WO2023131345A1

WO2023131345A1 - Gene treatment drug and method for x-linked adrenoleukodystrophy

Info

Publication number: WO2023131345A1
Application number: PCT/CN2023/071616
Authority: WO
Inventors: 吴小兵
Original assignee: 北京锦篮基因科技有限公司
Priority date: 2022-01-10
Filing date: 2023-01-10
Publication date: 2023-07-13
Also published as: CN116445492A

Abstract

The present invention provides a nucleic acid and an expression construct for treating X-linked adrenoleukodystrophy (X-ALD), a pharmaceutical composition including the nucleic acid or the construct, and a method for treating X-ALD.

Description

Gene therapy drug and method for X chromosome-linked adrenoleukodystrophy

technical field

The present invention relates to the field of gene therapy, and more specifically to nucleic acids, expression constructs, and pharmaceutical compositions comprising the nucleic acid or constructs for treating X-chromosome-linked adrenoleukodystrophy (X-ALD) and for treating X-ALD. ALD method.

Background technique

X-linked adrenoleukodystrophy (X-ALD) is a common metabolic genetic disorder characterized by progressive demyelination of the central nervous system (CNS), adrenal insufficiency, and very long-chain saturated fatty acids accumulation.

The clinical types of X-ALD include Addison type, cerebral type (childrenal type, adolescent type, and adult type), adrenomyeloneuropathy type (AMN) with or without intracranial demyelination, asymptomatic or presymptomatic type , and the heterozygous type. The disease primarily affects the adrenal cortex and nervous system. The pathological changes of the nervous system are diverse, ranging from inflammatory demyelination to axonal lesions involving the ascending and descending fiber tracts of the spinal cord. (J. Berger, Pathophysiology of X-linked adrenoleukodystrophy, Biochimie 98(2014) 135e142)

X-ALD disease is caused by mutations in the ABCD1 gene (ALD). The gene is located at Xq28, consists of 10 exons, and encodes the transmembrane ATP-binding cassette transporter (ATP-binding cassette transporter, ABCD1) on the peroxisome. The ABCD1 protein is responsible for the transport of CoA-activated very long-chain fatty acids (VLCFAs) from the cytoplasm into the peroxisome for degradation. Mutations in the ABCD1 gene will lead to the incapacity of this transmembrane protein, which in turn will cause the accumulation of VLCFA in cells, resulting in neurotoxicity and adrenal toxicity.

Nathalie Cartier et al. (Hematopoietic Stem Cell Gene Therapy with a Lentiviral Vector in X-Linked Adrenoleukodystrophy, Science 326,818 (2009)) reported a hematopoietic stem cell gene therapy method for X-ALD. In this approach, autologous CD34+ cells from the patient are transduced with a lentiviral vector encoding wild-type ABCD1 for genetic correction, and the genetically corrected cells are then returned to the patient. The results showed that lentivirus-mediated expression of ABCD1 in patients' hematopoietic stem cells conferred clinical benefit. However, lentiviral gene therapy, both in clinical and preclinical animal studies, has suggested that there is a risk of introducing cancer due to lentiviral gene insertion into host DNA.

Unlike lentiviruses, gene therapy based on recombinant AAV viral vectors is considered to be a safer approach than lentiviruses because it does not depend on the integration of the viral genome in the host cell nucleus. In addition, AAV virus also has the advantages of wide host cell range and long expression time in vivo, which make it one of the most promising gene therapy vectors.

Yi Gong et al. (Adeno-associated virus serotype 9-mediated gene therapy for X-linked Adrenoleukodystrophy (X-ALD), doi:10.1038/mt.2015.6) reported a gene therapy method for X-ALD using AAV vector. The method uses a recombinant adeno-associated virus (rAAV) serotype 9 vector to deliver the human ABCD1 gene to the central nervous system (CNS) of mice through the ICV and IV routes. However, the results of this literature show that there are still many gaps in the levels of ABCD1 protein and very long-chain fatty acids in treated model mice compared with wild-type mice; After injection, although the proportion of VLFA in the total fatty acids in the brain and spinal cord of the mice was reduced, it was not significant. The reason is presumed to be the low transcription and translation ability of the target gene.

For gene drug constructs, although the desired therapeutic effect can be achieved by increasing the dosage, the safety risk in the case of high dosage is increased. Therefore, this also makes it difficult for the dose to have a more obvious room for improvement.

Cardiotoxicity has been observed in both non-clinical and clinical studies of the marketed AAV gene therapy drug 'Zolgensma'. According to the analysis, this is related to the high-dose use of AAV9 vector and the expression of the target gene in heart tissue. In addition, in their follow-up study (Intrathecal Delivery of rAAV9-ABCD1 by Osmotic Pump in a Mouse Model of Adrenomyeloneuropathy, Molecular Therapy Volume 24, Supplement 1, May 2016), Yi Gong et al. have also pointed out that although the gene construct used ABCD1 could be successfully delivered to CNS cells by IV injection, but significant cardiac tissue toxicity was induced due to the expression level of the transgene in liver and cardiac tissue much higher than that in CNS.

In view of the current problems in X-ALD treatment, there is still a need to provide new X-ALD gene therapy means in this field.

Summary of the invention

The ABCD1 gene is a widely expressed housekeeping gene, and its expression can be detected in most tissues. ABCD1 protein is abundantly expressed in the central nervous system, adrenal gland, testis and other parts, indicating that the metabolism of very long-chain fatty acids in these tissues is relatively strong. When the ABCD1 gene is deleted, the ABCD1 protein level in the central nervous system, adrenal gland, testis and other parts decreases, resulting in the blockage of the very long-chain fatty acid metabolic pathway, causing cell oxidative stress and cell death. Therefore, gene therapy for X-ALD needs to take into account both the central and peripheral regions.

On the one hand, given that damage to the central nervous system is usually dangerous, further reducing the level of very long-chain fatty acids in the central nervous system and other tissues is the development direction of X-ALD gene therapy drugs. On the other hand, the risk of toxicity associated with gene therapy drugs that cannot be used for specific expression should be considered. Therefore, in addition to increasing the expression of the target gene in the target organ, it is also necessary to achieve a specific reduction in the expression of the ABCD1 protein in tissues and organs with poor tolerance, thereby reducing the risk of toxicity.

In order to achieve this goal, the inventors have made in-depth research, and by optimizing and combining multiple gene elements, they have proposed a method that can effectively alleviate the main affected organs (central nervous system and adrenal gland) of X-ALD after systemic administration. ) disease burden, and at the same time have a new AAV virus vector with low drug peripheral tissue toxicity, and its use. The expression construct of the present invention realizes high-efficiency expression of ABCD1 through the optimized promoter and ABCD1 encoding nucleic acid; at the same time, by including an optimized combination of miRNA target sequences in the 3'UTR, the toxicity of transgene overexpression to peripheral organs is reduced , especially myocardial tissue toxicity.

Accordingly, in one aspect, the invention provides a nucleic acid encoding ABCD1 comprising: SEQ ID No: 1, or at least 90%, 95%, 96%, 97%, 98%, 99%, 99.1% thereof , 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% identical nucleotide sequences. ABCD1-encoding nucleic acid according to the present invention, in some embodiments, compared to reference nucleic acid (for example, natural human ABCD1-encoding nucleic acid, for example, from the nucleic acid sequence of NCBI accession number NM_000033.3 or the nucleic acid sequence of SEQ ID NO:15) , under the control of a constitutive promoter, the expression level (preferably, the expression level in mammalian cells) is increased by at least 200% or more, such as at least 300%, 320%, 330%, 340%, 350%, 360% %, 370%, 380%, 390%, or 400%. Preferably, the ABCD1-encoding nucleic acid according to the invention comprises a Kozak sequence at the 5' end. According to the in vitro transient expression test described in Example 1, it can be determined that the expression efficiency of the encoding nucleic acid is improved compared with the reference nucleic acid.

In yet another aspect, the present invention provides an expression construct comprising the ABCD1 encoding nucleic acid according to the present invention, especially comprising the nucleotide sequence of SEQ ID NO:1.

In some embodiments, the expression construct according to the present invention further comprises a promoter, such as a constitutive promoter, operably linked to the ABCD1 encoding nucleic acid. Preferably, the promoter comprises a nucleotide sequence selected from SEQ ID No: 2-5, or nucleotides having at least 95%, 96%, 97%, 98%, 99% or 99.5% identity therewith Sequence, especially the nucleotide sequence of SEQ ID No:2.

In still other embodiments, the expression construct according to the present invention further comprises a 3'UTR operably linked to said ABCD1 encoding nucleic acid. The 3'UTR may comprise at least 1 copy (eg, 1-8 copies, such as 2, 3, or 4 copies) of the target sequence of a myocyte-specific miRNA and/or at least 1 copy (eg, 1-8 copies, eg, 1 or 2 copies) of the target sequence of the hepatocyte-specific miRNA. Preferably, the 3'UTR comprises at least 1 copy (such as 3 copies) of a myocyte-specific miRNA target sequence and at least 1 (such as 2 copies) of a hepatocyte-specific miRNA target sequence. The at least one myocyte-specific miRNA target sequence and the at least one hepatocyte-specific miRNA target sequence may be included in the 3'UTR in various arrangements, but preferably, the myocyte-specific miRNA target sequence is Hepatocyte-specific miRNA target sequences spaced apart. The miRNA target sequences can be connected directly, or can be separated by a few nucleotides, such as 1-5 nucleotides. The muscle cell-specific miRNA target sequence that can be used in the present invention can be selected from miRNA1 target sequence, miRNA206 target sequence and combinations thereof; for example, the miRNA1 target sequence shown in SEQ ID NO:6 and the miRNA1 target sequence shown in SEQ ID NO:7 miRNA206 target sequence. The hepatocyte-specific miRNA target sequence that can be used in the present invention can be a miRNA122 target sequence, such as the miRNA122 target sequence shown in SEQ ID NO:8. In a preferred embodiment, the 3'UTR comprises miRNA target sequences arranged as follows: miRNA1 target sequence-miRNA122 target sequence-miRNA1 target sequence-miRNA122 target sequence-miRNA206 target sequence; or miRNA206 target sequence-miRNA122 target sequence- miRNA1 target sequence - miRNA122 target sequence - miRNA1 target sequence. In some more preferred embodiments, the expression construct according to the present invention comprises a 3'UTR operably linked to the ABCD1 encoding nucleic acid, said 3'UTR comprising the nucleotide sequence of SEQ ID NO:12.

In a further aspect, the invention provides a vector comprising an expression construct according to the invention. In some embodiments, the vector is a plasmid or viral vector. In some preferred embodiments, the vector is an adeno-associated viral (AAV) vector. In a further aspect, the invention also provides a host cell, preferably a mammalian cell, comprising an expression construct or vector according to the invention.

