WO2023142860A1 - Method for constructing threonine-producing genetically engineered bacterium - Google Patents

Abstract

The present invention provides a method for constructing a threonine-producing genetically engineered bacterium. According to the present invention, by means of reducing the activity of 2-formyl-citrate synthase 2 or inactivating the synthase, the supply of oxaloacetate, a synthetic precursor of threonine, is enhanced, so that the threonine-producing ability of the strain is improved, and the threonine yield of the strain is increased by up to 25% compared to that of an unengineered strain. In addition, by means of further enhancing threonine synthesis pathway-related genes, and/or by means of knocking out or attenuating threonine synthesis-related competitive pathway genes, the threonine yield is improved. The method provides a new approach for the large-scale production of threonine and has relatively high application value.

Description

Construction method of gene engineering bacteria producing threonine technical field

The invention belongs to the technical field of microbial engineering, and in particular relates to a method for constructing threonine-producing genetically engineered bacteria.

Background technique

L-threonine (L-Threonin), the chemical name is β-hydroxy-α-aminobutyric acid, the molecular formula is C ₄ H ₉ NO ₃ , and the relative molecular mass is 119.12. L-threonine is an essential amino acid, mainly used in medicine, chemical reagents, food fortifiers, feed additives and other fields.

In Corynebacterium glutamicum, the generation of threonine from oxaloacetate requires a five-step catalytic reaction, which are aspartate kinase (encoded by lysC), aspartate semialdehyde dehydrogenase (encoded by asd), and homoserine dehydrogenase. Hydrogenase (hom coded), homoserine kinase (thrB) and threonine synthase (thrC) coded. Hermann Sahm and others have been committed to the development of high-threonine-producing Corynebacterium glutamicum, and have made some breakthroughs, obtaining the hom gene that is resistant to feedback inhibition (Reinscheid D J, Eikmanns B J, Sahm H. Analysis of a Corynebacterium glutamicum hom gene coding for a feedback-resistant homoserine dehydrogenase.[J].Journal of Bacteriology,1991,173(10):3228-3230), lysC gene (Eikmanns B J,Eggeling L,Sahm H.Molecular aspects of lysine,threonine , and isoleucine biosynthesis in Corynebacterium glutamicum.[J].Antonie Van Leeuwenhoek,1993,64(2):145-163). Following Hermann Sahm, Lothar Eggling increased the threonine production from 49mM to 67mM by weakening the coding gene glyA in the threonine utilization pathway and overexpressing the threonine export protein ThrE (Simic P, Willuhn J, Sahm H, et al. Identification of glyA(Encoding Serine Hydroxymethyltransferase) and Its Use Together with the Exporter ThrE To Increase l-Threonine Accumulation by Corynebacterium glutamicum[J].Applied and Environmental Microbiology,2002, 68(7):3321-3327) .

At present, the reports on the production of threonine by Corynebacterium glutamicum mainly focus on its synthesis pathway, and there are few reports on the supply of precursors. Moreover, the existing reports only did preliminary research on the threonine synthesis pathway, and did not form a system.

Contents of the invention

The purpose of the present invention is to enhance the supply of threonine synthesis precursor oxaloacetate by reducing the activity of 2-formyl-citrate synthase 2 (prpC2) or inactivating the enzyme, and improve the ability of bacterial strains to produce threonine, Therefore, a method for constructing a gene engineering bacterium producing threonine (L-threonine) is provided.

In order to achieve the purpose of the present invention, in a first aspect, the present invention provides a modified Corynebacterium microorganism, which has a reduced or lost activity of 2-formyl-citrate synthase 2 compared with an unmodified microorganism, And the microorganism has enhanced threonine production ability compared to the unmodified microorganism. Preferably, the reference sequence number of 2-formyl-citrate synthase 2 on NCBI is WP_011013797.1, or an amino acid sequence with 90% similarity thereto.

Further, the reduction or loss of the activity of 2-formyl-citrate synthase 2 in the microorganism is by reducing the expression of the gene encoding 2-formyl-citrate synthase 2 or knocking out the endogenous encoding 2-formyl -Achieved by the citrate synthase 2 gene.

Methods such as mutagenesis, site-directed mutation or homologous recombination can be used to reduce the expression of the gene encoding 2-formyl-citrate synthase 2 or to knock out the endogenous gene encoding 2-formyl-citrate synthase 2.

Further, compared with unmodified microorganisms, the activity of enzymes related to the threonine synthesis pathway in the microorganism is enhanced; or,

Compared with unmodified microorganisms, the enzyme activity of the competitive pathway or degradation pathway related to threonine synthesis in the microorganism is reduced or lost; or,

Compared with the unmodified microorganism, the enzyme activity of the threonine synthesis pathway in the microorganism is enhanced, and the enzyme activity of the competition pathway or degradation pathway related to the threonine synthesis is reduced or lost;

Wherein, the enzymes related to the threonine synthesis pathway are selected from at least one of aspartokinase, homoserine dehydrogenase, and threonine synthase; preferably, their reference sequence numbers on NCBI are respectively WP_003855724.1, WP_003854900.1, WP_011014964.1, or an amino acid sequence with a similarity of 90% to the above reference sequence.

The enzyme of the competitive pathway related to the synthesis of threonine is selected from the group consisting of diaminopimelate dehydrogenase, threonine dehydratase, 4-hydroxy-tetrahydrodipicolinate synthase, acetate kinase, phosphotransacetylase At least one of them; preferably, their reference sequence numbers on NCBI are respectively WP_011015254.1, WP_003862033.1, WP_011014792.1, WP_003862874.1, NP_601948.1, or 90% similarity with the above reference sequence amino acid sequence.

Preferably, the microorganism is any one of the following ①～⑦:

① Microorganisms with reduced or lost 2-formyl-citrate synthase 2 activity and at least one enhanced activity of aspartokinase, homoserine dehydrogenase and threonine synthase;

② Microorganisms with reduced or lost activity of 2-formyl-citrate synthase 2 and enhanced activities of aspartokinase, homoserine dehydrogenase and threonine synthase;

③ Microorganisms with decreased or lost activity of 2-formyl-citrate synthase 2 and enhanced activities of aspartokinase, homoserine dehydrogenase and threonine synthase, and decreased or lost activity of diaminopimelate dehydrogenase ;

④ Microorganisms with reduced or lost activity of 2-formyl-citrate synthase 2 and enhanced activities of aspartokinase, homoserine dehydrogenase and threonine synthase, and decreased or lost activity of threonine dehydratase;

⑤ The activity of 2-formyl-citrate synthase 2 is reduced or lost, and the activities of aspartokinase, homoserine dehydrogenase and threonine synthase are enhanced, and the activity of 4-hydroxy-tetrahydrodipicolinate synthase is reduced or lost microorganisms;

Preferably, the reduced activity of 4-hydroxy-tetrahydrodipicolinate synthase refers to the mutation of A in the start codon ATG of 4-hydroxy-tetrahydrodipicolinate synthase to G;

⑥ Microorganisms with reduced or lost activity of 2-formyl-citrate synthase 2 and enhanced activities of aspartokinase, homoserine dehydrogenase and threonine synthase, and reduced or lost activity of acetate kinase;

⑦ Microorganisms with decreased or lost activity of 2-formyl-citrate synthase 2 and enhanced activities of aspartokinase, homoserine dehydrogenase and threonine synthase, and decreased or lost activity of phosphotransacetylase.

The enhancement of the activity of enzymes related to the threonine synthesis pathway in the microorganism is achieved by being selected from the following 1) to 6), or an optional combination:

1) enhanced by introducing a plasmid having a gene encoding the enzyme;

2) enhanced by increasing the copy number of the gene encoding said enzyme on the chromosome;

3) Enhanced by changing the promoter sequence of the gene encoding the enzyme on the chromosome;

4) Enhanced by operably linking a strong promoter to the gene encoding the enzyme;

5) Enhanced by changing the amino acid sequence of the enzyme;

6) Enhanced by changes in the nucleotide sequence encoding the enzyme.

