WO2023142885A1

WO2023142885A1 - Polyhedral nanostructure-based sars-cov-2 vaccine, preparation method therefor, and application thereof

Info

Publication number: WO2023142885A1
Application number: PCT/CN2022/143936
Authority: WO
Inventors: 胡小龙; 张星; 梁子; 王崇龙; 贡成良
Original assignee: 苏州大学
Priority date: 2022-01-25
Filing date: 2022-12-30
Publication date: 2023-08-03
Also published as: CN114432435A

Abstract

Disclosed in the present invention are a polyhedral nanostructure-based SARS-CoV-2 vaccine, a construction method therefor, and an application thereof. A polyhedral nanostructure is used to wrap a SARS-CoV-2 spike protein receptor binding domain (RBD) to achieve the preparation of a SARS-CoV-2 vaccine immunogen. By means of the construction of an in-vitro recombinant baculovirus vector for the expression of a fusion protein of a polyhedrin and an RBD, and the characteristic that the first 110 amino acid residues of a polyhedrin protein can form a nanocrystal structure, fusion expression of a polyhedrin and an RBD is realized, and an RBD protein can be wrapped by polyhedrin protein crystals, wherein the protein crystals can be separated and purified only by simple centrifugation in a laboratory.

Description

A kind of SARS-Cov-2 vaccine based on polyhedron nanostructure and its preparation method and application

technical field

The invention relates to the technical field of virus genetic engineering, in particular to a polyhedron nanostructure-based SARS coronavirus-2 vaccine and its preparation method and application.

Background technique

The novel coronavirus (SARS-Cov-2) can cause severe respiratory disease. The virus is mainly transmitted from person to person, using human angiotensin-converting enzyme 2 (ACE2) as the receptor for the virus to infect host cells. Until now, effective medical protection measures are urgently needed to prevent the spread of SARS-Cov-2. The development and development of vaccines is the best measure to curb the indiscriminate spread of the virus in the future. For this reason, scientific researchers all over the world are working hard to develop antiviral drugs for SARS-Cov-2, antiviral DNA vaccines and protein vaccines against ACE2. At present, many reports have shown that the viral receptor domain RBD is an ideal immunogen. In vitro and in vivo studies have proved that it can stimulate the body's potential antibody immune response and protect the host. However, the preparation method for the vaccine needs to be further improved and the storage and transportation of the vaccine need to be simplified.

technical problem

The object of the present invention is to provide a SARS coronavirus-2 vaccine based on polyhedron nanostructure and its preparation method and application; Baculovirus expression system can be used to express multiple candidate vaccines as a commercial eukaryotic expression system and bioactive proteins. Baculovirus has a specific infection host (lepidoptera insects) and is not infectious to mammals. The main feature of this type of virus is that the virus particle is wrapped with a porous protein crystal, which is encoded by the virus gene, and In the late stage of viral infection, it is overexpressed. Virus particles wrapped in protein crystals are protected from damage by environmental factors, and can resist high temperature, strong alkali, strong acid, and ultraviolet rays.

technical solution

For achieving the above object, the technical scheme that the present invention adopts is.

A kind of construction method of the SARS-Cov-2 vaccine based on polyhedron nanostructure, comprises the following steps, SEQ ID NO:1 sequence and SEQ ID NO:2 sequence were respectively cloned into the pFSATBacDual vector to obtain the pFSATBacDual-Polyhedrin330-RBD plasmid; Pick the white colonies to obtain the recombinant Bacmid-Polyhedrin330-RBD DNA; transfect the recombinant Bacmid-Polyhedrin330-RBD DNA into silkworm cultured cells, cultivate until the cells develop disease, then collect the cell culture supernatant to obtain the recombinant virus Bacmid-polh-RBD, and then Inoculate the silkworm larvae or silkworm cultured cells with the recombinant virus Bacmid-polh-RBD, collect the hemolymph or silkworm cultured cells infected with silkworms, and centrifuge at 12000 rpm to obtain the vaccine wrapped in nanocrystals, which is based on polyhedron nanostructures. SARS-Cov-2 vaccine.