In a further aspect, the present invention provides a recombinant adeno-associated virus (AAV) vector, wherein said recombinant AAV vector comprises in its genome an expression construct according to the present invention. Preferably, the recombinant AAV vector comprises in its genome: (a) 5' and 3' AAV inverted terminal repeat (ITR) sequences, and (b) an expression construct located between the 5' and 3' ITR, Wherein said expression construct comprises the following elements functionally linked to each other in the direction of transcription: a promoter; a polynucleotide encoding human ABCD1; at least one miRNA target sequence; one or more terminators; and one or more polyA signal sequences . Preferably, the polyA signal sequence is selected from the group consisting of SV40 late polyA sequence, rabbit β-globin polyA sequence, and bovine growth hormone polyA sequence, more preferably bovine growth hormone polyA sequence, such as the nucleotide sequence of SEQ ID NO:13. The recombinant AAV viral vector according to the present invention may be a ssAAV vector or a scAAV vector. In some embodiments, a recombinant AAV viral vector according to the invention comprises a wild-type AAV2 ITR sequence, or in the case of scAAV vectors, one of said ITRs is a wild-type AAV2 ITR sequence and the other of said ITRs lacks a functional AA2ΔITR sequence of terminal melting sites (trs) and optionally D sequence. The recombinant AAV viral vector according to the present invention may comprise capsid proteins from any AAV serotype, such as AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9 serotypes, especially AAV9 serotypes . Preferably, the recombinant AAV vector is an AAV2/9 vector having AAV2 ITR sequence and AA9 capsid protein.

In yet another aspect, the present invention also provides a pharmaceutical composition comprising an expression construct according to the present invention, a vector according to the present invention or a recombinant AAV viral vector according to the present invention and a pharmaceutically acceptable carrier. The pharmaceutical composition may be formulated for different routes of administration, such as intraperitoneal, intramuscular, intraarterial, intravenous, intrathecal or intracerebroventricular administration, as desired. In a preferred embodiment, the pharmaceutical composition is an intravenous injection formulation. In a preferred embodiment, the formulation comprises a prophylactically or therapeutically effective amount of a recombinant AAV viral vector according to the invention.

In a further aspect, the invention also relates to the use of an expression construct according to the invention or a vector according to the invention or a recombinant AAV viral vector according to the invention for expressing ABCD1 in a mammalian cell, cell line or cell population, or Use in the preparation of a medicament for expressing ABCD1 in mammalian cells, cell lines or cell groups. The mammalian cells may be in vitro, ex vivo or in vivo. Therefore, in another aspect, the present invention also provides a method (such as an in vitro, in vivo, or ex vivo method) of expressing ABCD1 in mammalian cells, said method comprising using an expression construct according to the present invention or a method according to the present invention vector to transfect isolated mammalian cells, cell lines or cell populations. In some embodiments, the mammalian cell is a cell line, or a cell, such as a fibroblast, isolated from an ABCD1-deficient mammalian subject. The impact of the construct, vector or recombinant AAV virus vector of the present invention on the expression and/or viability of the target protein of the cells can be monitored by testing the expression of the target protein and/or the growth rate of the cell in vitro or in isolated cells.

In yet another aspect, the present invention provides a method for treating or preventing X-chromosome-linked adrenoleukodystrophy (X-ALD) and/or improving symptoms associated with X-ALD, wherein the method comprises administering to a subject in need The recombinant AAV viral vector according to the present invention or the pharmaceutical composition according to the present invention. Preferably, the method comprises intraperitoneal, intramuscular, intraarterial, intravenous, intrathecal or intracerebroventricular administration, more preferably intravenous injection of a recombinant AAV viral vector according to the invention. Preferably, the recombinant AAV viral vector is an AAV9 vector. In some embodiments, by IV administration of the recombinant AAV virus vector of the present invention, the plasma and tissues of the subject, especially the adrenal gland and cerebellum, the biochemical markers of X-ALD disease—very long chain fatty acid VLCFA (especially C26:0 fatty acid)——The content is reduced. In some embodiments, autophagic activity stimulated by VLCFA accumulation in the subject's spinal cord is alleviated/improved by IV administration of a recombinant AAV viral vector of the invention. In some embodiments, the methods of the invention ameliorate/alleviate symptoms of progressive demyelination of the subject's CNS.

In yet another aspect, the present invention also provides an expression construct comprising a 3'UTR operably linked to a gene, wherein said 3'UTR comprises:

-miRNA1 target x2 (ie, 2 copies of the miRNA1 target sequence) -miRNA206 target x1 (ie, 1 copy of the miRNA206 target sequence) -miRNA122 target x2 (ie, 2 copies of the miRNA122 target sequence); e.g. SEQ ID NO :9

-miRNA1 target x2 (i.e., 2 copies of the miRNA1 target sequence) -miRNA122 target x2 (i.e., 2 copies of the miRNA122 target sequence) -miRNA206 target x1 (i.e., 1 copy of the miRNA206 target sequence); e.g., SEQ ID NO:10

-miRNA1 target x1 (i.e., 1 copy of miRNA1 target sequence)-miRNA122 target x1 (i.e., 1 copy of miRNA122 target sequence)-miRNA1 target x1 (i.e., 1 copy of miRNA1 target sequence)-miRNA122 target x1 ( That is, 1 copy of the miRNA122 target sequence)-miRNA206 target x1 (ie, 1 copy of the miRNA206 target sequence); for example, SEQ ID NO: 11. In some embodiments, the expression construct according to the present invention can be used to selectively reduce the expression of a gene of interest operably linked thereto in muscle cells and liver cells, or to prepare a gene for selectively reducing the expression of a gene of interest in Use in drugs expressed in muscle cells and hepatocytes.

Description of drawings

Figure 1 shows the schematic diagram of the expression construct used in the present invention (Figure 1A) and the expression detection results of the optimized ABCD1 encoding nucleic acid (Figure 1B). In Fig. 1A, ITR: ITR sequence of AAV virus; CA: CA promoter; CAR-Mut: CAR promoter with mutation; hABCD1: natural human ABCD1 encoding nucleic acid; coABCD1: optimized ABCD1 encoding nucleic acid; EGFP: enhanced green Fluorescent protein; polyA: polyA signal sequence; 3'UTR: 3' untranslated region. The left panel of Figure 1B shows that the natural human ABCD1-encoding nucleic acid (hABCD1) and the optimized ABCD1-encoding nucleic acid (coABCD1) were transiently expressed in HEK293 cells, the cells were lysed after 48 hours, and the total cellular protein was extracted and separated by electrophoresis on 10% SDS-PAGE Protein bands (the upper left figure shows the ABCD1 protein band, and the lower left figure shows the actin band); the right figure in Figure 1B shows that the fluorescent color results of the bands separated by electrophoresis are relatively gray after grayscale scanning degree value.

Figure 2 shows a schematic diagram of the pscAAV-CAR-Gluc plasmid vector.

Figure 3 shows that in an assay based on cultured cells in vitro, compared with BHK-21 cells that were not transfected with the plasmid (i.e., blank control), the pscAAV-CAR-Gluc vector and the pscAAV-CAR-MutC-Gluc vector were transfected. Changes in Gluc levels measured in BHK-21 cells with vector, pscAAV-CAR-MutA-Gluc vector and pscAAV-CAR-MutG-Gluc vector. Among them, ** means p<0.01.

Figure 4 shows that in the EGFP-based expression plasmid vector, the impact of the target sequence embedded in miRNA1, 122, and 206 on the expression of the target gene in muscle cells and liver cells was detected.

Figure 5 shows that in the expression plasmid vector based on the Gluc reporter gene, the effect of increasing the number of repetitions of the miRNA target sequence and changing the arrangement and combination of the miRNA target sequence on the expression of the target gene in muscle cells was detected.

Figure 6 shows that in the Gluc reporter gene-based expression plasmid vector, the effect of increasing the number of repeats of the miRNA target sequence and changing the arrangement and combination of the miRNA target sequence on the expression of the target gene in hepatocytes was detected.

Figure 7 shows a schematic diagram of the basic plasmid pRDAAV-CMV-EGFP used to construct the AAV plasmid vector.

Figure 8 shows that using fibroblasts from X-ALD patient 1 and patient 2, the impact of recombinant AAV9-coABCD1 virus transduction on the expression of ABCD1 in cells was determined in the cell slide immunofluorescence assay. The red fluorescence shows the ABCD1 protein in the cytoplasm stained by the dylight549-labeled secondary antibody; the blue fluorescence shows the nuclei stained by dapi.

Figure 9 shows the effect of recombinant AAV9-coABCD1 virus transduction on cell growth and proliferation rate. Figures 9A and 9B show the cell densities of patient 2 fibroblasts not inoculated with AAV9-coABCD1 and inoculated with AAV9-coABCD1 at 7 days in culture, respectively. Figure 9C shows the cell density of normal human fibroblasts in culture for 7 days.

Figure 10 shows the changes in the content of very long chain fatty acids in various tissues after injection of AA9-coABCD1 or AAV9-coABCD1-miT recombinant virus compared to untreated C57BL6J wild-type mice (WT). Among them, * means p<0.05.

Figure 11 shows the histopathological changes in the test animals after injection of AA9-coABCD1 or AAV9-coABCD1-miT recombinant virus. Figure 11A shows that inoculation with the optimized recombinant virus rAAV9-coABCD1-miT significantly reduced the pathological changes in the hearts and livers of the tested mice. Black arrows indicate vacuolar degeneration of the heart and nuclear pyknosis and focal necrosis of the liver. Figure 11B shows the autopsy results of a dead mouse in the test animal group inoculated with rAAV9-coABCD1, the histopathological examination results of the heart tissue in the above figure, the black arrow indicates the occurrence of large-area vacuolar degeneration of the myocardium; Red arrows indicate extensive intracardiac thrombus formation; lower panel shows histopathological examination of liver tissue, showing extensive hepatocyte necrosis and nuclear pyknosis.

FIG. 12 shows the evaluation of the effect of administering AAV9-coABCD1-miT on the behavior of X-ALD model mice in the rope grabbing experiment. The results showed that intravenous administration of AAV9-coABCD1-miT effectively improved the exercise capacity of model mice.

Figure 13 shows that 8 weeks after the optimized drug AAV9-coABCD1-miT was administered to X-ALD model mice, the content of very long chain fatty acids in each tissue was detected, and compared with unadministered X-ALD model mice and wild animals. normal mice for comparison. Among them, * indicates p<0.05; NS indicates that the difference is not significant.

Figure 14 shows the histopathological results of the adrenal glands of X-ALD model mice treated with AAV9-coABCD1-miT tail vein injection 8 weeks after administration. The red fluorescence shows the ABCD1 protein in the immunofluorescence-labeled cells; the blue fluorescence shows that the nuclei are stained.

Figure 15 shows that after AAV9-coABCD1-miT administration, LC3β was immunofluorescently labeled on spinal cord tissue sections to evaluate the autophagy and improvement in the nervous system of X-ALD model mice.

