WO2023125112A1

WO2023125112A1 - Antagonist composition and application thereof in preparation of drug for treatment of sleep disorders with co-morbid psychiatric disorders

Info

Publication number: WO2023125112A1
Application number: PCT/CN2022/140077
Authority: WO
Inventors: 王立平; 曾渝婷; 赵炳皓
Original assignee: 中国科学院深圳先进技术研究院
Priority date: 2021-12-29
Filing date: 2022-12-19
Publication date: 2023-07-06
Also published as: CN114225039A

Abstract

Provided are an antagonist composition and application thereof in the preparation of a drug for treatment of sleep disorders with co-morbid psychiatric disorders; said antagonist composition comprises a CRH receptor antagonist and a glutamic acid receptor antagonist. It is found for the first time that regulation and control of the neuron activity of a subthalamic nucleus adrenocorticotropic hormone-releasing hormone neuron or downstream external globus pallidus region thereof can change REM sleep duration/stability and fear reaction degree, thus indicating that the subthalamic nucleus and the downstream brain region thereof are functional regulation and control targets of patients suffering from mental diseases related to sleep disorder and fear imbalance. It is also found for the first time that the subthalamic nucleus CRH neuron and the glutamic acid neuron have a high coincidence ratio. On the basis of the above discovery, the CRH receptor antagonist is combined with the glutamic acid receptor antagonist to regulate and control the CRH and glutamic acid signal transmission of the external globus pallidus of the subthalamic nucleus, so that the sleep disorder and the psychiatric disorder abnormal co-morbidities related to the fear emotion imbalance are improved.

Description

An antagonist composition and its application in the preparation of medicines for treating sleep disorders and mental illnesses

technical field

The invention belongs to the technical field of biomedicine, and relates to an antagonist composition and its application in the preparation of medicines for treating sleep disorders and mental diseases.

Background technique

There is a high proportion of comorbidities between sleep disorders and mental illnesses. David Nutt et al. reported in 2008 that more than 83% of patients with depression had sleep disorders, and Luc Staner reported 51%-78% of patients with anxiety disorders in 2003. Sleep disturbance is present. This reflects the high correlation between sleep and the development of mental illness. Sleep includes non-rapid eye movement sleep (NREM) and rapid eye movement sleep (rapid eye movement sleep, REM), each with different functions. Changes in REM sleep structure are more common in patients with mental disorders associated with fear disorders such as depression, anxiety and post-traumatic stress disorder. For example, Dieter Riemann et al. reported in 2019 that the latency of REM sleep was shortened in patients with depression (from falling asleep to interval between first REM episodes), increased REM sleep occurrence density, fragmentation, and prolongation of total REM time. This suggests that there is a causal relationship between the abnormality of REM sleep and the occurrence of mental illness.

Taking depression as an example, sedatives are also used clinically to treat patients with mental illnesses such as depression/anxiety/post-traumatic stress disorder. It is a more effective treatment to calm the patient down while reducing the symptoms of mental illness program, but sedative drugs are addictive. Adverse effects include addiction problems with continuous use and acute poisoning. Many antidepressants are accompanied by the effect of inhibiting REM sleep and improving depressive symptoms. These drugs reflect the high correlation between the regulation of REM sleep and the improvement of depressive symptoms, but most of the targets of antidepressants in the brain are not Not clear, especially the regulation mechanism of sleep. Due to the poor understanding of the pathogenesis of depression, it is impossible to design antidepressant drugs in a targeted manner. Moreover, because the mechanism of action is unclear, it cannot act on the local area, and because of its target, the scope of action is unknown, so the side effects produced are uncontrollable and more likely to cause side effects. At present, in the prior art, there is no good treatment method for the co-morbidity of sleep and psychiatric diseases.

Therefore, how to provide a drug with clear mechanism and target and high safety for the treatment of comorbidities of sleep and psychiatric diseases has become an urgent problem to be solved in this field.

Contents of the invention

Aiming at the deficiencies of the prior art, the object of the present invention is to provide an antagonist composition and its application in the preparation of medicines for treating sleep disorders and mental diseases.