Preferably, the recombinant virus Bacmid-polh-RBD is infected to the silkworm cultured cells, and after the onset, the silkworm cultured cell supernatant is collected to obtain the second-generation recombinant virus Bacmid-polh-RBD; then the second-generation recombinant virus Bacmid-polh-RBD is inoculated into the silkworm Larvae or silkworm cultured cells, by collecting hemolymph or silkworm cultured cells infected with silkworms, and centrifuging at 12,000 rpm, the vaccine wrapped in nanocrystals can be obtained, which is a SARS-Cov-2 vaccine based on polyhedron nanostructures. Further, the second-generation recombinant virus Bacmid-polh-RBD was used to infect silkworm cultured cells. After the onset of the disease, the supernatant of the silkworm cultured cells was collected to obtain the third-generation recombinant virus Bacmid-polh-RBD, and then the third-generation recombinant virus Bacmid-polh-RBD was inoculated into the silkworm Larvae or silkworm cultured cells, by collecting hemolymph or silkworm cultured cells infected with silkworms, and centrifuging at 12,000 rpm, the vaccine wrapped in nanocrystals can be obtained, which is a SARS-Cov-2 vaccine based on polyhedron nanostructures.

Specifically, clone the sequence of SEQ ID NO:1 into the BamHI/SalI site of pFSATBacDual; clone the sequence of SEQ ID NO:2 into the SalI/Hind III site of pFSATBacDual. Preferably, the sequence of SEQ ID NO:2 is cloned into the SalI/Hind III site of pFSATBacDual to obtain the pFSATBacDual-RBD vector, and then the sequence of SEQ ID NO:1 is cloned into the BamHI/SalI site of pFSATBacDual-RBD to obtain the pFSATBacDual-RBD vector Polyhedrin330-RBD plasmid.

Specifically, transform the pFSATBacDual-Polyhedrin330-RBD plasmid into DH10/Bac competent cells, spread it on an LB agar medium plate, culture it at 37°C, pick white colonies, and extract the recombinant Bacmid-Polyhedrin330-RBD DNA; the recombinant Bacmid-Polyhedrin330-RBD DNA was transfected into silkworm cultured cells, and conventionally cultured for 3 to 5 days, and then the cell culture supernatant was collected to obtain the recombinant virus Bacmid-polh-RBD; the recombinant virus Bacmid-polh-RBD was infected with silkworm cultured After 3 to 5 days, the supernatant of the silkworm cultured cells was collected to obtain the second-generation recombinant virus Bacmid-polh-RBD; the second-generation Bacmid-polh-RBD was inoculated into the silkworm, and after the onset of the disease, the silkworm hemolymph was collected and purified by centrifugation to obtain the nanocrystal package The vaccine, that is, the SARS-Cov-2 vaccine based on the polyhedron nanostructure; or Bacmid-polh-RBD infected silkworm cultured cells for 3 to 5 days, collected the supernatant of silkworm cultured cells, centrifuged and purified to obtain the vaccine wrapped in nanocrystals, namely SARS-Cov-2 vaccine based on polyhedron nanostructures. The third generation virus infection is the same as this step.

The invention also discloses the SARS-Cov-2 vaccine based on the polyhedron nanostructure prepared according to the above preparation method; the application of the above-mentioned SARS-Cov-2 vaccine based on the polyhedron nanostructure in the preparation of SARS coronavirus-2 immunopreventive medicine.

In the above technical scheme, the pUC57-COVID-19-spike-RBD plasmid is used as a template, and the primer pair is used for PCR reaction, the sequence of SEQ ID NO: 2 is cloned, and the pMD19-RBD plasmid is inserted into the pMD19 vector; the pMD19-RBD plasmid uses SalI/ After HindIII restriction endonuclease digestion, the recovered fragment was cloned into the SalI/HindIII site of pFSATBac Dual to obtain pFSATBacDual-RBD vector. Among them, the primer pair is as follows.

RBD-1: GTCGACATGCCTAATATTACAAACTTG.

RBD-2: AAGCTTTTACTCAAAGTGTCTGTGGATC.

In the above technical scheme, the pET28-BmNPV-Polyhedrin plasmid was used as a template, and a primer pair was used to carry out a PCR reaction to clone the sequence of SEQ ID NO: 1 and insert it into the pMD19 vector to construct the pMD19-Polyhedrin330 plasmid; the pMD19-Polyhedrin330 plasmid was restricted by BamHI/SalI After Dicer digestion, the recovered fragment was cloned into the BamHI/SalI site of pFSATBacDual-RBD to obtain pFSATBacDual-Polyhedrin330 vector. Among them, the primer pair is as follows.

Polyhedrin330-1: GGATCCATGCCGAATTATTCATACACC.

Polyhedrin330-2: GTCGACTACAATGGGGAAGCTGTCCTC.

In the above technical scheme, the pFSATBacDual-Polyhedrin330-RBD plasmid was transformed into DH10/Bac competent cells, cultured at 37°C for 4 hours, and then spread on LB containing kanamycin, gentamicin, tetracycline, IPTG, X-gal On the agar medium plate, cultured at 37°C for 18 hours, then picked white colonies, and extracted the recombinant Bacmid-Polyhedrin330-RBD DNA.

