WO2023121334A1 - Composition comprising cardamine flexuosa extract as active ingredient for prevention, alleviation, or treatment of respiratory disease - Google Patents

Composition comprising cardamine flexuosa extract as active ingredient for prevention, alleviation, or treatment of respiratory disease Download PDF

Info

Publication number
WO2023121334A1
WO2023121334A1 PCT/KR2022/021047 KR2022021047W WO2023121334A1 WO 2023121334 A1 WO2023121334 A1 WO 2023121334A1 KR 2022021047 W KR2022021047 W KR 2022021047W WO 2023121334 A1 WO2023121334 A1 WO 2023121334A1
Authority
WO
WIPO (PCT)
Prior art keywords
extract
radish
respiratory diseases
composition
active ingredient
Prior art date
Application number
PCT/KR2022/021047
Other languages
French (fr)
Korean (ko)
Inventor
성윤영
김동선
손은정
육흥주
이윤미
김영숙
Original Assignee
한국 한의학 연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국 한의학 연구원 filed Critical 한국 한의학 연구원
Publication of WO2023121334A1 publication Critical patent/WO2023121334A1/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K10/00—Animal feeding-stuffs
    • A23K10/30—Animal feeding-stuffs from material of plant origin, e.g. roots, seeds or hay; from material of fungal origin, e.g. mushrooms
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/105—Plant extracts, their artificial duplicates or their derivatives
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23P—SHAPING OR WORKING OF FOODSTUFFS, NOT FULLY COVERED BY A SINGLE OTHER SUBCLASS
    • A23P10/00—Shaping or working of foodstuffs characterised by the products
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/185—Magnoliopsida (dicotyledons)
    • A61K36/31—Brassicaceae or Cruciferae (Mustard family), e.g. broccoli, cabbage or kohlrabi
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health
    • A23V2200/314—Foods, ingredients or supplements having a functional effect on health having an effect on lung or respiratory system
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health
    • A23V2200/324—Foods, ingredients or supplements having a functional effect on health having an effect on the immune system
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2250/00—Food ingredients
    • A23V2250/20—Natural extracts
    • A23V2250/21—Plant extracts
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2300/00—Processes
    • A23V2300/14—Extraction

