WO2023122681A2 - Compounds and methods for reducing pcdh19 expression - Google Patents

Compounds and methods for reducing pcdh19 expression Download PDF

Info

Publication number
WO2023122681A2
WO2023122681A2 PCT/US2022/082164 US2022082164W WO2023122681A2 WO 2023122681 A2 WO2023122681 A2 WO 2023122681A2 US 2022082164 W US2022082164 W US 2022082164W WO 2023122681 A2 WO2023122681 A2 WO 2023122681A2
Authority
WO
WIPO (PCT)
Prior art keywords
modified
modified oligonucleotide
oligomeric
oligomeric compound
certain embodiments
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2022/082164
Other languages
English (en)
French (fr)
Other versions
WO2023122681A3 (en
Inventor
Ruben E. VALAS
Susan M. Freier
Jacqueline G. O'ROURKE
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ionis Pharmaceuticals Inc
Original Assignee
Ionis Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ionis Pharmaceuticals Inc filed Critical Ionis Pharmaceuticals Inc
Priority to US18/722,875 priority Critical patent/US20250340874A1/en
Priority to JP2024538028A priority patent/JP2025500438A/ja
Priority to EP22912708.9A priority patent/EP4453216A4/en
Publication of WO2023122681A2 publication Critical patent/WO2023122681A2/en
Publication of WO2023122681A3 publication Critical patent/WO2023122681A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/712Nucleic acids or oligonucleotides having modified sugars, i.e. other than ribose or 2'-deoxyribose
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7125Nucleic acids or oligonucleotides having modified internucleoside linkage, i.e. other than 3'-5' phosphodiesters
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3222'-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/323Chemical structure of the sugar modified ring structure
    • C12N2310/3231Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • C12N2310/334Modified C
    • C12N2310/33415-Methylcytosine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/341Gapmers, i.e. of the type ===---===
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/345Spatial arrangement of the modifications having at least two different backbone modifications
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/346Spatial arrangement of the modifications having a combination of backbone and sugar modifications

