WO2023135299A1 - Nanoparticules solides oligonucléotidiques de nucléolipides pour lutter contre la résistance aux antibiotiques - Google Patents

Nanoparticules solides oligonucléotidiques de nucléolipides pour lutter contre la résistance aux antibiotiques Download PDF

Info

Publication number
WO2023135299A1
WO2023135299A1 PCT/EP2023/050876 EP2023050876W WO2023135299A1 WO 2023135299 A1 WO2023135299 A1 WO 2023135299A1 EP 2023050876 W EP2023050876 W EP 2023050876W WO 2023135299 A1 WO2023135299 A1 WO 2023135299A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleolipid
oligonucleotide
antibiotic
nanoparticle
ctx
Prior art date
Application number
PCT/EP2023/050876
Other languages
English (en)
Inventor
Tina KAUSS
Corinne ARPIN
Philippe Barthelemy
Original Assignee
INSERM (Institut National de la Santé et de la Recherche Médicale)
Centre National De La Recherche Scientifique
Universite de Bordeaux
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by INSERM (Institut National de la Santé et de la Recherche Médicale), Centre National De La Recherche Scientifique, Universite de Bordeaux filed Critical INSERM (Institut National de la Santé et de la Recherche Médicale)
Publication of WO2023135299A1 publication Critical patent/WO2023135299A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
    • A61K9/51—Nanocapsules; Nanoparticles
    • A61K9/5107—Excipients; Inactive ingredients
    • A61K9/5123—Organic compounds, e.g. fats, sugars
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/54—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one sulfur as the ring hetero atoms, e.g. sulthiame
    • A61K31/542—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one sulfur as the ring hetero atoms, e.g. sulthiame ortho- or peri-condensed with heterocyclic ring systems
    • A61K31/545—Compounds containing 5-thia-1-azabicyclo [4.2.0] octane ring systems, i.e. compounds containing a ring system of the formula:, e.g. cephalosporins, cefaclor, or cephalexine
    • A61K31/546—Compounds containing 5-thia-1-azabicyclo [4.2.0] octane ring systems, i.e. compounds containing a ring system of the formula:, e.g. cephalosporins, cefaclor, or cephalexine containing further heterocyclic rings, e.g. cephalothin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/10—Dispersions; Emulsions
    • A61K9/127—Liposomes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/32—Special delivery means, e.g. tissue-specific
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention concerns the treatment of bacterial infections while avoiding resistance of the bacteria to this antibacterial treatment.
  • Multidrug-resistant bacteria is a major public health concern (World Health Organization 2014). This situation is particularly critical among extended-spectrum B-lactamase (ESBL) producing Enterobacteriaceae (World Health Organization 2014; O’Neill 2016; Bevan, Jones, and Hawkey 2017), classified as one of three pathogens of critical priority for the need of new therapeutic strategies by World Health Organization (WHO 2017).
  • ESBL extended-spectrum B-lactamase
  • ESBL-producing Escherichia coli are resistant enterobacteria that inactivate most B-lactam antibiotics, the predominant antibiotic class used to treat bacterial infections in humans.
  • ESBL genes (b/a genes) are mainly disseminated among bacteria through conjugative plasmids which also carry other resistance genes, leading to a “multi” and even “pan-resistance”, defined as resistance to all known families of antibiotics and consequently to treatment failure (Bevan, Jones, and Hawkey 2017).
  • CTX-M refers to their potent p-lactam hydrolytic activity against cefotaxime (a reference third-generation cephalosporin, 3GC).
  • cefotaxime a reference third-generation cephalosporin, 3GC.
  • group 1 CTX-M enzymes CTX-M-15 (37.1%) and CTX-M-1 (24.2%) are the most prevalent (Arpin et al. 2009).
  • CTX-M P-lactamases can also deactivate ceftriaxone (CFX) (Bevan, Jones, and Hawkey 2017), an extended-spectrum 3GC approved for the treatment of patients with Gram-positive or Gram-negative infections (Karlowsky et al. 2002), which was used in the experimental part below as a model 3GC antibiotic.
  • CFX ceftriaxone
  • EMA Comitee for Medicinal Products for Human Use 2014
  • NP Antibiotic nanoparticles reportedly (Kalhapure et al. 2014; Kavruk et al. 2015) enhanced antibiotic effect via formation of a local reservoir close to bacteria cell wall (Zhang et al. 2010).
  • nucleolipids can be employed due to their potent properties in protecting the formulated drug and in enhancing its intracellular delivery. Indeed, nucleolipids have been shown to possess intrinsic molecular recognition and favorable cell-penetrating abilities (Naseri, Valizadeh, and Zakeri-Milani 2015).
  • DOTAll nucleolipid has already been used to successfully formulate solid lipid NP (Oumzil et al. 2016; Benizri et al. 2018) and has been selected for ion pairing and as a nanocarrier in this study.
  • oligonucleotides As antibacterial agents, either to target viable genes and hence kill the targeted bacteria, or to target resistance genes and decrease bacterial resistance.
  • PNA peptide nucleic acids
  • PTO phosphorothioate oligonucleotides
  • LNA locked nucleic acids
  • PMO phosphorodiamidate morpholinooligomers
  • PTO antisense oligonucleotides ASO
  • ASO PTO antisense oligonucleotides
  • MICs minimum inhibitory concentrations
  • PMO and PNA oligonucleotides have been shown efficient in partially restoring cefotaxime activity in ESBL E. coli (John B. Readman, Dickson, and Coldham 2016). Recently (Kauss et al.
  • oligonucleotide chemical modifications including cell penetrating peptide conjugation (John B. Readman, Dickson, and Coldham 2016; Sully et al. 2016; Sully and Geller 2016; Xue et al. 2018; Popella et al. 2021) or nucleolipid conjugates (Kauss et al. 2020) and nanodelivery using liposomes (Frank- Kamenetsky et al.
  • the present application pertains to a novel nanoformulation based on antibiotic-nucleolipids ion-pair nanoparticles which are functionalized by oligonucleotides.
  • the experimental part below illustrates the efficiency of such functionalized nanoparticles in decreasing the MIC of ESBL-producing E. coli.
  • the nanoformulation design combines simultaneously (i) a PTO oligonucleotide against b/acTx-M-15, (ii) ceftriaxone as a model 3GC antibiotic, associated with (iii) membrane penetration enhancing nucleolipid DOTAU as a carrier.
  • the present inventors have surprisingly found that such novel nanoformulation is effective in significantly decreasing the minimum inhibitory concentrations (MIC) of ESBL-producing E. coli and, as a consequence, in reducing the bacterial resistance to antibiotics.
  • the present invention pertains to an oligonucleotide solid nucleolipid nanoparticle comprising:
  • an antibiotic molecule preferably negatively charged at physiological pH
  • nucleolipid preferably positively charged at physiological pH
  • an antisense oligonucleotide targeting an mRNA encoding a protein responsible for bacterial resistance to the antibiotic recited in (i), wherein the antibiotic and the nucleolipid molecules form ion pair nanoparticle which is functionalized by the antisense oligonucleotide.
  • the antibiotic molecule is selected from the group consisting of 3 rd generation cephalosporins, 4 th generation cephalosporins and monobactams and the antisense oligonucleotide sequence specifically targets an mRNA encoding an extended spectrum p-lactamase (ESBL), for example a CTX-M extended spectrum p-lactamase, preferably a group 1 CTX-M extended spectrum p- lactamase such as the CTX-M-15 extended spectrum p-lactamase.
  • ESBL extended spectrum p-lactamase
  • nucleolipids which can be used to obtain oligonucleotide solid nucleolipid nanoparticle according to the invention can be selected from the group consisting of dioleylphosphatidylcholine (DOPC), dioleylphosphatidyluridine phosphatidylcholine (DOLIPC), 1 ,2-dioleyl-sn-glycero-3-phosphatidylethanolamine (DOPE), 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), N-[5'-(2',3'- dioleoyl)uridine]-N',N',N'-trimethylammonium tosylate (DOTAll), and derivatives thereof.
  • DOPC dioleylphosphatidylcholine
  • DOLIPC dioleylphosphatidyluridine phosphatidylcholine
  • DOPE 1,2-dioleyl-sn-glycero-3-phosphatidylethanolamine
  • Particular antisense oligonucleotides which can be used to obtain oligonucleotide solid nucleolipid nanoparticle according to the invention are DNA sequences of at least 19 nucleotides and no more than 25 nucleotides, preferably with a PTO backbone.
  • the present invention also pertains to the use of an oligonucleotide solid nucleolipid nanoparticle as defined above, for treating a bacterial infection.
  • Another aspect of the invention is a pharmaceutical composition
  • a pharmaceutical composition comprising an oligonucleotide solid nucleolipid nanoparticle as defined above, as well as a method of treating a bacterial infection in a subject in need thereof, comprising administering to said subject a therapeutically effective amount of an antisense oligonucleotide oligonucleotide solid nucleolipid nanoparticle as defined above.
  • a method for preparing an oligonucleotide solid nucleolipid nanoparticle as defined above is also part of the present invention. Such a method may comprise:
  • such a method comprises:
  • the present invention aims at fighting antimicrobial resistance, in particular antibiotic resistance.
  • antibiotic resistance is herein meant the phenomenon that a microorganism does not exhibit sufficiently decreased viability or inhibited growth or reproduction when exposed to concentrations of the antibiotic agent that can be attained with normal therapeutic dosage regimes in patients. It implies that an infection caused by this microorganism cannot be successfully treated with this antibiotic agent.
  • antibiotic refers to a compound which decreases the viability of a microorganism, or which inhibits the growth or reproduction of a microorganism.
  • a decrease of antibiotic resistance can be evidenced by measuring the Minimal Inhibitory Concentration (MIC) in a bacterial strain resistant to this antibiotic with of (i) the antibiotic as such and (ii) the oligonucleotide solid nucleolipid nanoparticle comprising the same antibiotic.
  • MIC Minimal Inhibitory Concentration
  • any charged antibiotic preferably any negatively-charged antibiotic
  • examples of such antibiotics broadly include P-lactam antibiotics, such as penicillin derivatives (penams), cephalosporins and cephamycins (cephems), monobactams, carbapenems and carbacephems. More specific examples of antibiotics which can be included in nanoparticles are ampicillin, penicillin G, penicillin V, amoxicilline, ... , as well as cephalosporins cited below.
  • the oligonucleotide solid nucleolipid nanoparticles, pharmaceutical compositions and kits of the invention aim at fighting bacterial resistance against 3 rd generation cephalosporin.
  • 3 rd generation cephalosporin is meant herein a p-lactam antibiotic, i.e. a compound with antibiotic properties containing a beta-lactam functionality, including but not limited to cefixime, ceftazidime, cefotaxime, ceftriaxone, cefcapene, cefdaloxime, cefdinir, cefditoren, cefetamet, cefmenoxime, cefodizime, cefoperazone, cefpimizole, cefpiramide, cefpodoxime, cefsulodin, cefteram, ceftibuten, ceftiolene, ceftizoxime, and oxacephem.
  • cefixime ceftazidime, cefotaxime, ceftriaxone, cefcapene, cefdaloxime, cefdinir, cefditoren, cefetamet, cefmenoxime, cefodizime, cef
  • said 3 rd generation cephalosporin is ceftriaxone.
  • cephalosporin a p-lactam antibiotic, i.e. a compound with antibiotic properties containing a beta-lactam functionality, including but not limited to cefepime and cefiderocol.
  • monobactam is herein meant a subgroup of p-lactam antibiotics, which are monocyclic and wherein the p-lactam ring is not fused to another ring. They include aztreonam.
  • P-lactamases are a family of enzymes that hydrolyze p-lactam rings, such as p-lactam rings of p-lactam antibiotic drugs, p-lactamases are found in Gram positive and Gram negative bacteria and are responsible for the antibiotic resistance of many bacterial strains.
  • P-lactamases can be classified on the basis of their primary structure into four molecular classes, namely classes A to D. Classes A, C and D have a serine residue at their active site and class B, or metallo-p-lactamases, have zinc at their active site.
  • Carbapenemases are a diverse group of p-lactamases that include enzymes belonging to class A, B and D. Class A carbapenemases include KPC-1 , KPC-2, KPC-3 and KPC-4. Class B carbapenemases include the IMP family, VIM family, GIM-1 and SPM-1 as well as others.
  • Class D carbapenemases include OXA-23, OXA-24, OXA-25, OXA-26, OXA- 27, OXA-40 and OXA-48 as well as others.
  • AmpC p-lactamases are class C enzymes and can be encoded by chromosomal genes or be plasmid-borne. AmpC p-lactamases hydrolyze broad and extended-spectrum cephalosporins (i.e., cephamycins and oxyiminobeta lactams).
  • Extended-spectrum p-lactamases which can advantageously be targeted in the context of the present invention, are p-lactamases that hydrolyze cephalosporins with an oxyimino chain.
  • ESBLs include the TEM family, SHV family as well as others, and the CTX-M family, which are class A enzymes.
  • the ESBLs specifically targeted by the antisense oligonucleotide present in the nanoparticles of the invention are CTX-M ESBLs.
  • CTX-M ESBLs can be divided into five major groups, groups 1 , 2, 8, 9 and 25, inside which sequence identities are higher than 98%. Each group includes a number of minor allelic variants which differ from each other by one or few amino acid substitutions. Among these variants, the CTX-M-15 variant (belonging to group 1) is dominant worldwide.
  • the CTX-M EBSL is a group 1 CTX-M ESBL.
  • CTX-M ESBLs typically include CTX-M-1 , CTX-M-3, CTX-M-10, CTX-M-11 , CTX-M-12, CTX-M-15, CTX-M-22, CTX-M-23, CTX-M-28, CTX-M-29, CTX-M- 30, CTX-M-32, CTX-M-33, CTX-M-34, CTX-M-36, CTX-M-37, CTX-M-42, CTX-M-52, CTX-M-53, CTX-M-54, CTX-M-55, CTX-M-57, CTX-M-58, CTX-M-60, CTX-M-61 , CTX-M- 62, CTX-M-66, CTX-M-68, CTX-M-69, CTX-M-71, CTX-M-72, CTX-M-79, CTX-M-80, CTX-M-88, CTX-M-96, CTX-M