In the above technical solution, the silkworm is 4-5 instar larvae or pupates; the rotation speed of centrifugal purification is 12000 rpm, and SDS buffer is used for washing during purification, so that purified nanocrystal-encapsulated vaccine can be obtained.

In the present invention, the pFSATBacDual plasmid is a product of Invitrogen Corporation of the United States, which belongs to the Bac-to-Bac (Bacteria to Baculovirus) expression system vector.

Beneficial effect

The present invention discloses the SARS coronavirus-2 vaccine based on the polyhedron nanostructure for the first time. The micron-structured protein crystals wrap virus particles, which are protected from environmental factors and can resist high temperature, strong alkali, strong acid, and ultraviolet rays; The invention uses baculovirus as a vaccine carrier, which can realize immunization through injection, oral administration, immersion, etc., which increases the choice of immunization routes. The vaccine prepared by this method has a simple preparation process and can be stored and transported at room temperature.

Description of drawings

Figure 1 shows the recombinant plasmid pFastbac-dual-pH-Polyhedrin-RBD-p10-gfp PCR and restriction electrophoresis 1,5: Marker 2: RBD PCR product 3: Polyhedrin330 PCR product 4: GFP PCR product 6,7: pFastbac-dual- pH-Polyhedrin- RBD-p10-GFP digestion product.

Fig. 2 is a schematic diagram of the recombinant vector pFastbac-dual-pH-Polyhedrin-RBD-p10-gfp in Example 1.

Fig. 3 is an identification diagram of the recombinant Bacmid-polh-RBD-GFP in Example 1.

Fig. 4 is the immunofluorescence analysis of silkworm BmN cells infected with the first-generation virus BmNPV-polh-RBD-GFP.

Fig. 5 is the immunofluorescence analysis of silkworm BmN cells infected by the second generation virus BmNPV-polh-RBD-GFP.

Fig. 6 is the immunofluorescence analysis of silkworm BmN cells infected by the third-generation virus BmNPV-polh-RBD-GFP.

Figure 7 is Western Blotting Detect the expression of recombinant protein polh-RBD, the expression result of target protein RBD in BmN cells, primary antibody: anti-2019-nCoV S1 mAb secondary antibody: goat anti-mouse IgG-HRP.

Fig. 8 is a transmission electron microscope observation of silkworm cells infected with baculovirus BmNPV-polh-RBD-GFP.

Embodiments of the present invention

The raw materials used in the present invention are all conventional raw materials in the field, and the specific operation methods such as PCR reaction, cloning, enzyme digestion, transfection, infection, centrifugal purification, sequencing, etc. are all conventional methods in the field, and can be found in the documents disclosed by the applicant. The present invention will be further described below in conjunction with accompanying drawing and embodiment, wherein some conventional methods are shown briefly.

.

Overview of Experimental Methods.

(1) Construct plasmid vector pFastbac-dual-pH-Polyhedrin330-RBD-p10-GFP; obtain plasmids RBD-T, Polyhedrin330-T, GFP-T; combine RBD sequence (319–545 amino acid residues), Polyhedrin330 sequence (1 -330 bp), GFP sequences were cloned into the polyhedrin promoter of the Pfastbac-dual vector, transformed into DH5α after ligation, and the plasmid was extracted to obtain the recombinant plasmid pFastbac-dual-pH-Polyhedrin330-RBD-p10-GFP.

(2) Transfer the constructed pFastbac-dual-pH-Polyhedrin330-RBD-p10-GFP vector into DH10bac.

(3) Blue-white screening, pick the target colonies.

(4) Recombinant virus infects silkworm cultured cells and silkworms.

(5) Western Blotting to detect the recombinant protein.

The expression of recombinant protein polh-RBD was detected by Western blotting.

(1) Transmembrane after SDS-PAGE electrophoresis: Cut PVDF membrane according to the size of the target band and activate in methanol for 5 min. Place three layers of filter paper, gel, PVDF membrane, and three layers of filter paper on the negative electrode of the splint in sequence, drive away the air bubbles, clamp the splint, and place it in the transfer film tank. Turn on the power, run at 330 mA for 30 min.

(2) Blocking: Take out the PVDF membrane, rinse it with PBST and discard it, add 3% BSA, and incubate at room temperature for 2 h on a shaker.

(3) Primary antibody: Take out the PVDF membrane and add primary antibody diluted with 3% BSA (primary antibody: anti-2019-nCoV S1 mAb), overnight at 4°C.