Definitions

  • Such oligomeric agents, oligomeric compounds, methods, and pharmaceutical compositions are useful to ameliorate at least one symptom or hallmark of a neurodevelopmental disease or disorder.
  • neurodevelopmental diseases or disorders include PCDH19-Epilepsy.
  • symptoms or hallmarks include seizures, cognitive impairment, intellectual disabilities, autism spectrum disorder, behavioral problems, aggression, anxiety, obsessive-compulsive disorder, hyperactivity, attention deficit disorder (ADD), and attention deficit hyperactivity disorder (ADHD).
  • PCDH19 Protocadherin 19
  • PCDH19 mutations lead to PCDH19-associated neurodevelopmental diseases and disorders, including PCDH19-Epilepsy (also known as PCDH19-Girl Clusterng Epilepsy (GCE) Epilepsy, PCDH19 Disorder, and Mental Retardation Limited to Females (EFMR)) (Hoshima, N., et al., 2021, Science, Apr 16;372(6539):eaaz3893. doi: 10.1126/science.aaz3893).
  • PCDH19-Epilepsy is the second most common cause of epilepsy; about one in ten girls who have seizures before the age of five have PCDH19-Epilepsy.
  • PCDH19-Epilepsy has a unique pattern of inheritance, due to random X chromosome inactivation, PCDH19-Epilepsy is associated with mosaic expression of mutant PCDH19.
  • the mutation leads to aberrant neural development and is found in females who are heterozygous for PCDH19 mutations, and males who are mosaic carriers of somatic PCDH19 mutaions. Hemizygous males generally do not experience symptoms or have more subtle phenotypes (Thomas, P., et al., 2018, Neuron, 97, 59-66).
  • PCDH19 mutations are associated with seizures (including clusters of seizures, generalized tonic-clonic and/or focal seizures, which may evolve to bilateral, tonic-clonic seizures), cognitive impairment, intellectual disabilities, autism spectrum disorder, behavioral problems, aggression, anxiety, obsessive-compulsive disorder, hyperactivity, attention deficit disorder (ADD), and attention deficit hyperactivity disorder (ADHD).
  • seizures including clusters of seizures, generalized tonic-clonic and/or focal seizures, which may evolve to bilateral, tonic-clonic seizures
  • cognitive impairment intellectual disabilities, autism spectrum disorder, behavioral problems, aggression, anxiety, obsessive-compulsive disorder, hyperactivity, attention deficit disorder (ADD), and attention deficit hyperactivity disorder (ADHD).
  • 2’-deoxynucleoside means a nucleoside comprising a 2’-H(H) deoxyribosyl sugar moiety.
  • a 2’-deoxynucleoside is a 2’- ⁇ -D-deoxynucleoside and comprises a 2’- ⁇ -D- deoxyribosyl sugar moiety, which has the ⁇ -D configuration as found in naturally occurring deoxyribonucleic acids0 (DNA).
  • a 2’-deoxynucleoside or a nucleoside comprising an unmodified 2’-deoxyribosyl sugar moiety may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil).
  • “2’-MOE” means a 2’-OCH 2 CH 2 OCH 3 group in place of the 2’-OH group of a furanosyl sugar moiety.
  • a “2’-MOE sugar moiety” or a “2’-O-methoxyethyl sugar moiety” means a sugar moiety with a 2’- OCH 2 CH 2 OCH 3 group in place of the 2’-OH group of a furanosyl sugar moiety.
  • MOE means O-methoxyethyl.
  • 2’-MOE nucleoside means a nucleoside comprising a 2’-MOE sugar moiety.
  • 2’-OMe means a 2’-OCH 3 group in place of the 2’-OH group of a furanosyl sugar moiety.
  • A“2’-O-methyl sugar moiety” or “2’-OMe sugar moiety” means a sugar moiety with a 2’-OCH 3 group in place of the 2’-OH group of a furanosyl sugar moiety.
  • a 2’-OMe sugar moiety is in the0 ⁇ -D-ribosyl configuration.
  • “2’-OMe nucleoside” means a nucleoside comprising a 2’-OMe sugar moiety.
  • “2’-F” means a 2’-F group in place of the 2’-OH group of a furanosyl sugar moiety.
  • A“2’- O-fluoro sugar moiety” or “2’-F sugar moiety” means a sugar moiety with a 2’-OF group in place of the 2’-OH group of a furanosyl sugar moiety.
  • a 2’-F sugar moiety is in the ⁇ -D-ribosyl configuration.
  • xylo 2’-F means a 2’-F sugar moiety in the ⁇ -D-xylosyl configuration.
  • 2’-substituted nucleoside means a nucleoside comprising a 2’-substituted furanosyl sugar moiety.
  • 2’-substituted in reference to a sugar moiety means a sugar moiety comprising at least one 2'-substituent group other than H or OH.
  • 3’ target site refers to the 3’-most nucleotide of a target nucleic acid which is0 complementary to an antisense oligonucleotide, when the antisense oligonucleotide is hybridized to the target nucleic acid.
  • 5’ target site refers to the 5’-most nucleotide of a target nucleic acid which is complementary to an antisense oligonucleotide, when the antisense oligonucleotide is hybridized to the target nucleic acid.
  • 5-methylcytosine means a cytosine modified with a methyl group attached to the 5 position.
  • a 5-methylcytosine is a modified nucleobase.
  • abasic sugar moiety means a sugar moiety of a nucleoside that is not attached to a nucleobase. Such abasic sugar moieties are sometimes referred to in the art as “abasic nucleosides.”
  • administration or “administering” means providing a pharmaceutical agent or0 composition to an animal.
  • ameliorate in reference to a disease or condition means improvement in at least one symptom of the disease or condition relative to the same symptom in the absence of the treatment.
  • amelioration is the reduction in the severity or frequency of the symptom or the delayed onset or slowing of progression in the severity or frequency of a symptom.
  • “bicyclic nucleoside” or “BNA” means a nucleoside comprising a bicyclic sugar moiety.
  • “bicyclic sugar” or “bicyclic sugar moiety” means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure.
  • the first ring of the bicyclic sugar moiety is a furanosyl sugar moiety.
  • the furanosyl sugar moiety is a ribosyl sugar moiety. In certain embodiments, the0 bicyclic sugar moiety does not comprise a furanosyl sugar moiety.
  • “blunt” or “blunt ended” in reference to an oligomeric duplex formed by two oligonucleotides mean that there are no terminal unpaired nucleotides (i.e. no overhanging nucleotides). One or both ends of an oligomeric duplex can be blunt.
  • “cell-targeting moiety” means a conjugate group or portion of a conjugate group that is5 capable of binding to a particular cell type or particular cell types.
  • Cerebrospinal fluid or “CSF” means the fluid filling the space around the brain and spinal cord.
  • Artificial cerebrospinal fluid” or “aCSF” means a prepared or manufactured fluid that has certain properties of cerebrospinal fluid.
  • cleavable moiety means a bond or group of atoms that is cleaved under physiological0 conditions, for example, inside a cell, an animal, or a human.
  • complementary in reference to an oligonucleotide means that at least 70% of the nucleobases of the oligonucleotide or one or more portions thereof and the nucleobases of another nucleic acid or one or more portions thereof are capable of hydrogen bonding with one another when the nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions.
  • complementary nucleobases means nucleobases that are capable of forming hydrogen bonds with one another.
  • Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5- 5 methylcytosine ( m C) and guanine (G).
  • Certain modified nucleobases that pair with natural nucleobases or with other modified nucleobases are known in the art.
  • inosine can pair with adenosine, cytosine, or uracil.
  • Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated.
  • oligonucleotide As used herein, “fully complementary” or “100% complementary” in reference to an oligonucleotide, or a portion thereof, means that the oligonucleotide, or portion0 thereof, is complementary to another oligonucleotide or nucleic acid at each nucleobase of the shorter of the two oligonucleotides, or at each nucleoside if the oligonucleotides are the same length.
  • complementary region in reference to an oligonucleotide is the range of nucleobases of the oligonucleotide that is complementary with a second oligonucleotide or target nucleic acid.
  • conjugate group means a group of atoms that is directly or indirectly attached to an5 oligonucleotide.
  • Conjugate groups include a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.
  • conjugate linker means a single bond or a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.
  • conjugate moiety means a group of atoms that is attached to an oligonucleotide via a0 conjugate linker.
  • oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other.
  • contiguous nucleobases means nucleobases that are immediately adjacent to each other in a sequence.
  • constrained ethyl or “cEt” means a 4’ to 2’ bridge in place of the 2’OH-group of a5 ribosyl sugar moiety, wherein the bridge has the formula of 4'-CH(CH 3 )-O-2', and wherein the methyl group of the bridge is in the S configuration.
  • a “cEt sugar moiety” is a bicyclic sugar moiety with a 4’ to 2’ bridge in place of the 2’OH-group of a ribosyl sugar moiety, wherein the bridge has the formula of 4'-CH(CH 3 )-O-2', and wherein the methyl group of the bridge is in the S configuration.
  • cEt means constrained ethyl.
  • cEt nucleoside means a nucleoside comprising a cEt sugar moiety.
  • chirally enriched population means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom. Chirally enriched populations of molecules having5 multiple chiral centers within each molecule may contain one or more stereorandom chiral centers.
  • the molecules are modified oligonucleotides. In certain embodiments, the molecules are compounds comprising modified oligonucleotides.
  • chirally controlled in reference to an internucleoside linkage means chirality at that linkage is enriched for a particular stereochemical configuration.
  • “deoxy region” means a region of 5-12 contiguous nucleotides, wherein at least 70% of the nucleosides are 2’- ⁇ -D-deoxynucleosides. In certain embodiments, each nucleoside is selected from a 2’- ⁇ -D- deoxynucleoside, a bicyclic nucleoside, and a 2’-substituted nucleoside. In certain embodiments, a deoxy region supports RNase H activity. In certain embodiments, a deoxy region is the gap or internal region of a gapmer.
  • double-stranded in reference to a region or an oligonucleotide, means a duplex formed by complementary strands of nucleic acids (including, but not limited to oligonucleotides) hybridized to one 5 another.
  • the two strands of a double-stranded region are separate molecules.
  • the two strands are regions of the same molecule that has folded onto itself (e.g., a hairpin structure).
  • duplex or “duplex region” means the structure formed by two oligonucleotides or portions thereof that are hybridized to one another.
  • gapmer means a modified oligonucleotide comprising an internal region having a0 plurality of nucleosides that support RNase H cleavage positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions.
  • the internal region may be referred to as the “gap” and the external regions may be referred to as the “wings” or “wing segments.”
  • the internal region is a deoxy region.
  • the positions of the internal region or gap refer to the order of the nucleosides of the internal region5 and are counted starting from the 5’-end of the internal region.
  • each nucleoside of the gap is a 2’- ⁇ -D-deoxynucleoside.
  • the gap comprises one 2’-substituted nucleoside at position 1, 2, 3, 4, or 5 of the gap, and the remainder of the nucleosides of the gap are 2’- ⁇ -D-deoxynucleosides.
  • MOE gapmer indicates a gapmer having a gap comprising 2’- ⁇ -D-deoxynucleosides and wings comprising 2’-MOE nucleosides.
  • the term “mixed wing gapmer” indicates a gapmer having wings comprising modified nucleosides comprising at least two different sugar modifications. Unless otherwise indicated, a gapmer may comprise one or more modified internucleoside linkages and/or modified nucleobases and such modifications do not necessarily follow the gapmer pattern of the sugar modifications.
  • hotspot region is a range of nucleobases on a target nucleic acid that is amenable to5 oligomeric compound-mediated reduction of the amount or activity of the target nucleic acid.
  • hybridization means the pairing or annealing of complementary oligonucleotides and/or nucleic acids.
  • complementary nucleic acid molecules include, but are not0 limited to, an oligomeric duplex and a nucleic acid target.
  • complementary nucleic acid molecules include, but are not limited to, an antisense oligonucleotide and a nucleic acid target.
  • internucleoside linkage means the covalent linkage between contiguous nucleosides in an oligonucleotide.
  • modified internucleoside linkage means any internucleoside linkage other than a phosphodiester internucleoside linkage.
  • Phosphorothioate internucleoside linkage or “PS internucleoside5 linkage” is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with a sulfur atom.
  • inverted nucleoside means a nucleotide having a 3’ to 3’ and/or 5’ to 5’ internucleoside linkage, as shown herein.
  • inverted sugar moiety means the sugar moiety of an inverted nucleoside or an abasic0 sugar moiety having a 3’ to 3’ and/or 5’ to 5’ internucleoside linkage.
  • linked nucleosides are nucleosides that are connected in a contiguous sequence (i.e., no additional nucleosides are presented between those that are linked).
  • linker-nucleoside means a nucleoside that links, either directly or indirectly, an oligonucleotide to a conjugate moiety. Linker-nucleosides are located within the conjugate linker of an oligomeric compound.
  • Linker-nucleosides are not considered part of the oligonucleotide portion of an oligomeric compound even if they are contiguous with the oligonucleotide.
  • LNP Lipparticle
  • a pharmaceutically active molecule such as a nucleic acid molecule, e.g., an RNAi or a plasmid from which an RNAi is transcribed.
  • LNPs are described in, for example, U.S. Patent Nos.6,858,225, 6,815,432, 8,158,601, and 8,058,069, the entire contents of which are hereby incorporated herein by reference.
  • mismatch or “non-complementary” means a nucleobase of a first nucleic acid sequence0 that is not complementary with the corresponding nucleobase of a second nucleic acid sequence or target nucleic acid when the first and second nucleic acid sequences are aligned in opposing directions.
  • motif means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or internucleoside linkages, in an oligonucleotide.
  • non-bicyclic modified sugar moiety means a modified sugar moiety that comprises a5 modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring.
  • motif means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or internucleoside linkages, in an oligonucleotide.
  • nucleobase means an unmodified nucleobase or a modified nucleobase.
  • an “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G).
  • a “modified nucleobase” is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one unmodified nucleobase.
  • a “5-methylcytosine” is a modified nucleobase.
  • a universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases.
  • nucleobase sequence means the order of contiguous nucleobases in a target nucleic acid or oligonucleotide independent of any sugar or5 internucleoside linkage modification.
  • nucleoside means a compound, or a fragment of a compound, comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each, independently, unmodified or modified.
  • modified nucleoside means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety. Modified nucleosides include abasic nucleosides, which lack a nucleobase.
  • Linked nucleosides are0 nucleosides that are connected in a contiguous sequence (i.e., no additional nucleosides are presented between those that are linked).
  • nucleoside overhang refers to unpaired nucleotides at either or both ends of a duplex formed by hybridization of two oligonucleotides.
  • oligomeric agent means an oligomeric compound and optionally one or more additional5 features, such as a second oligomeric compound.
  • An oligomeric agent may be a single-stranded oligomeric compound or may be an oligomeric duplex formed by two complementary oligomeric compounds.
  • oligomeric compound means an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group.
  • An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound or may be unpaired.
  • a “singled-0 stranded oligomeric compound” is an unpaired oligomeric compound.
  • oligomeric duplex means a duplex formed by two oligomeric compounds having complementary nucleobase sequences.
  • oligonucleotide means a strand of linked nucleosides connected via internucleoside linkages, wherein each nucleoside and internucleoside linkage may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8-50 linked nucleosides.
  • modified oligonucleotide means an oligonucleotide, wherein at least one nucleoside or internucleoside linkage is modified.
  • oligonucleotide means an oligonucleotide that does not comprise any nucleoside modifications or internucleoside modifications.
  • An oligonucleotide may be paired with a second oligonucleotide that is complementary to the oligonucleotide or it may be unpaired.
  • a “single-stranded oligonucleotide” is an unpaired oligonucleotide.
  • a “double-stranded oligonucleotide” is an oligonucleotide that is paired with a second oligonucleotide.
  • an “oligonucleotide duplex” means a duplex formed by two paired oligonucleotides having complementary nucleobase sequences. Each oligo of an oligonucleotide duplex is a “duplexed oligonucleotide” or a “double-stranded oligonucleotide.”
  • pharmaceutically acceptable carrier or diluent means any substance suitable for use in administering to an animal. Certain such carriers enable pharmaceutical compositions to be formulated as, for5 example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspension and lozenges for the oral ingestion by an animal.
  • a pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution or sterile artificial cerebrospinal fluid.
  • pharmaceutically acceptable salts means physiologically and pharmaceutically acceptable salts of compounds. Pharmaceutically acceptable salts retain the desired biological activity of the parent0 compound and do not impart undesired toxicological effects thereto.
  • pharmaceutical composition means a mixture of substances suitable for administering to an animal.
  • a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution.
  • a pharmaceutical composition shows activity in free uptake assay in certain cell lines.
  • RNA means an RNA transcript and includes pre-mRNA and mature mRNA unless otherwise specified.
  • RNAi agent means an antisense agent that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and/or protein encoded by a target nucleic acid.
  • RNAi agents include, but are not limited to double-stranded siRNA, single-stranded RNAi (ssRNAi), and microRNA, including microRNA mimics.
  • RNAi agents may comprise conjugate groups and/or terminal groups. In certain embodiments, an RNAi agent modulates the amount and/or activity, of a target nucleic acid.
  • the term RNAi agent excludes antisense agents that5 act through RNase H.
  • RNase H agent means an antisense agent that acts through RNase H to modulate a target nucleic acid and/or protein encoded by a target nucleic acid.
  • RNase H agents are single- stranded. In certain embodiments, RNase H agents are double-stranded.
  • RNase H agents may comprise conjugate groups and/or terminal groups. In certain embodiments, an RNase H agent modulates the amount and/or activity of0 a target nucleic acid.
  • RNase H agent excludes antisense agents that act principally through RISC/Ago2.
  • self-complementary in reference to an oligonucleotide means an oligonucleotide that at least partially hybridizes to itself.
  • single-stranded means a nucleic acid (including but not limited to an oligonucleotide) that is unpaired and is not part of a duplex. Single-stranded compounds are capable of hybridizing with complementary nucleic acids to form duplexes, at which point they are no longer single-stranded.
  • stabilized phosphate group means a 5’-phosphate analog that is metabolically more 5 stable than a 5’-phosphate as naturally occurs on DNA or RNA.
  • standard cell assay and “standard in vitro assay” are used interchangeably herein and the terms mean the assay described in Example 1 and reasonable variations thereof.
  • stereochemical configuration in the context of a population of molecules of identical molecular formula means a chiral center having a random stereochemical configuration.
  • the number of molecules having the (S) configuration of the stereorandom chiral center may be but is not necessarily the same as the number of molecules having the (R) configuration of the stereorandom chiral center.
  • the stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method that is not designed to control the stereochemical configuration.
  • a stereorandom chiral center is a stereorandom phosphorothioate 5 internucleoside linkage.
  • subject means a human or non-human animal.
  • the terms “subject” “animal” and “individual” are used interchangeably. In certain embodiments, the subject is human.
  • sugar moiety means an unmodified sugar moiety or a modified sugar moiety.
  • unmodified sugar moiety means a 2’-OH(H) ⁇ -D-ribosyl sugar moiety, as found in RNA (an “unmodified0 RNA sugar moiety”), or a 2’-H(H) ⁇ -D-deoxyribosyl sugar moiety, as found in DNA (an “unmodified DNA sugar moiety”).
  • Unmodified sugar moieties have one hydrogen at each of the 1’, 3’, and 4’ positions, an oxygen at the 3’ position, and two hydrogens at the 5’ position.
  • modified sugar moiety or “modified sugar” means a modified furanosyl sugar moiety or a sugar surrogate.
  • sugar surrogate means a modified sugar moiety having other than a furanosyl moiety that5 can link a nucleobase to another group, such as an internucleoside linkage, conjugate group, or terminal group in an oligonucleotide.
  • Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or target nucleic acids.
  • symptom or hallmark means any physical feature or test result that indicates the0 existence or extent of a disease or disorder. In certain embodiments, a symptom is apparent to a subject or to a medical professional examining or testing said subject. In certain embodiments, a hallmark is apparent upon invasive diagnostic testing, including, but not limited to, post-mortem tests.
  • target nucleic acid and target RNA mean a nucleic acid that an antisense compound is designed to affect. Target RNA means an RNA transcript and includes pre-mRNA and mature mRNA unless5 otherwise specified.
  • target region means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.
  • terminal group means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.
  • “treating” means improving a subject’s disease or condition by administering an oligomeric agent or oligomeric compound described herein.
  • treating a subject improves a symptom relative to the same symptom in the absence of the treatment.
  • treatment reduces in the severity or frequency of a symptom, or delays the onset of a symptom, slows the progression of a symptom, or slows the severity or frequency of a symptom.
  • terapéuticaally effective amount means an amount of a pharmaceutical agent or composition that provides a therapeutic benefit to an animal. For example, a therapeutically effective amount 5 improves a symptom of a disease.
  • antisense activity means any detectable and/or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound. In certain0 embodiments, antisense activity is the modulation of splicing of a target pre-mRNA.
  • antisense agent means an antisense compound and optionally one or more additional features, such as a sense compound.
  • antisense compound means an antisense oligonucleotide and optionally one or more additional features, such as a conjugate group. 5