Definitions

  • the present invention relates to a composition for the prevention, improvement or treatment of respiratory diseases containing an extract of Dorado radish as an active ingredient.
  • Asthma chronic obstructive pulmonary disease, allergic rhinitis, cough, cough, acute and chronic bronchitis, bronchiolitis, sore throat, tonsillitis, laryngitis, etc. are typical respiratory diseases.
  • Asthma refers to chronic inflammation of the airways, particularly the bronchi. Inflammation caused by asthma can be aggravated by a wide variety of factors such as smoke, allergens, cold wind, exercise, and respiratory infections, and continuous inflammation causes airway deformation and airway hyper-responsiveness. Due to these causes, common symptoms such as wheezing (a symptom in which the airway is narrowed and wheezing or purring breath sounds appear), shortness of breath, coughing, and excessive sputum discharge appear.
  • wheezing a symptom in which the airway is narrowed and wheezing or purring breath sounds appear
  • shortness of breath, coughing, and excessive sputum discharge appear.
  • the respiratory tract is largely composed of a mucous membrane and a muscle called bronchial smooth muscle, and there are many glands in the mucous membrane that continuously secrete necessary secretions.
  • the bronchial smooth muscle contracts, the respiratory airway narrows.
  • an inflammatory reaction occurs due to a wide variety of factors such as smoke, allergens, cold wind, exercise, and respiratory infections, the secretion from the glands further increases, and this secretion blocks the airway, causing the mucous membrane to swell into the airway, further narrowing the airway. .
  • paroxysmal coughing accompanied by wheezing and difficulty in breathing appear severely, and during seizures, dry cough occurs and chest pressure is felt.
  • asthmatic patients who have only symptoms of chronic cough and chest tightness without wheezing and unexplained dyspnea, but these symptoms tend to appear suddenly and paroxysmal during daily life.
  • cardamine flexuosa grows near rice fields and in wetlands. Branches diverge and spread from the bottom, 10 to 30 cm high, and the lower part has hairs and is black purple.
  • the leaves are alternate and pinnate compound leaves. There are 7 to 17 small leaves, egg-shaped or broad egg-shaped, and the small leaf at the end is the largest. Flowers bloom in April- May, are white, and about 20 flowers run in raceme. It has about 10 cross-shaped flowers. There are 4 calyxes, black purple, and petals are twice as long as calyxes. It looks like an upside-down egg in the shape of a petal.
  • Korean Patent Publication No. 2021-0145578 discloses a cosmetic composition for moisturizing skin containing an extract of Stork radish. There is no mention of a preventive, ameliorative or therapeutic composition.
  • the present invention has been derived from the above needs, and the present invention provides a composition for preventing, improving or treating respiratory diseases containing a storus radish extract as an active ingredient, and the stor radish extract is a respiratory cell, bronchial epithelial cell. It reduces the production of chemokine RANTES, a mediator of inflammation, and reduces the expression of inflammatory cytokines (IL-6, TNF- ⁇ and MUC5AC).
  • the present invention provides a health functional food composition for preventing or improving respiratory diseases containing a storus extract as an active ingredient.
  • the present invention provides a pharmaceutical composition for the prevention or treatment of respiratory diseases containing a dorado extract as an active ingredient.
  • the present invention provides a veterinary composition for the prevention or treatment of respiratory diseases containing a storus extract as an active ingredient.
  • the present invention provides a feed additive for preventing or improving respiratory diseases containing the extract of radish radish as an active ingredient.
  • the present invention relates to a composition for preventing, ameliorating or treating respiratory diseases containing a storus extract as an active ingredient.
  • a composition for preventing, ameliorating or treating respiratory diseases containing a storus extract as an active ingredient not only has the effect of reducing the expression level of inflammatory cytokines (IL-6, TNF- ⁇ and MUC5AC), but also reduces the total number of BAL cells and the number of neutrophils in BAL in animal models, IL-1 ⁇ and TNF in BALF It has the effect of reducing the content of - ⁇ , IL-17, MIP2, and CXCL-1, and the expression level of TNF- ⁇ , MIP2, CXCL-1, and MUC5AC genes, and has the effect of inhibiting lung tissue damage.
  • Figure 1 is a result of confirming the RANTES production rate according to the treatment of dorado radish extract in bronchial epithelial cells (BEAS-2B).
  • Dexa is a positive control group treated with 0.5 ⁇ M of dexamethasone.
  • ### indicates a statistically significant increase in the RANTES production rate in the 10ng/ml TNF- ⁇ treated group compared to the control group, p ⁇ 0.001, and *** indicates a 10ng/ml TNF- ⁇ treated group It means that the rate of RANTES production in the contrast radish radish extract treatment group and the positive control group (Dexa) decreased statistically significantly, p ⁇ 0.001.
  • Figure 2 is the result of confirming the change in the expression level of the inflammatory cytokine IL-6 after inducing inflammation with LPS in bronchial epithelial cells.
  • ### indicates a statistically significant increase in the IL-6 expression level of the LPS-treated group (LPS20) compared to the control (normal control), p ⁇ 0.001, and *** indicates that the LPS group compared to the present invention 50 ⁇ g / ml , p ⁇ 0.001, indicating that the IL-6 expression level of the radish radish extract treatment group (CF50) decreased statistically significantly.
  • Figure 3 is the result of confirming the change in the expression level of the inflammatory cytokine TNF- ⁇ after inducing inflammation with LPS in bronchial epithelial cells.
  • ### indicates a statistically significant increase in TNF- ⁇ expression level in the LPS-treated group (LPS20) compared to the Control (normal control group), p ⁇ 0.001, and *** is 50 ⁇ g/ml of the present invention compared to the LPS group , p ⁇ 0.001, indicating that the TNF- ⁇ expression level of the radish radish extract treatment group (CF50) decreased statistically significantly.
  • Figure 4 is the result of confirming the change in the expression level of the inflammatory cytokine MUC5AC after inducing inflammation with LPS in bronchial epithelial cells.
  • ### indicates a statistically significant increase in MUC5AC expression level in the LPS-treated group (LPS20) compared to the Control (normal control group), p ⁇ 0.001, and ** indicates that 50 ⁇ g/ml of the present invention compared to the LPS group It means that the MUC5AC expression level of the extract treatment group decreased statistically significantly, p ⁇ 0.01.
  • Figure 5 is a schematic diagram showing an experimental schedule for confirming the effect of the storus radish extract of the present invention using a respiratory injury animal model.
  • Figure 6 is a result of confirming the total number of BAL cells after administering the storus extract of the present invention to a respiratory injury animal model.
  • ### indicates a statistically significant increase in the total number of BAL cells in the respiratory injury control group induced by LPS + CS (standard tobacco extract) compared to the normal group, p ⁇ 0.001, **, *** are compared to the control group
  • the total number of BAL cells in the radish radish extract administration group or the positive control group of the present invention was statistically significantly decreased, ** is p ⁇ 0.01, and *** is p ⁇ 0.001.
  • Figure 9 shows the results of confirming the expression levels of TNF- ⁇ , MIP2, CXCL-1, and MUC5AC genes in lung tissues after administering the wild horseradish extract of the present invention to a respiratory injury animal model.
  • ##, ### indicate a statistically significant increase in the expression levels of TNF- ⁇ , MIP2, CXCL-1, and MUC5AC genes in the lung tissue of the control group with respiratory injury induced by LPS+CS (standard tobacco extract) compared to the normal group.
  • ## is p ⁇ 0.01
  • ### is p ⁇ 0.001.
  • FIG. 10 shows the results of H&E staining and M-T staining confirming the inhibition of pathological damage to lung tissue after administering the extract of the present invention to a respiratory injury animal model.
  • the present invention relates to a health functional food composition for preventing or improving respiratory diseases containing an extract of Dorado radish as an active ingredient.
  • the respiratory disease is preferably selected from the group consisting of asthma, chronic obstructive pulmonary disease, bronchitis, sore throat, tonsillitis and laryngitis, but is not limited thereto.
  • the extract of Stork radish is extracted from the outpost of Stork radish, but is not limited thereto, and may be used by adopting a specific part as needed.
  • the raspberry extract may be prepared by a method comprising the following steps, but is not limited thereto:
  • step (3) preparing an extract by drying the filtered extract of step (2).
  • the extraction solvent is preferably selected from water, C 1 ⁇ C 4 lower alcohol or mixtures thereof, more preferably water or ethanol, and still more preferably ethanol, but is not limited thereto.
  • the extraction method all conventional methods known in the art such as hot water extraction, immersion extraction, reflux cooling extraction, and ultrasonic extraction may be used. It is preferable to extract the extraction solvent by adding 1 to 20 times the weight of the horseradish.
  • the extraction temperature is preferably 20 to 100 ° C, but is not limited thereto.
  • the extraction time is preferably 1 to 5 hours, more preferably 1 to 3 hours, but is not limited thereto.
  • drying is preferably reduced pressure drying, vacuum drying, boiling drying, spray drying or freeze drying, more preferably freeze drying, but not limited thereto.
  • the health functional food composition is preferably prepared in any one formulation selected from powder, granule, pill, tablet, capsule, candy, syrup and beverage, but is not limited thereto.
  • the health functional food composition of the present invention may be prepared by adding the extract of Dorsal japonica as it is or mixing it with other foods or food ingredients, and may be appropriately prepared according to a conventional method.
  • foods to which the radish radish extract can be added include caramel, meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, chewing gum, dairy products including ice cream, various soups, beverages, It may be in the form of any one selected from tea, drinks, alcoholic beverages and vitamin complexes, and includes all health functional foods in the conventional sense.
  • the health functional food composition includes various nutrients, vitamins, minerals (electrolytes), synthetic and natural flavors, coloring agents and enhancers (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners , pH regulators, stabilizers, preservatives, glycerin, alcohol, carbonation agents used in carbonated beverages, and the like. It may also contain fruit flesh for the preparation of natural fruit juices and vegetable beverages. The above components may be used independently or in combination.
  • the health functional food composition of the present invention may contain various flavoring agents or natural carbohydrates as additional components, and the natural carbohydrates may include monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, dextrin, and cyclosaccharides. polysaccharides such as dextrin, sugar alcohols such as xylitol, sorbitol, and erythritol.
  • the ratio of the natural carbohydrates is not very important, but is preferably 0.01 to 0.04 g, more preferably 0.02 to 0.03 g, with respect to 100 g of the composition of the present invention, but is not limited thereto.
  • natural sweeteners such as thaumatin and stevia extract, and synthetic sweeteners such as saccharin and aspartame may be used.
  • the present invention relates to a pharmaceutical composition for the prevention or treatment of respiratory diseases containing the extract of radish radish as an active ingredient.
  • the pharmaceutical composition containing the extract of Dorado radishes according to the present invention is preferably in any one formulation selected from capsules, powders, granules, tablets, suspensions, emulsions, syrups and aerosols, but is not limited thereto.
  • a pharmaceutically acceptable carrier, excipient or diluent may be further included, and carriers, excipients or diluents that may be included in the pharmaceutical composition containing the raspberry extract include lactose, dextrose, sucrose , oligosaccharide, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate , propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
  • the pharmaceutical composition containing the extract of the radish radish of the present invention is preferably administered at 0.0001 to 100 mg/kg per day, preferably at 0.001 to 10 mg/kg. Administration may be administered once a day, or may be administered in several divided doses. The dosage is not intended to limit the scope of the present invention in any way.
  • the present invention relates to a veterinary composition for the prevention or treatment of respiratory diseases containing the extract of Dorado radish as an active ingredient.
  • the veterinary composition of the present invention may further include appropriate excipients and diluents according to conventional methods.
  • Excipients and diluents that may be included in the veterinary composition of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, cetanol, stearyl alcohol, liquid paraffin, sorbitan monostearate , polysorbate 60, methylparaben, propylparaben and mineral oil.
  • the veterinary composition according to the present invention may further include fillers, anti-agglomerating agents, lubricants, wetting agents, spices, emulsifiers, preservatives, and the like. Or it may be formulated using a method well known in the art to provide delayed release, and the dosage form may be a powder, granule, tablet, capsule, suspension, emulsion, solution, syrup, aerosol, soft or hard gelatin capsule, It may be in the form of a suppository, a sterile injection solution, or a sterile external preparation. An effective amount of the veterinary composition according to the present invention can be appropriately selected according to the individual animal.
  • the present invention relates to a feed additive for the prevention or improvement of respiratory diseases containing a storus radish extract as an active ingredient.
  • the feed additive of the present invention corresponds to supplementary feed under the Feed Management Act.
  • the term 'feed' may mean any natural or artificial diet, one meal, etc., or a component of the one meal meal, for or suitable for the animal to eat, ingest, and digest.
  • the type of feed is not particularly limited, and feeds commonly used in the art may be used.
  • Non-limiting examples of the feed include vegetable feeds such as grains, root fruits, food processing by-products, algae, fibers, pharmaceutical by-products, oils and fats, starches, meal or grain by-products; Animal feed such as proteins, inorganic materials, oils, mineral oils, oils, single cell proteins, zooplankton, or food may be mentioned. These may be used alone or in combination of two or more.
  • the inhibitory activity of the inflammatory chemokine, RANTES was evaluated using human bronchial epithelial cell lines.
  • BEAS-2B human bronchial epithelial cell, ATCC, USA
  • DMEM Dulbecco's modified eagle's medium
  • FBS fetal bovine serum
  • PS penicillin-streptomycin
  • the amount of RANTES secretion was measured according to the manufacturer's method using an ELISA kit (R&D systems, USA) to measure the amount of RANTE secretion present in the cell supernatant. Statistical differences were assessed for significance using Student's t-test.
  • the amount of RANTES production was statistically significantly increased in the TNF- ⁇ treatment group compared to the control group (Control), and in contrast to this, the group treated with the radish radish extract of the present invention and the positive control group (Dexa) In , RANTES production was statistically significantly reduced.
  • Example 3 After inducing inflammation with LPS in bronchial epithelial cells, inflammatory cytokines IL-6, TNF- ⁇ , mucus secretion protein MUC5AC expression level change confirmation
  • BEAS-2B human bronchial epithelial cell, ATCC, USA
  • cells a human bronchial epithelial cell line
  • PS penicillin-streptomycin
  • the medium was replaced, and cultured for 24 hours by treating with 50 ⁇ g/ml of Stork radish extract and 20 ⁇ g/ml of LPS. After 24 hours, the cell supernatant was recovered and the expression levels of IL-6, TNF- ⁇ and MUC5AC were measured.
  • COPD chronic obstructive pulmonary disease
  • LPS+CS standard tobacco extract
  • the experimental group was a normal group without any treatment, a control group treated with a COPD inducer, a COPD inducer and a positive control dexamethasone (3mg/kg) administered group, a COPD inducer and a radish extract (200mg/kg)
  • the administration group (CF 200) and the COPD inducer and radish radish extract (100 mg/kg) administration group (CF 100) were selected.
  • the drug was administered orally every day for 14 days, and after the experiment, mouse alveolar lavage fluid (BALF) and lung tissue of each experimental group were separated (FIG. 5).
  • BALF bronchoalveolar lavage fluid
  • ELISA was performed to measure the amounts of IL-1 ⁇ , TNF- ⁇ , IL-17, MIP2, and CXCL-1 in BALF. After the capture antibody was added, and overnight at 4° C., the cells were washed 4 times with a washing buffer. 100 ⁇ l of biotin-conjugated antibody reagent was treated in each well, reacted at room temperature for 1 hour, washed twice, and then treated with 100 ⁇ l of streptavidin-HRP solution in each well and incubated at room temperature for 1 hour After the reaction, it was washed twice with a washing buffer solution. Here, 100 ⁇ l of the substrate solution was treated and reacted for 20 minutes, and then the reaction was terminated by treatment with 50 ⁇ l of the reaction stop solution, and the absorbance was measured at 450 nm.
  • IL-1 ⁇ , TNF- ⁇ , IL-17, MIP2, and CXCL-1 which are inflammation-related cytokines and chemokines, in BALF were all increased in the LPS+CS (standard tobacco extract) induced control group. There was a statistically significant decrease in the control group and the radish radish extract (CF)-administered group (FIG. 8).
  • RNA extraction solution was added and ground until dissolved. After centrifugation at 13,000 rpm, RNA was extracted by washing with ethanol and drying. The extracted RNA was used for first strand cDNA synthesis.
  • Real-time polymerization of the synthesized cDNA was carried out using an Applied Biosystem 7500 Real-Time PCR system (Applied Biosystems, USA). TNF- ⁇ , MIP2, CXCL-1, MUC5AC primers were used, and G3PDH probe (VIC, Applied Biosystems, USA) was used. Real-time polymerization chain reaction conditions were pre-denaturation at 50 °C for 2 minutes, 94 °C for 10 minutes, and 40 cycles at 95 °C for 0.15 minutes and 60 °C for 1 minute. RQ (relative quantitative) was calculated using G3PDH as an internal standard for the radish radish extract administration group and the control group.
  • the lung tissue was cut and fixed in 10% neutral-buffered formalin for 24 hours, then dehydrated with alcohol, embedded in paraffin to make a block, and then 4 ⁇ m with a microtome. Thick tissue sections were prepared and H&E (Hematoxylin & Eosin) staining, M-T (Masson-Trichrome) staining, collagen deposition staining, and PAS staining were performed to observe goblet cells and secreted mucus. After staining, it was observed through an optical microscope (Nikon, Japan) at 400 ⁇ magnification.
  • Results were reported as mean ⁇ error, and significance was determined using Duncan's multiple comparison analysis method (SPSS statistics version 19.0 statistic software, Inc, IBM, USA) followed by Student's t-test and one-way ANOVA.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Polymers & Plastics (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Food Science & Technology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biotechnology (AREA)
  • Epidemiology (AREA)
  • Microbiology (AREA)
  • Medical Informatics (AREA)
  • Alternative & Traditional Medicine (AREA)
  • Nutrition Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Pulmonology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Physiology (AREA)
  • Animal Husbandry (AREA)
  • Zoology (AREA)
  • Medicines Containing Plant Substances (AREA)

Abstract

The present invention relates to a composition comprising a Cardamine flexuosa extract as an active ingredient for prevention, alleviation, or treatment of respiratory disease. The Cardamine flexuosa extract has the effect of reducing the production of chemokine RANTEST, which is an inflammation-inducing mediator, from bronchial epithelial cells, which are respiratory cells, and thus can be advantageously used as a health functional food, a medical product, or a feed additive against respiratory diseases including asthma or chronic obstructive pulmonary disease (COPD).