  • said CTX-M ESBL is the CTX-M-15 ESBL.
  • the CTX-M-15 ESBL is encoded by the blacrx-M-is gene.
  • the Escherichia coli CTX-M-15 coding sequence consists typically of the sequence SEQ ID NO: 5.
  • the Escherichia coli CTX-M-15 amino acid sequence consists typically of the sequence SEQ ID NO: 6.
  • the b/a C Tx-M-i5 gene is typically preceded by an associated upstream insertional element ⁇ SEcp1.
  • the nucleic acid sequence of the Escherichia coli blacrx-M-is gene preceded by the associated upstream insertional element ⁇ SEcp1 is typically of sequence SEQ ID NO: 7.
  • nucleolipid carrier 1 or “nucleolipid’, it is preferably understood any nucleolipid able to form nanoparticles with an antibiotic molecule and an oligonucleotide.
  • nucleolipids examples include, but are not limited to, nucleolipids described in WO 2010/136676 A1 and/or in WO 2005/116043 A1.
  • the nucleolipid is a compound of compound of formula (I) wherein - X represents an oxygen or a sulphur atom or a methylene group,
  • - B represents a purine or pyrimidine base such as uracil, adenine, guanine, cytosine, thymine, hypoxanthine, or their derivatives, or also an non-natural mono- or bicyclic heterocylic base each ring of which comprises 4 to 7 members, optionally substituted;
  • Li and L2 identical or different, represent hydrogen, an oxycarbonyl -O- C(O)- group, a thiocarbamate -O-C(S)-NH- group, a carbonate -O-C(O)- O- group, a carbamate -O-C(O)-NH- group, an oxygen atom, a phosphate group, a phosphonate group or a heteroaryl group comprising 1 to 4 nitrogen atoms, unsubstituted or substituted by a linear or branched, saturated or unsaturated C2-C30 hydrocarbon chain, or also, Li and L2, together, form a ketal group of formula or also a thioketal group of formula or also Li or L2 represents hydrogen, and the other represents a hydroxy group or a heteroaryl group comprising 1 to 4 nitrogen atoms, unsubstituted or substituted by a linear or branched C2-C30 alkyl chain;
  • ⁇ a linear or branched C2-C30 hydrocarbon chain, preferably C6-C25, in particular C8-C25, saturated or partially unsaturated, optionally completely or partially fluorinated, unsubstituted or substituted on the carbon at the end of the chain by a fluorine atom or by a benzyl or naphthyl ester or ether, or
  • each acyl chain is C2-C30, or
  • Li or L2 represents hydrogen, and the other represents a hydroxy group or a heteroaryl group comprising 1 to 4 nitrogen atoms, R1 and R2 do not exist;
  • ⁇ a hydroxy, amino, phosphate, phosphonate, phosphatidylcholine, O-alkyl phosphatidylcholine, phosphatidylethanolamine, O-alkyl- phosphatidylethanolamine, O- alkylphosphate, thiophosphate, phosphonium, NH2-R4, NHR4R5 or NR4R5R6 group in which R4, Rs and Re, identical or different, represent a hydrogen atom or a linear or branched C1-C5 alkyl or linear or branched Ci- Cs hydroxyalkyl chain, or
  • R3 is linked by a covalent bond to another substituent R3, identical or different, of another compound of formula (I), identical or different, in order to form a compound of formula (I) in the form of a dimer.
  • linear or branched C1-C5 alkyl it is preferably understood a methyl, ethyl, propyl, i-propyl, n-butyl, i-butyl, tert-butyl radical, preferably methyl or ethyl.
  • the purine or pyrimidine base, or the nonnatural mono- or bicyclic heterocyclic base can be substituted by at least one substituent chosen, for example, from a halogen, an amino group, a carboxy group, a carbonyl group, a carbonylamino group, a hydroxy, azido, cyano, alkyl, cycloalkyl, perfluoroalkyl, alkyloxy (for example, methoxy), oxycarbonyl, vinyl, ethynyl, propynyl and/or acyl group.
  • substituent chosen, for example, from a halogen, an amino group, a carboxy group, a carbonyl group, a carbonylamino group, a hydroxy, azido, cyano, alkyl, cycloalkyl, perfluoroalkyl, alkyloxy (for example, methoxy), oxycarbonyl, vinyl, ethynyl, propynyl and/
  • non-natural mono- or bicyclic heterocyclic base it is preferably understood a base other than uracile, adenine, guanine, cytosine, thymine or hypoxanthine, which does not exist in nature.
  • heteroaryl group containing 1 to 4 nitrogen atoms is preferably understood a monocyclic or bicyclic, aromatic or partially unsaturated, carbocyclic group containing 5 to 12 atoms, interrupted by 1 to 4 nitrogen atoms, in particular the pyrazole, triazole, tetrazole or imidazole groups.
  • n is comprised between 1 and 100, preferably between 1 and 50, and even more preferably between 1 and 10.
  • X represents an oxygen atom and B represents adenine or thymine, more preferably thymine.
  • the charge of the compounds of formula (I) is determined by the polar groups that they contain, these being essentially present in or constituted by the substituents Li, L2 and/or R3.
  • the nucleolipid is positively charged at physiological pH.
  • the nucleolipid is a cationic compound at physiological pH.
  • Examples of cationic compounds of formula (I) include, but are not limited to, compounds of formula (I) in which Li, L2 and/or R3 represent a positively charged group such as, for example an ammonium, phosphonium, imidazolium group, optionally substituted.
  • the nucleolipid is selected from the group consisting of phosphatidylcholine derivatives, such as, for example, dioleylphosphatidylcholine (DOPC) and dioleylphosphatidyluridine phosphatidylcholine (DOLIPC), 1 ,2-dioleyl-sn-glycero-3- phosphatidylethanolamine (DOPE), 1 ,2-dioleoyl-3-trimethylammonium-propane (DOTAP), N-[5'-(2',3'-dioleoyl)uridine]-N',N',N'-trimethylammonium tosylate (DOTAll), and derivatives thereof.
  • DOPC dioleylphosphatidylcholine
  • DOLIPC dioleylphosphatidyluridine phosphatidylcholine
  • DOPE dioleylphosphatidyluridine phosphatidylcholine
  • DOPE dioleylphosphatidyl
  • the nucleolipid is selected from the group consisting of dioleylphosphatidylcholine (DOPC), dioleylphosphatidyluridine phosphatidylcholine (DOLIPC), 1,2-dioleyl-sn-glycero-3-phosphatidylethanolamine (DOPE), N-[5'-(2',3'- dioleoyl)uridine]-N',N',N'-trimethylammonium tosylate (DOTAll), and derivatives thereof.
  • DOPC dioleylphosphatidylcholine
  • DOLIPC dioleylphosphatidyluridine phosphatidylcholine
  • DOPE 1,2-dioleyl-sn-glycero-3-phosphatidylethanolamine
  • DOPE 1,2-dioleyl-sn-glycero-3-phosphatidylethanolamine
  • DOPE 1,2-dioleyl-sn-glycero-3-phosphatidylethanolamine
  • the nucleolipid is N-[5'-(2',3'-dioleoyl)uridine]-N',N',N'- trimethylammonium tosylate (DOTAll) or derivatives thereof.
  • DOTAll N-[5'-(2',3'-dioleoyl)uridine]-N',N',N'- trimethylammonium tosylate that is a compound having the following formula (II):
  • DOTAll is prepared as described in Pauline Chabaud et al., Bioconjugate Chem., 2006, 17, 466-472.
  • oligonucleotide refers to a nucleic acid sequence which may be 3'-5' or 5'-3' oriented.
  • the oligonucleotide of the invention may in particular be DNA or RNA.
  • the oligonucleotide used in the context of the invention is DNA.
  • the oligonucleotide of the invention preferably comprises or consists of a nucleic acid sequence, in particular a DNA sequence, of at least 15 nucleotides, preferably at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 21 nucleotides, at least 22 nucleotides, at least 23 nucleotides, at least 24 nucleotides or at least 25 nucleotides.
  • the oligonucleotide of the invention comprises or consists of a nucleic acid sequence, in particular a DNA sequence, of at least 19 nucleotides.
  • the oligonucleotide of the invention comprises or consists of a nucleic acid sequence, in particular a DNA sequence, of less than 25 nucleotides. In a particularly preferred embodiment of the invention, the oligonucleotide of the invention comprises or consists of a nucleic acid sequence, in particular a DNA sequence, of at least 19 nucleotides and less than 25 nucleotides.
  • the oligonucleotide of the invention comprises or consists of a nucleic acid sequence, in particular a DNA sequence, of 19 nucleotides, 20 nucleotides, 21 nucleotides or 25 nucleotides.
  • the oligonucleotides of the invention may be modified, preferably chemically modified, in order to increase the stability of the oligonucleotides in vivo.
  • the oligonucleotide of the invention may comprise modified nucleotides.
  • Chemical modifications may occur at three different sites: (i) at phosphate groups, (ii) on the sugar moiety, and/or (iii) on the entire backbone structure of the oligonucleotide.
  • the oligonucleotides may be employed as phosphorothioate derivatives (replacement of a non-bridging phosphoryl oxygen atom with a sulfur atom) which have increased resistance to nuclease digestion.
  • 2’-methoxyethyl (MOE) modification (such as the modified backbone commercialized by ISIS Pharmaceuticals) is also effective.
  • the antisense oligonucleotide present in the nanoparticles of the invention is a phosphorothioate derivative.
  • the oligonucleotides of the invention may comprise completely, partially or in combination, modified nucleotides which are derivatives with substitutions at the 2' position of the sugar, in particular with the following chemical modifications: O-methyl group (2'-O-Me) substitution, 2-methoxyethyl group (2'- O-MOE) substitution, fluoro group (2'-fluoro) substitution, chloro group (2'-CI) substitution, bromo group (2'-Br) substitution, cyanide group (2'-CN) substitution, trifluoromethyl group (2'-CF3) substitution, OCF3 group (2'-OCF3) substitution, OCN group (2'-OCN) substitution, O-alkyl group (2'-O-alkyl) substitution, S-alkyl group (2'-S-alkyl) substitution, N-alkyl group (2'-N-akyl) substitution, O-alkenyl group (2'-O-alkenyl) substitution, S-alkenyl group (2'-S- alken
  • the oligonucleotides of the invention may comprise completely or partially modified nucleotides wherein the ribose moiety is used to produce locked nucleic acid (LNA), in which a covalent bridge is formed between the 2' oxygen and the 4' carbon of the ribose, fixing it in the 3'-endo configuration.
  • LNA locked nucleic acid
  • the oligonucleotide of the invention comprises modified nucleotides selected from the group consisting of LNA, 2’-OMe analogs, 2’-phosphorothioate analogs, 2’-fluoro analogs, 2’-CI analogs, 2’-Br analogs, 2’- CN analogs, 2’-CF3 analogs, 2’-OCF3 analogs, 2’-OCN analogs, 2’-O-alkyl analogs, 2’-S- alkyl analogs, 2’-N-alkyl analogs, 2’-O-alkenyl analogs, 2’-S-alkenyl analogs, 2’-N-alkenyl analogs, 2’-SOCH3 analogs, 2’-SC>2CH3 analogs, 2’-ONC>2 analogs, 2’-NC>2 analogs, 2’-Ns analogs, 2’-NH2 analogs and combinations thereof. More preferably, the modified nucleotides are selected from the group consisting of LNA
  • nucleobases of the oligonucleotide may be present as desoxyriboses. That modification should only affect the skeleton of the nucleobase, in which the hydroxyl group is absent, but not the side chain of the nucleobase which remains unchanged.
  • antisense oligonucleotide refers to a single stranded DNA or RNA with complementary sequence to its target mRNA, and which binds its target mRNA thereby preventing protein translation either by steric hindrance of the ribosomal machinery or induction of mRNA degradation by ribonuclease H.
  • the antisense oligonucleotide may be a DNA or a RNA molecule.
  • an oligonucleotide that “targets” an mRNA refers to an oligonucleotide that is capable of specifically binding to said mRNA. That is to say, the oligonucleotide comprises a sequence that is at least partially complementary, preferably perfectly complementary, to a region of the sequence of said mRNA, said complementarity being sufficient to yield specific binding under intra-cellular conditions.
  • sequence that is “perfectly complementary to” a second sequence is meant the reverse complement counterpart of the second sequence, either under the form of a DNA molecule or under the form of a RNA molecule.
  • a sequence is “partially complementary to” a second sequence if there are one or more mismatches.
  • the oligonucleotides used in the oligonucleotide solid nucleolipid nanoparticle of the invention are antisense oligonucleotides which target mRNAs encoding an extended spectrum p-lactamase (ESBL), in particular a CTX-M ESBL as defined above.
  • ESBL extended spectrum p-lactamase
  • the antisense oligonucleotide used in the invention is capable of reducing the amount of (CTX-M) extended spectrum p-lactamase in bacteria.
  • Nucleic acids that target an mRNA encoding a CTX-M extended spectrum P-lactamase may be designed by using the sequence of said mRNA as a basis, e.g. using bioinformatic tools.
  • the sequences of SEQ ID NO: 5, SEQ ID NO: 7 or SEQ ID NO: 8 can be used as a basis for designing nucleic acids that target an mRNA encoding a CTX-M extended spectrum p-lactamase.
  • the antisense oligonucleotides used in the invention are capable of reducing the amount of CTX-M extended spectrum p-lactamase in bacteria, e.g. the amount of CTX-M-15 extended spectrum p-lactamase in bacterial cells such as Escherichia coli TcK12 cells.
  • Methods for determining whether an oligonucleotide is capable of reducing the amount of CTX-M extended spectrum p-lactamase in cells are known to the skilled in the art. This may be done for example by analyzing p-lactamase activity by hydrolyzing nitrocefin, a chromogenic cephalosporin, in the presence and in the absence of the oligonucleotide to be tested.
  • the inventors have designed four antisense oligonucleotides targeting an mRNA encoding CTX-M extended- spectrum p-lactamase that are very efficient in reducing the amount of CTX-M extended spectrum p-lactamase in bacteria.
  • These oligonucleotides target the region situated between nucleotide -4 upstream the atg codon and nucleotide 21 of the CTX-M coding sequence, the region situated between nucleotides 498 and 504 of the CTX-M coding sequence, the region situated between nucleotides 4 and 28 of the CTX-M coding sequence, and the region situated between nucleotides 492 and 512 of the CTX-M coding sequence, respectively.
  • the inventors have designed 3 additional antisense oligonucleotides targeting an mRNA encoding CTX-M extended-spectrum p-lactamase that decrease the ceftriaxone Minimal Inhibitory Concentration (MIC) in resistant laboratory E. coli strain TcK12. These oligonucleotides target the region situated between nucleotides 53 and 75 of the CTX-M coding sequence, the region situated between nucleotides 480 and 500 of the CTX-M coding sequence and the region situated between nucleotides 781 and 805 of the CTX-M coding sequence, respectively.