Figure 16 shows that after intravenous injection of optimized (AAV9-coABCD1-miRT) and unoptimized drugs (AAV9-coABCD1) into normal wild-type mice (2 mice in each group), the Western Blot method was used to determine the ABCD1 protein content. Figure 16A shows the Western Blot detection results, wherein the upper figure shows the ABCD1 band, and the lower figure shows the β-actin band; wherein,

lanes

1 and 2 are mice administered with AAV9-coABCD1 (RD48-1 and RD48 -2); lanes 3-4 are mice administered with AAV9-coABCD1-miRT (RD49-2 and RD49-4);

lanes

5 and 6 are normal mouse controls without administration (N1 and N2). Figure 16B shows the quantification results obtained by analyzing the gray value of the Western Blot detection result pictures using the software ImageJ.

Detailed description of the invention

The invention discloses a gene therapy construct, a pharmaceutical composition and a method for treating X-ALD, especially the construction, preparation and application of a recombinant AAV vector for delivering ABCD1.

Unless defined otherwise hereinafter, all technical and scientific terms used in this specification have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In addition, the materials, methods, and examples described herein are illustrative only and not intended to be limiting. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the appended claims.

definition

The term "about" when used in conjunction with a numerical value is meant to encompass a numerical value within a range having a lower limit of 5% less and an upper limit of 5% greater than the stated numerical value. The term is also intended to cover values within ±1%, ±0.5%, or ±0.1% of the specified figure.

As used herein, the term "comprising" or "comprising" means including stated elements, integers or steps, but not excluding any other elements, integers or steps.

Herein, the expression "and/or", when used to connect multiple items, means any one of the listed related items, or any and all possible combinations of a plurality or all of the listed related items.

Herein, recombinant adeno-associated virus can be represented by the AAV virus serotype from which the capsid is derived alone, or by the AAV virus serotype from which the capsid and genomic ITR sequences are derived. In the latter case, in this paper, the identifier "/" is used for separation, followed by the serotype of origin of the capsid and before the identifier "/" by the serotype of origin of the ITR. Thus, for example, the number 9 in the expression recombinant AAV9 indicates that the recombinant adeno-associated virus has a capsid from the AAV9 serotype; while the number before the identifier "/" in the expression recombinant AAV2/9 indicates that the recombinant adeno-associated virus has The wild-type or variant ITR sequence from AAV2, while the number after the identifier "/" indicates that the recombinant adeno-associated virus has a capsid protein from AAV9.

The term "functionally linked", also known as "operably linked" or "operably linked", means that the named components are in a relationship allowing them to function in their intended manner.

The term sequence "identity" is used to describe the similarity in sequence structure between two amino acid sequences or polynucleotide sequences. To determine the percent identity of two amino acid sequences or two nucleic acid sequences, the sequences can be aligned for optimal comparison purposes (e.g., the first and second amino acid sequences or the first and second amino acid sequences can be aligned for optimal alignment). Gaps may be introduced into one or both of the first and second nucleic acid sequences or non-homologous sequences may be discarded for comparison purposes). In a preferred embodiment, for comparison purposes, the length of the reference sequence being aligned is at least 30%, preferably at least 40%, more preferably at least 50%, 60% and even more preferably at least 70%, 80%, 90%, 100%. The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide at the corresponding position in the second sequence, then the first and second sequences are identical at that position.

The comparison of sequences and the calculation of percent identity between two sequences can be accomplished using a mathematical algorithm. In a preferred embodiment, the Needlema and Wunsch ((1970) J. Mol. Biol. 48:444-453) algorithm (available at http://www.gcg.com available), use the Blossum 62 matrix or the PAM250 matrix with gap weights of 16, 14, 12, 10, 8, 6 or 4 and length weights of 1, 2, 3, 4, 5 or 6 to determine the distance between two amino acid sequences. percent identity. In yet another preferred embodiment, using the GAP program in the GCG software package (available at http://www.gcg.com), using the NWSgapdna.CMP matrix and gap weights of 40, 50, 60, 70 or 80 and Length weights of 1, 2, 3, 4, 5 or 6 determine the percent identity between two nucleotide sequences. A particularly preferred parameter set (and one that should be used unless otherwise stated) is the Blossum 62 scoring matrix with a gap penalty of 12, a gap extension penalty of 4, and a frameshift gap penalty of 5.

It is also possible to use a PAM120 weighted remainder table, a gap length penalty of 12, and a gap penalty of 4, using the E. Meyers and W. Miller algorithm that has been incorporated into the ALIGN program (version 2.0), ((1989) CABIOS, 4:11-17 ), to determine the percent identity between two amino acid sequences or nucleotide sequences.

The term "host cell" refers to a cell into which an exogenous polynucleotide has been introduced, including the progeny of such cells. In some embodiments, the host cell is any type of cell that can be used to produce a recombinant AAV vector of the invention, for example, mammalian cells (such as HEK 293 cells suitable for production of recombinant AAV by a three-plasmid packaging system) and insect cells ( For example sf9 cells suitable for the production of recombinant AAV by the baculovirus packaging system).

The term "regulatory sequence" or "expression control sequence" refers to a nucleic acid sequence that induces, represses, or otherwise controls the transcription of a protein of an encoding nucleic acid sequence to which it is operably linked. Regulatory sequences can be, for example, initiation sequences, enhancer sequences, intron sequences, and promoter sequences, among others.

The terms "exogenous" or "heterologous" are used interchangeably when describing a nucleic acid or protein to mean that the nucleic acid or protein does not naturally exist in the chromosomal or host cell location in which it is found. An exogenous nucleic acid sequence also refers to a sequence that is derived from and inserted into the same host cell or subject but exists in a non-native state, eg, the sequence is present in a different copy number, or is under the control of a different regulatory element.

As used herein, an "isolated" polynucleotide (eg, isolated DNA or isolated RNA) means that the polynucleotide is at least partially separated from at least some other components of the native organism or virus in which it is comprised. In some embodiments, an "isolated" nucleic acid is enriched at least about 10-fold, 100-fold, 1000-fold, 10,000-fold or more relative to the starting material.

As used herein, an "isolated" polypeptide refers to a polypeptide that is at least partially separated from at least some other components of the native organism or virus in which it is contained. In some embodiments, an "isolated" polypeptide is enriched at least about 10-fold, 100-fold, 1000-fold, 10,000-fold or more relative to the starting material.

As used herein, an "isolated" or "purified" viral vector means that the viral vector has been partially separated from at least some components of the starting material comprising it. In some embodiments, an "isolated" viral vector is enriched at least about 10-fold, 100-fold, 1000-fold, 10,000-fold or more relative to the starting material.

As used herein, the term "viral vector" refers to a viral particle (such as an AAV viral particle) capable of serving as a delivery vehicle for a nucleic acid of interest. Generally, a viral vector comprises a capsid and a viral genome (for example, viral DNA) packaged therein, and the target nucleic acid to be delivered is inserted into the viral genome. In the case of recombinant AAV viral vectors, in order to generate recombinant virus particles that can deliver the nucleic acid of interest to tissues or cells, it is usually only necessary to retain the inverted terminal repeat (ITR) cis element in the genome, while the rest required for viral packaging Sequences can be provided in trans. Accordingly, in some embodiments, the recombinant AAV viral vectors of the present invention comprise a capsid and a recombinant viral genome packaged therein, wherein the recombinant viral genome comprises or consists of one or more exogenous genes located between two AAV ITR sequences. Source nucleotide sequence composition. The two ITR sequences located at the 5' and 3' ends of the recombinant viral genome (i.e., 5'ITR and 3'ITR) may be the same or different.

The term AAV "inverted terminal repeat" (inverted terminal repeat, ITR) refers herein to a cis-acting element from the AAV viral genome that plays an important role in the integration, rescue, replication, and genome packaging of the AAV virus. The ITR sequence of the natural AAV virus contains a Rep protein binding site (Rep binding site, RBS) and a terminal unzipping site trs (terminal resolution site), which can be recognized by the Rep protein and generate a nick at the trs. The ITR sequence can also form a unique "T" letter-shaped secondary structure, which plays an important role in the life cycle of the AAV virus. The earliest isolated AAV virus, AAV2, has "inverted terminal repeats" (ITRs) with a palindrome-hairpin structure of 145 bp located at both ends of the genome. Later, different ITR sequences were found in various serotypes of AAV viruses, but they all formed hairpin structures and had Rep binding sites. Traditional recombinant AAV viral vectors based on these wild-type ITR sequences are generally single-stranded AAV vectors (ssAAV), and the viral genome is packaged in the AAV capsid in a single-stranded form. Different from this type of ssAAV, it has been found that by modifying the ITR and deleting the trs sequence and optionally the D sequence in the ITR sequence on one side of the AAV virus, the genome carried by the recombinant AAV virus vector obtained by packaging can be self-complementary to form a double chain (Wang Z et al., Gene Ther. 2003; 10(26):2105-2111; McCarty DM et al., Gene Ther. 2003; 10(26):2112-2118). The virus thus packaged is a double-stranded AAV virus, that is, scAAV (self-complementary AAV) virus. The packaging capacity of the scAAV viral vector is smaller, only half of the packaging capacity of the ssAAV viral vector, about 2.2kb-2.5kb, but the transduction efficiency after infection of cells is higher.

As used herein, the term ITR in relation to AAV encompasses wild-type ITRs and variant ITRs. Wild-type ITRs can be from any native AAV virus, such as an AAV2 virus. The wild-type ITR contains a Rep protein binding site (Rep binding site, RBS) and a terminal unzipping site trs (terminal resolution site), which can be recognized by the Rep protein and generate a nick at trs. The wild-type ITR sequence can form a unique "T" letter-shaped secondary structure, which plays an important role in the life cycle of AAV virus. As used herein, a variant ITR is a non-native ITR sequence which may, for example, be derived from any wild-type AAV ITR sequence and which comprises a deletion, substitution, and/or addition of one or more nucleotides relative to the wild-type ITR, and/ Or truncated, but still functional, ie, can be used to generate ssAAV viral vectors or scAAV viral vectors. In some embodiments, a variant ITR is an AAV ITR sequence (also referred to herein as a ΔITR) that has been deleted for a functional trs site and optionally a D region sequence. In some embodiments, wild-type ITRs are combined with ΔITRs to generate self-complementary recombinant AAV viral vectors (scAAV). In other embodiments, two wild-type ITRs are used in combination to generate single-chain recombinant AAV viral vectors (ssAAV).

The AAV proteins VP1, VP2 and VP3 are capsid proteins that interact to form the AAV capsid. Different serotypes of AAV viruses have different tissue infection tropisms, and foreign genes can be transferred to specific organs and tissues by selecting the source serotype of the recombinant AAV virus vector capsid (Wu Z et al., Mol Ther.2006; 14(3):316-327). In the present invention, the recombinant AAV virus vector can have different targeting properties by selecting the source serotype of the capsid. In some embodiments, the capsid of the recombinant AAV virus is from an AAV serotype that targets neuronal cells. In one embodiment, the recombinant AAV viral vector comprises a capsid from AAV9. In yet another embodiment, the recombinant AAV viral vector comprises a capsid from AAV9 and an ITR from AAV2.

The term "treatment" refers to medical intervention intended to alter the natural course of a disease in the individual being treated. Desired therapeutic effects include, but are not limited to, preventing the onset or recurrence of the disease, alleviating symptoms, reducing any direct or indirect pathological consequences of the disease, preventing metastasis, reducing the rate of disease progression, ameliorating or palliation of the disease state, and remission or improved prognosis. In some embodiments, the recombinant AAV virus of the present invention, after administration to an ABCD1-deficient subject or an X-ALD patient, preferably after systemic administration, reduces the number of affected tissues (especially, the adrenal gland and central nervous system) of the subject. Nervous system) VLCFA content. In some embodiments, the recombinant AAV virus of the present invention improves central nervous system damage and/or adrenal damage in a subject after administration to an ABCD1-deficient subject or an X-ALD patient, preferably after systemic administration. In some embodiments, the recombinant AAV virus of the invention improves the exercise capacity of the subject after administration to an ABCD1-deficient subject or an X-ALD patient, preferably after systemic administration.

As used herein, "prevention" includes the inhibition of the occurrence or development of a disease or symptoms of a particular disease. In some embodiments, subjects predisposed to developing X-ALD disease are candidates for prophylactic regimens. In general, the term "prevention" refers to medical intervention performed before at least one symptom of a disease occurs. Therefore, in one embodiment, prevention includes administering the gene therapy drug of the present invention in subjects with ABCD1 gene deficiency before the symptoms of X-ALD disease occur, so as to delay the development of the disease or prevent the appearance of the disease. In one embodiment, the prevention includes using the gene therapy drug of the present invention to improve the abnormal phagocytosis stimulated by VLCFA in the nervous system, thereby preventing the occurrence of related spinal cord axonal lesions.

Various aspects of the invention are described below.

I. Constructs for Gene Therapy

A variety of factors can affect the expression of a transgene in a desired target cell, including the promoter, gene-encoding nucleic acid, 5'UTR, 3'UTR, and transcription factors or regulators available in the transfected target cell (e.g., cell The type, quantity and activity of expressed miRNA). These factors influence each other. Therefore, in order to construct a gene construct that effectively achieves the purpose, it is usually necessary to comprehensively examine the combination of elements of the gene construct according to the characteristics of the disease, such as affected target organs and tissue cells. Therefore, the present inventors have established an effective and safe gene construct for X-ALD treatment by optimizing and combining multiple components of the construct and based on in-depth research. The gene construct according to the present invention has at least one or more optimized gene elements as follows: (1) optimized ABCD1 encoding nucleic acid (also referred to as coABCD1 for short); (2) optimized constitutive promoter; and (3) optimized combination of miRNA target sequences.

ABCD1 encoding nucleic acid

The ABCD1-encoding nucleic acid contained in the construct of the present invention may be any polynucleotide capable of encoding functional ABCD1 protein activity. However, in order to facilitate expression in mammalian cells, it is advantageous to optimize the nucleic acid sequence of the nucleic acid encoding the ABCD1 polypeptide. In one embodiment, the ABCD1 encoding nucleic acid used in the expression construct of the present invention comprises the polynucleotide sequence of SEQ ID NO: 1, or has at least about 95%, about 96%, about 97%, 98%, Polynucleotide sequences with 99% or greater nucleotide sequence identity. Advantageously, the optimized ABCD1-encoding nucleic acid, with respect to a reference nucleic acid (for example, a natural human ABCD1-encoding nucleic acid, such as a nucleic acid having the nucleotide sequence shown in SEQ ID NO: 15), is in an operably linked composition An increased expression level in a host cell, especially a mammalian cell, under the control of a promoter, eg, an increase of at least 200%, eg, at least 250%, at least 300%, at least 350%, or at least 400%. Assays for determining protein expression levels are known in the art. Any such assay can be used by one skilled in the art to determine the degree of optimization achieved in terms of expression efficiency of an optimized ABCD1-encoding nucleic acid compared to a reference nucleic acid.

In one embodiment, the optimized ABCD1-encoding nucleic acid according to the present invention may comprise a Kozak sequence located upstream of the start codon at the 5' end. The Kozak sequence used in the present invention may be a consensus sequence defined as GCCRCC, wherein R is a purine (ie A or G), and wherein said sequence is located upstream of the start codon. In a preferred embodiment, the construct of the invention comprises a Kozak sequence, wherein said Kozak sequence has a 5'-GCCACC-3' sequence. Other different Kozak sequences can also be used in the constructs of the invention.

Promoter

The construct of the present invention may contain any promoter that can be used to promote the expression of an ABCD1-encoding nucleic acid in a mammalian cell of interest. Advantageously, the mutant constitutive promoter CAR-Mut according to the invention is included. The CAR-Mut constitutive promoter of the present invention can efficiently promote the expression of exogenous genes in various tissues, so it is especially suitable for use in the treatment method of the present invention, so as to take into account the peripheral and central therapeutic purposes of X-ALD.

In one embodiment, the construct of the invention comprises a CAR-Mut promoter comprising a polynucleotide selected from the group consisting of:

(i) the polynucleotide of SEQ ID NO:5,

(ii) polynucleotides having at least 95%, 96%, 97%, 98%, 99%, 99.5% identity to SEQ ID NO.5,

(iii) a polynucleotide obtained by substitution, deletion or addition of one or several nucleotides in the polynucleotide of SEQ ID NO.5,

And wherein, the polynucleotide has a mutated nucleotide C or G or A at nucleotide 568 of SEQ ID NO:5 or the corresponding position, more preferably T is mutated to C.

In a preferred embodiment, the mutant promoter of the present invention, relative to a reference promoter consisting of a corresponding polynucleotide without said mutation, increases the expression of a gene of interest functionally linked thereto, e.g., makes said gene of interest Gene expression is increased by 1%-70%, eg, at least 5%, 10%, 20%, 30%, 40%, or at least 50%, 60%.

In yet another preferred embodiment, the mutant promoter of the present invention increases the expression of the gene of interest functionally linked thereto in mammalian cells or tissues, for example, increases the expression of the gene of interest in mammals relative to the reference promoter. Expression in peripheral tissues and/or central nervous tissues, especially in the central nervous system. Preferably, the mammal is a human or a non-human mammal, eg, a mouse, a rat and a non-human primate.

In some further embodiments, the promoter comprises a nucleotide sequence selected from any one of SEQ ID NOs: 2 to 4, or differs therefrom by one or several nucleotide substitutions, deletions and/or additions and has Nucleotide sequences with equivalent promoter activity. Preferably, the promoter comprises or consists of the nucleotide sequence of SEQ ID NO:2.

Those skilled in the art can use any promoter functional assay known in the art (such as the luciferase reporter gene expression assay in Example 1) to determine whether any two promoters have equivalent promoter activity. In one embodiment, under the same test conditions, compared with the reference promoter (such as SEQ ID NO: 5), if the promoter to be tested has the same or substantially the same activity, for example, the activity of the reference promoter ± 10% , preferably ±5%, or more preferably ±1%, then the promoter to be tested can be considered to have equivalent promoter activity.

miRNA target sequence

Before gene therapy enters clinical trials, it not only needs to be optimized for its efficacy, but also needs to be carefully optimized to prove its safety.

MicroRNA (miRNA) is an endogenous small non-coding RNA that can regulate cellular gene expression in a sequence-specific manner, usually by repressing translation of target mRNAs. Endogenous miRNAs can suppress the expression of transgenes in expression cassettes that contain their perfectly complementary target sequences. The level of repression is related to factors such as the promoter used to express the construct, the corresponding miRNA abundance in the target tissue cells, and the like. According to in-depth research, the inventors found that in the expression construct containing a constitutive promoter, embedding specific types, quantities and arrangements of miRNA target cells in the 3' UTR can increase the safety of gene therapy based on the expression construct sex.

In some embodiments, therefore, the expression constructs of the invention further comprise one or more miRNA target sequences located in the 3'UTR operably linked to the coding nucleic acid sequence of interest. Without being bound by any particular theory, inclusion of miRNA target sequences in expression constructs will allow for the modulation (eg, inhibition) of expression of a gene of interest in cells and tissues producing the corresponding miRNA. Thus, in some embodiments, the expression constructs of the invention comprise one or more miRNA target sequences, so that the expression of ABCD1 can be downregulated in a cell type specific manner.

miRNA target sequences that can be used in the present invention include target sequences of muscle cell-specific miRNA and target sequences of hepatocyte-specific miRNA. The muscle cell-specific miRNA target sequence that can be used in the present invention can be selected from miRNA1 target sequence, miRNA206 target sequence and combinations thereof; for example, the miRNA1 target sequence shown in SEQ ID NO:6 and the miRNA1 target sequence shown in SEQ ID NO:7 miRNA206 target sequence. The liver cell-specific miRNA target sequence that can be used in the present invention can be a miRNA122 target sequence, such as the miRNA122 target sequence of SEQ ID NO:8.

The liver cell-specific miRNA target sequence contained in the expression construct according to the present invention can be at least one or more, and preferably 2-4, which can be connected in series or arranged at intervals with the muscle cell-specific miRNA target sequence . Similarly, the muscle cell-specific miRNA target sequence contained in the expression construct according to the present invention can be at least one or more, and preferably 2-4, which can be connected in series or combined with the liver cell-specific miRNA target sequence. Sequence spaced. The miRNA target sequences can be connected directly, or can be separated by a few nucleotides, such as 1-5 nucleotides.

In some embodiments, an expression construct according to the invention comprises a 3' UTR operably linked to said ABCD1 encoding nucleic acid. The 3'UTR comprises at least 1 copy (eg, 1-8 copies, such as 2, 3, or 4 copies) of the target sequence of a myocyte-specific miRNA and/or at least 1 copy (eg, 1 - 8 copies, eg 1 or 2 copies) of the target sequence of the hepatocyte-specific miRNA. Preferably, the 3'UTR comprises at least 1 copy (such as 3 copies) of a myocyte-specific miRNA target sequence and at least 1 (such as 2 copies) of a hepatocyte-specific miRNA target sequence. The at least one myocyte-specific miRNA target sequence and the at least one hepatocyte-specific miRNA target sequence may be present in various arrangements in the 3'UTR, but preferably, the myocyte-specific miRNA target sequence Spaced with hepatocyte-specific miRNA target sequences. In a preferred embodiment, the 3'UTR comprises miRNA target sequences arranged as follows: miRNA1 target sequence-miRNA122 target sequence-miRNA1 target sequence-miRNA122 target sequence-miRNA206 target sequence; or miRNA206 target sequence-miRNA122 target sequence- miRNA1 target sequence - miRNA122 target sequence - miRNA1 target sequence. In some more preferred embodiments, the expression construct according to the present invention comprises a 3'UTR operably linked to the ABCD1 encoding nucleic acid, said 3'UTR comprising the nucleotide sequence of SEQ ID NO:12.

expression construct

In one aspect, the invention provides expression constructs. The expression construct of the present invention can be advantageously used for gene therapy of X-ALD disease.