Description

황새냉이 추출물을 유효성분으로 함유하는 호흡기 질환의 예방, 개선 또는 치료용 조성물Composition for the prevention, improvement or treatment of respiratory diseases containing a storus extract as an active ingredient
본 발명은 황새냉이 추출물을 유효성분으로 함유하는 호흡기 질환의 예방, 개선 또는 치료용 조성물에 관한 것이다.The present invention relates to a composition for the prevention, improvement or treatment of respiratory diseases containing an extract of Dorado radish as an active ingredient.
천식, 만성폐쇄성폐질환, 알레르기비염, 진해 거담, 급만성기관지염, 세기관지염, 인후염, 편도염, 후두염 등은 호흡기질환의 대표적인 질환이다. 천식(asthma)은 기도, 특별히, 기관지에 생기는 만성 염증을 일컫는다. 천식으로 인해 유발되는 염증은 매연, 알레르기성 항원, 찬바람, 운동, 호흡기 감염 등 매우 다양한 소인에 의하여 악화될 수 있으며, 지속적인 염증은 기도의 변형 및 기도의 과민성(hyper-responsiveness)을 야기한다. 이러한 원인들에 의하여 천명(wheezing, 기도가 좁아져 쌕쌕거리거나 가랑가랑하는 호흡음이 나타나는 증상)이나, 숨이 차고 기침이 나며, 과도한 객담이 배출되는 등의 일반적인 증상이 나타난다. Asthma, chronic obstructive pulmonary disease, allergic rhinitis, cough, cough, acute and chronic bronchitis, bronchiolitis, sore throat, tonsillitis, laryngitis, etc. are typical respiratory diseases. Asthma refers to chronic inflammation of the airways, particularly the bronchi. Inflammation caused by asthma can be aggravated by a wide variety of factors such as smoke, allergens, cold wind, exercise, and respiratory infections, and continuous inflammation causes airway deformation and airway hyper-responsiveness. Due to these causes, common symptoms such as wheezing (a symptom in which the airway is narrowed and wheezing or purring breath sounds appear), shortness of breath, coughing, and excessive sputum discharge appear.
호흡기도는 크게 점막과 기관지평활근이라는 근육으로 이루어져 있고 점막에는 많은 분비샘들이 있어 필요한 분비물을 계속 분비하고 있으며 기관지 평활근이 수축하면 호흡기도가 좁아지게 된다. 매연, 알레르기성 항원, 찬바람, 운동, 호흡기 감염 등 매우 다양한 소인에 의하여 염증반응이 일어나면 분비샘에서 나오는 분비물이 더욱 증가하게 되고 이 분비물이 기도를 막아 점막이 기도 안쪽으로 부어오르게 되어 기도를 더욱 좁게 만든다. 이로 인해, 천명을 동반한 발작적인 기침과 호흡곤란이 심하게 나타나며, 발작 시에는 마른기침이 발생되고 흉부압박감을 느끼게 된다. 천명이 없이 만성적 기침과 흉부압박감이 있는 원인을 알 수 없는 호흡곤란 증상만 있는 천식도 많은데 이 증상들은 일상생활 중에서 갑자기 발작적으로 나타나는 경향이 있다.The respiratory tract is largely composed of a mucous membrane and a muscle called bronchial smooth muscle, and there are many glands in the mucous membrane that continuously secrete necessary secretions. When the bronchial smooth muscle contracts, the respiratory airway narrows. When an inflammatory reaction occurs due to a wide variety of factors such as smoke, allergens, cold wind, exercise, and respiratory infections, the secretion from the glands further increases, and this secretion blocks the airway, causing the mucous membrane to swell into the airway, further narrowing the airway. . As a result, paroxysmal coughing accompanied by wheezing and difficulty in breathing appear severely, and during seizures, dry cough occurs and chest pressure is felt. There are many asthmatic patients who have only symptoms of chronic cough and chest tightness without wheezing and unexplained dyspnea, but these symptoms tend to appear suddenly and paroxysmal during daily life.
한편, 황새냉이(Cardamine flexuosa)는 논밭 근처와 습지에서 자란다. 밑에서부터 가지가 갈라져서 퍼지고 높이 10∼30cm이며 밑부분은 털이 있고 검은 자주색이다. 잎은 어긋나고 깃꼴겹잎이다. 작은잎은 7∼17개이고 달걀 모양 또는 넓은 달걀 모양이며 끝의 작은잎이 가장 크다. 꽃은 4∼5월에 피고 백색이며 20개 내외의 꽃이 총상꽃차례로 달린다. 십자 모양의 꽃이 10여 송이 정도 달린다. 꽃받침은 4개이고 흑자색이 돌며 꽃잎은 꽃받침보다 2배 정도 길다. 꽃잎의 모양의 달걀을 거꾸로 세운 모양이다. 6개의 수술 중 4개가 길고 열매는 각과로 길이 2cm, 지름 1mm 정도로서 털이 없으며, 성숙하면 두 조각으로 갈라져서 뒤로 말린다. 어린 순을 나물로 한다. 동아시아·히말라야·유럽 및 북아메리카의 온대에서 난대에 걸쳐 분포한다.On the other hand, cardamine flexuosa grows near rice fields and in wetlands. Branches diverge and spread from the bottom, 10 to 30 cm high, and the lower part has hairs and is black purple. The leaves are alternate and pinnate compound leaves. There are 7 to 17 small leaves, egg-shaped or broad egg-shaped, and the small leaf at the end is the largest. Flowers bloom in April-May, are white, and about 20 flowers run in raceme. It has about 10 cross-shaped flowers. There are 4 calyxes, black purple, and petals are twice as long as calyxes. It looks like an upside-down egg in the shape of a petal. Four of the six stamens are long, and the fruit is a keratin, 2cm long and 1mm in diameter, hairless. When mature, it is split into two pieces and dried backwards. Use young shoots as herbs. Distributed from temperate to temperate zones in East Asia, the Himalayas, Europe and North America.
황새냉이 추출물 관련 기술로, 한국공개특허 제2021-0145578호에 큰황새냉이 추출물을 포함하는 피부 보습용 화장료 조성물이 개시되어 있으나, 아직까지는 본 발명의 황새냉이 추출물을 유효성분으로 함유하는 호흡기 질환의 예방, 개선 또는 치료용 조성물에 대하여 언급된 바 없다.As a technique related to the extract of Stork radish, Korean Patent Publication No. 2021-0145578 discloses a cosmetic composition for moisturizing skin containing an extract of Stork radish. There is no mention of a preventive, ameliorative or therapeutic composition.
본 발명은 상기와 같은 요구에 의해 도출된 것으로서, 본 발명은 황새냉이 추출물을 유효성분으로 함유하는 호흡기 질환의 예방, 개선 또는 치료용 조성물을 제공하고, 상기 황새냉이 추출물이 호흡기 세포인 기관지 상피세포로부터 염증유발 매개인자인 케모카인 RANTES의 생성량을 감소시키며, 염증성 사이토카인(IL-6, TNF-α 및 MUC5AC)의 발현량을 감소시키는 효과가 있을 뿐만 아니라, 동물모델에서 총 BAL 세포 수 및 BAL 내 호중구 수를 감소시키며, BALF 내의 IL-1α, TNF-α, IL-17, MIP2, CXCL-1의 함량을 감소시키고, TNF-α, MIP2, CXCL-1, MUC5AC 유전자 발현량을 감소시키는 효과가 있으며, 폐조직 손상억제 효과가 있다는 것을 확인함으로써, 본 발명을 완성하였다.The present invention has been derived from the above needs, and the present invention provides a composition for preventing, improving or treating respiratory diseases containing a storus radish extract as an active ingredient, and the stor radish extract is a respiratory cell, bronchial epithelial cell. It reduces the production of chemokine RANTES, a mediator of inflammation, and reduces the expression of inflammatory cytokines (IL-6, TNF-α and MUC5AC). It has the effect of reducing the number of neutrophils, reducing the content of IL-1α, TNF-α, IL-17, MIP2, and CXCL-1 in BALF, and reducing the expression level of TNF-α, MIP2, CXCL-1, and MUC5AC genes And, by confirming that there is an effect of inhibiting lung tissue damage, the present invention was completed.
상기 목적을 달성하기 위하여, 본 발명은 황새냉이 추출물을 유효성분으로 함유하는 호흡기 질환의 예방 또는 개선용 건강기능식품 조성물을 제공한다.In order to achieve the above object, the present invention provides a health functional food composition for preventing or improving respiratory diseases containing a storus extract as an active ingredient.
또한, 본 발명은 황새냉이 추출물을 유효성분으로 함유하는 호흡기 질환의 예방 또는 치료용 약학 조성물을 제공한다.In addition, the present invention provides a pharmaceutical composition for the prevention or treatment of respiratory diseases containing a dorado extract as an active ingredient.
또한, 본 발명은 황새냉이 추출물을 유효성분으로 함유하는 호흡기 질환의 예방 또는 치료용 수의학적 조성물을 제공한다.In addition, the present invention provides a veterinary composition for the prevention or treatment of respiratory diseases containing a storus extract as an active ingredient.
또한, 본 발명은 황새냉이 추출물을 유효성분으로 함유하는 호흡기 질환의 예방 또는 개선용 사료첨가제를 제공한다.In addition, the present invention provides a feed additive for preventing or improving respiratory diseases containing the extract of radish radish as an active ingredient.
본 발명은 황새냉이 추출물을 유효성분으로 함유하는 호흡기 질환의 예방, 개선 또는 치료용 조성물에 관한 것으로, 상기 황새냉이 추출물이 호흡기 세포인 기관지 상피세포로부터 염증유발 매개인자인 케모카인 RANTES의 생성량을 감소시키며, 염증성 사이토카인(IL-6, TNF-α 및 MUC5AC)의 발현량을 감소시키는 효과가 있을 뿐만 아니라, 동물모델에서 총 BAL 세포 수 및 BAL 내 호중구 수를 감소시키며, BALF 내의 IL-1α, TNF-α, IL-17, MIP2, CXCL-1의 함량을 감소시키고, TNF-α, MIP2, CXCL-1, MUC5AC 유전자 발현량을 감소시키는 효과가 있으며, 폐조직 손상억제 효과가 있다.The present invention relates to a composition for preventing, ameliorating or treating respiratory diseases containing a storus extract as an active ingredient. , not only has the effect of reducing the expression level of inflammatory cytokines (IL-6, TNF-α and MUC5AC), but also reduces the total number of BAL cells and the number of neutrophils in BAL in animal models, IL-1α and TNF in BALF It has the effect of reducing the content of -α, IL-17, MIP2, and CXCL-1, and the expression level of TNF-α, MIP2, CXCL-1, and MUC5AC genes, and has the effect of inhibiting lung tissue damage.
도 1은 기관지상피세포(BEAS-2B)에서, 황새냉이 추출물의 처리에 따른 RANTES 생성율을 확인한 결과이다. Dexa는 양성대조군으로 덱사메타손(dexamethasone) 0.5μM을 처리한 군이다. ###은 대조군(Control) 대비 10ng/㎖의 TNF-α 처리군에서의 RANTES 생성율이 통계적으로 유의미하게 증가하였다는 것으로, p<0.001이고, ***은 10ng/㎖의 TNF-α 처리군 대비 황새냉이 추출물 처리 군 및 양성대조군(Dexa)에서의 RANTES 생성율이 통계적으로 유의미하게 감소하였다는 것으로, p<0.001이다.Figure 1 is a result of confirming the RANTES production rate according to the treatment of dorado radish extract in bronchial epithelial cells (BEAS-2B). Dexa is a positive control group treated with 0.5 μM of dexamethasone. ### indicates a statistically significant increase in the RANTES production rate in the 10ng/ml TNF-α treated group compared to the control group, p<0.001, and *** indicates a 10ng/ml TNF-α treated group It means that the rate of RANTES production in the contrast radish radish extract treatment group and the positive control group (Dexa) decreased statistically significantly, p <0.001.
도 2는 기관지상피세포에서 LPS로 염증을 유도한 후, 염증성 사이토카인 IL-6의 발현량 변화를 확인한 결과이다. ###은 Control(정상 대조군) 대비 LPS 처리군(LPS20)의 IL-6 발현량이 통계적으로 유의미하게 증가하였다는 것으로, p<0.001이고, ***은 LPS 군 대비 본 발명의 50㎍/㎖의 황새냉이 추출물 처리군(CF50)의 IL-6 발현량이 통계적으로 유의미하게 감소하였다는 것으로, p<0.001이다.Figure 2 is the result of confirming the change in the expression level of the inflammatory cytokine IL-6 after inducing inflammation with LPS in bronchial epithelial cells. ### indicates a statistically significant increase in the IL-6 expression level of the LPS-treated group (LPS20) compared to the control (normal control), p<0.001, and *** indicates that the LPS group compared to the present invention 50 μg / ml , p<0.001, indicating that the IL-6 expression level of the radish radish extract treatment group (CF50) decreased statistically significantly.
도 3은 기관지상피세포에서 LPS로 염증을 유도한 후, 염증성 사이토카인 TNF-α의 발현량 변화를 확인한 결과이다. ###은 Control(정상 대조군) 대비 LPS 처리군(LPS20)의 TNF-α 발현량이 통계적으로 유의미하게 증가하였다는 것으로, p<0.001이고, ***은 LPS 군 대비 본 발명의 50㎍/㎖의 황새냉이 추출물 처리군(CF50)의 TNF-α 발현량이 통계적으로 유의미하게 감소하였다는 것으로, p<0.001이다.Figure 3 is the result of confirming the change in the expression level of the inflammatory cytokine TNF-α after inducing inflammation with LPS in bronchial epithelial cells. ### indicates a statistically significant increase in TNF-α expression level in the LPS-treated group (LPS20) compared to the Control (normal control group), p<0.001, and *** is 50 μg/ml of the present invention compared to the LPS group , p<0.001, indicating that the TNF-α expression level of the radish radish extract treatment group (CF50) decreased statistically significantly.