(4) Membrane washing: Recover the primary antibody, and quickly wash 3 times with PBST shaker, 5 min each time.

(5) Secondary antibody: Take out the PVDF membrane, add secondary antibody diluted in 3% BSA (secondary antibody: goat anti-mouse IgG-HRP), dilution factor 1:10000, and incubate at room temperature for 1 h.

(6) Membrane washing: Recover the secondary antibody, and quickly wash 3 times with PBST shaker, 5 min each time.

(7) Exposure: Mix equal volumes of exposure solutions A and B, drop them onto the PVDF membrane, expose them with a machine, and observe the results.

Electron microscope observation of polyhedron nanocrystals. The infected cells were collected and sent to the company (Hangzhou Huoke Biotechnology Co., Ltd.) for transmission electron microscope observation. Transmission electron microscopy step: take susceptible cells, put them into electron microscope fixative solution and fix at 4°C for 2-4h. Rinse with 0.1M phosphate buffer PBS (pH7.4) 3 times, 15 min each time. Then fix with 1% osmic acid-0.1M phosphate buffer PBS (pH7.4) at room temperature (20°C) for 2 h. Rinse with 0.1M phosphate buffer PBS (pH7.4) 3 times, 15 min each time. Then dehydrate with 50%-70%-80%-90%-95%-100%-100% alcohol in turn, 15min each time. Acetone: 812 embedding agent = 1: 1 mixed solution infiltrated overnight, pure 812 embedding agent infiltrated overnight, polymerized at 60°C for 48 hours. Microtome slices, uranium-lead double staining (2% uranium acetate saturated aqueous solution, lead citrate, each staining 15 min), and the slices were dried overnight at room temperature. Observed under a transmission electron microscope and collected images for analysis.

Primer pairs are as follows.

Polyhedrin330-1: GGATCCATGCCGAATTATTCATACACC.

Polyhedrin330-2: GTCGACTACAATGGGGAAGCTGTCCTC.

RBD-1: GTCGACATGCCTAATATTACAAACTTG.

RBD-2: AAGCTTTTACTCAAGTGTCTGTGGATC.

Gfp-1: CTCGAGATGGCTAGCAAAGGAGAAGAA.

Gfp-2: GGTACCTAATCCATGCCATGTGTAATCC.

Embodiment one.

(1) Using the pUC57-COVID-19-spike-RBD plasmid as a template, use primers to perform PCR reactions on RBD-1 and RBD-2, clone the RBD sequence and insert it into the pMD19 vector to construct pMD19-RBD, and perform sequencing verification, and the verification will be correct The plasmid was named pMD19-RBD.

Using the pET28-BmNPV-Polyhedrin plasmid as a template, PCR reactions were performed on Polyhedrin330-1 and Polyhedrin330-2 with primers, the Polyhedrin330 sequence was cloned and inserted into the pMD19 vector to construct pMD19-Polyhedrin330, and the verified plasmid was named pMD19-Polyhedrin330 .

Using the pIZT-V5/His plasmid as a template, PCR reactions were performed on Gfp-1 and Gfp-2 with primers, the GFP sequence was cloned and inserted into the pMD19 vector to construct pMD19-GFP, and the verified plasmid was named pMD19-GFP.

Polyhedrin330 sequence is SEQ ID NO:1, RBD sequence is SEQ ID NO:2, GFP sequence is SEQ ID NO:3.

The PCR reaction program was: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 50 s, annealing at 55°C for 50 s, extension at 72°C for 1 min, and a total of 35 cycles; finally, extension at 72°C for 10 min.

For agarose DNA electrophoresis, configure 1% agarose gel: add 100 mL of 0.5×TBE to 1 g of agarose powder, boil, cool to 50°C, add 10 μL of GelRed dye, shake well and pour. The PCR product was mixed with 3 µL 10×Loading Buffer, transferred to the sample well of 1% agarose gel, and separated by electrophoresis, the electrophoresis buffer was 0.5×TBE, and the voltage was 50-100V. After electrophoresis, place the gel in a UV exposure instrument to expose and take pictures, compare it with the DNA molecular standard Marker, cut the target band gel with a blade, and put it in 1.5 mL EP for gel recovery.

16°C metal bath overnight. Then transform DH5α, and finally carry out plasmid extraction. Finally, plasmids pMD19-RBD, pMD19-Polyhedrin330 and pMD19-GFP were obtained.

(2) Digest the pMD19-Polyhedrin330, pMD19-RBD and pMD19-GFP vectors with BamHI/SalI, SalI/HindIII and kpnI/SmaI restriction endonucleases, respectively, and recover the Polyhedrin330, RBD and GFP DNA fragments, respectively.