  • MIC ceftriaxone Minimal Inhibitory Concentration
  • the oligonucleotides according to the invention preferably target a sequence overlapping with nucleotides 38 to 62 of SEQ ID NO: 8, or with nucleotides 498 to 504 of SEQ ID NO: 5, or with nucleotides 4 to 28 of SEQ ID NO: 5, or with nucleotides 492 to 512 of SEQ ID NO: 5, or with nucleotides 53 to 75 of SEQ ID NO: 5, or with nucleotides 480 to 500 of SEQ ID NO: 5 or with nucleotides 781 to 805 of SEQ ID NO: 1 , said oligonucleotide being a DNA or a RNA.
  • the oligonucleotides according to the invention target a sequence overlapping with nucleotides 38 to 62 of SEQ ID NO: 8, or with nucleotides 498 to 504 of SEQ ID NO: 5, or with nucleotides 4 to 28 of SEQ ID NO: 5, or with nucleotides 492 to 512 of SEQ ID NO: 5, said oligonucleotide being a DNA or a RNA.
  • the oligonucleotides of the invention may for example consist of a sequence selected from the group consisting of the sequences GCGCAGTGATTTTTTAACCATGGGA (SEQ ID NO: 1), CGTGTAGGTACGGCAGATC (SEQ ID NO: 2), TGAACTGGCGCAGTGATTTTTTAAC (SEQ ID NO: 3), GTCGGCTCGGTACGGTCGAGA (SEQ ID NO: 4), CGGCACACTTCCTAACAACA (SEQ ID NO: 9), ACGGTCGAGACGGAACGTTT (SEQ ID NO : 10) and
  • oligonucleotides that can be used in the solid nucleolipid nanoparticles of the invention consist of a sequence selected from the group consisting of the sequences GCGCAGTGATTTTTTAACCATGGGA (SEQ ID NO: 1), CGTGTAGGTACGGCAGATC (SEQ ID NO: 2), TGAACTGGCGCAGTGATTTTTTAAC (SEQ ID NO: 3) and GTCGGCTCGGTACGGTCGAGA (SEQ ID NO: 4).
  • oligonucleotides targeting different locations of the same gene and/or different resistance genes, are used to polyfunctionalize the solid nucleolipid nanoparticles of the invention.
  • Oligonucleotide solid nucleolipid nanoparticles comprising several different oligonucleotides (in a same nanoparticle), are also parts the present invention.
  • Such poly-functionalized solid nucleolipid nanoparticles can advantageously be designed to inhibit several resistance genes (e.g., a CTX-M ESBL gene and another ESBL gene; two CTX-M genes of different groups; CTX-M-15 and CTX-M-1 ; etc.), so that these solid nucleolipid nanoparticles are efficient against a broader spectrum of bacteria.
  • poly-functionalized solid nucleolipid nanoparticles can comprise, in addition to an antisense olionucleotide targeting an mRNA encoding a protein responsible for bacterial resistance to the antibiotic present in the nucleoparticle, another antisense olionucleotide targeting an mRNA encoding a protein responsible for bacterial resistance to a different antibiotic that can be used in combination with the antibiotic present in the nucleoparticle.
  • oligonucleotide solid nucleolipid nanoparticles according to the invention can be obtained through a multi-step process.
  • solid nanoparticles of ion pairs comprising the antibiotic and the nucleolipid are first obtained.
  • a dispersion of the nucleolipid for example an aqueous solution of the antibiotic with an aqueous dispersion of the nucleolipid.
  • the skilled person can determine, through routine experimentation, appropriate concentrations and volumes of each solution for forming and precipitating ion pairs.
  • the obtained precipitate is then preferably washed with water and dissolved in an appropriate solvent such as methanol, ethanol, polyethylene glycol (PEG) and derivatives thereof (such as PEG200 and PEG400), propylene glycol, aqueous solution comprising a ionic or nonionic surfactant (such as aqueous solution comprising polysorbate 80), triglycerides and derivatives thereof (such medium chain triglycerides (MCT) and in particular Miglyol optionally in combination with lecithin), acetone, dichloromethane, dimethyl sulfoxide (DMSO), and mixtures thereof.
  • an appropriate solvent such as methanol, ethanol, polyethylene glycol (PEG) and derivatives thereof (such as PEG200 and PEG400), propylene glycol, aqueous solution comprising a ionic or nonionic surfactant (such as aqueous solution comprising polysorbate 80), triglycerides and derivatives thereof (such medium chain trig
  • the appropriate solvent is selected from methanol, ethanol, polyethylene glycol (PEG) and derivatives thereof (such as PEG200 and PEG400), propylene glycol, aqueous solution comprising a ionic or nonionic surfactant (such as aqueous solution comprising polysorbate 80), triglycerides and derivatives thereof (such medium chain triglycerides (MCT) and in particular Miglyol optionally in combination with lecithin), and mixtures thereof. More preferably, the obtained precipitate is then washed with water and dissolved in an appropriate solvent such as methanol.
  • the dissolved ion pairs are then nanoprecipitated using any technique known by the skilled person.
  • An example of nanoprecipitation method is described in the experimental part which follows.
  • the obtained nanoparticles (NP) preferably have a positive zeta potential.
  • the second part of the process is the functionalization of the NP with oligonucleotides (ON), to obtain ATB-nucleolipid-ON nanoparticles (ON NP).
  • This step can be monitored by measuring for example, (i) the inversion of NP zeta potential from positive to negative and (ii) the increase of NP size.
  • the skilled person can adapt, by routine experimentation, the concentration of the NP and of the ON to optimize the step of functionalization of the NP.
  • the ATB-nucleolipid-ON nanoparticle for example the ATB-DOTAU-ON nanoparticle, has a negative zeta potential.
  • the diameter of the ATB- nucleolipid-ON nanoparticle is between 150 and 200 nm.
  • the present invention also concerns a pharmaceutical composition
  • a pharmaceutical composition comprising an oligonucleotide solid nucleolipid nanoparticle according to the invention.
  • the pharmaceutical composition of the invention may further comprise a pharmaceutically acceptable excipient.
  • pharmaceutically acceptable refers to properties and/or substances which are acceptable for administration to a subject from a pharmacological or toxicological point of view. “Pharmaceutically acceptable” also refers to factors such as formulation, stability, patient acceptance and bioavailability which will be known to a manufacturing pharmaceutical chemist from a physical/chemical point of view. As used herein, “pharmaceutically acceptable excipient” refers to any substance in a pharmaceutical composition different from the active ingredient.
  • Said excipients can be liquids, sterile, as for example water and oils, including those of origin in the petrol, animal, vegetable or synthetic, as peanut oil, soy oil, mineral oil, sesame oil, and similar, disintegrate, wetting agents, solubilizing agents, antioxidant, antimicrobial agents, isotonic agents, stabilizing agents or diluents.
  • Suitable adjuvants and/or pharmaceutical carriers are described in “Remington's Pharmaceutical Sciences” by E. W. Martin.
  • compositions of the invention can be formulated for a parenteral (e.g., intravascular, intradermal, intracerebroventricular, subcutaneous, intramuscular, intraperitoneal), oral, buccal, nasal and pulmonary, other transmucosal (e.g., vaginal, rectal), transdermal, topical, or intraocular administration, for local or systemic effect.
  • parenteral e.g., intravascular, intradermal, intracerebroventricular, subcutaneous, intramuscular, intraperitoneal
  • oral, buccal, nasal and pulmonary e.g., other transmucosal (e.g., vaginal, rectal), transdermal, topical, or intraocular administration, for local or systemic effect.
  • the present invention concerns use of an oligonucleotide solid nucleolipid nanoparticle of the invention for treating a bacterial infection.
  • Another object of the invention concerns the use of an oligonucleotide solid nucleolipid nanoparticle of the invention for the manufacture of a medicament intended for treating a bacterial infection.
  • Still another object of the invention concerns a method of treating a bacterial infection in a subject, said method comprising administering a therapeutically effective amount of an oligonucleotide solid nucleolipid nanoparticle of the invention to a subject in need thereof.
  • the present invention also concerns the pharmaceutical composition of the invention, for use for treating a bacterial infection.
  • Still another object of the invention concerns a method of treating a bacterial infection in a subject, said method comprising the administration of a therapeutically effective amount of a pharmaceutical composition of the invention in a subject in need thereof.
  • the bacterial infection to be treated is due to bacteria resistant to the antibiotic present in the oligonucleotide solid nucleolipid nanoparticle.
  • an infection by a penicillin-resistant Staphylococcus aureus can be treated by administration of an oligonucleotide solid nucleolipid nanoparticle according to the invention comprising penicillin and an antisense oligonucleotide targeting mRNA encoding penicillinase.
  • the bacterial infection to be treated is due to bacteria resistant to 3 rd generation cephalosporins, 4 th generation cephalosporins and/or monobactams.
  • bacteria resistant to 3 rd generation cephalosporins, 4 th generation cephalosporins and/or monobactams bacteria producing ESBLs, as defined in the section “3 rd generation cephalosporins and CTX-M extended spectrum /3-lactamases” above.
  • said bacteria carry a b/acTx-M gene as defined in the section “3 rd generation cephalosporins and CTX-M extended spectrum /3- lactamases” above, in particular a Group 1 blacrx-M gene, more particularly a blacTx-M-15 gene.
  • said bacteria are Gram negative bacteria, in particular resistant to 3 rd generation cephalosporins, 4 th generation cephalosporins and/or monobactams, in particular carrying a b/acTx-M gene as defined above.
  • Gram-negative bacteria By way of Gram-negative bacteria, mention may be made of bacteria of the members of the order ‘Enterobacteriales’ and of the new reported order Enterobacterales ord. nov. which comprises seven families: Enterobacteriaceae , Erwiniaceae fam. nov., Pectobacteriaceae fam. nov., Yersiniaceae fam. nov., Hafniaceae fam. nov., Morganellaceae fam. nov., and Budviciaceae fam. nov.
  • said Gram-negative bacteria are selected from Escherichia, Salmonella, Shigella, Klebsiella, Serratia, Proteus, Morganella, Yersinia, Citrobacter, Hafnia, Edwardsiella, Providencia, Cedecea, Erwinia and Pantoea,
  • said bacterial infection to be treated is due to Enterobacteriaceae bacteria, in particular resistant to 3 rd generation cephalosporins, 4 th generation cephalosporins and/or monobactams, in particular carrying a b/acTx-M gene as defined above.
  • Enterobacteriaceae bacteria include bacteria of the genera Escherichia, Ewingella, Hafnia, Klebsiella, Kluyvera, Leclercia, Rahnella, Salmonella, and Shigella.
  • said bacterial infection to be treated is due to bacteria of the genera Escherichia or Klebsiella, in particular resistant to 3 rd generation cephalosporins, 4 th generation cephalosporins and/or monobactams, in particular carrying a b/acTx-M as defined above.
  • said bacterial infection to be treated is due to bacteria of the Escherichia coli or the Klebsiella pneumoniae species, in particular resistant to 3 rd generation cephalosporins, 4 th generation cephalosporins and/or monobactams, in particular carrying a b/acTx-M as defined above.
  • said bacterial infection to be treated is due to bacteria of the Escherichia coli species, in particular resistant to 3 rd generation cephalosporins, 4 th generation cephalosporins and/or monobactams, in particular carrying a b/acTx-M as defined above.
  • subject is meant herein a mammal, such as a rodent, a feline, a canine, or a primate.
  • a subject according to the invention is a human.
  • treating means reversing, alleviating, inhibiting the progress of the disorder or condition to which such term applies, or one or more symptoms of such disorder or condition.
  • Prophylaxis is also considered as a treatment in the context of the invention.
  • a "therapeutically effective amount" of an oligonucleotide solid nucleolipid nanoparticle or a pharmaceutical composition of the invention is meant a sufficient amount of the oligonucleotide solid nucleolipid nanoparticle or composition to treat a specific disease, at a reasonable benefit/risk ratio applicable to any medical treatment. It will be understood, however, that the total daily usage of the oligonucleotide solid nucleolipid nanoparticle or composition of the present invention will be decided by the attending physician within the scope of sound medical judgment.
  • the specific therapeutically effective dose level for any particular subject will depend upon a variety of factors including the disorder being treated and the severity of the disorder, activity of the specific oligonucleotide solid nucleolipid nanoparticle or composition employed, the age, body weight, general health, sex and diet of the subject, the time of administration, route of administration and rate of excretion of the specific compounds employed, the duration of the treatment, drugs used in combination or coincidental with the specific compounds employed, and like factors well known in the medical arts.
  • compositions for example, the route of administration, the dosage and the regimen naturally depend upon the condition to be treated, the severity of the illness, the age, weight, and sex of the patient, etc.
  • the oligonucleotide solid nucleolipid nanoparticle can be administered by any suitable route, in particular by parenteral (e.g., intravascular, intradermal, intracerebroventricular, subcutaneous, intramuscular, intraperitoneal), oral, buccal, nasal and pulmonary, other transmucosal (eg., vaginal, rectal), transdermal, topical, or intraocular route, for local or systemic effect.
  • parenteral e.g., intravascular, intradermal, intracerebroventricular, subcutaneous, intramuscular, intraperitoneal
  • oral buccal
  • nasal and pulmonary e.g., other transmucosal (eg., vaginal, rectal), transdermal, topical, or intraocular route, for local or systemic effect.