도 4는 기관지상피세포에서 LPS로 염증을 유도한 후, 염증성 사이토카인 MUC5AC의 발현량 변화를 확인한 결과이다. ###은 Control(정상 대조군) 대비 LPS 처리군(LPS20)의 MUC5AC 발현량이 통계적으로 유의미하게 증가하였다는 것으로, p<0.001이고, **은 LPS 군 대비 본 발명의 50㎍/㎖의 황새냉이 추출물 처리군의 MUC5AC 발현량이 통계적으로 유의미하게 감소하였다는 것으로, p<0.01이다.Figure 4 is the result of confirming the change in the expression level of the inflammatory cytokine MUC5AC after inducing inflammation with LPS in bronchial epithelial cells. ### indicates a statistically significant increase in MUC5AC expression level in the LPS-treated group (LPS20) compared to the Control (normal control group), p<0.001, and ** indicates that 50 μg/ml of the present invention compared to the LPS group It means that the MUC5AC expression level of the extract treatment group decreased statistically significantly, p<0.01.
도 5는 호흡기 손상 동물모델을 이용하여 본 발명의 황새냉이 추출물의 효과를 확인하는 실험일정을 나타낸 개략도이다.Figure 5 is a schematic diagram showing an experimental schedule for confirming the effect of the storus radish extract of the present invention using a respiratory injury animal model.
도 6은 호흡기 손상 동물모델에 본 발명의 황새냉이 추출물을 투여한 후 총 BAL 세포 수를 확인한 결과이다. ###은 정상군 대비 LPS+CS(표준 담배 추출물)로 유도한 호흡기 손상 대조군의 총 BAL 세포수가 통계적으로 유의미하게 증가하였다는 것으로, p<0.001이고, **, ***은 대조군 대비 본 발명의 황새냉이 추출물 투여군 또는 양성대조군의 총 BAL 세포수가 통계적으로 유의미하게 감소하였다는 것으로, **는 p<0.01이고, ***는 p<0.001이다. Figure 6 is a result of confirming the total number of BAL cells after administering the storus extract of the present invention to a respiratory injury animal model. ### indicates a statistically significant increase in the total number of BAL cells in the respiratory injury control group induced by LPS + CS (standard tobacco extract) compared to the normal group, p<0.001, **, *** are compared to the control group The total number of BAL cells in the radish radish extract administration group or the positive control group of the present invention was statistically significantly decreased, ** is p <0.01, and *** is p <0.001.
도 7은 호흡기 손상 동물모델에 본 발명의 황새냉이 추출물을 투여한 후 BAL 내 호중구 수를 확인한 결과이다. ###은 정상군 대비 LPS+CS(표준 담배 추출물)로 유도한 호흡기 손상 대조군의 BAL 내 호중구 수가 통계적으로 유의미하게 증가하였다는 것으로, p<0.001이고, ***은 대조군 대비 본 발명의 황새냉이 추출물 투여군 또는 양성대조군의 BAL 내 호중구 수가 통계적으로 유의미하게 감소하였다는 것으로, p<0.001이다. 7 is a result of confirming the number of neutrophils in BAL after administering the storus extract of the present invention to a respiratory injury animal model. ### indicates a statistically significant increase in the number of neutrophils in the BAL of the respiratory injury control group induced by LPS + CS (standard tobacco extract) compared to the normal group, p<0.001, and *** is the stork of the present invention compared to the control group The number of neutrophils in the BAL of the shepherd's purse extract administration group or the positive control group was statistically significantly decreased, p<0.001.
도 8은 호흡기 손상 동물모델에 본 발명의 황새냉이 추출물을 투여한 후 BALF 내의 IL-1α, TNF-α, IL-17, MIP2, CXCL-1의 함량을 확인한 결과이다. ##, ###은 정상군 대비 LPS+CS(표준 담배 추출물)로 유도한 호흡기 손상 대조군의 BALF 내의 IL-1α, TNF-α, IL-17, MIP2, CXCL-1의 함량이 통계적으로 유의미하게 증가하였다는 것으로, ##은 p<0.01이고, ###은 p<0.001이다. *, **은 대조군 대비 본 발명의 황새냉이 추출물 투여군 또는 양성대조군에서 BALF 내의 IL-1α, TNF-α, IL-17, MIP2, CXCL-1의 함량이 통계적으로 유의미하게 감소하였다는 것으로, *는 p<0.05이고, **는 p<0.01이다. 8 is a result of confirming the contents of IL-1α, TNF-α, IL-17, MIP2, and CXCL-1 in BALF after administering the extract of the present invention to an animal model with respiratory injury. ##, ### are statistically significant in the content of IL-1α, TNF-α, IL-17, MIP2, and CXCL-1 in the BALF of the control group with respiratory injury induced by LPS+CS (standard tobacco extract) compared to the normal group That is, ## is p <0.01, ### is p <0.001. *, ** indicates that the contents of IL-1α, TNF-α, IL-17, MIP2, and CXCL-1 in BALF were statistically significantly decreased in the group treated with the radish radish extract of the present invention or the positive control group compared to the control group, * is p<0.05, and ** is p<0.01.
도 9는 호흡기 손상 동물모델에 본 발명의 황새냉이 추출물을 투여한 후 폐조직에서 TNF-α, MIP2, CXCL-1, MUC5AC 유전자 발현량을 확인한 결과이다. ##, ###은 정상군 대비 LPS+CS(표준 담배 추출물)로 유도한 호흡기 손상 대조군의 폐조직에서 TNF-α, MIP2, CXCL-1, MUC5AC 유전자 발현량이 통계적으로 유의미하게 증가하였다는 것으로, ##은 p<0.01이고, ###은 p<0.001이다. *, **은 대조군 대비 본 발명의 황새냉이 추출물 투여군 또는 양성대조군의 폐조직에서 TNF-α, MIP2, CXCL-1, MUC5AC 유전자 발현량이 통계적으로 유의미하게 감소하였다는 것으로, *는 p<0.05이고, **는 p<0.01이다. Figure 9 shows the results of confirming the expression levels of TNF-α, MIP2, CXCL-1, and MUC5AC genes in lung tissues after administering the wild horseradish extract of the present invention to a respiratory injury animal model. ##, ### indicate a statistically significant increase in the expression levels of TNF-α, MIP2, CXCL-1, and MUC5AC genes in the lung tissue of the control group with respiratory injury induced by LPS+CS (standard tobacco extract) compared to the normal group. , ## is p<0.01, ### is p<0.001. *, ** indicates a statistically significant decrease in TNF-α, MIP2, CXCL-1, and MUC5AC gene expression levels in the lung tissue of the storus extract administration group or positive control group of the present invention compared to the control group, * is p <0.05 , ** is p<0.01.
도 10은 호흡기 손상 동물모델에 본 발명의 황새냉이 추출물 투여한 후 폐조직의 병리적 손상억제를 확인한 H&E 염색 및 M-T 염색 결과이다. 10 shows the results of H&E staining and M-T staining confirming the inhibition of pathological damage to lung tissue after administering the extract of the present invention to a respiratory injury animal model.
본 발명은 황새냉이 추출물을 유효성분으로 함유하는 호흡기 질환의 예방 또는 개선용 건강기능식품 조성물에 관한 것이다.The present invention relates to a health functional food composition for preventing or improving respiratory diseases containing an extract of Dorado radish as an active ingredient.
상기 호흡기 질환은 천식, 만성폐쇄성폐질환, 기관지염, 인후염, 편도염 및 후두염으로 이루어진 군에서 선택되는 것이 바람직하지만 이에 한정하는 것은 아니다.The respiratory disease is preferably selected from the group consisting of asthma, chronic obstructive pulmonary disease, bronchitis, sore throat, tonsillitis and laryngitis, but is not limited thereto.
상기 황새냉이 추출물은 황새냉이의 전초를 추출한 것이 바람직하지만 이에 한정하지 않고, 필요에 따라 특정부위를 채택하여 사용할 수 있다.It is preferable that the extract of Stork radish is extracted from the outpost of Stork radish, but is not limited thereto, and may be used by adopting a specific part as needed.
상기 황새냉이 추출물은 하기의 단계를 포함하는 방법에 의해 제조할 수 있으나, 이에 한정하지 않는다:The raspberry extract may be prepared by a method comprising the following steps, but is not limited thereto:
(1) 건조 황새냉이에 추출용매를 가하여 추출하는 단계;(1) extracting by adding an extraction solvent to dried horseradish;
(2) 단계 (1)의 추출액을 여과하는 단계; 및 (2) filtering the extract of step (1); and
(3) 단계 (2)의 여과한 추출액을 건조하여 추출물을 제조하는 단계. (3) preparing an extract by drying the filtered extract of step (2).
상기 단계 (1)에서 추출용매는 물, C1~C4의 저급 알코올 또는 이들의 혼합물 중에서 선택하는 것이 바람직하며, 더 바람직하게는 물 또는 에탄올이고, 더욱더 바람직하게는 에탄올이지만 이에 한정하지 않는다. 상기 제조방법에 있어서, 추출방법은 열수 추출, 침지 추출, 환류 냉각 추출 및 초음파 추출 등의 당 업계에 공지된 모든 통상적인 방법을 이용할 수 있다. 상기 추출용매는 황새냉이 중량의 1~20배 첨가하여 추출하는 것이 바람직하다. 추출온도는 20~100℃인 것이 바람직하나 이에 한정하지 않는다. 또한, 추출시간은 1~5시간인 것이 바람직하며, 1~3시간이 더욱 바람직하지만 이에 한정하지 않는다. 상기 단계 (3)에서, 건조는 감압건조, 진공건조, 비등건조, 분무건조 또는 동결건조하는 것이 바람직하며, 더 바람직하게는 동결건조이나 이에 한정하지 않는다.In the step (1), the extraction solvent is preferably selected from water, C 1 ~ C 4 lower alcohol or mixtures thereof, more preferably water or ethanol, and still more preferably ethanol, but is not limited thereto. In the above production method, as the extraction method, all conventional methods known in the art such as hot water extraction, immersion extraction, reflux cooling extraction, and ultrasonic extraction may be used. It is preferable to extract the extraction solvent by adding 1 to 20 times the weight of the horseradish. The extraction temperature is preferably 20 to 100 ° C, but is not limited thereto. In addition, the extraction time is preferably 1 to 5 hours, more preferably 1 to 3 hours, but is not limited thereto. In the step (3), drying is preferably reduced pressure drying, vacuum drying, boiling drying, spray drying or freeze drying, more preferably freeze drying, but not limited thereto.
상기 건강기능식품 조성물은 분말, 과립, 환, 정제, 캡슐, 캔디, 시럽 및 음료 중에서 선택된 어느 하나의 제형으로 제조되는 것이 바람직하지만 이에 한정하는 것은 아니다. 본 발명의 건강기능식품 조성물은 황새냉이 추출물을 그대로 첨가하거나 다른 식품 또는 식품 성분과 함께 혼합하여 제조될 수 있고, 통상적인 방법에 따라 적절하게 제조될 수 있다. 상기 황새냉이 추출물을 첨가할 수 있는 식품의 예로는 캐러멜, 육류, 소시지, 빵, 초콜릿, 캔디류, 스낵류, 과자류, 피자, 라면, 기타 면류, 껌류, 아이스크림류를 포함한 낙농제품, 각종 수프, 음료수, 차, 드링크제, 알코올 음료 및 비타민 복합제 중에서 선택된 어느 하나의 형태일 수 있으며, 통상적인 의미에서의 건강기능식품을 모두 포함한다. 즉, 상기 식품의 종류에는 특별한 제한은 없다. 상기 건강기능식품 조성물은 여러 가지 영양제, 비타민, 광물(전해질), 합성 및 천연 풍미제, 착색제 및 증진제(치즈, 초콜릿 등), 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알코올, 탄산음료에 사용되는 탄산화제 등을 함유할 수 있다. 또한, 천연 과일 주스 및 야채 음료의 제조를 위한 과육을 함유할 수 있다. 상기의 성분은 독립적으로 또는 조합하여 사용할 수 있다. The health functional food composition is preferably prepared in any one formulation selected from powder, granule, pill, tablet, capsule, candy, syrup and beverage, but is not limited thereto. The health functional food composition of the present invention may be prepared by adding the extract of Dorsal japonica as it is or mixing it with other foods or food ingredients, and may be appropriately prepared according to a conventional method. Examples of foods to which the radish radish extract can be added include caramel, meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, chewing gum, dairy products including ice cream, various soups, beverages, It may be in the form of any one selected from tea, drinks, alcoholic beverages and vitamin complexes, and includes all health functional foods in the conventional sense. That is, there is no particular limitation on the type of food. The health functional food composition includes various nutrients, vitamins, minerals (electrolytes), synthetic and natural flavors, coloring agents and enhancers (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners , pH regulators, stabilizers, preservatives, glycerin, alcohol, carbonation agents used in carbonated beverages, and the like. It may also contain fruit flesh for the preparation of natural fruit juices and vegetable beverages. The above components may be used independently or in combination.
또한, 본 발명의 건강기능식품 조성물은 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있으며, 상기 천연 탄수화물은 포도당, 과당과 같은 단당류, 말토스, 슈크로스와 같은 이당류, 덱스트린, 사이클로 덱스트린과 같은 다당류, 자일리톨, 소르비톨, 에리트리톨 등의 당 알코올이다. 상기 천연 탄수화물의 비율은 크게 중요하지 않지만, 본 발명의 조성물 100g에 대하여, 0.01~0.04g인 것이 바람직하고, 더욱 바람직하게는 0.02~0.03g을 포함하는 것이지만 이에 한정하지 않는다. 감미제로서는 타우마틴, 스테비아 추출물과 같은 천연 감미제, 사카린, 아스파르탐과 같은 합성 감미제 등을 사용할 수 있다.In addition, the health functional food composition of the present invention may contain various flavoring agents or natural carbohydrates as additional components, and the natural carbohydrates may include monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, dextrin, and cyclosaccharides. polysaccharides such as dextrin, sugar alcohols such as xylitol, sorbitol, and erythritol. The ratio of the natural carbohydrates is not very important, but is preferably 0.01 to 0.04 g, more preferably 0.02 to 0.03 g, with respect to 100 g of the composition of the present invention, but is not limited thereto. As the sweetener, natural sweeteners such as thaumatin and stevia extract, and synthetic sweeteners such as saccharin and aspartame may be used.