Cloning the recovered RBD fragment into the SalⅠ/HindIII site of pFSATBacDual to obtain the pFSATBacDual-RBD vector; cloning the recovered Polyhedrin330 fragment into the BamHI/SalⅠ site of the pFSATBacDual-RBD vector to obtain the pFSATBacDual-Polyhedrin330-RBD plasmid, using polyhedrin The promoter initiates transcription; the recovered GFP fragment is cloned into the kpn I/Sma I site of the pFSATBacDual-Polyhedrin330-RBD plasmid, and the p10 promoter is used to initiate transcription; the constructed recombinant vector pFastbac-dual-pH-Polyhedrin-RBD-p10-gfp see picture 1.

The RBD sequence was cloned into the polyhedrin promoter of the Pfastbac-dual vector to obtain the recombinant vector pFastbac-dual-RBD. Both plasmids RBD-T and pFastbac-dual were digested with enzymes. (Restriction sites: SalⅠ, HindⅢ).

.

Agarose DNA electrophoresis, gel recovery of the target band. The pMD19-RBD double digestion product was gel-recovered as the target fragment; the pFastbac-dual double-digestion product was gel-recovered as the carrier fragment.

16°C overnight. Transform DH5α. Then the plasmid was extracted to obtain the recombinant plasmid pFastbac-dual-RBD; the identification of the recombinant plasmid: bacterial liquid PCR identification and enzyme digestion identification.

The Polyhedrin330 sequence was cloned into the recombinant plasmid pFastbac-dual-RBD to obtain the recombinant plasmid pFastbac-dual-Polyhedrin-RBD. Firstly, the plasmids pMD19-Polyhedrin330 and pFastbac-dual-RBD were digested with BamHI (restriction site: BamHI, SalⅠ).

Enzyme digestion at 37°C for 1h. Then agarose DNA electrophoresis, gel recovery of the target band.

The products recovered from the respective gels were subjected to Sal I single enzyme digestion.

.

Agarose DNA electrophoresis, gel recovery of the target band. The Polyhedrin330-T double digestion product was gel-recovered as the target fragment; the pFastbac-dual-RBD double-digestion product was gel-recovered as the carrier fragment.

To transform DH5α, the steps are the same as above.

The plasmid was extracted to obtain the recombinant plasmid pFastbac-dual-Polyhedrin-RBD, and the recombinant plasmid pFastbac-dual-Polyhedrin-RBD was identified by PCR.

The GFP sequence was cloned into the recombinant plasmid pFastbac-dual-Polyhedrin-RBD to obtain the recombinant plasmid pFastbac-dual-pH-Polyhedrin-RBD-p10-GFP. Plasmids pMD19-GFP and pFastbac-dual-Polyhedrin-RBD were both digested with double enzymes. The enzyme cutting sites are SmaI and KpnI.

.

Agarose DNA electrophoresis, gel recovery of the target band. The pMD19-GFP double digestion product was gel-recovered as the target fragment; the pFastbac-dual-Polyhedrin-RBD double-digestion product was gel-recovered as the carrier fragment.

.

Transform DH5α, the steps are the same as above; plasmid extraction: obtain recombinant plasmid pFastbac-dual-pH-Polyhedrin-RBD-p10-GFP; recombinant plasmid pFastbac-dual-pH-Polyhedrin-RBD-p10-GFP was identified by PCR and enzyme digestion.

The above target fragments were recovered and ligated, and the ligated products were transformed into competent DH5ɑ, and the screening medium plates containing corresponding antibiotics were spread. After culture, monoclonal colonies were picked for expansion culture and recombinant plasmids were extracted. Using the recombinant plasmid as a template, primers RBD-1 and RBD-2, Polyhedrin330-1 and Polyhedrin330-2, Gfp-1 and Gfp-2 were used to perform PCR amplification on the coding sequences of RBD, Polyhedrin330 and GFP, respectively. The results of 1% agarose gel electrophoresis showed that the sizes of PCR products were about 768 bp, 330 bp and 708 bp, which were consistent with the theoretical sizes. At the same time, the recombinant plasmid was double-digested with restriction endonucleases SmaI and KpnI, and then agarose gel electrophoresis was performed. The results showed that the size of the insert fragment GFP and the vector fragment pFastbac-dual-Polyhedrin-RBD were consistent with the theoretical value (Figure 1) , indicating that the recombinant plasmid was constructed successfully, and it was named pFastbac-dual-pH-Polyhedrin-RBD-p10-GFP (Figure 2).

