4 mutant displays decreased (e.g., decreasing at least about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%) binding affinity to VLDL as compared to wild-type ApoE4. In some embodiments, the ApoE4 mutant displays increased (e.g., increasing at least about any of 10%, 20%, 30%, 40%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold, or more) binding affinity to HDL as compared to wild-type ApoE4. In some embodiments, the ApoE4 mutant exhibits increased (e.g., increasing at least about any of 10%, 20%, 30%, 40%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold, or more) Aβ uptake as compared to wild-type ApoE4. In some embodiments, the ApoE4 mutant facilitates an increased rate (e.g., increasing at least about any of 10%, 20%, 30%, 40%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold, or more) of Aβclearance as compared to that facilitated by wild-type ApoE4. In some embodiments, the ApoE4 mutant facilitates a decreased rate (e.g., decreasing at least about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%) of amyloid fibril formation as compared to that facilitated by wild-type ApoE4. In some embodiments, the ApoE4 mutant facilitates a decreased rate (e.g., decreasing at least about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%) of amyloid plaque formation as compared to that facilitated by wild-type ApoE4.

In some embodiments according to any of the ApoE4 mutants described above, the ApoE4 mutant comprises (including consisting of or consisting essentially of) a mutation selected from the group consisting of: Q35R, Q99R, Q181R, I195V, Q219R, E223G, Q226R, E230G, M236V, M239V, S241G, E249G, K251E, K251R, E252G, Q253R, E256G, K260R, E262G, E263G, Q264R, Q266R, Q267R, I268V, Q271R, E273G, K280E, K280R, S281G, E284G, D289G, Q302R, and H317R, in reference to SEQ ID NO: 1. In some embodiments, ApoE4 mutant comprises a mutation selected from the group consisting of: K251E, E252G, Q253R, E223G, M239V, and S241G, in reference to SEQ ID NO: 1.

In some embodiments according to any of the ApoE4 mutants described above, the ApoE4 mutant comprises a Signal Peptide corresponding to amino acid positions 1-18 in reference to SEQ ID NO: 1. In some embodiments, the ApoE4 does not comprise a Signal Peptide corresponding to amino acid positions 1-18 in reference to SEQ ID NO: 1.

In some aspects, provided are ApoE4 mutants having ApoE3-like function, wherein the ApoE4 mutant is generated by any one of the methods of altering ApoE4 in a cell described herein.

BRIEF DESCRIPTION OF DRAWINGS

FIG. 1A illustrates the schematics of an Aβ uptake assay performed on astroglial cells SVG p12. FIG. 1B shows the results of an Aβ uptake assay in astroglial cells expressing different APOE variants (APOE2, APOE3, APOE4) .

FIG. 1C illustrates the schematics of an Aβ degradation assay performed on astroglial cells SVG p12. FIG. 1B shows the results of an Aβ degradation assay in astroglial cells expressing different APOE variants (APOE3, APOE4) .

FIG. 2A illustrates the schematics of screening of astroglial cells expressing the APOE4 mutants including an Aβ uptake assay as the primary screen and an Aβdegradation assay as the secondary screen. FIG. 2B shows the APOE4 mutation sites resulting in increased Aβ uptake capacity corresponding to APOE protein functional regions. FIG. 2C shows the results of the Aβ degradation assay in astroglial cells expressing the indicated APOE4 mutations.

FIG. 3A illustrates the schematics of the generation and selection of ApoE-4 expressing iPS cell lines by CRISPR-Cas9 knock-in method. FIG. 3B shows the Sanger sequencing of five ApoE-4 expressing iPS cell lines (APOE-4, 1#to 5#) as well as the ApoE3 iPS cell line (cell source before ApoE-4 knock-in) .

DETAILED DESCRIPTON OF THE INVENTION

APOE4 allelic variant is considered to be the strongest genetic risk factor for AD and an important target for AD treatment. The present application provides methods of altering ApoE4 in a cell comprising a nucleic acid encoding ApoE4, the method comprising introducing into the cell one or more components of a nucleic acid editing system, wherein the nucleic acid editing system edits the nucleic acid encoding ApoE4 to mutate one or more nucleic acids within encoded by the nucleic acid, thereby producing an altered ApoE (ApoE4 mutant, or “altered ApoE4” ) having an ApoE3-like function. Altering ApoE4 to a phenotype resembling that of ApoE3 facilitates increased binding capacity to certain phospholipids (e.g., VLDL) and increased Aβ uptake, thereby alleviating symptoms of AD such as amyloid fibril and plaque formations. Also provided are various ApoE4 mutants having ApoE-3 like function, such as increased VLDL binding capacity and/or increased Aβ uptake capacity. Also provided are cells comprising one or more of the ApoE4 mutants.

The present invention provides effective gene therapies for treating disorders associated with ApoE4, such as AD. Modification of the structure of ApoE4 to form an ApoE3-like molecule may provide an effective approach to ameliorate the toxic effects of APOE4 protein.

In some embodiments, the nucleic acid encoding ApoE4 is a DNA, wherein the nucleic acid editing system can be a system that function through homology directed repair pathway (e.g., CRISPR/Cas9) , as well as DNA base editors such as adenosine base editors (ABEs) and cytidine base editors (CBEs) .

In some embodiments, the nucleic acid encoding ApoE4 is an RNA, wherein the nucleic acid editing system is an RNA base editor, wherein the RNA editing methods comprise specially designed RNAs for recruiting deaminases, such as adenosine deaminase acting on mRNA encoding ApoE4.

In some embodiments, the cell in which the ApoE4 is altered is a neuron. In some embodiments, the cell in which the ApoE4 is altered is an immortalized astrocyte or glial cell. In some embodiments, the cell in which the ApoE4 is altered is an induced pluripotent stem cell (iPS cell) . In some embodiments, the iPSC cell is differentiated into iPSC-derived astrocytes or microglial cells. In some embodiments, the cell in which the ApoE4 is altered is an iPSC-derived astrocyte or an iPSC-derived microglial cell.

Definitions

The present invention will be described with respect to particular embodiments and with reference to certain drawings, but the invention is not limited thereto but only by the claims. Any reference signs in the claims shall not be construed as limiting the scope. Where the term "comprising" is used in the present description and claims, it does not exclude other elements or steps. Where an indefinite or definite article is used when referring to a singular noun e.g., “a” or “an” , “the” , this includes a plural of that noun unless something else is specifically stated. For the recitation of numeric ranges of nucleotides herein, each intervening number there between, is explicitly contemplated. For example, for the range of 225-294 amino acid positions, any integer of nucleotides between 225 and 294 amino acid positions is contemplated in addition to the numbers of position 225 and position 294.

The following terms or definitions are provided solely to aid in the understanding of the invention. Unless specifically defined herein, all terms used herein have the same meaning as they would to one skilled in the art of the present invention. Practitioners are particularly directed to Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Press, Plainsview, New York (1989) ; and Ausubel et al., Current Protocols in Molecular Biology (Supplement 47) , John Wiley &Sons, New York (1999) , for definitions and terms of the art. The definitions provided herein should not be construed to have a scope less than understood by a person of ordinary skill in the art.

The terms “polynucleotide” , “nucleotide sequence” and “nucleic acid” are used interchangeably. They refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof.

The terms “adenine” , “guanine” , “cytosine” , “thymine” , “uracil” and “hypoxanthine” as used herein refer to the nucleobases as such. The terms “adenosine” , “guanosine” , “cytidine” , “thymidine” , “uridine” and “inosine” , refer to the nucleobases linked to the ribose or deoxyribose sugar moiety. The term “nucleoside” refers to the nucleobase linked to the ribose or deoxyribose. The term "nucleotide" refers to the respective nucleobase-ribosyl-phosphate or nucleobase-deoxyribosyl-phosphate. Sometimes the terms adenosine and adenine (with the abbreviation, “A” ) , guanosine and guanine (with the abbreviation, “G” ) , cytosine and cytidine (with the abbreviation, “C”) , uracil and uridine (with the abbreviation, “U” ) , thymine and thymidine (with the abbreviation, “T” ) , inosine and hypo-xanthine (with the abbreviation, “I” ) , are used interchangeably to refer to the corresponding nucleobase, nucleoside or nucleotide. Sometimes the terms nucleobase, nucleoside and nucleotide are used interchangeably, unless the context clearly requires differently.

It will be understood by one of ordinary skill in the art that uracil and thymine can both be represented by ‘t’ , instead of ‘u’ for uracil and ‘t’ for thymine; in the context of a ribonucleic acid, it will be understood that ‘t’ is used to represent uracil unless otherwise indicated.

In the context of the present application, "target RNA" refers to an RNA sequence to which a deaminase-recruiting RNA sequence is designed to have perfect complementarity or substantial complementarity, and hybridization between the target sequence and the anti-sense oligonucleotide (ASO) forms a double stranded RNA (dsRNA) region containing a target adenosine, which recruits an adenosine deaminase acting on RNA (ADAR) that deaminates the target adenosine. In some embodiments, the ADAR is naturally present in a host cell, such as a eukaryotic cell (preferably, a mammalian cell, more preferably, a human cell) . In some embodiments, the ADAR is introduced into the host cell.

As used herein, "complementarity" refers to the ability of a nucleic acid to form hydrogen bond (s) with another nucleic acid by traditional Watson-Crick base-pairing. A percent complementarity indicates the percentage of residues in a nucleic acid molecule which can form hydrogen bonds (i.e., Watson-Crick base pairing) with a second nucleic acid (e.g., about 5, 6, 7, 8, 9, 10 out of 10, being about 50%, 60%, 70%, 80%, 90%, and 100%complementary respectively) . "Perfectly complementary" means that all the contiguous residues of a nucleic acid sequence form hydrogen bonds with the same number of contiguous residues in a second nucleic acid sequence. "Substantially complementary" as used herein refers to a degree of complementarity that is at least about any one of 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100%over a region of about 40, 50, 60, 70, 80, 100, 150, 200, 250 or more nucleotides, or refers to two nucleic acids that hybridize under stringent conditions.

As used herein, "stringent conditions" for hybridization refer to conditions under which a nucleic acid having complementarity to a target sequence predominantly hybridizes with the target sequence, and substantially does not hybridize to non-target sequences. Stringent conditions are generally sequence-dependent, and vary depending on a number of factors. In general, the longer the sequence, the higher the temperature at which the sequence specifically hybridizes to its target sequence. Non-limiting examples of stringent conditions are described in detail in Tijssen (1993) , Laboratory Techniques In Biochemistry And Molecular Biology-Hybridization With Nucleic Acid Probes Part I, Second Chapter "Overview of principles of hybridization and the strategy of nucleic acid probe assay" , Elsevier, N, Y.

"Hybridization" refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized via hydrogen bonding between the bases of the nucleotide residues. The hydrogen bonding may occur by Watson Crick base pairing, Hoogstein binding, or in any other sequence specific manner. A sequence capable of hybridizing with a given sequence is referred to as the "complement" of the given sequence.

As used herein, the terms “cell” , “cell line” , and “cell culture” are used interchangeably and all such designations include progeny. It is understood that all progenies may not be precisely identical in DNA content, due to deliberate or inadvertent mutations. Variant progenies that have the same function or biological activity as the original cells are included.

As used herein, unless otherwise specified, “an article” can refer to one or more of such articles, such as but not limited to any one of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 100, or 1000 such articles, or any number of articles therebetween. For example, “a mutation” can refer to one or more mutations, such as but not limited to any one of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 100, or 1000 mutations, or any number of mutations therebetween. For example, “an amino acid” can refer to one or more mutations, such as but not limited to any one of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 100, or 1000 mutations, or any number of amino acids therebetween.

Wild-type ApoE4 (unaltered ApoE4)

The present invention provides method of altering a naturally occurring ApoE4 (also referred to as wildtype ApoE4, endogenous ApoE4 or unaltered ApoE4) by introducing one or more mutations to produce an altered ApoE4 having an ApoE3-like function (referred to herein as altered ApoE4 or ApoE4 mutants) , as well as altered ApoE4 or ApoE4 mutants resulting from such methods.

In some embodiments, the unaltered ApoE4 comprises an amino acid sequence of SEQ ID NO: 1. In some embodiments, the unaltered ApoE4 comprises an amino acid sequence with at least about any one of 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or higher sequence similarity to SEQ ID NO: 1. In some embodiments, the unaltered ApoE4 comprises an amino acid sequence with at least about 95%sequence similarity to SEQ ID NO: 1. In some embodiments, the unaltered ApoE4 comprises an amino acid sequence with at least about 98%sequence similarity to SEQ ID NO: 1. In some embodiments, the unaltered ApoE4 is encoded by a nucleic acid comprising the sequence of SEQ ID NO: 2.

APOE protein consists of 317 amino acid residues, of which amino acids 1-18 are signal peptides, which are excised after post-translation modification. The biologically active APOE protein consists of 299 amino acid residues. ApoE4 can comprises a Signal Peptide Region (prior to post-translation modification) , an N-terminal Helix1 to Helix 4 Region, a C-terminal lipid and lipoprotein binding region, and a C-terminal amino acid region.

Editing of nucleic acids encoding ApoE4

Presented herein are methods of modifying the function of ApoE4 to ApoE3-like via gene editing or RNA editing approaches. In some embodiments, the methods of altering ApoE4 produces an altered ApoE (or altered ApoE4) having an ApoE3-like phospholipid binding capacity. In some embodiments, the ApoE4 before the alteration ( “unaltered ApoE4) comprises an amino acid sequence of SEQ ID NO: 1. In some embodiments, the ApoE4 before the alteration comprises an amino acid sequence with at least about any one of 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or higher sequence similarity to SEQ ID NO: 1. In some embodiments, the ApoE4 before the alteration comprises an amino acid sequence with at least about 95%sequence similarity to SEQ ID NO: 1. In some embodiments, the ApoE4 before the alteration comprises an amino acid sequence with at least about 98% sequence similarity to SEQ ID NO: 1.

With reference to SEQ ID NO: 1, an unaltered ApoE4 can comprise a Signal Peptide (amino acid positions 1-18) , Helix N1 (amino acid positions 24-27) , Helix N2 (amino acid positions 30-40) , Helix 1 (amino acid positions 44-70) , Helix 2 (amino acid positions 73-97) , Helix 3 (amino acid positions 107-143) , Helix 4 (amino acid positions 149-182) , Hinge (amino acid positions 186-217) , Helix C1 (amino acid positions 228-241) , Helix C2 (amino acid positions 254-284) and Helix C3 (amino acid positions 289-294) . In some embodiments, provided herein is a method of altering ApoE4 in a cell comprising a nucleic acid encoding ApoE4, the method comprising introducing into the cell one or more components of a nucleic acid editing system, wherein the nucleic acid editing system edits the nucleic acid encoding ApoE4 to mutate one or more amino acids within Helix N1, Helix N2, Helix 1, Helix 2, Helix 3, Helix 4, Hinge, Helix C1, Helix C2 and/or Helix C3 in the ApoE4 encoded by the nucleic acid, thereby producing an altered ApoE4 having an ApoE3-like function. In some embodiments, provided herein is a method of altering ApoE4 in a cell comprising a nucleic acid encoding ApoE4, the method comprising introducing into the cell one or more components of a nucleic acid editing system, wherein the nucleic acid editing system edits the nucleic acid encoding ApoE4 to mutate one or more amino acids within Helix C1 of the ApoE4 encoded by the nucleic acid, thereby producing an altered ApoE4 having an ApoE3-like function. In some embodiments, provided herein is a method of altering ApoE4 in a cell comprising a nucleic acid encoding ApoE4, the method comprising introducing into the cell one or more components of a nucleic acid editing system, wherein the nucleic acid editing system edits the nucleic acid encoding ApoE4 to mutate one or more amino acids within Helix C2 of the ApoE4 encoded by the nucleic acid, thereby producing an altered ApoE4 having an ApoE3-like function.