  • Figure 1 Chemical structure of CFX and nucleolipids (DOTAU and diC16dT) ionized in aqueous medium at neutral pH (counterions of solid salts, Na+ and CI-, are not represented).
  • Figure 2 X-ray diffractogram of CFX, DOTAU and ion pair.
  • Figure 5 Impact of incubation time on ONa 6 oo NP size, PDI and zeta potential, as compared to non-incubated CFX-DOTAU NP (at TO time); * Student t-test was considered significant for p ⁇ 0.05.
  • Figure 6 Colloidal stability of CFX-DOTAU and ONa 6 oo NP characteristics (mean +/- SD): (left axis, expressed as % TO) size, zeta potential and (right axis) PDI
  • Figure 7 CFX MIC of ONa NP on ESBL producing E. coli compared to CFX-DOTAU NP and control conditions (* p ⁇ 0.05 and ** p ⁇ 0.01 Student t-test; NB: the concentration cited in brackets is the ONa incubation concentration during NP preparation).
  • Ceftriaxone heptahemihydrate di-sodium salt of pharmaceutical grade was purchased from Discovery Fine Chemical (UK).
  • DOTAU chloride was synthetized in our laboratory (Chabaud et al. 2006) by a Technology Transfer Unit SynVec (Bordeaux).
  • diC16dT nucleolipid sodium salt
  • MH-CA Mueller-Hinton bacteria culture medium adjusted in calcium and magnesium ions
  • the concentration of oligonucleotide samples was measured by microvolume spectrophotometer (mySPEC, VWR®) at 260 nm using automatic oligonucleotide detection mode.
  • Ion pairs were obtained by vortex mixing of CFX extemporaneously prepared aqueous solution and DOTAll sonicated aqueous dispersion at variable concentrations and volumes. White precipitated ion pairs were then centrifuged for 2 min at 5031g (Minispin plus, Eppendorf) and washed twice with 1 mL of demineralized water. The pellet was dried in (Digital Heatblock VWR) at 30°C under air flow. The dried film was re-dissolved in 300 pL of methanol using vortexing.
  • CFX-DOTAU NP were obtained by nanoprecipitation method.
  • Methanolic ion pair solution was added dropwise using a syringe (Terumo® Syringe 1 mL) and a needle (Fine Ject® 25G*5/8” 0.5*16mm) into a glass tube containing 10 mL of demineralized water under vortex agitation with a constant speed of 1 drop every 2 s.
  • Methanol and demineralized water were evaporated using a Heidolph Rotary Evaporator (Laborota 4001) at 40°C to obtain a final volume of NP suspension of 1 mL.
  • ONa NP were obtained by incubation of CFX-DOTAU NP in ONa solutions (100, 200, 300, 400, 600, 800pM) for 30 min (unless stated otherwise for protocol optimization) at room temperature.
  • the concentration of ONa cited refers to the concentration of the stock solution during the incubation and not to the concentration in the testing conditions. They were named accordingly (e.g. ONaeoo NP for NP prepared with 600 pM ONa solution ; ONa NP referring generically to Ona functionalized NP).
  • FT-IR Perkin Elmer Fourier Transform-Infrared
  • ATR Attenuated Total Reflection
  • the samples were put on sample holders made of aluminum alloy and flattened with a piece of glass. CFX and DOTAll raw material were used as controls.
  • the high performance liquid chromatography (HPLC) method for CFX was adapted from previously developed and validated methods for CFX (Gaudin et al. 2015) and DOTAU (Ferey et al. 2018) respectively. Briefly, a UHPLC UltiMate 3000 from Dionex-Thermo Scientific (USA), composed of a pump with a quaternary valve, a thermostated auto-sampler, and a thermostated column compartment was used. Two different conditions were used for the analysis of CFX and DOTAU. The injection volumes were set at 5 and 1 pL for CFX and DOTAU, respectively.
  • a Diode Array Detector (DAD 3000) was used at 240 and 255 nm for CFX and DOTAU, respectively.
  • RP-HPLC columns were a J’sphere® ODS-H80 (4.6*150 mm id, 4 pm) + a guard column ODS-H80 (10*4 mm id, 4 pm) (Interchim, Montlugon, France) and a Acquity® UPLC BEH C1850 x 2.1 mm, 1.7 pm) (Waters, Milford, MA, USA) for CFX and DOTAU, respectively.
  • the mobile phase for the CFX method was a mixture of 60% an aqueous phase prepared by dissolving 25 mM of C16-TMA Br in phosphate buffer 25 mM at pH 7.5 and 60% of acetonitrile, at 1 mL.min' 1 .
  • the mobile phase for the DOTAU method was composed of 100% methanol containing 20mM of ammonium acetate at 0.5 mL.min' 1 .
  • Size, polydispersity index (PDI) and Zeta potential of NP were measured using Zetasizer Nano ZS90 (Malvern Instruments Ltd., UK). Size was measured in a specific cell ZEN 0040 (Malvern, France) and expressed as Z-average mean size and Zeta Potential in a DTS 1070 cell (Malvern, France). Measurement conditions were performed in demineralized water, at the temperature of 25°C achieved after the equilibration time of 120 s. Each test was triplicated.
  • samples were diluted 1/100 in demineralized water to reach the desired concentration for analysis.
  • NP suspension 6 pL were deposited on carbon film grid for 2 min 30 prior to drying at room temperature. Contrast was done using Uranyless for 2 min before drying.
  • EDS energy dispersive-X-ray spectroscopy
  • a ThermoFisher Talos F200S G2 operated at 200 kV, was used combined with a STEM (scanning/transmission electron microscopy) unit and a STEM-HAADF (high angle annular dark field) detector.
  • STEM-EDS spectra were accumulated for 2 min and the compositional mapping for 15 min on uncontrasted samples.
  • VELOX software was required for data acquisition and processing.
  • MIC determination of NP in ESBL-producing E. coli Determination of CFX MIC of ONa NP was performed on K12 transconjugant strain of E. coli with a conjugative plasmid carrying the b/acTx-M-15 gene from the clinical strain Ec3536 (Kauss et al. 2020).
  • Free CFX, ion pair NP and ONa were used as control conditions.
  • MICs were performed by the broth micro-dilution method in accordance with the standard conditions (ELICAST and CASFM 2019).
  • the bacterial inoculum was prepared in 0.85% NaCI from 24h colonies on plates at an equivalent to a 0.5 McFarland (Densimat, BioMerieux). Bacterial suspension was diluted in MH-CA 2X broth (MH, BioRad) to obtain 5 x 10 4 cfu in the final volume of 100pL. CFX of NP equivalent to CFX content labelled (serially diluted 2-fold) were added in order to obtain a final volume per well of 96 well microplate of 50 pL and completed with 50 pL of 2X ONa nanoparticle suspension.
  • the first objective was to form an ion pair of CFX, that reportedly (Lee et al. 2006; Jeon et al. 2013) enhanced its permeability.
  • Nucleolipid DOTAU was selected as a candidate for its physico-chemical properties. Chemical structures are depicted in Figure 1.
  • DOTAU is a modified lipid nucleoside (Thanassoulas et al. 2014), which at physiological pH is positively charged. In aqueous solutions at room temperature, this nucleolipid forms liposome-like structures. Given the high structural variability of this amphiphilic compound, all interactions (H-bonds, TT-stacking, electrostatic, hydrophobic interactions) may contribute to the stabilization of the self-assembled aggregates (Simeone et al. 2012; Vialet et al. 2017; Baillet et al. 2018). DOTAU has already been used to successfully formulate solid lipid NP (Benizri et al. 2018; Oumzil et al. 2016; Karaki et al. 2017) where it promoted cell membrane penetration. In this work, it has been chosen as a counter ion for CFX to formulate an ion pair with CFX.
  • CFX is a crystal hemi-heptahydrate di-sodium salt with three pKas of 2.37 (COOH), 3.03 (aminothiazole) and 4.21 (hydroxytriazinone) respectively (Aleksic et al. 2005) and is consequently negatively charged at physiological pH. Its low permeability (i.e. log P -1.7 and oral bioavailability ⁇ 1% (“Ceftriaxone
  • BCS Biopharmaceutical Classification System
  • Table 1 Yield of ion pair formation at different ratios of CFX-DOTAU during formulation
  • the highest ion pair yield (i.e. 80% of initial mass recovered in the film) was prepared with the molar initial ratio of 1:1 for CFX and DOTAU and was therefore kept for further experimentation.
  • Laboratory scale-up was performed in view of biological tests, comparing yields of three different quantities of ion pair formed using 1:1 molar CFX - DOTAU ratio (8-12 mg, 17-21 mg and 23-25 mg).
  • the yields obtained were of comparable range (80% ⁇ 4%, 74% ⁇ 5% and 72% ⁇ 3% respectively), even if a limited decrease was observed when the batch scale increased.
  • the characterization of CFX-DOTAU ion pair was first performed using FT- IR and XRD analyses.
  • Powder XRD further confirmed the interaction of CFX and DOTAU as the crystalline structure of CFX became amorphous when ion pair was formed ( Figure 2).
  • NP were prepared by dissolving the ion pair film followed by nanoprecipitation.
  • Methanol showed sufficient solvent properties for CFX-DOTAU film (commonly dissolving 12 mg of film in 300 pL of methanol or equivalent proportion) and was kept for further formulation.
  • the volume of 10 ml of water in which methanolic solution was nanoprecipitated allowed better encapsulation yield compared to 5ml, and 300pl of methanol allowed better PDI compared to 500pl.
  • the CFX and DOTAU were analyzed at each step using HPLC method, which allowed the determination of NP encapsulation yields and molar ratio of 1 CFX for 2.4 DOTAU in the final composition of nanoprecipitated ion pairs.
  • the conditions of washing ion pair pellet were optimized to discard the excess of CFX, but preserve the ion pair formed (low quantity of DOTAU in supernatant).
  • CFX-DOTAU NP The functionalization of CFX-DOTAU NP with ONa to formulate ONa NP was anticipated as the interaction of ONa negative charges on the CFX-DOTAU positive surface. It induced the change of NP parameters: (i) the inversion of NP zeta potential from positive to negative and (ii) the increase of NP size. These changes were used to monitor the formation of ONa NP.
  • Monodisperse nanoparticles of mean size of 187 nm ⁇ 21 nm and -46 mV ⁇ 11 mV of mean zeta potential were formed when incubated with 600 pM ONa (cf. Table 4 for details).
  • the TEM was performed on ONa NP, but expectedly could not visualize ONa at the NP surface (not shown).
  • STEM mapping demonstrated that ONa NP indeed contained ONa via the presence of phosphorus (not shown).
  • NPs with ONa sequences were shown ONa concentration dependent, as shown in Figure 4.
  • Positive zeta potential of CFX-DOTAU NP decreased to close to neutral when incubated with 200 pM ONa and became negative for higher ONa concentrations.
  • the plateau of zeta potential, and hence of ONa adsorption on NP surface was reached at 600 pM ONa.
  • NP characteristics i.e. NP size, PDI and zeta potential.
  • the Figure 5 shows that the increased size and the decreased zeta potential could be observed fast, from 10 min on.
  • the evolution of the NP size and PDI were not significant between 10 min and 30 or 60 min.
  • the zeta potential significantly (p ⁇ 0.05, Student t-test) decreased until 30 min, indicating that at 30 min of incubation, a complete ONa adsorption was obtained. All these results led us to a conclusion that an incubation time of 30 min was needed for an optimal functionalization of our NPs with ONa.
  • NP Colloidal stability of NP was further investigated through 1 month at 4°C. As shown in Figure 6, no major evolution of zeta potential or NP size was observed and PDI values remained under 0.200 for one month. In view of further investigations requiring different concentrations of the nanoformulation, the stability of ONa NP upon dilution was questioned. Serial dilutions of CFX-DOTAU NP and ONa NP were evaluated for their size, PDI and zeta potential. As summarized in Table 5, the size and PDI of ONa 6 oo NP did not significantly change (p > 0.05) up till 1/1000 dilution and zeta potential up till 1/500.
  • MIC of ONa NP was tested on the transconjugant E. coli K12 and compared to the one of control conditions and CFX-DOTAU NP.
  • the MIC of CFX, ONa in presence of CFX, and CFX-DOTAU NP were not significantly different (p > 0.43).
  • a remarkably significant decrease of 75% of CFX MIC was demonstrated for the optimized formulation (i.e. incubation with 600 pM ONa). This indicated the capacity of ONa NP formulation to efficiently vectorize the ONa and decrease the MIC and hence the resistance of ESLB producing E. coli to CFX antibiotic.
  • the ONa alone (i.e., non encapsulated), co-incubated with CFX did not modify significantly the MIC, nor did the combination ONa with DOTAU.
  • the decrease of the MIC was ONa incubation concentration dependent.
  • the nanoformulation of ONa NP induced a significant decrease (p ⁇ 0.05 or 0.01, cf Figure 7) of the MIC starting from the 400 pM ONa incubation concentration (formulation ONcuoo NP), compared to CFX and ONa control conditions, and CFX-DOTAU NP.
  • the MIC of ONa4oo NP formulation obtained 768 mg.L' 1 at which the ONa concentration, recalculated from the molar ratio, was 112pM.
  • the optimal results were obtained with ONaeoo NP, giving the CFX MIC of 341 mg.L' 1 , at which the ONa recalculated concentration was 50 pM.
  • ONaeoo NP did not have any significant impact on the CFX MIC of non-resistant, parental K12 strain (0,016 ⁇ 0.07 mg.L -1 ), compared to CFX NP.
  • DNA tetrahedron carrier of b/acTx-M-3 decreased in vitro growth of cefotaxime resistant E. coli at 40 pM in presence of cefotaxime (John Benedict Readman, Dickson, and Coldham 2017).
  • Negatively charged liposomes encapsulating PTO oligonucleotides targeting oprM restored the sensitivity to piperacillin of resistant Pseudomonas aeruginosa at 2-20 pM concentration (Wang et al. 2010).
  • the same concentration of PTO sequences targeting acrB encapsulated in negatively charged liposomes decreased significantly the MIC value of ciprofloxacin and in fluoroquinolone resistant E. coli (Meng et al. 2012).
  • nucleolipid carrier DOTAll to deliver in the same formulation the antibiotic, CFX, along with ONa sequences to decrease bacterial resistance on ESBL-producing E. coli, a WHO priority pathogen.
  • ONa NP with the molar ratio of 10:24:1 were able to efficiently decrease the CFX MIC for 75%.
  • This nanoformulation strategy can be considered as a relevant and efficient strategy for oligonucleotide intra-bacterial delivery to fight against antibiotic resistances.

Abstract

La présente invention concerne la lutte contre les résistances aux antibiotiques. Les bactéries multirésistantes aux médicaments constituent un problème majeur de santé publique. Cette situation est plus particulièrement critique chez les entérobactéries productrices de ß-lactamase à spectre étendu (BLSE). Les inventeurs ont montré que des nanoparticules comprenant un antibiotique et un oligonucléotide antisens ciblant un gène responsable de la résistance bactérienne à cet antibiotique, liés par des interactions avec un composé nucléolipidique, conduisaient à une activité anti-résistance accrue, par comparaison avec des oligonucléotides non vectorisés. Plus particulièrement, la présente invention concerne une nanoparticule nucléolipidique solide oligonucléotidique comprenant : (i) une molécule antibiotique, (ii) un nucléolipide, et (iii) un oligonucléotide antisens ciblant un ARNm codant pour une protéine responsable de la résistance bactérienne à l'antibiotique décrit dans (i), l'antibiotique et les molécules nucléolipidiques formant une nanoparticule de paire d'ions qui est fonctionnalisée par l'oligonucléotide antisens. Plus particulièrement, les inventeurs ont testé une nouvelle nanoformulation composée d'un transporteur nucléolipidique DOTAU, de ceftriaxone et d'un oligonucléotide antisens ciblant CTX-M-15.
PCT/EP2023/050876 2022-01-17 2023-01-16 Nanoparticules solides oligonucléotidiques de nucléolipides pour lutter contre la résistance aux antibiotiques WO2023135299A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP22305042 2022-01-17
EP22305042.8 2022-01-17

Publications (1)

Publication Number Publication Date
WO2023135299A1 true WO2023135299A1 (fr) 2023-07-20

Family

ID=80446431

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2023/050876 WO2023135299A1 (fr) 2022-01-17 2023-01-16 Nanoparticules solides oligonucléotidiques de nucléolipides pour lutter contre la résistance aux antibiotiques

Country Status (1)

Country Link
WO (1) WO2023135299A1 (fr)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005116043A1 (fr) 2004-04-29 2005-12-08 Universite D'avignon Et Des Pays De Vaucluse Nouveaux composes amphiphiles, leur procede de preparation et leurs applications
WO2010136676A1 (fr) 2009-05-29 2010-12-02 Universite Victor Segalen Bordeaux 2 Formulations à compartiments multiples à base de molécules ou macromolécules amphiphiles fonctionnelles
US20190262469A1 (en) * 2015-09-04 2019-08-29 C. Jeffrey Brinker Protocells to treat microbial infection and for synergistic delivery
WO2020225371A1 (fr) * 2019-05-09 2020-11-12 Institut National De La Sante Et De La Recherche Medicale (Inserm) Oligonucléotide lipidique antisens contre la résistance aux antibiotiques

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005116043A1 (fr) 2004-04-29 2005-12-08 Universite D'avignon Et Des Pays De Vaucluse Nouveaux composes amphiphiles, leur procede de preparation et leurs applications
WO2010136676A1 (fr) 2009-05-29 2010-12-02 Universite Victor Segalen Bordeaux 2 Formulations à compartiments multiples à base de molécules ou macromolécules amphiphiles fonctionnelles
US20190262469A1 (en) * 2015-09-04 2019-08-29 C. Jeffrey Brinker Protocells to treat microbial infection and for synergistic delivery
WO2020225371A1 (fr) * 2019-05-09 2020-11-12 Institut National De La Sante Et De La Recherche Medicale (Inserm) Oligonucléotide lipidique antisens contre la résistance aux antibiotiques

Non-Patent Citations (78)

* Cited by examiner, † Cited by third party
Title
"Ceftriaxone I C18H18N807S3", PUBCHEM, 18 November 2021 (2021-11-18)
"Ceftriaxone Sodium ( Ceftriaxonum Natricum", PHARMACOPOEIA, EUROPEAN, 2021, pages 4 - 7
ABED, NADIAPATRICK COUVREUR: "Nanocarriers for Antibiotics: A Promising Solution to Treat Intracellular Bacterial Infections", INTERNATIONAL JOURNAL OF ANTIMICROBIAL AGENTS, vol. 43, no. 6, 2014, pages 485 - 96
ALEKSIC, MARA MVLADIMIR SAVICGORDANA V POPOVICNATA\VSA BURICVERA KAPETANOVIC: "Acidity Constants of Cefetamet, Cefotaxime and Ceftriaxone; the Effect of the Substituent at C3 Position", JOURNAL OF PHARMACEUTICAL AND BIOMEDICAL, vol. 39, no. 3-4, 2005, pages 752 - 56, XP005039088, DOI: 10.1016/j.jpba.2005.04.033
ARPIN, CORINNE, C. QUENTIN, F. GROBOST, E. CAMBAU, J. ROBERT, V. DUBOIS, L. COULANGE, C. ANDRE: "Nationwide Survey of Extended-Spectrum β-Lactamase-Producing Enterobacteriaceae in the French Community Setting", JOURNAL OF ANTIMICROBIAL CHEMOTHERAPY, vol. 63, no. 6, 2009, pages 1205 - 14
BA, BOUBAKAR, KAREN GAUDIN, AMELIE DESIRE, THIDA PHOEUNG, MARIE-HELENE LANGLOIS,CHARAN R BEHL, JOEL UNOWSKY: "Ceftriaxone Absorption Enhancement for Noninvasive Administration as an Alternative to Injectable Solutions", ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, vol. 62, no. 12, 2018, pages e01170 - 18, XP055934136, DOI: 10.1128/AAC.01170-18
BAILLET, JULIE, VALERIE DESVERGNES, ALADIN HAMOUD, LAURENT LATXAGUE, PHILIPPE BARTHELEMY.: "Lipid and Nucleic Acid Chemistries: Combining the Best of Both Worlds to Construct Advanced Biomaterials.", ADVANCED MATERIALS, vol. 1705078, 2018, pages 1 - 24
BARBOSA, TERESA M., AND STUART B. LEVY: " The Impact of Antibiotic Use onResistance Development and Persistence", DRUG RESISTANCE UPDATES, vol. 3, no. 5, 2000, pages 303 - 11
BENIZRI, SEBASTIENLUDIVINE FEREYBRUNO ALIESNAILA MEBAREKGAELLE VACHERANANDA APPAVOOCATHY STAEDELKAREN GAUDINPHILIPPE BARTHELEMY: "Nucleoside-Lipid-Based Nanocarriers for Sorafenib Delivery", NANOSCALE RESEARCH LETTERS, 2018, pages 13
BEVAN ET AL., J. ANTIMICROB. CHEMOTHER, vol. 72, 2017, pages 2145 - 2155
BEVAN, EDWARD RANNIE M. JONESPETER M. HAWKEY: "Global Epidemiology of CTX-M β-Lactamases: Temporal and Geographical Shifts in Genotype", JOURNAL OF ANTIMICROBIAL CHEMOTHERAPY, vol. 72, no. 8, 2017, pages 2145 - 55
BRAINE, THERESA: "Race against Time to Develop New Antibiotics", BULLETIN OF THE WORLD HEALTH ORGANIZATION, vol. 89, no. 2, 2011, pages 88 - 89
BUSH, KARENPATRICE COURVALINGAUTAM DANTASJULIAN DAVIESBARRY EISENSTEINPENTTI HUOVINENGEORGE A. JACOBY ET AL.: "Tackling Antibiotic Resistance", NATURE REVIEWS MICROBIOLOGY, vol. 9, no. 12, 2011, pages 894 - 96
CHABAUD, PAULINE, MICHEL CAMPLO, DOMINIQUE PAYET, GUILLAUME SERIN, LOUIS MOREAU,PHILIPPE BARTHELEMY, AND MARK W. GRINSTAFF.: "Cationic Nucleoside Lipids for Gene Delivery", BIOCONJUGATE CHEMISTRY, vol. 17, no. 2, 2006, pages 466 - 72, XP002490412, DOI: 10.1021/bc050162q
CHUA, KYRA Y.LANDREW J. STEWARDSON: "Individual and Community Predictors of Urinary Ceftriaxone-Resistant Escherichia Coli Isolates, Victoria, Australia", ANTIMICROBIAL RESISTANCE AND INFECTION CONTROL, vol. 8, no. 1, 2019, pages 1 - 12
EMA COMITEE FOR MEDICINAL PRODUCTS FOR HUMAN USE: "Assessment Report for Rocephin and Associated Names", NAMES, vol. EMA/144854, 2014
EUCASTCASFM, CASFM / EUCAST V2.0 MAI 2019 - RECOMMENDATION, 2019
FEREY, LUDIVINESARA ALBE SLABICLAUDE-ERIC ROYPHILIPPE BARTHELEMYKAREN GAUDIN: "Chromatographic Study of Nucleoside-Lipids by RP-UHPLC-DAD_CAD", ANALYTICAL AND BIOANALYTICAL CHEMISTRY, vol. 410, 2018, pages 7711 - 7721, XP036634361, DOI: 10.1007/s00216-018-1388-9
FILLION, PATRICK, ANNIE DESJARDINS, KHAMPOUNE SAYASITH, AND JACQUELINE LAGACE: "Encapsulation of DNA in Negatively Charged Liposomes and Inhibition of Bacterial Gene Expression with Fluid Liposome-Encapsulated Antisense Oligonucleotides", BIOCHIMICA ET BIOPHYSICA ACTA - BIOMEMBRANES, vol. 1515, no. 1, 2001, pages 44 - 54, XP004308695, DOI: 10.1016/S0005-2736(01)00392-3
FRANK-KAMENETSKY, M., A. GREFHORST, N. N. ANDERSON, T. S. RACIE, B. BRAMLAGE, A. AKINC,D. BUTLER: "Therapeutic RNAi Targeting PCSK9 Acutely Lowers Plasma Cholesterol in Rodents and LDL Cholesterol in Nonhuman Primates", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 105, no. 33, 2008, pages 11915 - 20, XP055666956, DOI: 10.1073/pnas.0805434105
FREIRE-MORAN, LAURA, BO ARONSSON, CHRIS MANZ, INGE C. GYSSENS, ANTHONY D. SO,DOMINIQUE L. MONNET OTTO CARS: "Critical Shortage of New Antibiotics in Development against Multidrug-Resistant Bacteria - Time to React Is Now", DRUG RESISTANCE UPDATES, vol. 14, no. 2, 2011, pages 118 - 24
GAUDIN, KAREN, MARIE-HELENE LANGLOIS, TINA KAUSS, THIDA PHOEUNG, STEPHANIE ARRACHART,ANNE-MARGAUX DEMARTINI,FLORIAN GAZIELLO: "In Vitro Ceftriaxone Stability at New-Borns ' Rectal PH Assessed by UV and HPLC Methods", PHARMACEUTICA ANALYTICA ACTE, vol. 6, no. 7, 2015
HEIDEL, J. DZ. YUJ. Y.-C. LIUS. M. RELEY. LIANGR. K. ZEIDAND. J. KORNBRUSTM. E. DAVIS: "Administration in Non-Human Primates of Escalating Intravenous Doses of Targeted Nanoparticles Containing Ribonucleotide Reductase Subunit M2 SiRNA", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 104, no. 14, 2007, pages 5715 - 21, XP002609879, DOI: 10.1073/PNAS.0701458104
HORWITZ, M. AG. HARTHB. J. DILLONS. MASLESA-GALIC: "Recombinant Bacillus Calmette-Guerin (BCG) Vaccines Expressing the Mycobacterium Tuberculosis 30-KDa Major Secretory Protein Induce Greater Protective Immunity Againts Tuberculosis than Conventional BCG Vaccines in a Highly Susceptible Animal Model", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 97, no. 25, 2000, pages 13853 - 58, XP002185379, DOI: 10.1073/pnas.250480397
HOWARD, KENNETH A., ULRIK L. RAHBEK, XIUDONG LIU, CHRISTIAN K. DAMGAARD, SYS ZOFFMANN,GLUD, MORTEN ANDERSEN, MADS B. HOVGAARD: "RNA Interference in Vitro and in Vivo Using a Novel Chitosan/SiRNA Nanoparticle System", MOLECULAR THERAPY, vol. 14, no. 4, 2006, pages 476 - 84
HUH, AE JUNGYOUNG JIK KWON: "Nanoantibiotics': A New Paradigm for Treating Infectious Diseases Using Nanomaterials in the Antibiotics Resistant Era", JOURNAL OF CONTROLLED RELEASE, vol. 156, no. 2, 2011, pages 128 - 45, XP028112005, DOI: 10.1016/j.jconrel.2011.07.002
JEON, OK-CHEOL, SEUNG RIM HWANG, TASLIM A AL-HILAL, JIN WOO PARK, HYUN TAE MOON,SEULKI LEE, AND JAE HYUNG PARK, ORAL DELIVERY OF IONIC COMPLEX OF CEFTRIAXONE WITH BILE ACID DERIVATIVE IN NON-HUMAN PRIMATES, 2013, pages 959 - 67
KALHAPURE RAHUL S ET AL: "Ion pairing with linoleic acid simultaneously enhances encapsulation efficiency and antibacterial activity of vancomycin in solid lipid nanoparticles", COLLOIDS AND SURFACES B: BIOINTERFACES, ELSEVIER AMSTERDAM, NL, vol. 117, 12 March 2014 (2014-03-12), pages 303 - 311, XP028647191, ISSN: 0927-7765, DOI: 10.1016/J.COLSURFB.2014.02.045 *
KARAKI, SARASEBASTIEN BENIZRIRAQUEL MEJIASVIRGINIE BAYLOT: "Lipid-Oligonucleotide Conjugates Improve Cellular Uptake and e Ffi Ciency of TCTP-Antisense in Castration-Resistant Prostate Cancer", JOURNAL OF CONTROLLED RELEASE, vol. 258, February 2017 (2017-02-01), pages 1 - 9
KARLOWSKY, J A, M E JONES, D C MAYFIELD, C THORNSBERΗ, D F SAHM.: "Ceftriaxone Activity against Gram-Positive and Gram-Negative Pathogens Isolated in US Clinical Microbiology Laboratories from 1996 to 2000: Results from The Surveillance Network (TSN) Database-USA", INTERNATIONAL JOURNAL OF ANTIMICROBIAL AGENTS, vol. 19, no. 5, 2002, pages 413 - 26
KAUSS, T., A. GAUBERT, L. TABARAN, G. TONELLI, T. PHOEUNG, M.-H. LANGLOIS, N. WHITE, A.,CARTWRIGHT, M. GOMES, K. GAUDIN: "Development of Rectal Self-Emulsifying Suspension of a Moisture-Labile Water-Soluble Drug", INTERNATIONAL JOURNAL OF PHARMACEUTICS, vol. 536, no. 1, 2018
KAUSS, T., C. ARPIN, L. BIENTZ, P. VINH NGUYEN, B. VIALET, S. BENIZRI, AND P. BARTHELEMY: "Lipid Oligonucleotides as a New Strategy for Tackling the Antibiotic Resistance", SCIENTIFIC REPORTS, vol. 10, no. 1, 2020, XP002806903 *
KAUSS, T., C. ARPIN, L. BIENTZ, P. VINH NGUYEN, B. VIALET, S. BENIZRI, P. BARTHELEMY: "Lipid Oligonucleotides as a New Strategy for Tackling the Antibiotic Resistance", SCIENTIFIC REPORTS, vol. 10, no. 1, 2020, XP002806903, DOI: 10.1038/s41598-020-58047-x
KAUSS, T., M.-H. LANGLOIS, A. GUYONNET-DUPERAT, T. PHOEUNG, X.Y. XIE, A. CARTWRIGHT, N,WHITE, M. GOMES, K. GAUDIN: "Development of Rectodispersible Tablets and Granulate Capsules for the Treatment of Serious Neonatal Sepsis in Developing Countries", JOURNAL OF PHARMACEUTICAL SCIENCES, vol. 108, no. 8, 2019
KAVRUK, M., O. CELIKBICAK, V. C. OZALP, B. A. BORSA, F. J. HERNANDEZ, G. BAYRAMOGLU, B SALIH, M. Y. ARICAG.: "Antibiotic Loaded Nanocapsules Functionalized with Aptamer Gates for Targeted Destruction of Pathogens", CHEMICAL COMMUNICATIONS, vol. 51, 2015, pages 8492 - 95
KHIATI, SALIMNATHALIE PIERRESOAHARY ANDRIAMANARIVOMARK W. GRINSTAFFNESSIM ARAZAMFREDERIC NALLETLAURENCE NAVAILLESPHILIPPE BARTHELE: "Anionic Nucleotide Lipids for 'In Vitro' DNA Transfection", BIOCONJUGATE CHEMISTRY, vol. 20, no. 9, 2009, pages 1765 - 72, XP055484358, DOI: 10.1021/bc900163s
LEE, SEULKI, SANG KYOON KIM, DONG YUN LEE, SU YOUNG CHAE, YOUNGRO BYUN: "Pharmacokinetics of a New , Orally Available Ceftriaxone Formulation in Physical Complexation with a Cationic Analogue of Bile Acid in Rats", ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, vol. 50, no. 5, 2006, pages 1869 - 71, XP055876245, DOI: 10.1128/AAC.50.5.1869-1871.2006
LEE, SEULKISANG KYOON KIMDONG YUN LEEKYEONGSOON PARKTADIPARTHI SURESH KUMARSU YOUNG CHAEYOUNGRO BYUN: "Cationic Analog of Deoxycholate as an Oral Delivery Carrier for Ceftriaxone", JOURNAL OF PHARMACEUTICAL SCIENCES, vol. 94, no. 11, 2005, pages 2541 - 48, XP002806904 *
LEE, SEULKISANG KYOON KIMDONG YUN LEEKYEONGSOON PARKTADIPARTHI SURESH KUMARSU YOUNG CHAEYOUNGRO BYUN: "Cationic Analog of Deoxycholate as an Oral Delivery Carrier for Ceftriaxone", JOURNAL OF PHARMACEUTICAL SCIENCES, vol. 94, no. 11, 2005, pages 2541 - 86, XP055934488, DOI: 10.1002/jps.20478
LEVYSTUART BMARSHALL BONNIE: "Antibacterial Resistance Worldwide: Causes, Challenges and Responses", NATURE MEDICINE, vol. 10, no. 12S, 2004, pages S122 - 29
LONG, QIPENG, BIN JIA, YE SHI, QIAN WANG, HANYANG YU, ZHE LI: "DNA Nanodevice as a Co-Delivery Vehicle of Antisense Oligonucleotide and Silver Ions for Selective Inhibition of Bacteria Growth ", ACS APPLIED MATERIALS AND INTERFACES, vol. 13, no. 40, 2021, pages 47987 - 95
MENG, JINGRU, HUI WANG, ZHENG HOU, TAO CHEN, JINGGUO FU, XUE MA, GONGHAO HE XIAOYAN XUE, MIN JIA,XIAOXING LUO: "Novel Anion Liposome-Encapsulated Antisense Oligonucleotide Restores Susceptibility of Methicillin-Resistant Staphylococcus Aureus and Rescues Mice from Lethal Sepsis by Targeting MecA", ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, vol. 53, no. 7, 2009, pages 2871 - 78, XP055312502, DOI: 10.1128/AAC.01542-08
MENG, JINGRUHUI BAIMIN JIAXUE MAZHENG HOUXIAOYAN XUEYING ZHOUXIAOXING LUO: "Restoration of Antibiotic Susceptibility in Fluoroquinolone-Resistant Escherichia Coli by Targeting AcrB with Antisense Phosphorothioate Oligonucleotide Encapsulated in Novel Anion Liposome", JOURNAL OF ANTIBIOTICS, vol. 65, no. 3, 2012, pages 129 - 34
MIKE TYERSERIC D. BROWNGERARD D. WRIGHT: "Combinations of Antibiotics and Nonantibiotic Drugs Enhance Antimicrobial Efficacy", NATURE CHEMICAL BIOLOGY, vol. 7, no. 6, 2011, pages 348 - 50, XP055253131, DOI: 10.1038/nchembio.559
MINAKUCHI, YOSHIKOFUMITAKA TAKESHITANOBUYOSHI KOSAKAHIDEO SASAKIYUSUKE YAMAMOTOMAKIKO KOUNOKIMI HONMA ET AL.: "Atelocollagen-Mediated Synthetic Small Interfering RNA Delivery for Effective Gene Silencing in Vitro and in Vivo", NUCLEIC ACIDS RESEARCH, vol. 32, no. 13, 2004, XP002567698, DOI: 10.1093/NAR/GNH093
MOELLERING, C., ROBERT.: "Antibiotic Resistance: Lessons for the Future", INFECTIOUS DISEASES, vol. 27, pages 135 - 40
MUTHU K. KATHIRAVANADAM SKELTONTHIRUMALA GOVENDER: "Ion Pairing with Linoleic Acid Simultaneously Enhances Encapsulation Efficiency and Antibacterial Activity of Vancomycin in Solid Lipid Nanoparticles", COLLOIDS AND SURFACES B, vol. 117, 2014, pages 303 - 11, XP028647191, DOI: 10.1016/j.colsurfb.2014.02.045
NASERI, NEDAHADI VALIZADEHPARVIN ZAKERI-MILANI: "Solid Lipid Nanoparticles and Nanostructured Lipid Carriers: Structure, Preparation and Application", ADVANCED PHARMACEUTICAL BULLETIN, vol. 5, no. 3, 2015, pages 305 - 13
NGUYEN PHUOC VINH ET AL: "Oligonucleotide Solid Nucleolipid Nanoparticles against Antibiotic Resistance of ESBL-Producing Bacteria", PHARMACEUTICS 2022, 14, 299, 27 January 2022 (2022-01-27), pages 1 - 17, XP055935386, Retrieved from the Internet <URL:https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8876242/pdf/pharmaceutics-14-00299.pdf> [retrieved on 20220624] *
NUTHANAKANTI, ASHOK.: "Cytidine and Ribothymidine Nucleolipids Synthesis Organogelation, and Selective Anion and Metal Ion Responsiveness", NEW JOURNAL OF CHEMISTRY, vol. 43, no. 34, 2019, pages 13447 - 56
O'NEILL, JIM: "Tackling Drug-Resistant Infections Globally", REVIEW ON ANTIMICROBIAL, 2016, pages 1 - 84
OUMZIL, KHALID, MICHAEL A. RAMIN, CYRIL LORENZATO, AUDREY HEMADOU, JEANNY LAROCHE,MARIE JOSEE JACOBIN-VALAT, STEPHANE MORNET: "Solid Lipid Nanoparticles for Image-Guided Therapy of Atherosclerosis", BIOCONJUGATE CHEMISTRY, vol. 27, no. 3, 2016, pages 569 - 75
OZPOLAT, BA. K. SOODG. LOPEZ-BERESTEIN: "Nanomedicine Based Approaches for the Delivery of SiRNA in Cancer", JOURNAL OF INTERNAL MEDICINE, vol. 267, no. 1, 2010, pages 44 - 53, XP055242950, DOI: 10.1111/j.1365-2796.2009.02191.x
PAULINE CHABAUD ET AL., BIOCONJUGATE CHEM, vol. 17, 2006, pages 466 - 472
PELGRIFT, ROBERT YADAM J. FRIEDMAN: "Nanotechnology as a Therapeutic Tool to Combat Microbial Resistance", ADVANCED DRUG DELIVERY REVIEWS, vol. 65, no. 13-14, 2013, pages 1803 - 15, XP028782535, DOI: 10.1016/j.addr.2013.07.011
PIFER, REED, AND DAVID E. GREENBERG: "Antisense Antibacterial Compounds", TRANSLATIONAL RESEARCH, vol. 223, September 2019 (2019-09-01), pages 89 - 106, XP086241402, DOI: 10.1016/j.trsl.2020.06.001
POPELLA, LINDA, JAKOB JUNG, KRISTINA POPOVA, SVETLANA URICA-MITIC´, LARS BARQUIST,JO&DIE;RG VOGEL: "Global RNA Profiles Show Target Selectivity and Physiological Effects of Peptide-Delivered Antisense Antibiotics", NUCLEIC ACIDS RESEARCH, vol. 49, no. 8, 2021, pages 4705 - 24
READMAN, JOHN B., GEORGE DICKSON, AND NICK G. COLDHAM.: "7", FRONTIERS IN MICROBIOLOGY, 2016, pages 1 - 11
READMAN, JOHN BENEDICT, GEORGE DICKSON, AND NICK G COLDHAM.: "Tetrahedral DNA Nanoparticle Vector for Intracellular Delivery of Targeted Peptide Nucleic Acid Antisense Agents to Restore Antibiotic Sensitivity", NUCLEIC ACID THERAPEUTICS, vol. 00, no. 00, 2017, pages 1 - 6
READMAN, JOHN BENEDICTGEORGE DICKSONNICK G. COLDHAM: "Translational Inhibition of CTX-M Extended Spectrum β-Lactamase in Clinical Strains of Escherichia Coli by Synthetic Antisense Oligonucleotides Partially Restores Sensitivity to Cefotaxime", FRONTIERS IN MICROBIOLOGY, vol. 7, 2016
REARDONSARA: "Bacterial Arms Race Revs Up", NATURE, vol. 521, no. 7553, 2015, pages 402 - 3
ROBIN ET AL., ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, vol. 61, 2017, pages e01911 - 16
SAUDE, AMANDA CAROLINE MARQUES, MARIANA DORNELLES CHEROBIM, ANDRE CORREA AMARAL, SIMONI CAMPOS DIAS, OCTAVIO LUIZ FRANCO: "Nanoformulated Antibiotics:b The Next Step for Pathogenic Bacteria Control.", CURRENT MEDICINAL CHEMISTRY, vol. 20, no. 10, 2013, pages 1234 - 40
SEBASTIEN BENIZRI ET AL: "Nucleoside-Lipid-Based Nanocarriers for Sorafenib Delivery", NANOSCALE RESEARCH LETTERS, SPRINGER, US, vol. 13, no. 1, 11 January 2018 (2018-01-11), pages 1 - 8, XP021252393, ISSN: 1931-7573, DOI: 10.1186/S11671-017-2420-2 *
SHARMA, ABHINAYDEEPAK KUMAR ARYAMEENAKSHI DUAGURSHARAN SINGH CHHATWALATUL KUMAR JOHN: "Nano-Technology for Targeted Drug Delivery to Combat Antibiotic Resistance", EXPERT OPINION ON DRUG DELIVERY, vol. 9, no. 11, 2012, pages 1325 - 32
SIMEONE, LUCA, CARLO IRACE, ANTONIO DI PASCALE, DONATO CICCARELLI, GERARDINO D'ERRICO,DANIELA MONTESARCHIO: "Synthesis, Self-Aggregation and Bioactivity Properties of a Cationic Aminoacyl Surfactant, Based on a New Class of Highly Functionalized Nucleolipids", EUROPEAN JOURNAL OF MEDICINAL CHEMISTRY, vol. 57, 2012, pages 429 - 40
STREICHERLAURA MICHELLE: "Exploring the Future of Infectious Disease Treatment in a Post-Antibiotic Era: A Comparative Review of Alternative Therapeutics", JOURNAL OF, 2021, pages 285 - 95
SULLY, ERIN K., AND BRUCE L. GELLER: "Antisense Antimicrobial Therapeutics", OPINION IN MICROBIOLOGY, vol. 33 (October, pages 47 - 55
SULLY, ERIN K., BRUCE L. GELLER, LIXIN LI, CHRISTINA M. MOODY, STACEY M. BAILEY, AMY L. MOORE, MICHAEL WONG: "Peptide-Conjugated Phosphorodiamidate Morpholino Oligomer (PPMO) Restores Carbapenem Susceptibility to NDM-1-Positive Pathogens in Vitro and in Vivo", JOURNAL OF ANTIMICROBIAL CHEMOTHERAPY, 2016
TEWABE, ASHAGRACHEWTESFA MAREWGEBREMARIAM BIRHANU: "The Contribution of Nano-Based Strategies in Overcoming Ceftriaxone Resistance: A Literature Review", PHARMACOLOGY RESEARCH AND PERSPECTIVES, vol. 9, no. 4, 2021, pages 1 - 12
THANASSOULAS, ANGELOS, PHILIPPE BARTHELEMY, LAURENCE NAVAILLES, AND GILLES SIGAUD: "From Nucleobases to Nucleolipids: An ITC Approach on the Thermodynamics of Their Interactions in Aqueous Solutions", JOURNAL OF PHYSICAL CHEMISTRY 6, vol. 118, no. 24, 2014, pages 6570 - 85, XP055484390, DOI: 10.1021/jp411459w
VIALET, BRUNEARNAUD GISSOTROMAIN DELZORPHILIPPE BARTHELEMY: "Controlling G-Quadruplex Formation via Lipid Modification of Oligonucleotide Sequences", CHEM., vol. 3, 2017, pages 11560 - 63, XP055587908, DOI: 10.1039/C7CC05693A
WANG, HUI, JINGRU MENG, MIN JIA, XUE MA, GONGHAO HE, JICHEN YU, RUTAO WANG, HUI BAI,ZHENG HOU,XIAOXING LUO: "OprM as a New Target for Reversion of Multidrug Resistance in Pseudomonas Aeruginosa by Antisense Phosphorothioate Oligodeoxynucleotides", FEMS IMMUNOLOGY AND MEDICAL MICROBIOLOGY, vol. 60, no. 3, 2010, pages 275 - 82
WHO: "Global Priority List of Antibiotic-Resistant Batceria to Guide Research, Discovery, and Development of New Antibiotics", WHO, 2017
WORLD HEALTH ORGANIZATION: "Antimicrobial Resistance: Global Report on Surveillance", BULLETIN OF THE WORLD HEALTH ORGANIZATION, vol. 61, no. 3, 2014, pages 383 - 94
XUE, XIAO YAN, XING GANG MAO, YING ZHOU, ZHOU CHEN, YUE HU, ZHENG HOU, MING KAI LI, JING RU MENG, AND XIAO XING LUO: "Advances in the Delivery of Antisense Oligonucleotides for Combating Bacterial Infectious Diseases", NANOMEDICINE, 2018
ZELPHATI, OF C SZOKA: "Mechanism of Oligonucleotide Release from Cationic Liposomes", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 93, no. 21, 1996, pages 11493 - 98, XP000859038, DOI: 10.1073/pnas.93.21.11493
ZHANG, LD PORNPATTANANANGKULJ C.-M. HUC.-M. HUANG: "Development of Nanoparticles for Antimicrobial Drug Delivery", CURRENT MEDICINAL CHEMISTRY, 2010

Similar Documents

Publication Publication Date Title
de Vries et al. DNA nanoparticles for ophthalmic drug delivery
US20200339996A1 (en) Anti-tnf compounds
Xue et al. Advances in the delivery of antisense oligonucleotides for combating bacterial infectious diseases
JP6440679B2 (ja) 陰イオン性薬剤を製剤化するための方法
EP3239132B1 (fr) Lipide cationique
Tam et al. Therapeutic potentials of short interfering RNAs
US20240115730A1 (en) Tissue-specific nucleic acid delivery by 1,2-dioleoyl-3-trimethylammonium-propane (dotap) lipid nanoparticles
US20220220481A1 (en) Lipid oligonucleotide antisense against antibiotic resistance
JP6368363B2 (ja) デングウィルス特異的ｓｉＲＮＡ、そのようなｓｉＲＮＡを含む二重らせんオリゴＲＮＡ構造体およびこれを含むデングウィルス増殖抑制用組成物
WO2023135299A1 (fr) Nanoparticules solides oligonucléotidiques de nucléolipides pour lutter contre la résistance aux antibiotiques
US11529314B2 (en) Lipid-based nanoparticles for encapsulation and sustained release of therapeutic agents
CN113412330A (zh) 用于肌营养不良的外显子跳跃寡聚物缀合物
US9540638B2 (en) Lipid particle, nucleic acid transfer carrier, compound for manufacturing nucleic acid transfer carrier, method for manufacturing lipid particle, and gene transfer method
US9974862B2 (en) Lipid particles and nucleic acid delivery carrier
WO2022094320A2 (fr) Thérapie de modulation du récepteur de l&#39;interleukine-7 soluble (sil7r) pour traiter des cancers
US9453060B2 (en) Protein engineered systems for delivery of molecules
WO2021211552A1 (fr) Compositions et procédés pour l&#39;administration de médicaments et le traitement d&#39;infections virales
CN112384222B (zh) 用于肌营养不良的外显子跳跃寡聚物缀合物
JP6495995B2 (ja) 脂質粒子および核酸送達キャリア
CN112384222A (zh) 用于肌营养不良的外显子跳跃寡聚物缀合物
CN112639097A (zh) 用于肌营养不良的外显子跳跃寡聚物

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23700875

Country of ref document: EP

Kind code of ref document: A1