(3) Transform 5 μL of pFastbac-dual-pH-Polyhedrin-RBD-p10-gfp into 200 ul of DH10/Bac competent cells, gently pipette and mix, place at 0°C for 30 min, and heat shock in a metal bath at 42°C 90 s, place at 0°C for 5 min, add 1 mL of preheated LB liquid medium, incubate at 37°C for 4 h; centrifuge at 5000 r/min for 5 min, discard the supernatant, keep 200 μL to suspend the precipitate by blowing, and spread on On the LB solid medium containing antibiotics, place it upright at 37°C for 30 min, then invert for 12 h, pick the colonies and culture them in 3 mL LB liquid medium containing antibiotics overnight (12 h), screen for blue and white spots, and identify recombinants by PCR Bacmid-polh-RBD-GFP; antibiotics: Kan+ 1:1000, Qingda 1:1000, Sihuan 1:1000, IPTG 1:1000, X-gal 1:500; PCR system: (select Ex taq) PCR program: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 50 s, annealing at 55°C for 50 s, extension at 72°C for 2 min, a total of 35 cycles; final extension at 72°C for 10 min. Agarose DNA electrophoresis to identify the recombinant virus.

Transform the recombinant baculovirus transfer vector pFastbac-dual-pH-Polyhedrin-RBD-p10-GFP into DH10/Bac competent cells, use the Bac-to-Bac system to construct recombinant Bacmid, and use M13 primers to amplify in the recombinant Bacmid A specific product consistent with the theoretical value of 4236 bp (Bacmid-polh-RBD-GFP=Bacmid 2430 bp+RBD 768 bp+Polyhedrin 330 bp+GFP 708 bp) was obtained (Figure 3), indicating that the recombinant bacmid was successfully constructed and named is Bacmid-polh-RBD-GFP.

(4) The recombinant Bacmid-polh-RBD-GFP was transfected into BmN cells, and the control was wild Bacmid. Bacmid-polh-RBD-GFP concentration: 3161.9 ng/μL; wild Bacmid concentration: 4038.2 ng/μL.

Cell transfection: blow up 2×10 ⁵ BmN cells with TC-100 medium containing 10% FBS, spread them on a culture dish, and perform transfection when the cells are adherent and in good condition. Take two empty tubes: tube A and tube B, add 197 μL serum-free medium and 3 μL Roche liposomes to tube A, add 198 μL serum-free medium and 2 μg plasmid to tube B, and then separate the two tubes The liquids in the solution were mixed together and allowed to stand for 30 min to form a liposome-plasmid mixture. Remove the old medium in the culture plate, add 1.6 mL of serum-free medium to the mixture, mix well, and add to the culture dish. After culturing in a 26°C incubator for 6 hours, replace with a new serum-containing medium. When the cells become ill, the symptoms of onset: the cells become round and change from a semi-adherent state to a suspension state. The susceptible cells were observed by fluorescence, and the diseased cells were collected with EP tubes, centrifuged at 12000r/min for 3 minutes, and the supernatant was the virus liquid, and the BmN cells were reinfected with the virus liquid. In addition, protein extraction was performed on the cell pellet for subsequent western blotting.

BmN cells were transfected with Bacmid-polh-RBD-GFP. After transfection for 72 hours, compared with normal BmN cells, the cells in the experimental group showed obvious cytopathic changes such as roundness and weakened cell attachment ability (Figure 4). The first generation (P1) virus was obtained from the cell culture supernatant, which was named BmNPV-polh-RBD-GFP. Infect the BmN cells with the recombinant virus of the P1 generation, collect the cell culture supernatant to obtain the P2 generation virus, and repeat this operation to obtain the P3 generation virus. See 4, Figure 5 and Figure 6 for the immunofluorescence analysis of silkworm BmN cells infected by the third-generation virus BmNPV-polh-RBD-GFP.

The anti-2019-nCoV S1 mAb was used to detect the antibody, and the expression of RBD protein after the recombinant baculovirus BmNPV-polh-RBD-GFP infected BmN cells was detected, and the Western blotting results showed that it was compared with wild BmNPV infection. The recombinant baculovirus BmNPV-polh-RBD-GFP successfully expressed the target protein RBD in silkworm cells (Figure 7).