The activity reduction or loss of enzymes related to threonine synthesis-related competitive pathways or degradation pathways in the microorganism is achieved by being selected from the following 1)-5), or an optional combination:

1) reduce or lose by changing the promoter sequence of the gene encoding the enzyme;

2) reduced or lost by changing the ribosome binding site of the gene encoding the enzyme;

3) reduction or loss by changing the amino acid sequence of the enzyme;

4) reduced or lost by changing the nucleotide sequence encoding the enzyme;

5) Loss by knocking out the coding sequence of the enzyme.

Preferably, the corynebacterium before the modification used in the present invention is Corynebacterium glutamicum (Corynebacterium glutamicum), and Corynebacterium glutamicum comprises ATCC13032, ATCC13870, ATCC13869, ATCC21799, ATCC21831, ATCC14067, ATCC13287 etc. (see NCBI Corunebacterium glutamicum evolutionary tree https://www.ncbi.nlm.nih.gov/genome/469), more preferably Corynebacterium glutamicum ATCC 13032.

In a second aspect, the present invention provides a method for constructing a threonine-producing genetically engineered bacterium, wherein the method is selected from any one of schemes i～iv:

Scheme i: Weaken the gene encoding 2-formyl-citrate synthase 2 in corynebacteria with amino acid production ability, and obtain a gene weakened strain; the attenuation includes knocking out or reducing the 2-formyl-citrate synthase 2 encoding gene expression;

Scheme ii:

A. Weaken the gene encoding 2-formyl-citrate synthase 2 in corynebacteria with amino acid production ability to obtain a gene weakened strain; the weakening includes knocking out or reducing the 2-formyl-citrate synthase 2 encoding gene expression of

B. Enhancing the enzymes related to the threonine synthesis pathway in the gene weakened strain of step A to obtain enzyme activity enhanced strains;

Scheme iii:

a. Weakening the gene encoding 2-formyl-citrate synthase 2 in corynebacteria with amino acid production ability to obtain a gene weakened strain; and

b. further weakening the coding gene of the enzyme of the competition pathway or degradation pathway related to threonine synthesis in the gene weakening strain of step a;

Said attenuation comprises knocking out or reducing the expression of a gene;

Scheme iv:

1) Weakening the gene encoding 2-formyl-citrate synthase 2 in corynebacteria with amino acid production ability to obtain gene weakened strains;

2) Enhancing step 1) Enzymes related to threonine synthesis pathway in gene weakened strains to obtain enzyme activity enhanced strains; and 3) further weakening step 2) Enhancing the competition pathway or degradation pathway related to threonine synthesis in the strain Enzyme-encoding genes;

The enhanced pathway is selected from the following 1) to 6), or an optional combination:

1) enhanced by introducing a plasmid having a gene encoding the enzyme;

2) enhanced by increasing the copy number of the gene encoding said enzyme on the chromosome;

3) Enhanced by changing the promoter sequence of the gene encoding the enzyme on the chromosome;

4) Enhanced by operably linking a strong promoter to the gene encoding the enzyme;

5) Enhanced by changing the amino acid sequence of the enzyme;

6) Enhanced by changes in the nucleotide sequence encoding the enzyme.

The enzyme activity reduction or loss is achieved by being selected from the following 1)-5), or an optional combination:

1) Reduced or lost by changing the promoter sequence of the gene encoding the enzyme

2) Reduced or lost by changing the ribosome binding site of the gene encoding the enzyme

3) Reduced or lost by changing the amino acid sequence of the enzyme

4) Reduced or lost by changing the nucleotide sequence encoding the enzyme

5) Loss by knocking out the coding sequence of the enzyme.

Wherein, the enzyme related to the threonine synthesis pathway is selected from at least one of aspartokinase, homoserine dehydrogenase, and threonine synthase;

The enzymes of the competition pathway or degradation pathway related to the synthesis of threonine are selected from the group consisting of diaminopimelate dehydrogenase, threonine dehydratase, dihydrodipicolinate synthase 4-hydroxyl-tetrahydrodipyridinecarboxylate At least one of acid synthase, acetate kinase, and phosphotransacetylase.

In a third aspect, the present invention provides a method for producing threonine, the method comprising the steps of:

a) cultivating said modified Corynebacterium genus microorganism to obtain a culture of said microorganism;

b) collecting the threonine produced from said culture obtained in step a).

In the fourth aspect, the present invention provides the knockout or reduced expression of the gene encoding 2-formyl-citrate synthase 2 in the fermentative production of threonine or the improvement of threonine fermentative yield.

Further, the fermentation yield of threonine was improved by inactivating 2-formyl-citrate synthase 2 in Corynebacterium having amino acid production ability.

Preferably, the corynebacterium before the modification used in the present invention is Corynebacterium glutamicum (Corynebacterium glutamicum), and Corynebacterium glutamicum comprises ATCC13032, ATCC13870, ATCC13869, ATCC21799, ATCC21831, ATCC14067, ATCC13287 etc. (see NCBI Corunebacterium glutamicum evolutionary tree https://www.ncbi.nlm.nih.gov/genome/469), more preferably Corynebacterium glutamicum ATCC 13032.

In the fifth aspect, the present invention provides the application of the modified Corynebacterium genus microorganism or the threonine-producing genetically engineered bacteria constructed according to the above-mentioned method in the fermentative production of threonine or in improving the fermentative yield of threonine.

The transformation methods of the above-mentioned related strains, including gene enhancement and weakening, are transformation methods known to those skilled in the art. ,2016; Cui Yi. Metabolic engineering of Corynebacterium glutamicum to produce L--leucine [D]. Tianjin University of Science and Technology.; Xu Guodong. Construction of L-isoleucine production strain and optimization of fermentation conditions. Tianjin University of Science and Technology ,2015.

By virtue of the above technical solutions, the present invention has at least the following advantages and beneficial effects:

The present invention improves the yield of threonine produced by strains (corynebacteria, such as corynebacterium glutamicum) by reducing the activity of 2-formyl-citrate synthase 2 or inactivating the enzyme. The production of threonine can be increased by up to 25% compared with the unmodified strain. And further strengthen threonine synthesis pathway-related genes, and/or knock out or weaken threonine synthesis-related competitive pathway genes, so as to increase the threonine production. It provides a new way for large-scale production of threonine and has high application value.

Detailed ways

Since 2-formyl-citrate synthase 2 is not directly related to the threonine synthesis pathway, and there are no related reports that the inactivation of 2-formyl-citrate synthase 2 can increase the downstream products of threonine. The inventor speculates that the inactivation of 2-formyl-citrate synthase 2 can enhance the supply of oxaloacetate, the precursor of threonine synthesis, and improve the ability of the strain to produce threonine. Therefore, on the basis of threonine-producing bacteria A series of 2-formyl-citrate synthase 2 inactivated strains were constructed, and the threonine production was improved from the preliminary verification of shake flasks.

Due to the strict metabolic regulation in bacteria, aspartokinase and homoserine dehydrogenase in the threonine synthesis pathway are strictly regulated by intracellular threonine concentration. Therefore, to transform the strain to produce threonine, it is first necessary to open up its synthesis pathway, which mainly includes the deregulation and expression enhancement of aspartokinase and homoserine dehydrogenase, and overexpression on the basis of the starting strain Corynebacterium glutamicum ATCC 13032 Aspartokinase, homoserine dehydrogenase, and the modified strain SMCT092 were obtained so that the strain had preliminary threonine synthesis ability, and its threonine production was 2.4g/L.

On this basis, strain SMCT094 was obtained by inactivating 2-formyl-citrate synthase 2, and the threonine production capacity of the strain increased from 2.4g/L to 2.6g/L.

In order to further verify that the increase in threonine production is due to the inactivation of 2-formyl-citrate synthase 2, and that it is effective in different strains, the enhanced expression of threonine synthase was obtained in the strain SMCT092, and the modified strain SMCT093 was obtained. Obtained by inactivating at least one enzyme in diaminopimelate dehydrogenase, threonine dehydratase, 4-hydroxy-tetrahydrodipicolinate synthase, acetate kinase, and phosphotransacetylase respectively in bacterial strain SMCT093 A series of strains SMCT095, SMCT096, SMCT097, SMCT098, SMCT099; respectively expressed weakened threonine dehydratase and 4-hydroxy-tetrahydrodipicolinate synthase in strain SMCT093, and obtained strains SMCT100 and SMCT101.