또한, 본 발명은 황새냉이 추출물을 유효성분으로 함유하는 호흡기 질환의 예방 또는 치료용 약학 조성물에 관한 것이다.In addition, the present invention relates to a pharmaceutical composition for the prevention or treatment of respiratory diseases containing the extract of radish radish as an active ingredient.
본 발명에 따른 황새냉이 추출물을 포함하는 약학조성물은 캡슐제, 산제, 과립제, 정제, 현탁액, 에멀젼, 시럽 및 에어로졸 중에서 선택된 어느 하나의 제형인 것이 바람직하지만 이에 한정하지 않는다. 상기 황새냉이 추출물 이외에 약학적으로 허용 가능한 담체, 부형제 또는 희석제를 더 포함할 수 있으며, 황새냉이 추출물을 포함하는 약학 조성물에 포함될 수 있는 담체, 부형제 또는 희석제로는 락토즈, 덱스트로즈, 수크로스, 올리고당, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다. 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제될 수 있다. 본 발명의 황새냉이 추출물의 바람직한 투여량은 환자의 상태 및 체중, 질병의 정도, 약물형태, 투여경로 및 기간에 따라 다르지만, 당업자에 의해 적절하게 선택될 수 있다. 그러나 바람직한 효과를 위해서, 본 발명의 황새냉이 추출물을 포함하는 약학 조성물은 1일 0.0001~100㎎/㎏으로, 바람직하게는 0.001~10㎎/㎏으로 투여하는 것이 좋다. 투여는 하루에 한 번 투여할 수도 있고, 수회 나누어 투여할 수도 있다. 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다.The pharmaceutical composition containing the extract of Dorado radishes according to the present invention is preferably in any one formulation selected from capsules, powders, granules, tablets, suspensions, emulsions, syrups and aerosols, but is not limited thereto. In addition to the raspberry extract, a pharmaceutically acceptable carrier, excipient or diluent may be further included, and carriers, excipients or diluents that may be included in the pharmaceutical composition containing the raspberry extract include lactose, dextrose, sucrose , oligosaccharide, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate , propylhydroxybenzoate, talc, magnesium stearate and mineral oil. When formulated, it may be prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants. A preferred dosage of the extract of radish radish of the present invention varies depending on the condition and body weight of the patient, the severity of the disease, the type of drug, the route of administration and the period of administration, but can be appropriately selected by those skilled in the art. However, for a desirable effect, the pharmaceutical composition containing the extract of the radish radish of the present invention is preferably administered at 0.0001 to 100 mg/kg per day, preferably at 0.001 to 10 mg/kg. Administration may be administered once a day, or may be administered in several divided doses. The dosage is not intended to limit the scope of the present invention in any way.
또한, 본 발명은 황새냉이 추출물을 유효성분으로 함유하는 호흡기 질환의 예방 또는 치료용 수의학적 조성물에 관한 것이다.In addition, the present invention relates to a veterinary composition for the prevention or treatment of respiratory diseases containing the extract of Dorado radish as an active ingredient.
본 발명의 수의학적 조성물은 통상의 방법에 따른 적절한 부형제 및 희석제를 더 포함할 수 있다. 본 발명의 수의학적 조성물에 포함될 수 있는 부형제 및 희석제로는 락토즈, 덱스트로즈, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시 벤조에이트, 탈크, 마그네슘 스테아레이트, 세탄올, 스테아릴알콜, 유동파라핀, 솔비탄모노스테아레이트, 폴리소르베이트 60, 메칠파라벤, 프로필파라벤 및 광물유를 들 수 있다. 본 발명에 따른 수의학적 조성물은 충진제, 항응집제, 윤활제, 습윤제, 향신료, 유화제, 방부제 등을 추가로 포함할 수 있는데, 본 발명에 따른 수의학적 조성물은 동물에 투여된 후 활성 성분의 신속, 지속 또는 지연된 방출을 제공할 수 있도록 당업계에 잘 알려진 방법을 사용하여 제형화될 수 있고, 제형은 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 용액, 시럽, 에어로졸, 연질 또는 경질 젤라틴 캅셀, 좌제, 멸균 주사용액, 멸균 외용제 등의 형태일 수 있다. 본 발명에 따른 수의학적 조성물의 유효한 양은 동물의 개체에 따라 적절하게 선택할 수 있다. 질환 내지 상태의 중증도, 개체의 연령, 체중, 건강상태 또는 성별에 따른 본 발명의 유효성분에 대한 민감도, 투여 경로, 투여 기간, 상기 조성물과 배합 또는 동시 사용되는 다른 조성물을 포함한 요소 및 기타 생리 내지 수의학 분야에 잘 알려진 요소에 따라 결정될 수 있다.The veterinary composition of the present invention may further include appropriate excipients and diluents according to conventional methods. Excipients and diluents that may be included in the veterinary composition of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, cetanol, stearyl alcohol, liquid paraffin, sorbitan monostearate , polysorbate 60, methylparaben, propylparaben and mineral oil. The veterinary composition according to the present invention may further include fillers, anti-agglomerating agents, lubricants, wetting agents, spices, emulsifiers, preservatives, and the like. Or it may be formulated using a method well known in the art to provide delayed release, and the dosage form may be a powder, granule, tablet, capsule, suspension, emulsion, solution, syrup, aerosol, soft or hard gelatin capsule, It may be in the form of a suppository, a sterile injection solution, or a sterile external preparation. An effective amount of the veterinary composition according to the present invention can be appropriately selected according to the individual animal. The severity of the disease or condition, the sensitivity to the active ingredient of the present invention according to the age, weight, health condition or sex of the subject, the route of administration, the period of administration, factors including other compositions that are combined or used simultaneously with the above composition, and other physiological or It can be determined according to factors well known in the veterinary field.
또한, 본 발명은 황새냉이 추출물을 유효성분으로 함유하는 호흡기 질환의 예방 또는 개선용 사료첨가제에 관한 것이다.In addition, the present invention relates to a feed additive for the prevention or improvement of respiratory diseases containing a storus radish extract as an active ingredient.
본 발명의 사료 첨가제는 사료관리법상의 보조사료에 해당한다. 본 발명에서 용어 '사료'는 동물이 먹고, 섭취하며, 소화시키기 위한 또는 이에 적당한 임의의 천연 또는 인공 규정식, 한끼식 등 또는 상기 한 끼 식의 성분을 의미할 수 있다. 상기 사료의 종류는 특별히 제한되지 아니하며, 당해 기술 분야에서 통상적으로 사용되는 사료를 사용할 수 있다. 상기 사료의 비제한적인 예로는, 곡물류, 근과류, 식품 가공 부산물류, 조류, 섬유질류, 제약 부산물류, 유지류, 전분류, 박류 또는 곡물 부산물류 등과 같은 식물성 사료; 단백질류, 무기물류, 유지류, 광물성류, 유지류, 단세포 단백질류, 동물성 플랑크톤류 또는 음식물 등과 같은 동물성 사료를 들 수 있다. 이들은 단독으로 사용되거나 2종 이상을 혼합하여 사용될 수 있다.The feed additive of the present invention corresponds to supplementary feed under the Feed Management Act. In the present invention, the term 'feed' may mean any natural or artificial diet, one meal, etc., or a component of the one meal meal, for or suitable for the animal to eat, ingest, and digest. The type of feed is not particularly limited, and feeds commonly used in the art may be used. Non-limiting examples of the feed include vegetable feeds such as grains, root fruits, food processing by-products, algae, fibers, pharmaceutical by-products, oils and fats, starches, meal or grain by-products; Animal feed such as proteins, inorganic materials, oils, mineral oils, oils, single cell proteins, zooplankton, or food may be mentioned. These may be used alone or in combination of two or more.
이하, 실시예를 이용하여 본 발명을 더욱 상세하게 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로 본 발명의 범위가 이들에 의해 제한되지 않는다는 것은 당해 기술분야에서 통상의 지식을 가진 자에게 있어 자명한 것이다. Hereinafter, the present invention will be described in more detail using examples. These examples are only for explaining the present invention in more detail, and it is obvious to those skilled in the art that the scope of the present invention is not limited thereto.
실시예 1. 황새냉이 추출물의 제조Example 1. Preparation of Stove radish extract
건조 황새냉이 전초를 70%(v/v) 에탄올로 2시간 동안 2회 환류 추출한 후 추출액을 여과하고 여과액을 감압농축, 건조하여 추출물을 각각 수득하였다.After refluxing the dried radish root extract twice for 2 hours with 70% (v/v) ethanol, the extract was filtered, and the filtrate was concentrated under reduced pressure and dried to obtain extracts, respectively.
실시예 2. 기관지 상피세포(BEAS-2B)에서 호흡기 염증 억제 활성 확인Example 2. Confirmation of respiratory inflammatory activity in bronchial epithelial cells (BEAS-2B)
황새냉이 추출물의 호흡기 염증 억제 활성은 인체 기관지 상피세포주를 이용하여 염증유발 케모카인 RANTES의 분비 억제 활성을 평가하였다. The inhibitory activity of the inflammatory chemokine, RANTES, was evaluated using human bronchial epithelial cell lines.
FBS(fetal bovine serum) 및 PS(penicillin-streptomycin)를 첨가한 DMEM(Dulbecco's modified eagle's medium)으로 인체 기관지 상피세포주인 BEAS-2B(human bronchial epithelial cell, ATCC, USA) 세포를 배양하였으며, BEAS-2B (5×104 cells/well) 세포를 96웰 플레이트에 10%가 포함된 DMEM 배지에 18시간 배양한 후, 배지를 제거하여 혈청-프리 DMEM으로 배지를 교체하고, 100 및 200㎍/㎖의 황새냉이 추출물과 10ng/㎖의 TNF-α를 동시 처리하여 24시간 동안 배양하였다. RANTES 분비량은 ELISA 키트(R&D systems, USA)를 이용하여 제조사의 방법에 따라 세포 상등액에 존재하는 RANTE의 분비량을 측정하였다. 통계적 차이는 스튜던트 t-테스트를 이용하여 유의성을 평가하였다.BEAS-2B (human bronchial epithelial cell, ATCC, USA) cells were cultured with DMEM (Dulbecco's modified eagle's medium) supplemented with FBS (fetal bovine serum) and PS (penicillin-streptomycin). (5×10 4 cells/well) After culturing the cells in a 96-well plate in DMEM medium containing 10% for 18 hours, the medium was removed and the medium was replaced with serum-free DMEM, and 100 and 200 μg/ml of The extract was simultaneously treated with 10 ng/ml of TNF-α and cultured for 24 hours. The amount of RANTES secretion was measured according to the manufacturer's method using an ELISA kit (R&D systems, USA) to measure the amount of RANTE secretion present in the cell supernatant. Statistical differences were assessed for significance using Student's t-test.
그 결과 도 1에 개시한 바와 같이, 대조군(Control) 대비 TNF-α처리군에서 RANTES 생성량이 통계적으로 유의미하게 증가하였고, 이에 대비하는 본 발명의 황새냉이 추출물을 처리한 군 및 양성대조군(Dexa)에서는 RANTES 생성량이 통계적으로 유의미하게 감소하였다.As a result, as shown in FIG. 1, the amount of RANTES production was statistically significantly increased in the TNF-α treatment group compared to the control group (Control), and in contrast to this, the group treated with the radish radish extract of the present invention and the positive control group (Dexa) In , RANTES production was statistically significantly reduced.
실시예 3. 기관지상피세포에서 LPS로 염증을 유도한 후, 염증성 사이토카인 IL-6, TNF-α, 점액 분비 단백질 MUC5AC 발현량 변화 확인Example 3. After inducing inflammation with LPS in bronchial epithelial cells, inflammatory cytokines IL-6, TNF-α, mucus secretion protein MUC5AC expression level change confirmation
LPS로 염증을 유도한 인체 기관지 상피세포주에서 염증성 사이토카인 IL-6, TNF-α, 점액 분비 단백질 MUC5AC 발현량 변화를 평가하였다. Changes in the expression levels of inflammatory cytokines IL-6, TNF-α, and mucus secretion protein MUC5AC were evaluated in human bronchial epithelial cell lines in which inflammation was induced by LPS.
인체 기관지 상피세포주인 BEAS-2B(human bronchial epithelial cell, ATCC, USA) 세포는 FBS, 페니실린-스트렙토마이신(PS)를 첨가한 DMEM 배지에 18시간 배양한 후, 배지를 제거하여 혈청-프리 DMEM으로 배지를 교체하고, 50㎍/㎖의 황새냉이 추출물 및 20㎍/㎖의 LPS를 처리하여 24시간 배양하였다. 24시간 후 세포 상층액을 회수하여 IL-6, TNF-α 및 MUC5AC 발현량을 측정하였다. BEAS-2B (human bronchial epithelial cell, ATCC, USA) cells, a human bronchial epithelial cell line, were cultured in DMEM medium supplemented with FBS and penicillin-streptomycin (PS) for 18 hours, and then the medium was removed and replaced with serum-free DMEM. The medium was replaced, and cultured for 24 hours by treating with 50 μg/ml of Stork radish extract and 20 μg/ml of LPS. After 24 hours, the cell supernatant was recovered and the expression levels of IL-6, TNF-α and MUC5AC were measured.