(5) Take the second-generation recombinant virus, inoculate silkworm cultured cells at a ratio of 1:100 (V/V), and culture at 27°C for 4 days. After the disease occurs, collect the cell culture supernatant and centrifuge at 1000 rpm for 10 minutes to remove cell debris. Centrifuge the supernatant at 12,000 rpm at 4 degrees for 60 minutes, discard the supernatant, dissolve the precipitate with 1*SDS buffer, centrifuge at 2,000 rpm for 10 minutes, and centrifuge the supernatant at 12,000 rpm at 4 degrees for 60 minutes. Wash with 1*SDS buffer to obtain the SARS coronavirus-2 (SARS-Cov-2) vaccine based on the polyhedron nanostructure.

The cells were infected with the recombinant baculovirus BmNPV-polh-RBD-GFP, and the BmN cells infected for 96 h were collected by centrifugation, and sent to the company for sectioning and observation with a transmission electron microscope. Electron microscopy results showed that dense black particles appeared in the nucleus, with a size of about 200 nm, which were polyhedron nanocrystals (Figure 8).

Example 2: (1) to (4) are the same as steps (1) to (4) in Example 1; (5) Take the second-generation recombinant virus with insect needles, puncture and inoculate the 5th instar silkworm from the intersegmental membrane, 25 ℃ normal feeding, 5 days after silkworm onset, collect silkworm hemolymph, freeze-thaw alternately more than 3 times. Centrifuge at 1000 rpm for 10 minutes. After removing cell debris, centrifuge at 12000 rpm at 4 degrees for 60 minutes. Discard the supernatant, dissolve the precipitate with 1*SDS buffer, centrifuge at 1000 rpm for 10 minutes, centrifuge the supernatant at 12000 rpm at 4 degrees for 60 minutes, wash the precipitate with 1*SDS buffer, and obtain polyhedron-based nanostructures SARS coronavirus-2 (SARS-Cov-2) vaccine.

For the current SARS-Cov-2, there is an urgent need to develop vaccines with high safety, low cost and easy use. In this study, the polyhedron nanostructure was used to wrap the receptor-binding domain of the SARS-Cov-2 spike protein to prepare SARS-Cov-2 vaccine. The vaccine prepared by this method has a simple preparation process and realizes storage and transportation of the vaccine at room temperature, and the present invention solves the defect that the existing polyhedron vaccine is micron, obtains nanostructured porous protein crystals for the first time, and realizes high efficiency of RBD pack.

Sequence Listing Free Content

In the present invention, the sequence SEQ ID NO: 1 is: ATGCCGAATTATTCATACACCCCCCACCATCGGGCGTACTTACGTGTACGACAATAAATATTACAAAAACTTGGGCTGTCTTATCAAAAACGCCAAGCGCAAGAAGCACCTAGTCGAACATGAACAAGAGGAGAAGCAATGGGATCTTCTTAGACAACTACATGGTTGCCGAAGATCCCTTTTTAGGACCGGGCAAAA ACCAAAAACTTACCCTTTTTAAAGAAATTCGCAGTGTGAAACCCGATACCATGAAGTTAATCGTCAACTGGAGCGGCAAAAGAGTTTTGCGTGAAACTTGGACCCGTTTTGTTGAGGACAGCTTCCCCATTGTA.

Sequence SEQ ID NO: 2 is: ATGCCTAATATTACAAACTTGTGCCCTTTTGGTGAAGTTTTTAACGCCACCAGATTTGCATCTGTTTATGCTTGGAACAGGAAGAGAATCAGCAACTGTGTTGCTGATTATTCTGTCCTATAATTCCGCATCATTTTCCACTTTTAAGTGTTATGGAGTGTCTCCTACTAAATTAAATGATCTCTGCTTTACTAATGTCTATGCAG ATTCATTTGTAATTAGAGGTGATGAAGTCAGACAAATCGCTCCAGGGCAAACTGGAAAGATTGCTGATTATAATTATAAATTACCAGATGATTTAATTATAAATTACCAGATGATTTTACAGGCTGCGTTATAGCTTGGAATTCTAACAATCTTGATTCTAAGGTTGGTGGTAATTATAATTACCTGTATAGATTGTTTAGGAAGTCTAATCTCAAACCTTTTGAGAGAGATATTTCAACTGAAATCTATCAG GCCGGTAGCACACCCTTGTAATGGTGTTGAAGGTTTTAATTGTTACTTTCCTTTACAATCATATGGTTTCCAACCCACTAATGGTGTTGGTTACCAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTACATGCACCAGCAACTGTTTGTGGACCTAAAAAGTCTAATTTGGTTAAAAACAAATGTGTCCAATTTCAACTTCAATGGTTTAACAGGCACAGGT GTTCTTACTGAGTCTAACAAAAAGTTTCTGCCTTTCCAACAATTTGGCAGAGACATTGCTGACACTACTGATGCTGTCCGTGATCCACAGACACTTGAGTAA.