To achieve this purpose of the invention, the present invention adopts the following technical solutions:

In a first aspect, the present invention provides an antagonist composition, which includes a CRH receptor antagonist and a glutamatergic receptor antagonist.

(1) The present invention found for the first time that regulating the activity of corticotropin releasing hormone (CRH) neurons in the subthalamic nucleus or its downstream lateral globus pallidus brain area can change the duration/stability of REM sleep and the degree of fear response, It shows that the subthalamic nucleus and its downstream brain regions are the functional regulatory targets of the comorbidity of sleep disorders and fear disorder-related mental diseases.

(2) The present invention also found for the first time that CRH neurons in the subthalamic nucleus have a high overlap ratio with glutamatergic neurons, suggesting that such neurons co-release CRH and glutamatergic neurons.

(3) Based on the above findings, the present invention combines CRH receptor antagonists with glutamatergic receptor antagonists to realize the regulation of CRH and glutamate signal transmission in the subthalamic nucleus-lateral pallidus, thereby improving sleep disorders Unusual comorbidity with psychiatric disorders associated with dysregulation of fear emotions.

Preferably, the ratio of the amount of substances of the CRH receptor antagonist to the glutamatergic receptor antagonist is (1-10):(1-10), and the specific values in (1-10) are for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, etc.

Preferably, the CRH receptor antagonists include compounds having the structure shown in formula I, compounds having the structure shown in formula II, compounds having the structure shown in formula III, compounds having the structure shown in formula IV, N-butyl -N-ethyl-2,5-dimethyl-7-(2,4,6-trimethylphenyl)-7H-pyrrolo[2,3-D]pyrimidin-4-amine), NBI30775 , 3-(6-(dimethylamino)-4-methylpyridin-3-yl)-2,5-dimethyl-N,N-dipropylpyrazolo[1,5-A]pyrimidine Any one or a combination of at least two of -7-amine, verteporfin or analamine hydrochloride;

The combination of at least two such as the combination of verteporfin and analamine hydrochloride, NBI30775 and 3-(6-(dimethylamino)-4-methylpyridin-3-yl)-2,5- A combination of dimethyl-N,N-dipropylpyrazolo[1,5-A]pyrimidin-7-amine, N-butyl-N-ethyl-2,5-dimethyl-7-( 2,4,6-trimethylphenyl)-7H-pyrrolo[2,3-D]pyrimidin-4-amine) and NBI30775, etc., any other combinations are possible.

Preferably, the CRH receptor antagonist includes any one of the compounds having the structure shown in formula I, the compound having the structure shown in formula II, the compound having the structure shown in formula III, and the compound having the structure shown in formula IV One or a combination of at least two, such as a combination of a compound having the structure shown in formula I and a compound having the structure shown in formula II, a compound having the structure shown in formula III and a compound having the structure shown in formula IV Combinations of compounds having the above structure, combinations of compounds having the structure represented by formula II and compounds having the structure represented by formula III, etc., other arbitrary combinations are possible.

Preferably, the CRH receptor antagonist includes a compound having the structure shown in formula III, and its name is CP-154526.

Preferably, the glutamate receptor antagonists include N-methyl-D-aspartate receptor antagonists, α-amino-3-hydroxy-5-methyl-4-isoxazole receptor antagonists , any one or a combination of at least two of kainic acid receptor antagonists or metabotropic glutamate receptor antagonists. The combination of at least two such as the combination of N-methyl-D-aspartate receptor antagonist and kainate receptor antagonist, the combination of kainate receptor antagonist and metabotropic glutamate receptor A combination of kainic acid receptor antagonists, a combination of kainic acid receptor antagonists and an N-methyl-D-aspartate receptor antagonist, etc., and other arbitrary combinations are possible.

Preferably, the glutamate receptor antagonist comprises an N-methyl-D-aspartate receptor antagonist.

Preferably, the N-methyl-D-aspartate receptor antagonists include AP5, AP7, CGP-37849, CPP, Saifutai, amantadine, atomoxetine, dextromethorphan, Any one or a combination of at least two of Zhuoxipine, ketamine, memantine, atiganel, fordine, 7-chlorokynuric acid or TK-40. The combination of the at least two kinds, for example, the combination of dextromethorphan and dezrozepine, the combination of ketamine and memantine, the combination of fordinine and 7-chlorokynuric acid, etc., any other combination is acceptable.

Preferably, the α-amino-3 hydroxy-5-methyl-4-isoxazole receptor antagonist includes any one or at least one of NBQX, AMP397, CNQX, tiampanel, NGX426, MQPX or Kaiocephalin A combination of the two. The combination of at least two kinds, for example, the combination of NBQX and AMP397, the combination of AMP397 and CNQX, the combination of CNQX and tijapanel, etc., any other combination is acceptable.

Preferably, the kainate receptor antagonist includes any one or a combination of at least two of UBP, tiampanel, CNQX, NS102 or Dasolampanel. The combination of the at least two kinds, for example, the combination of UBP and Ticampanel, the combination of Ticampanel and CNQX, the combination of CNQX and NS102, etc., any other combinations are acceptable.

Special note: Tejapanel and CNQX are not only α-amino-3-hydroxy-5-methyl-4-isoxazole receptor antagonists, but also kainic acid receptor antagonists.

Preferably, the metabotropic glutamate receptor antagonist includes any one or a combination of at least two of MTEP, Lithium, APICA or EGLU. The combination of the at least two kinds, for example, the combination of MTEP and Lithium, the combination of Lithium and APICA, the combination of APICA and EGLU, etc., any other combination can be used.

In the second aspect, the present invention provides the use of the antagonist composition as described in the first aspect in the preparation of a medicament for treating sleep disorders and mental illnesses.

In the third aspect, the present invention provides the application of CRH receptor antagonist in the preparation of medicine for treating sleep disorder and mental disease comorbidity.

Preferably, the CRH receptor antagonist includes any one of the compounds having the structure shown in formula I, the compound having the structure shown in formula II, the compound having the structure shown in formula III, and the compound having the structure shown in formula IV one or a combination of at least two.

In a fourth aspect, the present invention provides the use of a glutamatergic receptor antagonist in the preparation of a medicament for treating sleep disorders and mental illnesses.

Preferably, the glutamate receptor antagonists include N-methyl-D-aspartate receptor antagonists, α-amino-3-hydroxy-5-methyl-4-isoxazole receptor antagonists , any one or a combination of at least two of kainic acid receptor antagonists or metabotropic glutamate receptor antagonists.

Preferably, the N-methyl-D-aspartate receptor antagonists include AP5, AP7, CGP-37849, CPP, Saifutai, amantadine, atomoxetine, dextromethorphan, Any one or a combination of at least two of Zhuoxipine, ketamine, memantine, atiganel, fordine, 7-chlorokynuric acid or TK-40.

Preferably, the α-amino-3 hydroxy-5-methyl-4-isoxazole receptor antagonist includes any one or at least one of NBQX, AMP397, CNQX, tiampanel, NGX426, MQPX or Kaiocephalin A combination of the two.

Preferably, the kainate receptor antagonist includes any one or a combination of at least two of UBP, tiampanel, CNQX, NS102 or Dasolampanel;

Preferably, the metabotropic glutamate receptor antagonist includes any one or a combination of at least two of MTEP, Lithium, APICA or EGLU.

The mental illness in the present invention includes any one or a combination of at least two of depression, anxiety, bipolar disorder, post-traumatic stress disorder, panic disorder, obsessive-compulsive disorder or autism spectrum disorder.

In terms of the object of use, the medicament for treating sleep disorders and psychiatric diseases co-morbidity prepared by the CRH receptor antagonist, glutamatergic receptor antagonist or antagonist composition of the present invention can be used for sleep and psychiatric disease co-morbidity. Diseased animals, including humans or non-human primates, rats, mice and the like are also included.

In terms of use, the medicament for treating sleep disorders and mental illness comorbidities prepared by the CRH receptor antagonist, glutamatergic receptor antagonist or antagonist composition of the present invention can be administered locally or The purpose of targeted drug delivery is to limit the range of drug diffusion, reduce side effects, and reduce non-specific drug binding. For local administration, a microcannula can be used. Specifically, the microcannula is implanted above the globus pallidus on the outside of the subject, and the cannula is combined with a microinjection pump for administration. In addition, it can also be used in combination with a targeted drug delivery system for drug delivery, such as drug release targeting the specific protein binding site of the lateral globus pallidum.

The numerical ranges described in the present invention not only include the above-listed point values, but also include any point values between the above-mentioned numerical ranges that are not listed. Due to space limitations and for the sake of simplicity, the present invention will not exhaustively list the ranges. The specific pip value to include.

Compared with the prior art, the present invention has the following beneficial effects:

(2) The present invention also finds for the first time that CRH neurons in the subthalamic nucleus have a high overlap ratio with glutamatergic neurons, suggesting that there is a joint release of CRH and glutamatergic neurons in these neurons, which can be stimulated by optogenetic technology. Stimulation of the subthalamic nucleus-lateral globus pallidum circuit in subjects can increase REM sleep and regulate defensive escape behavior, and administering receptor antagonists to the lateral pallidus through a small cannula can activate CRH neurons in the subthalamic nucleus Then it can basically eliminate the changes of REM sleep and fear response caused by light stimulation. Based on the present invention, it is found that CRH neurons are basically glutamatergic neurons, so CRH and glutamate receptor antagonists are used to regulate the lateral globus pallidus , by weakening or blocking the signal transduction of the subthalamic nucleus-lateral globus pallidus loop, so as to realize the regulation of mental illness symptoms related to abnormal sleep and fear response, it is an effective method to improve sleep disorders and fear disorders. An Approach to Unusual Comorbidity of Mental Illness.

(3) Based on the above findings, the present invention creatively proposes the application of CRH receptor antagonists and glutamatergic receptor antagonists in the preparation of drugs for the treatment of sleep disorders and mental illnesses. It is also proposed that glutamatergic receptor antagonists be used in combination with CRH receptor antagonists to further improve the regulation of the subthalamic nucleus-lateral globus pallidus loop, and to prepare drugs for the treatment of sleep disorders and mental illnesses . The drug can act on the subthalamic nucleus-the lateral globus pallidus loop through local administration, the scope of action is small, and the target of action is known, so it is safer to use (safety here refers to fewer side effects) , through the joint action of two antagonists, to achieve the regulation of sleep and mental disease co-morbidity, which is also the first composition that can act on the regulation target of sleep and psychiatric disease co-morbidity that the applicant consulted.

The present invention does not negate the effects of other psychiatric drugs, but only provides an antagonist composition, which can be used to prepare drugs for the treatment of sleep disorders and psychiatric diseases, so that it can target the drugs used for sleep and psychiatric diseases. In patients, especially those who do not respond to other psychiatric medications.

Description of drawings

Figure 1 is a schematic diagram of the CRH promoter sequence.

Figure 2A is a schematic diagram of chemically inhibited virus injection and electrophysiological function verification.

Fig. 2B is a schematic diagram of the test subject's response to natural enemy odor in sleep state.

Figure 2C is a graph of the test results of awakening induced by natural enemy odor stimulation in non-REM sleep.

Figure 2D is a graph of the test results of awakening induced by natural enemy odor stimulation under rapid eye movement sleep.

Figure 2E is a graph showing the test results of the defense response induced by natural enemy odor in the awake state.

Figure 2F is a diagram of the test results of defense responses elicited by visual fear stimuli in the awakening state.

Figure 2G is a schematic diagram of virus injection and optical fiber implantation in the subthalamic nucleus of a subject.

Figure 2H is a graph of the test results of light stimulation-induced awakening under REM sleep.

Figure 3A is a schematic diagram of fluorescently labeled virus injection.

Figure 3B is a graph showing the overlapping results of Vglut2 probe-labeled cells and virus EYFP-labeled cells.

Figure 3C is a projection of virus-labeled glutamatergic neurons in the subthalamic nucleus to the lateral globus pallidus.

Fig. 3D is a test result diagram of the overlap between CRH neurons and glutamatergic neurons in the subthalamic nucleus.

Figure 4A is a schematic diagram of optogenetic virus and antagonist injection.

Fig. 4B is a diagram of the test results of time-induced awakening without natural enemy odor under non-REM sleep.

Figure 4C is a graph showing the test results of awakening induced by time without natural enemy odor under rapid eye movement sleep.

Figure 4D is a graph of the test results of awakening induced by time with the smell of natural enemies under rapid eye movement sleep.

Figure 4E is a graph showing the results of the visual instinctive fear looming test.

Detailed ways

The technical solutions of the present invention will be further described below through specific embodiments. It should be clear to those skilled in the art that the examples are only for helping to understand the present invention, and should not be regarded as specific limitations on the present invention.

Example 1

Exploring the regulatory role of CRH neurons in the subthalamic nucleus on REM sleep and fear responses

This example explores the regulatory effect of CRH neurons in the subthalamic nucleus on REM sleep and fear response.

Firstly, AAV9-Crh-Cre and AAV9-DIO-Syn-hM4Di-mCherry (experimental group) were expressed in the subthalamic nucleus of the subject (C57BL6J wild-type mice) through stereotaxic brain region and micro-injection of virus (experimental group). A total of 75 nanoliters were injected after mixing the substance ratio of 1:1); or AAV9-Crh-Cre and AAV9-DIO-Syn-mCherry (control group) (after mixing the two at a substance ratio of 1:1 A total of 75 nL was injected). Wherein AAV9-Crh-cre is used to express the Cre enzyme in the neurons expressing CRH in the subject, wherein the CRH promoter sequence was reported by J Chen et al. in 2012 (see Figure 1 for details). The sequence of AAV9-DIO-Syn-hM4Di-mCherry and AAV9-DIO-Syn-mCherry contains a loxp site, which can be recognized by Cre enzyme, and the sequence can be reversed by Cre enzyme, thereby starting the expression of functional protein, so as to achieve Express hM4Di-mCherry (ie, chemoinhibitory receptor hM4Di and red-labeled fluorescent protein mCherry) or express mCherry. By intraperitoneal injection of the chemical ligand molecule Clozapine N Oxide that binds to the chemical inhibitory receptor, it binds to the hM4Di protein to inhibit the CRH neurons of the subthalamic nucleus, while only expressing mCherry but not expressing hM4Di will not produce an inhibitory effect. Observe the effects of inhibited/normal activity of CRH neurons on REM sleep and fear response (Fig. 2A upper panel: schematic diagram of virus injection, scale bar is 500 μm). Whole-cell patch-clamp recordings were performed 4 weeks after hM4Di-mCherry virus injection to verify the effect of hM4Di on suppressing neuronal activity (Fig. 2A lower panel).

After confirming that the virus is well expressed and its function is confirmed, test the subject’s response to the odor of natural enemies in the sleeping state (Figure 2B), and the subject implants EEG (electroencephalogram)/EMG (electromyography) to record changes in sleep state , give the natural enemy odor when recognizing NREM or REM sleep respectively, the results are shown in Figure 2C and Figure 2D, the subjects wake up when they feel the natural enemy odor, the latency of awakening (that is, the time from the stimulation of the natural enemy odor to the awakening time interval) NREM was longer, and both mCherry control group and hM4Di were around 40s. In the REM state, the average awakening latency of the mCherry group was about 2s, which indicated that compared with NREM sleep, subjects in REM sleep responded faster to the odor of natural enemies. The hM4Di group was about 10s, indicating that chemical inhibition of CRH neurons prolongs the latency of awakening. Among them, the middle graph and the right graph of Fig. 2C/Fig. 2D are the average EEG power density spectra before the natural enemy odor stimulation to the subjects. In addition, when the subjects were awake, given natural enemy odor stimulation, it can be found that compared with the mCherry control group, the proportion of freezing-like behavior induced by natural enemies in the hM4Di experimental group was smaller, and the freezing latency (that is, from giving natural enemy odor stimulation The longer time interval to the onset of freezing-like behavior) means that the subjects' instinctive fear defense response is weaker. In addition, when subjects were given visual natural enemy fear stimuli, it was found that compared with the mCherry group, the response latency of the escape response evoked by visual natural enemy stimuli in the hM4Di experimental group (that is, the time interval from when the natural enemy stimulus was given to the start of the escape defense response, See Figure 2F left panel) is longer, the time required to return to the safe area is longer (Figure 2F middle panel), and the time spent in the safe area is shorter (Figure 2F right panel), indicating that chemical inhibition of CRH neurons in the subthalamic nucleus significantly Reduced visual visceral fear response. The above results indicate that CRH neurons in the subthalamic nucleus can regulate the subjects' instinctive fear response during REM sleep and wakefulness.

Figure 2G is a schematic diagram of virus injection and optical fiber implantation in the subthalamic nucleus of a subject. AAV-Crh-Cre and AAV-DIO-EF1a-Arch3.0-EYFP were mixed at a substance ratio of 1:1 and injected with a total of 75 nanoliters as the experimental group; AAV-Crh-Cre and AAV-DIO- EF1a-EYFP was mixed at a substance ratio of 1:1 and injected with a total of 75 nanoliters as a control group. Among them, the AAV-Crh-Cre virus can be used to express the Cre enzyme in the CRH-expressing neurons of the subthalamic nucleus, and Arch3. Outflow, to achieve the effect of neuron inhibition, can be used for real-time yellow light stimulation to cause neuron inhibition, and the combination of the two can achieve the effect of light inhibition on CRH neurons in the subthalamic nucleus. After virus injection, an optical fiber was implanted 0.1 mm above the virus injection area of the subthalamic nucleus for 4 weeks to deliver yellow light stimulation, and EEG/EMG was implanted to record the state of sleep and wakefulness. Photostimulation was initiated at the onset of REM sleep and terminated at the end of REM sleep. It was found that after expressing Arch protein, light stimulation significantly reduced the duration of REM sleep, and from the EEG power map (Fig. Increased, indicating that photoinhibition of CRH neurons affects the stability of REM sleep. All data are expressed as mean ± SEM.

To sum up, this example confirms the regulatory effect of CRH neurons in the subthalamic nucleus on REM sleep and fear response.

Example 2

Exploring the overlap between CRH neurons and glutamatergic neurons in the subthalamic nucleus

After the present invention confirms the regulating effect of the CRH neurons of the subthalamic nucleus on REM sleep and fear response through Example 1, the CRH neuron types of the subthalamic nucleus are further analyzed. This example explores the overlap between CRH neurons and glutamatergic neurons in the subthalamic nucleus.

By injecting Vglut2-Cre mice with AAV-DIO-EYFP virus (75 nL injection) into the subthalamic nucleus (Fig. 3A) to infect the glutamatergic neurons of the subthalamic nucleus, a large amount of glutamate was observed to be expressed in the subthalamic nucleus able neurons. In situ hybridization staining was used to judge whether the expression of endogenous glutamic acid RNA was co-labeled with a high ratio of viral expression EYFP to verify the specificity of the VGLUT2-cre mice used. The statistical results are shown in Figure 3B. It can be seen that the Vglut2 probe-labeled cells and the virus EYFP-labeled cells have more than 90% common labeling, which proves the specificity of the VGLUT2-cre transgenic mice.

Afterwards, the projection of VGLUT2-Cre mice to the lateral globus pallidus (LGP) after injection of AAV-DIO-EF1a-EYFP virus (injection 75 nanoliters) in the subthalamic nucleus to label glutamatergic neurons in the subthalamic nucleus was observed , a high density of axon terminals was found (Fig. 3C left panel), demonstrating that glutamatergic neurons in the subthalamic nucleus project output to the lateral globus pallidus. Staining CRH RNA by in situ hybridization found that the subthalamic nucleus CRH and virus EYFP-labeled cells had a high co-labeling ratio of more than 80% (Figure 3D), which proved that CRH and glutamate were highly co-expressed in labeled neurons. Data are expressed as mean ± SEM.

The primer sequences used in the present invention are all from Allen Brain Atlas:

Wherein, the slc17a6/Vglut2 probe primer sequence is: CCAAATCTTACGGTGCTACCTC/TAGCCATCTTTCCTGTTCCACT (SEQ ID NO 1). CRH probe primer sequence is: TAGAGCCTGTCTTGTCTGTGG/AGCATGGGCAATACAAATAACGCT (SEQ ID NO 2).

To sum up, the results of this example show that there is a high overlap ratio of CRH neurons and glutamatergic neurons in the subthalamic nucleus, suggesting that such neurons co-release CRH and glutamatergic neurons.

Example 3

Exploring the effects of CRH receptor antagonists on sleep and fear response

This example explores the effects of administering CRH receptor antagonists on sleep and fear responses.

The CRH antagonist group was used as the experimental group, and the DMSO solvent group was used as the control group. The CRH antagonist is selected from CP154526, which can bind to CRH receptor type 1, thereby competitively blocking the binding of CRH transmitters. Inject 75 nanoliters of a mixture of AAV-DIO-EF1a-ChR2-mCherry and AAV-Crh-cre (mass ratio 1:1) in the subthalamic nucleus of the subject (C57BL6J wild-type mice) ChR2 light-activated protein was expressed in CRH type neurons, and after 4 weeks of virus expression, an optical fiber was implanted in the subthalamic nucleus to deliver blue light, so that the blue light stimulated ChR2 protein to activate CRH neurons in the subthalamic nucleus, and administered to the lateral globus pallidus DMSO (injection of 400 nanoliters) or CRH antagonist (injection of 400 nanoliters, the concentration is 3.5 mg/ml, the solvent is DMSO), to block the transmission of CRH transmitters in the subthalamic nucleus-lateral globus pallidus loop, and activate the thalamus The CRH neurons of the basal nucleus were tested for behavior (Figure 4A is a schematic diagram of injection of optogenetic virus and antagonist). The results showed that blue light stimulation of CRH neurons in the subthalamic nucleus induced faster awakening in non-rapid eye movement sleep, and compared with the control group injected with DMSO solvent in the lateral globus pallidus, the awakening latency of subjects given CRH receptor antagonists was longer ( See Figure 4B). Blue light stimulated CRH neurons in the subthalamic nucleus under rapid eye movement sleep. Compared with the control group injected with DMSO solvent in the lateral pallidus, subjects given CRH receptor antagonists had no significant changes in rapid eye movement sleep (see Figure 4C). However, when subjects were given a natural enemy odor test during rapid eye movement sleep, it was found that compared with the DMSO group, the natural enemy odor-induced awakening latency of the CRH antagonist group was significantly prolonged (see Figure 4D). These results indicated that CRH antagonists attenuated the response to natural enemy stimuli during REM sleep. Figure 4E is the results of the visual instinct fear looming test, as shown in the figure, compared with the control group DMSO, the CRH antagonist group significantly prolongs the initiation of defense response time, prolongs the time to return to the safe area, and shortens the time to stay in the safe area, indicating that CRH antagonists attenuated defense responses evoked by visceral fear stimuli in waking conditions.

In summary, this example proves that CRH antagonists can weaken the response to natural enemy stimuli during REM sleep, and attenuate the defense response induced by visual instinctive fear stimuli. Based on the high co-expression of subthalamic nucleus glutamatergic neurons and CRH neurons confirmed in Example 2, there is a common regulation of sleep and defense responses, so it is proposed to antagonize glutamatergic receptor antagonists with CRH receptors Drugs are used in combination to improve the regulation of the subthalamic nucleus-lateral globus pallidus loop, and are used to prepare drugs for treating sleep disorders and mental diseases.

The applicant declares that the present invention illustrates an antagonist composition of the present invention and its application in the preparation of drugs for the treatment of sleep disorders and mental illness comorbidities through the above examples, but the present invention is not limited to the above examples , that is, it does not mean that the present invention can only be implemented depending on the above-mentioned embodiments. Those skilled in the art should understand that any improvement of the present invention, the equivalent replacement of each raw material of the product of the present invention, the addition of auxiliary components, the selection of specific methods, etc., all fall within the scope of protection and disclosure of the present invention.

The preferred embodiments of the present invention have been described in detail above, but the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solutions of the present invention. These simple modifications All belong to the protection scope of the present invention.

In addition, it should be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable way if there is no contradiction. The combination method will not be described separately.

Claims

An antagonist composition, characterized in that the antagonist composition includes a CRH receptor antagonist and a glutamatergic receptor antagonist.
antagonist composition as claimed in claim 1, is characterized in that, the ratio of the substance amount of described CRH receptor antagonist and glutamatergic receptor antagonist is (1-10):(1-10) .
The antagonist composition according to claim 1 or 2, wherein the CRH receptor antagonist comprises a compound having a structure shown in formula I, a compound having a structure shown in formula II, a compound having a structure shown in formula III Compounds, compounds with the structure shown in formula IV, N-butyl-N-ethyl-2,5-dimethyl-7-(2,4,6-trimethylphenyl)-7H-pyrrolo [2,3-D]pyrimidin-4-amine), NBI30775, 3-(6-(dimethylamino)-4-methylpyridin-3-yl)-2,5-dimethyl-N,N - Any one or a combination of at least two of dipropylpyrazolo[1,5-A]pyrimidin-7-amine, verteporfin or analamine hydrochloride;

Preferably, the CRH receptor antagonist includes any one of the compounds having the structure shown in formula I, the compound having the structure shown in formula II, the compound having the structure shown in formula III, and the compound having the structure shown in formula IV one or a combination of at least two.
The antagonist composition according to any one of claims 1-3, wherein the glutamate receptor antagonist comprises N-methyl-D-aspartate receptor antagonist, α- Any one or a combination of at least two of amino-3-hydroxy-5-methyl-4-isoxazole receptor antagonists, kainic acid receptor antagonists or metabotropic glutamate receptor antagonists.
The antagonist composition of any one of claims 1-4, wherein the glutamate receptor antagonist comprises an N-methyl-D-aspartate receptor antagonist.
The antagonist composition according to claim 4 or 5, wherein said N-methyl-D-aspartate receptor antagonist comprises AP5, AP7, CGP-37849, CPP, Saifutai, Any one or at least two of amantadine, atomoxetine, dextromethorphan, dezrozepine, ketamine, memantine, atiganel, fordine, 7-chlorokynuric acid or TK-40 combination;

Preferably, the α-amino-3 hydroxy-5-methyl-4-isoxazole receptor antagonist includes any one or at least one of NBQX, AMP397, CNQX, tiampanel, NGX426, MQPX or Kaiocephalin a combination of the two;

Preferably, the kainate receptor antagonist includes any one or a combination of at least two of UBP, tiampanel, CNQX, NS102 or Dasolampanel;

Preferably, the metabotropic glutamate receptor antagonist includes any one or a combination of at least two of MTEP, Lithium, APICA or EGLU.
Use of the antagonist composition according to any one of claims 1-6 in the preparation of a medicament for treating sleep disorders and mental illnesses.
Application of CRH receptor antagonist in preparation of medicine for treating sleep disorder and mental disease comorbidity.
Application of glutamatergic receptor antagonist in preparation of medicine for treating sleep disorder and mental disease comorbidity.
The application according to any one of claims 7-9, wherein the mental illness comprises depression, anxiety, bipolar disorder, post-traumatic stress disorder, panic disorder, obsessive-compulsive disorder or autism spectrum disorder Any one or a combination of at least two of these disorders.