WO2023140652A1 - 알츠하이머 조기진단용 바이오마커와 이의 용도 - Google Patents
알츠하이머 조기진단용 바이오마커와 이의 용도 Download PDFInfo
- Publication number
- WO2023140652A1 WO2023140652A1 PCT/KR2023/000954 KR2023000954W WO2023140652A1 WO 2023140652 A1 WO2023140652 A1 WO 2023140652A1 KR 2023000954 W KR2023000954 W KR 2023000954W WO 2023140652 A1 WO2023140652 A1 WO 2023140652A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- mir
- hsa
- mature
- disease
- alzheimer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Definitions
- the present invention relates to a composition and kit for diagnosing Alzheimer's disease using a novel miRNA biomarker, and a method for providing information for diagnosing Alzheimer's disease using the same.
- Dementia is a representative disease of old age. It is a degenerative disease in which acquired intellectual ability is lost and gradually deterioration of personality is caused by cognitive impairment, behavioral and psychological symptoms (abnormal behavior and psychological symptoms such as insomnia, bulimia, anxiety, anxiety, depression, delusion, etc.). Any disease that can cause damage to overall brain function can cause dementia.
- Commonly known Alzheimer's-type dementia or Alzheimer's disease (AD) accounts for about 60% of all dementia, and brain tissue is lost and the brain atrophy as neurons degenerate or slowly decline in the cerebral cortex or hippocampus.
- vascular dementia occurs when brain cells die due to cerebral blood circulation disorders or cerebrovascular abnormalities.
- Alzheimer's disease is estimated to be affected by more than 20% of the elderly aged 80 years or older, and the number tends to increase rapidly as the aging society progresses.
- the most common diagnostic methods for Alzheimer's disease include image diagnosis such as magnetic resonance imaging (MRI) and positron emission tomography (PET), as well as indirect methods such as mini mental state examination (MMSE) and questionnaire.
- MRI magnetic resonance imaging
- PET positron emission tomography
- MMSE mini mental state examination
- An object of the present invention is to provide a composition for diagnosing Alzheimer's disease using a novel miRNA biomarker.
- Another object of the present invention is to provide a kit for diagnosing Alzheimer's disease comprising the composition for diagnosing Alzheimer's disease.
- an object of the present invention is to provide a method for providing information for diagnosis of Alzheimer's disease using a novel miRNA biomarker.
- One aspect of the present invention is hsa-miR-1-3p, hsa-miR-10393-5p, hsa-miR-10395-3p, hsa-miR-122-3p, hsa-miR-1233-5p, hsa-miR-1287-3p, hsa-miR-1287-5p, hsa-miR-1296-3p, hsa-miR- 136-3p, hsa-miR-136-5p, hsa-miR-148a-5p, hsa-miR-15a-5p, hsa-miR-188-3p, hsa-miR-199a-5p, hsa-miR-19b-2-5p, hsa-miR-214-3p, hsa-miR-27a-5p, hsa-miR-29 a-3p, hsa-mi
- the Mature_99 is represented by SEQ ID NO: 1
- the Mature_141 is represented by SEQ ID NO: 2
- the Mature_163 is represented by SEQ ID NO: 3
- the Mature_167 is represented by SEQ ID NO: 4
- the Mature_184 is represented by SEQ ID NO: 5
- the Mature_258 is represented by SEQ ID NO: 6
- the Mature_385 is represented by SEQ ID NO: 7
- the Mature _649 may be represented by SEQ ID NO: 8
- the Mature_776 may be represented by SEQ ID NO: 9.
- the miRNAs are hsa-miR-10393-5p, hsa-miR-10395-3p, hsa-miR-122-3p, hsa-miR-1296-3p, hsa-miR-136-3p, hsa-miR-29a-3p, hsa-miR-301b-5p, hsa-miR-3667-3 p, hsa-miR-375-3p, hsa-miR-376b-5p, hsa-miR-376c-5p, hsa-miR-4467, hsa-miR-4485-5p, hsa-miR-4659b-5p, hsa-miR-490-5p, hsa-miR-497-5p, hsa-miR-642a-5p, It may be at least one selected from the group consist
- the miRNA is HSA-MIR-10395-3P, HSA-MIR-122-3P, HSA-MIR-376B-5P, HSA-MIR-376C-5P, HSA-MIR-MIR-4485-5P It may be one or more selected from the group consisting of _258 and MATURE_385.
- the biological sample may be at least one selected from the group consisting of blood, plasma, serum, lymph, saliva, urine, and tissue.
- the agent may be a substance that binds miRNA.
- the agent may be at least one selected from the group consisting of primers, probes, and antisense oligonucleotides that specifically bind to miRNA.
- Another aspect of the present invention provides a kit for diagnosing Alzheimer's disease comprising the above-described composition for diagnosing Alzheimer's disease.
- the kit may further include a reagent for nucleic acid amplification.
- the kit may be at least one selected from the group consisting of PCR, RT-PCR kits, real-time PCR kits, and microarray chip kits.
- the kit may further include a reagent for separating nucleic acids.
- Another aspect of the present invention is a step of collecting a biological sample from a subject in need of diagnosis; b) measuring the expression level of one or more miRNAs selected from the miRNA group for early diagnosis of Alzheimer's disease in the biological sample; and c) providing information for diagnosing Alzheimer's disease, comprising comparing the measured miRNA expression level with a control group.
- the biological sample in step a) may be at least one selected from the group consisting of blood, plasma, serum, lymph, saliva, urine, and tissue.
- the miRNAs in step b) are hsa-miR-10393-5p, hsa-miR-10395-3p, hsa-miR-122-3p, hsa-miR-1296-3p, hsa-miR-136-3p, hsa-miR-29a-3p, hsa-miR-301b-5p, hsa-miR-36 67-3p, hsa-miR-375-3p, hsa-miR-376b-5p, hsa-miR-376c-5p, hsa-miR-4467, hsa-miR-4485-5p, hsa-miR-4659b-5p, hsa-miR-490-5p, hsa-miR-497-5p, hsa-miR-642a -5p, hsa-miR-490-5p,
- the miRNA in step b) is at least one selected from the group consisting of hsa-miR-10395-3p, hsa-miR-122-3p, hsa-miR-376b-5p, hsa-miR-376c-5p, hsa-miR-4485-5p, Mature_99, Mature_141, Mature_258 and Mature_385 can be
- the miRNA expression level in step b) may be measured by one or more methods selected from the group consisting of polymerase chain reaction (PCR), reverse transcription-polymerase chain reaction (RT-PCR), competitive RT-PCR, real-time RT-PCR, nuclease protection assay, in situ hybridization, microarray, and northern blot.
- PCR polymerase chain reaction
- RT-PCR reverse transcription-polymerase chain reaction
- competitive RT-PCR competitive RT-PCR
- nuclease protection assay in situ hybridization
- microarray microarray
- northern blot the miRNA expression level in step b)
- control group may be a normal person, an individual without suspected symptoms of Alzheimer's disease or an individual who has not been diagnosed with Alzheimer's disease, or a sample obtained therefrom.
- step c) comprises hsa-miR-1-3p, hsa-miR-10393-5p, hsa-miR-122-3p, hsa-miR-1233-5p, hsa-miR-136-3p, hsa-miR-136-5p, hsa-miR-15a-5p, hsa-miR-323b-3p, hsa-miR-329-3p, hsa-miR-3667-3p, hsa-miR-375-3p, hsa-miR-376a-2-5p, hsa-miR-376a-3p, hsa-miR-376b-5p, hsa-miR-376c-5p, hsa-miR-3920, hsa-miR-410-3p, h sa-miR-4467, hsa
- step c) may be performed in the subject in the subject: 19b-2-5p, hsa-miR-214-3p, hsa-miR-27a-5p, hsa-miR-29a-3p, hsa-miR-301b-5p, hsa-miR-4301, hsa-miR-4436b-3p, hsa-miR-4645-3p, hsa-miR-4659b-5p, hsa-miR- 4743-5p, hsa-miR-490-5p, hsa-miR-497-5p, hsa-miR-518e-5p, hsa-miR-519a-5p, hsa-miR-519b-5p, hsa-miR-519c-5p, hsa-miR-522-5p, hsa
- Another aspect of the present invention provides a use of the 'miRNA group for early diagnosis of Alzheimer's disease' for early diagnosis of Alzheimer's disease.
- Another aspect of the present invention provides the use of the 'miRNA group for early diagnosis of Alzheimer's disease' for the manufacture of a kit for early diagnosis of Alzheimer's disease.
- the Alzheimer's disease, diagnosis, and miRNA are as described above.
- composition and kit for diagnosing Alzheimer's disease by presenting a novel biomarker capable of predicting Alzheimer's disease, it is possible to quickly and accurately diagnose Alzheimer's disease patients and provide appropriate treatment to Alzheimer's disease patients.
- 1 shows the number of reads for all 20 samples according to an embodiment of the present invention.
- FIG. 2 shows the types and ratios of small RNA (smRNA) classified in processing data according to an embodiment of the present invention.
- Figure 3 shows the number of mature miRNAs commonly observed in all 20 samples according to an embodiment of the present invention.
- 5 shows the expression density of each sample based on logarithmic transformation and TMM normalization for original data (number of reads), reads per million (CPM) according to an embodiment of the present invention.
- FIG. 6 shows the degree of similarity between samples using Pearson's correlation coefficient for normal values according to an embodiment of the present invention.
- FIG 7 illustrates hierarchical clustering analysis using normal values according to an embodiment of the present invention.
- Figure 9 shows the number of up- and down-regulated mature miRNAs based on the fold change (fc) between the NC group and the LOAD group according to an embodiment of the present invention.
- FIG. 10 shows the number of up- and down-regulated mature miRNAs based on fold change and p value between the NC group and the LOAD group according to an embodiment of the present invention.
- FIG. 11 shows log-transformed fold changes and p values compared between the NC group and the LOAD group according to an embodiment of the present invention.
- 13 is a hierarchical clustering analysis of similarities between mature miRNAs and samples according to an embodiment of the present invention.
- One aspect of the present invention provides a composition for diagnosing Alzheimer's disease comprising an agent for measuring the expression level of one or more miRNAs selected from the miRNA group for early diagnosis of Alzheimer's disease.
- Alzheimer's disease is a brain pathological finding in which a neuritic plaque, a neurofibrillary tangle, etc. related to the deposition of beta amyloid are observed, and a degenerative brain disease showing overall brain atrophy due to loss of nerve cells with the naked eye.
- memory loss usually appears, and as it progresses, not only cognitive function decline, but also psychobehavioral symptoms such as personality change, nervous behavior, depression, delusion, hallucination, increased aggression, and sleep disorder are accompanied and intensified.
- miRNA can be used as a biomarker for diagnosing Alzheimer's disease.
- a biomarker is a substance that is generally detectable in a biological sample and includes all organic biomolecules such as polypeptides, proteins, nucleic acids, genes, lipids, glycolipids, glycoproteins, and sugars that can detect biological changes.
- miRNA is also called micro RNA, and refers to 21 to 23 non-coding RNAs that regulate gene expression after transcription by promoting degradation of target RNA or inhibiting their translation.
- miRNA is transcribed as a precursor of about 70 to 80 nt (nucleotide) in length having a hairpin structure called pre-miRNA, and then cleaved by Dicer, an RNAse III enzyme, to be produced in a mature form. More than 30% of human miRNAs exist in clusters, and after being transcribed as one precursor, the final mature miRNA is formed through a cleavage process.
- These miRNAs are composed of specific miRNAs that show specific expression level changes in Alzheimer's disease patients identified through next-generation sequencing (NGS), and can be suggested as biomarkers for Alzheimer's disease diagnosis.
- NGS next-generation sequencing
- the NGS has a multiplexing ability to simultaneously perform hundreds of thousands of reactions, and sequencing is possible even with a small amount of sample.
- NGS has slightly different specific application techniques depending on the commercialized technology, but in general, clonal amplification, massively parallel sequencing, and a new sequencing method with a different mechanism of action from the Sanger method are used.
- Commercialized technologies include the 454 GS improved FLX model sequencer released by Roche in 2007, Genome Analyzer HiSeq released by Illumina in 2006, and SOLiD released by Applied Biosystems in 2007.
- These 64 miRNAs for diagnosis of Alzheimer's disease include previously identified miRNAs as well as novel miRNAs first identified as miRNAs by the present inventors.
- the novel miRNAs have not been reported in previous references, and include Mature_99, Mature_141, Mature_163, Mature_167, Mature_184, Mature_258, Mature_385, Mature_649, and Mature_776.
- the Mature_99 is represented by SEQ ID NO: 1
- the Mature_141 is represented by SEQ ID NO: 2
- the Mature_163 is represented by SEQ ID NO: 3
- the Mature_167 is represented by SEQ ID NO: 4
- the Mature_184 is represented by SEQ ID NO: 5
- the Mature_258 is represented by SEQ ID NO: 6
- the Mature_385 is represented by SEQ ID NO: 7
- the Mature _649 may be represented by SEQ ID NO: 8
- the Mature_776 may be represented by SEQ ID NO: 9.
- These 64 miRNAs may be used alone or in combination of two or more as biomarkers for Alzheimer's diagnosis.
- miRNA alone or miRNA combination having a statistically significant expression difference (
- the miRNAs are hsa-miR-10393-5p, hsa-miR-10395-3p, hsa-miR-122-3p, hsa-miR-1296-3p, hsa-miR-136-3p, hsa-miR-29a-3p, hsa-miR-301b-5p, hsa-miR-3667-3 p, hsa-miR-375-3p, hsa-miR-376b-5p, hsa-miR-376c-5p, hsa-miR-4467, hsa-miR-4485-5p, hsa-miR-4659b-5p, hsa-miR-490-5p, hsa-miR-497-5p, hsa-miR-642a-5p, It may be at least one selected from the group consist
- the miRNA is HSA-MIR-10395-3P, HSA-MIR-122-3P, HSA-MIR-376B-5P, HSA-MIR-376C-5P, HSA-MIR-MIR-4485-5P It may be one or more selected from the group consisting of _258 and MATURE_385.
- the expression level of the miRNA according to the present invention can be measured in a biological sample.
- biological sample refers to a sample including cells and tissues as well as organic biomolecules such as nucleic acids, genes, peptides, amino acids, proteins, lipids, sugars, glycolipids, and glycoproteins derived from a living body and capable of detecting biological changes.
- organic biomolecules such as nucleic acids, genes, peptides, amino acids, proteins, lipids, sugars, glycolipids, and glycoproteins derived from a living body and capable of detecting biological changes.
- any sample containing miRNA is not limited.
- the biological sample may be at least one selected from the group consisting of blood, plasma, serum, lymph, saliva, urine, and tissue.
- the agent may be a substance that binds miRNA.
- the agent may be at least one selected from the group consisting of primers, probes, and antisense oligonucleotides that specifically bind to miRNA.
- binding means that the binding ability to a target substance is superior to other substances to the extent that the presence or absence of the target substance can be detected by binding.
- primer is a nucleic acid sequence having a short free 3-terminal hydroxyl group, capable of forming base pairs with a complementary template and serving as a starting point for copying the template strand. Refers to a single strand oligonucleotide.
- the primers can initiate DNA synthesis in the presence of a reagent for polymerization (i.e., DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates in an appropriate buffer and temperature.
- the primers are composed of sense and antisense nucleic acids having 7 to 50 nucleotide sequences, and may have 15 to 30 nucleotide sequences at a level that does not change the basic properties of the primer that serves as the starting point of DNA synthesis.
- probe refers to a linear oligomer of natural or modified monomers or linkages, including deoxyribonucleotides and ribonucleotides, capable of specifically hybridizing to a target nucleotide sequence, naturally occurring or artificially synthesized.
- Another aspect of the present invention provides a kit for diagnosing Alzheimer's disease comprising the above-described composition for diagnosing Alzheimer's disease.
- the "Alzheimer's disease diagnosis kit” used in the present invention refers to a substance capable of diagnosing Alzheimer's disease through a biological sample collected from a test subject, and through this, Alzheimer's disease can be diagnosed quickly, accurately, and conveniently.
- the kit for diagnosing Alzheimer's disease includes an agent capable of measuring miRNA expression levels, and preferably includes a primer or a primer set as the agent.
- the kit may further include a reagent for nucleic acid amplification.
- the nucleic acid amplification reagent may include conventional PCR reagents known in the art, and may include, for example, nucleoside triphosphate, a (deoxy) ribonuclease inhibitor, a thermostable polymerase, and a reaction buffer, but is not limited thereto.
- the nucleoside triphosphate refers to a molecule in which a purine-based or pyrimidine-based nucleoside is bonded to ribose or deoxyribose to form three phosphate groups, (deoxy) adenosine triphosphate ((deoxy) adenosine triphosphate, ATP or dATP), (deoxy) guanosine triphosphate ((deoxy)guanosine triphosphate , GTP or dGTP), (deoxy)cytidine triphosphate (CTP or dCTP) and (deoxy)thymidine triphosphate (TTP or dTTP).
- the reaction buffer may be Taq polymerase buffer, PCR buffer, etc., and is a compound added to the amplification reaction that changes the stability, activity and/or longevity of one or more components of the amplification reaction by adjusting the pH of the amplification reaction.
- This reaction buffer may further contain additives for optimizing an efficient PCR reaction.
- the kit may be at least one selected from the group consisting of PCR, RT-PCR kits, real-time PCR kits, and microarray chip kits.
- the kit may further include a reagent for separating nucleic acids.
- the nucleic acid isolation reagent is a conventional RNA or miRNA extraction reagent known in the art, and may include a salt capable of cell lysis, a surfactant, a metal ion, a sugar, a reducing agent (eg, DTT), and the like.
- the kit according to the present invention may include, without limitation, a diagnostic kit based on conventional genetic quantitative analysis.
- the kit of the present invention may optionally include reagents required for PCR amplification, such as a buffer, DNA polymerase, DNA polymerase cofactor, and dNTPs.
- reagents required for PCR amplification such as a buffer, DNA polymerase, DNA polymerase cofactor, and dNTPs.
- the kit according to the present invention may be manufactured in a plurality of separate packaging or compartments including the reagent components described above, and the kit of the present invention may be a diagnostic kit including essential elements necessary for performing a DNA or RNA chip.
- Another aspect of the present invention is a step of collecting a biological sample from a subject in need of diagnosis; b) measuring the expression level of one or more miRNAs selected from the miRNA group for early diagnosis of Alzheimer's disease in the biological sample; and c) providing information for diagnosing Alzheimer's disease, comprising comparing the measured miRNA expression level with a control group.
- Steps a) to c) will be examined in detail in the following, and the description of the contents common to the above will be omitted to avoid excessive complexity.
- Step a) is a process of collecting a biological sample from a subject who needs to be tested for Alzheimer's disease.
- the biological sample in step a) may be at least one selected from the group consisting of blood, plasma, serum, lymph, saliva, urine, and tissue.
- Step b) is a process of measuring the expression level together with the presence or absence of the biomarker miRNA in the biological sample.
- the miRNAs in step b) are hsa-miR-10393-5p, hsa-miR-10395-3p, hsa-miR-122-3p, hsa-miR-1296-3p, hsa-miR-136-3p, hsa-miR-29a-3p, hsa-miR-301b-5p, hsa-miR-36 67-3p, hsa-miR-375-3p, hsa-miR-376b-5p, hsa-miR-376c-5p, hsa-miR-4467, hsa-miR-4485-5p, hsa-miR-4659b-5p, hsa-miR-490-5p, hsa-miR-497-5p, hsa-miR-642a -5p, hsa-miR-490-5p,
- the miRNA in step b) is at least one selected from the group consisting of hsa-miR-10395-3p, hsa-miR-122-3p, hsa-miR-376b-5p, hsa-miR-376c-5p, hsa-miR-4485-5p, Mature_99, Mature_141, Mature_258 and Mature_385 can be
- the miRNA expression level in step b) may be measured by one or more methods selected from the group consisting of polymerase chain reaction (PCR), reverse transcription-polymerase chain reaction (RT-PCR), competitive RT-PCR, real-time RT-PCR, nuclease protection assay, in situ hybridization, microarray, and northern blot.
- PCR polymerase chain reaction
- RT-PCR reverse transcription-polymerase chain reaction
- competitive RT-PCR competitive RT-PCR
- nuclease protection assay in situ hybridization
- microarray microarray
- northern blot the miRNA expression level in step b)
- composition or kit for diagnosing Alzheimer's disease according to the present invention it is preferable to use the above-described composition or kit for diagnosing Alzheimer's disease according to the present invention to determine the level of miRNA expression.
- Step c) is a process of determining Alzheimer's disease by comparing the amount of miRNA expression measured in the biological sample with a control group.
- control group may be a normal person, an individual without suspected symptoms of Alzheimer's disease or an individual who has not been diagnosed with Alzheimer's disease, or a sample obtained therefrom.
- step c) comprises hsa-miR-1-3p, hsa-miR-10393-5p, hsa-miR-122-3p, hsa-miR-1233-5p, hsa-miR-136-3p, hsa-miR-136-5p, hsa-miR-15a-5p, hsa-miR-323b-3p, hsa-miR-329-3p, hsa-miR-3667-3p, hsa-miR-375-3p, hsa-miR-376a-2-5p, hsa-miR-376a-3p, hsa-miR-376b-5p, hsa-miR-376c-5p, hsa-miR-3920, hsa-miR-410-3p, h sa-miR-4467, hsa
- step c) may be performed in the subject in the subject: 19b-2-5p, hsa-miR-214-3p, hsa-miR-27a-5p, hsa-miR-29a-3p, hsa-miR-301b-5p, hsa-miR-4301, hsa-miR-4436b-3p, hsa-miR-4645-3p, hsa-miR-4659b-5p, hsa-miR- 4743-5p, hsa-miR-490-5p, hsa-miR-497-5p, hsa-miR-518e-5p, hsa-miR-519a-5p, hsa-miR-519b-5p, hsa-miR-519c-5p, hsa-miR-522-5p, hsa
- NGS analysis was performed to analyze gene expression patterns between normal subjects and patients with Alzheimer's disease.
- Blood samples collected from the population were used for miRNA sequencing ( Homo sapiens miRNA sequencing), which was commissioned by Macrogen. Briefly, RNA present in blood was synthesized into cDNA using PrimeScript reverse transcriptase (RT) and SMARTer® smRNA-Seq Kit for Illumina® (TaKaRa), followed by PCR amplification. After sequencing, the quality of the raw sequence reads was evaluated for data processing, excluding reads containing adapter sequences, and trimmed reads and non-adapter reads ( ⁇ 50 bp) were selected (FIG. 1). Thereafter, reads that match 100% in read length, sequence identity, etc.
- RT PrimeScript reverse transcriptase
- TaKaRa SMARTer® smRNA-Seq Kit for Illumina®
- RNA samples were collected to form one cluster, and then unnecessary rRNA was removed and used for miRNA profiling. Most of the rRNA was removed, and the remaining RNA was a short RNA of 18 to 100 nt, including a trim lead of 47 bp and a mature miRNA of 20 to 25 nt.
- New miRNAs were predicted from processing data using the miRNA analysis software miRDeep2.
- the reference genome miRBase v22.1 (2,656 human miRNAs) and the non-coding RNA database RNAcentral 14.0 were sequentially used to classify previously known miRNAs and other RNAs such as tRNA, snRNA, and snoRNA (Fig. 2).
- tRNA tRNA
- snRNA snoRNA
- Fig. 2 previously unreported miRNAs were determined as novel miRNAs.
- Table 2 above shows 64 mature miRNAs corresponding to the core data, including 55 previously reported mature miRNAs and 9 new mature miRNAs first identified in this sequencing analysis. These miRNAs were selected as candidate biomarkers for diagnosis of Alzheimer's disease.
- Novel mature miRNA Base sequence (5'-3') sequence number Mature_99 TTGTTTTTGGGGTTTGGCAG One Mature_141 AGGATGAGACTCCGTCAC 2 Mature_163 CTCAGGCTACACCCTAGACC 3 Mature_167 GGGGGGAGGGGGGAAAAAGG 4 Mature_184 CATGGAGGCCATGGGGTGG 5 Mature_258 ACTGAAGAATGGAGAGAG 6 Mature_385 GGAGGCCATGGGGTTGGGG 7 Mature_649 CATGGAGGCCATGGGGTCA 8 Mature_776 AGAGCGAGACCCCGTCTCTT 9
- composition and kit for diagnosing Alzheimer's disease by presenting a novel biomarker capable of predicting Alzheimer's disease, it is possible to quickly and accurately diagnose Alzheimer's disease patients and provide appropriate treatment to Alzheimer's disease patients.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
본 발명은 신규 miRNA 바이오마커를 이용하여 알츠하이머병을 진단하는 알츠하이머병 진단용 조성물 및 키트, 및 이를 이용한 알츠하이머병 진단을 위한 정보의 제공 방법에 관한 것으로, 본 발명에서는 알츠하이머병을 예측할 수 있는 신규 바이오마커를 제시함으로써 알츠하이머병 진단용 조성물 및 키트를 제공하여 알츠하이머병 환자를 신속하고 정확하게 진단할 수 있으며, 알츠하이머병 환자에게 적절한 치료법을 제공할 수 있다.
Description
본 발명은 신규 miRNA 바이오마커를 이용하여 알츠하이머병을 진단하는 알츠하이머병 진단용 조성물 및 키트, 및 이를 이용한 알츠하이머병 진단을 위한 정보의 제공 방법에 관한 것이다.
치매(Dementia)는 대표적인 노년기 질환으로, 후천적으로 지적 능력을 상실하고 인지 장애, 행동 심리증상 (불면증, 과식증, 불안, 초조, 우울, 망상 등의 이상 행동 및 심리 증상)에 의한 성격의 점진적 황폐화가 나타나는 퇴행성 질환이다. 전반적인 뇌 기능의 손상을 일으킬 수 있는 모든 질환이 치매의 원인이 될 수 있다. 흔히 알려진 알츠하이머형 치매 또는 알츠하이머병(Alzheimer's disease, AD)은 전체 치매의 약 60%를 차지하며, 대뇌 피질이나 해마에서 신경세포가 변성되거나 서서히 쇠퇴하면서 뇌 조직이 소실되고 뇌가 위축된다. 일부에서는 뇌 혈액순환 장애나 뇌혈관 이상으로 인해 뇌세포가 죽으면선 발생하는 혈관성 치매가 발생한다.
알츠하이머병은 80세 이상 노인의 20% 이상이 알츠하이머병의 영향을 받고 있을 것으로 추정되며, 고령화 사회가 될수록 그 수가 급격히 증가하는 추세이다. 하지만 알츠하이머병은 뇌 조직에서의 베타 아밀로이드(β-amyloid) 축적을 동반한 다양한 병인학적 요인에 의해 발병하기 때문에 아직까지 명확한 진단 및 치료 방법이 없다. 가장 일반적인 알츠하이머병의 진단 방법으로는 MRI(magnetic resonance imaging), PET(positron emission tomography) 등의 영상 진단과 함께 간이 인지 상태 검사(mini mental state examination: MMSE), 문진 등의 간접적인 방법이 사용되고 있으나, 영상 진단은 고가의 비용과 장비의 제한성 때문에 환자의 부담이 크며, MMSE를 통한 진단은 나이, 학력 등에 의해 그 결과가 달라지므로 진단의 정확성이 문제가 되고 있다.
최근 전세계적으로 알츠하이머병 진단을 위해 혈중 바이오마커에 대한 연구가 활발히 진행되고 있다. 그러나 현재까지의 결과물은 극히 제한적이며 이에 대해서도 다양한 반박의 의견 및 결과가 나오고 있고, 단백질 바이오마커의 경우 체내 존재하는 무수히 많은 단백질 간의 결합 상태 또는 응집 여부에 의해 정량적 수치 차이를 보이고 있다. 따라서 단백질 이외의 다른 형태의 바이오마커에 대한 연구가 절실히 요구되고 있다.
[선행기술문헌]
[특허문헌]
대한민국 공개특허 제10-2018-0067313호
대한민국 공개특허 제10-2020-0097636호
본 발명은 신규 miRNA 바이오마커를 이용한 알츠하이머병 진단용 조성물을 제공하는 것을 목적으로 한다.
또한, 본 발명은 상기 알츠하이머병 진단용 조성물을 포함하는 알츠하이머병 진단용 키트를 제공하는 것을 목적으로 한다.
또한, 본 발명은 신규 miRNA 바이오마커를 이용한 알츠하이머병 진단을 위한 정보의 제공 방법을 제공하는 것을 목적으로 한다.
본 발명의 일 양상은 hsa-miR-1-3p, hsa-miR-10393-5p, hsa-miR-10395-3p, hsa-miR-122-3p, hsa-miR-1233-5p, hsa-miR-1287-3p, hsa-miR-1287-5p, hsa-miR-1296-3p, hsa-miR-136-3p, hsa-miR-136-5p, hsa-miR-148a-5p, hsa-miR-15a-5p, hsa-miR-188-3p, hsa-miR-199a-5p, hsa-miR-19b-2-5p, hsa-miR-214-3p, hsa-miR-27a-5p, hsa-miR-29a-3p, hsa-miR-301b-5p, hsa-miR-323b-3p, hsa-miR-329-3p, hsa-miR-3667-3p, hsa-miR-375-3p, hsa-miR-376a-2-5p, hsa-miR-376a-3p, hsa-miR-376b-5p, hsa-miR-376c-5p, hsa-miR-3920, hsa-miR-410-3p, hsa-miR-4301, hsa-miR-4436b-3p, hsa-miR-4467, hsa-miR-4485-5p, hsa-miR-4645-3p, hsa-miR-4659b-5p, hsa-miR-4743-5p, hsa-miR-490-5p, hsa-miR-494-3p, hsa-miR-497-5p, hsa-miR-518e-5p, hsa-miR-519a-5p, hsa-miR-519b-5p, hsa-miR-519c-5p, hsa-miR-522-5p, hsa-miR-523-5p, hsa-miR-5582-3p, hsa-miR-579-5p, hsa-miR-598-5p, hsa-miR-642a-5p, hsa-miR-6809-5p, hsa-miR-6825-5p, hsa-miR-6842-5p, hsa-miR-6858-3p, hsa-miR-7112-3p, hsa-miR-758-5p, Mature_99, Mature_141, Mature_163, Mature_167, Mature_184, Mature_258, Mature_385, Mature_649 및 Mature_776로 이루어진 군(이하, “알츠하이머병 조기진단용 miRNA군”이라 한다)에서 선택된 1종 이상의 miRNA 발현 수준을 측정하는 제제를 포함하는 알츠하이머병 진단용 조성물을 제공한다.
본 발명의 일 구체예에 따르면, 상기 Mature_99는 서열번호 1로 표시되는 것이고, 상기 Mature_141는 서열번호 2로 표시되는 것이고, 상기 Mature_163은 서열번호 3으로 표시되는 것이고, 상기 Mature_167는 서열번호 4로 표시되는 것이고, 상기 Mature_184는 서열번호 5로 표시되는 것이고, 상기 Mature_258는 서열번호 6으로 표시되는 것이고, 상기 Mature_385는 서열번호 7로 표시되는 것이고, 상기 Mature_649는 서열번호 8로 표시되는 것이고, 및 상기 Mature_776는 서열번호 9로 표시되는 것일 수 있다.
본 발명의 일 구체예에 따르면, 상기 miRNA는 hsa-miR-10393-5p, hsa-miR-10395-3p, hsa-miR-122-3p, hsa-miR-1296-3p, hsa-miR-136-3p, hsa-miR-29a-3p, hsa-miR-301b-5p, hsa-miR-3667-3p, hsa-miR-375-3p, hsa-miR-376b-5p, hsa-miR-376c-5p, hsa-miR-4467, hsa-miR-4485-5p, hsa-miR-4659b-5p, hsa-miR-490-5p, hsa-miR-497-5p, hsa-miR-642a-5p, hsa-miR-6809-5p, hsa-miR-7112-3p, hsa-miR-758-5p, Mature_99, Mature_141, Mature_163, Mature_167, Mature_184, Mature_258, Mature_385 및 Mature_649로 이루어진 군에서 선택된 1종 이상인 것일 수 있다.
또한, 본 발명의 일 구체예에 따르면, 상기 miRNA는 hsa-miR-10395-3p, hsa-miR-122-3p, hsa-miR-376b-5p, hsa-miR-376c-5p, hsa-miR-4485-5p, Mature_99, Mature_141, Mature_258 및 Mature_385로 이루어진 군에서 선택된 1종 이상인 것일 수 있다.
본 발명의 일 구체예에 따르면, 상기 생물학적 시료는 혈액, 혈장, 혈청, 림프액, 타액, 소변 및 조직으로 이루어진 군에서 선택된 1종 이상인 것일 수 있다.
상기 제제는 miRNA에 결합하는 물질일 수 있다.
본 발명의 일 구체예에 따르면, 상기 제제는 miRNA에 특이적으로 결합하는 프라이머, 프로브 및 안티센스 올리고뉴클레오티드로 이루어진 군에서 선택된 1종 이상인 것일 수 있다.
본 발명의 다른 양상은 전술한 알츠하이머병 진단용 조성물을 포함하는 알츠하이머병 진단용 키트를 제공한다.
본 발명의 일 구체예에 따르면, 상기 키트는 핵산 증폭용 시약을 더 포함하는 것일 수 있다.
본 발명의 일 구체예에 따르면, 상기 키트는 PCR, RT-PCR 키트, 실시간 PCR 키트 및 마이크로어레이 칩 키트로 이루어진 군에서 선택된 1종 이상인 것일 수 있다.
본 발명의 일 구체예에 따르면, 상기 키트는 핵산 분리용 시약을 더 포함하는 것일 수 있다.
본 발명의 다른 양상은 a) 진단이 필요한 개체로부터 생물학적 시료를 채취하는 단계; b) 상기 생물학적 시료에서 상기 ‘알츠하이머병 조기진단용 miRNA군’에서 선택된 1종 이상의 miRNA 발현 수준을 측정하는 단계; 및 c) 상기 측정된 miRNA 발현 수준을 대조군과 비교하는 단계를 포함하는 알츠하이머병 진단을 위한 정보의 제공 방법을 제공한다.
본 발명의 일 구체예에 따르면, 상기 a) 단계의 생물학적 시료는 혈액, 혈장, 혈청, 림프액, 타액, 소변 및 조직으로 이루어진 군에서 선택된 1종 이상인 것일 수 있다.
본 발명의 일 구체예에 따르면, 상기 b) 단계의 miRNA는 hsa-miR-10393-5p, hsa-miR-10395-3p, hsa-miR-122-3p, hsa-miR-1296-3p, hsa-miR-136-3p, hsa-miR-29a-3p, hsa-miR-301b-5p, hsa-miR-3667-3p, hsa-miR-375-3p, hsa-miR-376b-5p, hsa-miR-376c-5p, hsa-miR-4467, hsa-miR-4485-5p, hsa-miR-4659b-5p, hsa-miR-490-5p, hsa-miR-497-5p, hsa-miR-642a-5p, hsa-miR-6809-5p, hsa-miR-7112-3p, hsa-miR-758-5p, Mature_99, Mature_141, Mature_163, Mature_167, Mature_184, Mature_258, Mature_385 및 Mature_649로 이루어진 군에서 선택된 1종 이상인 것일 수 있다.
또한, 본 발명의 일 구체예에 따르면, 상기 b) 단계의 miRNA는 hsa-miR-10395-3p, hsa-miR-122-3p, hsa-miR-376b-5p, hsa-miR-376c-5p, hsa-miR-4485-5p, Mature_99, Mature_141, Mature_258 및 Mature_385로 이루어진 군에서 선택된 1종 이상인 것일 수 있다.
본 발명의 일 구체예에 따르면, 상기 b) 단계의 miRNA 발현 수준은 중합효소 연쇄반응(PCR), 역전사 중합효소 연쇄반응(RT-PCR), 경쟁적 RT-PCR, 실시간 RT-PCR, 핵산분해효소 보호 분석(nuclease protection assay), in situ 교잡법, 마이크로어레이 및 노던 블롯으로 이루어진 군에서 선택된 1종 이상의 방법으로 측정되는 것일 수 있다.
본 발명의 일 구체예에 따르면, 상기 대조군은 정상인 또는 알츠하이머병이 의심되는 증상이 없거나 알츠하이머병을 진단받지 않은 개체, 또는 이로부터 수득한 시료인 것일 수 있다.
본 발명의 일 구체예에 따르면, 상기 c) 단계는 개체에서 hsa-miR-1-3p, hsa-miR-10393-5p, hsa-miR-122-3p, hsa-miR-1233-5p, hsa-miR-136-3p, hsa-miR-136-5p, hsa-miR-15a-5p, hsa-miR-323b-3p, hsa-miR-329-3p, hsa-miR-3667-3p, hsa-miR-375-3p, hsa-miR-376a-2-5p, hsa-miR-376a-3p, hsa-miR-376b-5p, hsa-miR-376c-5p, hsa-miR-3920, hsa-miR-410-3p, hsa-miR-4467, hsa-miR-4485-5p, hsa-miR-494-3p, hsa-miR-5582-3p, hsa-miR-6809-5p, hsa-miR-6825-5p, hsa-miR-6842-5p, hsa-miR-6858-3p, hsa-miR-7112-3p, hsa-miR-758-5p, Mature_99, Mature_141, Mature_163, Mature_167, Mature_184, Mature_258, Mature_385, Mature_649 및 Mature_776로 이루어진 군에서 선택된 1종 이상의 miRNA 발현 수준이 대조군에 비해 높은 경우 알츠하이머병으로 진단하는 것일 수 있다.
또한, 본 발명의 일 구체예에 따르면, 상기 c) 단계는 개체에서 hsa-miR-10395-3p, hsa-miR-1287-3p, hsa-miR-1287-5p, hsa-miR-1296-3p, hsa-miR-148a-5p, hsa-miR-188-3p, hsa-miR-199a-5p, hsa-miR-19b-2-5p, hsa-miR-214-3p, hsa-miR-27a-5p, hsa-miR-29a-3p, hsa-miR-301b-5p, hsa-miR-4301, hsa-miR-4436b-3p, hsa-miR-4645-3p, hsa-miR-4659b-5p, hsa-miR-4743-5p, hsa-miR-490-5p, hsa-miR-497-5p, hsa-miR-518e-5p, hsa-miR-519a-5p, hsa-miR-519b-5p, hsa-miR-519c-5p, hsa-miR-522-5p, hsa-miR-523-5p, hsa-miR-579-5p, hsa-miR-598-5p 및 hsa-miR-642a-5p로 이루어진 군에서 선택된 1종 이상의 miRNA 발현 수준이 대조군에 비해 낮은 경우 알츠하이머병으로 진단하는 것일 수 있다.
본 발명의 다른 양상은, 상기 ‘알츠하이머병 조기진단용 miRNA군’ 의 알츠하이머 조기 진단 용도를 제공한다.
본 발명의 다른 양상은, 알츠하이머 조기 진단용 키트의 제조를 위한, 상기 ‘알츠하이머병 조기진단용 miRNA군’ 의 용도를 제공한다.
상기 용도에 있어서, 알츠하이머, 진단, miRNA에 대해서는 상기 설명한 바와 같다.
본 발명에서는 알츠하이머병을 예측할 수 있는 신규 바이오마커를 제시함으로써 알츠하이머병 진단용 조성물 및 키트를 제공하여 알츠하이머병 환자를 신속하고 정확하게 진단할 수 있으며, 알츠하이머병 환자에게 적절한 치료법을 제공할 수 있다.
도 1은 본 발명의 일 실시예에 따른 전체 시료 20개에 대한 리드 수를 나타낸 것이다.
도 2는 본 발명의 일 실시예에 따른 가공 데이터에서 분류된 smRNA (small RNA) 유형 및 이의 비율을 나타낸 것이다.
도 3은 본 발명의 일 실시예에 따른 전체 시료 20개에서 공통적으로 관찰되는 성숙 miRNA의 수를 나타낸 것이다.
도 4는 본 발명의 일 실시예에 따른 원본 데이터 (리드 수), 리드 백만개당 개수(CPM)의 로그 변환 및 TMM 정규화를 기반으로 각 시료의 발현 분포를 나타낸 것이다.
도 5는 본 발명의 일 실시예에 따른 원본 데이터 (리드 수), 리드 백만개당 개수(CPM)에 대한 로그 변환 및 TMM 정규화를 기반으로 각 시료의 발현 밀도를 나타낸 것이다.
도 6은 본 발명의 일 실시예에 따른 정규 값에 대한 피어슨 상관계수를 이용하여 각 시료들 간의 유사도를 나타낸 것이다.
도 7은 본 발명의 일 실시예에 따른 정규 값을 이용한 계층적 군집화 분석을 나타낸 것이다.
도 8은 본 발명의 일 실시예에 따른 정규 값을 이용한 다차원 척도 분석을 나타낸 것이다.
도 9는 본 발명의 일 실시예에 따른 NC 그룹과 LOAD 그룹 간의 배수 변화(fold change, fc)에 기반하여 상향 및 하향 조절된 성숙 miRNA 수를 나타낸 것이다.
도 10은 본 발명의 일 실시예에 따른 NC 그룹과 LOAD 그룹 간의 배수 변화 및 p 값에 기반하여 상향 및 하향 조절된 성숙 miRNA 수를 나타낸 것이다
도 11은 본 발명의 일 실시예에 따른 NC 그룹과 LOAD 그룹을 비교한 로그 변환된 배수 변화 및 p 값을 나타낸 것이다.
도 12는 본 발명의 일 실시예에 따른 NC 그룹에 비해 발현 차이가 있는 전사체를 나타낸 것이다.
도 13은 본 발명의 일 실시예에 따른 성숙 miRNA와 시료의 유사성을 계층적 군집화 분석한 것이다.
본 발명의 일 양상은 상기 ‘알츠하이머병 조기진단용 miRNA군’ 선택된 1종 이상의 miRNA 발현 수준을 측정하는 제제를 포함하는 알츠하이머병 진단용 조성물을 제공한다.
본 발명에서 사용된 "알츠하이머병"은 뇌 병리 소견으로 베타 아밀로이드의 침착과 관련한 신경반(neuritic plaque), 신경섬유 다발(neurofibrillary tangle) 등이 관찰되며, 육안으로는 신경세포 소실에 의한 전반적인 뇌 위축 소견을 보이는 퇴행성 뇌질환을 의미한다. 초기에 기억력 저하가 주로 나타나다가 진행됨에 따라 인지기능 저하뿐만 아니라 성격변화, 초조행동, 우울증, 망상, 환각, 공격성 증가, 수면 장애 등의 정신행동 증상이 동반되며 심해진다.
본 발명에서는 알츠하이머병 진단을 위한 바이오마커로써 miRNA를 이용할 수 있다. 여기서 바이오마커(biomarker)란 일반적으로 생물학적 시료에서 검출 가능한 물질로서 생체 변화를 알아낼 수 있는 폴리펩티드, 단백질, 핵산, 유전자, 지질, 당지질, 당단백질, 당 등과 같은 유기 생체 분자들을 모두 포함한다.
본 발명에서 사용된 "miRNA"는 마이크로 RNA(micro RNA)라고도 하며, 표적 RNA의 분해를 촉진시키거나 또는 그들의 번역을 억제시킴으로써 유전자 발현을 전사 후에 조절하는 21 내지 23개의 비암호화(non-coding) RNA를 의미한다. 일반적으로 miRNA는 pre-miRNA라 불리는 헤어핀(hairpin) 구조를 가지는 약 70 ~ 80 nt (nucleotide) 길이의 전구체로 전사된 후 RNAse III 효소인 Dicer에 의해 잘려 성숙된 형태로 생성된다. 30% 이상의 인간 miRNA는 클러스터로 존재하며, 하나의 전구체로 전사된 후 절단과정을 거쳐 최종 성숙 miRNA(mature miRNA)가 형성된다.
이러한 miRNA는 차세대 염기서열분석(next-generation sequencing, NGS)을 통해 확인된 알츠하이머병 환자에서 특이적인 발현 수준 변화를 보이는 특정 miRNA로 구성되며, 알츠하이머병 진단을 위한 바이오마커로 제시될 수 있다.
상기 NGS는 수십만 개의 반응을 동시에 수행하는 다중화(multiplexing) 능력이 있으며, 적은 양의 샘플로도 시퀀싱이 가능하다. NGS는 상용화된 기술에 따라 구체적인 적용 기법이 다소 다르지만, 일반적으로 클론증폭(clonal amplification), 대량병렬 시퀀싱 및 Sanger 방법과 작용기전이 다른 새로운 염기서열결정법을 사용한다. 상용화 기술로는 2007년에 Roche가 출시한 454 GS 개량형 FLX model sequencer, 2006년에 Illumina가 출시한 Genome Analyzer HiSeq, 2007년에 Applied Biosystems가 출시한 SOLiD 등이 있다. 이러한 세 가지의 플랫폼은 공통적으로 복잡한 라이브러리 구축과 클로닝 과정을 버리고 클론증폭기술을 채택하였고, 한꺼번에 대량으로 처리할 수 있는 대량병렬방식(massively parallel sequencing) 기술을 택하였으며, 순환 시퀀싱(cyclic sequencing)을 통한 합성신호읽기(sequencing by synthesis)로 염기서열을 결정하여 번잡한 전기영동과정을 배제하였다. 또한 shotgun 방식을 사용하여 읽혀진 짧은 리드(read)를 컴퓨터로 배열하여 중복된 부분을 찾아 전체를 완성하는 알고리즘을 사용한다.
이러한 알츠하이머병 진단을 위한 64개의 miRNA는 기존에 확인된 miRNA뿐만 아니라 본 발명자들에 의해 miRNA로 처음 확인된 신규 miRNA를 포함한다.
상기 신규 miRNA는 기존 레퍼런스에 보고된 바 없는 것으로, Mature_99, Mature_141, Mature_163, Mature_167, Mature_184, Mature_258, Mature_385, Mature_649 및 Mature_776가 해당한다.
본 발명의 일 구체예에 따르면, 상기 Mature_99는 서열번호 1로 표시되는 것이고, 상기 Mature_141는 서열번호 2로 표시되는 것이고, 상기 Mature_163은 서열번호 3으로 표시되는 것이고, 상기 Mature_167는 서열번호 4로 표시되는 것이고, 상기 Mature_184는 서열번호 5로 표시되는 것이고, 상기 Mature_258는 서열번호 6으로 표시되는 것이고, 상기 Mature_385는 서열번호 7로 표시되는 것이고, 상기 Mature_649는 서열번호 8로 표시되는 것이고, 및 상기 Mature_776는 서열번호 9로 표시되는 것일 수 있다.
이러한 64개의 miRNA는 알츠하이머 진단을 위한 바이오마커로써 단독으로 사용되거나, 또는 2종 이상의 복수로 사용될 수 있다.
보다 구체적으로, 64개의 miRNA 중에서 보다 정확한 알츠하이머병 진단을 위해 통계적으로 유의성이 높은 발현 차이 (|fc| > 2 및/또는 p 값 < 0.01)를 가지는 miRNA 단독 또는 miRNA 조합을 이용하는 것이 바람직하다.
본 발명의 일 구체예에 따르면, 상기 miRNA는 hsa-miR-10393-5p, hsa-miR-10395-3p, hsa-miR-122-3p, hsa-miR-1296-3p, hsa-miR-136-3p, hsa-miR-29a-3p, hsa-miR-301b-5p, hsa-miR-3667-3p, hsa-miR-375-3p, hsa-miR-376b-5p, hsa-miR-376c-5p, hsa-miR-4467, hsa-miR-4485-5p, hsa-miR-4659b-5p, hsa-miR-490-5p, hsa-miR-497-5p, hsa-miR-642a-5p, hsa-miR-6809-5p, hsa-miR-7112-3p, hsa-miR-758-5p, Mature_99, Mature_141, Mature_163, Mature_167, Mature_184, Mature_258, Mature_385 및 Mature_649로 이루어진 군에서 선택된 1종 이상인 것일 수 있다.
또한, 본 발명의 일 구체예에 따르면, 상기 miRNA는 hsa-miR-10395-3p, hsa-miR-122-3p, hsa-miR-376b-5p, hsa-miR-376c-5p, hsa-miR-4485-5p, Mature_99, Mature_141, Mature_258 및 Mature_385로 이루어진 군에서 선택된 1종 이상인 것일 수 있다.
본 발명에 따른 miRNA는 생물학적 시료에서 그 발현 수준을 측정할 수 있다.
본 발명에서 사용된 "생물학적 시료"는 생체에서 유래되어 생체 변화를 알아낼 수 있는 핵산, 유전자, 펩티드, 아미노산, 단백질, 지질, 당, 당지질, 당단백질 등과 같은 유기 생체 분자들뿐만 아니라 세포, 조직을 포함하는 시료를 의미한다. 본 발명에서는 miRNA를 포함하는 시료라면 제한되지 않는다.
본 발명의 일 구체예에 따르면, 상기 생물학적 시료는 혈액, 혈장, 혈청, 림프액, 타액, 소변 및 조직으로 이루어진 군에서 선택된 1종 이상인 것일 수 있다.
상기 제제는 miRNA에 결합하는 물질일 수 있다.
본 발명의 일 구체예에 따르면, 상기 제제는 miRNA에 특이적으로 결합하는 프라이머, 프로브 및 안티센스 올리고뉴클레오티드로 이루어진 군에서 선택된 1종 이상인 것일 수 있다.
본 발명에서 사용된 "특이적으로 결합하는"이란 결합에 의해 표적 물질의 존재 여부를 검출할 수 있을 정도로 다른 물질에 비해 표적 물질에 대한 결합력이 뛰어남을 의미한다.
본 발명에서 사용된 "프라이머(primer)"는 짧은 자유 3 말단 수산화기를 가지는 핵산 서열로, 상보적인 주형(template)과 염기쌍을 형성할 수 있고 주형 가닥 복사를 위한 시작 지점으로 기능을 하는 단일 가닥 올리고뉴클레오티드(single strand oligonucleotide)를 의미한다. 상기 프라이머는 적절한 완충용액 및 온도에서 중합반응 (즉, DNA 중합효소 또는 역전사효소)을 위한 시약 및 상이한 4가지 뉴클레오사이드 트리포스페이트의 존재하에서 DNA 합성을 개시할 수 있다. 또한, 상기 프라이머는 7개 내지 50개의 뉴클레오티드 서열을 가진 센스(sense) 및 안티센스(antisense) 핵산으로 구성되며, DNA 합성의 개시점으로 작용하는 프라이머의 기본 성질을 변화시키지 않는 수준에서 15 ~ 30개의 뉴클레오티드 서열을 가질 수 있다.
본 발명에서 사용된 "프로브(probe)"는 자연의 또는 변형된 모노머(monomer) 또는 연쇄(linkages)의 선형 올리고머를 의미하며, 디옥시리보뉴클레오티드 및 리보뉴클레오티드를 포함하고, 표적 뉴클레오티드 서열에 특이적으로 혼성화할 수 있으며, 자연적으로 존재하거나 또는 인위적으로 합성된 것이다.
본 발명의 다른 양상은 전술한 알츠하이머병 진단용 조성물을 포함하는 알츠하이머병 진단용 키트를 제공한다.
본 발명에서 사용된 "알츠하이머병 진단용 키트"는 검사 대상자로부터 채취한 생물학적 시료를 통해 알츠하이머병 여부를 진단할 수 있는 물질을 의미하며, 이를 통해 알츠하이머병을 신속하고 정확하게 그리고 간편하게 진단할 수 있다. 본 발명에서는 알츠하이머병 진단용 키트가 miRNA 발현 수준을 측정할 수 있는 제제를 포함하며, 그 제제로서 프라이머 또는 프라이머 세트를 포함하는 것이 바람직하다.
본 발명의 일 구체예에 따르면, 상기 키트는 핵산 증폭용 시약을 더 포함하는 것일 수 있다.
상기 핵산 증폭용 시약은 당업계에 공지된 통상적인 PCR용 시약을 포함할 수 있으며, 일례로 뉴클레오시드 트리포스페이트, (디옥시)리보뉴클레아제 저해제, 내열성 중합효소 및 반응 완충액 등을 포함할 수 있으나, 이에 제한되지 않는다.
상기 뉴클레오시드 트리포스페이트는 퓨린(purine)계 또는 피리미딘(pyrimidine)계 뉴클리오시드가 리보스(ribose) 또는 디옥시리보스(deoxyribose)에 결합하여 세 개의 인산기와 결합된 분자를 의미하며, (디옥시)아데노신 트리포스페이트((deoxy)adenosine triphosphate, ATP 또는 dATP), (디옥시)구아노신 트리포스페이트((deoxy)guanosine triphosphate, GTP 또는 dGTP), (디옥시)사이티딘 트리포스페이트((deoxy)cytidine triphosphate, CTP 또는 dCTP) 및 (디옥시)티아미딘 트리포스페이트((deoxy)thymidine triphosphate, TTP 또는 dTTP)를 포함한다.
상기 반응 완충액은 Taq 중합효소 완충액, PCR 완충액 등일 수 있으며, 증폭 반응의 pH를 조절함으로써 증폭 반응의 하나 이상의 성분들의 안정성, 활성 및/또는 지속성(longevity)을 변화시키는 증폭 반응에 첨가되는 화합물이다. 이러한 반응 완충액은 효율적인 PCR 반응을 최적화하기 위한 첨가물질들을 더 포함할 수 있다.
본 발명의 일 구체예에 따르면, 상기 키트는 PCR, RT-PCR 키트, 실시간 PCR 키트 및 마이크로어레이 칩 키트로 이루어진 군에서 선택된 1종 이상인 것일 수 있다.
본 발명의 일 구체예에 따르면, 상기 키트는 핵산 분리용 시약을 더 포함하는 것일 수 있다.
상기 핵산 분리용 시약은 당업계에 공지된 통상적인 RNA 또는 miRNA 추출용 시약으로, 세포 용해(lysis)가 가능한 염, 계면활성제, 금속 이온, 당, 환원제 (예, DTT) 등을 포함할 수 있다.
본 발명에 따른 키트는 통상적인 유전자 정량 분석에 기반한 진단 키트를 제한 없이 포함할 수 있다.
예를 들면, 상기 키트가 PCR 증폭 과정에 적용되는 경우, 본 발명의 키트는 선택적으로 PCR 증폭에 필요한 시약, 예컨대, 완충액, DNA 중합효소, DNA 중합 효소 보조인자 및 dNTPs를 포함할 수 있다. 또한, 본 발명에 따른 키트는 상기한 시약 성분을 포함하는 다수의 별도 패키징 또는 컴파트먼트로 제작될 수 있으며, 본 발명의 키트는 DNA 또는 RNA 칩을 수행하기 위해 필요한 필수 요소를 포함하는 진단용 키트일 수 있다.
본 발명의 다른 양상은 a) 진단이 필요한 개체로부터 생물학적 시료를 채취하는 단계; b) 상기 생물학적 시료에서 상기 ‘알츠하이머병 조기진단용 miRNA군’ 선택된 1종 이상의 miRNA 발현 수준을 측정하는 단계; 및 c) 상기 측정된 miRNA 발현 수준을 대조군과 비교하는 단계를 포함하는 알츠하이머병 진단을 위한 정보의 제공 방법을 제공한다.
상기 a) 내지 c) 단계에 대해 다음에서 자세히 살펴보며, 전술한 내용과 공통된 내용은 과도한 복잡성을 회피하기 위하여 그 기재를 생략한다.
상기 a) 단계는 알츠하이머병 여부에 대한 검사가 필요한 대상자로부터 생물학적 시료를 채취하는 과정이다.
본 발명의 일 구체예에 따르면, 상기 a) 단계의 생물학적 시료는 혈액, 혈장, 혈청, 림프액, 타액, 소변 및 조직으로 이루어진 군에서 선택된 1종 이상인 것일 수 있다.
상기 b) 단계는 생물학적 시료에서 바이오마커 miRNA의 존재 여부와 함께 발현 수준을 측정하는 과정이다.
본 발명의 일 구체예에 따르면, 상기 b) 단계의 miRNA는 hsa-miR-10393-5p, hsa-miR-10395-3p, hsa-miR-122-3p, hsa-miR-1296-3p, hsa-miR-136-3p, hsa-miR-29a-3p, hsa-miR-301b-5p, hsa-miR-3667-3p, hsa-miR-375-3p, hsa-miR-376b-5p, hsa-miR-376c-5p, hsa-miR-4467, hsa-miR-4485-5p, hsa-miR-4659b-5p, hsa-miR-490-5p, hsa-miR-497-5p, hsa-miR-642a-5p, hsa-miR-6809-5p, hsa-miR-7112-3p, hsa-miR-758-5p, Mature_99, Mature_141, Mature_163, Mature_167, Mature_184, Mature_258, Mature_385 및 Mature_649로 이루어진 군에서 선택된 1종 이상인 것일 수 있다.
또한, 본 발명의 일 구체예에 따르면, 상기 b) 단계의 miRNA는 hsa-miR-10395-3p, hsa-miR-122-3p, hsa-miR-376b-5p, hsa-miR-376c-5p, hsa-miR-4485-5p, Mature_99, Mature_141, Mature_258 및 Mature_385로 이루어진 군에서 선택된 1종 이상인 것일 수 있다.
본 발명의 일 구체예에 따르면, 상기 b) 단계의 miRNA 발현 수준은 중합효소 연쇄반응(PCR), 역전사 중합효소 연쇄반응(RT-PCR), 경쟁적 RT-PCR, 실시간 RT-PCR, 핵산분해효소 보호 분석(nuclease protection assay), in situ 교잡법, 마이크로어레이 및 노던 블롯으로 이루어진 군에서 선택된 1종 이상의 방법으로 측정되는 것일 수 있다.
이러한 miRNA 발현 수준은 전술한 본 발명에 따른 알츠하이머병 진단용 조성물 또는 키트를 이용하는 것이 바람직하다.
상기 c) 단계는 생물학적 시료에서 측정된 miRNA 발현량을 대조군과 비교하여 알츠하이머병 여부를 판단하는 과정이다.
본 발명의 일 구체예에 따르면, 상기 대조군은 정상인 또는 알츠하이머병이 의심되는 증상이 없거나 알츠하이머병을 진단받지 않은 개체, 또는 이로부터 수득한 시료인 것일 수 있다.
본 발명의 일 구체예에 따르면, 상기 c) 단계는 개체에서 hsa-miR-1-3p, hsa-miR-10393-5p, hsa-miR-122-3p, hsa-miR-1233-5p, hsa-miR-136-3p, hsa-miR-136-5p, hsa-miR-15a-5p, hsa-miR-323b-3p, hsa-miR-329-3p, hsa-miR-3667-3p, hsa-miR-375-3p, hsa-miR-376a-2-5p, hsa-miR-376a-3p, hsa-miR-376b-5p, hsa-miR-376c-5p, hsa-miR-3920, hsa-miR-410-3p, hsa-miR-4467, hsa-miR-4485-5p, hsa-miR-494-3p, hsa-miR-5582-3p, hsa-miR-6809-5p, hsa-miR-6825-5p, hsa-miR-6842-5p, hsa-miR-6858-3p, hsa-miR-7112-3p, hsa-miR-758-5p, Mature_99, Mature_141, Mature_163, Mature_167, Mature_184, Mature_258, Mature_385, Mature_649 및 Mature_776로 이루어진 군에서 선택된 1종 이상의 miRNA 발현 수준이 대조군에 비해 높은 경우 알츠하이머병으로 진단하는 것일 수 있다.
또한, 본 발명의 일 구체예에 따르면, 상기 c) 단계는 개체에서 hsa-miR-10395-3p, hsa-miR-1287-3p, hsa-miR-1287-5p, hsa-miR-1296-3p, hsa-miR-148a-5p, hsa-miR-188-3p, hsa-miR-199a-5p, hsa-miR-19b-2-5p, hsa-miR-214-3p, hsa-miR-27a-5p, hsa-miR-29a-3p, hsa-miR-301b-5p, hsa-miR-4301, hsa-miR-4436b-3p, hsa-miR-4645-3p, hsa-miR-4659b-5p, hsa-miR-4743-5p, hsa-miR-490-5p, hsa-miR-497-5p, hsa-miR-518e-5p, hsa-miR-519a-5p, hsa-miR-519b-5p, hsa-miR-519c-5p, hsa-miR-522-5p, hsa-miR-523-5p, hsa-miR-579-5p, hsa-miR-598-5p 및 hsa-miR-642a-5p로 이루어진 군에서 선택된 1종 이상의 miRNA 발현 수준이 대조군에 비해 낮은 경우 알츠하이머병으로 진단하는 것일 수 있다.
이하, 첨부된 도면을 참조하며 본 발명을 보다 상세하게 설명한다. 그러나, 이러한 설명은 본 발명의 이해를 돕기 위하여 예시적으로 제시된 것일 뿐, 본 발명의 범위가 이러한 예시적인 설명에 의하여 제한되는 것은 아니다.
실시예: 알츠하이머병 진단용 신규 바이오마커 발굴
1. 모집단 선정
2020년 4월부터 2021년 2월까지 MMSE를 포함한 알츠하이머병 검사를 받은 정상인(normal control, NC) 10명과 알츠하이머병 환자 (late-onset Alzheimer's disease, LOAD) 10명을 선정하여 모집단을 구성하였다 (표 1).
| 구분 | ID | 성별 | 연령 | MMSE |
| NC | 19 | 여 | 72 | 28 |
| 25 | 여 | 73 | 30 | |
| 77 | 여 | 73 | 29 | |
| 21 | 여 | 74 | 30 | |
| 7 | 여 | 75 | 28 | |
| 12 | 남 | 75 | 30 | |
| 30 | 여 | 76 | 30 | |
| 26 | 여 | 77 | 27 | |
| 39 | 남 | 79 | 18 | |
| 49 | 여 | 82 | 29 | |
| LOAD | 86 | 여 | 72 | 25 |
| 46 | 남 | 73 | 25 | |
| 56 | 여 | 73 | 21 | |
| 13 | 여 | 75 | 21 | |
| 48 | 남 | 75 | 29 | |
| 63 | 여 | 75 | 22 | |
| 41 | 여 | 76 | 23 | |
| 16 | 여 | 77 | 15 | |
| 17 | 남 | 79 | 23 | |
| 79 | 여 | 82 | 12 |
2. miNRA 서열분석 및 데이터 가공
정상인과 알츠하이머병 환자 간의 유전자 발현 패턴을 분석하기 위해 NGS 분 석을 실시하였다. 모집단에서 채취한 혈액 시료는 miRNA 서열분석 (Homo sapiens miRNA sequencing)을 위해 사용하였으며, ㈜마크로젠에 의뢰하였다. 간략하게 설명하면, PrimeScript 역전사효소(reverse transcriptase, RT) 및 SMARTer® smRNA-Seq Kit for Illumina® (TaKaRa)를 사용하여 혈액에 존재하는 RNA를 cDNA로 합성한 후 PCR 증폭을 수행하였다. 서열분석 후 데이터 가공을 위해 원본 서열 리드(raw sequence read)에 대해 품질을 평가하여 어댑터 시퀀스(adapter sequence)를 포함한 리드를 제외하였고, 트림 리드(trimmed read)와 어댑터 시퀀스가 없는 리드(non-adapter read) (≥ 50 bp)를 선택하였다 (도 1). 이후, 리드 길이, 서열 동일성(sequence identity) 등이 100% 일치하는 리드를 모아서 하나의 클러스터(cluster)를 형성한 후 불필요한 rRNA를 제거하여 miRNA 프로파일링에 사용하였다. 대부분의 rRNA를 제거하고 남은 RNA는 18 ~ 100 nt의 짧은(short) RNA이며, 47 bp의 트림 리드 및 20 ~ 25 nt의 성숙 miRNA를 포함하였다.
3. miRNA 프로파일링
miRNA 분석 소프트웨어 miRDeep2를 사용하여 가공 데이터로부터 신규 miRNA를 예측하였다. 먼저, 레퍼런스 게놈(reference genome) miRBase v22.1 (human miRNA 2,656개)와 비암호화 RNA 데이터베이스(non-coding RNA database) RNAcentral 14.0를 순차적으로 사용하여 종래 알려진 miRNA와 tRNA, snRNA, snoRNA 등 다른 RNA를 분류하였다 (도 2). 이후, 레퍼런스 Homo sapiens GRCh3를 사용하여 기존에 보고된 바 없는 miRNA를 신규 miRNA로 판단하였다.
4. 차등 발현 miRNA 분석 결과
NC 그룹 (n = 10) 및 LOAD 그룹 (n = 10)에서 시료들 간의 차등 발현 miRNA 분석을 수행하였다. 차등 발현 miRNA 분석에서는 miRDeep2 Quantifier module에서 얻은 성숙 miRNA 리드 수를 원본 데이터(raw data)로 사용하였다.
먼저, 데이터 전처리 과정으로 데이터 품질 및 유사성 검사를 수행하였다. 총 3,473개의 성숙 miRNA (원본 데이터) 중 273개가 전체 시료 20개에서 공통적으로 관찰된 반면, 1,068개가 전체 시료에서 전혀 관찰되지 않았다. 전체 시료 수의 절반이 넘는 10개 이상의 시료에서 공통적으로 관찰되는 성숙 miRNA 895개 (가공 데이터)를 분석에 이용하였다 (도 3). 이후, 데이터의 체계적인 편향(systematic bias)을 줄이기 위해 데이터 변환 및 정규화를 수행하였다. calcNormFactors 방법으로 원본 데이터의 리드 크기를 추정하여 리드 수를 리드 백만개당 개수(counts per million read, CPM)로 로그 변환하였으며, 이를 TMM(Trimmed mean of M-values) 방법으로 정규화하였다 (도 4). 여기서 음(-)의 값을 방지하기 위해 CPM 또는 정규화된 리드 수에 1을 더하였다. 그리고 원본 데이터, 로그 변환 및 TMM 정규화를 시각화하여 시료당 발현 밀도를 나타내었다 (도 5). 각 시료들 간의 연관성 분석을 위해 각 시료에 대한 정규 값(normalized value)의 피어슨 상관계수(Pearson's coefficient, r)를 이용하여 각 시료들 간의 유사도(similarity)를 파악하였다. 상관계수(r)는 약 0.7 내지 1.0의 범위로 나타났다 (도 6). 이어서 계층적 군집화 분석(Hierarchical clustering analysis)에서는 각 시료의 정규 값을 이용하여 높은 발현 유사성을 가지는 시료들을 그룹화하였다 (도 7). 여기서 거리 척도(Distance metric)로는 유클리드 거리(Euclidean distance)를, 연결법(Linkage method)으로는 완전 연결(Complete Linkage)을 사용하였다. 전체 데이터의 변동성을 나타내기 위해 다차원 척도 분석(multidimensional scaling analysis)을 통해 각 시료의 정규 값을 이용하여 시료들 간의 유사성을 2차원 그래프로 나타내었다 (도 8). 그래프에서는 이상점(outlier)을 갖는 샘플 유무 및 그룹 간 발현 패턴 유사성을 확인할 수 있었다.
이후, 성숙 miRNA 895개에 대해 통계 분석 (fold change 및 exactTest)을 수행하여 NC 그룹과 LOAD 그룹 간의 상향 및 하향조절된 성숙 miRNA를 확인하였다. 895개 중 배수 변화(fold change, fc)에 의해 발현 차이를 보인 성숙 miRNA는 114개였으며 (도 9), 배수 변화와 함께 p 값에 의해 유의미한 발현 차이를 보인 성숙 miRNA는 65개였다 (도 10). |fc| ≥ 2 및 exactTest 초기 p 값 < 0.05의 조건을 만족하는 64개의 성숙 miRNA를 핵심 데이터(significant data)로 선택하였다 (표 2). NC 그룹과 LOAD 그룹 간의 비교하여 배수 변화와 p 값을 로그 변환하였다 (도 11). 또한 전체 평균 발현 수준에 따라 NC 그룹에 비해 발현 차이가 큰 miRNA를 확인하기 위해 산점도로 나타내었다 (도 12). 예를 들면, 성숙 miRNA가 배수 변화에서 2배 이상의 차이가 있더라도 평균 logCPM보다 높은 경우 더 신뢰성이 있다고 할 수 있다. 이를 종합하여, 핵심 데이터의 발현 수준 (정규 값)에 따라 성숙 miRNA와 시료의 유사성을 군집화하여 계층적 군집화 분석으로 나타내었다 (도 13).
| fold change > 2 |
p-value < 0.05 |
fold change > 2 |
p-value < 0.05 |
||
| hsa-miR-1-3p | 2.463 | 0.0401 | hsa-miR-4485-5p | 10.264 | 0.0017 |
| hsa-miR-10393-5p | 3.291 | 0.0332 | hsa-miR-4645-3p | -2.182 | 0.0170 |
| hsa-miR-10395-3p | -14.515 | 0.0003 | hsa-miR-4659b-5p | -2.242 | 0.0374 |
| hsa-miR-122-3p | 3.431 | 0.0090 | hsa-miR-4743-5p | -2.815 | 0.0460 |
| hsa-miR-1233-5p | 2.981 | 0.0301 | hsa-miR-490-5p | -3.147 | 0.0389 |
| hsa-miR-1287-3p | -2.333 | 0.0174 | hsa-miR-494-3p | 2.080 | 0.0398 |
| hsa-miR-1287-5p | -2.073 | 0.0272 | hsa-miR-497-5p | -2.272 | 0.0096 |
| hsa-miR-1296-3p | -3.776 | 0.0405 | hsa-miR-518e-5p | -2.789 | 0.0112 |
| hsa-miR-136-3p | 2.228 | 0.0091 | hsa-miR-519a-5p | -2.789 | 0.0111 |
| hsa-miR-136-5p | 2.172 | 0.0420 | hsa-miR-519b-5p | -2.794 | 0.0113 |
| hsa-miR-148a-5p | -2.612 | 0.0420 | hsa-miR-519c-5p | -2.794 | 0.0113 |
| hsa-miR-15a-5p | 2.054 | 0.0406 | hsa-miR-522-5p | -2.793 | 0.0113 |
| hsa-miR-188-3p | -2.179 | 0.0334 | hsa-miR-523-5p | -2.793 | 0.0113 |
| hsa-miR-199a-5p | -2.193 | 0.0175 | hsa-miR-5582-3p | 2.796 | 0.0344 |
| hsa-miR-19b-2-5p | -2.897 | 0.0309 | hsa-miR-579-5p | -2.015 | 0.0409 |
| hsa-miR-214-3p | -2.149 | 0.0162 | hsa-miR-598-5p | -2.665 | 0.0343 |
| hsa-miR-27a-5p | -2.075 | 0.0166 | hsa-miR-642a-5p | -3.195 | 0.0370 |
| hsa-miR-29a-3p | -2.971 | 0.0004 | hsa-miR-6809-5p | 2.674 | 0.0080 |
| hsa-miR-301b-5p | -2.559 | 0.0037 | hsa-miR-6825-5p | 2.395 | 0.0448 |
| hsa-miR-323b-3p | 2.119 | 0.0281 | hsa-miR-6842-5p | 2.297 | 0.0130 |
| hsa-miR-329-3p | 2.031 | 0.0382 | hsa-miR-6858-3p | 2.983 | 0.0316 |
| hsa-miR-3667-3p | 3.060 | 0.0250 | hsa-miR-7112-3p | 3.327 | 0.0243 |
| hsa-miR-375-3p | 3.218 | 0.0226 | hsa-miR-758-5p | 4.532 | 0.0147 |
| hsa-miR-376a-2-5p | 2.432 | 0.0256 | Mature_99 | 4.733 | 0.0089 |
| hsa-miR-376a-3p | 2.051 | 0.0252 | Mature_141 | 14.250 | 0.0011 |
| hsa-miR-376b-5p | 3.295 | 0.0036 | Mature_163 | 6.791 | 0.0306 |
| hsa-miR-376c-5p | 3.145 | 0.0033 | Mature_167 | 3.024 | 0.0317 |
| hsa-miR-3920 | 2.458 | 0.0211 | Mature_184 | 4.433 | 0.0421 |
| hsa-miR-410-3p | 2.165 | 0.0384 | Mature_258 | 5.417 | 0.0071 |
| hsa-miR-4301 | -2.469 | 0.0437 | Mature_385 | 23.504 | 0.0001 |
| hsa-miR-4436b-3p | -2.068 | 0.0219 | Mature_649 | 3.799 | 0.0234 |
| hsa-miR-4467 | 3.133 | 0.0462 | Mature_776 | 2.468 | 0.0248 |
| * hsa-miR는 레퍼런스에 보고된 성숙 miRNA이며, Mature는 신규 miRNA로 예측되는 서열임 | |||||
상기 표 2는 핵심 데이터에 해당하는 성숙 miRNA 64개를 나타낸 것으로, 기존에 보고된 성숙 miRNA 55개와 이번 서열분석에서 처음 확인된 신규 성숙 miRNA 9개를 포함한다. 이러한 miRNA는 알츠하이머병 진단을 위한 후보 바이오마커로 선정되었다.
신규 성숙 miRNA 9개의 서열은 하기 표 3에 나타내었다
| 신규 성숙 miRNA | 염기서열 (5'-3') | 서열번호 |
| Mature_99 | TTGTTTTTGGGGTTTGGCAG | 1 |
| Mature_141 | AGGATGAGACTCCGTCAC | 2 |
| Mature_163 | CTCAGGCTACACCCTAGACC | 3 |
| Mature_167 | GGGGGGAGGGGGGAAAAAGG | 4 |
| Mature_184 | CATGGAGGCCATGGGGTGG | 5 |
| Mature_258 | ACTGAAGAATGGAGAGAG | 6 |
| Mature_385 | GGAGGCCATGGGGTTGGGG | 7 |
| Mature_649 | CATGGAGGCCATGGGGTCA | 8 |
| Mature_776 | AGAGCGAGACCCCGTCTCTT | 9 |
그리고 하기 표 4에서와 같이 64개의 miRNA 중 NC 그룹 대비 발현 수준의 배수 변화(fc)가 3배를 초과하거나 p 값이 0.01 미만 (fc > 3 또는 p < 0.01)인 28개의 miRNA를 알츠하이머병 진단용 바이오마커로 선택하였으며, 이들 중 상기 조건을 모두 만족하는 9개의 miRNA (fc > 3 및 p < 0.01)가 알츠하이머병 진단의 정확도 및 신뢰도를 향상시킬 것으로 예상할 수 있다.
| fold change > 3 |
p-value < 0.01 |
|
| hsa-miR-10393-5p | O | - |
| hsa-miR-10395-3p | O | O |
| hsa-miR-122-3p | O | O |
| hsa-miR-1296-3p | O | - |
| hsa-miR-136-3p | - | O |
| hsa-miR-29a-3p | - | O |
| hsa-miR-301b-5p | - | O |
| hsa-miR-3667-3p | O | - |
| hsa-miR-375-3p | O | - |
| hsa-miR-376b-5p | O | O |
| hsa-miR-376c-5p | O | O |
| hsa-miR-4467 | O | - |
| hsa-miR-4485-5p | O | O |
| hsa-miR-4659b-5p | - | O |
| hsa-miR-490-5p | O | - |
| hsa-miR-497-5p | - | O |
| hsa-miR-642a-5p | O | - |
| hsa-miR-6809-5p | - | O |
| hsa-miR-7112-3p | O | - |
| hsa-miR-758-5p | O | - |
| Mature_99 | O | O |
| Mature_141 | O | O |
| Mature_163 | O | - |
| Mature_167 | O | - |
| Mature_184 | O | - |
| Mature_258 | O | O |
| Mature_385 | O | O |
| Mature_649 | O | - |
이제까지 본 발명에 대하여 그 바람직한 실시예들을 중심으로 살펴보았다. 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자는 본 발명이 본 발명의 본질적인 특성에서 벗어나지 않는 범위에서 변형된 형태로 구현될 수 있음을 이해할 수 있을 것이다. 그러므로 개시된 실시예들은 한정적인 관점이 아니라 설명적인 관점에서 고려되어야 한다. 본 발명의 범위는 전술한 설명이 아니라 특허청구범위에 나타나 있으며, 그와 동등한 범위 내에 있는 모든 차이점은 본 발명에 포함된 것으로 해석되어야 할 것이다.
본 발명에서는 알츠하이머병을 예측할 수 있는 신규 바이오마커를 제시함으로써 알츠하이머병 진단용 조성물 및 키트를 제공하여 알츠하이머병 환자를 신속하고 정확하게 진단할 수 있으며, 알츠하이머병 환자에게 적절한 치료법을 제공할 수 있다.
서열목록 전자파일 첨부
Claims (12)
- hsa-miR-1-3p, hsa-miR-10393-5p, hsa-miR-10395-3p, hsa-miR-122-3p, hsa-miR-1233-5p, hsa-miR-1287-3p, hsa-miR-1287-5p, hsa-miR-1296-3p, hsa-miR-136-3p, hsa-miR-136-5p, hsa-miR-148a-5p, hsa-miR-15a-5p, hsa-miR-188-3p, hsa-miR-199a-5p, hsa-miR-19b-2-5p, hsa-miR-214-3p, hsa-miR-27a-5p, hsa-miR-29a-3p, hsa-miR-301b-5p, hsa-miR-323b-3p, hsa-miR-329-3p, hsa-miR-3667-3p, hsa-miR-375-3p, hsa-miR-376a-2-5p, hsa-miR-376a-3p, hsa-miR-376b-5p, hsa-miR-376c-5p, hsa-miR-3920, hsa-miR-410-3p, hsa-miR-4301, hsa-miR-4436b-3p, hsa-miR-4467, hsa-miR-4485-5p, hsa-miR-4645-3p, hsa-miR-4659b-5p, hsa-miR-4743-5p, hsa-miR-490-5p, hsa-miR-494-3p, hsa-miR-497-5p, hsa-miR-518e-5p, hsa-miR-519a-5p, hsa-miR-519b-5p, hsa-miR-519c-5p, hsa-miR-522-5p, hsa-miR-523-5p, hsa-miR-5582-3p, hsa-miR-579-5p, hsa-miR-598-5p, hsa-miR-642a-5p, hsa-miR-6809-5p, hsa-miR-6825-5p, hsa-miR-6842-5p, hsa-miR-6858-3p, hsa-miR-7112-3p, hsa-miR-758-5p, Mature_99, Mature_141, Mature_163, Mature_167, Mature_184, Mature_258, Mature_385, Mature_649 및 Mature_776로 이루어진 군에서 선택된 1종 이상의 miRNA 발현 수준을 측정하는 제제를 포함하는 알츠하이머병 진단용 조성물.
- 청구항 1에 있어서,상기 Mature_99는 서열번호 1로 표시되는 것이고, 상기 Mature_141는 서열번호 2로 표시되는 것이고, 상기 Mature_163은 서열번호 3으로 표시되는 것이고, 상기 Mature_167는 서열번호 4로 표시되는 것이고, 상기 Mature_184는 서열번호 5로 표시되는 것이고, 상기 Mature_258는 서열번호 6으로 표시되는 것이고, 상기 Mature_385는 서열번호 7로 표시되는 것이고, 상기 Mature_649는 서열번호 8로 표시되는 것이고, 및 상기 Mature_776는 서열번호 9로 표시되는 것인 조성물.
- 청구항 1에 있어서,상기 miRNA는 hsa-miR-10393-5p, hsa-miR-10395-3p, hsa-miR-122-3p, hsa-miR-1296-3p, hsa-miR-136-3p, hsa-miR-29a-3p, hsa-miR-301b-5p, hsa-miR-3667-3p, hsa-miR-375-3p, hsa-miR-376b-5p, hsa-miR-376c-5p, hsa-miR-4467, hsa-miR-4485-5p, hsa-miR-4659b-5p, hsa-miR-490-5p, hsa-miR-497-5p, hsa-miR-642a-5p, hsa-miR-6809-5p, hsa-miR-7112-3p, hsa-miR-758-5p, Mature_99, Mature_141, Mature_163, Mature_167, Mature_184, Mature_258, Mature_385 및 Mature_649로 이루어진 군에서 선택된 1종 이상인 것인 조성물.
- 청구항 1에 있어서,상기 miRNA는 hsa-miR-10395-3p, hsa-miR-122-3p, hsa-miR-376b-5p, hsa-miR-376c-5p, hsa-miR-4485-5p, Mature_99, Mature_141, Mature_258 및 Mature_385로 이루어진 군에서 선택된 1종 이상인 것인 조성물.
- 청구항 1에 있어서,상기 제제는 miRNA에 특이적으로 결합하는 프라이머, 프로브 및 안티센스 올리고뉴클레오티드로 이루어진 군에서 선택된 1종 이상인 것인 조성물.
- 청구항 1 내지 5 중 어느 한 항의 조성물을 포함하는 알츠하이머병 진단용 키트.
- 청구항 6에 있어서,상기 키트는 핵산 증폭용 시약을 더 포함하는 것인 키트.
- a) 진단이 필요한 개체로부터 생물학적 시료를 채취하는 단계;b) 상기 생물학적 시료에서 hsa-miR-1-3p, hsa-miR-10393-5p, hsa-miR-10395-3p, hsa-miR-122-3p, hsa-miR-1233-5p, hsa-miR-1287-3p, hsa-miR-1287-5p, hsa-miR-1296-3p, hsa-miR-136-3p, hsa-miR-136-5p, hsa-miR-148a-5p, hsa-miR-15a-5p, hsa-miR-188-3p, hsa-miR-199a-5p, hsa-miR-19b-2-5p, hsa-miR-214-3p, hsa-miR-27a-5p, hsa-miR-29a-3p, hsa-miR-301b-5p, hsa-miR-323b-3p, hsa-miR-329-3p, hsa-miR-3667-3p, hsa-miR-375-3p, hsa-miR-376a-2-5p, hsa-miR-376a-3p, hsa-miR-376b-5p, hsa-miR-376c-5p, hsa-miR-3920, hsa-miR-410-3p, hsa-miR-4301, hsa-miR-4436b-3p, hsa-miR-4467, hsa-miR-4485-5p, hsa-miR-4645-3p, hsa-miR-4659b-5p, hsa-miR-4743-5p, hsa-miR-490-5p, hsa-miR-494-3p, hsa-miR-497-5p, hsa-miR-518e-5p, hsa-miR-519a-5p, hsa-miR-519b-5p, hsa-miR-519c-5p, hsa-miR-522-5p, hsa-miR-523-5p, hsa-miR-5582-3p, hsa-miR-579-5p, hsa-miR-598-5p, hsa-miR-642a-5p, hsa-miR-6809-5p, hsa-miR-6825-5p, hsa-miR-6842-5p, hsa-miR-6858-3p, hsa-miR-7112-3p, hsa-miR-758-5p, Mature_99, Mature_141, Mature_163, Mature_167, Mature_184, Mature_258, Mature_385, Mature_649 및 Mature_776로 이루어진 군에서 선택된 1종 이상의 miRNA 발현 수준을 측정하는 단계; 및c) 상기 측정된 miRNA 발현 수준을 대조군과 비교하는 단계를 포함하는 알츠하이머병 진단을 위한 정보의 제공 방법.
- 청구항 8에 있어서,상기 a) 단계의 생물학적 시료는 혈액, 혈장, 혈청, 림프액, 타액, 소변 및 조직으로 이루어진 군에서 선택된 1종 이상인 것인 방법.
- 청구항 8에 있어서,상기 b) 단계의 miRNA 발현 수준은 중합효소 연쇄반응(PCR), 역전사 중합효소 연쇄반응(RT-PCR), 경쟁적 RT-PCR, 실시간 RT-PCR, 핵산분해효소 보호 분석(nuclease protection assay), in situ 교잡법, 마이크로어레이 및 노던 블롯으로 이루어진 군에서 선택된 1종 이상의 방법으로 측정되는 것인 방법.
- 청구항 8에 있어서,상기 c) 단계는 개체에서 hsa-miR-1-3p, hsa-miR-10393-5p, hsa-miR-122-3p, hsa-miR-1233-5p, hsa-miR-136-3p, hsa-miR-136-5p, hsa-miR-15a-5p, hsa-miR-323b-3p, hsa-miR-329-3p, hsa-miR-3667-3p, hsa-miR-375-3p, hsa-miR-376a-2-5p, hsa-miR-376a-3p, hsa-miR-376b-5p, hsa-miR-376c-5p, hsa-miR-3920, hsa-miR-410-3p, hsa-miR-4467, hsa-miR-4485-5p, hsa-miR-494-3p, hsa-miR-5582-3p, hsa-miR-6809-5p, hsa-miR-6825-5p, hsa-miR-6842-5p, hsa-miR-6858-3p, hsa-miR-7112-3p, hsa-miR-758-5p, Mature_99, Mature_141, Mature_163, Mature_167, Mature_184, Mature_258, Mature_385, Mature_649 및 Mature_776로 이루어진 군에서 선택된 1종 이상의 miRNA 발현 수준이 대조군에 비해 높은 경우 알츠하이머병으로 진단하는 것인 방법.
- 청구항 8에 있어서,상기 c) 단계는 개체에서 hsa-miR-10395-3p, hsa-miR-1287-3p, hsa-miR-1287-5p, hsa-miR-1296-3p, hsa-miR-148a-5p, hsa-miR-188-3p, hsa-miR-199a-5p, hsa-miR-19b-2-5p, hsa-miR-214-3p, hsa-miR-27a-5p, hsa-miR-29a-3p, hsa-miR-301b-5p, hsa-miR-4301, hsa-miR-4436b-3p, hsa-miR-4645-3p, hsa-miR-4659b-5p, hsa-miR-4743-5p, hsa-miR-490-5p, hsa-miR-497-5p, hsa-miR-518e-5p, hsa-miR-519a-5p, hsa-miR-519b-5p, hsa-miR-519c-5p, hsa-miR-522-5p, hsa-miR-523-5p, hsa-miR-579-5p, hsa-miR-598-5p 및 hsa-miR-642a-5p로 이루어진 군에서 선택된 1종 이상의 miRNA 발현 수준이 대조군에 비해 낮은 경우 알츠하이머병으로 진단하는 것인 방법.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020220009470A KR102779900B1 (ko) | 2022-01-21 | 2022-01-21 | 알츠하이머 조기진단용 바이오마커와 이의 용도 |
| KR10-2022-0009470 | 2022-01-21 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2023140652A1 true WO2023140652A1 (ko) | 2023-07-27 |
Family
ID=87348514
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2023/000954 Ceased WO2023140652A1 (ko) | 2022-01-21 | 2023-01-19 | 알츠하이머 조기진단용 바이오마커와 이의 용도 |
Country Status (2)
| Country | Link |
|---|---|
| KR (1) | KR102779900B1 (ko) |
| WO (1) | WO2023140652A1 (ko) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013055865A1 (en) * | 2011-10-11 | 2013-04-18 | The Brigham And Women's Hospital, Inc. | Micrornas in neurodegenerative disorders |
| JP2017184642A (ja) * | 2016-04-01 | 2017-10-12 | 株式会社ヘルシーパス | 認知症マーカー、それを用いた認知症の評価方法、評価試薬および評価キット |
| JP2021121187A (ja) * | 2018-08-30 | 2021-08-26 | 台湾基督長老教会馬偕医療財団法人馬偕紀念医院 | 細胞外小胞による疾患の診断方法 |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR102699674B1 (ko) | 2016-12-12 | 2024-08-26 | 건국대학교 글로컬산학협력단 | 신경퇴행성질환 진단용 신규 바이오 마커 gcn5 및 이의 용도 |
| KR20200097636A (ko) | 2019-02-08 | 2020-08-19 | 아주대학교산학협력단 | 퇴행성 뇌질환 진단용 바이오마커 조성물 |
| KR102691806B1 (ko) * | 2020-04-23 | 2024-08-06 | 주식회사 바이오오케스트라 | 상향조절된 mirna의 진단 및 치료를 위한 용도 |
-
2022
- 2022-01-21 KR KR1020220009470A patent/KR102779900B1/ko active Active
-
2023
- 2023-01-19 WO PCT/KR2023/000954 patent/WO2023140652A1/ko not_active Ceased
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013055865A1 (en) * | 2011-10-11 | 2013-04-18 | The Brigham And Women's Hospital, Inc. | Micrornas in neurodegenerative disorders |
| JP2017184642A (ja) * | 2016-04-01 | 2017-10-12 | 株式会社ヘルシーパス | 認知症マーカー、それを用いた認知症の評価方法、評価試薬および評価キット |
| JP2021121187A (ja) * | 2018-08-30 | 2021-08-26 | 台湾基督長老教会馬偕医療財団法人馬偕紀念医院 | 細胞外小胞による疾患の診断方法 |
Non-Patent Citations (2)
| Title |
|---|
| DATABASE NUCLEOTIDE 11 December 2019 (2019-12-11), ANONYMOUS : "Homo sapiens LNC_000421 lncRNA, complete sequence", XP093079209, retrieved from NCBI Database accession no. MN309058.1 * |
| LI QINGQIN S., CAI DIANA: "Integrated miRNA-Seq and mRNA-Seq Study to Identify miRNAs Associated With Alzheimer’s Disease Using Post-mortem Brain Tissue Samples", FRONTIERS IN NEUROSCIENCE, vol. 15, XP093079207, DOI: 10.3389/fnins.2021.620899 * |
Also Published As
| Publication number | Publication date |
|---|---|
| KR102779900B1 (ko) | 2025-03-12 |
| KR20230113048A (ko) | 2023-07-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2733219B1 (en) | Diagnostic miRNA markers for Alzheimer | |
| US10011873B2 (en) | Diagnostic miRNA markers for Parkinson disease | |
| EP3083986B1 (en) | Mirnas as non-invasive biomarkers for parkinson's disease | |
| CN111292804B (zh) | 一种借助高通量测序检测smn1基因突变的方法和系统 | |
| CN112553328B (zh) | 检测基因表达水平的产品及其在制备重度抑郁症诊断工具中的应用 | |
| US20250257392A1 (en) | Kit for determining endometrial status and method of determining mirna expression profile of endometrial sample | |
| WO2013103945A1 (en) | Composite assay for developmental disorders | |
| WO2023140653A1 (ko) | 알츠하이머병 진단용 바이오마커 및 이의 용도 | |
| WO2023140652A1 (ko) | 알츠하이머 조기진단용 바이오마커와 이의 용도 | |
| WO2022114887A1 (ko) | 통합전사체분석 기반 만성 간질환 진단용 복합마커 및 이의 용도 | |
| US20240327915A1 (en) | piRNA BIOMARKER USED FOR DIFFERENTIAL DIAGNOSIS OF PATIENTS WITH DIFFERENT SYMPTOMS AND DISEASE STATUS OF PARKINSON'S DISEASE | |
| KR20250016651A (ko) | 경도인지장애 환자의 신경병성 질환 조기진단용 바이오마커 | |
| KR102585879B1 (ko) | 피부 보습 진단용 단일염기다형성 마커 및 이의 용도 | |
| KR102940935B1 (ko) | 고인지예비능 생체표지자로서의 snp 및 이의 이용 | |
| KR102478811B1 (ko) | 멀티플렉스 pcr 플랫폼 기반의 알츠하이머 질환 진단을 위한 신규한 마커 조성물 및 이의 용도 | |
| US11655507B2 (en) | Method for diagnosing Parkinson's disease using nasal mucus, composition therefore, and kit comprising the same | |
| WO2023238973A1 (ko) | 전사체 분석을 이용한 인트론 유지 검출을 통해 퇴행성 뇌 질환을 진단하는 방법 | |
| WO2024049247A1 (ko) | 신규 파킨슨병 바이오마커 및 이의 용도 | |
| KR20240072348A (ko) | 폐암 진단용 바이오마커 및 이의 용도 | |
| WO2024151100A1 (ko) | 불안장애를 진단하기 위한 바이오마커 및 이의 용도 | |
| WO2025164902A1 (ko) | 알츠하이머병 발병 위험도 예측을 위한 레이 복잡도 복사 점수 저하와 관련이 있는 단일염기다형성 마커 및 이의 용도 | |
| WO2024128688A1 (ko) | 간질성방광염 진단 또는 예후 예측용 신규 바이오마커 및 이의 용도 | |
| KR20200056503A (ko) | 소음인 판별용 조성물 | |
| HK1230665B (en) | Mirnas as non-invasive biomarkers for parkinson's disease |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 23743496 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 23743496 Country of ref document: EP Kind code of ref document: A1 |