SEQ ID NO:3 ATGGCTAGCAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCTACATACGGAAAGCTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACTTGTCACTACTTTTCTCTTATGGTGTTCAATGCTTTTC CCGTTATCCGGATCATATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAACGCACTATATCTTTCAAAGATGACGGGAACTACAAGACGCGTGCTGAAGTCAAGTTTGAAGGTGATACCTTGTTAATCGTATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTCGGACACAAACTCGAGTACAACTATAACTCA CACAATGTATACATCACGGCAGACAAACAAAAGAATGGAATCAAAGCTAACTTCAAAATTCGTCACAACATTGAAGATGGATCCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCCAGACAACCATTACCTGTCGACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGCGTGACCACATGGTCCTTCTTGAGTTTGT AACTGCTGCTGGGATTACACATGGCATGGATTAA.

Claims

A kind of construction method based on the SARS-Cov-2 vaccine of polyhedron nanostructure, is characterized in that, comprises the following steps, respectively clones into pFSATBacDual vector with SEQ ID NO:1 sequence, SEQ ID NO:2 sequence, obtains pFSATBacDual-Polyhedrin330 -RBD plasmid; then the plasmid is transformed into DH10/Bac competent cells, then spread on LB agar medium plate, culture, and pick white colonies to obtain recombinant Bacmid-Polyhedrin330-RBD DNA; recombinant Bacmid-Polyhedrin330-RBD DNA transfected silkworm cultured cells, cultivated until the cells became diseased, then collected the cell culture supernatant to obtain the recombinant virus Bacmid-polh-RBD, then inoculated the recombinant virus Bacmid-polh-RBD into silkworm larvae or silkworm cultured cells, collected the blood of infected silkworms Lymphoid or silkworm cultured cells were centrifuged to obtain a SARS-Cov-2 vaccine based on polyhedron nanostructures.
According to the construction method of the SARS-Cov-2 vaccine based on polyhedron nanostructure according to claim 1, it is characterized in that, SEQ ID NO:1 sequence is cloned into the BamHI/SalI site of pFSATBacDual; SEQ ID NO:2 sequence Cloned into the SalI/HindIII site of pFSATBacDual.
According to the construction method of the SARS-Cov-2 vaccine based on polyhedron nanostructure according to claim 2, it is characterized in that, the sequence of SEQ ID NO:2 is cloned into the SalI/HindIII site of pFSATBacDual to obtain the pFSATBacDual-RBD vector, Then the sequence of SEQ ID NO: 1 was cloned into the BamHI/SalI site of pFSATBacDual-RBD to obtain the pFSATBacDual-Polyhedrin330-RBD plasmid.
According to the construction method of the SARS-Cov-2 vaccine based on the polyhedron nanostructure according to claim 1, it is characterized in that the silkworm is 4-5 instar larvae or first pupation.
According to the construction method of the SARS-Cov-2 vaccine based on polyhedron nanostructure according to claim 1, it is characterized in that, described LB agar medium contains tetracycline, kanamycin, gentamycin, IPTG and X-gal .
The method for constructing the SARS-Cov-2 vaccine based on the polyhedron nanostructure according to claim 1, wherein the speed of centrifugal purification is 10,000 to 150,000 rpm, and SDS buffer is used for washing during purification.
The SARS-Cov-2 vaccine based on the polyhedron nanostructure constructed according to the construction method of the SARS-Cov-2 vaccine based on the polyhedron nanostructure according to claim 1.
A SARS-Cov-2 immunopreventive drug, comprising the SARS-Cov-2 vaccine based on the polyhedron nanostructure according to claim 7.
The application of recombinant virus Bacmid-polh-RBD in the SARS-Cov-2 vaccine based on polyhedron nanostructure described in claim 7, is characterized in that, SEQ ID NO:1 sequence, SEQ ID NO:2 sequence are respectively cloned Enter the pFSATBacDual vector to obtain the pFSATBacDual-Polyhedrin330-RBD plasmid; then transform the plasmid into DH10/Bac competent cells, spread it on an LB agar medium plate, culture it, and pick white colonies to obtain recombinant Bacmid-Polyhedrin330-RBD DNA; recombinant Bacmid-Polyhedrin330-RBD The cultured cells of silkworm were transfected with DNA, cultured until the cells became pathogenic, and then the cell culture supernatant was collected to obtain the recombinant virus Bacmid-polh-RBD.
The application of the SARS-Cov-2 vaccine based on the polyhedron nanostructure described in claim 7 in the preparation of SARS coronavirus-2 immunopreventive medicine.