In some embodiments, there is provided a method of altering ApoE4 in a cell comprising a nucleic acid encoding ApoE4, the method comprising introducing into the cell one or more components of a nucleic acid editing system, wherein the nucleic acid editing system edits the nucleic acid encoding ApoE4 to mutate one or more amino acids within amino acid positions 228-241 of the ApoE4 encoded by the nucleic acid, wherein the amino acid positions are in reference to SEQ ID NO: 1, thereby producing an altered ApoE4 having an ApoE3-like function, optionally wherein the nucleic acid editing system edits the nucleic acid encoding ApoE4 to mutate one or more of E230, M236, M239, and/or S241 in reference to SEQ ID NO: 1. In some embodiments, there is provided a method of altering ApoE4 in a cell comprising a nucleic acid encoding ApoE4, the method comprising introducing into the cell one or more components of a nucleic acid editing system, wherein the nucleic acid editing system edits the nucleic acid encoding ApoE4 to mutate one or more amino acids within amino acid positions 254-284 of the ApoE4 encoded by the nucleic acid, wherein the amino acid positions are in reference to SEQ ID NO: 1, thereby producing an altered ApoE4 having an ApoE3-like function, optionally wherein the nucleic acid editing system edits the nucleic acid encoding ApoE4 to mutate one or more of E256, E262, Q264, Q267, Q271, K280, S281, K260, E263, Q266, I268, E273, K280, and/or E284 in reference to SEQ ID NO: 1. In some embodiments, there is provided a method of altering ApoE4 in a cell comprising a nucleic acid encoding ApoE4, the method comprising introducing into the cell one or more components of a nucleic acid editing system, wherein the nucleic acid editing system edits the nucleic acid encoding ApoE4 to mutate one or more amino acids within amino acid positions 289-294 of the ApoE4 encoded by the nucleic acid, wherein the amino acid positions are in reference to SEQ ID NO: 1, thereby producing an altered ApoE4 having an ApoE3-like function. In some embodiments according to the methods described herein, the ApoE4 before mutation ( “unaltered ApoE4” ) comprises an amino acid sequence of SEQ ID NO: 1.

With reference to SEQ ID NO: 1, an unaltered ApoE4 can comprise a Signal Peptide Region (amino acid positions 1-18) , an N-terminal Helix1 to Helix 4 Region (amino acid positions 19-184) , a Hinge Region (amino acid positions 185-224) , a C-terminal lipid and lipoprotein binding region (amino acid positions 225-294) , and a C-terminal amino acid region (amino acid positions 295-317) . In some embodiments, provided is a method of altering ApoE4 in a cell comprising a nucleic acid encoding ApoE4, the method comprising introducing into the cell one or more components of a nucleic acid editing system, wherein the nucleic acid editing system edits the nucleic acid encoding ApoE4 to mutate one or more amino acids within the N-terminal Helix1 to Helix 4 Region (amino acid positions 19-184) , the Hinge Region (amino acid positions 185-224) , the C-terminal lipid and lipoprotein binding region (amino acid positions 225-294) , and/or the C-terminal amino acid region (amino acid positions 295-317) of the ApoE4 encoded by the nucleic acid, wherein the amino acid positions are in reference to SEQ ID NO: 1, thereby producing an altered ApoE4 having an ApoE3-like function. In some embodiments, provided is a method of altering ApoE4 in a cell comprising a nucleic acid encoding ApoE4, the method comprising introducing into the cell one or more components of a nucleic acid editing system, wherein the nucleic acid editing system edits the nucleic acid encoding ApoE4 to mutate one or more amino acids within the C-terminal lipid and lipoprotein binding region (amino acid positions 225-294) of the ApoE4 encoded by the nucleic acid, thereby producing an altered ApoE4 having an ApoE3-like function, wherein the amino acid positions are in reference to SEQ ID NO: 1.

In some embodiments, there is provided a method of altering ApoE4 in a cell comprising a nucleic acid encoding ApoE4, the method comprising introducing into the cell one or more components of a nucleic acid editing system, wherein the nucleic acid editing system edits the nucleic acid encoding ApoE4 to mutate one or more amino acids within amino acid positions 225-294 of the ApoE4 encoded by the nucleic acid, wherein the amino acid positions are in reference to SEQ ID NO: 1, thereby producing an altered ApoE4 having an ApoE3-like function. In some embodiments, there is provided a method of altering ApoE4 in a cell comprising a nucleic acid encoding ApoE4, the method comprising introducing into the cell one or more components of a nucleic acid editing system, wherein the nucleic acid editing system edits the nucleic acid encoding ApoE4 to mutate one or more amino acids at amino acid positions 19-184 of the ApoE4 encoded by the nucleic acid, wherein the amino acid positions are in reference to SEQ ID NO: 1, thereby producing an altered ApoE4 having an ApoE3-like function, optionally wherein the nucleic acid editing system edits the nucleic acid encoding ApoE4 to mutate one or more amino acids selected from the group consisting of: Q35, Q99 and Q181 in reference to SEQ ID NO: 1. In some embodiments, there is provided a method of altering ApoE4 in a cell comprising a nucleic acid encoding ApoE4, the method comprising introducing into the cell one or more components of a nucleic acid editing system, wherein the nucleic acid editing system edits the nucleic acid encoding ApoE4 to mutate one or more amino acids at amino acid positions 185-224 of the ApoE4 encoded by the nucleic acid, wherein the amino acid positions are in reference to SEQ ID NO: 1, thereby producing an altered ApoE4 having an ApoE3-like function, optionally wherein the nucleic acid editing system edits the nucleic acid encoding ApoE4 to mutate one or more amino acids selected from the group consisting of: I195, Q219, and E223 in reference to SEQ ID NO: 1. In some embodiments, there is provided a method of altering ApoE4 in a cell comprising a nucleic acid encoding ApoE4, the method comprising introducing into the cell one or more components of a nucleic acid editing system, wherein the nucleic acid editing system edits the nucleic acid encoding ApoE4 to mutate one or more amino acids at amino acid positions 225-294 of the ApoE4 encoded by the nucleic acid, wherein the amino acid positions are in reference to SEQ ID NO: 1, thereby producing an altered ApoE4 having an ApoE3-like function, optionally wherein the nucleic acid editing system edits the nucleic acid encoding ApoE4 to mutate one or more amino acids selected from the group consisting of: Q226, E230, M236, M239, S241, E249, K251, E252, Q253, E256, K260, E262, E263, Q264, Q266, Q267, I268, Q271, E273, K280, S281, E284, and D289 in reference to SEQ ID NO: 1. In some embodiments, there is provided a method of altering ApoE4 in a cell comprising a nucleic acid encoding ApoE4, the method comprising introducing into the cell one or more components of a nucleic acid editing system, wherein the nucleic acid editing system edits the nucleic acid encoding ApoE4 to mutate one or more amino acids at amino acid positions 295-317 of the ApoE4 encoded by the nucleic acid, wherein the amino acid positions are in reference to SEQ ID NO: 1, thereby producing an altered ApoE4 having an ApoE3-like function, optionally wherein the nucleic acid editing system edits the nucleic acid encoding ApoE4 to mutate Q302 and/or H317 in reference to SEQ ID NO: 1. In some embodiments according to the methods described herein, the ApoE4 before mutation ( “unaltered ApoE4” ) comprises an amino acid sequence of SEQ ID NO: 1.

In some embodiments, there is provided a method of altering ApoE4 in a cell comprising a nucleic acid encoding ApoE4, the method comprising introducing into the cell one or more components of a nucleic acid editing system, wherein the nucleic acid editing system edits the nucleic acid encoding ApoE4 to mutate one or more of amino acids selected from the group consisting of: Q35, Q99, Q181, I195, Q219, E223, Q226, E230, M236, M239, S241, E249, K251, E252, Q253, E256, K260, E262, E263, Q264, Q266, Q267, I268, Q271, E273, K280, S281, E284, D289, Q302, and H317 of the ApoE4 encoded by the nucleic acid, in reference to SEQ ID NO: 1, thereby producing an altered ApoE4 having an ApoE3-like function. In some embodiments, there is provided a method of altering ApoE4 in a cell comprising a nucleic acid encoding ApoE4, the method comprising introducing into the cell one or more components of a nucleic acid editing system, wherein the nucleic acid editing system edits the nucleic acid encoding ApoE4 to mutate one or more amino acids selected from the group consisting of: K251, E252, Q253, E223, M239, and S241 of the ApoE4 encoded by the nucleic acid, in reference to SEQ ID NO: 1, thereby producing an altered ApoE4 having an ApoE3-like function. In some embodiments according to the methods described herein, the ApoE4 before mutation ( “unaltered ApoE4” ) comprises an amino acid sequence of SEQ ID NO: 1.

In some embodiments, the nucleic acid editing system edits the nucleic acid encoding ApoE4 to produce one or more mutations selected from the group consisting of:Q35R, Q99R, Q181R, I195V, Q219R, E223G, Q226R, E230G, M236V, M239V, S241G, E249G, K251E, K251R, E252G, Q253R, E256G, K260R, E262G, E263G, Q264R, Q266R, Q267R, I268V, Q271R, E273G, K280E, K280R, S281G, E284G, D289G, Q302R, and H317R in reference to SEQ ID NO: 1. In some embodiments, the nucleic acid editing system edits the nucleic acid encoding ApoE4 to produce one or more mutations selected from the group consisting of: K251E, E252G, Q253R, E223G, M239V, and S241G in reference to SEQ ID NO: 1. In some embodiments, the nucleic acid editing system edits the nucleic acid encoding ApoE4 to produce a K251E mutation in reference to SEQ ID NO: 1. In some embodiments, the nucleic acid editing system edits the nucleic acid encoding ApoE4 to produce an E252G mutation in reference to SEQ ID NO: 1. In some embodiments, the nucleic acid editing system edits the nucleic acid encoding ApoE4 to produce a Q253R mutation in reference to SEQ ID NO: 1. In some embodiments, the nucleic acid editing system edits the nucleic acid encoding ApoE4 to produce an E223G mutation in reference to SEQ ID NO: 1. In some embodiments, the nucleic acid editing system edits the nucleic acid to encoding ApoE4 produce a M239V mutation in reference to SEQ ID NO: 1. In some embodiments, the nucleic acid editing system edits the nucleic acid encoding ApoE4 to produce a S241G mutation in reference to SEQ ID NO: 1. In some embodiments according to the methods described herein, the ApoE4 before mutation ( “unaltered ApoE4” ) comprises an amino acid sequence of SEQ ID NO: 1.

In some embodiments, the altered ApoE4 displays decreased binding affinity to very low density lipoprotein (VLDL) as compared to an unaltered ApoE4. In some embodiments, the binding affinity of the altered ApoE4 to VLDL is lower by about any one of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2-fold, 3-fold, 5-fold, 10-fold, 20-fold or more as compared to that of an unaltered ApoE4. In some embodiments, the altered ApoE4 displays increased binding affinity to high density lipoprotein (HDL) as compared to an unaltered ApoE4. In some embodiments, the binding affinity of the altered ApoE4 to HDL is higher by about any one of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2-fold, 3-fold, 5-fold, 10-fold, 20-fold or more as compared to that of an unaltered ApoE4. In some embodiments, the altered ApoE4 exhibits an increase in Aβ uptake as compared to unaltered ApoE4. In some embodiments, the altered ApoE4 exhibits increased Aβ uptake by about any one of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2-fold, 3-fold, 5-fold, 10-fold, 20-fold or more as compared to unaltered ApoE4. In some embodiments, the altered ApoE4 facilitates an increased rate of Aβ clearance as compared to that facilitated by unaltered ApoE4. In some embodiments, the altered ApoE4 facilitates Aβ clearance at a rate that is higher by about any one of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2-fold, 3-fold, 5-fold, 10-fold, 20-fold or more as compared to unaltered ApoE4. In some embodiments, the altered ApoE4 facilitates a decreased rate of amyloid fibril formation as compared to that facilitated by unaltered ApoE4. In some embodiments, the altered ApoE4 facilitates a decreased rate of amyloid plaque formation as compared to that facilitated by unaltered ApoE4.

In some embodiments, the nucleic acid encoding ApoE4 is a double stranded DNA. In some embodiments, the nucleic acid encoding ApoE4 is an mRNA.

ApoE4 mutants having ApoE3-like function (altered ApoE4)

Presented herein are ApoE4 mutants having altered properties (such as ApoE-3 like function) as compared to a wild-type ApoE4. In some embodiments, provided are ApoE4 mutants, generated by modifying the function of ApoE4 to ApoE3-like via gene editing approaches. In some embodiments, provided are ApoE4 mutants, generated by introducing one or more mutation in reference to wild-type ApoE4 via gene editing approaches. In some embodiments, the ApoE4 mutant comprises an ApoE3-like phospholipid binding capacity.

With reference to SEQ ID NO: 1, wild-type ApoE4 can comprise a Signal Peptide (amino acid positions 1-18) , Helix N1 (amino acid positions 24-27) , Helix N2 (amino acid positions 30-40) , Helix 1 (amino acid positions 44-70) , Helix 2 (amino acid positions 73-97) , Helix 3 (amino acid positions 107-143) , Helix 4 (amino acid positions 149-182) , Hinge (amino acid positions 186-217) , Helix C1 (amino acid positions 228-241) , Helix C2 (amino acid positions 254-284) and Helix C3 (amino acid positions 289-294) regions. In some embodiments, provided is an ApoE4 mutant having ApoE3-like function, wherein the ApoE4 mutant comprises one or more mutations within Helix N1, Helix N2, Helix 1, Helix 2, Helix 3, Helix 4, Hinge, Helix C1, Helix C2 and/or Helix C3 with reference to a wild-type ApoE4 (SEQ ID NO: 1) . In some embodiments, provided is an ApoE4 mutant having ApoE3-like function, wherein the ApoE4 mutant comprises one or more mutations within Helix C1 with reference to a wild-type ApoE4 (SEQ ID NO: 1) . In some embodiments, provided is an ApoE4 mutant having ApoE3-like function, wherein the ApoE4 mutant comprises one or more mutations within Helix C2 with reference to a wild-type ApoE4 (SEQ ID NO: 1) .

In some embodiments, provided is an ApoE4 mutant having ApoE3-like function, wherein the ApoE4 mutant comprises one or more mutations within amino acid positions 228-241, wherein the amino acid positions are with reference to a wild-type ApoE4 (SEQ ID NO: 1) . In some embodiments, provided is an ApoE4 mutant having ApoE3-like function, wherein the ApoE4 mutant comprises one or more mutations within amino acid positions 254-284, wherein the amino acid positions are with reference to a wild-type ApoE4 (SEQ ID NO: 1) . In some embodiments, provided is an ApoE4 mutant having ApoE3-like function, wherein the ApoE4 mutant comprises one or more mutations within amino acid positions 289-294, wherein the amino acid positions are with reference to a wild-type ApoE4 (SEQ ID NO: 1) .

With reference to SEQ ID NO: 1, a wild-type ApoE4 can comprise a Signal Peptide Region (amino acid positions 1-18) , an N-terminal Helix1 to Helix 4 Region (amino acid positions 19-184) , a Hinge Region (amino acid positions 185-224) , a C-terminal lipid and lipoprotein binding region (amino acid positions 225-294) , and a C-terminal amino acid region (amino acid positions 295-317) . In some embodiments, provided is an ApoE4 mutant having ApoE3-like function, wherein the ApoE4 mutant comprises one or more mutations within the N-terminal Helix1 to Helix 4 Region (amino acid positions 19-184) , the Hinge Region (amino acid positions 185-224) , the C-terminal lipid and lipoprotein binding region (amino acid positions 225-294) , and/or the C-terminal amino acid region (amino acid positions 295-317) , wherein the amino acid positions are with reference to a wild-type ApoE4 (SEQ ID NO: 1) . In some embodiments, provided is an ApoE4 mutant having ApoE3-like function, wherein the ApoE4 mutant comprises one or more mutations within the C-terminal lipid and lipoprotein binding region with reference to a wild-type ApoE4 (SEQ ID NO: 1) .

In some embodiments, provided is an ApoE4 mutant having ApoE3-like function, wherein the ApoE4 mutant comprises one or more mutations within amino acid positions 225-294, wherein the amino acid positions are with reference to a wild-type ApoE4 (SEQ ID NO: 1) . In some embodiments, provided is an ApoE4 mutant having ApoE3-like function, wherein the ApoE4 mutant comprises one or more mutations within amino acid positions 19-184, wherein the amino acid positions are with reference to a wild-type ApoE4 (SEQ ID NO: 1) , optionally wherein the ApoE4 mutant comprises one or more mutations at one or more amino acids selected from the group consisting of: Q35, Q99 and Q181 in reference to SEQ ID NO: 1. In some embodiments, provided is an ApoE4 mutant having ApoE3-like function, wherein the ApoE4 mutant comprises one or more mutations within amino acid positions 185-224, wherein the amino acid positions are with reference to a wild-type ApoE4 (SEQ ID NO: 1) , optionally wherein the ApoE4 mutant comprises one or more mutations at one or more amino acids selected from the group consisting of: I195, Q219, and E223 in reference to SEQ ID NO: 1. In some embodiments, provided is an ApoE4 mutant having ApoE3-like function, wherein the ApoE4 mutant comprises one or more mutations within amino acid positions 225-294, wherein the amino acid positions are with reference to a wild-type ApoE4 (SEQ ID NO: 1) , optionally wherein the ApoE4 mutant comprises one or more mutations at one or more amino acids selected from the group consisting of: Q226, E230, M236, M239, S241, E249, K251, E252, Q253, E256, K260, E262, E263, Q264, Q266, Q267, I268, Q271, E273, K280, S281, E284, and D289 in reference to SEQ ID NO: 1. In some embodiments, provided is an ApoE4 mutant having ApoE3-like function, wherein the ApoE4 mutant comprises one or more mutations within amino acid positions 295-317, wherein the amino acid positions are with reference to a wild-type ApoE4 (SEQ ID NO: 1) , optionally wherein the ApoE4 mutant comprises one or more mutations at amino acid Q302 and/or H317 in reference to SEQ ID NO: 1.

In some embodiments, provided is an ApoE4 mutant having ApoE3-like function, wherein the ApoE4 mutant comprises (including consisting of or consisting essentially of) one or more mutations at one or more of amino acids selected from the group consisting of: Q35, Q99, Q181, I195, Q219, E223, Q226, E230, M236, M239, S241, E249, K251, E252, Q253, E256, K260, E262, E263, Q264, Q266, Q267, I268, Q271, E273, K280, S281, E284, D289, Q302, and H317 with reference to a wild-type ApoE4 (SEQ ID NO: 1) . In some embodiments, provided is an ApoE4 mutant having ApoE3-like function, wherein the ApoE4 mutant comprises (including consisting of or consisting essentially of) one or more mutations at one or more amino acids selected from the group consisting of: K251, E252, Q253, E223, M239, and S241 with reference to a wild-type ApoE4 (SEQ ID NO: 1) .

In some embodiments, provided is an ApoE4 mutant having ApoE3-like function, wherein the ApoE4 mutant comprises (including consisting of or consisting essentially of) one or more mutations selected from the group consisting of: Q35R, Q99R, Q181R, I195V, Q219R, E223G, Q226R, E230G, M236V, M239V, S241G, E249G, K251E, K251R, E252G, Q253R, E256G, K260R, E262G, E263G, Q264R, Q266R, Q267R, I268V, Q271R, E273G, K280E, K280R, S281G, E284G, D289G, Q302R, and H317R with reference to a wild-type ApoE4 (SEQ ID NO: 1) . In some embodiments, provided is an ApoE4 mutant having ApoE3-like function, wherein the ApoE4 mutant comprises (including consisting of or consisting essentially of) one or more mutations selected from the group consisting of: K251E, E252G, Q253R, E223G, M239V, and S241G with reference to a wild-type ApoE4 (SEQ ID NO: 1) . In some embodiments, the ApoE4 mutant comprises a K251E mutation with reference to a wild-type ApoE4 (SEQ ID NO: 1) . In some embodiments, the ApoE4 mutant comprises a E252G mutation with reference to a wild-type ApoE4 (SEQ ID NO: 1) . In some embodiments, the ApoE4 mutant comprises a Q253R mutation with reference to a wild-type ApoE4 (SEQ ID NO: 1) . In some embodiments, the ApoE4 mutant comprises a E223G mutation with reference to a wild-type ApoE4 (SEQ ID NO: 1) . In some embodiments, the ApoE4 mutant comprises a S241G mutation with reference to a wild-type ApoE4 (SEQ ID NO: 1) .

In some embodiments, provided is an ApoE4 mutant selected from the group consisting of the mutants described below in Table 1.

Table 1: List of ApoE4 variants and ApoE4 mutants

In some embodiments, the ApoE4 mutant displays decreased binding affinity to very low density lipoprotein (VLDL) as compared to an ApoE4 without the corresponding mutation (such as the wild-type ApoE4) . In some embodiments, the binding affinity of the ApoE4 mutant to VLDL is lower by about any one of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2-fold, 3-fold, 5-fold, 10-fold, 20-fold or more as compared to that of an ApoE4 without the corresponding mutation (such as the wild-type ApoE4) . In some embodiments, the ApoE4 mutant displays increased binding affinity to high density lipoprotein (HDL) as compared to an ApoE4 without the corresponding mutation (such as the wild-type ApoE4) . In some embodiments, the binding affinity of the ApoE4 mutant to HDL is higher by about any one of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2-fold, 3-fold, 5-fold, 10-fold, 20-fold or more as compared to that of an ApoE4 without the corresponding mutation (such as the wild-type ApoE4) . In some embodiments, the ApoE4 mutant exhibits an increase in Aβ uptake as compared to an ApoE4 without the corresponding mutation (such as the wild-type ApoE4) . In some embodiments, the ApoE4 mutant exhibits increased Aβuptake by about any one of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2-fold, 3-fold, 5-fold, 10-fold, 20-fold or more as compared to an ApoE4 without the corresponding mutation (such as the wild-type ApoE4) . In some embodiments, the ApoE4 mutant facilitates an increased rate of Aβ clearance as compared to that facilitated by an ApoE4 without the corresponding mutation (such as the wild-type ApoE4) . In some embodiments, the ApoE4 mutant facilitates Aβ clearance at a rate that is higher by about any one of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2-fold, 3-fold, 5-fold, 10-fold, 20-fold or more as compared to an ApoE4 without the corresponding mutation (such as the wild-type ApoE4) . In some embodiments, the ApoE4 mutant facilitates a decreased rate of amyloid fibril formation as compared to that facilitated by an ApoE4 without the corresponding mutation (such as the wild-type ApoE4) . In some embodiments, the ApoE4 mutant facilitates a decreased rate of amyloid plaque formation as compared to that facilitated by an ApoE4 without the corresponding mutation (such as the wild-type ApoE4) .

In some embodiments according to any one of the ApoE4 mutants described herein, the ApoE4 mutant is generated by a method of altering ApoE4 in a cell comprising a nucleic acid encoding ApoE4, the method comprising introducing into the cell one or more components of a nucleic acid editing system, wherein the nucleic acid editing system edits the nucleic acid encoding ApoE4 to mutate one or more amino acids at amino acids.

In some embodiments according to any one of the ApoE4 mutants described herein, the ApoE4 mutant comprises a Signal Peptide. In some embodiments, the ApoE4 mutant comprises a Signal Peptide, wherein the Signal Peptide corresponds to amino acid positions 1-18 of SEQ ID NO: 1. In some embodiments, the ApoE4 mutant is processed into a mature form, wherein the mature form of the ApoE4 mutant does not comprise a Signal peptide. In some embodiments, the ApoE4 mutant does not comprise a Signal Peptide. In some embodiments, the ApoE4 mutant does not comprises a Signal Peptide, wherein the Signal Peptide corresponds to amino acid positions 1-18 of SEQ ID NO: 1. In some embodiments, the ApoE4 mutant comprises a sequence corresponding to amino acid positions 19-317 in reference to SEQ ID NO: 1, wherein the sequence further comprises (including consisting of or consisting essentially of) one or more of any of the mutations described herein in reference to SEQ ID NO: 1.

Cells comprising ApoE4 mutant (s)

Provided herein are cells comprising ApoE4 mutants with altered properties as compared to a wild-type ApoE4. In some embodiments, the ApoE4 mutants comprised within the cell comprises ApoE-3 like function. In some embodiments, provided are cells comprising one or more ApoE4 mutants, generated by modifying the function of endogenous ApoE4 within the cell to ApoE3-like via gene editing approaches. In some embodiments, provided are cells comprising one or more ApoE4 mutants, generated by introducing one or more mutations to the endogenous ApoE4 within the cell, in reference to wild-type ApoE4, via gene editing approaches. In some embodiments, the ApoE4 mutant comprises an ApoE3-like phospholipid binding capacity. In some embodiments, the endogenous ApoE4 comprises at least about 95%amino acid sequence similarity as a wild-type ApoE4 (SEQ ID NO: 1) . In some embodiments, the endogenous ApoE4 is a wild-type ApoE4 (SEQ ID NO: 1) .

In some embodiments, provided is a cell comprising an ApoE4 mutant having ApoE3-like function, wherein the ApoE4 mutant comprises one or more mutations within Helix N1, Helix N2, Helix 1, Helix 2, Helix 3, Helix 4, Hinge, Helix C1, Helix C2 and/or Helix C3 with reference to a wild-type ApoE4 (SEQ ID NO: 1) . In some embodiments, provided is a cell comprising an ApoE4 mutant having ApoE3-like function, wherein the ApoE4 mutant comprises one or more mutations within Helix C1 with reference to a wild-type ApoE4 (SEQ ID NO: 1) . In some embodiments, provided is a cell comprising an ApoE4 mutant having ApoE3-like function, wherein the ApoE4 mutant comprises one or more mutations within Helix C2 with reference to a wild-type ApoE4 (SEQ ID NO: 1) .

In some embodiments, provided is a cell comprising an ApoE4 mutant having ApoE3-like function, wherein the ApoE4 mutant comprises one or more mutations within amino acid positions 228-241, wherein the amino acid positions are with reference to a wild-type ApoE4 (SEQ ID NO: 1) . In some embodiments, provided is a cell comprising an ApoE4 mutant having ApoE3-like function, wherein the ApoE4 mutant comprises one or more mutations within amino acid positions 254-284, wherein the amino acid positions are with reference to a wild-type ApoE4 (SEQ ID NO: 1) . In some embodiments, provided is a cell comprising an ApoE4 mutant having ApoE3-like function, wherein the ApoE4 mutant comprises one or more mutations within amino acid positions 289-294, wherein the amino acid positions are with reference to a wild-type ApoE4 (SEQ ID NO: 1) .

In some embodiments, provided is a cell comprising an ApoE4 mutant having ApoE3-like function, wherein the ApoE4 mutant comprises one or more mutations within the N-terminal Helix1 to Helix 4 Region (amino acid positions 19-184) , the Hinge Region (amino acid positions 185-224) , the C-terminal lipid and lipoprotein binding region (amino acid positions 225-294) , and/or the C-terminal amino acid region (amino acid positions 295-317) , wherein the amino acid positions are with reference to a wild-type ApoE4 (SEQ ID NO: 1) . In some embodiments, provided is a cell comprising an ApoE4 mutant having ApoE3-like function, wherein the ApoE4 mutant comprises one or more mutations within the C-terminal lipid and lipoprotein binding region with reference to a wild-type ApoE4 (SEQ ID NO: 1) .

In some embodiments, provided is a cell comprising an ApoE4 mutant having ApoE3-like function, wherein the ApoE4 mutant comprises one or more mutations within amino acid positions 225-294, wherein the amino acid positions are with reference to a wild-type ApoE4 (SEQ ID NO: 1) . In some embodiments, provided is a cell comprising an ApoE4 mutant having ApoE3-like function, wherein the ApoE4 mutant comprises one or more mutations within amino acid positions 19-184, wherein the amino acid positions are with reference to a wild-type ApoE4 (SEQ ID NO: 1) , optionally wherein the ApoE4 mutant comprises one or more mutations at one or more amino acids selected from the group consisting of: Q35, Q99 and Q181 in reference to SEQ ID NO: 1. In some embodiments, provided is a cell comprising an ApoE4 mutant having ApoE3-like function, wherein the ApoE4 mutant comprises one or more mutations within amino acid positions 185-224, wherein the amino acid positions are with reference to a wild-type ApoE4 (SEQ ID NO: 1) , optionally wherein the ApoE4 mutant comprises one or more mutations at one or more amino acids selected from the group consisting of: I195, Q219, and E223 in reference to SEQ ID NO: 1. In some embodiments, provided is a cell comprising an ApoE4 mutant having ApoE3-like function, wherein the ApoE4 mutant comprises one or more mutations within amino acid positions 225-294, wherein the amino acid positions are with reference to a wild-type ApoE4 (SEQ ID NO: 1) , optionally wherein the ApoE4 mutant comprises one or more mutations at one or more amino acids selected from the group consisting of: Q226, E230, M236, M239, S241, E249, K251, E252, Q253, E256, K260, E262, E263, Q264, Q266, Q267, I268, Q271, E273, K280, S281, E284, and D289, in reference to SEQ ID NO: 1. In some embodiments, provided is a cell comprising an ApoE4 mutant having ApoE3-like function, wherein the ApoE4 mutant comprises one or more mutations within amino acid positions 295-317, wherein the amino acid positions are with reference to a wild-type ApoE4 (SEQ ID NO: 1) , optionally wherein the ApoE4 mutant comprises one or more mutations at amino acid Q302 and/or H317 in reference to SEQ ID NO: 1.

In some embodiments, provided is a cell comprising an ApoE4 mutant having ApoE3-like function, wherein the ApoE4 mutant comprises (including consisting of or consisting essentially of) one or more mutations at one or more of amino acids selected from the group consisting of: Q35, Q99, Q181, I195, Q219, E223, Q226, E230, M236, M239, S241, E249, K251, E252, Q253, E256, K260, E262, E263, Q264, Q266, Q267, I268, Q271, E273, K280, S281, E284, D289, Q302, and H317 with reference to a wild-type ApoE4 (SEQ ID NO: 1) . In some embodiments, provided is a cell comprising an ApoE4 mutant having ApoE3-like function, wherein the ApoE4 mutant comprises (including consisting of or consisting essentially of) one or more mutations at one or more amino acids selected from the group consisting of: K251, E252, Q253, E223, M239, and S241 with reference to a wild-type ApoE4 (SEQ ID NO: 1) . In some embodiments according to the methods described herein, the ApoE4 comprises an amino acid sequence of SEQ ID NO: 1 before the mutation.

In some embodiments, provided is a cell comprising an ApoE4 mutant having ApoE3-like function, wherein the ApoE4 mutant comprises (including consisting of or consisting essentially of) one or more mutations selected from the group consisting of: Q35R, Q99R, Q181R, I195V, Q219R, E223G, Q226R, E230G, M236V, M239V, S241G, E249G, K251E, K251R, E252G, Q253R, E256G, K260R, E262G, E263G, Q264R, Q266R, Q267R, I268V, Q271R, E273G, K280E, K280R, S281G, E284G, D289G, Q302R, and H317R with reference to a wild-type ApoE4 (SEQ ID NO: 1) . In some embodiments, provided is a cell comprising an ApoE4 mutant having ApoE3-like function, wherein the ApoE4 mutant comprises (including consisting of or consisting essentially of) one or more mutations selected from the group consisting of: K251E, E252G, Q253R, E223G, M239V, and S241G with reference to a wild-type ApoE4 (SEQ ID NO : 1) . In some embodiments, the ApoE4 mutant within the cell comprises a K251E mutation with reference to a wild-type ApoE4 (SEQ ID NO: 1) . In some embodiments, the ApoE4 mutant within the cell comprises a E252G mutation with reference to a wild-type ApoE4 (SEQ ID NO: 1) . In some embodiments, the ApoE4 mutant with the cell comprises a Q253R mutation with reference to a wild-type ApoE4 (SEQ ID NO: 1) . In some embodiments, the ApoE4 mutant with the cell comprises a E223G mutation with reference to a wild-type ApoE4 (SEQ ID NO: 1) . In some embodiments, the ApoE4 mutant within the cell comprises a S241G mutation with reference to a wild-type ApoE4 (SEQ ID NO: 1) .

In some embodiments, provided is a cell comprising an ApoE4 mutant selected from the group consisting of the mutants described in Table 1.

In some embodiments, the ApoE4 mutant within the cell displays decreased binding affinity to very low density lipoprotein (VLDL) as compared to an ApoE4 without the corresponding mutation (such as the wild-type ApoE4) . In some embodiments, the binding affinity of the ApoE4 mutant within the cell to VLDL is lower by about any one of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2-fold, 3-fold, 5-fold, 10-fold, 20-fold or more as compared to that of an ApoE4 without the corresponding mutation (such as the wild-type ApoE4) . In some embodiments, the ApoE4 mutant within the cell displays increased binding affinity to high density lipoprotein (HDL) as compared to an ApoE4 without the corresponding mutation (such as the wild-type ApoE4) . In some embodiments, the binding affinity of the ApoE4 mutant to HDL is higher by about any one of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2-fold, 3-fold, 5-fold, 10-fold, 20-fold or more as compared to that of an ApoE4 without the corresponding mutation (such as the wild-type ApoE4) . In some embodiments, the cell comprising the ApoE4 mutant exhibits an increase in Aβ uptake as compared to a cell comprising ApoE4 without the corresponding mutation (such as the wild-type ApoE4) . In some embodiments, the cell comprising the ApoE4 mutant exhibits increased Aβ uptake by about any one of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2-fold, 3-fold, 5-fold, 10-fold, 20-fold or more as compared to a cell comprising ApoE4 without the corresponding mutation (such as the wild-type ApoE4) . In some embodiments, the cell comprising the ApoE4 mutant exhibits an increased rate of Aβ clearance as compared to a cell comprising ApoE4 without the corresponding mutation (such as the wild-type ApoE4) . In some embodiments, the cell comprising the ApoE4 mutant exhibits Aβ clearance at a rate that is higher by about any one of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2-fold, 3-fold, 5-fold, 10-fold, 20-fold or more as compared to a cell comprising ApoE4 without the corresponding mutation (such as the wild-type ApoE4) . In some embodiments, the cell comprising the ApoE4 mutant facilitates a decreased rate of amyloid fibril formation as compared to that facilitated by a cell comprising ApoE4 without the corresponding mutation (such as the wild-type ApoE4) . In some embodiments, the cell comprising the ApoE4 mutant facilitates a decreased rate of amyloid plaque formation as compared to that facilitated by a cell comprising ApoE4 without the corresponding mutation (such as the wild-type ApoE4) .

In some embodiments according to any one of the cell described herein, the cell comprising the ApoE4 mutant is generated by a method of altering ApoE4 in the cell comprising a nucleic acid encoding ApoE4, the method comprising introducing into the cell one or more components of a nucleic acid editing system, wherein the nucleic acid editing system edits the nucleic acid encoding ApoE4 to mutate one or more amino acids at amino acids. In some embodiment, the cell is a eukaryotic cell. In some embodiments, the cell is a mammalian cell. In some embodiments, the cell is a murine cell or a human cell. In some embodiments, the cell is an immortalized cell, such as immortalized astrocytes or glial cells. In some embodiments, the cell is a primary cell, such as fibroblast, epithelial, or immune cell. In some embodiments, the cell is a post-mitosis cell. In some embodiments, the cell is a cell of the central nervous system (CNS) , such as a brain cell, e.g., a cerebellum cell. In some embodiments, the cell is an induced pluripotent stem cell (iPSC) . In some embodiments, the cell is a neural stem cell. In some embodiments, the cell is a neural progenitor. In some embodiments, the cell is astro-glial progenitor. In some embodiments, the cell is an astrocyte. In some embodiments, the cell is a glial cell.

In some embodiments according to any one of cells comprising an ApoE4 mutant described herein, the ApoE4 mutant comprises a Signal Peptide. In some embodiments, the ApoE4 mutant comprises a Signal Peptide, wherein the Signal Peptide corresponds to amino acid positions 1-18 of SEQ ID NO: 1. In some embodiments, the ApoE4 mutant is processed into a mature form, wherein the mature form of the ApoE4 mutant does not comprise a Signal peptide. In some embodiments, the ApoE4 mutant does not comprise a Signal Peptide. In some embodiments, the ApoE4 mutant does not comprises a Signal Peptide, wherein the Signal Peptide corresponds to amino acid positions 1-18 of SEQ ID NO: 1. In some embodiments, the ApoE4 mutant comprises a sequence corresponding to amino acid positions 19-317 in reference to SEQ ID NO: 1, wherein the sequence further comprises (including consisting of or consisting essentially of) one or more of any of the mutations described herein in reference to SEQ ID NO: 1.

Methods of DNA editing

In some embodiments, there is provided a method of altering ApoE4 in a cell comprising a nucleic acid encoding ApoE4, the method comprising introducing into the cell one or more components of a nucleic acid editing system, wherein the nucleic acid editing system edits the nucleic acid encoding ApoE4 to mutate one or more amino acids of the ApoE4 encoded by the nucleic acid, thereby producing an altered ApoE4 having an ApoE3-like function. In some embodiments, there is provided a method of altering ApoE4 in a cell comprising a nucleic acid encoding ApoE4, the method comprising introducing into the cell one or more components of a nucleic acid editing system, wherein the nucleic acid editing system edits the nucleic acid encoding ApoE4 to mutate one or more amino acids within amino acids 225-294 of the ApoE4 encoded by the nucleic acid, wherein the amino acid positions are in reference to SEQ ID NO: 1, thereby producing an altered ApoE4 having an ApoE3-like function.

Nucleic acid programmable DNA binding proteins (napDNAbp) , such as the clustered regularly interspaced short palindromic repeat (CRISPR) system is a recently discovered prokaryotic adaptive immune system that has been modified to enable robust and general genome engineering in a variety of organisms and cell lines. CRISPR-Cas (CRISPR associated) systems are protein-RNA complexes that use an RNA molecule (sgRNA) as a guide to localize the complex to a target DNA sequence via base-pairing. In the natural systems, a Cas protein then acts as an endonuclease to cleave the targeted DNA sequence. The target DNA sequence must be both complementary to the sgRNA, and also contain a “protospacer-adjacent motif (PAM) at the 3 ‘-end of the complementary region in order for the system to function. Among the known Cas proteins, S. pyogenes Cas9 has been mostly widely used as a tool for genome engineering.

A donor template can be introduced to the target cell concurrently or subsequently to introduction of the Cas-sgRNA complex. This donor template has the desired insertion or modification, flanked by segments of DNA homologous to the blunt ends of the cleaved DNA. Following the RNA-guided cleavage of a specific site of DNA (e.g. the DNA encoding an amino acid within amino acid positions 225-294 of ApoE4) , the natural DNA-repair mechanisms (such as homology directed repair pathway) of the cell can be used to insert the desired genetic material (e.g. DNA to mutate an amino acid within amino acid positions 225-294 of ApoE4, wherein the amino acid positions are in reference to SEQ ID NO: 1) , thereby editing the genome of a target cell with high-precision. Genome modification carried out in this way can be used to insert novel genes, or edit or knock out existing genes.

In some embodiments according to any one of the methods described herein, the nucleic acid editing system functions through a homology directed repair pathway. In some embodiments, the nucleic acid editing system comprises a sgRNA. In some embodiments, the nucleic acid editing system comprises a DNA nuclease selected from the group consisting of CRISPR/Cas9, TALE nuclease, and zinc finger nuclease. In some embodiments, the nucleic acid editing system further comprises a donor DNA.

In some embodiments, where the target DNA sequence comprises DNA encoding an Arg residue in ApoE4, the sgRNA hybridizes to a DNA sequence encoding the Arg residue of ApoE4. In some embodiments, the sgRNA comprises a region complementary the target DNA sequence encoding the Arg residue of ApoE4. In some embodiments, where the target sequence comprises DNA encoding a Glu residue in ApoE4, the sgRNA hybridizes to a DNA sequence encoding the Glu residue of ApoE4. In some embodiments, the sgRNA comprises a region complementary the target DNA sequence encoding an Arg residue in ApoE4. In some embodiments, the sgRNA comprises a region complementary the target DNA sequence encoding Glu residue in ApoE4. In some embodiments, the sgRNA further comprises a spacer domain, and scaffold sequence for Cas-binding. In some embodiments, the target DNA sequence comprises a “protospacer-adjacent motif (PAM) ” at the 3 ‘-end of the region complementary to the sgRNA.

In some embodiments, the donor template comprises DNA sequence comprising the desired sequence replacement for Arg and/or Glu, and additional homologous sequence upstream and downstream of the sequences encoding the replacement residue. In some embodiments, the donor template comprises DNA sequence encoding Glycine or Alanine for replacement of Arg, and homology sequences of any one of about 20, 22, 24, 26, 28 or 30 nucleotides downstream and/or homology sequences of any one of about 20, 22, 24, 26, 28 or 30 nucleotides upstream. In some embodiments, the donor template comprises DNA sequence encoding Glycine or Alanine for replacement of Arginine, and homology sequences of any one of about 20, 22, 24, 26, 28 or 30 nucleotides downstream and/or homology sequences of any one of about 20, 22, 24, 26, 28 or 30 nucleotides upstream. In some embodiments, the donor template comprises a DNA sequence of any one of about 30, 35, 40, 45, 50, 55, 60, 65 70, 75, 80, 85, 90, 95, 100, 150 or 200 nucleotides. In some embodiments, the donor template is a linear DNA sequence. In some embodiments, the donor template is in a circular plasmid. In some embodiments, the circular plasmid comprises both the donor template and the sgRNA.

In some embodiments, the nucleic acid is DNA. In some embodiments, the nucleic acid is a double stranded DNA. In some embodiments, the nucleic acid editing system comprises a DNA base editor. In some embodiments, the process of altering ApoE4 in a cell comprising a nucleic acid encoding ApoE4, comprises introducing into the cell one or more components of a DNA base editor, wherein the DNA base editor edits the DNA encoding ApoE4 to mutate one or more of amino acids selected from the group consisting of: Q35, Q99, Q181, I195, Q219, E223, Q226, E230, M236, M239, S241, E249, K251, E252, Q253, E256, K260, E262, E263, Q264, Q266, Q267, I268, Q271, E273, K280, S281, E284, D289, Q302, and H317, with reference to SEQ ID NO: 1, thereby producing an altered ApoE4 having an ApoE3-like function. In some embodiments, the process of altering ApoE4 in a cell comprising a nucleic acid encoding ApoE4, comprises introducing into the cell one or more components of a DNA base editor, wherein the DNA base editor edits the DNA encoding ApoE4 to mutate one or more amino acids within amino acid positions 225-294 of the ApoE4 encoded by the DNA, wherein the amino acid positions are with reference to SEQ ID NO: 1, thereby producing an altered ApoE4 having an ApoE3-like function.

In some embodiments according to any one of the methods described herein, the nucleic acid is a double stranded DNA. In some embodiments, the DNA base editor comprises an adenine base editor.

Adenine base editors (ABEs) allow the efficient programmable conversion of adenine to guanine in target DNA without creating double strand breaks (DSBs) . ABE is comprised of an evolved Escherichia coli tRNA^ARG-modifying enzyme, TadA, covalently fused to a catalytically impaired Cas9 protein (D10A nickase Cas9, nCas9) . A single guide RNA (sgRNA) directs the ABE to a target genomic DNA sequence and, upon binding and stable R-loop formation, a short stretch of single stranded nucleotides becomes accessible to TadA, an enzyme that chemically converts adenine to inosine. Inosine exclusively base pairs with cytosine in DNA polymerase binding pockets, resulting in an ABE-catalyzed A·T to G·C transition mutation at user defined base pairs following DNA replication or strand resection and nick repair. Multiple generations of ABEs have enabled efficient A·T to G·C transition in the genomes of humans and a variety of other species (reviewed in Nat. Rev. Genet. 19, 770–788 (2018) ) . One constraint of Cas9 is its dependency on the protospacer adjacent motif (PAM) sequence to bind DNA. However, additional evolved SpCas9 variants greatly expanded potentially accessible PAM sequences space of SpCas9 (Miller, et. al, 2020) . In addition, they may have differences in their sizes, and targeting specificity. Thus, multiple generations of ABE with different Cas9 variants may be applied to the base editing to alter one or more amino acids of ApoE4 described herein. The ABE could be delivered in vivo via lipid nanoparticle or via AAV.

In some embodiments, the adenosine base editor (ABE) comprises: an evolved Escherichia coli tRNA ^ARG-modifying enzyme, TadA, covalently fused to a catalytically impaired Cas9 protein (D10A nickase Cas9, nCas9) ; wherein the ABE is complexed with a single guide RNA (sgRNA) , wherein the sgRNA directs the ABE to the target DNA sequence, wherein the ABE catalyzes A·T to G·C transition mutation at defined base pairs. In some embodiments, the guide sequence comprises at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 contiguous nucleobases that are 100%complementary to a target DNA sequence within the DNA encoding ApoE4. In some embodiments, the target DNA sequence comprises DNA encoding for K251, E252, Q253, E223, M239, or S241 of ApoE4. In some embodiments, the ABE nicks the target DNA sequence, wherein deamination of the A nucleobase within a three-base motif encoding an amino acid in ApoE4, causing the complementary T to undergo a T to C mutation. In some embodiments, deaminating the one or more adenosine nucleobases of the three-base motif encoding an amino acid in ApoE4 results in a T-A base pair (s) in the motif being mutated to a C-G base pair.

In some embodiments according to any one of the methods described herein, the nucleic acid is a double stranded DNA. In some embodiments, the DNA base editor comprises a cytidine base editor.

Cytidine base editors (CBEs) allow the efficient programmable conversion of adenine to guanine in target DNA without creating double strand breaks (DSBs) . One example of a C to G base editor includes a fusion protein containing a nucleic acid programmable DNA binding protein (e.g., a Cas9 domain) , an uracil DNA glycosylase (UDG) domain, and a cytidine deaminase. In a non-limiting embodiment, such a base editing fusion protein is capable of binding to a specific nucleic acid sequence (e.g., via the Cas9 domain) , deaminating a cytosine within the nucleic acid sequence to a uridine, which can then be excised from the nucleic acid molecule by UDG. The nucleobase opposite the abasic site can then be replaced with another base (e.g., cytosine) , for example by an endogenous translesion polymerase. Typically, base repair machinery (e.g., in a cell) replaces a nucleobase opposite an abasic site with a cytosine, although other bases (e.g., adenine, guanine, or thymine) may replace a nucleobase opposite an abasic site.

In some embodiments, the cytidine base editor (CBE) comprises: a fusion protein comprising: (i) a nucleic acid programmable DNA binding protein (napDNAbp) ; (ii) a cytidine deaminase domain; and (iii) an uracil glycosylase inhibitor (UGI) domain, wherein the napDNAbp is a CasX, CasY, Cpf1, C2c1, C2c2, C2c3, or Argonaute protein. In some embodiments, “napDNAbp” refers to a protein that associates with a nucleic acid (e.g., DNA or RNA) , such as a guide nucleic acid, that guides the napDNAbp to a specific nucleic acid sequence. For example, a Cas9 protein can associate with a guide RNA that guides the Cas9 protein to a specific DNA sequence that has complementary to the guide RNA. In some embodiments, the cytidine deaminase domain is a deaminase from the apolipoprotein B mRNA-editing complex (APOBEC) family deaminase. In some embodiments, the APOBEC family deaminase is selected from the group consisting of APOBEC1 deaminase, APOBEC2 deaminase, APOBEC3A deaminase, APOBEC3B deaminase, APOBEC3C deaminase, APOBEC3D deaminase, APOBEC3F deaminase, APOBEC3G deaminase, and APOBEC3H deaminase. In some embodiments, the cytidine deaminase domain is a human cytidine deaminase with one or more mutations or wherein the cytidine deaminase domain is an activation-induced deaminase (AID) . In some embodiments, the fusion protein comprises the structure: NH2- [cytidine deaminase domain] - [napDNAbp] - [UGI domain] -COOH; NH2- [cytidine deaminase domain] - [napDNAbp] - [UGI] - [UGI] -COOH; NH2- [cytidine deaminase domain] - [napDNAbp] - [UGI] -COOH; NH2- [UGI] - [Apobec] - [napDNAbp] -COOH; NH2- [cytidine deaminase domain] - [UGI] - [napDNAbp] -COOH; NH2- [napDNAbp] - [UGI] - [cytidine deaminase domain] -COOH; or NH2- [napDNAbp] - [cytidine deaminase domain] - [UGI] –COOH; wherein each instance of “-” comprises an optional linker.

In some embodiments, the guide sequence comprises guide sequence comprises at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 contiguous nucleobases that are 100%complementary to a target DNA sequence that is antisense to the DNA encoding ApoE4. In some embodiments, the target DNA sequence is the DNA strand encoding for ApoE4. In some embodiments, the CBE nicks the target DNA sequence, wherein deamination of a C nucleobase on the sense strand to “G” in a motif encoding in ApoE4 causes a mutation of the G nucleobase in the anti-sense non-coding strand (e.g., to A) as well as a mutation of the C nucleobase in the coding strand (e.g., to T) . In some embodiments, deaminating the one or more C nucleobases anti-sense to “G” in the three-base motif results in the target amino acid being mutated. In some embodiments, the target DNA sequence is antisense to the DNA encoding ApoE4. In some embodiments, the CBE nicks the target DNA sequence, wherein deamination of a C nucleobase anti-sense to “G” in a motif encoding in ApoE4 causes a mutation of the C nucleobase in the anti-sense non-coding strand (e.g., to T) as well as a mutation of the G nucleobase in the coding strand (e.g., to A) . In some embodiments, deaminating the one or more C nucleobases anti-sense to “G” in the three-base motif results in the target amino acid being mutated.

Methods of RNA editing

In some embodiments, there is provided a method of altering ApoE4 in a cell comprising a nucleic acid encoding ApoE4, the method comprising introducing into the cell one or more components of a nucleic acid editing system, wherein the nucleic acid editing system edits the nucleic acid encoding ApoE4 to mutate one or more of amino acids selected from the group consisting of: Q35, Q99, Q181, I195, Q219, E223, Q226, E230, M236, M239, S241, E249, K251, E252, Q253, E256, K260, E262, E263, Q264, Q266, Q267, I268, Q271, E273, K280, S281, E284, D289, Q302, and H317 of the ApoE4 encoded by the nucleic acid, in reference to SEQ ID NO: 1, thereby producing an altered ApoE4 having an ApoE3-like function. In some embodiments, there is provided a method of altering ApoE4 in a cell comprising a nucleic acid encoding ApoE4, the method comprising introducing into the cell one or more components of a nucleic acid editing system, wherein the nucleic acid editing system edits the nucleic acid encoding ApoE4 to mutate one or more amino acids within amino acid positions 225-294 of the ApoE4 encoded by the nucleic acid, wherein the amino acid positions are in reference to SEQ ID NO: 1, thereby producing an altered ApoE4 having an ApoE3-like function.

In some embodiments, the nucleic acid editing system comprises an RNA base editor.

In some embodiments, the RNA base editor comprises RNA Editing for Programmable A to I Replacement (See, RNA editing with CRISPR-Cas13, Cox et al., 2017) . The method utilizes exogenous expression of Cas13-ADAR fusion protein and single guide RNA (sgRNA) , which enables the editing the target adenosines in the ApoE4 mRNA from A (Adenosine) to I (Inosine) .

In some embodiments, the RNA base editing system comprises a i) a Cas13b effector protein; and ii) a crRNA. In some embodiments, the crRNA comprises a) a guide sequence that is capable of hybridizing to an ApoE4 mRNA, and b) a direct repeat sequence. In some embodiments, there is formed a CRISPR complex comprising the Cas13b effector protein complexed with the guide sequence that is hybridized to the ApoE4 mRNA. In some embodiments, the guide sequence has a length of about 20-53 nt, preferably 25-53 nt, more preferably 29-53 nt or 40-50 nt capable of forming an RNA duplex with said ApoE4 mRNA sequence. In some embodiments, the guide sequence comprises one or more mismatch corresponding to different adenosine sites in ApoE4 mRNA sequence.

In some embodiments, the composition comprises an accessory protein that enhances Cas13b effector protein activity. In some embodiments, the accessory protein is a Csx28 protein or a Csx27 protein. In some embodiments, the Cas13b effector protein comprises one or more nuclear localization signals. In some embodiments, the Cas13b effector protein effector protein is associated with one or more functional domains. In some embodiments, the functional domain cleaves the target sequence.

The international application PCT/EP2017/071912 disclosed a method that is more suitable for in vivo editing. This method does not require expression of exogenous proteins, and only relies on the introduction of a small piece of RNA that is complementary to the sequence of the target site into the cell, wherein ADAR protein can be recruited to edit the target site of the RNA. The complementary RNA used in this method is short (less than 54 nt) , but requires complex chemical modification. This method also appears to exhibit low editing efficiency.

In some embodiments, the RNA base editing system comprises an antisense oligonucleotide (AON) capable of forming a double stranded complex with a ApoE4 mRNA in a cell, for the deamination of a target adenosine in the ApoE4 mRNA by an ADAR, said AON comprising a Central Triplet of 3 sequential nucleotides, wherein the nucleotide directly opposite the target adenosine is the middle nucleotide of the Central Triplet, wherein 1 , 2 or 3 nucleotides in said Central Triplet comprise a sugar modification and/or a base modification to render the AON more stable and/or more effective in inducing deamination of the target adenosine; further wherein the middle nucleotide does not have a 2’-O-methyl modification.

In some embodiments, 2 or 3 nucleotides in the Central Triplet do not have a 2’-O-methyl modification. In some embodiments, 2 or 3 nucleotides in the Central Triplet do not have a 2’-O-methyl modification. In some embodiments, 2 or 3 nucleotides in the Central Triplet do not have a 2’-O-alkyl modification. In some embodiments, 1 or 2 nucleotides in the Central Triplet, preferably other than the middle nucleotide, are replaced by an inosine. In some embodiments, the sugar modification is selected from the group consisting of deoxyribose (DNA) , Unlocked Nucleic Acid (UNA) and 2’-fluororibose. In some embodiments, the sugar modification is selected from the group consisting of deoxyribose (DNA) , Unlocked Nucleic Acid (UNA) and 2’-fluororibose. In some embodiments, the AON comprises at least one internucleoside linkage modification selected from the group consisting of phosphorothioate, 3’-methylenephosphonate, 5’-methylenephosphonate, 3’-phosphoroamidate and 2’-5’-phosphodiester. In some embodiments, the 2, 3, 4, 5, or 6 terminal nucleotides of the 5’ and 3’ terminus of the AON are linked with phosphorothioate linkages. In some embodiments, the terminal 5 nucleotides at the 5’ and 3’ terminus are linked with phosphorothioate and/or LNA linkages. In some embodiments, said base modification is selected from the group consisting of 2-aminopurine, 2, 6-diaminopurine, 3-deazaadenosine, 7-deazaadenosine, 7-methyladenosine, 8-azidoadenosine, 8-methyladenosine, 5-hydroxymethylcytosine, 5-methylcytidine, Pyrrolocytidine, 7-aminomethyl-7-deazaguanosine, 7-deazaguanosine, 7-methylguanosine, 8-aza-7-deazaguanosine, thienoguanosine, inosine, 4-thio-uridine, 5-methoxyuridine, dihydrouridine, and pseudouridine. In some embodiments, the middle nucleotide in the Central Triplet is a cytidine or a uridine. In some embodiments, one or more nucleotides in the AON outside the Central Triplet comprise a modification selected from the group consisting of: DNA, a 2’-O-alkyl group such as a 2’-O-methyl group, a 2’-O-MOE group, a 2’-F group, a 2’-NH2 group, and an LNA; or combinations thereof. In some embodiments, the AON comprises 18 to 70 nucleotides, preferably comprises 18 to 60 nucleotides, more preferably comprises 18 to 50 nucleotides.

In some embodiments, the nucleic acid editing technology RESTORE (Recruiting endogenous ADAR to specific trans for oligonucleotide-mediated RNA editing, Merkle et al., 2019) can be used to mutate one or more of amino acids selected from the group consisting of: Q35, Q99, Q181, I195, Q219, E223, Q226, E230, M236, M239, S241, E249, K251, E252, Q253, E256, K260, E262, E263, Q264, Q266, Q267, I268, Q271, E273, K280, S281, E284, D289, Q302, and H317 of the ApoE4 encoded by the ApoE4 mRNA, with reference to SEQ ID NO: 1, thereby producing an altered ApoE4 having an ApoE3-like function, thereby producing an altered ApoE4 having an ApoE3-like function. In some embodiments, the nucleic acid editing technology RESTORE (Recruiting endogenous ADAR to specific trans for oligonucleotide-mediated RNA editing, Merkle et al., 2019) can be used to mutate one or more amino acids within amino acid positions 225-294 of the ApoE4 encoded by the ApoE4 mRNA, wherein the amino acid positions are with reference to SEQ ID NO: 1, thereby producing an altered ApoE4 having an ApoE3-like function. RESTORE technology is not dependent on exogenous proteins, but requires the presence of IFN-γ to achieve high editing efficiency.

In some embodiments, the RNA based editing system comprise engineered antisense oligonucleotides (ASO) , wherein each ASO comprises (i) a programmable specificity domain that determines ApoE4 mRNA binding and (ii) an invariant ADAR-recruiting domain to steer endogenous ADAR to an ASO: mRNA hybrid. In certain embodiments according to any one of the methods described herein, the specificity domain comprises a cytidine, adenosine or uridine directly opposite the target A in the mRNA encoding ApoE4 (e.g., adenosine in mRNA encoding for amino acid at positions 225-294 of ApoE4, wherein the amino acid positions are with reference to SEQ ID NO: 1) . In some embodiments, the specificity domain comprises a cytidine mismatch directly opposite the target A in the mRNA encoding ApoE4. In some embodiments, the cytidine mismatch is located at least 5 nucleotides, e.g., at least 10, 15, 20, 25, 30, or more nucleotides, away from the 5’ end of the complementary RNA sequence. In some embodiments, the cytidine mismatch is located at least 20 nucleotides, e.g., at least 25, 30, 35, or more nucleotides, away from the 3’ end of the complementary RNA sequence.

In some embodiments, the RNA encoding ApoE4 is a pre-messenger RNA (pre-mRNA) . In some embodiments, the RNA encoding ApoE4 is a mature messenger RNA (mature mRNA) .

In some embodiments, the RNA based editing system comprises suppressor tRNAs. In some embodiments, the RNA based editing system comprises a vector encoding one or more tRNA having an anticodon sequence that recognizes a mRNA encoding ApoE4. In some embodiments, the tRNA is an endogenous tRNA with a modified anticodon stem recognizing the mRNA encoding ApoE4. In some embodiments, the tRNA is charged with a serine. In some embodiments, the tRNA is charged with a non-canonical tRNA, optionally wherein the non-canonical amino acid is pyrrolysine. In some embodiments, the vector further comprises a corresponding tRNA synthetase.

In certain embodiments according to any one of the methods described herein, the efficiency of editing of the RNA encoding ApoE4 is at least about 5%, such as at least about any one of 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or higher. In some embodiments, the efficiency of editing of the RNA encoding ApoE4 is at least about 5% (e.g., at least about 7%) in vivo, e.g., in an animal. In certain embodiments according to any one of the methods described herein, the efficiency of editing of the RNA encoding an amino acid selected from the group consisting of: Q35, Q99, Q181, I195, Q219, E223, Q226, E230, M236, M239, S241, E249, K251, E252, Q253, E256, K260, E262, E263, Q264, Q266, Q267, I268, Q271, E273, K280, S281, E284, D289, Q302, and H317 in ApoE4, with reference to SEQ ID NO: 1, is at least about 5%, such as at least about any one of 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or higher. In some embodiments, the efficiency of editing of the RNA encoding an amino acid selected from the group consisting of: Q35, Q99, Q181, I195, Q219, E223, Q226, E230, M236, M239, S241, E249, K251, E252, Q253, E256, K260, E262, E263, Q264, Q266, Q267, I268, Q271, E273, K280, S281, E284, D289, Q302, and H317 in ApoE4, with reference to SEQ ID NO: 1, is at least about 5% (e.g., at least about 7%) in vivo, e.g., in an animal. In certain embodiments according to any one of the methods described herein, the efficiency of editing of the RNA encoding an amino acid selected from the group consisting of: K251, E252, Q253, E223, M239, and S241 in ApoE4, with reference to SEQ ID NO: 1, is at least about 5%, such as at least about any one of 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or higher. In some embodiments, the efficiency of editing of the RNA encoding an amino acid selected from the group consisting of: K251, E252, Q253, E223, M239, and S241 in ApoE4, with reference to SEQ ID NO: 1, is at least about 5% (e.g., at least about 7%) in vivo, e.g., in an animal.

In some embodiments, the efficiency of editing of the RNA encoding ApoE4 is at least about 10% (e.g., at least about 15%) in a cell in vitro or ex vivo. In some embodiments, the efficiency of editing of the RNA encoding an amino acid selected from the group consisting of: Q35, Q99, Q181, I195, Q219, E223, Q226, E230, M236, M239, S241, E249, K251, E252, Q253, E256, K260, E262, E263, Q264, Q266, Q267, I268, Q271, E273, K280, S281, E284, D289, Q302, and H317 in ApoE4, with reference to SEQ ID NO: 1, is at least about 10% (e.g., at least about 15%) in a cell in vitro or ex vivo. In some embodiments, the efficiency of editing of the RNA encoding an amino acid selected from the group consisting of: K251, E252, Q253, E223, M239, and S241 in ApoE4, with reference to SEQ ID NO: 1, is at least about 10% (e.g., at least about 15%) in a cell in vitro or ex vivo. In some embodiments, the efficiency of editing is determined by Sanger sequencing. In some embodiments, the efficiency of editing is determined by next-generation sequencing.

In certain embodiments according to any one of the methods described herein, the method has low off-target editing rate. In some embodiments, the method has lower than about 1% (e.g., no more than about any one of 0.5%, 0.1%, 0.05%, 0.01%, 0.001%or lower) editing efficiency on non-target As in the RNA encoding ApoE4. In some embodiments, the method does not edit non-target As in the RNA encoding ApoE4. In some embodiments, the method has lower than about 0.1% (e.g., no more than about any one of 0.05%, 0.01%, 0.005%, 0.001%, 0.0001%or lower) editing efficiency on adenosine in non-target RNA (i.e., RNAs not encoding ApoE4) .

In certain embodiments according to any one of the methods described herein, the method does not induce immune response, such as innate immune response. In some embodiments, the method does not induce interferon and/or interleukin expression in the cell. In some embodiments, the method does not induce IFN-β and/or IL-6 expression in the host cell.

“Cell” or “Host cell” as described herein refers to any cell type that can be used as a host cell provided it can be modified as described herein. For example, the cell may be an eukaryotic cell. In some embodiments, the cell is derived from a pre-established cell line, such as mammalian cell lines including human cell lines or non-human cell lines. In some embodiments, the cell is derived from an individual, such as a human individual. In some embodiments, the cell is derived from an individual, such as a human individual, and subsequently reprogrammed (e.g., induced pluripotent stem cells, iPSCs) .

“Introducing” or “introduction” used herein means delivering one or more nucleic acid editing system components, such as polynucleotides (e.g., sgRNAs) or Cas proteins, or one or more constructs including vectors as described herein, or one or more transcripts thereof, to a host cell. The methods of the present application can employ many delivery systems, including but not limited to, viral, liposome, electroporation, microinjection and conjugation, to achieve the introduction of the construct as described herein into a cell. Conventional viral and non-viral based gene transfer methods can be used to introduce nucleic acids into mammalian cells or target tissues. Such methods can be used to administer nucleic acids of the present application to cells in culture, or in a host organism. Non-viral vector delivery systems include DNA plasmids, RNA (e.g., a transcript of a construct described herein) , naked nucleic acid, and nucleic acid complexed with a delivery vehicle, such as a liposome. Viral vector delivery systems include DNA and RNA viruses, which have either episomal or integrated genomes for delivery to the host cell.

Methods of non-viral delivery of one or more components of a nucleic acid editing system, including nucleic acids, include lipofection, nucleofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycation or lipid: nucleic acid conjugates, electroporation, nanoparticles, exosomes, microvesicles, or gene-gun, naked DNA and artificial virions.

The use of RNA or DNA viral based systems for the delivery of nucleic acids has high efficiency in targeting a virus to specific cells and trafficking the viral payload to the cellular nuclei.

In certain embodiments according to any one of the methods described herein, the method comprises introducing a viral vector (such as lentiviral vector) encoding the nucleic acid to the cell. In some embodiments, the viral vector is an AAV, e.g., AAV8. In some embodiments, the method comprises introducing a plasmid encoding one or more nucleic acid editing system components, such as polynucleotides (e.g., sgRNAs) or Cas proteins to the cell. In some embodiments, the method comprises introducing (e.g., by electroporation) of one or more nucleic acid editing system components into the cell. In some embodiments, the method comprises transfection of one or more nucleic acid editing system components into the host cell.

Application of editing of nucleic acids encoding ApoE4

In some embodiments, there is provided a method of ameliorating a symptom of a neurodegenerative disorder in an individual, comprising altering ApoE4 in the individual according to any of the methods described herein.

In some embodiments, the individual carries at least one APOE4 allele (ε4) in at least 90%of the neural cells. In some embodiments, the individual carries at least one APOE4 allele (ε4) in at least about any one of 50%, 60%, 70%, 80%, 90%or 95%of the neural cells. In some embodiments, the individual does not carry an APOE2 allele (ε2) in at least 90%of the neural cells. In some embodiments, the individual does not carry an APOE2 allele (ε2) in at least about any one of 50%, 60%, 70%, 80%, 90%or 95%of the neural cells.

In some embodiments according to the methods described herein, an individual with ApoE4 altered exhibits an increased rate of Aβ clearance as compared to the same individual before the altering of ApoE4. In some embodiments, the individual exhibits APOE4 expression that is higher than the median APOE4 expression in a population. In some embodiments, the individual exhibits APOE4 expression that is comparable to the median APOE4 expression in a population. In some embodiments, the individual exhibits a plasma ApoE4 concentration that is higher than the median plasma ApoE4 concentration in a population by at least about any one of 10%, 20%, 30%, 40%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, 1000-fold or more. In some embodiments, the individual exhibits a plasma ApoE4: ApoE3 concentration ratio that is higher than the median plasma ApoE4: ApoE3 concentration ratio in a population by at least about any one of 10%, 20%, 30%, 40%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold, or more. In some embodiments, the individual exhibits a plasma ApoE4: ApoE2 concentration ratio that is higher than the median plasma ApoE4: ApoE2 concentration ratio in a population by at least about any one of 10%, 20%, 30%, 40%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, 1000-fold or more. In some embodiments, the individual exhibits a cerebrospinal fluid (CSF) ApoE4 concentration that is higher than the median CSF ApoE4 concentration in a population by at least about any one of 10%, 20%, 30%, 40%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, 1000-fold or more. In some embodiments, wherein the individual exhibits a CSF ApoE4: ApoE3 concentration ratio that is higher than the median CSF ApoE4: ApoE3 concentration ratio in a population by at least about any one of 10%, 20%, 30%, 40%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, 1000-fold or more. In some embodiments, the individual exhibits a CSF ApoE4: ApoE2 concentration ratio that is higher than the median CSF ApoE4: ApoE2 concentration ratio in a population by at least about any one of 10%, 20%, 30%, 40%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, 1000-fold or more.

In some embodiments, the individual is at higher risk of developing early-onset familial neurodegenerative disease than the average population. In some embodiments, the risk of the individual developing early-onset familial neurodegenerative disease is at least about any one of about: 10%, 20%, 30%, 40%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, 1000-fold higher than that of a population. In some embodiments, the individual is at higher risk of developing early-onset familial neurodegenerative disease than the average population. In some embodiments, the risk of the individual developing early-onset familial neurodegenerative disease is at least about any one of: 10%, 20%, 30%, 40%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, 1000-fold higher than that of a population. In some embodiments, the individual is at higher risk of developing sporadic late-onset neurodegenerative disease than the average population. In some embodiments, the risk of the individual developing sporadic late-onset neurodegenerative disease is at least about any one of about: 10%, 20%, 30%, 40%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, 1000-fold higher than that of a population.

In some embodiments, the population is an average population. In some embodiments, the population is as defined by one or more parameters. In some embodiments, the population is defined by one or more parameters including age group. In some embodiments, the population is defined by one or more parameters including race. In some embodiments, the population is defined by one or more parameters including gender. In some embodiments, the population is defined by one or more parameters including geographical region.

APOE4 editing in neural cells

In some embodiments, there is provided a method of ameliorating a symptom of a neurodegenerative disorder in an individual, comprising altering ApoE4 in the individual, wherein the method of altering ApoE4 comprises altering ApoE4 in a cell comprising a nucleic acid encoding ApoE4, the method comprising introducing into the cell one or more components of a nucleic acid editing system, wherein the nucleic acid editing system edits the nucleic acid encoding ApoE4 to mutate one or more of amino acids selected from the group consisting of: Q35, Q99, Q181, I195, Q219, E223, Q226, E230, M236, M239, S241, E249, K251, E252, Q253, E256, K260, E262, E263, Q264, Q266, Q267, I268, Q271, E273, K280, S281, E284, D289, Q302, and H317 of the ApoE4, with reference to SEQ ID NO: 1, encoded by the nucleic acid, thereby producing an altered ApoE4 having an ApoE3-like function. In some embodiments, there is provided a method of ameliorating a symptom of a neurodegenerative disorder in an individual, comprising altering ApoE4 in the individual, wherein the method of altering ApoE4 comprises altering ApoE4 in a cell comprising a nucleic acid encoding ApoE4, the method comprising introducing into the cell one or more components of a nucleic acid editing system, wherein the nucleic acid editing system edits the nucleic acid encoding ApoE4 to mutate one or more amino acids within amino acids positions 225-294 of the ApoE4, wherein the amino acid positions are with reference to SEQ ID NO: 1, encoded by the nucleic acid, thereby producing an altered ApoE4 having an ApoE3-like function.

In some embodiments, the cell is present in the individual. In some embodiments, the cell is a neuron. In some embodiments, the cell is exogenous to the individual, and transplanted into the individual subsequent to the alteration. In some embodiments, the cell is an iPSC. In some embodiments, the iPSC is autologous to the individual. In some embodiments, the iPSC is allogeneic to the individual. In some embodiments, the iPSC is differentiated into a neural progenitor before transplantation into the individual. In some embodiments, the iPSC is differentiated into an astro-glial progenitor before transplantation into the individual. In some embodiments, the iPSC is differentiated into an astrocyte before transplantation into the individual. In some embodiments, the iPSC is differentiated into a glial cell before transplantation into the individual.

Ameliorating symptoms of neurodegenerative disease

In some embodiments, there is provided a method of ameliorating a symptom of a neurodegenerative disorder in an individual, comprising altering ApoE4 in the individual according to any one of the methods described herein. In some embodiments, the neurodegenerative disorder is an early-onset familial disease. In some embodiments, the neurodegenerative disorder is a late-onset familial disease. In some embodiments, the neurodegenerative disorder is a sporadic late-onset disease. In some embodiments, the method comprises altering ApoE4 in at least about any one of: 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 98%of the cells in the individual’s central nervous system. In some embodiments, the method comprises altering ApoE4 in at least about any one of: 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 98%of the cells in the individual’s astro-glial cells. In some embodiments, the method comprises altering at least about any one of: 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 98%of the nucleic acids encoding ApoE4 in the individual’s central nervous system. In some embodiments, the method comprises altering at least about any one of: 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 98%of the mRNA transcripts encoding ApoE4 in the individual’s central nervous system. In some embodiments, the method comprises altering ApoE4 by systemic administration of a base editor (e.g., DNA base editor) . In some embodiment, the method comprises altering ApoE4 by local administration of a base editor (e.g., DNA base editor) . In some embodiments, the method comprises altering ApoE4 in at least about any one of: 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 98%of the iPSCs in culture, optionally wherein the iPSCs with altered ApoE4 is detected and enriched. In some embodiments, the method further comprises differentiating the iPSCs with altered ApoE4 into neural progenitors before transplantation into the individual. In some embodiments, the method further comprises differentiating the iPSCs with altered ApoE4 into astro-glial progenitors s before transplantation into the individual. In some embodiments, the method further comprises differentiating the iPSCs with altered ApoE4 into astrocytes before transplantation into the individual. In some embodiments, the method further comprises differentiating the iPSCs with altered ApoE4 into astrocytes before transplantation into the individual. In some embodiments according to any one of the methods described herein, the individual comprises altered ApoE4.

In some embodiments, an individual with altered ApoE4 exhibits an increased rate of Aβ clearance as compared to the same individual before the altering of ApoE4. In some embodiments, an individual with altered ApoE4 exhibits an increased rate of Aβ clearance by at least about any one of 10%, 20%, 30%, 40%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, 1000-fold as compared to the same individual before the altering of ApoE4. In some embodiments, an individual with altered ApoE4 exhibits a decreased rate of amyloid fibril formation as compared to the same individual before the altering of ApoE4. In some embodiments, an individual with altered ApoE4 exhibits a decreased rate of amyloid fibril formation by at least about any one of 10%, 20%, 30%, 40%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, 1000-fold as compared to the same individual before the altering of ApoE4. In some embodiments, an individual with altered ApoE4 exhibits a decreased rate of amyloid plaque formation as compared to the same individual before the altering of ApoE4. In some embodiments, an individual with altered ApoE4 exhibits a decreased rate of amyloid plaque formation by at least about any one of 10%, 20%, 30%, 40%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, 1000-fold as compared to the same individual before the altering of ApoE4.

Methods of Gene and Cell Therapy

The DNA and RNA editing methods and compositions described herein may be used to treat a disease or condition in an individual, including, but not limited to neurodegenerative diseases. In some embodiments, the nucleic acid editing components are introduced into cells ex vivo, wherein the cells with altered ApoE4 are then administered into the individual.

In some embodiments, there is provided a method of editing an ApoE4-encoding nucleic acid in a cell of an individual (e.g., human individual) ex vivo, comprising editing the ApoE4-encoding nucleic acid using any one of the methods of nucleic acid editing described herein.

In some embodiments, there is provided a method of editing an ApoE4 mRNA in a cell of an individual (e.g., human individual) ex vivo, comprising editing the ApoE4 RNA using any one of the methods of RNA editing described herein.

In some embodiments, there is provided a method of editing an ApoE4-encoding nucleic acid in a cell of an individual (e.g., human individual) ex vivo, comprising introducing nucleic acid editing system components or constructs encoding the nucleic acid editing system components into the cell of the individual. In some embodiments, the ApoE4-encoding nucleic acid is associated with a neurodegenerative disease or condition of the individual. In some embodiments, the disease or condition is a hereditary genetic disease or a disease or condition associated with one or more allelic variations, such as the allelic variation in ApoE. In some embodiments, the method further comprises obtaining the cell, such as glial cells, astrocytes, neural progenitors, or fibroblasts for reprogramming into iPSCs, from the individual.

In some embodiments, there is provided a method of editing an ApoE4 mRNA in a cell of an individual (e.g., human individual) ex vivo, comprising introducing nucleic acid editing system components or constructs encoding the nucleic acid editing system components into the cell of the individual. In some embodiments, the ApoE4 mRNA is associated with a neurodegenerative disease or condition of the individual. In some embodiments, the disease or condition is a hereditary genetic disease or a disease or condition associated with one or more allelic variations, such as the allelic variation in ApoE. In some embodiments, the method further comprises obtaining the cell, such as glial cells, astrocytes, neural progenitors, or fibroblasts for reprogramming into iPSCs, from the individual.

In some embodiments, there is provided a method of ameliorating a symptom of a neurodegenerative disease or condition in an individual (e.g., human individual) , comprising editing the ApoE4-encoding nucleic acid associated with the neurodegenerative disease or condition in a cell of the individual using any one of the methods of nucleic acid editing described herein.

In some embodiments, there is provided a method of ameliorating a symptom of a neurodegenerative disease or condition in an individual (e.g., human individual) , comprising editing the ApoE4 mRNA associated with the neurodegenerative disease or condition in a cell of the individual using any one of the methods of RNA editing described herein.

In some embodiments, there is provided a method of ameliorating a symptom of a neurodegenerative disease or condition in an individual (e.g., human individual) , comprising introducing nucleic acid editing system components or constructs encoding the nucleic acid editing system components into an isolated cell of the individual ex vivo. In some embodiments, the method further comprises culturing the cell having the edited nucleic acid. In some embodiments, the method further comprises administering the cell having the edited nucleic acid to the individual. In some embodiments, the disease or condition is a hereditary genetic disease or a disease or condition associated with one or more allelic variations, such as the allelic variation in ApoE.

In some embodiments, there is provided a method of ameliorating a symptom of a neurodegenerative disease or condition in an individual (e.g., human individual) , comprising introducing nucleic acid editing system components or constructs encoding the nucleic acid editing system components into an isolated cell of the individual ex vivo. In some embodiments, the method further comprises culturing the cell having the edited RNA. In some embodiments, the method further comprises administering the cell having the edited RNA to the individual. In some embodiments, the disease or condition is a hereditary genetic disease or a disease or condition associated with one or more allelic variations, such as the allelic variation in ApoE.

In some embodiments, there is provided a method of ameliorating a symptom of a disease or condition in an individual (e.g., human individual) , comprising administering an effective amount of nucleic acid editing system components or constructs encoding the nucleic acid editing system components to the individual. In some embodiments, the disease or condition is a hereditary genetic disease or a disease or condition associated with one or more allelic variations, such as the allelic variation in ApoE.

In some embodiments, there is provided a method of improving function of a nervous system in an individual (e.g., human individual) having an impaired function in the nervous system, comprising editing an ApoE4-encoding nucleic acid associated with the impaired nervous system function in a cell of the individual using any one of the methods of nucleic acid editing described herein.

In some embodiments, there is provided a method of improving function of a nervous system in an individual (e.g., human individual) having an impaired function in the nervous system, comprising editing an ApoE4 mRNA associated with the impaired nervous system function in a cell of the individual using any one of the methods of RNA editing described herein.

In some embodiments, there is provided a method of improving function of a nervous system in an individual (e.g., human individual) having an impaired function in the nervous system, comprising introducing nucleic acid editing system components or constructs encoding the nucleic acid editing system components into an isolated cell of the individual ex vivo. In some embodiments, the method further comprises culturing the cell having the edited nucleic acid. In some embodiments, the method further comprises administering the cell having the edited nucleic acid to the individual. In some embodiments, the nervous system impairment is associated with a hereditary genetic disease or a disease or condition associated with one or more allelic variations, such as the allelic variation in ApoE.

In some embodiments, there is provided a method of improving function of a nervous system in an individual (e.g., human individual) having an impaired function in the nervous system, comprising introducing nucleic acid editing system components or constructs encoding the nucleic acid editing system components into an isolated cell of the individual ex vivo. In some embodiments, the method further comprises culturing the cell having the edited RNA. In some embodiments, the method further comprises administering the cell having the edited RNA to the individual. In some embodiments, the nervous system impairment is associated with a hereditary genetic disease or a disease or condition associated with one or more allelic variations, such as the allelic variation in ApoE.

In some embodiments, there is provided a method of improving function of a nervous system in an individual (e.g., human individual) having an impaired function in the nervous system, comprising administering an effective amount of nucleic acid editing system components or constructs encoding the nucleic acid editing system components to the individual. In some embodiments, the nervous system impairment is associated with a hereditary genetic disease or a disease or condition associated with one or more allelic variations, such as the allelic variation in ApoE.

As used herein, "amelioration" or "ameliorating" of a disease symptom is an approach for decreasing one or more symptoms resulting from the disease, diminishing the extent of the disease, stabilizing the disease, delaying the spread of the disease, preventing or delaying or slowing the progression of the disease.

As used herein, "treatment" or "treating" is an approach for obtaining beneficial or desired results including clinical results. For purposes of this invention, beneficial or desired clinical results include, but are not limited to, one or more of the following: decreasing one or more symptoms resulting from the disease, diminishing the extent of the disease, stabilizing the disease (e.g., preventing or delaying the worsening of the disease) , preventing or delaying the spread of the disease, preventing or delaying the occurrence or recurrence of the disease, delay or slowing the progression of the disease, ameliorating the disease state, providing a remission (whether partial or total) of the disease, decreasing the dose of one or more other medications required to treat the disease, delaying the progression of the disease, increasing the quality of life, and/or prolonging survival. Also encompassed by "treatment" is a reduction of pathological consequence of the disease or condition. The methods of the invention contemplate any one or more of these aspects of treatment.

The terms “individual, ” “subject” and “patient” are used interchangeably herein to describe a mammal, including humans. An individual includes, but is not limited to, human, bovine, horse, feline, canine, rodent, or primate. In some embodiments, the individual is human. In some embodiments, an individual suffers from a disease or condition, such as drug resistance. In some embodiments, the individual is in need of treatment.

As is understood in the art, an “effective amount” refers to an amount of a composition (e.g., nucleic acids or constructs encoding the nucleic acids) sufficient to produce a desired therapeutic outcome (e.g., reducing the severity or duration of, stabilizing the severity of, or eliminating one or more symptoms of a disease or condition) . For therapeutic use, beneficial or desired results include, e.g., decreasing one or more symptoms resulting from the disease (biochemical, histologic and/or behavioral) , including its complications and intermediate pathological phenotypes presented during development of the disease, increasing the quality of life of those suffering from the disease or condition, decreasing the dose of other medications required to treat the disease , ameliorating the symptom of a disease and/or improving function of a nervous system, enhancing effect of another medication, delaying the progression of the disease, and/or prolonging survival of patients.

Generally, dosages, schedules, and routes of administration of the compositions (e.g., nucleic acid editing system components or constructs encoding the nucleic acid editing system components) or cells (e.g., cells comprising altered ApoE4) may be determined according to the size and condition of the individual, and according to standard pharmaceutical practice. Exemplary routes of administration include intravenous, intra-arterial, intraperitoneal, intrapulmonary, intravesicular, intramuscular, intra-tracheal, subcutaneous, intraocular, intrathecal, or transdermal.

Compositions, kits and articles of manufacture

Also provided herein are compositions (such as pharmaceutical compositions) comprising any one of the nucleic acid editing system components, constructs, libraries, or edited host cells as described herein.

In some embodiments, there is provided a pharmaceutical composition comprising any one of the nucleic acid editing system components or constructs encoding the nucleic acid editing system components described herein, and a pharmaceutically acceptable carrier, excipient or stabilizer. Exemplary pharmaceutically acceptable carriers, excipients and stabilizers have been described, for example, in Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980) . Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propylparaben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol) ; low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as olyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt-forming counter-ions such as sodium; metal complexes (e.g. Zn-protein complexes) ; and/or non-ionic surfactants such as TWEEN^TM, PLURONICS^TM or polyethylene glycol (PEG) . In some embodiments, lyophilized formulations are provided. Pharmaceutical compositions to be used for in vivo administration must be sterile. This is readily accomplished by, e.g., filtration through sterile filtration membranes.

Further provided are kits or articles of manufacture useful for any one of the methods of nucleic acid editing or methods of ameliorating a disease symptom or improving function of a nervous system described herein, comprising any one of the nucleic acid editing system components, constructs, compositions, libraries, or edited host cells as described herein.

In some embodiments, there is provided a kit for editing the RNA encoding ApoE4 in a cell, comprising an RNA base editor, such as but not limited to any one of the RNA base editors described herein. In some embodiments, the RNA base editor comprises an RNA binding component (such as but not limited to a guide RNA or an anti-sense oligonucleotides) and a base editing component (such as but not limited to a Cas protein or an ADAR recruiting domain) . In some embodiments, the kit further comprises an instruction for carrying out any one of the RNA editing methods described herein.

In some embodiments, there is provided a kit for editing the DNA encoding ApoE4 in a cell, comprising a DNA base editor, such as but not limited to any one of the DNA base editors described herein. In some embodiments, the DNA base editor comprises a DNA binding component (such as but not limited to a DNA binding protein, or a guide RNA) and a base editing component (such as but not limited to cytosine deaminase, a Cas protein or a nickase) . In some embodiments, the kit further comprises an instruction for carrying out any one of the DNA editing methods described herein.

The kits of the present application are in suitable packaging. Suitable packaging includes, but is not limited to, vials, bottles, jars, flexible packaging (e.g., sealed Mylar or plastic bags) , and the like. Kits may optionally provide additional components such as transfection or transduction reagents, cell culturing medium, buffers, and interpretative information.

The present application thus also provides articles of manufacture. The article of manufacture can comprise a container and a label or package insert on or associated with the container. Suitable containers include vials (such as sealed vials) , bottles, jars, flexible packaging, and the like. In some embodiments, the container holds a pharmaceutical composition, and may have a sterile access port (for example the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle) . The container holding the pharmaceutical composition may be a multi-use vial, which allows for repeat administrations (e.g., from 2-6 administrations) of the reconstituted formulation. Package insert refers to instructions customarily included in commercial packages of therapeutic products that contain information about the indications, usage, dosage, administration, contraindications and/or warnings concerning the use of such products. Additionally, the article of manufacture may further comprise a second container comprising a pharmaceutically-acceptable buffer, such as bacteriostatic water for injection (BWFI) , phosphate-buffered saline, Ringer's solution and dextrose solution. It may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, and syringes.

The kits or article of manufacture may include multiple unit doses of the pharmaceutical compositions and instructions for use, packaged in quantities sufficient for storage and use in pharmacies, for example, hospital pharmacies and compounding pharmacies.

EXAMPLE

The examples below are intended to be purely exemplary of the present application and should therefore not be considered to limit the invention in any way. The following examples and detailed description are offered by way of illustration and not by way of limitation.

Example 1. Establishing Aβ uptake and Aβ degradation assay screening methods in SVG p12 astrocytes

1.1 Establishing Aβ uptake assay method.

Cell lines were constructed to stably overexpress APOE2, APOE3 and APOE4, respectively, and the functional differences of the APOE variants in Aβ uptake were measured. Specifically, SVG p12 cells stably overexpressing APOE2, APOE3 and APOE4 were seeded in a 24-well plate at a density of 3×10⁴ cells per well, and 50nM fAβ was added to each well after 24 hours. The supernatant was collected after 48 hours, and the amount of remaining fAβ in the supernatant was detected by Aβ ELISA kit. The amount of fAβ taken up by cells in each well was measured by subtracting the remaining amount of fAβ in the supernatant from the total amount of fAβ initially added minus, and the amount of fAβ taken up was normalized by the number of cells in the well, to account for fAβ uptake capacity per cell, i.e. (Total Aβ -supernatant remaining Aβ)/cell number. (FIG. 1A) .

The Aβ uptake assay showed that the fAβ uptake facilitated by APOE4 was significantly lower than that of APOE2 and APOE3 cells (FIG. 1B) .

1.2 Establishing the Aβ degradation assay method.

SVG p12 cells stably expressing APOE3 or APOE4 were seeded in a 6-well plate at a density of 2 × 10⁵ cells/well. The cells were incubated with 0.5 μM fAβfor 2 hours on the second day, and washed twice with medium. Complete medium was then added to continue culturing of the cells for 48 hours. After 48 hours, 1 mL of RIPA lysis solution (+1%PMSF+1%protease inhibitor) was added to each well, and the cells were lysed at 4℃ for 30 min, before centrifuging at 10000g for 10min at 4℃. After centrifugation, the supernatant lysate was diluted 10× with the dilution buffer of the AβELISA kit before detection of Aβ (FIG. 1C) . The differences in the degradation of fAβfacilitated by APOE3 and APOE4 were reflected by examining the amount of fAβremaining in the cells.

The Aβ degradation assay showed that the fAβ degradation facilitated by APOE4 was significantly lower than that of APOE3 (FIG. 1D) .

Example 2. Characterizing the Aβ uptake and Aβ degradation profiles in astroglial cell lines expressing APOE variants or APOE4 A→G mutants

SVG p12 cells were infected with an APOE virus, allowing the cells to stably overexpress APOE protein. A total of 144 SVG p12 cell lines were generated, with each overexpressing an APOE4 mutant resulting from an A→G mutation at a different site of the encoding nucleic acid. Together with cell lines overexpressing wild-type APOE2, APOE3 and APOE4 proteins, a total of 147 APOE-overexpressing cells were constructed. The cells constructed above were screened by the Aβ uptake assay as described in Example 1.

The human APOE gene coding sequence (CDS) was retrieved from NCBI (GenBank Accession ID: 348) . The full CDS is 954bp, with 1-54bp being the sequence coding for the signal peptide. After excluding the signal peptide and stop codon positions, the remaining coding sequence included 159 A base sites. After further excluding silent mutations (where A→G mutation did not result in a change of the amino acid) , a total of 144 target A→G mutation sites in APOE4 were screened.

Based on the NCBI human APOE gene sequence, the full-length APOE3 sequence was synthesized. Then, sequence mutation was performed on the APOE3 sequence by site-directed mutagenesis to construct APOE4 and APOE2 sequences, respectively. Finally, based on the constructed APOE4 sequence, single-site mutation was performed at the 144 target A mutation positions described above to complete the APOE4 A→G mutation sequence. Finally, 147 APOE gene variant or mutation sequences (APOE2, APOE3, APOE4, and 144 APOE4 A→G mutants) were obtained and analyzed.

The amino acid sequence differences between common variants of human APOE gene: APOE2, APOE3 and APOE4, are as follows:

APOE mutant plasmid construction

MluI or SpeI restriction sites were present, respectively, at either end of the above-synthesized 147 sequences, which were then ligated to a lentiviral vector carrying a BSD resistance selection marker using a double restriction method. The MluI and SpeI double enzyme digestion and the ligation protocols are as follows:

SpeI/MlUI double digestion

Ligation

Lentiviral Packaging of APOE Mutant Plasmids

The APOE mutant plasmids constructed above were separately packaged by lentivirus. In a 6-well cell plate, 293T cells were plated at a density of 1 x 10⁶ cells each well, then 2 ml of cell culture medium was added to each well, and placed in a 37℃, 5%CO2 cell incubator overnight. The next day, the medium was discarded, 2 ml of fresh serum-free medium was added, and the transfection complex was prepared as described below:

The endogenous APOE in the SVG p12 astrocytes were first knocked out using CRISPR-Cas9 Knock-out method. Cas9 and APOE sgRNA (sgRNA-1: GGTGCAGTACCGCGGCGAGG (SEQ ID NO: 3) and sgRNA-2: GCGGACATGGAGGACGTGTG (SEQ ID NO: 4) ) were introduced into SVG p12 astrocytes by electroporation, and resultants cells were cultured for colony selection. Single colonies were assayed to confirm knockout of the endogenous APOE (SVG p12 APOE knockout cell line) . The SVG p12 APOE knockout cell line was then used to construct APOE2-, APOE3-, or APOE4-expressing cell lines using plasmids expressing the APOE variant or APOE4 mutant sequences described above.

2.1 Screening for APOE4 mutation sites resulting in increased Aβ uptake capacity

The SVG p12 APOE knockout cell line as well as cell lines overexpressing different APOE variants and various APOE4 mutants were trypsinized and counted, and subsequently seeded in a 96-well plate at a density of 3,000 cells per well, wherein 3 wells were left unseeded (labeled as “Total Aβ” for determining levels of total Aβ without uptake) . The next day, medium containing 100 nM Aβ was added to the wells. After Aβ treatment for 24 hours, the cell culture supernatant was collected, centrifuged at 200 g × 5 min, and the Aβ content was detected by ELISA in the supernatant after centrifugation. The Aβ uptake of cells expressing different APOE variants was calculated according to Aβ uptake = (Total Aβ -supernatant remaining Aβ)/cell number. Cell lines with higher Aβ uptake than APOE4 were screened by comparative analysis, and the corresponding mutation sites were potential target sites. Cell lines carrying mutant APOE4 exhibiting higher Aβ uptake than the wild-type APOE4-expressing cells were screened by the comparative analysis, and the corresponding mutation sites were potential target sites for further analysis.

The overall APOE functional screening process is shown in FIG. 2A The Aβuptake assay screening results of APOE4 are shown in Table 2.1. According to the results in Table 2.1, there were 33 A→G sites in APOE4-enconding nucleic acid which resulted in a fold change value of greater than 1.2, indicating that the Aβ uptake capacity resulting from these mutant sites was higher than that of wild-type APOE4.

Table 2.1 Aβ uptake capacity in ApoE4 mutants

2.2 Mapping APOE4 mutation sites resulting in increased Aβ uptake capacity to APOE protein functional region

As displayed on the Uniprot website, the APOE protein consists of 317 amino acid residues, of which amino acids 1-18 are signal peptides, which are excised after post-translation modification. The biologically active APOE protein consists of 299 amino acid residues. The APOE4 mutation position Cys112 in mature ApoE4 corresponds to the Cys130 position with reference to SEQ ID NO: 1, and the APOE2 mutation position Arg158 in mature ApoE2 corresponds to the Arg176 position with reference to SEQ ID NO: 1. According to Uniprot as well as literature, the APOE protein functional region can be divided into 5 regions. Mutation sites resulting a >1.2-fold Aβ uptake fold change relative to wild-type APOE4 were mapped onto the corresponding functional region. Through site mapping, we found that mutations enhancing APOE4's ability to uptake Aβ were concentrated in the C-terminal lipid-binding and lipoprotein-binding region (see Table 2.2 and FIG. 2B) .

Table 2.2 –Mutations that enhance ApoE4’s ability to uptake Aβ

2.3 Further Screening of APOE4 mutation sites resulting in increased Aβ uptake capacity for increase in Aβ degradation capacity

Based on the screening results in Example 2.1, 30 mutation sites resulting in high Aβ uptake level (fold change>1.2) were selected, and an Aβdegradation assay screening was performed according to the method in Example 1.

Specifically, the cell lines mutated in the target sites selected above were seeded in 6-well plates at a density of 2 × 10⁵ cells per well. Then, the test cell lines were treated with 0.5 μM Aβ for 2 hours, whereas the negative control cell group was not treated with Aβ. The Aβ-containing medium was then removed. After washing twice with medium, 1 mL of RIPA lysis solution (containing protease inhibitors and PMSF) was added to each well. After lysis at 4℃ for 30 min, centrifugation at 10,000 g × 20 min was performed to remove the unlysed materials and cell debris, and the supernatant was collected. The remaining Aβ content in the lysate supernatant was detected by ELISA. The functional differences of APOE4 mutants in Aβ clearance were then evaluated.

The screening results showed that for APOE4 carrying mutations at S122, S124, S125, S110, S116 and S117, the Aβ degradation capacity was significantly higher than that of wild-type APOE4, as indicated by the significantly lower amount of remaining Aβ in the cell (FIG. 2C) .

Example 3. iPS cell lines expressing APOE variants or APOE4 mutants

APOE3 iPS cell lines were modified by using the CRISPR-Cas9 Knock- in method to construct the APOE4 mutant iPS cell line. Cas9-mRNA, sgRNA and ssODN components were co-delivered into iPS cells by electroporation. The iPS cells were then diluted into single cells, seeded into 10 cm dishes, and cultured to form single cell clones. Then, single cell clones were selected for Sanger sequencing to detect whether Cys112 coding sequence (TGC) was replaced by Arg112 variant sequence (CGC) (amino acid position with respect to mature APOE protein) .

Specifically, using APOE3-expressing iPS (APOE3) cell lines, APOE4 mutant iPS cell lines were constructed by CRISPR-Cas9 knock-in method. The specific experimental process was designed as follows. We designed two sgRNAs targeting the APOE gene near the Cys112 coding region. At the same time, the repair template ssODN sequence was designed with the Arg112 mutated sequence. APOE site-directed mutagenesis sgRNA sequences were: sgRNA-1: GGTGCAGTACCGCGGCGAGG (SEQ ID NO: 3) , and sgRNA-2: GCGGACATGGAGGACGTGTG (SEQ ID NO: 4) . The repair template ssODN sequence was: CAAGGAGCTGCAGGCGGCGCAGGCCCGGCTGGGCGCGGACATGGAGGAC GTGCGCGGCCGCCTCGTGCAGTACCGCGGCGAGGTGCAGGCCATGCTCGG (SEQ ID NO: 5; FIG. 3A; mutation sites are bolded)

Cas9-mRNA, sgRNAs and repair template ssODN components were co-delivered into the iPS cells by electroporation according to the protocol in Table 3.1, using LONZA's 4D-Nucleofector^TM X Electroporation instrument and program CA137. The cells were then diluted into single cells and seeded onto a 10cm culture dish, and continued to be cultured kept in culture until development of single cell clones. Subsequently, the single clones were selected for sanger sequencing to detect whether Cys112 coding sequence (TGC) was replaced by the Arg112 variant sequence (CGC) .

As shown in FIG. 3B, Sanger sequencing was employed to confirm that five APOE4 iPSC cell lines were generated (APOE4-1#to 5#) , with the Cys112 coding sequence (TGC) replaced by Arg112 variant sequence (CGC) . The same method could be used to construct and screen target APOE4 mutant iPS cells.

Example 4. Characterizing the Aβ uptake and Aβ degradation profiles in astroglial cells derived from iPS cell lines expressing APOE variants or APOE4 mutants

The iPS cells expressing APOE variants (APOE4 and APOE3) , or APOE4 mutants constructed in Example 3 are induced to differentiate into astrocytes, microglia and brain organoids, in order to characterize the differences in Aβ uptake and Aβ degradation in corresponding differentiated cells. The astrocytes and microglia differentiated from iPS cells are seeded in a 24-well plate at a density of 3×10⁴ cells/well, and 50 nM fAβ is added to each well after 4 hours. After 48 hours, the supernatants are collected, and the amount of remaining Aβ in the supernatant is detected by Aβ ELISA, to measure Aβ uptake, (Total Aβ -supernatant remaining Aβ) /cell number.

Separately, the differentiated iPSC-differentiated astrocytes and microglia are seeded in another 24-well plate at a density of 3 × 10⁴ cells/well, and after 24 hours, 2 μM mAβ is added to the wells for 2-hour incubation, then washed with serum-free medium for 3 times. Subsequently, complete medium is added and the cells are placed in culture for 48h. After 48 hours, 1 ml of PBS is added to each well to wash the cells once, and then 200 μl of RIPA lysis buffer (+1%PMSF) is added to each well. The cells are lysed at 4℃ for 30 minutes, and then centrifuged at 10,000 g × 10 minutes at 4℃. The lysate is diluted 10× with the dilution buffer of Aβ ELISA kit and detected. The content of fAβ in cells reflects the ability of cells to degrade Aβ.

Claims

A method of altering apolipoprotein E4 (ApoE4) in a cell comprising a nucleic acid encoding ApoE4, the method comprising introducing into the cell one or more components of a nucleic acid editing system, wherein the nucleic acid editing system edits the nucleic acid encoding ApoE4 to mutate an amino acid at amino acid positions 225-294 of the ApoE4 encoded by the nucleic acid, wherein the amino acid positions are in reference to SEQ ID NO: 1, thereby producing an altered ApoE4 having an apolipoprotein E3 (ApoE3) -like function.
A method of altering ApoE4 in a cell comprising a nucleic acid encoding ApoE4, the method comprising introducing into the cell one or more components of a nucleic acid editing system, wherein the nucleic acid editing system edits the nucleic acid encoding ApoE4 to mutate an amino acid selected from the group consisting of: Q35, Q99, Q181, I195, Q219, E223, Q226, E230, M236, M239, S241, E249, K251, E252, Q253, E256, K260, E262, E263, Q264, Q266, Q267, I268, Q271, E273, K280, S281, E284, D289, Q302, and H317 of the ApoE4 encoded by the nucleic acid, in reference to SEQ ID NO: 1, thereby producing an altered ApoE having an ApoE3-like function.
The method of claim 1 or 2, wherein the ApoE4 before mutation ( “unaltered ApoE4” ) comprises an amino acid sequence of SEQ ID NO: 1.
The method of any one of claims 1-3, wherein the ApoE3-like function comprises phospholipid binding capacity.
The method of any one of claims 1-4, wherein the altered ApoE4 displays decreased binding affinity to very-low-density lipoprotein (VLDL) as compared to unaltered ApoE4.
The method of any one of claims 1-5, wherein the altered ApoE4 displays increased binding affinity to high-density lipoprotein (HDL) as compared to unaltered ApoE4.
The method of any one of claims 1-6, wherein the altered ApoE4 exhibits increased amyloid β (Aβ) uptake as compared to unaltered ApoE4.
The method of any one of claims 1-7, wherein the altered ApoE4 facilitates an increased rate of Aβ clearance as compared to that facilitated by unaltered ApoE4.
The method of any one of claims 1-8, wherein the altered ApoE4 facilitates a decreased rate of amyloid fibril formation as compared to that facilitated by unaltered ApoE4.
The method of any one of claims 1-9, wherein the altered ApoE4 facilitates a decreased rate of amyloid plaque formation as compared to that facilitated by unaltered ApoE4.
The method of any one of claims 2-10, wherein the nucleic acid editing system edits the nucleic acid encoding ApoE4 to produce a mutation selected from the group consisting of: Q35R, Q99R, Q181R, I195V, Q219R, E223G, Q226R, E230G, M236V, M239V, S241G, E249G, K251E, K251R, E252G, Q253R, E256G, K260R, E262G, E263G, Q264R, Q266R, Q267R, I268V, Q271R, E273G, K280E, K280R, S281G, E284G, D289G, Q302R, and H317R, in reference to SEQ ID NO: 1.
The method of any one of claims 2-11, wherein the nucleic acid editing system edits the nucleic acid encoding ApoE4 to produce a mutation selected from the group consisting of: K251E, E252G, Q253R, E223G, M239V, and S241G, in reference to SEQ ID NO: 1.
The method of any one of claims 1-12, wherein the nucleic acid encoding ApoE4 is a double stranded DNA.
The method of claim 13, wherein the nucleic acid editing system comprises a DNA base editor.
The method of claim 14, wherein the DNA base editor is a cytidine base editor (CBE) .
The method of claim 14, wherein the DNA base editor is an adenosine base editor (ABE) .
The method of claim 15, wherein the CBE comprises:

a fusion protein comprising: (i) a nucleic acid programmable DNA binding protein (napDNAbp) ; (ii) a cytidine deaminase domain; and (iii) an uracil glycosylase inhibitor (UGI) domain, wherein the napDNAbp is a CasX, CasY, Cpf1, C2c1, C2c2, C2c3, or Argonaute protein.
The method of claim 16, wherein the ABE comprises: an evolved Escherichia coli tRNA^ARG-modifying enzyme, TadA, covalently fused to a catalytically impaired Cas9 protein (D10A nickase Cas9, nCas9) ;

wherein the ABE is complexed with a single guide RNA (sgRNA) ,

wherein the sgRNA directs the ABE to the DNA sequence encoding ApoE4, wherein the ABE catalyzes A·T to G·C transition mutation at defined base pairs.
The method of claim 13, wherein the nucleic acid editing system functions through a homology directed repair pathway.
The method of claim 19, wherein the nucleic acid editing system comprises a DNA nuclease selected from the group consisting of CRISPR/Cas9, TALE nuclease, and zinc figure nuclease.
The method of any one of claims 1-12, wherein the nucleic acid encoding ApoE4 is an mRNA.
The method of claim 21, wherein the nucleic acid editing system comprises an RNA base editor.
The method of claim 22, wherein the RNA base editing system comprises an antisense oligonucleotide (AON) capable of forming a double stranded complex with a target RNA sequence in the cell, for the deamination of a target adenosine in the target RNA sequence by an adenosine deaminases acting on RNA (ADAR) , said AON comprising a Central Triplet of 3 sequential nucleotides, wherein the nucleotide directly opposite the target adenosine is the middle nucleotide of the Central Triplet, wherein 1 , 2, or 3 nucleotides in said Central Triplet comprise a sugar modification and/or a base modification to render the AON more stable and/or more effective in inducing deamination of the target adenosine; further wherein the middle nucleotide does not have a 2’-O-methyl modification;

wherein the target RNA is an mRNA encoding ApoE4.
The method of claim 22, wherein the RNA based editing system is a composition comprising:

i) a Cas13b effector protein; and

ii) a CRISPR RNA (crRNA) ,

wherein the crRNA comprises a) a guide sequence that is capable of hybridizing to a target RNA sequence, and b) a direct repeat sequence,

wherein there is formed a CRISPR complex comprising the Cas13b effector protein complexed with the guide sequence that is hybridized to the target RNA sequence;

optionally wherein the composition comprises an accessory protein that enhances Cas13b effector protein activity, further optionally wherein the accessory protein is a Csx28 protein or a Csx27 protein;

wherein the target RNA is an mRNA encoding ApoE4.
The method of claim 22, wherein the RNA based editing system comprises a vector encoding one or more tRNAs having an anticodon sequence that recognizes the mRNA encoding ApoE4, optionally wherein the tRNA is an endogenous tRNA with a modified anticodon stem recognizing the mRNA encoding ApoE4.
The method of claim 22, wherein the RNA based editing system comprise engineered antisense oligonucleotides (ASO) , wherein each ASO comprises (i) specificity domain that determines programmed to target binding to the mRNA encoding ApoE4, and (ii) an invariant ADAR-recruiting domain to steer endogenous ADAR to an ASO: mRNA hybrid.
The method of any one of claims 1-26, wherein the one or more components of the nucleic acid editing system is introduced into the cell via lipid nanoparticles.
The method of any one of claims 1-26, wherein the one or more components of the nucleic acid editing system is introduced into the cell via a vector.
The method of claim 28, wherein the vector is a viral vector.
The method of any one of claims 1-29, wherein the cell is present in an individual.
The method of claim 30, wherein the individual has a neurodegenerative disorder.
A method of ameliorating a symptom of a neurodegenerative disorder in an individual, comprising altering ApoE4 in the individual according to the method of claim 31.
The method of claim 32, wherein the individual with altered ApoE4 exhibits an increased rate of Aβ clearance as compared to the same individual before the altering of ApoE4.
The method of claim 32 or 33, wherein the individual with altered ApoE4 exhibits a decreased rate of amyloid fibril formation as compared to the same individual before the altering of ApoE4.
The method of any one of claims 32-34, wherein the individual with altered ApoE4 exhibits a decreased rate of amyloid plaque formation as compared to the same individual before the altering of ApoE4.
The method of any one of claims 31-35, wherein the neurodegenerative disorder is an early-onset familial disease, a late-onset familial disease, or a sporadic late-onset disease.
The method of any one of claims 31-36, wherein the neurodegenerative disorder is Alzheimer’s disease.
A method of improving function of a nervous system in an individual having an impaired function in the nervous system, the method comprises altering ApoE4 in the individual according to the method of any one of claims 30-37.
The method of any one of claims 30-38, wherein the individual carries at least one APOE4 allele in at least 90%of the neural cells.
The method of any one of claims 30-39, wherein the individual does not carry an APOE2 allele in at least 90%of the neural cells.
The method of any one of claims 30-40, wherein the individual exhibits APOE4 expression that is higher than the median APOE4 expression in a population.
The method of any one of claims 30-40, wherein the individual exhibits comparable APOE4 expression as the median APOE4 expression in a population.
The method of any one of claims 30-41, wherein the individual exhibits a plasma ApoE4 concentration that is higher than the median plasma ApoE4 concentration in a population by at least about any of 10%, 20%, 30%, 40%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold, or more.
The method of any one of claims 30-41 and 43, wherein the individual exhibits a plasma ApoE4: ApoE3 concentration ratio that is higher than the median plasma ApoE4: ApoE3 concentration ratio in a population by at least about any of 10%, 20%, 30%, 40%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold, or more.
The method of any one of claims 30-41, 43, and 44, wherein the individual exhibits a plasma ApoE4: ApoE2 concentration ratio that is higher than the median plasma ApoE4: ApoE2 concentration ratio in a population by at least about any of 10%, 20%, 30%, 40%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold, or more.
The method of any one of claims 30-41 and 43-45, wherein the individual exhibits a cerebrospinal fluid (CSF) ApoE4 concentration that is higher than the median CSF ApoE4 concentration in a population by at least about any of 10%, 20%, 30%, 40%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold, or more.
The method of any one of claims 30-41 and 43-46, wherein the individual exhibits a CSF ApoE4: ApoE3 concentration ratio that is higher than the median CSF ApoE4: ApoE3 concentration ratio in a population by at least about any of 10%, 20%, 30%, 40%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold, or more.
The method of any one of claims 30-41 and 43-47, wherein the individual exhibits a CSF ApoE4: ApoE2 concentration ratio that is higher than the median CSF ApoE4: ApoE2 concentration ratio in a population by at least about any of 10%, 20%, 30%, 40%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold, or more.
The method of any one of claims 30-48, wherein the individual is at higher risk of developing early-onset familial neurodegenerative disease than the average population, optionally wherein the risk of the individual developing early-onset familial neurodegenerative disease is at least about any of 10%, 20%, 30%, 40%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold higher than that of the average population.
The method of any one of claims 30-48, wherein the individual is at higher risk of developing late-onset familial neurodegenerative disease than the average population, optionally wherein the risk of the individual developing late-onset familial neurodegenerative disease is at least about any of 10%, 20%, 30%, 40%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold higher than that of the average population.
The method of any one of claims 30-48, wherein the individual is at higher risk of developing sporadic late-onset neurodegenerative disease than the average population, optionally wherein the risk of the individual developing sporadic late-onset neurodegenerative disease is at least about any of 10%, 20%, 30%, 40%, 50%, 75%, 100%, 2-fold, 5-fold, 10-fold higher than that of the average population.
An ApoE4 mutant having ApoE3-like function, wherein the ApoE4 mutant comprises a mutation within amino acid positions 225-294, wherein the amino acid positions are in reference to a wild-type ApoE4 (SEQ ID NO: 1) .
An ApoE4 mutant having ApoE3-like function, wherein the ApoE4 mutant comprises a mutation at an amino acid selected from the group consisting of: Q35, Q99, Q181, I195, Q219, E223, Q226, E230, M236, M239, S241, E249, K251, E252, Q253, E256, K260, E262, E263, Q264, Q266, Q267, I268, Q271, E273, K280, S281, E284, D289, Q302, and H317, in reference to a wild-type ApoE4 (SEQ ID NO: 1) .
The ApoE4 mutant of claim 52 or 53, wherein the ApoE3-like function comprises phospholipid binding capacity.
The ApoE4 mutant of any one of claims 52-54, wherein the ApoE4 mutant displays decreased binding affinity to VLDL as compared to wild-type ApoE4.
The ApoE4 mutant of any one of claims 52-55, wherein the ApoE4 mutant displays increased binding affinity to HDL as compared to wild-type ApoE4.
The ApoE4 mutant of any one of claims 52-56, wherein the ApoE4 mutant exhibits increased Aβ uptake as compared to wild-type ApoE4.
The ApoE4 mutant of any one of claims 52-57, wherein the ApoE4 mutant facilitates an increased rate of Aβ clearance as compared to that facilitated by wild-type ApoE4.
The ApoE4 mutant of any one of claims 52-58, wherein the ApoE4 mutant facilitates a decreased rate of amyloid fibril formation as compared to that facilitated by wild-type ApoE4.
The ApoE4 mutant of any one of claims 52-59, wherein the ApoE4 mutant facilitates a decreased rate of amyloid plaque formation as compared to that facilitated by wild-type ApoE4.
The ApoE4 mutant of any one of claims 53-60, wherein the ApoE4 mutant comprises a mutation selected from the group consisting of: Q35R, Q99R, Q181R, I195V, Q219R, E223G, Q226R, E230G, M236V, M239V, S241G, E249G, K251E, K251R, E252G, Q253R, E256G, K260R, E262G, E263G, Q264R, Q266R, Q267R, I268V, Q271R, E273G, K280E, K280R, S281G, E284G, D289G, Q302R, and H317R, in reference to a wild-type ApoE4 (SEQ ID NO: 1) .
The ApoE4 mutant of any one of claims 53-61, wherein the ApoE4 mutant comprises one or more mutations selected from the group consisting of: K251E, E252G, Q253R, E223G, M239V, and S241G, in reference to a wild-type ApoE4 (SEQ ID NO: 1) .
An ApoE4 mutant having ApoE3-like function, wherein the ApoE4 mutant is generated by the method of any one of claims 1-31.
The ApoE4 mutant of any one of claims 52-63, wherein the ApoE4 mutant comprises a Signal Peptide corresponding to amino acid positions 1-18 in reference to SEQ ID NO: 1.
The ApoE4 mutant of any one of claims 52-63, wherein the ApoE4 does not comprise a Signal Peptide corresponding to amino acid positions 1-18 in reference to SEQ ID NO: 1.