In one embodiment, the expression construct of the invention comprises the following elements functionally linked to each other in the direction of transcription:

-Promoter,

-Kozak sequence,

-encoding ABCD1 nucleic acid, preferably, according to the optimized ABCD1 encoding nucleic acid of the present invention, more preferably comprises the nucleic acid of nucleotide sequence shown in SEQ ID NO:1,

- at least one miRNA target sequence;

- one or more transcription terminators,

- polyA signal sequence.

In some embodiments, the expression construct also includes two ITR sequences. For example, from the 5' end to the 3' end, the expression construct may comprise elements arranged as follows: 5'ITR-promoter-ABCD1 coding sequence-miRNA target sequence-polyA-3'ITR. In some embodiments, the 5'ITR and 3'ITR are the same. In another embodiment, the 5'ITR and the 3'ITR are different and one (preferably the 3'ITR) is a ΔITR lacking a functional trs site. In one embodiment, the 5'ITR and 3'ITR in the expression construct are identical and both comprise or consist of the AAV2 ITR sequence.

The promoter used in the expression construct of the present invention may be the CAR-Mut promoter described in any of the above embodiments of the present invention. In a preferred embodiment, the promoter comprises or consists of the nucleotide sequence of SEQ ID No:2. In another preferred embodiment, the promoter comprises or consists of the nucleotide sequence of SEQ ID NO:3. In another preferred embodiment, the promoter comprises or consists of the nucleotide sequence of SEQ ID NO:4.

The ABCD1-encoding nucleic acid used in the expression construct of the present invention may be the ABCD1-encoding nucleic acid described in any of the above embodiments of the present invention. In a preferred embodiment, the encoding nucleic acid comprises or consists of the nucleotide sequence of SEQ ID NO:1.

The miRNA target sequence used in the expression construct of the present invention may be the miRNA target sequence described in any of the above embodiments of the present invention, in particular, at least one hepatocyte-specific miRNA target sequence according to the present invention and at least one muscle specific miRNA target sequence according to the present invention. Cell-specific miRNA target sequence, preferably, comprises the nucleotide sequence of SEQ ID NO:12.

Transcription terminators useful in the present invention include any nucleic acid sequence that can terminate translation of a nucleic acid. For example, the terminator can be "TAG", "TGA" or "TAA", and the corresponding RNA sequence is "UAG", "UGA" or "UAA".

In some embodiments, the expression construct of the invention further comprises at least one polyA tail located downstream of the ABCD1 encoding nucleic acid and the miRNA target sequence. Any suitable polyA sequence may be used, including but not limited to hGHpolyA, BGHpolyA, SV40 late polyA sequence, rabbit β-globin polyA sequence, or any variant thereof. In a preferred embodiment, polyA is BGHpolyA, such as polyA shown in SEQ ID NO: 13, or has at least 80%, 85%, 90%, 95%, 96%, 97% with SEQ ID NO: 13, A polyA polynucleotide sequence having 98% or 99% nucleotide sequence identity.

In some aspects, the invention also provides vectors comprising expression constructs of the invention. In some embodiments, the vector is a plasmid (eg, a plasmid used for recombinant viral particle production). In other embodiments, the vector is a viral vector, such as a recombinant AAV vector or a baculovirus vector. In some embodiments, the genome of the recombinant AAV vector is single-stranded (eg, single-stranded DNA). In some embodiments, the genome of the recombinant AAV vector is self-complementary.

In a further aspect, the present invention also provides host cells, such as mammalian cells or insect cells, comprising the expression construct or vector of the present invention. In some embodiments, the cells can be used to produce recombinant AAV viruses.

recombinant AAV vector

In one aspect, the invention provides recombinant AAV vectors. The recombinant AAV vectors of the present invention are particularly useful for X-ALD disease or ameliorating symptoms associated therewith. In one embodiment, the recombinant AAV vector comprises a capsid and nucleic acid located within the capsid, also referred to herein as the "genome of the recombinant AAV vector." The genome of the recombinant AAV vector contains multiple elements, including but not limited to two inverted terminal repeats (ITRs, i.e., 5'-ITR and 3'-ITR), and other elements located between the two ITRs, including the promoter , a heterologous gene, and a polyA tail. Preferably, at least one miRNA target sequence may also be included between the two ITRs.

As used herein, adeno-associated virus (AAV) includes, but is not limited to, AAV of any serotype, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 AAV, and AAV with AAV with artificially altered capsid proteins. The genome sequences of various serotypes and artificial AAVs and their native inverted terminal repeat (ITR) sequences, Rep proteins and capsid cap proteins are known in the art. These sequences can be found in public databases such as GenBank or in the literature.

In some embodiments, the present invention provides a recombinant AAV viral vector comprising a capsid, wherein the capsid is composed of a capsid protein capable of crossing the blood-brain barrier, such as AAV9, AAVPHP.B, AAVPHP.eB capsid protein. In some embodiments, the recombinant AAV vectors of the invention transduce cells of the central nervous system (CNS), including neuronal cells and glial cells, as well as peripheral non-neuronal cells. In other embodiments, recombinant AAV vectors are capable of targeting and transducing neuronal cells, astrocytes, and microglia after systemic administration. In another embodiment, the recombinant AAV vector is capable of targeting and transducing the peripheral organs and central nervous system of a subject following systemic administration. In yet another embodiment, the recombinant AAV vector is capable of targeting and transducing multiple tissues (e.g., brain, spinal cord, adrenal gland) of a subject following systemic administration, and preferably, is compatible with non-administered recombinant AAV vectors. The recombinant AAV vector resulted in higher expression of the foreign gene of interest (the gene encoding ABCD1 in this application) and/or reduced VLCFA levels in the targeted and transduced tissues compared to control subjects. At the biochemical level, the therapeutic efficacy of the recombinant AAV vector or gene drug of the present invention can be detected by decreasing the cellular level of saturated linear VLCFA (C24:0 and C26:0, especially C26:0).

In some embodiments, the recombinant AAV vectors of the invention have a capsid from an AAV9 serotype (also referred to herein as an AAV9 vector); preferably, the recombinant AAV vector has a wild-type or capsid from AAV2 in its genome. Variant ITR sequences (also referred to herein as AAV2/9 vectors).

In some embodiments, the two ITR sequences of the recombinant AAV vector of the present invention are full-length ITRs (for example, about 125-145 bp in length, and contain a functional Rep binding site (RBS) and a terminal melting site ( trs)). In some embodiments, full-length functional ITRs are used to produce single-chain recombinant AAV vectors (ssAAV). In still other embodiments, one of the ITRs of the recombinant AAV vector is truncated. In some embodiments, truncated ITRs lack functional terminal melting sites trs and are used to produce self-complementary recombinant AAV vectors (scAAV vectors).

Therefore, in one aspect, the present invention provides a recombinant adeno-associated virus (AAV) vector, wherein said recombinant AAV vector comprises in its genome: 5' and 3' AAV inverted terminal repeat (ITR) sequences, and located at Expression construct according to the invention between the 5' and 3'ITR.

In some embodiments, after the recombinant AAV viral vector of the present invention is administered to mammalian target cells (including cells in vitro, in vivo and in vivo), the amount of ABCD1 gene expression or the amount of ABCD1 protein expression in the cells is increased compared with that before the administration , thereby reducing the level of VLCFA in the cell, eg by at least 1-3 fold. In some embodiments, the recombinant viral vector of the present invention, after being administered to a subject, results in a decrease in VLCFA levels in the adrenal gland and CNS such as cerebellum, brain, spinal cord, for example, at least 0.5 times lower than before administration, for example At least 1-3 times. Determination of this fold reduction can be performed according to standard methods known in the art for the quantification of VLCFAs.

II. Preparation of Recombinant AAV Vectors

There is a relatively mature AAV vector packaging system in the field, which facilitates large-scale production of AAV vectors.

Currently commonly used AAV vector packaging systems mainly include three-plasmid co-transfection system, adenovirus as helper virus system, Herpes simplex virus type 1 (HSV1) as helper virus packaging system, and baculovirus-based packaging system. system. Each packaging system has its own characteristics, and those skilled in the art can make appropriate choices according to needs.

The three-plasmid co-transfection packaging system is the most widely used AAV vector packaging system because it does not require helper virus and has high safety. It is also the mainstream production system in the world. The slight disadvantage is that the absence of an efficient large-scale transfection method limits the application of the three-plasmid transfection system in the large-scale preparation of AAV vectors.

The recombinant AAV viral vectors of the invention can be produced using any suitable method known in the art. In one embodiment, the recombinant AAV virus of the present invention is produced using a three-plasmid packaging system. In another embodiment, the recombinant AAV virus of the present invention is produced using a baculovirus packaging system.

III. Pharmaceutical composition

In yet another aspect, the present invention provides a pharmaceutical composition comprising a recombinant AAV viral vector of the present invention. The pharmaceutical composition of the present invention preferably comprises a pharmaceutically acceptable excipient, diluent or carrier. The pharmaceutical compositions of the present invention may be formulated in any suitable preparation form.

Examples of suitable pharmaceutically acceptable excipients, diluents or carriers for formulation are well known in the art and include, for example, phosphate buffered saline, water, emulsions, such as oil/water emulsions, various types of Wet agent, sterile solution, etc. Preparations can be formulated by conventional methods, and administered to subjects in appropriate doses. Administration of a suitably formulated composition can be achieved in different ways, eg. Administration is by intravenous, intraperitoneal, subcutaneous, intramuscular, topical or intradermal. The particular route of administration depends, inter alia, on the type of carrier included in the pharmaceutical composition. The dosage regimen will be determined by the attending physician and other clinical factors. As is well known in the medical arts, the dosage for any one patient will depend on many factors, including the patient's size, body surface area, age, sex, the particular active agent to be administered, the timing and route used, and the type and phase of the drug used. Infections or diseases, general health conditions, and combinations of other medications.

In some embodiments, the pharmaceutical compositions of the present invention may include a second active agent. In some embodiments, the second active agent is a drug for treating or alleviating X-ALD, or a component capable of reducing side effects when the drug is administered.

The pharmaceutical compositions of the present invention may be administered by any suitable route, including systemic administration and topical administration. In some embodiments, the pharmaceutical composition of the present invention is for systemic administration, especially intravenous administration. Accordingly, in one embodiment, the present invention provides a pharmaceutical composition comprising a recombinant AAV vector of the present invention, wherein said pharmaceutical composition is an intravenous formulation, or a lyophilized stable formulation suitable for formulation as an intravenous formulation. In other embodiments, the pharmaceutical composition of the present invention is suitable for local administration, for example, directly in or near the organ or tissue to be treated in a subject. Accordingly, in one embodiment, the present invention provides a pharmaceutical composition comprising a recombinant AAV vector of the present invention, wherein said pharmaceutical composition is a formulation suitable for topical administration.

IV. Treatment

In another aspect, the present invention relates to methods of treating diseases using the recombinant AAV vectors of the present invention or pharmaceutical compositions comprising the same. In one embodiment, the disease is X-ALD. In another embodiment, the disease is a defect in the ABCD1 gene. In one embodiment, the method comprises: administering a recombinant AAV vector or pharmaceutical composition of the invention to a subject in need thereof. The recombinant AAV vector or pharmaceutical composition can be administered by any suitable route, including but not limited to, intramuscular, subcutaneous, intraspinal, intracerebroventricular, intrathecal, intravenous, intradiaphragmatic, intrathoracic, intraperitoneal. Preferably, the recombinant AAV vector or pharmaceutical composition of the present invention is delivered to a subject by systemic administration, especially intravenous administration. In some embodiments, the treatment is therapeutic. In other embodiments, the treatment is prophylactic. In some embodiments, the subject is a mammal, wherein the mammal is especially a human, primate, dog, horse, cow, especially a human subject.

In methods involving treating a subject, in some embodiments, treatment includes any one or more of: (1) arresting or delaying the onset of the disease; (2) lessening the severity of the disease; (3) lessening the severity of the disease; or prevent the onset and/or worsening of at least one symptom of the disease; (4) improve disease-related neurodegeneration and/or behavior of the subject; and (5) prolong the survival of the subject. It should be understood that treatment of X-ALD, while encompassing, does not require complete elimination of the disease or symptoms associated therewith.

Subjects who can be treated/prevented by the method of the present invention include Addison type, cerebral type (children's brain type, adolescent brain type and adult brain type), adrenomyeloneuropathy type (AMN) with or without intracranial demyelination, Asymptomatic or presymptomatic, and heterozygous. In one embodiment, the subject is a patient with cerebral ALD. In other embodiments, the subject is an AMN patient. In yet other embodiments, the subject is an asymptomatic patient. In other embodiments, the subject is an individual exhibiting symptoms associated with the onset of ALD or AMN, such as accumulation of high levels of VLCFA in plasma. In yet other embodiments, the subject is an individual at risk for ALD or AMN disease due to family history; or an individual whose genetic testing includes one or more mutations associated with ALD or AMN in the ABCD1 gene.

Therefore, in one aspect, the present invention provides a method for treating or preventing X-chromosome-linked adrenoleukodystrophy (X-ALD) and/or improving symptoms associated with X-ALD, wherein the method comprises providing A subject is administered the recombinant AAV viral vector according to the present invention or the pharmaceutical composition according to the present invention. Preferably, said method comprises intraperitoneal, intramuscular, intraarterial, intravenous, intrathecal or intraventricular administration, more preferably intravenous injection, of said recombinant AAV viral vector.

Beneficial technical effect of the present invention

1. The X-ALD gene therapy drug of the present invention (for example, according to the recombinant AAV virus vector of the present invention or according to the pharmaceutical composition of the present invention) can break through the blood-brain barrier, thereby reducing the extremely long chain in the multi-organ organs of the whole body. fatty acid levels. When the adeno-associated virus AAV9 is used as a vector, the drug can have a wider biodistribution, especially to cover the central nervous system, improve the level of very long chain fatty acids in the central nervous system, and prevent white matter lesions.

2. The X-ALD gene therapy drug of the present invention (for example, according to the recombinant AAV viral vector of the present invention or according to the pharmaceutical composition of the present invention) has increased the expression level of the drug in vivo through the optimization of the promoter and the coding gene, and the viral vector Genomic stability is enhanced, resulting in longer-lasting reductions in tissue and blood VLCFA levels.

3. The X-ALD gene therapy drug of the present invention (for example, the recombinant AAV virus vector according to the present invention or the pharmaceutical composition according to the present invention) has reduced toxicity to peripheral tissues and organs. By selecting the target sequence of tissue-specifically expressed miRNA, the X-ALD gene therapy drug of the present invention can reduce the toxicity of transgene overexpression to peripheral organs, especially myocardial tissue toxicity.

4. The X-ALD gene therapy drug of the present invention (for example, according to the recombinant AAV virus vector of the present invention or according to the pharmaceutical composition of the present invention), after intravenous injection into the ABCD1 gene-deficient model mice, can Efficient, continuous and stable expression of ABCD1 protein, and the ABCD1 protein produced by expression can participate in the degradation of extremely long-chain fatty acids in cells, reduce its accumulation in cells, and maintain it at a normal level, thereby eliminating cells caused by extremely long-chain fatty acids Various disease symptoms caused by excessive accumulation of fatty acids, to achieve the purpose of treatment. In addition, although the drug exposure of the heart and liver is the largest under intravenous injection, when the X-ALD gene therapy drug of the present invention is used to achieve the therapeutic purpose, no drug-related toxic changes have been seen in the heart and liver, indicating that the drug-related changes of the present invention Drug safety is better.

5. The X-ALD gene therapy medicine of the present invention (for example, according to the recombinant AAV virus vector of the present invention or according to the pharmaceutical composition of the present invention) after intravenous injection and treatment of X-ALD model mice, the extremely long The level of chain fatty acids decreased significantly and returned to normal levels, and the very long chain fatty acids in peripheral tissues and blood also changed significantly. This shows that the medicine of the present invention can be used in the treatment of X-ALD by intrathecal injection. On the one hand, the treatment effect of intrathecal injection will be better and more significant for the improvement of abnormal indicators of the central nervous system. At the same time, after intrathecal injection, the biodistribution of the AAV vector genome will be more concentrated in the central nervous system, and the proportion of vector biodistribution in peripheral organs such as the heart and liver is low (lower exposure), so the safety of the drug will be improved. Further improvement.

Example

Taking the X-ALD mouse model as an example, the present invention realizes the improvement of disease symptoms and simultaneously achieves good drug safety through a uniquely designed and constructed gene expression construct. Below in conjunction with specific embodiment and accompanying drawing, the present invention will be further described:

Embodiment 1: ABCD1 gene coding sequence optimization

Although the natural ABCD1 coding sequence (CDS) can effectively express the target gene, the resistance to expression and translation still exists, there are many limiting factors such as trans-acting elements and uneven distribution of GC%.

In this example, the nucleotide sequence of the gene encoding hABCD1 (UniProtKB-P33897) was optimized, and the optimized sequence for improving the expression efficiency of hABCD1 was determined by in vitro expression in HEK293 cell line and detection of ABCD1 protein expression level by WESTERN BLOT (coABCD1).

The wild-type ABCD1 coding nucleic acid sequence (from the sequence of NCBI accession number NM_000033.3) and the optimized coABCD1 coding nucleic acid sequence (SEQ ID NO: 1) were synthesized by GenScript Biotechnology Co., Ltd. The synthesized sequence was cloned into the pUC57 simple vector (GenScript Biotechnology, Nanjing). After that, the synthetic wild-type coding sequence and the optimized coding sequence were respectively cloned into the pAAV vector plasmid through KpnI and EcoRI sites, and embedded between the CA promoter and polyA (as shown in Figure 1A). After sequencing and identification, they were frozen and stored in the library and the plasmids were extracted for in vitro transfection experiments. Briefly, plasmids were miniprepped and HEK293 cell line was transiently transfected using Lipofectamine 2000. The medium was changed 6 hours after transfection, and the cells were collected 48 hours later, and the total protein of the cells was lysed and extracted. The protein bands were separated by 10% SDS-PAGE gel electrophoresis and transferred to PVDF membrane by wet transfer method. Anti-ABCD1 antibody (1:2000, Abcam, ab197013) was used to incubate overnight. After rinsing, incubation with secondary antibody (HRP-labeled goat anti-rabbit IgG, Zhongshan Jinqiao, ZB-2301) and rinsing again, ECL-enhanced chemiluminescence reagent (Sanko, C500044) was used for ECL luminescent color development. The color rendering results were processed and analyzed by grayscale scanning.

As shown in Figure 1B, after optimization of the gene coding sequence, the expression level increased by about 400%. It was proved that sequence optimization effectively changed the expression efficiency of ABCD1 gene.

Example 2: Promoter optimization

2.1. Construction of CAR-Mut promoter

On the CA promoter composed of the enhancer sequence of human CMV virus and the basal promoter of chicken β-actin protein, the 3' end of the sequence was introduced into the human TATA box binding protein-related factor 1 gene (GenBank: NG_012771.2) The intron sequence from position 62804 to position 62890 was named CAR promoter. Transform the CAR promoter, mutate the T at the 568th position at the end of the promoter to a non-T nucleotide, and obtain the CAR-Mut promoter, that is, CAR-MutC (with mutation T568C, the sequence is shown in SEQ ID NO: 2 ), CAR-MutA (with mutation T568A, sequence shown in SEQ ID NO: 3), and CAR-MutG (with mutation T568G, sequence shown in SEQ ID NO: 4).

2.2. Characterization of in vitro activity of CAR-Mut promoter

In order to characterize the promoter CAR-Mut, the pscAAV-CAR-Gluc plasmid vector shown in Figure 2 was constructed, including:

i) ITR from the 5' end of the AAV2 genome (GenBank No.AF043303);

ii) CAR promoter, the sequence is as shown in SEQ ID NO:5;

iii) Gluc, the nucleotide sequence encoding the luciferase reporter gene;

iv) the polynucleotide tailing signal of bovine growth hormone, also abbreviated as BGH polyA;

v) Based on the ITR sequence at the 3' end of the AAV2 genome (GenBank No.AF043303), the trs sequence and the D sequence in the sequence are deleted to obtain the ΔITR.

Based on the pscAAV-CAR-Gluc plasmid, the CAR promoter in the pscAAV vector was replaced with the CAR-Mut promoter sequence to obtain the pscAAV-CAR-Mut-Gluc vector.

The well-grown BHK-21 cells were passaged to 24-well plates, and when the density reached 60%, Lipofectamine2000 (Invitrogen, USA) was used to transfect pscAAV-CAR-Gluc, pscAAV-CAR-MutC-Gluc, pscAAV according to the manufacturer's instructions - 3 wells each for CAR-MutA-Gluc and pscAAV-CAR-MutG-Gluc. 48 hours after transfection, 100 μL of the supernatant was taken from each well, the Gluc level was detected with a Glomax96 microplate luminometer (Promega), and data analysis was performed using the detector software.

As shown in Figure 3, compared with the blank (BHK-21 cells without transfection plasmid), after the transfection of plasmids pscAAV-CAR-Gluc and pscAAV-CAR-Mut-Gluc, the expression level of Gluc in the cells increased significantly, And the level of Gluc after transfection with pscAAV-CAR-MutC-Gluc was increased by 29.8% compared with transfection with pscAAV-CAR-Gluc. There was no significant difference between pscAAV-CAR-MutA-Gluc, pscAAV-CAR-MutG-Gluc and pscAAV-CAR-MutC-Gluc.

The results confirmed that the CAR-MUT promoter has increased promoter function.

Example 3: Optimizing the 3'UTR sequence

In the EGFP-based expression plasmid vector, the target sequences of miRNA1, 122, and 206 (respectively SEQ ID NO: 6, 7, and 8) were embedded, and whether the miRNA target sequences were effective in down-regulating the expression of the target gene in cell lines derived from different tissues expected effect.