  • sense compound means a sense oligonucleotide and optionally one or more additional features, such as a conjugate group.
  • antisense oligonucleotide means an oligonucleotide, including the oligonucleotide portion of an antisense compound, that is capable of hybridizing to a target nucleic acid and is capable of at least one antisense activity.
  • Antisense oligonucleotides include but are not limited to antisense RNAi oligonucleotides0 and antisense RNase H oligonucleotides.
  • sense oligonucleotide means an oligonucleotide, including the oligonucleotide portion of a sense compound, that is capable of hybridizing to an antisense oligonucleotide.
  • CERTAIN EMBODIMENTS The present disclosure provides the following non-limiting numbered embodiments: 5 Embodiment 1.
  • An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion of an PCDH19 nucleic acid, and wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar and a modified internucleoside linkage.
  • An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 15-482, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar and a modified internucleoside linkage. 5 Embodiment 3.
  • An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, or 16 contiguous nucleobases of any of SEQ ID NOs: 15-560, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar and a modified internucleoside linkage.
  • Embodiment 4 The oligomeric compound of embodiment 2 or embodiment 3, wherein the modified oligonucleotide has a nucleobase sequence consisting of the nucleobase sequence of any of SEQ ID NOs: 15-560.
  • An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of any of SEQ ID NOs: 561-1028, wherein the modified oligonucleotide comprises at 5 least one modification selected from a modified sugar and a modified internucleoside linkage.
  • Embodiment 6 Embodiment 6.
  • Embodiment 7 An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at0 least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases complementary to: an equal length portion of nucleobases 4,743-4,767 of SEQ ID NO: 1; an equal length portion of nucleobases 12,319-12,346 of SEQ ID NO: 1; an equal length portion of nucleobases 34,364-34,389 of SEQ ID NO: 1; or an equal length portion of nucleobases 84,408-84,431 of SEQ ID NO: 1; 5 wherein the modified oligonucle
  • Embodiment 8 An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of a sequence selected from: 0 SEQ ID NO: 132, 228, 284, 330, or 440; SEQ ID NO: 416, 72, 129, or 204; SEQ ID NO: 371, 425, 20, or 111; or SEQ ID NO: 367, 407, 24, 93, or 218; wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar and a5 modified internucleoside linkage.
  • Embodiment 9 The oligomeric compound of any of embodiments 1-8, wherein the nucleobase sequence of the modified oligonucleotide is at least 80%, 85%, 90%, 95%, or 100% complementary to any of the nucleobase sequences of SEQ ID NO: 1 or SEQ ID NO: 2 when measured across the entire nucleobase sequence of the modified oligonucleotide.
  • the nucleobase sequence of the modified oligonucleotide is at least 80%, 85%, 90%, 95%, or 100% complementary to any of the nucleobase sequences of SEQ ID NO: 1 or SEQ ID NO: 2 when measured across the entire nucleobase sequence of the modified oligonucleotide.
  • the modified oligonucleotide consists of 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18, 16
  • Embodiment 12. The oligomeric compound of embodiment 11, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety. 0 Embodiment 13.
  • Embodiment 14 The oligomeric compound of embodiment 13, wherein the bicyclic sugar moiety comprises a 2’-4’ bridge selected from –O-CH 2 -; and –O-CH(CH 3 )-.
  • Embodiment 18 The oligomeric compound of any of embodiments 1-17, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate.
  • Embodiment 19 The oligomeric compound of embodiment 18, wherein at least one modified nucleoside of the modified oligonucleotide comprises a sugar surrogate selected from morpholino and PNA. 5 Embodiment 20.
  • each internucleoside linkage is independently selected from a phosphodiester internucleoside linkage or a 5 phosphorothioate internucleoside linkage.
  • Embodiment 25 The oligomeric compound of any of embodiments 20 or 22-24, wherein at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19 internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages. 0 Embodiment 26.
  • each internucleoside linkage is a phosphorothioate internucleoside linkage.
  • Embodiment 27 The oligomeric compound of any of embodiments 20 or 22-26, wherein the internucleoside linkage motif of the modified oligonucleotide is selected from: 5’- ssssssssssssss -3’, 5’- sssssssssssssssssss -3’, 5’- soooossssssssssooss-3’, and ssooooooooooooooooooooooss; wherein each ‘o’ represents a5 phosphodiester internucleoside linkage and each ‘s’ represents a phosphorothioate internucleoside linkage.
  • Embodiment 28 The oligomeric compound of any of embodiments 1-27, wherein the modified oligonucleotide comprises a modified nucleobase.
  • Embodiment 29 The oligomeric compound of embodiment 28, wherein the modified nucleobase is a 5- methylcytosine.
  • Embodiment 30 The oligomeric compound of any of embodiments 1-29, wherein the oligomeric compound comprises a modified oligonucleotide consisting of 12-22, 12-20, 14-18, 14-20, 15-17, 15-25, 16-20, 16- 18, 18-22, 18-25, 18-20, 20-25, or 21-23 linked nucleosides, or a pharmaceutically acceptable salt thereof.
  • Embodiment 31 The oligomeric compound of any of embodiments 1-27, wherein the modified oligonucleotide comprises a modified nucleobase.
  • Embodiment 29 The oligomeric compound of embodiment 28, wherein the modified nucleobase is a 5- methylcytosine.
  • Embodiment 34. The oligomeric compound of any of embodiments 1-31, wherein the modified oligonucleotide consists of 20 linked nucleosides. 0 Embodiment 35.
  • Embodiment 36. The oligomeric compound of any of embodiments 1-31, wherein the modified oligonucleotide consists of 23 linked nucleosides.
  • Embodiment 37. The oligomeric compound of any of embodiments 1-35, wherein the oligomeric5 compound activates RNase H.
  • Embodiment 38. The oligomeric compound of embodiment 37, wherein the modified oligonucleotide is a gapmer.
  • Embodiment 40 The oligomeric compound of any of embodiments 1-39, wherein the modified0 oligonucleotide has a sugar motif comprising: a 5’-region consisting of 1-6 linked 5’-region nucleosides; a central region consisting of 6-10 linked central region nucleosides; and a 3’-region consisting of 1-6 linked 3’-region nucleosides; wherein each of the 5’-region nucleosides and each of the 3’-region nucleosides comprises a modified sugar moiety5 and each of the central region nucleosides comprises a 2’- ⁇ -D-deoxyribosyl sugar moiety.
  • Embodiment 41 Embodiment 41.
  • the oligomeric compound of embodiment 40 wherein the modified oligonucleotide has a sugar motif comprising: a 5’-region consisting of 5 linked 5’-region nucleosides; a central region consisting of 10 linked central region nucleosides; and 0 a 3’-region consisting of 5 linked 3’-region nucleosides; wherein each of the 5’-region nucleosides and each of the 3’-region nucleosides comprises a 2’-O(CH 2 ) 2 -OCH 3 ribosyl modified sugar moiety, and each of the central region nucleosides comprises a 2’- ⁇ -D-deoxyribosyl sugar moiety.
  • a sugar motif comprising: a 5’-region consisting of 5 linked 5’-region nucleosides; a central region consisting of 10 linked central region nucleosides; and 0 a 3’-region consisting of 5 linked 3’-region nucleosides; wherein each of
  • the oligomeric compound of embodiment 40 wherein the modified oligonucleotide has a 5 sugar motif comprising: a 5’-region consisting of 3 linked 5’-region nucleosides; a central region consisting of 10 linked central region nucleosides; and a 3’-region consisting of 3 linked 3’-region nucleosides; wherein each of the 5’-region nucleosides and each of the 3’-region nucleosides comprises a cEt sugar moiety, and0 each of the central region nucleosides comprises a 2’- ⁇ -D-deoxyribosyl sugar moiety.
  • Embodiment 43 Embodiment 43.
  • the chirally enriched population of embodiment 43 wherein the population is enriched for modified oligonucleotides having a particular, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage.
  • Embodiment 46 The chirally enriched population of embodiment 43, wherein the population is enriched for modified oligonucleotides having the (Rp) configuration at one particular phosphorothioate internucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages.
  • Embodiment 47 Embodiment 47.
  • the chirally enriched population of embodiment 43 wherein the population is enriched for modified oligonucleotides having at least 3 contiguous phosphorothioate internucleoside linkages in the Sp, Sp,5 and Rp configurations, in the 5’ to 3’ direction.
  • Embodiment 48 A population of oligomeric compounds of any of embodiments 1-42, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotide are stereorandom.
  • Embodiment 49 A population of oligomeric compounds of any of embodiments 1-42, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotide are stereorandom.
  • An oligomeric duplex comprising a first oligomeric compound and a second oligomeric compound comprising a second modified oligonucleotide, wherein the first oligomeric compound is an oligomeric0 compound of any of embodiments 1-42.
  • Embodiment 50 The oligomeric duplex of embodiment 49, wherein the second oligomeric compound comprises a second modified oligonucleotide consisting of 12 to 50 linked nucleosides, and wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 12 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide. 5 Embodiment 51.
  • An oligomeric duplex comprising: a first oligomeric compound comprising a first modified oligonucleotide consisting of 19 to 30 linked nucleosides wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 561-1028; and0 a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 30 linked nucleosides wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 12 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.
  • Embodiment 52 An oligomeric duplex comprising: a first oligomeric compound comprising a first modified oligonucleotide consisting of 19 to 30 linked 5 nucleosides wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 561-1028; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 30 linked nucleosides wherein the nucleobase sequence of the second modified oligonucleotide comprises at least0 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 1029-1496,
  • Embodiment 53 An oligomeric duplex comprising: 5 a first oligomeric compound comprising a first modified oligonucleotide consisting of 23 linked nucleosides wherein the nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of any of SEQ ID NOs: 561-1028; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 21 linked nucleosides wherein the nucleobase sequence of the second modified oligonucleotide comprises the0 nucleobase sequence of any of SEQ ID NOs: 1029-1496, wherein the nucleobase sequence of the second modified oligonucleotide is at least 90% complementary to an equal length portion of the first modified oligonucleotide.
  • Embodiment 54 The oligomeric duplex of any of embodiments 49-53, wherein the modified oligonucleotide of the first oligomeric compound comprises a 5’-stabilized phosphate group.
  • Embodiment 55 The oligomeric duplex of embodiment 54, wherein the 5’-stabilized phosphate group comprises a cyclopropyl phosphonate or a vinyl phosphonate.
  • Embodiment 56 The oligomeric duplex of any of embodiments 49-53, wherein the modified oligonucleotide of the first oligomeric compound comprises a glycol nucleic acid (GNA) sugar surrogate.
  • GNA glycol nucleic acid
  • Embodiment 58. The oligomeric duplex of any of embodiments 49-57, wherein at least one nucleoside of the second modified oligonucleotide comprises a modified sugar moiety.
  • Embodiment 59. The oligomeric duplex of embodiment 58, wherein the modified sugar moiety of the second modified oligonucleotide comprises a bicyclic sugar moiety. 5 Embodiment 60.
  • the oligomeric duplex of embodiment 59 wherein the bicyclic sugar moiety of the second modified oligonucleotide comprises a 2’-4’ bridge selected from –O-CH 2 -; and –O-CH(CH 3 )-.
  • Embodiment 61 The oligomeric duplex of embodiment 59 or embodiment 60, wherein the modified sugar moiety of the second modified oligonucleotide comprises a non-bicyclic modified sugar moiety.
  • Embodiment 62 Embodiment 62.
  • the oligomeric duplex of embodiment 61 wherein the non-bicyclic modified sugar0 moiety of the second modified oligonucleotide is a 2’-MOE sugar moiety, a 2’-F sugar moiety, or 2’-OMe sugar moiety.
  • Embodiment 63 The oligomeric duplex of any of embodiments 49-62, wherein at least one nucleoside of the second modified oligonucleotide comprises a sugar surrogate.
  • Embodiment 64 The oligomeric duplex of any of embodiments 49-63, wherein the second modified oligonucleotide comprises at least one modified internucleoside linkage. 5 Embodiment 65.
  • the oligomeric duplex of embodiment 64 wherein at least one modified internucleoside linkage of the second modified oligonucleotide is a phosphorothioate internucleoside linkage.
  • Embodiment 66 The oligomeric duplex of any of embodiments 49-65, wherein the second modified oligonucleotide comprises at least one phosphodiester internucleoside linkage.
  • each internucleoside0 linkage of the second modified oligonucleotide is independently selected from a phosphodiester or a phosphorothioate internucleoside linkage.
  • Embodiment 68 Embodiment 68.
  • Embodiment 71. The oligomeric duplex of any of embodiments 49-70, wherein the second modified oligonucleotide comprises a conjugate group.
  • Embodiment 72. The oligomeric duplex of embodiment 71, wherein the conjugate group comprises a conjugate linker and a conjugate moiety.
  • Embodiment 75. The oligomeric duplex of embodiment 71 or embodiment 72, wherein the conjugate group is attached to the second modified oligonucleotide through a modified internucleoside linkage. 0 Embodiment 76.
  • Embodiment 77 The oligomeric duplex of any of embodiments 71-76, wherein the conjugate moiety is a 6-palmitamidohexyl conjugate moiety.
  • Embodiment 78 The oligomeric duplex of any of embodiments 71-74, wherein the conjugate group has the following structure: .
  • Embodiment 79 The oligomeric duplex of any of embodiments 71-78, wherein the conjugate group comprises a cell-targeting moiety.
  • Embodiment 80 The oligomeric duplex of any of embodiments 49-79, wherein the second modified oligonucleotide comprises a terminal group. 5 Embodiment 81.
  • Embodiment 82. The oligomeric duplex of any of embodiments 49-81, wherein the second modified oligonucleotide consists of 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18, 16 to 20, 16 to 25, 16 to 30, 16 to 50, 17 to0 20, 17 to 25, 17 to 30, 17 to 50, 18 to 20, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, 20 to 50, 21 to 25, 21 to 30, 21 to 50, 22 to 25, 22 to 30, 22 to 50, 23 to 25, 23 to 30, or 23 to 50 linked nucleosides.
  • Embodiment 83 The oligomeric duplex of any of embodiments 49-81, wherein the modified oligonucleotide of the first oligomeric compound consists of 23 linked nucleosides and the second modified5 oligonucleotide consists of 21 linked nucleosides.
  • Embodiment 84 The oligomeric duplex of any of embodiments 49-81, wherein the modified oligonucleotide of the first oligomeric compound consists of 23 linked nucleosides and the second modified5 oligonucleotide consists of 21 linked nucleosides.
  • the oligomeric duplex of embodiment 83 wherein the modified oligonucleotide of the first oligomeric compound has a sugar motif (from 5′ to 3′) of: yfyyyfyyyyyyyfyfyyyyyyyyy and the second modified oligonucleotide has a sugar motif (from 5′ to 3′) of: yyyyyyfyfffyyyyyyyyyyyyy, wherein each “y” represents a 2’-OMe sugar moiety and each “f” represents a 2’-F sugar moiety.
  • yyyyyfyfffyyyyyyyyyyyyyyyyyyy wherein each “y” represents a 2’-OMe sugar moiety and each “f” represents a 2’-F sugar moiety.
  • An antisense agent comprising an antisense compound, wherein the antisense compound is the oligomeric compound of any of embodiments 1-42.
  • Embodiment 86. An antisense agent, wherein the antisense agent is the oligomeric duplex of any of embodiments 49-84.
  • Embodiment 87. The antisense agent of embodiment 85 or embodiment 86, wherein the antisense agent is:5 i. an RNase H agent capable of reducing the amount of PCDH19 nucleic acid through the activation of RNase H; or ii. an RNAi agent capable of reducing the amount of PCDH19 nucleic acid through the activation of RISC/Ago2.
  • Embodiment 89. A pharmaceutical composition comprising an oligomeric compound of any of embodiments 1-42, a population of any of embodiments 43-48, an oligomeric duplex of any of embodiments 49-84, or an antisense agent of any of embodiments 85-88, and a pharmaceutically acceptable diluent.
  • Embodiment 90. The pharmaceutical composition of embodiment 89, wherein the pharmaceutically5 acceptable diluent is artificial cerebrospinal fluid (aCSF) or PBS.
  • composition of embodiment 90 wherein the pharmaceutical composition consists essentially of the oligomeric compound, the population, the oligomeric duplex, or the antisense agent, and aCSF.
  • Embodiment 92 The pharmaceutical composition of embodiment 90, wherein the pharmaceutical0 composition consists essentially of the oligomeric compound, the population, the oligomeric duplex, or the antisense agent, and PBS.
  • Embodiment 93 A method comprising administering to a subject an oligomeric compound of any of embodiments 1-42, a population of any of embodiments 43-48, an oligomeric duplex of any of embodiments 49-84, an antisense agent of any of embodiments 85-88, or a pharmaceutical composition of any of embodiments 89-92.
  • Embodiment 94 The method of embodiment 93, wherein the subject has a disease associated with 5 PCDH19.
  • Embodiment 95. The method of embodiment 93, wherein the subject has PCDH19 Epilepsy.
  • Embodiment 96. A method of treating a disease associated with PCDH19 comprising administering to a subject having or at risk for developing a disease associated with PCDH19 a therapeutically effective amount of an oligomeric compound of any of embodiments 1-42, a population of any of embodiments 43-48, an oligomeric0 duplex of any of embodiments 49-84, an antisense agent of any of embodiments 85-88, or a pharmaceutical composition of any of embodiments 89-92; and thereby treating the disease associated with PCDH19.
  • Embodiment 97 The method of embodiment 96, wherein the disease associated with PCDH19 is a neurodevelopmental disease.
  • Embodiment 98 The method of embodiment 96 or embodiment 97, wherein the disease associated with5 PCDH19 is PCDH19 Epilepsy.
  • Embodiment 99 The method of any of embodiments 96-98, wherein at least one symptom or hallmark of the disease associated with PCDH19 is ameliorated.
  • Embodiment 100 The method of embodiment 99, wherein the symptom or hallmark is seizures, cognitive impairment, intellectual disabilities, autism spectrum disorder, behavioral problems, aggression, anxiety, obsessive-0 compulsive disorder, hyperactivity, attention deficit disorder (ADD), or attention deficit hyperactivity disorder (ADHD).
  • Embodiment 101 Embodiment 101.
  • Embodiment 102 The method of any of embodiments 96-101, wherein administering an oligomeric5 compound of any of embodiments 1-42, a population of any of embodiments 43-48, an oligomeric duplex of any of embodiments 49-84, an antisense agent of any of embodiments 85-88, or a pharmaceutical composition of any of embodiments 89-92 reduces seizures, reduces or delays cognitive impairment, reduces or delays intellectual disabilities, reduces or delays symptoms of autism spectrum disorder, reduces behavioral problems, reduces aggression, reduces anxiety, reduces obsessive-compulsive behavior, reduces hyperactivity, reduces symptoms of0 attention deficit disorder (ADD), or reduces symptoms of attention deficit hyperactivity disorder (ADHD) in the subject.
  • ADD attention deficit disorder
  • ADHD attention deficit hyperactivity disorder
  • Embodiment 103 The method of any of embodiments 93-102, wherein the subject is human.
  • Embodiment 104 A method of reducing expression of PCDH19 in a cell comprising contacting the cell with an oligomeric compound of any of embodiments 1-42, a population of any of embodiments 43-48, an5 oligomeric duplex of any of embodiments 49-84, an antisense agent of any of embodiments 85-88, or a pharmaceutical composition of any of embodiments 89-92.
  • Embodiment 105 The method of embodiment 104, wherein the cell is a neuron.
  • Embodiment 106 The method of embodiment 104 or embodiment 105, wherein the cell is a human cell.
  • Embodiment 107 The method of embodiment 104 or embodiment 105, wherein the cell is a human cell.
  • Embodiment 108. Use of an oligomeric compound of any of embodiments 1-42, a population of any of embodiments 43-48, an oligomeric duplex of any of embodiments 49-84, or an antisense agent of any of embodiments 85-88in the manufacture of a medicament for treating a disease associated with PCDH19.
  • embodiment 107 or embodiment 108 wherein the disease associated with 5 PCDH19 is PCDH19 Epilepsy.
  • Certain Oligomeric Agents and Oligomeric Compounds Certain embodiments provide oligomeric agents targeted to a PCDH19 nucleic acid.
  • the PCDH19 nucleic acid has the sequence set forth in SEQ ID NO: 1 (ENSEMBL Accession No. 0 ENSG00000165194.15 from version 104: May 2021), to SEQ ID NO: 2 (the cDNA of ENSEMBL Accession No. ENST00000373034.8 from version 104: May2021), or to both., each of which is incorporated by reference in its entirety.
  • the oligomeric agent is a single-stranded oligomeric compound. In certain embodiments, the oligomeric agent is oligomeric duplex. Certain embodiments provide an oligomeric compound comprising a modified oligonucleotide consisting5 of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion of a PCDH19 nucleic acid, and wherein the modified oligonucleotide has at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.
  • the PCDH19 nucleic acid has the nucleobase sequence of SEQ ID NOs: 1 or 2.
  • an oligomeric compound comprising a modified oligonucleotide consisting0 of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, or at least 16 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 15-560.
  • an oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least5 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 15-482
  • Certain embodiments provide an oligomeric compound comprising a modified oligonucleotide consisting of 16 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises the nucleobase sequence of any of nucleobase sequences of SEQ ID NOs: 15-560.
  • an oligomeric compound comprising a modified oligonucleotide consisting of 20 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence consisting of the nucleobase sequence of any of the nucleobase sequences of SEQ ID NOs: 15-482. Certain embodiments provide an oligomeric compound comprising a modified oligonucleotide consisting of 16 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence consisting of the5 nucleobase sequence of any of the nucleobase sequences of SEQ ID NOs: 483-560.
  • the nucleobase sequence of the modified oligonucleotide can be at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of a PCDH19 nucleic acid, wherein the PCDH19 nucleic acid has the nucleobase sequence of SEQ ID NOs: 1 or 2.
  • the modified oligonucleotide can consist of 12 to 20,0 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18, 16 to 20, 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 25, 17 to 30, 17 to 50, 18 to 20, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, 20 to 50, 21 to 25, 21 to 30, 21 to 50, 22 to 25, 22 to 30, 22 to 50, 23 to 25, 23 to 30, or 23 to 50 linked nucleosides.
  • At least one nucleoside of the modified oligonucleotide can comprise a modified sugar moiety.
  • the modified sugar moiety 5 comprises a bicyclic sugar moiety, such as a 2’-4’ bridge selected from –O-CH 2 -; and –O-CH(CH 3 )-.
  • the modified sugar moiety comprises a non-bicyclic sugar moiety, such as a 2’-MOE sugar moiety or 2’-OMe sugar moiety.
  • at least one nucleoside of the modified oligonucleotide compound can comprise a sugar surrogate.
  • At least one internucleoside linkage of the modified oligonucleotide can comprise a modified internucleoside linkage, such as a phosphorothioate internucleoside linkage.
  • each internucleoside linkage of the modified oligonucleotide can be a modified internucleoside linkage or each internucleoside linkage of the modified oligonucleotide can be a phosphorothioate internucleoside linkage.
  • at least one internucleoside linkage of the modified 5 oligonucleotide can be a phosphodiester internucleoside linkage.
  • each internucleoside linkage of the modified oligonucleotide can be independently selected from a phosphodiester or a phosphorothioate internucleoside linkage.
  • at least 2, at least 3, at least 4, at least 5, or at least 6 internucleoside linkages of the modified oligonucleotide can be phosphodiester internucleoside linkages.
  • at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least0 18 internucleoside linkages of the modified oligonucleotide can be phosphorothioate internucleoside linkages.
  • At least one nucleobase of the modified oligonucleotide can be a modified nucleobase, such as 5-methylcytosine.
  • each cytosine is 5-methylcytosine.
  • the modified oligonucleotide can comprise a deoxy5 region consisting of 5-12 contiguous 2’-deoxynucleosides.
  • each nucleoside of the deoxy region is a 2’- ⁇ -D-deoxynucleoside.
  • the deoxy region consists of 7, 8, 9, 10, or 7-10 linked nucleosides.
  • each nucleoside immediately adjacent to the deoxy region comprises a modified sugar moiety.
  • the deoxy region is flanked on the 5’-side by a 5’-region consisting of 1-6 linked 5’-region nucleosides and on the 3’-side by a 3’-region consisting of 1-6 linked 3’-region nucleosides;0 wherein the 3’-most nucleoside of the 5’-region comprises a modified sugar moiety; and the 5’-most nucleoside of the 3’-region comprises a modified sugar moiety.
  • each nucleoside of the 3’-region comprises a modified sugar moiety.
  • each nucleoside of the 5’-region comprises a modified sugar moiety.
  • a compound comprises or consists of a modified oligonucleotide consisting of 165 to 50 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 483-560, wherein the modified oligonucleotide has: a gap segment consisting of ten linked 2’-deoxynucleosides; a 5’ wing segment consisting of three linked nucleosides; and a 3’ wing segment consisting of three linked nucleosides; 0 wherein the gap segment is positioned between the 5’ wing segment and the 3’ wing segment; wherein each nucleoside of each wing segment comprises a cEt nucleoside; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytos
  • the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides. In certain embodiments, a compound comprises or consists of a modified oligonucleotide consisting of 16 to 50 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in any one 5 of SEQ ID NOs: 15-482, wherein the modified oligonucleotide has: a gap segment consisting of ten linked 2’-deoxynucleosides; a 5’ wing segment consisting of five linked nucleosides; and a 3’ wing segment consisting of five linked nucleosides; wherein the gap segment is positioned between the 5’ wing segment and the 3’ wing segment; wherein0 each nucleoside of each wing segment comprises a 2’-MOE nucleoside, and wherein each cytosine
  • the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides wherein the internucleoside linkage motif for the modified oligonucleotide is (from 5’ to 3’): soooossssssssooss ; wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.5
  • an oligomeric compound comprises a conjugate group. In certain embodiments, the conjugate group comprises a conjugate linker and a conjugate moiety.
  • the conjugate linker consists of a single bond, the conjugate linker is cleavable, the conjugate linker comprises 1-3 linker- nucleosides, the conjugate linker does not comprise any linker nucleosides, the conjugate group is attached to the modified oligonucleotide at the 5’-end of the modified oligonucleotide, or the conjugate group is attached to the0 modified oligonucleotide at the 3’-end of the modified oligonucleotide.
  • the conjugate group comprises a cell-targeting moiety having an affinity for transferrin receptor (TfR), also known as TfR1 and CD71.
  • the conjugate group comprises an anti-TfR1 antibody or fragment thereof. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding TfR1. In certain embodiments, the conjugate group comprises an aptamer capable of5 binding TfR1.
  • conjugate groups may be selected from any of a C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.
  • conjugate groups may be selected from any of C220 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, where the alkyl chain has one or more unsaturated bonds.
  • the conjugate group has the following structure: 5 Certain Oligomeric Duplexes Certain embodiments are directed to oligomeric duplexes comprising a first oligomeric compound and a0 second oligomeric compound.
  • an oligomeric duplex comprises: a first oligomeric compound comprising a first modified oligonucleotide consisting of 12 to 50 linked nucleosides wherein the nucleobase sequence of the first modified oligonucleotide comprises at least at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 5 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 15-560; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 12 to 50 linked nucleosides wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.
  • the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.
  • an oligomeric duplex comprises: a first oligomeric compound comprising a first modified oligonucleotide consisting of 16 to 50 linked nucleosides wherein the nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of any of SEQ ID NOs: 15-560; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 16 to0 50 linked nucleosides wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 16 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.
  • the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric5 compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.
  • an oligomeric duplex comprises: a first oligomeric compound comprising a first modified oligonucleotide consisting of 19 to0 30linked nucleosides wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 561-1028, and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to5 30 linked nucleosides wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.
  • the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric0 compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.
  • an oligomeric duplex comprises: a first oligomeric compound comprising a first modified oligonucleotide consisting of 19 to 30 linked nucleosides wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 5 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 561-1028, and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 30 linked nucleosides wherein the nucleobase sequence of the second modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least0 17, at least 18, at least 19, at least 20, or at least 21 contiguous nucleobase
  • the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric5 compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.
  • an oligomeric duplex comprises: a first oligomeric compound comprising a first modified oligonucleotide consisting of 23 linked0 nucleosides wherein the nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of any of SEQ ID NOs: 561-1028; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 21 linked nucleosides wherein the nucleobase sequence of the second modified oligonucleotide comprises the nucleobase sequence of any of SEQ ID NOs: 1029-1496, wherein the nucleobase sequence of the second5 modified oligonucleotide is at least 90% complementary to an equal length portion of the first modified oligonucleotide.
  • the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense 0 oligonucleotide.
  • an oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 15 to 30 linked nucleosides and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 29 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide and the nucleobase sequence of the second modified oligonucleotide each5 comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of any of the following pairs of nucleobase sequences recited in SEQ ID NOs: 723/1029, 724/1030, 725/1031, 561/1032, 562/1033, 563/1034, 726/1035, 727/1036, 728/1037, 564/1038,
  • an oligomeric duplex comprises a first oligomeric compound comprising a first 5 modified oligonucleotide consisting of 15 to 30 linked nucleosides and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 29 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide and the nucleobase sequence of the second modified oligonucleotide comprise any of the following pairs of nucleobase sequences recited in SEQ ID NOs: 723/1029, 724/1030, 725/1031, 561/1032, 562/1033, 563/1034, 726/1035, 727/1036, 728/1037, 564/1038, 729/1039, 730/1040, 731/1041,0 732/1042, 733/1043, 565/1044, 734/1045, 566/1046, 735/1047, 567/1048, 736/1049, 737/10
  • an oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 23 linked nucleosides and a second oligomeric compound comprising a second modified oligonucleotide consisting of 21 linked nucleosides, wherein the nucleobase sequence of the first0 modified oligonucleotide and the nucleobase sequence of the second modified oligonucleotide consist of any of the following pairs of nucleobase sequences recited in SEQ ID NOs: 723/1029, 724/1030, 725/1031, 561/1032, 562/1033, 563/1034, 726/1035, 727/1036, 728/1037, 564/1038, 729/1039, 730/1040, 731/1041, 732/1042, 733/1043, 565/1044, 734/1045, 566/1046, 735/1047, 567/1048, 736/1049, 737/1050, 738
  • At least one nucleoside of the first modified oligonucleotide and/or the second modified oligonucleotide can comprise a modified sugar moiety.
  • suitable modified sugar moieties include, but are not limited to, a bicyclic sugar moiety, such as a 2’-4’ bridge selected from –O-CH 2 -; and –O-CH(CH 3 )-, and a non-bicyclic sugar moiety, such as a 2’-MOE sugar moiety, a 2’- F sugar moiety, a 2’-OMe sugar moiety, or a 2’-NMA sugar moiety.
  • At least 80%, at least5 90%, or 100% of the nucleosides of the first modified oligonucleotide and/or the second modified oligonucleotide comprises a modified sugar moiety selected from 2’-F and 2’-OMe.
  • at least one nucleoside of the first modified oligonucleotide and/or the second modified oligonucleotide can comprise a sugar surrogate.
  • suitable sugar surrogates include, but are not limited to, morpholino, peptide nucleic acid (PNA), glycol nucleic acid0 (GNA), and unlocked nucleic acid (UNA).
  • At least one nucleoside of the first modified oligonucleotide comprises a sugar surrogate, which can be a GNA.
  • at least one internucleoside linkage of the first modified oligonucleotide and/or the second modified oligonucleotide can comprise a modified internucleoside linkage.
  • the modified internucleoside linkage is a phosphorothioate internucleoside linkage.
  • At least one of the first, second, or third internucleoside linkages from the 5’ end 5 and/or the 3’ end of the first modified oligonucleotide comprises a phosphorothioate linkage. In certain embodiments, at least one of the first, second, or third internucleoside linkages from the 5’ end and/or the 3’ end of the second modified oligonucleotide comprises a phosphorothioate linkage. In any of the oligomeric duplexes described herein, at least one internucleoside linkage of the first modified oligonucleotide and/or the second modified oligonucleotide can comprise a phosphodiester 0 internucleoside linkage.
  • each internucleoside linkage of the first modified oligonucleotide and/or the second modified oligonucleotide can be independently selected from a phosphodiester or a phosphorothioate internucleoside linkage.
  • the internucleoside linkage motif of the second5 modified oligonucleotide can be ssooooooooooooooooss, wherein wherein each “o” represents a phosphodiester internucleoside linkage and each “s” represents a phosphorothioate internucleoside linkage.
  • At least one nucleobase of the first modified oligonucleotide and/or the second modified oligonucleotide can be modified nucleobase.
  • the modified nucleobase is 5-methylcytosine.
  • the first modified oligonucleotide can comprise a stabilized phosphate group attached to the 5’ position of the 5’-most nucleoside.
  • the stabilized phosphate group comprises a cyclopropyl phosphonate or an (E)-vinyl phosphonate.
  • the first modified oligonucleotide can comprise a conjugate group.
  • the conjugate group comprises a conjugate linker and a conjugate5 moiety.
  • the conjugate group is attached to the first modified oligonucleotide at the 5’-end of the first modified oligonucleotide.
  • the conjugate group is attached to the first modified oligonucleotide at the 3’-end of the modified oligonucleotide.
  • the conjugate group comprises N-acetyl galactosamine.
  • the conjugate group comprises a cell-targeting moiety having an affinity for transferrin receptor (TfR), also known as TfR1 and CD71.
  • TfR transferrin receptor
  • the0 conjugate group comprises an anti-TfR1 antibody or fragment thereof.
  • the conjugate group comprises a protein or peptide capable of binding TfR1.
  • the conjugate group comprises an aptamer capable of binding TfR1.
  • conjugate groups may be selected from any of a C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl,5 C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.
  • conjugate groups may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, where the alkyl chain has one or more unsaturated bonds.
  • the second modified oligonucleotide can comprise a conjugate group.
  • the conjugate group comprises a conjugate linker and a conjugate moiety. In certain embodiments, the conjugate group is attached to the second modified oligonucleotide at the 5’- end of the second modified oligonucleotide. In certain embodiments, the conjugate group is attached to the second modified oligonucleotide at the 3’-end of the modified oligonucleotide. In certain embodiments, the conjugate group comprises N-acetyl galactosamine. In certain embodiments, the conjugate group comprises a cell-targeting moiety having an affinity for transferrin receptor (TfR), also known as TfR1 and CD71.
  • TfR transferrin receptor
  • the conjugate group comprises an anti-TfR1 antibody or fragment thereof.
  • the conjugate group comprises a protein or peptide capable of binding TfR1.
  • the conjugate group comprises an aptamer capable of binding TfR1.
  • conjugate groups may be selected from any of a C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C160 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.
  • conjugate groups may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, where the alkyl chain has one or more unsaturated bonds.
  • an antisense agent comprises an antisense compound, which comprises an oligomeric compound or an oligomeric duplex described herein.
  • an antisense agent which can comprise an oligomeric compound or an oligomeric duplex described herein, is an RNAi agent capable of reducing the amount of PCDH19 nucleic acid through the activation of RISC/Ago2.
  • an antisense agent which can comprise an oligomeric compound or an oligomeric duplex described herein, is an0 RNAse H agent capable of reducing the amount of PCDH19 nucleic acid through the activation of RNAse H.
  • Certain embodiments provide an oligomeric agent comprising two or more oligomeric duplexes.
  • an oligomeric agent comprises two or more of any of the oligomeric duplexes described herein.
  • an oligomeric agent comprises two or more of the same oligomeric duplex, which can be any of the oligomeric duplexes described herein.
  • the two or more oligomeric duplexes are5 linked together.
  • the two or more oligomeric duplexes are covalently linked together.
  • the second modified oligonucleotides of two or more oligomeric duplexes are covalently linked together.
  • the second modified oligonucleotides of two or more oligomeric duplexes are covalently linked together at their 3’ ends.
  • the two or more oligomeric duplexes are covalently linked together by a glycol linker, such as a tetraethylene glycol linker.
  • a glycol linker such as a tetraethylene glycol linker.
  • modified oligonucleotides comprise at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nucleobase) and/or at least one modified internucleoside linkage.
  • modified nucleosides and modified internucleoside linkages suitable for use in modified oligonucleotides are described below.
  • A. Certain Modified Nucleosides 0 Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modified sugar moiety and a modified nucleobase.
  • modified nucleosides comprising the following modified sugar moieties and/or the following modified nucleobases may be incorporated into modified oligonucleotides. 1.
  • modified sugar moieties are non-bicyclic modified sugar moieties.
  • modified sugar moieties are bicyclic or tricyclic sugar moieties.
  • modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.
  • modified sugar moieties are non-bicyclic modified sugar moieties comprising a furanosyl ring with one or more substituent groups none of which bridges two atoms of the furanosyl ring to form a bicyclic0 structure.
  • non bridging substituents may be at any position of the furanosyl, including but not limited to substituents at the 2’, 3’, 4’, and/or 5’ positions.
  • one or more non-bridging substituent of non-bicyclic modified sugar moieties is branched.
  • 2’-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 2’-F, 2'-OCH 3 (“OMe” or “O-methyl”), and 2'- O(CH 2 ) 2 OCH 3 (“MOE” or “O-methoxyethyl”).
  • 2’-substituent groups are selected from5 among: halo, allyl, amino, azido, SH, CN, OCN, CF 3 , OCF 3 , O-C 1 -C 10 alkoxy, O-C 1 -C 10 substituted alkoxy, O-C 1 - C 10 alkyl, O-C 1 -C 10 substituted alkyl, S-alkyl, N(R m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-alkenyl, O-alkynyl, S- alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH 2 ) 2 SCH 3 , O(CH2)2ON(Rm)(Rn) or OCH2C(
  • non-bicyclic modified sugar moieties comprise a substituent group at the 3’-position.
  • substituent5 groups suitable for the 3’-position of modified sugar moieties include but are not limited to alkoxy (e.g., methoxy), alkyl (e.g., methyl, ethyl).
  • non-bicyclic modified sugar moieties comprise a substituent group at the 4’-position.
  • 4’-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015/106128.
  • 5’-substituent groups suitable for non-bicyclic modified sugar moieties include but are0 not limited to: 5’-methyl (R or S), 5'-vinyl, ethyl, and 5’-methoxy.
  • non-bicyclic modified sugar moieties comprise more than one non-bridging sugar substituent, for example, 2'-F-5'-methyl sugar moieties and the modified sugar moieties and modified nucleosides described in Migawa et al., WO 2008/101157 and Rajeev et al., US2013/0203836.
  • a non-bridging 2’-substituent group
  • a non-bridging 2’-substituent group selected from: F, OCF 3, OCH 3 , OCH 2 CH 2 OCH 3 , O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(CH 3 ) 2
  • a 2’-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2’-substituent group selected from: F, OCH 3 , and OCH 2 CH 2 OCH 3 .
  • modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties are further defined by isomeric configuration.
  • a 2’-deoxyfuranosyl sugar 5 moiety may be in seven isomeric configurations other than the naturally occurring ⁇ -D-deoxyribosyl configuration.
  • modified sugar moieties are described in, e.g., WO 2019/157531, incorporated by reference herein.
  • a 2’- modified sugar moiety has an additional stereocenter at the 2’-position relative to a 2’-deoxyfuranosyl sugar moiety; therefore, such sugar moieties have a total of sixteen possible isomeric configurations.
  • 2’-modified sugar moieties described herein are in the ⁇ -D-ribosyl isomeric configuration unless otherwise specified. 0
  • sugars are linked to one another 3’ to 5’.
  • oligonucleotides include one or more nucleoside or sugar moiety linked at an alternative position, for example at the 2’ or inverted 5’ to 3’.
  • the 2’-substituent groups may instead be at the 3’-position.
  • Certain modified sugar moieties comprise a substituent that bridges two atoms of the furanosyl ring to5 form a second ring, resulting in a bicyclic sugar moiety.
  • Nucleosides comprising such bicyclic sugar moieties have been referred to as bicyclic nucleosides (BNAs), locked nucleosides, or conformationally restricted nucleotides (CRN). Certain such compounds are described in US Patent Publication No.2013/0190383; and PCT publication WO 2013/036868.
  • the bicyclic sugar moiety comprises a bridge between the 4' and the 2' furanose ring atoms.
  • the furanose ring is a ribose ring.
  • 4’ to0 2’ bridging sugar substituents include but are not limited to: 4'-CH 2 -2', 4'-(CH 2 ) 2 -2', 4'-(CH 2 ) 3 -2', 4'-CH 2 -O-2' (“LNA”), 4'-CH 2 -S-2', 4'-(CH 2 ) 2 -O-2' (“ENA”), 4'-CH(CH 3 )-O-2' (referred to as “constrained ethyl” or “cEt” when in the S configuration), 4’-CH 2 -O-CH 2 -2’, 4’-CH 2 -N(R)-2’, 4'-CH(CH 2 OCH 3 )-O-2' (“constrained MOE” or “cMOE
  • bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration.
  • an LNA nucleoside (described herein) may be in the ⁇ -L configuration or in the ⁇ -D configuration. 0 ⁇ -L-methyleneoxy (4’-CH 2 -O-2’) or ⁇ -L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). The addition of locked nucleic acids to siRNAs has been shown to increase siRNA stability in serum, and to reduce off- target effects (Elmen, J.
  • bicyclic nucleosides include both isomeric configurations.
  • positions of specific bicyclic nucleosides e.g., LNA or cEt
  • they are in the ⁇ -D configuration, unless otherwise specified.
  • modified sugar moieties comprise one or more non-bridging sugar substituent and0 one or more bridging sugar substituent (e.g., 5’-substituted and 4’-2’ bridged sugars).
  • modified sugar moieties are sugar surrogates.
  • the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom.
  • such modified sugar moieties also comprise bridging and/or non-bridging substituents as described herein.
  • sugar surrogates comprise a 4’-sulfur atom and a substitution at the 2'-position (see,5 e.g., Bhat et al., U.S.7,875,733 and Bhat et al., U.S.7,939,677) and/or the 5’ position.
  • sugar surrogates comprise rings having other than 5 atoms.
  • a sugar surrogate comprises a six-membered tetrahydropyran (“THP”). Such tetrahydropyrans may be further modified or substituted.
  • Nucleosides comprising such modified tetrahydropyrans include but are not limited to hexitol nucleic acid (“HNA”), anitol nucleic acid (“ANA”), manitol nucleic acid (“MNA”) (see, e.g., Leumann, CJ. Bioorg. & Med. Chem.2002, 10, 841-854), fluoro HNA: 5 (“F-HNA”, see e.g.
  • F-HNA can also be referred to as a F-THP or 3'-fluoro tetrahydropyran), and nucleosides comprising additional modified THP compounds having the formula: 4 x 0 wherein, independently, for each of said modified THP nucleoside: Bx is a nucleobase moiety; T 3 and T 4 are each, independently, an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide or one of T 3 and T 4 is an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide and the other of T 3 and T 4 is5 H,
  • modified THP nucleosides are provided wherein q 1 , q 2 , q 3 , q 4 , q 5 , q 6 and q 7 are each H. In certain embodiments, at least one of q 1 , q 2 , q 3 , q 4 , q 5 , q 6 and q 7 is other than H. In certain embodiments, at least one of q 1 , q 2 , q 3 , q 4 , q 5 , q 6 and q 7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of R 1 and R 2 is F.
  • R 1 is F and R 2 is H
  • R 1 is methoxy5 and R 2 is H
  • R 1 is methoxyethoxy and R 2 is H
  • sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom.
  • nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., U.S.5,698,685; Summerton et al., U.S.5,166,315; Summerton et al., U.S.5,185,444; and Summerton et al., U.S.5,034,506).
  • morpholino means a sugar surrogate having the following structure: Bx .
  • morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure.
  • Such sugar surrogates are referred to herein as “modified morpholinos.”
  • sugar surrogates comprise acyclic moieties. Examples of nucleosides and oligonucleotides comprising such acyclic sugar surrogates include but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol.
  • sugar surrogates comprise acyclic moieties.
  • nucleosides and oligonucleotides comprising such acyclic sugar0 surrogates include, but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., US2013/130378.
  • sugar surrogates are the “unlocked” sugar structure of UNA (unlocked nucleic acid) nucleosides.
  • UNA is an unlocked acyclic nucleic acid, wherein any of the bonds of the sugar has been removed, forming an unlocked sugar surrogate.
  • sugar surrogates are the glycerol as found in GNA (glycol nucleic acid) nucleosides as depicted below: (S)-GNA 5 where Bx represents any nucleobase. Many other bicyclic and tricyclic sugar and sugar surrogates are known in the art that can be used in modified nucleosides. 2.
  • modified oligonucleotides comprise one or more nucleosides comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleosides that does not comprise a nucleobase, referred to as an abasic nucleoside. In certain embodiments, modified oligonucleotides comprise one or more inosine nucleosides (i.e., nucleosides comprising a hypoxanthine nucleobase).
  • modified nucleobases are selected from: 5-substituted pyrimidines, 6-azapyrimi- dines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and O-6 substituted purines.
  • modified nucleobases are selected from: 5-methylcytosine, 2-aminopropyladenine, 5- hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2- propyladenine , 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (-C ⁇ C-CH 3 ) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8- thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-0 halouracil, and 5-halocytosine
  • modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one and 9-(2-5 aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp).
  • Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2- aminopyridine and 2-pyridone.
  • nucleobases include those disclosed in Merigan et al., U.S.3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J.I., Ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi,0 Y.S., Chapter 15, Antisense Research and Applications, Crooke, S.T. and Lebleu, B., Eds., CRC Press, 1993, 273- 288; and those disclosed in Chapters 6 and 15, Antisense Drug Technology, Crooke S.T., Ed., CRC Press, 2008, 163-166 and 442-443.
  • nucleosides of modified oligonucleotides may be linked together using one or more modified internucleoside linkages.
  • the two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom.
  • Modified internucleoside linkages compared to naturally occurring phosphate linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide.
  • internucleoside linkages having a 5 chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Methods of preparation of phosphorous-containing and non-phosphorous-containing internucleoside linkages are well known to those skilled in the art. Representative internucleoside linkages having a chiral center include but are not limited to alkylphosphonates and phosphorothioates.
  • Modified oligonucleotides comprising internucleoside linkages having a0 chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom internucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate linkages in particular stereochemical configurations.
  • populations of modified oligonucleotides comprise phosphorothioate internucleoside linkages wherein all of the phosphorothioate internucleoside linkages are stereorandom.
  • Such modified oligonucleotides can be generated using synthetic methods that result in random5 selection of the stereochemical configuration of each phosphorothioate linkage.
  • each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration.
  • populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate internucleoside linkages in a particular, independently selected stereochemical configuration.
  • the particular configuration of the particular phosphorothioate linkage is0 present in at least 65% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 70% of the molecules in the population.
  • the particular configuration of the particular phosphorothioate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the5 particular configuration of the particular phosphorothioate linkage is present in at least 99% of the molecules in the population.
  • Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO 2017/015555.
  • a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (Sp) configuration. In0 certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration.
  • modified oligonucleotides comprising (Rp) and/or (Sp) phosphorothioates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase:
  • a modified internucleoside linkage comprises a mesyl phosphoramidate linking group having a formula:
  • a mesyl phosphoramidate internucleoside linkage may comprise a chiral center.
  • modified oligonucleotides comprising (Rp) and/or (Sp) mesyl phosphoramidates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase:
  • chiral internucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.
  • Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y.S. Sanghvi and P.D. Cook,0 Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH 2 component parts.
  • modified oligonucleotides comprise one or more inverted nucleoside, as shown below: 5 , wherein each Bx independently represents any nucleobase.
  • an inverted nucleoside is terminal (i.e., the last nucleoside on one end of an oligonucleotide) and so only one internucleoside linkage depicted above will be present.
  • additional features such as a conjugate group may be attached to the inverted nucleoside.
  • Such terminal inverted nucleosides can be attached to either or both ends of an oligonucleotide.
  • such groups lack a nucleobase and are referred to herein as inverted sugar moieties.
  • an inverted sugar moiety is terminal (i.e., attached to the last nucleoside on one 5 end of an oligonucleotide) and so only one internucleoside linkage above will be present.
  • additional features such as a conjugate group
  • Such terminal inverted sugar moieties can be attached to either or both ends of an oligonucleotide.
  • nucleic acids can be linked 2’ to 5’ rather than the standard 3’ to 5’ linkage. Such a linkage is illustrated below. 0 , wherein each Bx represents any nucleobase.
  • modified oligonucleotides comprise one or more modified nucleosides comprising5 a modified sugar moiety.
  • modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase.
  • modified oligonucleotides comprise one or more modified internucleoside linkage.
  • the modified, unmodified, and differently modified sugar moieties, nucleobases, and/or internucleoside linkages of a modified oligonucleotide define a pattern or motif.
  • the patterns of sugar moieties, nucleobases, and internucleoside linkages are each0 independent of one another.
  • a modified oligonucleotide may be described by its sugar motif, nucleobase motif and/or internucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases).
  • nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases.
  • modified oligonucleotides comprise or consist of a region having a gapmer motif, which is defined by two external regions or “wings” and a central or internal region or “gap.”
  • the three regions of0 a gapmer motif (the 5’-wing, the gap, and the 3’-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap.
  • the sugar moieties of the nucleosides of each wing that are closest to the gap differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap (i.e., the wing/gap junction).
  • the sugar moieties within the gap are the same as one another.
  • the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap.
  • the sugar motifs of the two wings are the same as one another (symmetric gapmer).
  • the sugar motif of the 5'-wing differs from 5 the sugar motif of the 3'-wing (asymmetric gapmer).
  • the wings of a gapmer comprise 1-6 nucleosides.
  • each nucleoside of each wing of a gapmer comprises a modified sugar moiety.
  • at least one nucleoside of each wing of a gapmer comprises a modified sugar moiety.
  • at least two nucleosides of each wing of a gapmer comprises a modified sugar moiety.
  • at least three0 nucleosides of each wing of a gapmer comprises a modified sugar moiety.
  • each wing of a gapmer comprises a modified sugar moiety.
  • the gap of a gapmer comprises 7-12 nucleosides.
  • each nucleoside of the gap of a gapmer comprises a 2’- ⁇ -D-deoxyribosyl sugar moiety.
  • at least one nucleoside of the gap of a gapmer comprises a modified sugar moiety. 5 In certain embodiments, the gapmer is a deoxy gapmer.
  • the nucleosides on the gap side of each wing/gap junction comprise 2’- deoxyribosyl sugar moieties and the nucleosides on the wing sides of each wing/gap junction comprise modified sugar moieties.
  • each nucleoside of the gap comprises a 2’- ⁇ -D-deoxyribosyl sugar moiety.
  • each nucleoside of each wing of a gapmer comprises a modified sugar moiety.
  • at least one nucleoside of the gap of a gapmer0 comprises a modified sugar moiety.
  • one nucleoside of the gap comprises a modified sugar moiety and each remaining nucleoside of the gap comprises a 2’-deoxyribosyl sugar moiety.
  • at least one nucleoside of the gap of a gapmer comprises a 2’-OMe sugar moiety.
  • the lengths (number of nucleosides) of the three regions of a gapmer may be provided using the notation [# of nucleosides in the 5’-wing] – [# of nucleosides in the gap] – [# of nucleosides in the 3’-wing].
  • a 3-10-3 gapmer consists of 3 linked nucleosides in each wing and 10 linked nucleosides in the gap.
  • that modification is the modification in each sugar moiety of each wing and the gap nucleosides comprise 2’- ⁇ -D-deoxyribosyl sugar moieties.
  • a 3-10-3 cEt gapmer consists of 3 linked cEt nucleosides in the 5’-wing, 10 linked 2’- ⁇ -D-deoxynucleosides in the gap, and 3 linked cEt nucleosides in the 3’-wing.
  • a 5-10-5 MOE gapmer consists of 5 linked 2’-MOE nucleosides in the 5’-wing, 100 linked 2’- ⁇ -D-deoxynucleosides in the gap, and 5 linked 2’-MOE nucleosides in the 3’-wing.
  • modified oligonucleotides have the sugar motif from 5’ to 3’: eeeeeddddddddddeeeee; wherein each “d” represents a 2’- ⁇ -D-deoxyribosyl sugar moiety and each “e” represents a 2’-MOE ribosyl sugar moiety.
  • modified oligonucleotides have the sugar motif from 5’ to 3’: 5 kkkddddddddkkk; wherein each “d” represents a 2’- ⁇ -D-deoxyribosyl sugar moiety, and each “k” represents a cEt sugar moiety.
  • oligonucleotides comprise modified and/or unmodified nucleobases arranged0 along the oligonucleotide or region thereof in a defined pattern or motif.
  • each nucleobase is modified.
  • none of the nucleobases are modified.
  • each purine or each pyrimidine is modified.
  • each adenine is modified.
  • each guanine is modified.
  • each thymine is modified.
  • each uracil is modified.
  • each cytosine is modified.
  • some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methylcytosines.
  • all of the cytosine nucleobases are 5-methylcytosines and all of the other nucleobases of the modified oligonucleotide are unmodified 5 nucleobases.
  • modified oligonucleotides comprise a block of modified nucleobases.
  • the block is at the 3’-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 3’-end of the oligonucleotide. In certain embodiments, the block is at the 5’-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 5’-end of the oligonucleotide.0 In certain embodiments, oligonucleotides having a gapmer motif comprise a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is in the central gap of an oligonucleotide having a gapmer motif.
  • the sugar moiety of said nucleoside is a 2’-deoxyribosyl sugar moiety.
  • the modified nucleobase is selected from: a 2-thiopyrimidine and a 5-propynepyrimidine. 5 3.
  • Certain Internucleoside Linkage Motifs oligonucleotides comprise modified and/or unmodified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif.
  • each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and phosphodiester internucleoside linkage.
  • each phosphorothioate internucleoside linkage is independently selected from a stereorandom phosphorothioate a (Sp) phosphorothioate, and a (Rp) phosphorothioate.
  • the sugar motif of a modified oligonucleotide is a gapmer and the internucleoside linkages within the gap are all modified.
  • some or all of the internucleoside linkages in the wings are unmodified phosphodiester internucleoside linkages.
  • the terminal internucleoside linkages are modified.
  • the sugar motif of a modified oligonucleotide is a gapmer
  • the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at0 least one wing, wherein the at least one phosphodiester linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages.
  • all of the phosphorothioate linkages are stereorandom.
  • all of the phosphorothioate linkages in the wings are (Sp) phosphorothioates
  • the gap comprises at least one Sp, Sp, Rp motif.
  • populations of modified oligonucleotides are enriched for modified oligonucleotides comprising such 5 internucleoside linkage motifs.
  • C. Certain Lengths It is possible to increase or decrease the length of an oligonucleotide without eliminating activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a series of oligonucleotides 13-250 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model.
  • Oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the oligonucleotides were able to direct specific cleavage of the target RNA, albeit to a lesser extent than the oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with 1 or 3 mismatches. In certain embodiments, oligonucleotides (including modified oligonucleotides) can have any of a variety of ranges of lengths.
  • oligonucleotides consist of X to Y linked nucleosides, where X 5 represents the fewest number of nucleosides in the range and Y represents the largest number nucleosides in the range.
  • X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X ⁇ Y.
  • oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to0 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to5 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 19, 16 to 20, 16 to
  • modified oligonucleotides are incorporated into a modified oligonucleotide.
  • modified oligonucleotides are characterized by their modification motifs and overall lengths. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer0 sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications.
  • the internucleoside linkages within the wing regions of a sugar gapmer may be the same or different from one another and may be the same or different from the internucleoside linkages of the gap region of the sugar motif.
  • sugar gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. Unless otherwise indicated, all5 modifications are independent of nucleobase sequence.
  • E. Certain Populations of Modified Oligonucleotides Populations of modified oligonucleotides in which all of the modified oligonucleotides of the population have the same molecular formula can be stereorandom populations or chirally enriched populations.
  • All of the0 chiral centers of all of the modified oligonucleotides are stereorandom in a stereorandom population.
  • a chirally enriched population at least one particular chiral center is not stereorandom in the modified oligonucleotides of the population.
  • the modified oligonucleotides of a chirally enriched population are enriched for ⁇ -D ribosyl sugar moieties, and all of the phosphorothioate internucleoside linkages are stereorandom.
  • the modified oligonucleotides of a chirally enriched population are enriched for both ⁇ -D ribosyl sugar moieties and at least one, particular phosphorothioate internucleoside linkage in a particular stereochemical configuration.
  • 5 F. Nucleobase Sequence oligonucleotides (unmodified or modified oligonucleotides) are further described by their nucleobase sequence. In certain embodiments oligonucleotides have a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid.
  • a region of an oligonucleotide has a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid.
  • the nucleobase sequence of a region or entire length of an oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the second oligonucleotide or nucleic acid, such as a target nucleic acid. 5 II.
  • oligomeric compounds which consist of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and/or terminal groups.
  • Conjugate groups consist of one or more conjugate moiety and a conjugate linker which links the conjugate moiety to the 0 oligonucleotide.
  • Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position.
  • conjugate groups are attached to the 2'-position of a nucleoside of a modified oligonucleotide.
  • conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups. In certain such embodiments, conjugate groups or terminal groups are attached at the 3’ and/or 5’-end of oligonucleotides. In certain such embodiments, conjugate groups (or terminal groups) are5 attached at the 3’-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3’-end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5’-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5’-end of oligonucleotides.
  • terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are 0 independently modified or unmodified.
  • A. Certain Conjugate Groups In certain embodiments, oligonucleotides are covalently attached to one or more conjugate groups. In certain embodiments, conjugate groups modify one or more properties of the attached oligonucleotide, including5 but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance.
  • conjugation of one or more carbohydrate moieties to a modified oligonucleotide can optimize one or more properties of the modified oligonucleotide.
  • the carbohydrate moiety is attached to a modified subunit of the modified oligonucleotide.
  • the ribose sugar of one or0 more ribonucleotide subunits of a modified oligonucleotide can be replaced with another moiety, e.g. a non- carbohydrate (preferably cyclic) carrier to which is attached a carbohydrate ligand.
  • a ribonucleotide subunit in which the ribose sugar of the subunit has been so replaced is referred to herein as a ribose replacement modification subunit (RRMS), which is a modified sugar moiety.
  • RRMS ribose replacement modification subunit
  • a cyclic carrier may be a carbocyclic ring system, i.e., one or more ring atoms may be a heteroatom, e.g., nitrogen, oxygen, sulphur.
  • the cyclic carrier may be a monocyclic ring system, or may contain two or more rings, e.g. fused rings.
  • the cyclic carrier may be a fully saturated ring system, or it may contain one or more double bonds.
  • the modified oligonucleotide is a gapmer.
  • conjugate groups impart a new property on the attached oligonucleotide, e.g., fluorophores or reporter groups that enable detection of the oligonucleotide.
  • Certain conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053- 1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y.
  • Acids Res., 1990, 18,5 3777-3783 a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229- 237), an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp.
  • conjugate groups may be selected from any of a C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.
  • conjugate groups may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, where the alkyl chain has one or more unsaturated bonds.
  • a conjugate group has the following structure: . 0 1.
  • Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.
  • intercalators include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, bio
  • a conjugate moiety comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.
  • an active drug substance for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, car
  • Conjugate Linkers Conjugate moieties are attached to oligonucleotides through conjugate linkers.
  • the conjugate linker is a single chemical bond (i.e., the conjugate moiety is attached directly to an oligonucleotide through a single bond).
  • the conjugate linker comprises a chain structure, 5 such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units.
  • a conjugate linker comprises pyrrolidine.
  • a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino.
  • the0 conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups.
  • the conjugate linker comprises groups selected from alkyl and amide groups.
  • the conjugate linker comprises groups selected from alkyl and ether groups.
  • the conjugate linker comprises at least one phosphorus moiety.
  • the conjugate linker comprises at least one phosphate group.
  • the conjugate linker includes at least one neutral5 linking group.
  • conjugate linkers including the conjugate linkers described above, are bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate groups to compounds, such as the oligonucleotides provided herein.
  • a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a particular site on a compound and the other0 is selected to bind to a conjugate group. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups.
  • bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.
  • conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6-dioxaoctanoic acid5 (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA).
  • conjugate linkers include but are not limited to substituted or unsubstituted C 1 -C 10 alkyl, substituted or unsubstituted C 2 -C 10 alkenyl or substituted or unsubstituted C 2 -C 10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl. 0
  • conjugate linkers comprise 1-10 linker-nucleosides. In certain embodiments, conjugate linkers comprise 2-5 linker-nucleosides.
  • conjugate linkers comprise exactly 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise the TCA motif. In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, linker-nucleosides are unmodified. In certain embodiments,5 linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine.
  • a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N- benzoyladenine, guanine and 2-N-isobutyrylguanine. It is typically desirable for linker-nucleosides to be cleaved from the oligomeric compound after it reaches a target tissue. Accordingly, linker-nucleosides are typically linked0 to one another and to the remainder of the oligomeric compound through cleavable bonds.
  • cleavable bonds are phosphodiester bonds.
  • linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which an oligomeric compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and/or a specified percent complementarity to a reference nucleic acid and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising linker- 5 nucleosides, those linker-nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for the reference nucleic acid.
  • an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker-nucleosides that are contiguous with the nucleosides of the modified oligonucleotide.