그 결과, 대조군(CON) 대비 LPS 유도군의 IL-6, TNF-α 및 MUC5AC 발현량이 현저하게 증가하였으나, 이에 대비하여 황새냉이 추출물을 처리한 실험군의 IL-6, TNF-α 및 MUC5AC 발현량은 현저하게 감소하였다(도 2 내지 도 4). As a result, the expression levels of IL-6, TNF-α and MUC5AC in the LPS-induced group were markedly increased compared to the control group (CON). was significantly decreased (Figs. 2 to 4).
실시예 4. LPS+CS(표준 담배 추출물)로 유도한 호흡기 손상모델에서 호흡기 염증 개선 효과 확인Example 4. LPS + CS (Standard Tobacco Extract) Induced Respiratory Injury Model Confirmation of Respiratory Inflammation Improvement Effect
7주령 BALB/c 수컷 생쥐에 LPS+CS(표준 담배 추출물)을 2주간 3회 코와 입을 통하여 50㎕씩 총 100㎕를 흡인시켜 만성폐쇄성폐질환(COPD)를 유발시켰다. 실험군은 아무런 처리를 하지 않은 정상군(Normal), COPD 유도물질을 처리한 대조군(Control), COPD 유도물질과 양성대조군 덱사메타손(3mg/kg) 투여군, COPD 유도물질과 황새냉이 추출물(200mg/kg) 투여군(CF 200), COPD 유도물질과 황새냉이 추출물(100 mg/kg) 투여군(CF 100)으로 하였다. 약물은 14일 동안 매일 경구투여하였고, 실험이 끝난 후 각 실험군의 마우스 폐포세척액(BALF) 및 폐조직을 분리하였다(도 5). Chronic obstructive pulmonary disease (COPD) was induced in 7-week-old BALB/c male mice by inhaling 50 μl of LPS+CS (standard tobacco extract) through the nose and mouth three times for two weeks. The experimental group was a normal group without any treatment, a control group treated with a COPD inducer, a COPD inducer and a positive control dexamethasone (3mg/kg) administered group, a COPD inducer and a radish extract (200mg/kg) The administration group (CF 200) and the COPD inducer and radish radish extract (100 mg/kg) administration group (CF 100) were selected. The drug was administered orally every day for 14 days, and after the experiment, mouse alveolar lavage fluid (BALF) and lung tissue of each experimental group were separated (FIG. 5).
(1) 기관지 폐포 세척액 분리(1) Separation of bronchoalveolar lavage fluid
실험 마지막 날에 채혈한 후, 개흉하여 기도를 노출시켜 FBS free DMEM 배지 1㎖을 넣은 주사기를 기관지 (trachea)에 삽입하여 주입시키고, 끈으로 묶어 고정한 후에 기관지 폐포세척을 3회 순환하여 세척액(BALF)을 얻었다. 기관지폐포 세척액을 4℃, 2,000rpm, 5분 동안 원심분리한 후에, 상층액은 세포원심분리를 측정하기 위해 냉동보관하였고, BALF에서 분리한 세포는 ACK 액을 3분 동안 처리하여 적혈구를 용해시키고, 다시 1% FBS 프리 DMEM 배양액으로 세척한 후, 혈구계수기를 사용하여 총 세포수를 측정하였다.After blood collection on the last day of the experiment, open the thorax to expose the airway, insert a syringe containing 1 ml of FBS-free DMEM medium into the trachea and inject it, tie it with a string and fix it. ) was obtained. After centrifugation of the bronchoalveolar lavage fluid at 4°C, 2,000 rpm for 5 minutes, the supernatant was stored frozen to measure cell centrifugation, and the cells isolated from BALF were treated with ACK solution for 3 minutes to lyse red blood cells. , After washing again with 1% FBS-free DMEM culture medium, the total cell number was measured using a hemocytometer.
(2) 기관지 폐포 세척액(BALF) 분리 및 총 호중구 세포 수 확인(2) Isolation of bronchoalveolar lavage fluid (BALF) and determination of total neutrophil cell count
혈액을 채혈한 후 해부하여 호중구의 BALF 내 세포 계수를 위해 원심분리 후. 침전된 혈구를 분리하여 0.04% 트리판블루(trypan blue)로 염색한 후 총세포수를 측정하였다. Diff-Quick 염색(Romanowsky stain)을 3회에 걸쳐 처리하였고, 이후 PBS로 2회 세척한 후, 군당 9개의 슬라이드를 제작하여 400× 배율의 광학현미경(Light microscope, Nikon, Japan)을 통해 계수하였다.Blood was drawn, dissected and centrifuged for cell count in BALF of neutrophils. The precipitated blood cells were separated, stained with 0.04% trypan blue, and the total cell number was measured. Diff-Quick staining (Romanowsky stain) was treated three times, then washed twice with PBS, and nine slides per group were prepared and counted through a light microscope (Light microscope, Nikon, Japan) at 400× magnification. .
그 결과 생쥐에 LPS와 표준담배추출물을 INT 방법으로 주입한 대조군에서 호중구 수가 현저하게 증가하였고, 이 결과로부터 폐에서의 염증 수치가 증가한 것으로 판단하였다. As a result, the number of neutrophils increased significantly in the control group injected with LPS and standard tobacco extract by INT method, and from this result, it was judged that the level of inflammation in the lungs increased.
또한 양성대조군인 덱사메타손 투여군 및 황새냉이 추출물(CF) 투여군에서는 BAL 총 세포수와 호중구 수가 유의미하게 감소하였다(도 6 및 도 7). In addition, in the positive control group, dexamethasone-administered group and radish radish extract (CF)-administered group, the BAL total cell number and neutrophil count were significantly decreased (FIGS. 6 and 7).
(3) 효소면역분석법(ELISA)(3) enzyme immunoassay (ELISA)
BALF 내의 IL-1α, TNF-α, IL-17, MIP2, CXCL-1의 양을 측정하기 위해 ELISA를 수행하였다. 포획 항체를 넣고, 4℃에서 밤샘(overnight)한 후, 세척용 완충용액으로 4회 세척하였다. 비오틴이 결합된 항체 시약을 각각의 웰에 100㎕씩 처리하여 1시간 동안 실온에서 반응시킨 후 2회 세척한 다음, 스트렙타비딘-HRP 용액을 각각의 웰에 100㎕씩 처리하여 1시간 동안 실온에서 반응시킨 후에 다시 세척용 완충용액으로 2회 세척하였다. 여기에 기질용액을 100㎕씩 처리하여 20분 동안 반응시킨 후에, 50㎕의 반응정지 용액을 처리하여 반응을 종결시킨 뒤 450nm에서 흡광도를 측정하였다.ELISA was performed to measure the amounts of IL-1α, TNF-α, IL-17, MIP2, and CXCL-1 in BALF. After the capture antibody was added, and overnight at 4° C., the cells were washed 4 times with a washing buffer. 100 μl of biotin-conjugated antibody reagent was treated in each well, reacted at room temperature for 1 hour, washed twice, and then treated with 100 μl of streptavidin-HRP solution in each well and incubated at room temperature for 1 hour After the reaction, it was washed twice with a washing buffer solution. Here, 100 μl of the substrate solution was treated and reacted for 20 minutes, and then the reaction was terminated by treatment with 50 μl of the reaction stop solution, and the absorbance was measured at 450 nm.
그 결과, BALF에서 염증관련 사이토카인 케모카인인 IL-1α, TNF-α, IL-17, MIP2, CXCL-1의 생산량은 LPS+CS(표준 담배 추출물) 유도 대조군에서 모두 증가하였고, 이에 대비하여 양성대조군과 황새냉이 추출물(CF) 투여군에서는 통계적으로 유의미하게 감소하였다(도 8).As a result, the production of IL-1α, TNF-α, IL-17, MIP2, and CXCL-1, which are inflammation-related cytokines and chemokines, in BALF were all increased in the LPS+CS (standard tobacco extract) induced control group. There was a statistically significant decrease in the control group and the radish radish extract (CF)-administered group (FIG. 8).
(4) 폐조직에서 TNF-α, MIP2, CXCL-1, MUC5AC 유전자 발현량 확인(4) Confirmation of TNF-α, MIP2, CXCL-1, and MUC5AC gene expression levels in lung tissue
생쥐의 폐조직을 적출한 후에 RNA 추출용액 500㎕를 넣고 용해될 때까지 분쇄하였다. 13,000rpm으로 원심분리한 후에 에탄올로 수세하고 건조하여 RNA를 추출하였다. 추출한 RNA는 first strand cDNA 합성에 사용하였다. After extracting the lung tissue of the mouse, 500 μl of RNA extraction solution was added and ground until dissolved. After centrifugation at 13,000 rpm, RNA was extracted by washing with ethanol and drying. The extracted RNA was used for first strand cDNA synthesis.
합성한 cDNA를 실시간 중합연쇄반응은 Applied Biosystem 7500 Real-Time PCR 시스템(Applied Biosystems, USA)를 이용하여 수행하였다. TNF-α, MIP2, CXCL-1, MUC5AC 프라이머를 사용하였으며 G3PDH 프로브(VIC, Applied Biosystems, USA)를 사용하였다. 실시간 중합연쇄반응 조건은 프리-변성(pre-denaturation)은 50℃에서 2분, 94℃에서 10분, 및 40사이클을 95℃에서 0.15분, 60℃에서 1분 수행하였다. 황새냉이 추출물 투여군과 대조군은 내부 표준물질(internal strandard)로 G3PDH를 사용하여 RQ(relative quantitative)를 계산하였다. Real-time polymerization of the synthesized cDNA was carried out using an Applied Biosystem 7500 Real-Time PCR system (Applied Biosystems, USA). TNF-α, MIP2, CXCL-1, MUC5AC primers were used, and G3PDH probe (VIC, Applied Biosystems, USA) was used. Real-time polymerization chain reaction conditions were pre-denaturation at 50 °C for 2 minutes, 94 °C for 10 minutes, and 40 cycles at 95 °C for 0.15 minutes and 60 °C for 1 minute. RQ (relative quantitative) was calculated using G3PDH as an internal standard for the radish radish extract administration group and the control group.
프라이머 및 프로브 서열Primer and Probe Sequences
유전자gene 방향direction 서열(5′->3′)Sequence (5′->3′) 서열번호sequence number
TNF-αTNF-α 정방향forward CCTGTAGCCCACGTCGTAGCCCTGTAGCCCACGTCGTAGC 1One
역방향 reverse TTGACCTCAGCGCTGAGTTGTTGACCTCAGCGCTGAGTTG 22
MIP2 MIP2 정방향forward ATGCCTGAAGACCCTGCCAAGATGCCTGAAGACCCTGCCAAG 33
역방향reverse GGTCAGTTAGCCTTGCCTTTGGGTCAGTTAGGCCTTGCCTTTG 44
CXCL-1CXCL-1 정방향 forward CCGAAGTCATAGCCACACCCGAAGTCATAGCCACAC 55
역방향 reverse GTGCCATCAGAGCAGTCTGTGCCATCAGAGCAGTCT 66
MUC5AC MUC5AC 정방향forward AGAATATCTTTCAGGACCCCTGCTAGAATATCTTTCAGGACCCCTGCT 77
역방향 reverse ACACCAGTGCTGAGCATACTTTTACACCAGTGCTGAGCATACTTTT 88
G3PDH G3PDH 프로브probe CATGTTCCAGTATGACTCCACTCACGCATGTTCCAGTATGACTCCACTCACG 99
그 결과, 염증관련 사이토카인 TNF-α, MIP2, CXCL-1과 점액 단백질 MUC5AC의 유전자 발현은 LPS+CS(표준 담배 추출물) 유도 대조군에서 증가하였고, 양성대조군과 황새냉이 추출물(CF) 투여군에서 유의성 있는 수준으로 감소하였다(도 9).As a result, the gene expression of inflammation-related cytokines TNF-α, MIP2, CXCL-1 and mucin protein MUC5AC increased in the LPS+CS (standard tobacco extract) induced control group, and was significant in the positive control group and the radish radish extract (CF)-administered group. It decreased to a level that is (FIG. 9).
(5) 조직병리검사(5) Histopathological examination
폐조직의 병리적 손상 정도를 관찰하기 위해 폐조직을 절취하여 10% 중화 포르말린(neutral-buffered formalin)에 24시간 동안 고정시킨 다음 알코올로 탈수시키고 파라핀으로 포매하여 블럭을 제작한 다음 마이크로톰으로 4㎛ 두께의 조직절편을 제작하여 H&E(Hematoxylin & Eosin) 염색과 콜라겐 deposition 염색인 M-T(Masson-Trichrome) 염색, 배상세포(goblet cell) 및 분비된 점액질을 관찰하기 위해 PAS 염색을 수행하였다. 염색 후 400× 배율의 광학현미경(Nikon, Japan)을 통해 관찰하였다. To observe the degree of pathological damage to the lung tissue, the lung tissue was cut and fixed in 10% neutral-buffered formalin for 24 hours, then dehydrated with alcohol, embedded in paraffin to make a block, and then 4㎛ with a microtome. Thick tissue sections were prepared and H&E (Hematoxylin & Eosin) staining, M-T (Masson-Trichrome) staining, collagen deposition staining, and PAS staining were performed to observe goblet cells and secreted mucus. After staining, it was observed through an optical microscope (Nikon, Japan) at 400× magnification.
그 결과, LPS+CS(표준 담배 추출물) 유도 대조군의 H&E 염색법을 통해 염증세포 침윤, 폐세포 벽이 두꺼워진 것을 확인할 수 있었고, M-T 염색법을 통해 교원섬유 증가를 확인할 수 있었다. 이에 대비하여 양성대조군인 덱사메타손 투여군과 황새냉이 추출물(CF) 투여군은 얇은 폐세포 벽과 염증세포 감소, 교원섬유의 감소를 확인할 수 있었다(도 10). As a result, inflammatory cell infiltration and lung cell wall thickening were confirmed through H&E staining of the LPS+CS (standard tobacco extract) induced control group, and collagen fiber increase was confirmed through M-T staining. In contrast, in the positive control group, the dexamethasone-administered group and the radish radish extract (CF)-administered group, thin lung cell walls, reduction of inflammatory cells, and reduction of collagen fibers were confirmed (FIG. 10).
[통계처리][Statistical Processing]
결과는 평균±오차로 기록하였고, 유의성 검증은 스튜던트 t-테스트 및 일원분석 ANOVA에 따른 던컨의 다중비교분석법(SPSS statistics version 19.0 statistic software, Inc, IBM, USA)을 이용하여 결정하였다. Results were reported as mean ± error, and significance was determined using Duncan's multiple comparison analysis method (SPSS statistics version 19.0 statistic software, Inc, IBM, USA) followed by Student's t-test and one-way ANOVA.