On the basis of strains SMCT093, SMCT095, SMCT096, SMCT097, SMCT098, SMCT099, SMCT100, SMCT101, 2-formyl-citrate synthase 2 was inactivated to obtain strains SMCT102, SMCT103, SMCT104, SMCT105, SMCT381, SMCT382, SMCT383 , SMCT384, the threonine yields were all increased, the highest was 25% higher than that of the control strain.

Expression enhancement during the transformation process includes promoter replacement, ribosome binding site change, copy number increase, plasmid overexpression and other means, expression attenuation includes promoter replacement, ribosome binding site change and other means, and The above means are all means known to those skilled in the art. The above means cannot be exhausted by examples, and the specific examples only use promoter enhancement as a representative for illustration.

The present invention adopts following technical scheme:

One of the technical solutions of the present invention provides a bacterial strain in which 2-formyl-citrate synthase 2 is inactivated.

The second technical solution of the present invention provides a bacterial strain with inactivation of 2-formyl-citrate synthase 2 and enhanced expression of at least one of aspartokinase, homoserine dehydrogenase and threonine synthase.

The third technical solution of the present invention is to provide a 2-formyl-citrate synthase 2 inactivation, aspartokinase, homoserine dehydrogenase, threonine synthase expression enhancement and diaminopimelic acid deactivation A strain with weakened or inactivated expression of at least one of hydrogenase, threonine dehydratase, 4-hydroxy-tetrahydrodipicolinate synthase, acetate kinase, and phosphotransacetylase.

The fourth technical solution of the present invention provides a bacterial strain with inactivation of 2-formyl-citrate synthase 2 and enhanced expression of aspartokinase, homoserine dehydrogenase and threonine synthase.

The fifth technical solution of the present invention is to provide a 2-formyl-citrate synthase 2 inactivation, aspartokinase, homoserine dehydrogenase, threonine synthase expression enhancement and diaminopimelic acid deactivation Hydrogenase inactive strains.

The sixth technical solution of the present invention provides an inactivation of 2-formyl-citrate synthase 2, enhanced expression of aspartokinase, homoserine dehydrogenase, threonine synthase and expression of threonine dehydratase Weakened or inactivated strains.

The seventh technical solution of the present invention is to provide a 2-formyl-citrate synthase 2 inactivation, aspartokinase, homoserine dehydrogenase, threonine synthase expression enhancement and 4-hydroxy-tetrahydro Strains with attenuated or inactivated dipicolinic acid synthase expression.

The eighth technical solution of the present invention provides a bacterial strain with inactivation of 2-formyl-citrate synthase 2, enhanced expression of aspartokinase, homoserine dehydrogenase, threonine synthase and inactivation of acetate kinase .

The ninth technical solution of the present invention provides an inactivation of 2-formyl-citrate synthase 2, enhanced expression of aspartokinase, homoserine dehydrogenase, threonine synthase and inactivation of phosphotransacetylase strains.

Above-mentioned bacterial strain is Corynebacterium, preferred Corynebacterium glutamicum, most preferably Corynebacterium glutamicum ATCC 13032.

The proteins involved in the present invention and their coding genes are as follows:

2-formyl-citrate synthase 2, encoding gene name prpC2, NCBI number: cg0762, Cgl0659, NCgl0630.

Aspartokinase, encoding gene name lysC, NCBI number: cg0306, Cgl0251, NCgl0247.

Homoserine dehydrogenase, encoding gene name hom, NCBI number: cg1337, Cgl1183, NCgl1136.

Threonine synthase, encoding gene name thrC, NCBI number: cg2437, Cgl2220, NCgl2139.

Diaminopimelate dehydrogenase, encoding gene name ddh, NCBI number: cg2900, Cgl2617, NCgl2528.

Threonine dehydratase, encoding gene name ilvA, NCBI number: cg2334, Cgl2127, NCgl2046.

4-Hydroxy-tetrahydrodipyridine carboxylate synthase, coded gene name dapA, NCBI number: cg2161, Cgl1971, NCgl1896.

Acetate kinase, encoding gene name ackA, NCBI number: cg3047, Cgl2752, NCgl2656.

Phosphotransacetylase, encoding gene name pta, NCBI number: cg3048, Cgl2753, NCgl2657.

The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the examples are all in accordance with conventional experimental conditions, such as Sambrook et al. Molecular Cloning Experiment Manual (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2001), or in accordance with the conditions suggested by the manufacturer's instructions.

The experimental materials used in the following examples are as follows:

The experimental methods involved in the following examples are as follows:

The PCR amplification system is as follows:

Element	Volume (microliter)
Sterilized deionized water	29
5×pfu buffer	10
2.5mM dNTPs	5
10 μM upstream primer	2
10 μM downstream primer	2
Pfu	1
template	1 (Fusion PCR template added to a maximum of 2 microliters)
total	50

The PCR amplification procedure is as follows:

Strain transformation method:

1. Seamless assembly reaction procedure: refer to the ClonExpress MultiS One Step Cloning Kit manual.

2. Transformation method: refer to the instructions of Trans1-T1 Phage Resistant Chemically Competent Cell.

3. Preparation of competent cells: refer to C. glutamicum Handbook, Chapter 23.

The construction of embodiment 1 bacterial strain genome modification plasmid

1. Construction of aspartate aminotransferase expression enhancing plasmid pK18mobsacB-P _sod -lysC ^g1a-T311I

Using the genome of Corynebacterium glutamicum ATCC 13032 as a template, the upstream homology arm up was obtained by PCR amplification with the P21/P22 primer pair, and the promoter fragment P _sod was obtained by PCR amplification with the P23/P24 primer pair. The primer pair was used for PCR amplification to obtain lysC ^g1a-T311I , and the P27/P28 primer pair was used for PCR amplification to obtain the downstream homology arm dn. The fragment up-P _sod was obtained by fusion PCR with the P21/P24 primer pair and up and P _sod as templates. The full-length fragment up-P _sod -lysC g1a ^-T311I -dn was obtained by fusion PCR with P21/P28 primer pair and up-P _sod , lysC ^g1a-T311I , dn as templates. pK18mobsacB was digested with BamHI/HindIII. The two were assembled with a seamless cloning kit, and Trans1T1 competent cells were transformed to obtain the recombinant plasmid pK18mobsacB-P _sod -lysC ^g1a-T311I .

Among them, g1a means that the first base of the start codon of the lysC gene (see SEQ ID NO: 1 for the wild-type gene sequence of lysC) is mutated from g to a, and T311I means that the 311th base of the aspartokinase encoded by the lysC gene is The amino acid is mutated from T to I.

2. Construction of homoserine dehydrogenase expression enhanced plasmid pK18mobsacB-P _cspB -hom ^GapG378E

Using the genome of Corynebacterium glutamicum ATCC 13032 as a template, the upstream homology arm up was obtained by PCR amplification with the P29/P30 primer pair, and the promoter fragment P _cspB was obtained by PCR amplification with the ATCC14067 genome as a template and the P31/P32 primer pair , the ATCC13032 genome was used as a template to obtain hom ^GapG378E by PCR amplification with P33/P34 primer pair, and the downstream homology arm dn was obtained by PCR amplification with P35/P36 primer pair. The fragment up-P _cspB was obtained by fusion PCR using the P29/P32 primer pair and up and P _cspB as templates. The full-length fragment up-P _cspB -hom ^GapG378E -dn was obtained by fusion PCR with P29/P36 primer pair and up-P _cspB , hom ^GapG378E , dn as templates. pK18mobsacB was digested with BamHI/HindIII. The two were assembled with a seamless cloning kit, and Trans1T1 competent cells were transformed to obtain the recombinant plasmid pK18mobsacB-P _cspB -hom ^GapG378E .