  • the total number of contiguous linked nucleosides in such an oligomeric compound is more than0 30.
  • an oligomeric compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in such an oligomeric compound is no more than 30.
  • conjugate linkers comprise no more than 10 linker- nucleosides.
  • conjugate linkers comprise no more than 5 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 3 linker-nucleosides. In certain embodiments, conjugate5 linkers comprise no more than 2 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 1 linker-nucleoside. In certain embodiments, it is desirable for a conjugate group to be cleaved from the oligonucleotide.
  • conjugate linkers may comprise one or more cleavable moieties.
  • a cleavable moiety is a cleavable bond.
  • a cleavable moiety is a group of atoms comprising at least one cleavable bond.
  • a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds.
  • a cleavable moiety is selectively cleaved inside a cell or subcellular5 compartment, such as a lysosome.
  • a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.
  • a cleavable bond is selected from among: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide.
  • a cleavable bond is one or both of the esters of a phosphodiester.
  • a cleavable moiety comprises a phosphate0 or phosphodiester.
  • the cleavable moiety is a phosphate linkage between an oligonucleotide and a conjugate moiety or conjugate group.
  • a cleavable moiety comprises or consists of one or more linker-nucleosides. In certain such embodiments, the one or more linker-nucleosides are linked to one another and/or to the remainder of the oligomeric compound through cleavable bonds.
  • cleavable bonds are unmodified5 phosphodiester bonds.
  • a cleavable moiety is 2'-deoxynucleoside that is attached to either the 3' or 5'-terminal nucleoside of an oligonucleotide by a phosphate internucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate linkage.
  • the cleavable moiety is 2'-deoxyadenosine. 3. Cell-Targeting Moieties 0
  • a conjugate group comprises a cell-targeting moiety.
  • a conjugate group has the general formula: wherein n is from 1 to about 3, m is 0 when n is 1, m is 1 when n is 2 or greater, j is 1 or 0, and k is 1 or 0. 5 In certain embodiments, n is 1, j is 1 and k is 0. In certain embodiments, n is 1, j is 0 and k is 1. In certain embodiments, n is 1, j is 1 and k is 1. In certain embodiments, n is 2, j is 1 and k is 0. In certain embodiments, n is 2, j is 0 and k is 1. In certain embodiments, n is 2, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 0.
  • conjugate groups comprise cell-targeting moieties that have at least one tethered0 ligand.
  • cell-targeting moieties comprise two tethered ligands covalently ligands covalently attached to a branching group.
  • each ligand of a cell-targeting moiety has an affinity for at least one type of receptor on a target cell.
  • each ligand has an affinity for at least one type of receptor on the surface of a mammalian liver cell.
  • each ligand has an affinity for the hepatic 5 asialoglycoprotein receptor (ASGP-R).
  • ASGP-R hepatic 5 asialoglycoprotein receptor
  • each ligand is a carbohydrate.
  • oligomeric compounds comprise a conjugate group comprising a cell-targeting moiety having an affinity for transferrin receptor (TfR), also known as TfR1 and CD71.
  • TfR transferrin receptor
  • the conjugate group comprises an anti-TfR1 antibody or fragment thereof.
  • the anti-TfR1 antibody or fragment thereof can be any known in the art including but not limited to those described in 0 WO1991/004753; WO2013/103800; WO2014/144060; WO2016/081643; WO2016/179257; WO2016/207240; WO2017/221883; WO2018/129384; WO2018/124121; WO2019/151539; WO2020/132584; WO2020/028864; US 7,208,174; US 9,034,329; and US 10,550,188.
  • a fragment of an anti-TfR1 antibody is F(ab')2, Fab, Fab', Fv, or scFv.
  • the conjugate group comprises a protein or peptide capable of binding TfR1.
  • the protein or peptide capable of binding TfR1 can be any known in the art including but not limited to those described in WO2019/140050; WO2020/037150; WO2020/124032; and US 10,138,483.
  • the conjugate group comprises an aptamer capable of binding TfR1.
  • the aptamer capable of binding TfR1 can be any known in the art including but not limited to those described in WO2013/163303; WO2019/033051; and WO2020/245198.
  • oligomeric compounds comprise one or more terminal groups.
  • oligomeric compounds comprise a stabilized 5’-phosphate.
  • Stabilized 5’-phosphates include, but are not limited to 5’-phosphonates, including, but not limited to 5’-vinylphosphonates.
  • 5 terminal groups comprise one or more abasic sugar moieties and/or inverted nucleosides.
  • terminal groups comprise one or more 2’-linked nucleosides or sugar moieties.
  • the 2’-linked group is an abasic sugar moiety.
  • oligomeric compounds and oligomeric duplexes are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity; such oligomeric compounds and oligomeric duplexes are antisense agents.
  • antisense agents have antisense activity when they reduce or inhibit 5 the amount or activity of a target nucleic acid by 25% or more in the standard cell assay. In certain embodiments, antisense agents selectively affect one or more target nucleic acid.
  • Such antisense agents comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in significant undesired antisense activity.
  • hybridization of an antisense agents or a portion or an antisense agentto a target nucleic acid results in recruitment of a protein that cleaves the target nucleic acid.
  • certain antisense agents result in RNase H mediated cleavage of the target nucleic acid.
  • RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex.
  • the DNA in such an RNA:DNA duplex need not be unmodified DNA.
  • antisense agents comprising antisense oligomeric5 compounds comprising antisense oligonucleotidesthat are sufficiently “DNA-like” to elicit RNase H activity.
  • one or more non-DNA-like nucleoside in the gap of a gapmer is tolerated.
  • an antisense agent or a portion of an antisense agent is loaded into an RNA- induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid.
  • RISC RNA- induced silencing complex
  • RNAi agents may be double-stranded (siRNA or dsRNAi) or single-stranded (ssRNAi).
  • hybridization of an antisense agent or portion thereof to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid.
  • hybridization of the antisense agent or portion thereof to the target nucleic acid results in alteration of splicing of the target nucleic acid.
  • hybridization of an antisense agent or a portion thereof to a target nucleic acid results5 in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, hybridization of an antisense agent or a portion thereof to a target nucleic acid results in alteration of translation of the target nucleic acid. Antisense activities may be observed directly or indirectly. In certain embodiments, observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid0 or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein and/or a phenotypic change in a cell or animal. IV.
  • oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid.
  • the target nucleic acid is an5 endogenous RNA molecule.
  • the target nucleic acid encodes a protein.
  • the target nucleic acid is selected from: a mature mRNA and a pre-mRNA, including intronic, exonic and untranslated regions.
  • the target RNA is a mature mRNA.
  • the target nucleic acid is a pre-mRNA.
  • the target region is entirely within an intron.
  • the target region spans an intron/exon junction. In certain embodiments, the target region is at least0 50% within an intron.
  • oligonucleotides are complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, oligonucleotides are 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid.
  • oligonucleotides are at least 80% complementary 5 to the target nucleic acid over the entire length of the oligonucleotide and comprise a region that is 100% or fully complementary to a target nucleic acid. In certain embodiments, the region of full complementarity is from 6 to 20, 10 to 18, or 18 to 20 nucleobases in length. It is possible to introduce mismatch bases without eliminating activity. For example, Gautschi et al (J. Natl. Cancer Inst.
  • oligonucleotides 16:3341-3358, 1988) tested a series of tandem 14 nucleobase oligonucleotides, and 28 and 42 nucleobase oligonucleotides comprised of the sequence of two or three of the tandem oligonucleotides, respectively, for their ability to arrest translation of human DHFR in a rabbit5 reticulocyte assay.
  • Each of the three 14 nucleobase oligonucleotides alone was able to inhibit translation, albeit at a more modest level than the 28 or 42 nucleobase oligonucleotides.
  • oligonucleotides comprise one or more mismatched nucleobases relative to the target nucleic acid.
  • antisense activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount.
  • selectivity of the0 oligonucleotide is improved.
  • the mismatch is specifically positioned within an oligonucleotide having a gapmer motif.
  • the mismatch is at position 1, 2, 3, 4, 5, 6, 7, or 8 from the 5’-end of the gap region.
  • the mismatch is at position 9, 8, 7, 6, 5, 4, 3, 2, 1 from the 3’-end of the gap region.
  • the mismatch is at position 1, 2, 3, or 4 from the 5’-end of the wing region.
  • oligomeric compounds comprise or consist of an oligonucleotide that is complementary to a target nucleic acid, wherein the target nucleic acid is a PCDH19 nucleic acid.
  • the PCDH19 nucleic acid has the nucleobase sequence set forth in SEQ ID NO: 1 (ENSEMBL0 Accession No. ENSG00000165194.15 from version 104: May 2021), to SEQ ID NO: 2 (the cDNA of ENSEMBL Accession No. ENST00000373034.8 from version 104: May2021), or to both.
  • contacting a cell with an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 reduces the amount of PCDH19 RNA, and in certain embodiments reduces the amount of PCDH19 protein. In certain embodiments, contacting a cell with an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 reduces the5 amount of PCDH19 RNA in a cell, and in certain embodiments reduces the amount of PCDH19 protein in a cell. In certain embodiments, the cell is in vitro. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide..
  • the oligomeric compound consists of a modified oligonucleotide and a conjugate group. In certain embodiments, the oligomeric compound is paired with an additional oligomeric compound in an oligomeric duplex. In certain embodiments, the oligomeric duplex comprises a conjugate group. 0 In certain embodiments, an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing the detectable amount of PCDH19 RNA in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% in the standard cell assay.
  • an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing the detectable amount of PCDH19 protein in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing the detectable amount of PCDH19 RNA 5 in vivo by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.
  • an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing the detectable amount of PCDH19 protein in vivo by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.
  • an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing0 the detectable amount of PCDH19 RNA in the CSF of an animal by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.
  • an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing the detectable amount of PCDH19 protein in the CSF of an animal by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. 5
  • contacting a cell in an animal with the oligomeric compound ameliorates one or more symptom or hallmark of a neurodevelopmental disease or disorder.
  • the neurodevelopmental disease or disorder is PCDH19 Epilepsy.
  • the symptom or hallmark is any of seizures, cognitive impairment, intellectual disabilities, autism spectrum disorder, behavioral problems, aggression, anxiety, obsessive-compulsive disorder, hyperactivity, attention deficit disorder (ADD), and attention0 deficit hyperactivity disorder (ADHD).
  • the seizures are any of clusters of seizures, generalized tonic-clonic seizures, or focal seizures, which may evolve to bilateral, tonic-clonic seizures.
  • C. Certain Target Nucleic Acids in Certain Tissues In certain embodiments, oligomeric compounds comprise or consist of an oligonucleotide comprising a5 region that is complementary to a target nucleic acid, wherein the target nucleic acid is expressed in a pharmacologically relevant tissue.
  • the pharmacologically relevant tissues are the cells and tissues that comprise the central nervous system. Such tissues include the brain and spinal cord. IV. Certain Methods and Uses 0 Certain embodiments provided herein relate to methods of reducing or inhibiting PCDH19 expression or activity, which can be useful for treating, preventing, or ameliorating a disease associated with PCDH19.
  • the disease associated with PCDH19 is a neurodevelopmental disease.
  • the disease associated with PCDH19 is PCDH19 Epilepsy.
  • a method comprises administering to a subject an oligomeric compound, a5 modified oligonucleotide, an oligomeric duplex, or an antisense agent, any of which having a nucleobase sequence complementary to a PCDH19 nucleic acid.
  • the subject has a neurodevelopmental disease.
  • the subject has PCDH19 Epilepsy.
  • a method of treating a disease associated with PCDH19 comprises administering to a subject an oligomeric compound, a modified oligonucleotide, an oligomeric duplex, or an antisense agent, any0 of which having a nucleobase sequence complementary to a PCDH19 nucleic acid.
  • the subject has or is a risk of developing a disease associated with PCDH19.
  • the subject has a neurodevelopmental disease.
  • the subject has PCDH19 Epilepsy.
  • at least one symptom or hallmark of the disease associated with PCDH19 is ameliorated.
  • the at least one symptom or hallmark is seizures, cognitive impairment, intellectual disabilities, autism spectrum disorder, behavioral problems, aggression, anxiety, obsessive-compulsive disorder, hyperactivity, attention deficit disorder (ADD), or attention deficit hyperactivity disorder (ADHD).
  • the seizures are any of 5 clusters of seizures, generalized tonic-clonic seiaures, focal seizures, or bilateral seizures.
  • administration of the oligomeric compound, the modified oligonucleotide, the oligomeric duplex, or the antisense agent to the subject reduces or delays the onset or progression of seizures, cognitive impairment, intellectual disabilities, autism spectrum disorder, behavioral problems, aggression, anxiety, obsessive-compulsive disorder, hyperactivity, attention deficit disorder (ADD), or attention deficit hyperactivity disorder (ADHD) in the subject.
  • cognitive impairment intellectual disabilities, autism spectrum disorder, behavioral problems, aggression, anxiety, obsessive-compulsive disorder, hyperactivity, attention deficit disorder (ADD), or attention deficit hyperactivity disorder (ADHD) in the subject.
  • a method of reducing expression of PCDH19 nucleic acid, for example RNA, or reducing expression of PCDH19 protein in a cell comprises contacting the cell with an oligomeric compound, a modified oligonucleotide, an oligomeric duplex, or an antisense agent, any of which having a nucleobase sequence complementary to a PCDH19 nucleic acid.
  • the subject has or is a risk of developing a disease associated with PCDH19.
  • the subject has a neurodevelopmental disease.
  • the subject has PCDH19 Epilepsy.
  • the cell is a neuron.
  • the cell is a human cell.
  • Certain embodiments are drawn to an oligomeric compound, a modified oligonucleotide, an oligomeric duplex, or an antisense agent, any of which having a nucleobase sequence complementary to a PCDH19 nucleic acid, for use in treating a disease associated with PCDH19 or for use in the manufacture of a medicament for0 treating a disease associated with PCDH19.
  • the disease associated with PCDH19 is a neurodevelopmental disease.
  • the disease associated with PCDH19 is PCDH19 Epilepsy.
  • the oligomeric compound, the modified oligonucleotide, the oligomeric duplex, or the antisense agent can be any described herein. 5 V.
  • compositions comprising one or more oligomeric compounds.
  • the one or more oligomeric compounds each consists of a modified oligonucleotide.
  • the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier.
  • a pharmaceutical composition comprises or consists of a sterile saline0 solution and one or more oligomeric compound.
  • the sterile saline is pharmaceutical grade saline.
  • a pharmaceutical composition comprises or consists of one or more oligomeric compound and sterile water.
  • the sterile water is pharmaceutical grade water.
  • a pharmaceutical composition comprises or consists of one or more oligomeric compound and phosphate-buffered saline (PBS).
  • the sterile PBS is pharmaceutical grade PBS.
  • a pharmaceutical composition comprises or consists of one or more oligomeric compound and artificial cerebrospinal fluid (“artificial CSF” or “aCSF”).
  • the artificial cerebrospinal fluid is pharmaceutical grade.
  • a pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid (aCSF).
  • a pharmaceutical composition consists of a modified0 oligonucleotide and artificial cerebrospinal fluid.
  • a pharmaceutical composition consists essentially of a modified oligonucleotide and artificial cerebrospinal fluid.
  • the artificial cerebrospinal fluid is pharmaceutical grade.
  • aCSF comprises sodium chloride, potassium chloride, sodium dihydrogen phosphate dihydrate, sodium phosphate dibasic anhydrous, calcium chloride dihydrate, and magnesium chloride hexahydrate.
  • the pH of an aCSF solution is modulated with a suitable pH-adjusting agent, for example, with acids such as hydrochloric acid and alkalis such as sodium hydroxide, to a range of from about 5 7.1-7.3, or to about 7.2.
  • compositions comprise one or more oligomeric compound and one or more excipients.
  • excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone.
  • oligomeric compounds may be admixed with pharmaceutically acceptable active and/or inert substances for the preparation of pharmaceutical compositions or formulations.
  • Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
  • compositions comprising an oligomeric compound encompass any5 pharmaceutically acceptable salts of the oligomeric compound, esters of the oligomeric compound, or salts of such esters.
  • pharmaceutical compositions comprising oligomeric compounds comprising one or more oligonucleotide upon administration to an animal, including a human, are capable of providing (directly or indirectly) the biologically active metabolite or residue thereof.
  • the disclosure is also drawn to pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts0 of such prodrugs, and other bioequivalents.
  • pharmaceutically acceptable salts comprise inorganic salts, such as monovalent or divalent inorganic salts.
  • Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and, potassium, calcium, and magnesium salts.
  • prodrugs comprise one or more conjugate group attached to an oligonucleotide, wherein the conjugate group is cleaved by endogenous nucleases within the body. 5
  • oligomeric compounds are lyophilized and isolated as sodium salts.
  • the sodium salt of an oligomeric compound is mixed with a pharmaceutically acceptable diluent.
  • the pharmaceutically acceptable diluent comprises sterile saline, sterile water, PBS, or aCSF.
  • the sodium salt of an oligomeric compound is mixed with PBS.
  • the sodium salt of an oligomeric compound is mixed with aCSF.
  • aCSF aCSF.
  • the nucleic acid such as an oligomeric compound
  • the nucleic acid is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids.
  • DNA complexes with mono- or poly-cationic lipids are formed without the presence of a neutral lipid.
  • a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue.
  • a lipid moiety5 is selected to increase distribution of a pharmaceutical agent to fat tissue.
  • a lipid moiety is selected to increase distribution of a pharmaceutical agent to muscle tissue.
  • pharmaceutical compositions comprise a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds. In certain embodiments,0 certain organic solvents such as dimethylsulfoxide are used.
  • pharmaceutical compositions comprise one or more tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents comprising an oligomeric compound provided herein to specific tissues or cell types.
  • pharmaceutical compositions include liposomes coated with a tissue-specific antibody.
  • pharmaceutical compositions comprise a co-solvent system.
  • co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, 5 and an aqueous phase.
  • co-solvent systems are used for hydrophobic compounds.
  • a non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant Polysorbate 80TM and 65% w/v polyethylene glycol 300.
  • the proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics.
  • co-solvent components0 may be varied: for example, other surfactants may be used instead of Polysorbate 80TM; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.
  • pharmaceutical compositions are prepared for oral administration.
  • pharmaceutical compositions are prepared for buccal administration.
  • a5 pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), intraneural, perineural, etc.).
  • a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer.
  • aqueous solution such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer.
  • other ingredients are included (e.g., ingredients that aid in solubility or serve as0 preservatives).
  • injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like.
  • Certain pharmaceutical compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers.
  • Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • Certain solvents suitable for use in pharmaceutical compositions5 for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.
  • certain compounds disclosed herein act as acids. Although such compounds may be drawn or described in protonated (free acid) form, or ionized and in association with a cation (salt) form, aqueous solutions of such compounds exist in equilibrium among such forms. For example, a phosphate linkage of0 an oligonucleotide in aqueous solution exists in equilibrium among free acid, anion and salt forms.
  • oligonucleotides have several such linkages, each of which is in equilibrium. Thus, oligonucleotides in solution exist in an ensemble of forms at multiple positions all at equilibrium.
  • the term “oligonucleotide” is intended to include all such forms.
  • Drawn structures necessarily depict a single form. Nevertheless, unless otherwise indicated,5 such drawings are likewise intended to include corresponding forms.
  • a structure depicting the free acid of a compound followed by the term “or salt thereof” or “or a pharmaceutically acceptable salt thereof” expressly includes all such forms that may be fully or partially protonated/de-protonated/in association with a cation or a combination of cations.
  • one or more specific cation is identified.
  • the cations include, but are not limited to, sodium, potassium, calcium, and magnesium.
  • a structure depicting the0 free acid of a compound followed by the term “or a pharmaceutically acceptable salt thereof” expressly includes all such forms that may be fully or partially protonated/de-protonated/in association with one or more cations selected from sodium, potassium, calcium, and magnesium.
  • modified oligonucleotides or oligomeric compounds are in aqueous solution with sodium.
  • modified oligonucleotides or oligomeric compounds are in aqueous solution with potassium.
  • modified oligonucleotides or oligomeric compounds are in PBS. In certain embodiments, modified oligonucleotides or oligomeric compounds are in water. In certain such embodiments, the 5 pH of the solution is adjusted with NaOH and/or HCl to achieve a desired pH.
  • a dose may be in the form of a dosage unit. For clarity, a dose (or dosage unit) of a modified oligonucleotide or an oligomeric compound in milligrams indicates the mass of the free acid form of the modified oligonucleotide or oligomeric compound. As described above, in aqueous solution, the free acid is in equilibrium with anionic and salt forms.
  • the modified oligonucleotide or oligomeric compound exists as a solvent-free, sodium-acetate free, anhydrous, free acid.
  • the modified oligonucleotide or oligomeric compound may be partially or fully de-protonated and in association with sodium ions.
  • the mass of the protons is nevertheless counted5 toward the weight of the dose, and the mass of the sodium ions is not counted toward the weight of the dose.
  • a dose, or dosage unit of 10 mg of a number of fully protonated molecules that weighs 10 mg.
  • a dose, or dosage unit of 10 mg of a number of fully protonated molecules that weighs 10 mg.
  • the modified oligonucleotide or oligomeric0 compound may be partially or fully de-protonated and in association with sodium, potassium, calcium, and/or magnesium.
  • nucleobases in the ranges specified below comprise a hotspot region of a PCDH19 nucleic acid.
  • modified oligonucleotides that are complementary to a hotspot0 region of PCDH19 nucleic acid achieve an average of more than 50% reduction of PCDH19 RNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides that are complementary to a hotspot region of PCDH19 nucleic acid achieve an average of 50% or greater reduction of PCDH19 RNA in vivo in the standard in vivo assay. 5 1. Nucleobases 4743-4767 of SEQ ID NO: 1 In certain embodiments, nucleobases 4743-4767 of SEQ ID NO: 1 comprise a hotspot region.
  • modified oligonucleotides are complementary to a portion of nucleobases 4743-4767 of SEQ ID NO: 1. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain0 embodiments, the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.
  • nucleobase sequences of SEQ ID NOs: 132, 228, 284, 330, and 440 are complementary to nucleobases 4743-4767 of SEQ ID NO: 1.
  • nucleobase sequences of Compound Nos: 1549744, 1549855, 1549749, 1549523, and 1549712 are complementary to nucleobases 4743-4767 of SEQ ID NO: 1.
  • modified oligonucleotides complementary to a portion of nucleobases 4743-4767 of SEQ ID NO: 1 achieve at least 81% reduction of PCDH19 mRNA in the standard in vitro assay.
  • modified oligonucleotides complementary to a portion of nucleobases 4743-4767 of SEQ ID NO: 1 achieve an average of 86% reduction of PCDH19 mRNA in the standard in vitro assay. 0 2.
  • Nucleobases 12,319-12,346 of SEQ ID NO: 1 In certain embodiments, nucleobases 12,319-12,346 of SEQ ID NO: 1 comprise a hotspot region.
  • modified oligonucleotides are complementary to a portion of nucleobases 12,319-12,346 of SEQ ID NO: 1. In certain embodiments, modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are gapmers.
  • the gapmers are MOE gapmers.
  • the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.
  • the nucleobase sequences of SEQ ID NOs: 416, 72, 129, and 204 are complementary to nucleobases 12,319-12,346 of SEQ ID NO: 1.
  • the nucleobase sequences of Compound Nos: 1549581, 1549876, 1549736, and 1549694 are0 complementary to nucleobases 12,319-12,346 of SEQ ID NO: 1.
  • modified oligonucleotides complementary to a portion of nucleobases 12,319- 12,346 of SEQ ID NO: 1 achieve at least 65% reduction of PCDH19 mRNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 12,319-12,346 of SEQ ID NO: 1 achieve an average of 69% reduction of PCDH19 mRNA in the standard in vitro assay. 5 3. Nucleobases 34364-34389 of SEQ ID NO: 1 In certain embodiments, nucleobases 34364-34389 of SEQ ID NO: 1 comprise a hotspot region.
  • modified oligonucleotides are complementary to a portion of nucleobases 34364-34389 of SEQ ID NO: 1. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments,0 modified oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.
  • the nucleobase sequences of SEQ ID NOs: 371, 425, 20, and 111 are complementary to nucleobases 34364-34389 of SEQ ID NO: 1.
  • nucleobase sequences of Compound Nos: 1549753, 1549642, 1549562, and 1549613 are complementary to nucleobases 34364-34389 of SEQ ID NO: 1.
  • modified oligonucleotides complementary to a portion of nucleobases 34364- 34389 of SEQ ID NO: 1 achieve at least 64% reduction of 34389 of SEQ ID NO: 1 achieve an average of 80% reduction of PCDH19.
  • modified oligonucleotides complementary to a portion of0 nucleobases 34364-34389 of SEQ ID NO: 1 achieve an average of 80% reduction of PCDH19 mRNA in the standard in vitro assay. 4.
  • nucleobases 84,408-84,431 of SEQ ID NO: 1 comprise a hotspot region.
  • modified oligonucleotides are complementary to a portion of nucleobases 84,408-84,431 of SEQ ID NO: 1.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers.
  • the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.
  • the nucleobase sequences of SEQ ID NOs: 367, 407, 24, 93, and 218 are complementary to nucleobases 84,408-84,431 of SEQ ID NO: 1.
  • the nucleobase sequences of Compound Nos: 1549714, 1549528, 1549617, 1549514, and 1549790 are complementary to nucleobases 84,408-84,431 of SEQ ID NO: 1.
  • modified oligonucleotides complementary to a portion of nucleobases 84,408- 84,431 of SEQ ID NO: 1 achieve at least 65% reduction of PCDH19 mRNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 84,408-84,431 of SEQ5 ID NO: 1 achieve an average of 74% reduction of PCDH19 mRNA in the standard in vitro assay.
  • an oligonucleotide comprising a nucleoside comprising a 2’-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar moiety (2’-OH in place of one 2’-H of DNA) or as an RNA having a modified base (thymine (methylated uracil) in place of a uracil of RNA).
  • nucleic acid sequences provided herein, including, but not limited to those in the0 sequence listing are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, unless otherwise stated, including, but not limited to such nucleic acids having modified nucleobases.
  • an oligomeric compound having the nucleobase sequence “ATCGATCG” encompasses any oligomeric compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence5 “AUCGAUCG” and those having some DNA bases and some RNA bases such as “AUCGATCG” and oligomeric compounds having other modified nucleobases, such as “AT m CGAUCG,” wherein m C indicates a cytosine base comprising a methyl group at the 5-position.
  • nucleobase sequence of SEQ ID NO: X refers only to the sequence of nucleobases in that SEQ ID NO: X, independent of any sugar or internucleoside linkage modifications also described in such SEQ ID. 0 While effort has been made to accurately describe compounds in the accompanying sequence listing, should there be any discrepancies between a description in this specification and in the accompanying sequence listing, the description in the specification and not in the sequence listing is the accurate description.
  • Certain compounds described herein e.g., modified oligonucleotides have one or more asymmetric center and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), as ⁇ or ⁇ such as for sugar anomers, or as (D) or (L), such as for amino acids, etc.
  • Compounds provided herein that are drawn or described as having certain stereoisomeric 5 configurations include only the indicated compounds.
  • Compounds provided herein that are drawn or described with undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms, unless specified otherwise.
  • Oligomeric compounds described herein include chirally pure or enriched mixtures as well as racemic mixtures.
  • Oligomeric compounds having a plurality of phosphorothioate0 internucleoside linkages include such compounds in which chirality of the phosphorothioate internucleoside linkages is controlled or is random.
  • compounds described herein are intended to include corresponding salt forms.
  • the compounds described herein include variations in which one or more atoms are replaced with a non- radioactive isotope or radioactive isotope of the indicated element.
  • compounds herein that comprise5 hydrogen atoms encompass all possible deuterium substitutions for each of the 1 H hydrogen atoms.
  • Isotopic substitutions encompassed by the compounds herein include but are not limited to: 2 H or 3 H in place of 1 H, 13 C or 1 4 C in place of 12 C, 15 N in place of 14 N, 17 O or 18 O in place of 16 O, and 33 S, 34 S, 35 S, or 36 S in place of 32 S.
  • non-radioactive isotopic substitutions may impart new properties on the oligomeric compound that are beneficial for use as a therapeutic or research tool.
  • radioactive isotopic substitutions0 may make the compound suitable for research or diagnostic purposes such as imaging.
  • Example 1 Effect of 5-10-5 MOE modified oligonucleotides with mixed PS/PO internucleoside linkages complementary to a human PCDH19 RNA in vitro, single dose 0 Modified oligonucleotides complementary to human PCDH19 nucleic acid were designed and tested for their single dose effects on PCDH19 RNA in vitro. The modified oligonucleotides were tested in a series of experiments that had the same culture conditions.
  • the modified oligonucleotides in the table below are 5-10-5 MOE modified oligonucleotides with mixed PS/PO internucleoside linkages.
  • the modified oligonucleotides are 20 nucleosides in length.
  • the sugar motif for5 the modified oligonucleotides is (from 5’ to 3’): eeeeeddddddddddeeeee; wherein each “d” represents a 2’- ⁇ -D- deoxyribosyl sugar moiety, and each “e” represents a 2’-MOE ribosyl sugar moiety.
  • the internucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): soooossssssssooss; wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.
  • Each cytosine residue is a 5-methylcytosine.
  • Start site indicates the 5’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence.
  • “Stop site” indicates the 3’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence.
  • Each modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO: 1 (ENSEMBL Accession No. ENSG00000165194.15 from version 104: May 2021), to SEQ ID NO: 2 (the cDNA of ENSEMBL Accession No. ENST00000373034.8 from version 104: May2021), or to both. “N/A” indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.
  • SHSY5Y cells plated at a density of 15,000 cells/well, were differentiated in Neurobasal media supplemented with B27 (ThermoFisher), penicillin/streptomycin (ThermoFisher), and 10 ⁇ M retinoic acid (Sigma) for 10 days.
  • Differentiated SH-SY5Y cells were treated with modified oligonucleotide at a concentration of 15,000 nM by free uptake.
  • PCDH19 RNA levels were measured by quantitative real-time RT-PCR using human primer-probe set RTS533900 (forward sequence GCTAACCACATCTACCATCACTC, designated herein as SEQ ID NO: 3; reverse sequence GCTATTCACGTAGTTGGAGTCA, designated herein as SEQ ID NO: 4; probe sequence TTTCAGTCTCAGGCAGAGGCACAC, designated herein as SEQ ID NO: 5).
  • PCDH19 RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of PCDH19 RNA is presented in the table below as percent PCDH19 RNA relative to the amount in untreated control cells (% UTC).
  • Example 2 Effect of modified oligonucleotides on human PCDH19 in vitro, multiple doses SHSY5Y cells, plated at a density of 10,000 cells/well, were differentiated in Neurobasal media supplemented with B27 (ThermoFisher), penicillin/streptomycin (ThermoFisher), and 10 ⁇ M retinoic acid (Sigma) 5 for 10 days. Differentiated SH-SY5Y cells were treated with modified oligonucleotides at concentrations indicated in the tables below by free uptake.
  • RNA levels were measured by quantitative real-time RT-PCR using human PCDH19 primer- probe set RTS53390 (described herein above) was used to measure RNA levels.
  • PCDH19 RNA levels were normalized to total RNA content, as measured by GAPDH.
  • Human GAPDH was measured using the human0 primer-probe set RTS104 (forward sequence GAAGGTGAAGGTCGGAGTC, designated herein as SEQ ID NO: 6; reverse sequence GAAGATGGTGATGGGATTTC, designated herein as SEQ ID NO: 7; probe sequence CAAGCTTCCCGTTCTCAGCC, designated herein as SEQ ID NO: 8).
  • PCDH19 RNA Reduction of PCDH19 RNA is presented in the tables below as percent PCDH19 RNA, relative to untreated control cells (% UTC). “N.C.” refers to values that were not calculated. 5
  • the half maximal inhibitory concentration (IC 50 ) of each modified oligonucleotide was calculated using a linear regression on a log/linear plot of the data in Excel and is also presented in the table below. Table 2 Dose-dependent reduction of human PCDH19 RNA in differentiated SH-SY5Y cells by modified oligonucleotides
  • Example 3 Dose-dependent reduction of human PCDH19 RNA in differentiated SH-SY5Y cells by modified oligonucleotides 5
  • Example 3 Effect of 3-10-3 cEt modified oligonucleotides with uniform phosphorothioate internucleoside linkages complementary to a human PCDH19 RNA in vitro, single dose Modified oligonucleotides complementary to human PCDH19 nucleic acid were designed and tested for their single dose effects on PCDH19 RNA in vitro. The modified oligonucleotides were tested in a series of experiments that had the same culture conditions.
  • the modified oligonucleotides in the table below are 3-10-3 cEt modified oligonucleotides with uniform phosphorothioate internucleoside linkages.
  • the modified oligonucleotides are 16 nucleosides in length.
  • the sugar motif for the modified oligonucleotides is (from 5’ to 3’): kkkdddddddddkkk; wherein each “d” represents a 2’- ⁇ - D-deoxyribosyl sugar moiety, and each “k” represents a cEt sugar moiety.
  • the internucleoside linkage motif for the 5 modified oligonucleotides is (from 5’ to 3’): ssssssssssssss; wherein each “s” represents a phosphorothioate internucleoside linkage.
  • Each cytosine residue is a 5-methylcytosine.
  • Start site indicates the 5’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence.
  • “Stop site” indicates the 3’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence.
  • Each modified oligonucleotide listed in the table below is0 100% complementary to SEQ ID NO: 1 (described herein above), to SEQ ID NO: 2 (described herein above), or to both. “N/A” indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.
  • SHSY5Y cells plated at a density of 10,000 cells/well, were differentiated in Neurobasal media supplemented with B27 (ThermoFisher), penicillin/streptomycin (ThermoFisher), and 10 ⁇ M retinoic acid (Sigma)5 for 10 days.
  • PCDH19 RNA levels were measured by quantitative real-time RT-PCR using human primer-probe set RTS53390 (described herein above). PCDH19 RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of PCDH19 RNA is presented in the table below as percent PCDH19 RNA relative to0 the amount in untreated control cells (% UTC). Each separate experiment described in this example is identified by an Assay Identification letter in the table column labeled “AID”.
  • Example 4 Effect of modified oligonucleotides on human PCDH19 in vitro, multiple doses SHSY5Y cells, plated at a density of 8,000 cells/well, were differentiated in Neurobasal media supplemented with B27 (ThermoFisher), penicillin/streptomycin (ThermoFisher), and 10 ⁇ M retinoic acid (Sigma) 5 for 10 days. Differentiated SH-SY5Y cells were treated with modified oligonucleotides at concentrations indicated in the table below by free uptake.
  • PCDH19 RNA levels were measured by quantitative real-time RT-PCR using human PCDH19 primer- probe set RTS53390 (described herein above) was used to measure RNA levels.
  • PCDH19 RNA levels were normalized to total RNA content, as measured by GAPDH.
  • Human GAPDH was measured using the human0 primer-probe set RTS104 (described herein above). Reduction of PCDH19 RNA is presented in the tables below as percent PCDH19 RNA, relative to untreated control cells (% UTC).
  • Example 5 Design of 5-10-5 MOE gapmer modified oligonucleotides with PS internucleoside linkages that target a human PCDH19 nucleic acid
  • Modified oligonucleotides complementary to a human PCDH19 nucleic acid were designed, as described 5 in the table below.
  • “Start site” indicates the 5’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence.
  • “Stop site” indicates the 3’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence.
  • Each modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO: 1 (described herein above), to SEQ ID NO: 2 (described herein above), or to both. ‘N/A’ indicates that the modified oligonucleotide has two or more mismatches0 to that particular target nucleic acid sequence.
  • the modified oligonucleotides in the table below are 5-10-5 MOE modified oligonucleotides with uniform phosphorothioate internucleoside linkages.
  • the modified oligonucleotides are 20 nucleosides in length, wherein the central gap segment consists of ten 2’- ⁇ -D-deoxynucleosides, and wherein the 5’ and 3’ wing segments each consist of five 2’-MOE nucleosides.
  • the sugar motif for the modified oligonucleotides is (from 5’ to 3’): 5 eeeeeddddddddddeeee; wherein each “d” represents a 2’- ⁇ -D-deoxyribosyl sugar moiety, and each “e” represents a 2’-MOE ribosyl sugar moiety.
  • the internucleoside linkage motifs for the modified oligonucleotides is (from 5’ to 3’): ssssssssssssssssssssssssssss; wherein each “s” represents a phosphorothioate internucleoside linkage. All cytosine nucleobases are 5-methylcytosines. 0 Table 6 5-10-5 MOE modified oligonucleotides with uniform phosphorothioate internucleoside linkages complementary to human PCDH19
  • RNAi compounds that target a human PCDH19 nucleic acid RNAi compounds comprising antisense RNAi oligonucleotides complementary to a human PCDH19 nucleic acid, and sense RNAi oligonucleotides complementary to the antisense RNAi oligonucleotides were 5 designed as follows.
  • the antisense RNAi oligonucleotide in each case is 23 nucleosides in length; has a sugar motif (from 5’ to 3’) of: yfyyyfyyyyyyfyfyyyyyyyy; wherein each ‘y’ represents a 2′-O-methylribosyl sugar moiety and each “f” represents a 2’-fluororibosyl sugar; and an internucleoside linkage motif (from 5’ to 3’) of: ssooooooooooooooooooss; wherein ‘o’ represents a phosphodiester internucleoside linkage and ‘s’ represents a0 phosphorothioate internucleoside linkage.
  • Each cytosine residue is a non-methylated cytosine.
  • Each antisense RNAi oligonucleotide has a terminal phosphate at the 5’-end.
  • the antisense RNAi oligonucleotides are listed below in Tables 7 and 8. “Start site” indicates the 5’-most nucleoside to which the antisense RNAi oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3’-most nucleoside to which the5 antisense RNAi oligonucleotide is complementary in the target nucleic acid sequence.
  • Each antisense RNAi oligonucleoside listed in the Table 7 below is 100% complementary to SEQ ID NO: 1 (ENSEMBL Accession No. ENSG00000165194.15 from version 104: May 2021), to SEQ ID NO: 2 (ENSEMBL Accession No. ENST00000373034.8 from version 104: May 2021), or to both.
  • N/A indicates that the antisense RNAi oligonucleotide is not 100% complementary to that particular target nucleic acid sequence in Table 7 below. 0 Table 7 Design of antisense strand modified oligonucleotides targeted to human PCDH19
  • “Start site” indicates the 5’-most nucleoside to which the antisense RNAi oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3’-most nucleoside to which the antisense RNAi oligonucleotide is complementary in the target nucleic acid sequence.
  • Each antisense RNAi 5 oligonucleoside listed in the Table 8 below is complementary to SEQ ID NO: 1 (ENSEMBL Accession No. ENSG00000165194.15 from version 104: May 2021), to SEQ ID NO: 2 (ENSEMBL Accession No.
  • the sense RNAi oligonucleotide in each case is 21 nucleosides in length; has a sugar motif (from 5’ to 3’) of: yyyyyyfyfffyyyyyyyyyyy; wherein “y” represents a 2’-O-methylribosyl sugar and the “f” represents a 2’- fluororibosyl sugar; and an internucleoside linkage motif (from 5’ to 3’) of: ssooooooooooooooooss; wherein ‘o’ 5 represents a phosphodiester internucleoside linkage and ‘s’ represents a phosphorothioate internucleoside linkage.
  • the sense RNAi oligonucleotides are listed below in Table 9. Each antisense RNAi oligonucleotide is complementary to the target nucleic acid (PCDH19), and each sense RNAi oligonucleotides is complementary to the first of the 21 nucleosides of the antisense RNAi oligonucleotide (from 5’ to 3’) wherein the last two 3’-nucleosides of the antisense RNAi oligonucleotides are not0 paired with the sense RNAi oligonucleotide (are overhanging nucleosides).
  • the sense RNAi oligonucleotides and siRNAs are listed in Table 9 below.
  • RNAi compounds on human PCDH19 in vitro, single dose Double-stranded RNAi compounds described above are tested in a series of experiments for their single dose 5 effects on PCDH19 RNA in vitro in cultured cells that express PCDH19. Cultured cells are treated with double-stranded RNAi. RNA is isolated from the cells and PCDH19 RNA levels are measured by quantitative real-time RTPCR. A human PCDH19 primer-probe set is used to measure RNA levels. PCDH19 RNA levels are normalized to total RNA content, as measured by RIBOGREEN®.
  • Example 8 Effect of modified oligonucleotides on human PCDH19 RNA levels in neurons differentiated from IPS cells, multiple dose Modified oligonucleotides selected from the examples above were tested at various doses in neurons differentiated from IPSCs (Gibco, Cat. # A18945).
  • the IPSCs were differentiated into neurons using the Elixirgen Scientific Quick Neuron TM Excitatory kit (Cat.# EX-SeV-L) .
  • the neurons were aged for 2 weeks, and were treated5 by free uptake with various concentrations of modified oligonucleotide as specified in the tables below. Seven days post treatment total RNA was isolated from the cells, and PCDH19 RNA levels were measured by quantitative real-time RT-PCR.
  • PCDH19 primer-probe set RTS53390 (described herein above) was used to measure RNA levels as described above. PCDH19 RNA levels were normalized to total RNA content, as measured by human GAPDH. Human GAPDH was amplified using human primer probe set RTS104 (described0 herein above). Reduction of PCDH19 RNA is presented in the tables below as percent PCDH19 RNA, relative to the amount of PCDH19 in untreated control cells (% UTC). The half maximal inhibitory concentration (IC50) of each modified oligonucleotide was calculated using GraphPad Prism and is also presented in the tables below.
  • IC50 half maximal inhibitory concentration
  • RNAi compounds were tested in a series of experiments that had the same culture conditions.
  • Cultured HEK293 cells were treated with RNAi compounds at a concentration of 200 nM by Lipofectamine RNAiMAX at a density of 10,000 cells per well.
  • total RNA was isolated from the cells and PCDH19 RNA levels were measured by quantitative real-time RT-PCR using human primer-probe set0 RTS53390 (described herein above).
  • PCDH19 RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of PCDH19 RNA is presented in the table below as percent PCDH19 RNA relative to the amount in untreated control cells (% UTC).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Saccharide Compounds (AREA)
  • Medicinal Preparation (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/US2022/082164 2021-12-22 2022-12-21 Compounds and methods for reducing pcdh19 expression Ceased WO2023122681A2 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
US18/722,875 US20250340874A1 (en) 2021-12-22 2022-12-21 Compounds and methods for reducing pcdh19 expression
JP2024538028A JP2025500438A (ja) 2021-12-22 2022-12-21 Pcdh19発現を低減するための化合物及び方法
EP22912708.9A EP4453216A4 (en) 2021-12-22 2022-12-21 Compounds and methods for reducing pcdh19 expression

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202163292829P 2021-12-22 2021-12-22
US63/292,829 2021-12-22

Publications (2)

Publication Number Publication Date
WO2023122681A2 true WO2023122681A2 (en) 2023-06-29
WO2023122681A3 WO2023122681A3 (en) 2023-09-21

Family

ID=86903772

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2022/082164 Ceased WO2023122681A2 (en) 2021-12-22 2022-12-21 Compounds and methods for reducing pcdh19 expression

Country Status (4)

Country Link
US (1) US20250340874A1 (enExample)
EP (1) EP4453216A4 (enExample)
JP (1) JP2025500438A (enExample)
WO (1) WO2023122681A2 (enExample)

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP5624892B2 (ja) * 2008-01-04 2014-11-12 セントラル アデレード ローカル ヘルス ネットワーク インコーポレイテッド Efmr(女性に限られた癲癇及び精神遅滞)の診断方法及び治療方法
US9567581B2 (en) * 2012-08-07 2017-02-14 The General Hospital Corporation Selective reactivation of genes on the inactive X chromosome

Also Published As

Publication number Publication date
JP2025500438A (ja) 2025-01-09
WO2023122681A3 (en) 2023-09-21
US20250340874A1 (en) 2025-11-06
EP4453216A2 (en) 2024-10-30
EP4453216A4 (en) 2026-05-06

Similar Documents

Publication Publication Date Title
WO2022246251A2 (en) Compounds for modulating unc13a expression
US20220380773A1 (en) Compounds and methods for reducing app expression
US12384814B2 (en) Compounds and methods for reducing app expression
CN116322707B (zh) 用于调节scn2a的化合物和方法
EP4281084A1 (en) Compounds and methods for reducing dux4 expression
CN121674396A (zh) 用于降低kcnt1表达的化合物和方法
EP4433591A1 (en) Compounds and methods for modulating progranulin expression
US12180479B2 (en) Compounds and methods for modulating ATXN1
US20240279654A1 (en) Compounds for reducing ptbp1 expression
EP4216964A1 (en) Compounds and methods for reducing apoe expression
WO2021258011A1 (en) Compounds and methods for modulating pmp22
WO2024064854A2 (en) Compounds and methods for reducing mecp2 expression
US20240124513A1 (en) Compounds and methods for reducing mecp2 expression
WO2023164656A2 (en) Compounds and methods for modulating atn1 expression
WO2023215863A2 (en) Rnai agents for modulating snca
EP4222261A1 (en) Compounds for modulating chmp7
AU2021299290A1 (en) Compounds and methods for modulating PLP1
WO2023122681A2 (en) Compounds and methods for reducing pcdh19 expression
WO2024226802A2 (en) Compositions and methods for allele specific modulation of tnpo2 expression
WO2023073661A2 (en) Compounds and methods for reducing psd3 expression

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22912708

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 2024538028

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2022912708

Country of ref document: EP

Effective date: 20240722

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22912708

Country of ref document: EP

Kind code of ref document: A2

WWP Wipo information: published in national office

Ref document number: 18722875

Country of ref document: US