Claims (9)

  1. 황새냉이(Cardamine flexuosa) 추출물을 유효성분으로 함유하는 호흡기 질환의 예방 또는 개선용 건강기능식품 조성물.A health functional food composition for preventing or improving respiratory diseases containing an extract of Cardamine flexuosa as an active ingredient.
  2. 제1항에 있어서, 상기 황새냉이 추출물의 추출용매는 물, C1~C4의 저급 알코올 또는 이들의 혼합물인 것을 특징으로 하는 호흡기 질환의 예방 또는 개선용 건강기능식품 조성물.The health functional food composition for preventing or improving respiratory diseases according to claim 1, wherein the extraction solvent of the horseradish extract is water, C 1 ~ C 4 lower alcohol, or a mixture thereof.
  3. 제1항에 있어서, 상기 호흡기 질환은 천식, 만성폐쇄성폐질환, 기관지염, 인후염, 편도염 및 후두염으로 이루어진 군에서 선택되는 것을 특징으로 하는 호흡기 질환의 예방 또는 개선용 건강기능식품 조성물.The functional food composition for preventing or improving respiratory diseases according to claim 1, wherein the respiratory disease is selected from the group consisting of asthma, chronic obstructive pulmonary disease, bronchitis, sore throat, tonsillitis and laryngitis.
  4. 제1항에 있어서, 상기 황새냉이 추출물은 황새냉이의 전초를 추출한 것을 특징으로 하는 호흡기 질환의 예방 또는 개선용 건강기능식품 조성물.The health functional food composition for preventing or improving respiratory diseases according to claim 1, wherein the extract of the horseradish radish is obtained by extracting the whole plant of the horseradish.
  5. 제1항 있어서, 상기 조성물은 분말, 과립, 환, 정제, 캡슐, 캔디, 시럽 및 음료 중에서 선택된 어느 하나의 제형으로 제조되는 것을 특징으로 하는 호흡기 질환의 예방 또는 개선용 건강기능식품 조성물.The functional food composition for preventing or improving respiratory diseases according to claim 1, wherein the composition is prepared in any one formulation selected from powders, granules, pills, tablets, capsules, candies, syrups and beverages.
  6. 황새냉이 추출물을 유효성분으로 함유하는 호흡기 질환의 예방 또는 치료용 약학 조성물.A pharmaceutical composition for the prevention or treatment of respiratory diseases, containing an extract of radish radish as an active ingredient.
  7. 제6항에 있어서, 상기 황새냉이 추출물 이외에 약학적으로 허용 가능한 담체, 부형제 또는 희석제를 더 포함하는 것을 특징으로 하는 호흡기 질환의 예방 또는 치료용 약학 조성물.[Claim 7] The pharmaceutical composition for preventing or treating respiratory diseases according to claim 6, further comprising a pharmaceutically acceptable carrier, excipient or diluent in addition to the raspberry extract.
  8. 황새냉이 추출물을 유효성분으로 함유하는 호흡기 질환의 예방 또는 치료용 수의학적 조성물.A veterinary composition for the prevention or treatment of respiratory diseases, containing an extract of radish radish as an active ingredient.
  9. 황새냉이 추출물을 유효성분으로 함유하는 호흡기 질환의 예방 또는 개선용 사료첨가제.A feed additive for prevention or improvement of respiratory diseases containing stork radish extract as an active ingredient.
PCT/KR2022/021047 2021-12-23 2022-12-22 Composition comprising cardamine flexuosa extract as active ingredient for prevention, alleviation, or treatment of respiratory disease WO2023121334A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20210186404 2021-12-23
KR10-2021-0186404 2021-12-23