3. Construction of threonine synthase expression enhanced plasmid pK18mobsacB-P _sod -thrC ^g1a

Using the genome of Corynebacterium glutamicum ATCC 13032 as a template, the upstream homology arm up was obtained by PCR amplification with the P37/P38 primer pair, and the promoter fragment P _sod -thrC ^g1a , P41 was obtained by PCR amplification with the P39/P40 primer pair The dn of the downstream homology arm was obtained by PCR amplification with the /P42 primer pair. The full-length fragment up-P _sod -thrC ^g1a -dn was obtained by fusion PCR with P37/P42 primer pair and up, P _sod -thrC ^g1a , dn as templates. pK18mobsacB was digested with BamHI/HindIII. The two were assembled with a seamless cloning kit, and Trans1T1 competent cells were transformed to obtain the recombinant plasmid pK18mobsacB-P _sod -thrC ^g1a .

Among them, g1a means that the first base of the start codon of the thrC gene (see SEQ ID NO: 2 for the wild-type gene sequence of thrC) is mutated from g to a. 4. Construction of diaminopimelate dehydrogenase inactivation plasmid pK18mobsacB-△ddh

Using the genome of Corynebacterium glutamicum ATCC 13032 as a template, the upstream homology arm up was obtained by PCR amplification with the P99/P100 primer pair, and the downstream homology arm dn was obtained by PCR amplification with the P101/P102 primer pair. Fragment up-dn was obtained by fusion PCR with primer pair P99/P102 and up and dn as templates. pK18mobsacB was digested with BamHI/HindIII. The two were assembled with a seamless cloning kit, transformed into Trans1T1 competent cells, and obtained the recombinant plasmid pK18mobsacB-△ddh.

5. Construction of threonine dehydratase inactivating plasmid pK18mobsacB-△ilvA

Using the genome of Corynebacterium glutamicum ATCC 13032 as a template, the upstream homology arm up was obtained by PCR amplification with the P87/P88 primer pair, and the downstream homology arm dn was obtained by PCR amplification with the P89/P90 primer pair. The fragment up-dn was obtained by fusion PCR using the P87/P90 primer pair and up and dn as templates. pK18mobsacB was digested with BamHI/HindIII. The two were assembled with a seamless cloning kit, transformed into Trans1T1 competent cells, and obtained the recombinant plasmid pK18mobsacB-△ilvA.

6. Construction of 4-hydroxy-tetrahydrodipicolinate synthase inactivating plasmid pK18mobsacB-△dapA

Using the genome of Corynebacterium glutamicum ATCC 13032 as a template, the upstream homology arm up was obtained by PCR amplification with the P79/P80 primer pair, and the downstream homology arm dn was obtained by PCR amplification with the P81/P82 primer pair. The fragment up-dn was obtained by fusion PCR using the P79/P82 primer pair and up and dn as templates. pK18mobsacB was digested with BamHI/HindIII. The two were assembled with a seamless cloning kit, transformed into Trans1T1 competent cells, and obtained the recombinant plasmid pK18mobsacB-△dapA.

7. Construction of acetate kinase inactivating plasmid pK18mobsacB-△ackA

Using the genome of Corynebacterium glutamicum ATCC 13032 as a template, the upstream homology arm up was obtained by PCR amplification with the P165/P166 primer pair, and the downstream homology arm dn was obtained by PCR amplification with the P167/P168 primer pair. Using P165/P168 primer pair and using up and dn as templates to perform fusion PCR to obtain the fragment up-dn. pK18mobsacB was digested with BamHI/HindIII. The two were assembled with a seamless cloning kit, transformed into Trans1T1 competent cells, and obtained the recombinant plasmid pK18mobsacB-△ackA.

8. Construction of phosphotransacetylase inactivation plasmid pK18mobsacB-△pta

Using the genome of Corynebacterium glutamicum ATCC 13032 as a template, the upstream homology arm up was obtained by PCR amplification with the P67/P68 primer pair, and the downstream homology arm dn was obtained by PCR amplification with the P69/P70 primer pair. Fragment up-dn was obtained by fusion PCR with P67/P70 primer pair and up and dn as template. pK18mobsacB was digested with BamHI/HindIII. The two were assembled with a seamless cloning kit, transformed into Trans1T1 competent cells, and obtained the recombinant plasmid pK18mobsacB-△pta.

9. Construction of 2-formyl-citrate synthase 2 inactivation plasmid pK18mobsacB-△prpC2

Using the genome of Corynebacterium glutamicum ATCC 13032 as a template, the upstream homology arm up was obtained by PCR amplification with the P71/P72 primer pair, and the downstream homology arm dn was obtained by PCR amplification with the P73/P74 primer pair. The fragment up-dn was obtained by fusion PCR using the P71/P74 primer pair and up and dn as templates. pK18mobsacB was digested with BamHI/HindIII. The two were assembled with a seamless cloning kit, transformed into Trans1T1 competent cells, and obtained the recombinant plasmid pK18mobsacB-△prpC2.

10. Construction of threonine dehydratase expression weakened plasmid pK18mobsacB-ilvA ^a1g

Using the genome of Corynebacterium glutamicum ATCC 13032 as a template, the upstream homology arm up was obtained by PCR amplification with the P87/P88 primer pair, and the ilvA ^a1g was obtained by PCR amplification with the P83/P84 primer pair, and the ilvA a1g was obtained by PCR with the P85/P86 primer pair. The downstream homology arm dn was amplified by PCR. The fragment up-ilvA ^a1g -dn was obtained by fusion PCR using the P87/P86 primer pair and up, ilvA ^a1g , dn as templates. pK18mobsacB was digested with BamHI/HindIII. The two were assembled with a seamless cloning kit, and Trans1 T1 competent cells were transformed to obtain the recombinant plasmid pK18mobsacB-ilvA ^a1g .

Among them, a1g means that the first base of the start codon of the ilvA gene (see SEQ ID NO: 3 for the ilvA wild-type gene sequence) is mutated from a to g.

11. Construction of 4-hydroxy-tetrahydrodipicolinate synthase expression weakened plasmid pK18mobsacB-dapA ^a1g

Using the genome of Corynebacterium glutamicum ATCC 13032 as a template, the upstream homology arm up was obtained by PCR amplification with the P79/P80 primer pair, dapA ^a1g was obtained by PCR amplification with the P75/P76 primer pair, and the P77/P78 primer pair was used for PCR amplification. The downstream homology arm dn was amplified by PCR. The fragment up-dapA ^a1g -dn was obtained by fusion PCR using the P79/P78 primer pair and up, dapA ^a1g , dn as templates. pK18mobsacB was digested with BamHI/HindIII. The two were assembled with a seamless cloning kit, and Trans1T1 competent cells were transformed to obtain the recombinant plasmid pK18mobsacB-dapA ^a1g .

Among them, a1g means that the first base of the initiation codon of the dapA gene (see SEQ ID NO: 4 for the wild-type gene sequence of dapA) is mutated from a to g. The primers used in the construction process are shown in Table 1:

Table 1

name	Sequence (5'-3') (SEQ ID No: 5-58 in sequence)
P21	AATTCGAGCTCGGTACCCGGGGATCCAGCGACAGGACAAGCACTGG
P22	CCCGGAATAATTGGCAGCTATGTGCACCTTTCGATCTACG
P23	CGTAGATCGAAAGGTGCACATAGCTGCCAATTATTCCGGG
P24	TTTCTGTACGACCAGGGCCA T GGGTAAAAAATCCTTTCGTA
P25	TACGAAAGGATTTTTTACCC A TGGCCCTGGTCGTACAGAAA
P26	TCGGAACGAGGGCAGGTGAAGGTGATGTCGGTGGTGCCGTCT
P27	AGACGGCACCACCGACATCACCTTCACCTGCCCTCGTTCCGA
P28	GTAAAACGACGGCCAGTGCCAAGCTTAGCCTGGTAAGAGGAAACGT
P29	AATTCGAGCTCGGTACCCGGGGATCCCTGCGGGCAGATCCTTTTGA
P30	ATTTCTTTATAAACGCAGGTCATATCTACCAAAAACTACGC
P31	GCGTAGTTTTGGTAGATATGACCTGCGTTTATAAAGAAAT
P32	GTATATCTCTTCTGCAGGAATAGGTATCGAAAGACGAAA
P33	TTTCGTCTTTCGATACCTATTCCTGCAGAAGGAGATATAC
P34	TAGCCAATTCAGCCAAAACC C CCACGCGATCTTCCACATCC
P35	GGATGTGGAAGATCGCGTGG G GGTTTTGGCTGAATTGGCTA
P36	GTAAAACGACGGCCAGTGCCAAGCTTGCTGGCTCTTGCCGTCGATA
P37	ATTCGAGCTCGGTACCCGGGGATCCGCCGTTGATCATTGTTTCTTCA
P38	CCCGGAATAATTGGCAGCTAGGATATAACCCTAATCCCAAG
P39	CTTGGGATAGGGTTATATCCTAGCTGCCAATTATTCCGGG
P40	ACGCGTCGAAATGTAGTCCA T GGGTAAAAAATCCTTTCGTA
P41	TACGAAAGGATTTTTTACCC A TGGACTACATTTCGACGCGT
P42	GTAAAACGACGGCCAGTGCCAAGCTTGAATACGCGGATTCCCTCGC
P67	AGCTCGGTACCCGGGGATCCTGTCCAACTGCGGTGATT
P68	GGTAGACAAGCAAGGCAACAGGCAAATGTGTTTATCTTCC
P69	GGAAGATAAACACATTTGCCTGTTGCCTTGCTTGTCTACC
P70	CAATACGGAGCGGTTACAAAGCTTGGCACTGGCCGTCG
P71	TACGAATTCGAGCTCGGTACCCGGGGATCCAGTGGAAGGCATCGACTCCGCGAT
P72	TCGGACAGTGGGCGGATGAGCGAGTTGTTTAATCTTCCACCGCGTAGCCACGGTAGGTC
P73	AAACAACTCGCTCATCCGCC
P74	CGATCCTCATCCTGTCTCTTGATCAGATTCTAGTTAAATCCACTCCGAAAGCAC
P75	CATGATTACGAATTCGAGCTCGGTACCCGGGGATCCCAAGCCAAACAAGGTTTAGTG
P76	GAAGAAGGTAACCTTGAACTCT G TGAGCACAGGTTTAACAGC
P77	GCTGTTAAACCTGTGCTCA C AGAGTTCAAGGTTACCTTTCTTC
P78	TCACGACGTTGTAAAACGACGGCCAGTGCCAAGCTTATGAGTCTCGGTTCGCTTTC
P79	CATGATTACGAATTCGAGCTCGGTACCCGGGGATCCACCTGAAGATGGGAAGAGCA
P80	GAAGAAGGTAACCTTGAACTCTATATGAATGATTCCCGAAATCGC
P81	GCGATTTCGGGAATCATTCATATAGAGTTCAAGGTTACCTTCTTC
P82	TCACGACGTTGTAAAACGACGGCCAGTGCCAAGCTTGATGAGTCTCGGTTCGCTTTC
P83	CATGATTACGAATTCGAGCTCGGTACCCGGGGATCCTGCCATATCAGCCATGTAGC
P84	GGAGAAGATTACACTAGTCAACC G TGAGTGAAACATACGTGTCT
P85	AGACACGTATGTTTCACTCA C GGTTGACTAGTGTAATTCTTCTCC
P86	TCACGACGTTGTAAAACGACGGCCAGTGCCAAGCTTCACTGGCATTTCGGACAAC

P87	CATGATTACGAATTCGAGCTCGGTACCCGGGGATCCAATCGGCGACCGTCCTTCCA
P88	GGAGAAGATTACACTAGTCAACCACATAGCTGAAGGCCACCTC
P89	GAGGTGGCCTTCAGCTATGTGGTTGACTAGTGTAATTCTTCTCC
P90	TCACGACGTTGTAAAACGACGGCCAGTGCCAAGCTTCACTGGCATTTCGGACAAC
P99	GAGCTCGGTACCCGGGGATCCTCTGCAACTGGCATGTTGGA
P100	TCGAGCTAAACCTTGTTGGGCTAGTTGTCCTCCTTTTTTCCGTAGCC
P101	GGCTACGGAAAAAAGGAGGACAACTAGCCCAACAAGGTTTAGCTCGA
P102	ACGACGGCCAGTGCCAAGCTTACTCAACGGCGATTGCGG
P165	CGAGCTCGGTACCCGGGGATCCACCCGGGTGTGGCGCGCAAGAAGATGCCAG
P166	TAAATGTTGTACGCGGACCAGAACAAGATTCCGCCGTGGACCACGC
P167	GGCGGAATCTTGTTCTGGTCCGCGTACAACATTTACATACACC
P168	GTAAAACGACGGCCAGTGCCAAGCTTAGCAAGGTGTTAGAGCAAATTTTCG

Note: Bold and underlined are primers for introducing corresponding point mutations.

The construction of embodiment 2 genome modification bacterial strains

1. Construction of Aspartokinase Enhanced Expression Strain

ATCC13032 competent cells were prepared according to the classical glutamicum method (C. glutamicum Handbook, Chapter 23). The recombinant plasmid pK18mobsacB-P _sod -lysC ^g1a-T311I was used to transform the competent cells by electroporation, and the transformant was screened on the selection medium containing 15mg/L kanamycin, wherein the gene of interest was eliminated due to homology. inserted into the chromosome. The screened transformants were cultured overnight in common liquid brain-heart infusion medium at a temperature of 30° C. on a rotary shaker at 220 rpm. During this culture, the transformants undergo a second recombination, whereby the vector sequence is removed from the genome by gene exchange. The culture was serially diluted (from 10 ^-2 to 10 ^-4 ), the diluted solution was spread on common solid brain heart infusion medium containing 10% sucrose, and cultured at 33°C for 48 hours. Strains grown on sucrose media do not carry the inserted vector sequence in their genome. The target sequence was amplified by PCR and analyzed by nucleotide sequencing, and the target mutant strain was obtained and named SMCT091.

2. Construction of homoserine dehydrogenase expression enhanced strain

SMCT091 competent cells were prepared according to the classical method of Guban. The recombinant plasmid pK18mobsacB-P _cspB -hom ^GapG378E was used to transform the competent cells by electroporation, and the transformants were selected on the selection medium containing 15 mg/L kanamycin. The screened transformants were cultured overnight in common liquid brain-heart infusion medium at a temperature of 30° C. on a rotary shaker at 220 rpm. During this culture, the transformants undergo a second recombination, whereby the vector sequence is removed from the genome by gene exchange. The culture was serially diluted (from 10 ^-2 to 10 ^-4 ), the diluted solution was spread on common solid brain heart infusion medium containing 10% sucrose, and cultured at 33°C for 48 hours. Strains grown on sucrose media do not carry the inserted vector sequence in their genome. The target sequence was amplified by PCR and analyzed by nucleotide sequencing, and the target mutant strain was obtained and named SMCT092.

3. Construction of Threonine Synthase Expression Enhanced Strain

SMCT092 competent cells were prepared according to the classical method of Guban. The recombinant plasmid pK18mobsacB-P _sod -thrC ^g1a was used to transform the competent cells by electroporation, and the transformants were selected on the selection medium containing 15 mg/L kanamycin. The screened transformants were cultured overnight in common liquid brain-heart infusion medium at a temperature of 30° C. on a rotary shaker at 220 rpm. During this culture, the transformants undergo a second recombination, whereby the vector sequence is removed from the genome by gene exchange. The culture was serially diluted (from 10 ^-2 to 10 ^-4 ), the diluted solution was spread on common solid brain heart infusion medium containing 10% sucrose, and cultured at 33°C for 48 hours. Strains grown on sucrose media do not carry the inserted vector sequence in their genome. The target sequence was amplified by PCR and analyzed by nucleotide sequencing, and the target mutant strain was obtained and named SMCT093.

4. Construction of diaminopimelate dehydrogenase inactivated strain

SMCT093 competent cells were prepared according to the classical method of Guban. The recombinant plasmid pK18mobsacB-△ddh was used to transform the competent cells by electroporation, and the transformants were selected on the selection medium containing 15 mg/L kanamycin. The screened transformants were cultured overnight in common liquid brain-heart infusion medium at a temperature of 30° C. on a rotary shaker at 220 rpm. During this culture, the transformants undergo a second recombination, whereby the vector sequence is removed from the genome by gene exchange. The culture was serially diluted (from 10 ^-2 to 10 ^-4 ), the diluted solution was spread on common solid brain heart infusion medium containing 10% sucrose, and cultured at 33°C for 48 hours. Strains grown on sucrose media do not carry the inserted vector sequence in their genome. The target sequence was amplified by PCR and analyzed by nucleotide sequencing, and the target mutant strain was obtained and named SMCT095.

5. Construction of Threonine Dehydratase Inactivated Strain

SMCT093 competent cells were prepared according to the classical method of Guban. The competent cells were transformed with the recombinant plasmid pK18mobsacB-△ilvA by electroporation, and the transformants were selected on the selection medium containing 15 mg/L kanamycin. The screened transformants were cultured overnight in common liquid brain-heart infusion medium at a temperature of 30° C. on a rotary shaker at 220 rpm. During this culture, the transformants undergo a second recombination, whereby the vector sequence is removed from the genome by gene exchange. The culture was serially diluted (from 10 ^-2 to 10 ^-4 ), the diluted solution was spread on common solid brain heart infusion medium containing 10% sucrose, and cultured at 33°C for 48 hours. Strains grown on sucrose media do not carry the inserted vector sequence in their genome. The target sequence was amplified by PCR and analyzed by nucleotide sequencing, and the target mutant strain was obtained and named SMCT096.

6. Construction of 4-hydroxy-tetrahydrodipicolinate synthase inactivated strain

SMCT093 competent cells were prepared according to the classical method of Guban. The competent cells were transformed with the recombinant plasmid pK18mobsacB-ΔdapA by electroporation, and the transformants were selected on the selection medium containing 15 mg/L kanamycin. The screened transformants were cultured overnight in common liquid brain-heart infusion medium at a temperature of 30° C. on a rotary shaker at 220 rpm. During this culture, the transformants undergo a second recombination, whereby the vector sequence is removed from the genome by gene exchange. The culture was serially diluted (from 10 ^-2 to 10 ^-4 ), the diluted solution was spread on common solid brain heart infusion medium containing 10% sucrose, and cultured at 33°C for 48 hours. Strains grown on sucrose media do not carry the inserted vector sequence in their genome. The target sequence was amplified by PCR and analyzed by nucleotide sequencing, and the target mutant strain was obtained and named SMCT097.

7. Construction of acetate kinase inactivated strain

SMCT093 competent cells were prepared according to the classical method of Guban. The competent cells were transformed with the recombinant plasmid pK18mobsacB-△ackA by electroporation, and the transformants were selected on the selection medium containing 15 mg/L kanamycin. The screened transformants were cultured overnight in common liquid brain-heart infusion medium at a temperature of 30° C. on a rotary shaker at 220 rpm. During this culture, the transformants undergo a second recombination, whereby the vector sequence is removed from the genome by gene exchange. The culture was serially diluted (from 10 ^-2 to 10 ^-4 ), the diluted solution was spread on common solid brain heart infusion medium containing 10% sucrose, and cultured at 33°C for 48 hours. Strains grown on sucrose media do not carry the inserted vector sequence in their genome. The target sequence was amplified by PCR and analyzed by nucleotide sequencing, and the target mutant strain was obtained and named SMCT098.

8. Construction of phosphotransacetylase inactivated strain

SMCT093 competent cells were prepared according to the classical method of Guban. The competent cells were transformed with the recombinant plasmid pK18mobsacB-△pta by electroporation, and the transformants were selected on the selection medium containing 15 mg/L kanamycin. The screened transformants were cultured overnight in common liquid brain-heart infusion medium at a temperature of 30° C. on a rotary shaker at 220 rpm. During this culture, the transformants undergo a second recombination, whereby the vector sequence is removed from the genome by gene exchange. The culture was serially diluted (from 10 ^-2 serially diluted to 10 ^-4 ), the diluted solution was spread on common solid brain heart infusion medium containing 10% sucrose, and cultured at 33°C for 48 hours. Strains grown on sucrose media do not carry the inserted vector sequence in their genome. The target sequence was amplified by PCR and analyzed by nucleotide sequencing, and the target mutant strain was obtained and named SMCT099.

9. Construction of threonine dehydratase expression-weakened strain

SMCT093 competent cells were prepared according to the classical method of Guban. The recombinant plasmid pK18mobsacB-ilvA ^a1g was used to transform the competent cells by electroporation, and the transformants were selected on the selection medium containing 15 mg/L kanamycin. The screened transformants were cultured overnight in common liquid brain-heart infusion medium at a temperature of 30° C. on a rotary shaker at 220 rpm. During this culture, the transformants undergo a second recombination, whereby the vector sequence is removed from the genome by gene exchange. The culture was serially diluted (from 10 ^-2 serially diluted to 10 ^-4 ), the diluted solution was spread on common solid brain heart infusion medium containing 10% sucrose, and cultured at 33°C for 48 hours. Strains grown on sucrose media do not carry the inserted vector sequence in their genome. The target sequence was amplified by PCR and analyzed by nucleotide sequencing, and the target mutant strain was obtained and named SMCT100.

10. Construction of strains with weakened expression of 4-hydroxy-tetrahydrodipicolinate synthase

SMCT093 competent cells were prepared according to the classical method of Guban. The competent cells were transformed with the recombinant plasmid pK18mobsacB-dapA ^a1g by electroporation, and the transformants were selected on the selection medium containing 15 mg/L kanamycin. The screened transformants were cultured overnight in common liquid brain-heart infusion medium at a temperature of 30° C. on a rotary shaker at 220 rpm. During this culture, the transformants undergo a second recombination, whereby the vector sequence is removed from the genome by gene exchange. The culture was serially diluted (from 10 ^-2 to 10 ^-4 ), the diluted solution was spread on common solid brain heart infusion medium containing 10% sucrose, and cultured at 33°C for 48 hours. Strains grown on sucrose media do not carry the inserted vector sequence in their genome. The target sequence was amplified by PCR and analyzed by nucleotide sequencing, and the target mutant strain was obtained and named SMCT101.

11. Construction of 2-formyl-citrate synthase 2 inactivation strain

SMCT092, SMCT093, SMCT095, SMCT096, SMCT097, SMCT098, SMCT099, SMCT100, SMCT101 competent cells were prepared according to the classical method of Guban. The competent cells were transformed with the recombinant plasmid pK18mobsacB-ΔprpC2 by electroporation, and the transformants were selected on the selection medium containing 15 mg/L kanamycin. The screened transformants were cultured overnight in common liquid brain-heart infusion medium at a temperature of 30° C. on a rotary shaker at 220 rpm. During this culture, the transformants undergo a second recombination, whereby the vector sequence is removed from the genome by gene exchange. The culture was serially diluted (from 10 ^-2 serially diluted to 10 ^-4 ), the diluted solution was spread on common solid brain heart infusion medium containing 10% sucrose, and cultured at 33°C for 48 hours. Strains grown on sucrose media do not carry the inserted vector sequence in their genome. The target sequence was amplified by PCR and analyzed by nucleotide sequencing, and the corresponding target mutant strains were named SMCT094, SMCT102, SMCT103, SMCT104, SMCT105, SMCT381, SMCT382, SMCT383, SMCT384.

The strains obtained are shown in Table 2:

Table 2

strain	genotype
SMCT091	ATCC13032, P sod -lysC g1a-T311I
SMCT092	ATCC13032, P sod -lysC g1a-T311I , P cspB -hom GapG378E
SMCT093	ATCC13032, P sod -lysC g1a-T311I , P cspB -hom GapG378E , P sod -thrC g1a
SMCT094	ATCC13032, P sod -lysC g1a-T311I , P cspB -hom GapG378E , △prpC2
SMCT095	ATCC13032, P sod -lysC g1a-T311I , P cspB -hom GapG378E , P sod -thrC g1a , △ddh
SMCT096	ATCC13032, P sod -lysC g1a-T311I , P cspB -hom GapG378E , P sod -thrC g1a , △ilvA
SMCT097	ATCC13032, P sod -lysC g1a-T311I , P cspB -hom GapG378E , P sod -thrC g1a , △dapA
SMCT098	ATCC13032, P sod -lysC g1a-T311I , P cspB -hom GapG378E , P sod -thrC g1a , △ackA
SMCT099	ATCC13032, P sod -lysC g1a-T311I , P cspB -hom GapG378E , P sod -thrC g1a , Δpta
SMCT100	ATCC13032, P sod -lysC g1a-T311I , P cspB -hom GapG378E , P sod -thrC g1a , ilvA a1g
SMCT101	ATCC13032, P sod -lysC g1a-T311I , P cspB -hom GapG378E , P sod -thrC g1a , dapA a1g
SMCT102	ATCC13032, P sod -lysC g1a-T311I , P cspB -hom GapG378E , P sod -thrC g1a , △prpC2
SMCT103	ATCC13032, P sod -lysC g1a-T311I , P cspB -hom GapG378E , P sod -thrC g1a , △ddh, △prpC2
SMCT104	ATCC13032, P sod -lysC g1a-T311I , P cspB -hom GapG378E , P sod -thrC g1a , △ilvA, △prpC2
SMCT105	ATCC13032, P sod -lysC g1a-T311I , P cspB -hom GapG378E , P sod -thrC g1a , △dapA, △prpC2
SMCT381	ATCC13032, P sod -lysC g1a-T311I , P cspB -hom GapG378E , P sod -thrC g1a , △ackA, △prpC2
SMCT382	ATCC13032, P sod -lysC g1a-T311I , P cspB -hom GapG378E , P sod -thrC g1a , △pta, △prpC2
SMCT383	ATCC13032, P sod -lysC g1a-T311I , P cspB -hom GapG378E , P sod -thrC g1a , ilvA a1g , △prpC2
SMCT384	ATCC13032, P sod -lysC g1a-T311I , P cspB -hom GapG378E , P sod -thrC g1a , dapA a1g , △prpC2

Embodiment 3 constructs bacterial strain shaking flask verification

1. Medium

Seed activation medium: BHI 3.7%, agar 2%, pH7.

Seed medium: peptone 5/L, yeast extract 5g/L, sodium chloride 10g/L, ammonium sulfate 16g/L, urea 8g/L, potassium dihydrogen phosphate 10.4g/L, dipotassium hydrogen phosphate 21.4g /L, biotin 5mg/L, magnesium sulfate 3g/L. Glucose 50g/L, pH 7.2.

Fermentation medium: corn steep liquor 50mL/L, glucose 30g/L, ammonium sulfate 4g/L, MOPS 30g/L, potassium dihydrogen phosphate 10g/L, urea 20g/L, biotin 10mg/L, magnesium sulfate 6g/L , ferrous sulfate 1g/L, VB1·HCl 40mg/L, calcium pantothenate 50mg/L, nicotinamide 40mg/L, manganese sulfate 1g/L, zinc sulfate 20mg/L, copper sulfate 20mg/L, pH 7.2.

2. Shake flask fermentation of engineering bacteria to produce L-threonine

(1) Seed culture: pick SMCT091, SMCT092, SMCT093, SMCT094, SMCT095, SMCT096, SMCT097, SMCT098, SMCT099, SMCT100, SMCT101SMCT102, SMCT103, SMCT104, SMCT105, SMCT381, SMCT382, SMCT383, SMCT384 slope Seed 1 ring connected to pack In a 500mL Erlenmeyer flask with 20mL of seed medium, shake culture at 30°C and 220r/min for 16h.

(2) Fermentation culture: inoculate 2 mL of seed solution into a 500 mL Erlenmeyer flask containing 20 mL of fermentation medium, and culture at 33° C. and 220 r/min for 24 hours with shaking.

(3) Take 1 mL of fermentation broth and centrifuge (12000rpm, 2min), collect the supernatant, and use HPLC to detect L-threonine in the fermentation broth of engineering bacteria and control bacteria.

The fermentation results of the strains with initial threonine synthesis ability and their 2-formyl-citrate synthase 2 inactivated strains are shown in Table 3:

table 3

Strain number	OD 562	L-threonine (g/L)
SMCT091	twenty four	1.2
SMCT092	twenty three	2.4
SMCT094	twenty three	2.6

It can be seen from Table 3 that after the transformation of aspartokinase on the basis of the starting strain ATCC13032, the threonine yield of the strain initially accumulated, and with the strengthening of the expression of homoserine dehydrogenase, the threonine yield increased. A further improvement was achieved, reaching 2.4g/L. On the basis of basically opening up the synthesis pathway of threonine terminal, further inactivating 2-formyl-citrate synthase 2, the threonine production increased to 2.6g/L.

(4) Effect of inactivation of 2-formyl-citrate synthase 2 on threonine synthesis in different threonine producing strains

In order to explore the effect of inactivation of 2-formyl-citrate synthase 2 on the synthesis of threonine, based on the threonine producing strain SMCT092, a strain SMCT093 with enhanced expression of threonine synthase was obtained, and further obtained diamino Strains with inactivated or weakened expression of pimelate dehydrogenase, threonine dehydratase, 4-hydroxy-tetrahydrodipyridine carboxylate synthase, acetate kinase, and phosphotransacetylase were explored on this basis to inactivate 2 - Effect of formyl-citrate synthase 2 on threonine production. The results are shown in Table 4:

Table 4

Strain number	OD 562	L-threonine (g/L)	Strain number	OD 562	L-threonine (g/L)
SMCT093	twenty three	3.0	SMCT102	twenty three	3.5
SMCT095	twenty two	3.8	SMCT103	twenty two	4.6
SMCT096	twenty two	3.6	SMCT104	twenty two	4.2
SMCT097	twenty two	3.9	SMCT105	twenty two	4.9
SMCT098	twenty three	3.5	SMCT381	twenty three	4.4
SMCT099	twenty three	3.3	SMCT382	twenty three	3.8
SMCT100	twenty two	3.5	SMCT383	twenty two	4.1
SMCT101	twenty two	3.6	SMCT384	twenty two	4.2

It can be seen from Table 4 that the threonine production of all the modified strains with inactivated 2-formyl-citrate synthase 2 increased by about 15% to 25% in varying degrees. It can be seen that the inactivation of 2-formyl-citrate synthase 2 is beneficial to the improvement of threonine production of the strain, and it is effective in different threonine production strains.

In addition, when 2-formyl-citrate synthase 2 is combined with other sites, the increase of threonine production is higher than that of only aspartokinase and homoserine dehydrogenase combined with threonine production. magnitude. Explain that when 2-formyl-citrate synthase 2 and aspartokinase, homoserine dehydrogenase, threonine synthase expression enhancement and diaminopimelate dehydrogenase, threonine dehydratase, 4- Hydroxy-tetrahydrodipyridine carboxylate synthase, acetate kinase, and phosphotransacetylase combined with at least one expression weakening or inactivation can increase the production of threonine, and the combined effect of the two is not just a single superimposed effect .

Although the present invention has been described in detail with general descriptions and specific embodiments above, it is obvious to those skilled in the art that some modifications or improvements can be made on the basis of the present invention. Therefore, the modifications or improvements made on the basis of not departing from the spirit of the present invention all belong to the protection scope of the present invention.

sequence description

SEQ ID No: 1 Corynebacterium glutamicum (Corynebacterium glutamicum) lysC wild type

SEQ ID No:2 Corynebacterium glutamicum (Corynebacterium glutamicum) thrC wild type

SEQ ID No: 3 Corynebacterium glutamicum (Corynebacterium glutamicum) ilvA wild type

SEQ ID No: 4 Corynebacterium glutamicum (Corynebacterium glutamicum) dapA wild type

Claims (11)

1. A modified microorganism of the genus Corynebacterium, characterized in that, compared with unmodified microorganisms, the activity of 2-formyl-citrate synthase 2 is reduced or lost, and compared with unmodified microorganisms, said microorganisms microorganisms with enhanced threonine production capacity.
2. The microorganism according to claim 1, characterized in that, the reduction or loss of the activity of 2-formyl-citrate synthase 2 in the microorganism is by reducing the expression of the gene encoding 2-formyl-citrate synthase 2 or This was achieved by knocking out the endogenous gene encoding 2-formyl-citrate synthase 2.
3. The microorganism according to claim 2, characterized in that, the expression of the gene encoding 2-formyl-citrate synthase 2 is reduced or the endogenous encoding 2- Gene for formyl-citrate synthase 2.
4. The microorganism according to claim 1, characterized in that, compared with unmodified microorganisms, the activity of enzymes related to the threonine synthesis pathway in the body of the microorganism is enhanced; or,

   Compared with unmodified microorganisms, the enzyme activity of the competitive pathway or degradation pathway related to threonine synthesis in the microorganism is reduced or lost; or,

   Compared with the unmodified microorganism, the enzyme activity of the threonine synthesis pathway in the microorganism is enhanced, and the enzyme activity of the competition pathway or degradation pathway related to the threonine synthesis is reduced or lost;

   Wherein, the enzyme related to the threonine synthesis pathway is selected from at least one of aspartokinase, homoserine dehydrogenase, and threonine synthase;

   The enzyme of the competitive pathway related to the synthesis of threonine is selected from the group consisting of diaminopimelate dehydrogenase, threonine dehydratase, 4-hydroxy-tetrahydrodipicolinate synthase, acetate kinase, phosphotransacetylase at least one of the
5. The microorganism according to claim 4, wherein the microorganism is any one of the following ①～⑦:

   ① Microorganisms with reduced or lost 2-formyl-citrate synthase 2 activity and at least one enhanced activity of aspartokinase, homoserine dehydrogenase and threonine synthase;

   ② Microorganisms with reduced or lost activity of 2-formyl-citrate synthase 2 and enhanced activities of aspartokinase, homoserine dehydrogenase and threonine synthase;

   ③ Microorganisms with decreased or lost activity of 2-formyl-citrate synthase 2 and enhanced activities of aspartokinase, homoserine dehydrogenase and threonine synthase, and decreased or lost activity of diaminopimelate dehydrogenase ;

   ④ Microorganisms with reduced or lost activity of 2-formyl-citrate synthase 2 and enhanced activities of aspartokinase, homoserine dehydrogenase and threonine synthase, and decreased or lost activity of threonine dehydratase;

   ⑤ The activity of 2-formyl-citrate synthase 2 is reduced or lost, and the activities of aspartokinase, homoserine dehydrogenase and threonine synthase are enhanced, and the activity of 4-hydroxy-tetrahydrodipicolinate synthase is reduced or lost microorganisms;

   Preferably, the reduction in the activity of 4-hydroxy-tetrahydrodipicolinate synthase refers to the mutation of A in the initiation codon ATG of 4-hydroxy-tetrahydrodipicolinate synthase to G;

   ⑥ Microorganisms with reduced or lost activity of 2-formyl-citrate synthase 2 and enhanced activities of aspartokinase, homoserine dehydrogenase and threonine synthase, and reduced or lost activity of acetate kinase;

   ⑦ Microorganisms with decreased or lost activity of 2-formyl-citrate synthase 2 and enhanced activities of aspartokinase, homoserine dehydrogenase and threonine synthase, and decreased or lost activity of phosphotransacetylase.
6. The microorganism according to claim 4, characterized in that, the enhancement of the activity of enzymes related to the threonine synthesis pathway in the microorganism is achieved by being selected from the following 1) to 6), or an optional combination:

   1) enhanced by introducing a plasmid having a gene encoding the enzyme;

   2) enhanced by increasing the copy number of the gene encoding the enzyme;

   3) enhanced by changing the promoter sequence of the gene encoding the enzyme;

   4) Enhanced by operably linking a strong promoter to the gene encoding the enzyme;

   5) Enhanced by changing the amino acid sequence of the enzyme;

   6) Enhanced by changes in the nucleotide sequence encoding the enzyme.
7. The microorganism according to claim 4, characterized in that, the reduction or loss of the activity of enzymes related to threonine synthesis related to the competition pathway or degradation pathway in the microorganism is selected from the following 1)-5), or optionally A combination of:

   1) reduce or lose by changing the promoter sequence of the gene encoding the enzyme;

   2) reduced or lost by changing the ribosome binding site of the gene encoding the enzyme;

   3) reduction or loss by changing the amino acid sequence of the enzyme;

   4) reduced or lost by changing the nucleotide sequence encoding the enzyme;

   5) Loss by knocking out the coding sequence of the enzyme.
8. The microorganism according to any one of claims 1-7, characterized in that, the microorganism is Corynebacterium glutamicum.
9. The method for constructing threonine-producing genetically engineered bacteria is characterized in that the method is selected from any one of schemes i～iv:

   Scheme i: Weaken the gene encoding 2-formyl-citrate synthase 2 in corynebacteria with amino acid production ability, and obtain a gene weakened strain; the attenuation includes knocking out or reducing the 2-formyl-citrate synthase 2 encoding gene expression;

   Scheme ii:

   A. Weaken the gene encoding 2-formyl-citrate synthase 2 in corynebacteria with amino acid production ability to obtain a gene weakened strain; the weakening includes knocking out or reducing the 2-formyl-citrate synthase 2 encoding gene expression of

   B. Enhancing the enzymes related to the threonine synthesis pathway in the gene weakened strain of step A to obtain enzyme activity enhanced strains;

   Scheme iii:

   a, weakening the gene encoding 2-formyl-citrate synthase 2 in corynebacteria with amino acid production ability, and obtaining a gene weakened strain; and

   b. further weakening the coding gene of the enzyme of the competition pathway or degradation pathway related to threonine synthesis in the gene weakening strain of step a;

   Said attenuation comprises knocking out or reducing the expression of a gene;

   Scheme iv:

   1) Weakening the gene encoding 2-formyl-citrate synthase 2 in corynebacteria with amino acid production ability to obtain gene weakened strains;

   2) Enhancing step 1) Enzymes related to threonine synthesis pathway in gene weakened strains to obtain enzyme activity enhanced strains; and

   3) Further weaken step 2) Enhancing the genes encoding the enzymes of the competition pathway or degradation pathway related to threonine synthesis in the strain;

   Said attenuation comprises knocking out or reducing the expression of a gene;

   The enhanced pathway is selected from the following 1) to 6), or an optional combination:

   1) enhanced by introducing a plasmid having a gene encoding the enzyme;

   2) enhanced by increasing the copy number of the gene encoding said enzyme on the chromosome;

   3) Enhanced by changing the promoter sequence of the gene encoding the enzyme on the chromosome;

   4) Enhanced by operably linking a strong promoter to the gene encoding the enzyme;

   5) Enhanced by changing the amino acid sequence of the enzyme;

   6) enhanced by changes in the nucleotide sequence encoding the enzyme;

   The activity reduction or loss is achieved by being selected from the following 1)-5), or an optional combination:

   1) reduce or lose by changing the promoter sequence of the gene encoding the enzyme;

   2) reduced or lost by changing the ribosome binding site of the gene encoding the enzyme;

   3) reduction or loss by changing the amino acid sequence of the enzyme;

   4) reduced or lost by changing the nucleotide sequence encoding the enzyme;

   5) loss by knocking out the coding sequence of said enzyme;

   Wherein, the enzyme related to the threonine synthesis pathway is selected from at least one of aspartokinase, homoserine dehydrogenase, and threonine synthase;

   The enzymes of the competition pathway or degradation pathway related to the synthesis of threonine are selected from the group consisting of diaminopimelate dehydrogenase, threonine dehydratase, dihydrodipicolinate synthase 4-hydroxyl-tetrahydrodipyridinecarboxylate At least one of acid synthase, acetate kinase, and phosphotransacetylase.
10. The method according to claim 9, wherein the corynebacterium is Corynebacterium glutamicum.
11. A method for producing threonine, characterized in that the method comprises the steps of:

    A) cultivating the microorganism described in any one of claims 1-8 or the engineering bacterium constructed with the method described in claim 9 or 10, to obtain the culture of said microorganism or engineering bacterium;

    b) collecting the threonine produced from said culture obtained in step a).