SEQ ID NO: 6miRNA1 target_ATACATACTTCTTTACATTCCA;

SEQ ID NO: 7miRNA206 target_CCACACACTTCCTTACATTCCA;

SEQ ID NO:8miRNA122 target_CAAACACCATTGTCACACTCCA;

Construction of plasmid vectors based on EGFP expression constructs. In this vector plasmid, the CMV promoter drives EGFP gene expression, and the miRNA1 target sequence (miRNA1 Target), miRNA206 target sequence (miRNA206 Target), and miRNA122 target sequence (miRNA122 Target) are embedded in the 3' UTR. As a control, a corresponding EGFP expression construct was constructed without embedding the miRNA target sequence.

The plasmids were transiently transfected in C2C12 cell line (myoblasts, preserved by Jinlan Laboratory) and Huh7 cell line (human liver cancer cells, preserved by Jinlan Laboratory). After 48 hours of transfection, the fluorescent signal of the cells was observed under a fluorescent microscope. The effects of different miRNA target sequences located in the 3'UTR on the expression of the target gene EGFP were compared.

The results are shown in Figure 4. As shown, the combination of miRNA1 and miRNA206 target sequences can significantly reduce the expression level of the target gene in skeletal muscle cells. The miRNA122 target sequence can down-regulate the expression of target genes in hepatocytes. The plasmid vector embedded with the miRNA target sequence had significantly down-regulated expression of the target gene in Huh7 cells and C2C12 cells, which indicated that the 3'UTR containing the miRNA target sequence had specific expression down-regulation ability.

Example 4: Combinatorial alignment optimization of miRNA target sequences in the 3'UTR

In the construct based on Example 3, the EGFP gene was replaced by the Gluc reporter gene, and the number of repeats of the miRNA target sequence was increased in the 3'UTR and its arrangement and combination were changed, thereby comparing miRNA 1, miRNA 206, and miRNA 122 targets The effect of different combinations of sequences on the expression of the target gene.

Construction of different miRNA target sequence combinations: (SEQ ID NO: 9, 10, or 11)

Combination method 1 (SEQ ID NO:9):

Combination mode 2 (SEQ ID NO: 10):

Combination mode 3 (SEQ ID NO: 11):

Transient transfection was performed on the C2C12 cell line (myoblast, preserved by Jinlan Laboratory) and the Huh7 cell line (human liver cancer cell, preserved by Jinlan Laboratory) with the expression plasmid containing the construct. After 48 hours of transfection, the fluorescent signal of the cells was observed.

As shown in Figure 5, by repeating and combining the three miRNA target sequences, the expression level of the target gene in C2C12 (skeletal muscle cells) showed a significant decrease, and the decline rate was higher than that of the single-copy miRNA combination, and the down-regulation rate of the combination mode 3 The largest and significantly higher than the other two combinations (p<0.05).

As shown in Figure 6, the combination of the three miRNA target sequences also showed a better ability to down-regulate the target gene. Compared with the down-regulation ability of the single-copy miRNA combination, it increased the ability to inhibit the target gene by ~300%. The expression in hepatocytes was suppressed by more than 90%.

The above results indicated that increasing the repeat number of miRNA target sequence and optimizing its sequence can further improve the gene expression silencing efficiency of miRNA.

Embodiment 4. Construction of recombinant AAV virus

An AAV plasmid vector containing an optimized promoter CAR-MutC, an optimized target gene co-ABCD1, and an ABCD1 expression cassette inserted into the 3'UTR miRNA target sequence was constructed. The constructed AAV plasmid vector contains:

i) ITRs from the AAV2 genome;

ii) CAR-MutC promoter;

iii) co-ABCD1 encoding nucleic acid sequence;

iv) 3'UTR, comprising the miRNA target sequence;

v) polynucleotide tailing signal BGH polyA of bovine growth hormone;

vi) ITRs from the AAV2 genome.

Based on pRDAAV-CMV-EGFP (Figure 7), replace the CAR-MutC promoter (SEQ ID No.2) in the pRDAAV vector

CMV promoter, resulting in pRDAAV-CAR-Mut-EGFP vector. Next, the artificially synthesized coABCD1 coding nucleotide sequence (SEQ ID NO: 1) was cloned into the pRDAAV-CAR-Mut-EGFP vector to replace EGFP to obtain pRDAAV-CAR-Mut-

coABCD1 vector.

Specifically, the coABCD1 nucleic acid sequence was synthesized by GenScript Biotechnology Co., Ltd., and a KpnI restriction site and a Kozak sequence 5'-GCCACC-3' were added upstream of the synthetic sequence, and a taa stop codon and EcoRI enzyme were added downstream cut site. The synthesized sequence was cloned into the pUC57 simple vector (GenScript Biotechnology, Nanjing) to obtain the pUC57-coABCD1 vector. The pUC57-coABCD1 vector and the pRDAAV-CAR-Mut-EGFP vector were digested with KpnI and EcoRI respectively, the coABCD1 fragment and the pRDAAV-CAR-Mut-EGFP vector fragment with the EGFP reporter gene removed were recovered, and the two fragments were ligated and transformed into E.coli DH5α competent cells (Qingke Xinye, Beijing) were screened and identified to obtain the pRDAAV-CAR-Mut-coABCD1 vector. Next, the artificially synthesized miRNA target fragment (comprising miRNA122, 206, 1 target sequence, sequence information see SEQ ID No.12) is cloned into between the EcoRI and SalI restriction sites of the pRD.AAV-CAR-Mut-coABCD1 vector The pRD.AAV-CAR-Mut-coABCD1-miT vector was obtained.

Using the constructed AAV plasmid vector, pRDAAV-CAR-Mut-coABCD1 vector and pRD.AAV-CAR-Mut-coABCD1-miT vector, through the three-plasmid co-transfection method, using the HEK293 packaging system, the recombinant AAV virus, AAV9- coABCD1 and AAV9-coABCD1-miT, and the virus titer was detected.

Example 5: In vitro transduction and functional testing of recombinant AAV9 virus

5.1 The effect of recombinant AAV9 virus transduction on the expression of ABCD1 in cells

Skin fibroblasts from two X-ALD patients (patient 1 and patient 2) were infected with the prepared recombinant AAV virus at a multiplicity of infection of 10000. Cells were fixed with formalin 72 hours after infection and immunofluorescent staining was performed. Cells were incubated overnight with Anti-ABCD1 antibody (diluted 1:100, Abcam), rinsed, washed with dylight549-labeled secondary antibody for 1 hour, counterstained with dapi, and mounted. Red fluorescence and blue fluorescence were observed under a fluorescence microscope.

The results are shown in Figure 8. ABCD1-positive cells can be observed in the cell slides infected with AAV9-coABCD1, and there is a strong red fluorescent signal in the cytoplasm of the cells. No ABCD1-positive cells were found in the uninoculated cell slides.

The results showed that AAV9-coABCD1 in vitro transduction of fibroblasts from X-ALD patients increased the expression of ABCD1 in the cells.

5.2 Effect of recombinant AAV9 virus transduction on cell growth and proliferation rate

Skin fibroblasts from X-ALD patients were infected with the prepared recombinant AAV virus at a MOI of 50000. Cell density was observed on day 7 after infection.

The results are shown in Figure 9. The proliferation rate of cells infected with AAV9-coABCD1 (Fig. 9B) was similar to that of normal human skin fibroblasts (Fig. 9C), and the cell density was about 90% when cultured for 7 days, and there was no significant difference between the two. Fibroblasts from patients not inoculated with AAV9-coABCD1 ( FIG. 9A ) grew and proliferated at a lower rate, and the cell density was <50%.

Example 6: A single tail vein injection of AAV9-coABCD1-miT and AAV9-coABCD1 interferes with C57BL6/J wild-type mice

In this example, the adeno-associated virus vector containing the ABCD1 expression construct before and after optimization was injected into the tail vein of C57BL6J wild-type mice at a dose of 1.5E+14vg/kg, with 4 mice in each group. Except for one mouse in the unoptimized group that died 3 weeks after administration, the remaining 7 mice were killed 4 weeks after injection, and samples were collected for histopathology and the content of very long chain fatty acids. The histopathological changes in vivo and the changes of very long chain fatty acids before and after 3'UTR optimization are shown in Figures 10 and 11.

The detection results of the very long-chain fatty acid content showed that, for normal mice, after intervention by injection, the ABCD1 expression construct before and after priority could reduce the level of very long-chain fatty acids in various tissues and blood of normal mice (Figure 10), It shows that the ABCD1 delivered by the virus plays its physiological function.

Histopathological examination was carried out on the remaining 7 surviving experimental mice in the 4th week after administration. The results showed that the mice in the unoptimized test group had obvious pathological changes in the myocardium and liver, with vacuolar degeneration of cardiomyocytes, necrosis of a single hepatocyte, mononuclear cell infiltration and extensive hepatocyte edema as the main pathological changes . The above-mentioned pathological changes were not found in the mice in the experimental group after optimization. (Figure 11A)

Necropsy was performed on mice in the non-optimized group that died 3 weeks after administration. Histopathological diagnosis revealed that the heart of the dead mouse had extensive vacuolar degeneration, obvious myocardial fibrosis, and thrombus in the cardiac cavity. Liver pathological examination revealed a large area of hepatocyte necrosis, which spread outwards mainly centered on the central vein. The above pathological changes are considered to be related to the toxicity of the test product. (Figure 11B)

The pathological results showed that the optimized AAV9-coABCD1-miT could significantly improve the toxicity caused by ABCD1 gene expression.

Example 7: AAV9-coABCD1-miT Tail Vein Injection Treats X-ALD Model Mice

In this example, a B6.129 mouse model in which the ABCD1 gene was knocked out was selected, and the model mouse was purchased from Jackson Lab. Due to the species differences of the mice, the deletion of ABCD1 did not cause serious physiological or behavioral effects in the model mice, but the model mice showed phenotypes such as decreased exercise ability at 10 weeks, and the fibroblasts and The levels of C26:0 in various tissues (adrenal gland, brain, etc.) and blood were significantly higher than those in wild-type mice, indicating that there is pathological accumulation of very long-chain fatty acids in the model mice. This process simulates the pathological process of X-ALD patients.

For this model, AAV9-coABCD1-miT was delivered by intravenous injection, and the model mice were treated reparatively, and compared with normal wild-type mice and untreated mice. In short:

In order to determine the therapeutic effect of the optimized drug AAV9-coABCD1-miT, the optimized drug was administered intravenously to 8 X-ALD model mice of the same age at a dose of 5E+13vg/kg. There were 8 wild-type mice and X-ALD model mice of the same age without any intervention.

Eight weeks after administration, histopathological immunofluorescence detection, evaluation of very long chain fatty acid content and motor score were performed.

exercise assessment

The locomotion of the mice was assessed using the grab rope method. The test results can be seen from Figure 12, the average score of normal wild-type mice is 4.5 points; the average score of untreated X-ALD model mice is 0 points, and the mice that were put on the rope fell within 10s. It shows that under the development of the natural history of the diseased mice, the muscles will atrophy and become weak; the average score of the treated diseased mice is 3.7 points, these mice can grasp the rope for more than 30s, and some will try to climb On the rope, some can put the front paw and one hind paw on the rope. Compared with the untreated diseased mice, the treatment effect is very obvious, and the data results of the treatment group are not significantly different from those of the wild type . These results indicate that the optimized drug has a significantly superior therapeutic effect through intravenous administration.

Assessment of Very Long Chain Fatty Acid Content

Eight weeks after administration, the very long chain fatty acid content in various tissues of the AAV9-coABCD1-miT drug-treated model animals was detected, and compared with normal healthy mice and X-ALD model mice.

The content of very long chain fatty acids was determined by HPLC-MS/MS. First, the experimental mice were dissected and weighed, and then each tissue was ground into powder by liquid nitrogen grinding, and the very long-chain fatty acids were extracted from the tissue through a series of rough extraction and fine extraction using the Matyash extraction method, and used The content of very long chain fatty acids was determined by HPLC-MS/MS, and the detection results are shown in Figure 13.

It can be seen from the figure that compared with untreated model mice, the levels of very long-chain fatty acids in various tissues in the treated mice were significantly reduced, and were close to the wild-type levels, especially the contrast of affected parts was obvious, such as the adrenal gland, cerebellum. This result indicates that AAV9-coABCD1-miT drug therapy can achieve effective and excellent therapeutic effect.

Adrenal histopathological examination

X-ALD model mice were treated by tail vein injection of AAV9-coABCD1-miT, and ABCD1 was immunofluorescently labeled on tissue sections 8 weeks after administration.

The results of histopathological examination of the adrenal glands are shown in Figure 14. The results showed that no ABCD1 gene expression was detected in the untreated group. ABCD1 was widely expressed in the adrenal cells of the treatment group, showing red spot signal in the cytoplasm.

Assess the autophagy and improvement of the nervous system, and evaluate the efficacy after gene therapy

X-ALD activates autophagy due to the accumulation of very long-chain fatty acids. Autophagy wraps and transports very long-chain fatty acids accumulated in various subcellular organelles to lysosomes. But very long-chain fatty acids must be degraded in peroxisomes, so autophagy does not improve the accumulation of very long-chain fatty acids. The accumulation of very long-chain fatty acids continuously stimulates and activates autophagy, and thus, the autophagic flux is stagnant and ineffective. In ABCD1-deficient mice, it has been shown that aberrant phagocytosis impairs neuronal projections and is associated with spinal cord axonopathy (Microglial dysfunction as a key pathological change in adrenomyeloneuropathy, doi:10.1002/ana.25085). By evaluating changes in autophagy, it is possible to indirectly assess whether the damage caused by intracellular very long-chain fatty acids has improved.

X-ALD model mice were treated with AAV9-coABCD1-miT tail vein injection. Eight weeks after administration, the spinal cord tissue sections were immunofluorescently labeled with LC3β (axonemal dynein light chain 2β). The results are shown in Figure 15. From the results shown in the figure, it can be seen that in the untreated group, the anterior and dorsal horns of the spinal cord showed strong autophagy protein signals of myelin sheath, indicating that autophagy activation was obvious. The autophagy signal in the anterior horn of the spinal cord decreased significantly in the treatment group. In the myelin sheath of the dorsal horn white matter area, the trend of decreasing autophagy signal can also be observed, although the decrease degree is not as good as that in the forefoot area of the spinal cord (this is because AAV9 is more tropistic to the anterior horn cells after intravenous injection), but it can be clearly compared The autophagy activity in the spinal cord decreased after treatment. It shows that after treatment, the problem of autophagy pathway disorder can be improved.

Embodiment 8: Evaluation of the safety and optimization degree of drugs

The protein content of ABCD1 was determined by Western Blot method to explore the safety and optimization degree of the drug.

The optimized (AAV9-coABCD1-miRT) and unoptimized drug (AAV9-coABCD1) were intravenously injected into normal wild-type mice, and compared with untreated normal mice.

The results of Western Blot detection are shown in Figure 16A. Using the software ImageJ to analyze the gray value of the picture, the quantification results obtained are shown in Figure 16B. From the results shown in the figure, it can be seen that the two mice injected with the drug AAV9-coABCD1 had relatively high levels of ABCD1 protein in the myocardial tissue; while the two mice injected with the drug AAV9-coABCD1-miRT had a relatively high level of ABCD1 protein in the myocardial tissue. The ABCD1 protein content was relatively low, but still higher than that in normal mouse myocardial tissue. The comparison of the average gray value of these three kinds of mice is: C57/AAV9-hABCD1=1.58>C57/AAV9-coABCD1-miRT=0.60>C57/WT=0.15.

The results showed that the optimized drug AAV9-coABCD1-miRT reduced the toxicity of the drug in peripheral tissues and organs, mainly myocardial tissue, to a certain extent.

Claims

A nucleic acid encoding ABCD1 comprising: SEQ ID No: 1, or a nucleotide sequence having at least 90%, 95%, 96%, 97%, 98%, 99%, 99.5% identity thereto.
The nucleic acid of claim 1, wherein the expression level of said nucleic acid under the control of a constitutive promoter is increased by at least 200% or more, such as 300% or 400%, compared to the natural human ABCD1 encoding nucleic acid.
An expression construct comprising the ABCD1 encoding nucleic acid of claim 1 or 2.
The expression construct of claim 3, which also comprises a promoter operably linked to the nucleic acid,

Preferably said promoter comprises a nucleotide sequence selected from SEQ ID No:2-5, especially the nucleotide sequence of SEQ ID No:2.
The expression construct of claim 3 or 4, which further comprises a 3'UTR operably linked to said ABCD1-encoding nucleic acid.
The expression construct of claim 5, wherein the 3'UTR comprises 1-8 copies (for example, 2, 3, or 4 copies) of the target sequence of the myocyte-specific miRNA and/or 1-8 copies (e.g., 1 or 2 copies) of the target sequence of a hepatocyte-specific miRNA,

Preferably, the 3'UTR comprises 3 copies of the muscle cell-specific miRNA target sequence and 2 copies of the liver cell-specific miRNA target sequence, wherein preferably, the muscle cell-specific miRNA target sequence and the liver cell-specific miRNA Target sequences spaced;

More preferably, the muscle cell-specific miRNA target sequence is selected from miRNA1 target sequence, miRNA206 target sequence and combinations thereof; the liver cell-specific miRNA target cell is miRNA122 target sequence;

More preferably, the 3'UTR comprises miRNA target sequences arranged as follows:

miRNA1 target-miRNA122 target-miRNA1 target-miRNA122 target-miRNA206 target; or

miRNA206 target-miRNA122 target-miRNA1 target-miRNA122 target-miRNA1 target.
The expression construct of claim 6, wherein said 3'UTR comprises the nucleotide sequence of SEQ ID NO:12.
A vector comprising the expression construct of any one of claims 1-7.
The vector of claim 8, wherein said vector is a viral vector.
8. The vector of claim 8 or 9, wherein said vector is an adeno-associated viral (AAV) vector.
A host cell, preferably a mammalian cell, comprising an expression construct according to any one of claims 1-7 or a vector according to any one of claims 8-10.
A recombinant adeno-associated virus (AAV) vector, wherein said recombinant AAV vector comprises in its genome an expression construct according to any one of claims 1-7 between the 5' and 3' AAV inverted terminal repeats ,

Preferably, wherein said recombinant AAV vector comprises in its genome:

a. 5' and 3' AAV inverted terminal repeat (ITR) sequences, and

b. An expression construct positioned between the 5' and 3' ITR, wherein the expression construct comprises the following elements functionally linked to each other in the direction of transcription:

-Promoter,

- a polynucleotide encoding human ABCD1,

- at least one miRNA target sequence,

- one or more terminators; and

- one or more polyA signal sequences, preferably selected from the group consisting of SV40 late polyA sequence, rabbit β-globin polyA sequence, and bovine growth hormone polyA sequence, more preferably bovine growth hormone polyA sequence, such as the nucleosides of SEQ ID NO: 13 acid sequence.
The recombinant AAV viral vector of claim 12, wherein said ITR is a wild-type AAV2 ITR sequence, or one of said ITRs is an AA2 ΔITR sequence lacking a functional terminal melting site (trs) and optionally a D sequence.
The recombinant AAV viral vector according to any one of claims 12-13, wherein said vector is a ssAAV vector or a scAAV vector, especially an ssAAV vector.
The recombinant AAV viral vector according to any one of claims 12-14, wherein said recombinant AAV vector comprises a capsid from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9 serotype, especially AAV9 serotype protein, preferably, the recombinant AAV vector is an AAV2/9 vector.
A pharmaceutical composition comprising the carrier of claims 8-10 or the recombinant AAV virus vector of any one of claims 12-15 and a pharmaceutically acceptable carrier, preferably, the pharmaceutical composition is used for intraperitoneal, intramuscular , intraarterial, intravenous, intrathecal or intracerebroventricular administration, more preferably intravenous administration.
Use of the expression construct according to any one of claims 1-7 or the vector according to any one of claims 8-15 for expressing ABCD1 in mammalian cells, cell lines or cell groups, or in the preparation for use in breast-feeding Use in pharmaceuticals expressing ABCD1 in animal cells, cell lines or cell groups.
A method for treating or preventing X-chromosome-linked adrenoleukodystrophy (X-ALD) and/or improving symptoms associated with X-ALD, wherein the method comprises administering claims 12-15 to a subject in need thereof any one of the recombinant AAV viral vectors or the pharmaceutical composition of claim 16,

Preferably, said method comprises intraperitoneal, intramuscular, intraarterial, intravenous, intrathecal or intraventricular administration, more preferably intravenous injection, of said recombinant AAV viral vector.
18. The method of claim 18, wherein said recombinant AAV viral vector is AAV9.
18. The method of claim 18 or 19, wherein said method reduces the level of very long chain fatty acids (VLCFA) in the subject's plasma and tissues, especially the adrenal gland and cerebellum.
The method of any one of claims 18-20, wherein the method reduces autophagic activity stimulated by VLCFA accumulation in the spinal cord.
A method (such as in vitro, in vivo, or ex vivo method) of expressing ABCD1 in mammalian cells, said method comprising using the expression construct according to any one of claims 1-7 or any one according to claims 8-10 Isolated mammalian cells, or cell lines or populations of cells are transfected with the vector of the present invention.
An expression construct comprising a 3'UTR operably linked to a gene, wherein the 3'UTR comprises a tandem miRNA target sequence selected from the group consisting of:

-miRNA1 target x2-miRNA206 target x1-miRNA122 target x2; for example the sequence shown in SEQ ID NO:9;

-miRNA1 target x2-miRNA122 target x2-miRNA206 target x1; for example, the sequence shown in SEQ ID NO: 10; or

-miRNA1 target x1-miRNA122 target x1-miRNA1 target x1-miRNA122 target x1-miRNA206 target x1; for example the sequence shown in SEQ ID NO:11.
23. Use of the expression construct of claim 23 for selectively reducing gene expression in muscle cells and hepatocytes.