Publications (1)

Publication Number Publication Date
WO2023121334A1 true WO2023121334A1 (en) 2023-06-29

Family

ID=86903147

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/021047 WO2023121334A1 (en) 2021-12-23 2022-12-22 Composition comprising cardamine flexuosa extract as active ingredient for prevention, alleviation, or treatment of respiratory disease

Country Status (2)

Country Link
KR (1) KR20230098053A (en)
WO (1) WO2023121334A1 (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2011195533A (en) * 2010-03-23 2011-10-06 Shiseido Co Ltd Fibroblast proliferation promoter and anti-ageing agent
JP2011195534A (en) * 2010-03-23 2011-10-06 Shiseido Co Ltd Hyaluronic acid production promoter, anti-ageing agent and wrinkle-ameliorating agent
KR101863731B1 (en) * 2017-05-18 2018-06-01 충남대학교산학협력단 Composition for preventing, improving or treating prostate disease comprising extract of Cardamine scutata as effective component
KR20210120422A (en) * 2020-03-26 2021-10-07 애경산업(주) Cosmetic composition for skin moisturizing comprising extract of Cardamine amaraeformis

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2011195533A (en) * 2010-03-23 2011-10-06 Shiseido Co Ltd Fibroblast proliferation promoter and anti-ageing agent
JP2011195534A (en) * 2010-03-23 2011-10-06 Shiseido Co Ltd Hyaluronic acid production promoter, anti-ageing agent and wrinkle-ameliorating agent
KR101863731B1 (en) * 2017-05-18 2018-06-01 충남대학교산학협력단 Composition for preventing, improving or treating prostate disease comprising extract of Cardamine scutata as effective component
KR20210120422A (en) * 2020-03-26 2021-10-07 애경산업(주) Cosmetic composition for skin moisturizing comprising extract of Cardamine amaraeformis

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
ANONYMOUS: "Edible wild grass/stork horseradish", TRMAN'S BLOG, 28 February 2020 (2020-02-28), XP093074493, Retrieved from the Internet <URL:https://m.blog.naver.com/trman/221807807660> [retrieved on 20230817] *

Also Published As

Publication number Publication date
KR20230098053A (en) 2023-07-03

Similar Documents

Publication Publication Date Title
WO2022050516A1 (en) Coronavirus therapeutic agent comprising elaeocarpus sylvestris extract as active ingredient
WO2018117659A1 (en) Pharmaceutical composition comprising indigo pulverata levis extract or fraction thereof as effective ingredient for preventing or treating inflammatory bowel disease
WO2019124863A1 (en) Composition containing schisandra chinensis leaf extract as active ingredient for prevention, improvement and treatment of atopic dermatitis
WO2019189992A1 (en) Composition for preventing, alleviating or treating inflammatory diseases, containing zanthoxylum schinifolium oil as active ingredient
WO2024080715A1 (en) Composition for prevention, amelioration or treatment of fatty liver disease containing glycine max extract as active ingredient
WO2016200002A1 (en) Composition for skin-cancer treatment or metastasis suppression
WO2017073849A1 (en) Composition for prevention or treatment of arthritis, containing sargassum serratifolium extract as active ingredient
WO2023121334A1 (en) Composition comprising cardamine flexuosa extract as active ingredient for prevention, alleviation, or treatment of respiratory disease
WO2022124803A1 (en) Composition for preventing, alleviating, or treating allergic diseases, comprising extract of spatholobus suberectus as active ingredient
WO2023121331A1 (en) Composition for prevention, amelioration or treatment of respiratory disease containing lysimachia mauritiana extract as active ingredient
WO2019083264A1 (en) Composition for preventing, alleviating or treating liver diseases, containing fermented product of aged sprout ginseng extract as active ingredient
WO2018080157A1 (en) Composition for preventing, improving or treating cognitive impairment, containing ficus erecta extract as active ingredient
WO2023287151A1 (en) Composition for preventing, alleviating, or treating respiratory diseases, comprising fermented centella asiatica extract as active ingredient
WO2018030650A1 (en) Anti-obesity composition containing chrysanthemum leaf extract as active ingredient
WO2020122373A1 (en) Composition comprising glycyrrhiza uralensis extract as active ingredient for prevention, alleviation, or treatment of late-onset hypogonadism syndrome
WO2015122728A1 (en) Anti-tuberculosis composition for treating and preventing tuberculosis comprising melia azedarach l. extract or lobelia chinensis lour extract and fractions thereof
WO2023204364A1 (en) Composition for prevention, amelioration or treatment of allergic respiratory diseases comprising alpinia officinarum hance extract as active ingredient
WO2019156498A1 (en) Composition comprising sicyos angulatus extract as effective ingredient for prevention, alleviation, or treatment of disease attributed to side effect of anticancer agent
KR20230096889A (en) Composition for preventing, ameliorating or treating respiratory disease comprising Carpesium sp. plant extract as effective component
WO2019103571A1 (en) Composition for treating dermatitis, containing extract and fraction of aerial parts of gypsophila oldhamiana miq, and use thereof
WO2012067322A1 (en) Pharmaceutical composition for treatment of asthma containing 4-phenylbutyric acids or pharmaceutically acceptable salts thereof as active ingredient
WO2023195644A1 (en) Composition for prevention, amelioration or treatment of asthma containing malus baccata var. mandshurica extract as active ingredient
WO2020027574A1 (en) Composition for preventing, alleviating or treating respiratory diseases, containing siraitia grosvenorii extract as active ingredient
WO2017142255A1 (en) Composition containing medicinal herb extract as active ingredient for preventing, alleviating, or treating stress or depression
WO2012036344A1 (en) Appetite suppressant food composition comprising a specific compound as an active ingredient

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22911967

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE