WO2023116911A1 - 抗FRα抗体及其抗体药物偶联物和用途 - Google Patents

抗FRα抗体及其抗体药物偶联物和用途 Download PDF

Info

Publication number
WO2023116911A1
WO2023116911A1 PCT/CN2022/141572 CN2022141572W WO2023116911A1 WO 2023116911 A1 WO2023116911 A1 WO 2023116911A1 CN 2022141572 W CN2022141572 W CN 2022141572W WO 2023116911 A1 WO2023116911 A1 WO 2023116911A1
Authority
WO
WIPO (PCT)
Prior art keywords
amino acid
seq
antibody
acid sequence
antigen
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/CN2022/141572
Other languages
English (en)
French (fr)
Chinese (zh)
Inventor
汤伟佳
麦思琪
周鑫
严辉
李硕旭
范建军
沈静宜
梁世德
俞金泉
李胜峰
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Bio Thera Solutions Ltd
Original Assignee
Bio Thera Solutions Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bio Thera Solutions Ltd filed Critical Bio Thera Solutions Ltd
Priority to US18/722,899 priority Critical patent/US20250059274A1/en
Priority to JP2024537958A priority patent/JP2024547111A/ja
Priority to EP22910217.3A priority patent/EP4455164A1/en
Publication of WO2023116911A1 publication Critical patent/WO2023116911A1/zh
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47Quinolines; Isoquinolines
    • A61K31/4738Quinolines; Isoquinolines ortho- or peri-condensed with heterocyclic ring systems
    • A61K31/4745Quinolines; Isoquinolines ortho- or peri-condensed with heterocyclic ring systems condensed with ring systems having nitrogen as a ring hetero atom, e.g. phenantrolines
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7105Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/711Natural deoxyribonucleic acids, i.e. containing only 2'-deoxyriboses attached to adenine, guanine, cytosine or thymine and having 3'-5' phosphodiester links
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7115Nucleic acids or oligonucleotides having modified bases, i.e. other than adenine, guanine, cytosine, uracil or thymine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/713Double-stranded nucleic acids or oligonucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6801Drug-antibody or immunoglobulin conjugates defined by the pharmacologically or therapeutically active agent
    • A61K47/6803Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6801Drug-antibody or immunoglobulin conjugates defined by the pharmacologically or therapeutically active agent
    • A61K47/6803Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates
    • A61K47/68037Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates the drug being a camptothecin [CPT] or derivatives
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • A61K47/6849Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a receptor, a cell surface antigen or a cell surface determinant
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0684Cells of the urinary tract or kidneys
    • C12N5/0686Kidney cells
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/30Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/33Crossreactivity, e.g. for species or epitope, or lack of said crossreactivity
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/51Complete heavy chain or Fd fragment, i.e. VH + CH1
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/515Complete light chain, i.e. VL + CL
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/52Constant or Fc region; Isotype
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565Complementarity determining region [CDR]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/567Framework region [FR]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • C07K2317/732Antibody-dependent cellular cytotoxicity [ADCC]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/77Internalization into the cell
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/90Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00Genetically modified cells

Definitions

  • the present invention relates to an anti-FR ⁇ antibody, an antibody-drug conjugate comprising the anti-FR ⁇ antibody and uses thereof.
  • Folate an essential vitamin required for DNA synthesis and repair, cell division processes, is transported by endocytosis by binding to folate receptors on the cell surface, where folate receptors are internalized and then recycled back to the cell membrane.
  • the folate receptor is a transmembrane single-chain glycoprotein linked to glycosylated phosphatidylinositol and has a high affinity for folate.
  • Folate receptors include three subtypes, namely folate receptor ⁇ (Folate Receptor ⁇ , FOLR1, FR ⁇ ), folate receptor ⁇ (Folate Receptor ⁇ , FOLR2) and folate receptor ⁇ (Folate Receptor ⁇ , FOLR3).
  • the expression of folate receptors is highly restricted in normal cells, but significantly high in tumor cells. Overexpression of folate receptor ⁇ has been found in a variety of malignant tumors, so it has become one of the popular targets of anticancer drugs.
  • the present invention provides an antibody that specifically recognizes and binds to folate receptor ⁇ (also known as "anti-folate receptor ⁇ antibody” or “anti-FR ⁇ antibody”).
  • the antibodies of the invention are capable of recognizing and binding to human folate receptor alpha.
  • the present invention provides an antibody or an antigen-binding unit thereof, which specifically binds folate receptor ⁇ , and comprises one or more of (a)-(f) indivual:
  • VH CDR1 comprises the amino acid sequence shown in SEQ ID NO: 5, or an amino acid sequence with one or more site substitutions, deletions or insertions compared with the amino acid sequence shown in SEQ ID NO: 5, or composed of its composition;
  • VH CDR2 comprises the amino acid sequence shown in SEQ ID NO: 6, or an amino acid sequence with one or more site substitutions, deletions or insertions compared with the amino acid sequence shown in SEQ ID NO: 6, or composed of its composition;
  • VH CDR3 comprises the amino acid sequence shown in SEQ ID NO: 7, or an amino acid sequence with one or more site substitutions, deletions or insertions compared with the amino acid sequence shown in SEQ ID NO: 7, or composed of its composition;
  • VL CDR1 comprises the amino acid sequence shown in SEQ ID NO: 8, or has the amino acid sequence that one or more positions are substituted, deleted or inserted compared with the amino acid sequence shown in SEQ ID NO: 8, or consists of its composition;
  • VL CDR2 comprises the amino acid sequence shown in SEQ ID NO: 9, or has the amino acid sequence that one or more positions are substituted, deleted or inserted compared with the amino acid sequence shown in SEQ ID NO: 9, or by its composition;
  • VL CDR3 comprises the amino acid sequence shown in SEQ ID NO: 10, or has the amino acid sequence that one or more positions are substituted, deleted or inserted compared with the amino acid sequence shown in SEQ ID NO: 10, or consists of its composition.
  • the antibody or its antigen-binding unit specifically binds folate receptor alpha, and comprises:
  • VH CDR1 comprises the amino acid sequence shown in SEQ ID NO: 5, or an amino acid sequence with one or more site substitutions, deletions or insertions compared with the amino acid sequence shown in SEQ ID NO: 5, or composed of its composition;
  • VH CDR2 comprises the amino acid sequence shown in SEQ ID NO: 6, or an amino acid sequence with one or more site substitutions, deletions or insertions compared with the amino acid sequence shown in SEQ ID NO: 6, or composed of its composition;
  • VH CDR3 comprises the amino acid sequence shown in SEQ ID NO: 7, or an amino acid sequence with one or more site substitutions, deletions or insertions compared with the amino acid sequence shown in SEQ ID NO: 7, or composed of its composition.
  • the antibody or its antigen binding unit comprises VH CDR1 as shown in SEQ ID NO:5, VH CDR2 as shown in SEQ ID NO:6 and VH CDR2 as shown in SEQ ID NO:7 VH CDR3.
  • the antibody or its antigen-binding unit specifically binds folate receptor alpha, and comprises:
  • VL CDR1 comprises the amino acid sequence shown in SEQ ID NO: 8, or has the amino acid sequence that one or more positions are substituted, deleted or inserted compared with the amino acid sequence shown in SEQ ID NO: 8, or consists of its composition;
  • VL CDR2 comprises the amino acid sequence shown in SEQ ID NO: 9, or has the amino acid sequence that one or more positions are substituted, deleted or inserted compared with the amino acid sequence shown in SEQ ID NO: 9, or by its composition;
  • VL CDR3 comprises the amino acid sequence shown in SEQ ID NO: 10, or has the amino acid sequence that one or more positions are substituted, deleted or inserted compared with the amino acid sequence shown in SEQ ID NO: 10, or consists of its composition.
  • the antibody or its antigen binding unit comprises VL CDR1 as shown in SEQ ID NO:8, VL CDR2 as shown in SEQ ID NO:9 and VL CDR2 as shown in SEQ ID NO:10 VL CDR3.
  • the antibody or its antigen-binding unit specifically binds folate receptor alpha, and comprises:
  • VH CDR1 comprises the amino acid sequence shown in SEQ ID NO: 5, or an amino acid sequence with one or more site substitutions, deletions or insertions compared with the amino acid sequence shown in SEQ ID NO: 5, or composed of its composition;
  • VH CDR2 comprises the amino acid sequence shown in SEQ ID NO: 6, or an amino acid sequence with one or more site substitutions, deletions or insertions compared with the amino acid sequence shown in SEQ ID NO: 6, or composed of its composition;
  • VH CDR3 comprises the amino acid sequence shown in SEQ ID NO: 7, or an amino acid sequence with one or more site substitutions, deletions or insertions compared with the amino acid sequence shown in SEQ ID NO: 7, or composed of its composition;
  • VL CDR1 comprises the amino acid sequence shown in SEQ ID NO: 8, or has the amino acid sequence that one or more positions are substituted, deleted or inserted compared with the amino acid sequence shown in SEQ ID NO: 8, or consists of its composition;
  • VL CDR2 comprises the amino acid sequence shown in SEQ ID NO: 9, or has the amino acid sequence that one or more positions are substituted, deleted or inserted compared with the amino acid sequence shown in SEQ ID NO: 9, or by its composition;
  • VL CDR3 comprises the amino acid sequence shown in SEQ ID NO: 10, or has the amino acid sequence that one or more positions are substituted, deleted or inserted compared with the amino acid sequence shown in SEQ ID NO: 10, or consists of its composition.
  • the site substitutions, deletions or insertions are independently one, two or three.
  • the antibody or its antigen-binding unit comprises VH CDR1 as shown in SEQ ID NO:5, VH CDR2 as shown in SEQ ID NO:6, and VH CDR2 as shown in SEQ ID NO:7 VH CDR3, VL CDR1 as shown in SEQ ID NO:8, VL CDR2 as shown in SEQ ID NO:9, and VL CDR3 as shown in SEQ ID NO:10.
  • the antibody or antigen-binding unit thereof further comprises one or more of (g)-(n):
  • VHFR1 comprises the amino acid sequence shown in SEQ ID NO:1 or SEQ ID NO:29, or has at least 90% sequence identity compared to the amino acid sequence shown in SEQ ID NO:1 or SEQ ID NO:29 amino acid sequence, or an amino acid sequence having one or more substitutions, deletions or insertions compared to the amino acid sequence shown in SEQ ID NO:1 or SEQ ID NO:29;
  • VHFR2 comprises the amino acid sequence shown in SEQ ID NO:2 or SEQ ID NO:30, or has at least 90% sequence identity compared to the amino acid sequence shown in SEQ ID NO:2 or SEQ ID NO:30 amino acid sequence, or an amino acid sequence having one or more substitutions, deletions or insertions compared to the amino acid sequence shown in SEQ ID NO: 2 or SEQ ID NO: 30;
  • VH FR3 comprises the amino acid sequence shown in SEQ ID NO:3 or SEQ ID NO:31, or has at least 90% sequence identity compared with the amino acid sequence shown in SEQ ID NO:3 or SEQ ID NO:31 A non-specific amino acid sequence, or an amino acid sequence with one or more substitutions, deletions or insertions compared to the amino acid sequence shown in SEQ ID NO:3 or SEQ ID NO:31;
  • VH FR4 comprises the amino acid sequence shown in SEQ ID NO: 11, or an amino acid sequence having at least 90% sequence identity compared to the amino acid sequence shown in SEQ ID NO: 11, or an amino acid sequence with SEQ ID NO: 11
  • the amino acid sequence shown has one or more site substitutions, deletions or insertions compared to the amino acid sequence;
  • VLFR1 comprises the amino acid sequence shown in SEQ ID NO: 12, or an amino acid sequence having at least 90% sequence identity compared with the amino acid sequence shown in SEQ ID NO: 12, or an amino acid sequence with SEQ ID NO: 12 Amino acid sequences having one or more site substitutions, deletions or insertions compared to the amino acid sequence shown;
  • VL FR2 comprises the amino acid sequence shown in SEQ ID NO: 13, or an amino acid sequence having at least 90% sequence identity compared with the amino acid sequence shown in SEQ ID NO: 13, or an amino acid sequence with SEQ ID NO: 13
  • the amino acid sequence shown has one or more site substitutions, deletions or insertions compared to the amino acid sequence;
  • VL FR3 comprises the amino acid sequence shown in SEQ ID NO:4 or SEQ ID NO:32, or has at least 90% sequence identity compared with the amino acid sequence shown in SEQ ID NO:4 or SEQ ID NO:32 A non-specific amino acid sequence, or an amino acid sequence with one or more site substitutions, deletions or insertions compared to the amino acid sequence shown in SEQ ID NO: 4 or SEQ ID NO: 32;
  • VL FR4 comprises the amino acid sequence shown in SEQ ID NO: 14, or an amino acid sequence having at least 90% sequence identity compared to the amino acid sequence shown in SEQ ID NO: 14, or an amino acid sequence with SEQ ID NO: 14
  • the amino acid sequences shown are compared to amino acid sequences having one or more site substitutions, deletions or insertions.
  • the antibody or its antigen-binding unit specifically binds folate receptor alpha, and comprises:
  • VH FR1 comprises the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 29, or has at least 90% sequence identity compared with the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 29 A non-specific amino acid sequence, or an amino acid sequence having one or more substitutions, deletions or insertions compared to the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 29; and
  • VH FR2 comprises the amino acid sequence shown in SEQ ID NO:2 or SEQ ID NO:30, or has at least 90% sequence identity compared with the amino acid sequence shown in SEQ ID NO:2 or SEQ ID NO:30 A non-specific amino acid sequence, or an amino acid sequence having one or more substitutions, deletions or insertions compared to the amino acid sequence shown in SEQ ID NO: 2 or SEQ ID NO: 30; and
  • VH FR3 comprises the amino acid sequence shown in SEQ ID NO:3 or SEQ ID NO:31, or has at least 90% sequence identity compared with the amino acid sequence shown in SEQ ID NO:3 or SEQ ID NO:31 A non-specific amino acid sequence, or an amino acid sequence having one or more substitutions, deletions or insertions compared to the amino acid sequence shown in SEQ ID NO: 3 or SEQ ID NO: 31; and
  • VH FR4 comprises the amino acid sequence shown in SEQ ID NO: 11, or an amino acid sequence having at least 90% sequence identity compared to the amino acid sequence shown in SEQ ID NO: 11, or an amino acid sequence with SEQ ID NO: 11
  • the amino acid sequence shown has one or more site substitutions, deletions or insertions compared to the amino acid sequence; and/or
  • VL FR1 comprises the amino acid sequence shown in SEQ ID NO: 12, or an amino acid sequence having at least 90% sequence identity compared to the amino acid sequence shown in SEQ ID NO: 12, or an amino acid sequence with SEQ ID NO: 12 Amino acid sequences having one or more site substitutions, deletions or insertions compared to the amino acid sequence shown; and
  • VL FR2 comprises the amino acid sequence shown in SEQ ID NO: 13, or an amino acid sequence having at least 90% sequence identity compared with the amino acid sequence shown in SEQ ID NO: 13, or an amino acid sequence with SEQ ID NO: 13 Amino acid sequences having one or more site substitutions, deletions or insertions compared to the amino acid sequence shown; and
  • VL FR3 comprises the amino acid sequence shown in SEQ ID NO:4 or SEQ ID NO:32, or has at least 90% sequence identity compared with the amino acid sequence shown in SEQ ID NO:4 or SEQ ID NO:32 A non-specific amino acid sequence, or an amino acid sequence having one or more substitutions, deletions or insertions compared to the amino acid sequence shown in SEQ ID NO: 4 or SEQ ID NO: 32; and
  • VL FR4 comprises the amino acid sequence shown in SEQ ID NO: 14, or an amino acid sequence having at least 90% sequence identity compared to the amino acid sequence shown in SEQ ID NO: 14, or an amino acid sequence with SEQ ID NO: 14
  • the amino acid sequences shown are compared to amino acid sequences having one or more site substitutions, deletions or insertions.
  • the antibody or its antigen-binding unit comprises VH FR1 as shown in SEQ ID NO:1, VH FR2 as shown in SEQ ID NO:2, VH FR2 as shown in SEQ ID NO:3 VH FR3 and VH FR4 as shown in SEQ ID NO:11.
  • the antibody or its antigen-binding unit comprises VL FR1 as shown in SEQ ID NO: 12, VL FR2 as shown in SEQ ID NO: 13, VL FR2 as shown in SEQ ID NO: 4 VL FR3 and VL FR4 as shown in SEQ ID NO:14.
  • the antibody or its antigen-binding unit comprises VHFR1 as shown in SEQ ID NO:1, VHFR2 as shown in SEQ ID NO:2, VHFR2 as shown in SEQ ID NO:3 VH FR3, VH FR4 as shown in SEQ ID NO:11, VL FR1 as shown in SEQ ID NO:12, VL FR2 as shown in SEQ ID NO:13, VL FR3 as shown in SEQ ID NO:4 and VL FR4 as shown in SEQ ID NO:14.
  • the antibody or its antigen binding unit comprises VHFR1 as shown in SEQ ID NO:29, VHFR2 as shown in SEQ ID NO:30, VHFR2 as shown in SEQ ID NO:31 VH FR3 and VH FR4 as shown in SEQ ID NO: 11.
  • the antibody or its antigen binding unit comprises VL FR1 as shown in SEQ ID NO: 12, VL FR2 as shown in SEQ ID NO: 13, VL FR2 as shown in SEQ ID NO: 32 VL FR3 and VL FR4 as shown in SEQ ID NO:14.
  • the antibody or its antigen binding unit comprises VHFR1 as shown in SEQ ID NO:29, VHFR2 as shown in SEQ ID NO:30, VHFR2 as shown in SEQ ID NO:31 VH FR3, VH FR4 as shown in SEQ ID NO:11, VL FR1 as shown in SEQ ID NO:12, VL FR2 as shown in SEQ ID NO:13, VL FR3 as shown in SEQ ID NO:32 and VL FR4 as shown in SEQ ID NO:14.
  • the present invention provides an antibody or an antigen-binding unit thereof, which specifically binds folate receptor ⁇ , and comprises a heavy chain variable region (VH) and/or or light chain variable region (VL), wherein:
  • the heavy chain variable region comprises an amino acid sequence as shown in SEQ ID NO: 15, or an amino acid sequence having at least 90% sequence identity compared with the amino acid sequence shown in SEQ ID NO: 15, or an amino acid sequence with SEQ ID NO: Compared with the amino acid sequence shown in 15, there is an amino acid sequence with one or more site substitutions, deletions or insertions; and/or
  • the light chain variable region comprises an amino acid sequence as shown in SEQ ID NO: 16, or an amino acid sequence having at least 90% sequence identity compared with the amino acid sequence shown in SEQ ID NO: 16, or an amino acid sequence with SEQ ID NO: Compared with the amino acid sequence shown in 16, there is one or more amino acid sequences with substitution, deletion or insertion.
  • the antibody or antigen binding unit thereof comprises a heavy chain variable region as set forth in SEQ ID NO: 15 and a light chain variable region as set forth in SEQ ID NO: 16.
  • the antibody or antigen-binding unit thereof further comprises a heavy chain constant region, a light chain constant region, an Fc region, or a combination thereof.
  • the light chain constant region is a kappa or lambda chain constant region.
  • the antibody or antigen binding unit thereof is of an isotype of IgG, IgM, IgA, IgE or IgD.
  • the isotype is IgGl, IgG2, IgG3 or IgG4.
  • the antibody or antigen-binding unit thereof is a murine antibody, a chimeric antibody, a humanized antibody, or a fully human antibody.
  • the antibody or antigen binding unit thereof is scFv, Fab, Fab' or F(ab) 2 . In one or more embodiments, the antibody or antigen-binding unit thereof is a monoclonal antibody.
  • the antibody or antigen binding unit thereof comprises a heavy chain constant region (CH) and/or a light chain constant region (CL), wherein:
  • the heavy chain constant region comprises an amino acid sequence as shown in SEQ ID NO: 17, or an amino acid sequence having at least 90% sequence identity compared with the amino acid sequence shown in SEQ ID NO: 17, or an amino acid sequence with SEQ ID NO: Compared with the amino acid sequence shown in 17, the amino acid sequence having one or more site substitutions, deletions or insertions; and/or
  • the light chain constant region comprises an amino acid sequence as shown in SEQ ID NO: 18, or an amino acid sequence having at least 90% sequence identity compared with the amino acid sequence shown in SEQ ID NO: 18, or an amino acid sequence with SEQ ID NO:
  • the amino acid sequence shown in 18 has one or more substitutions, deletions or insertions compared to the amino acid sequence.
  • the antibody or antigen binding unit thereof comprises a heavy chain constant region as set forth in SEQ ID NO: 17 and a light chain constant region as set forth in SEQ ID NO: 18.
  • the invention provides an antibody specifically binding folate receptor ⁇ , the heavy chain of the antibody comprising the heavy chain variable region shown in SEQ ID NO: 15 and the heavy chain variable region shown in SEQ ID NO: The heavy chain constant region shown in 17; the light chain of the antibody comprises the light chain variable region shown in SEQ ID NO: 16 and the light chain constant region shown in SEQ ID NO: 18.
  • the invention provides an antibody that specifically binds folate receptor alpha, and the antibody comprises a heavy chain (H) and a light chain (L), wherein:
  • the heavy chain comprises an amino acid sequence as shown in SEQ ID NO: 19, or an amino acid sequence having at least 90% sequence identity compared with the amino acid sequence shown in SEQ ID NO: 19, or an amino acid sequence with the amino acid sequence shown in SEQ ID NO: 19 Amino acid sequences having one or more site substitutions, deletions or insertions compared to the amino acid sequence shown; and/or
  • the light chain comprises an amino acid sequence as shown in SEQ ID NO: 20, or an amino acid sequence having at least 90% sequence identity compared with the amino acid sequence shown in SEQ ID NO: 20, or an amino acid sequence with the amino acid sequence shown in SEQ ID NO: 20 Amino acid sequences having one or more site substitutions, deletions or insertions compared to the amino acid sequences shown.
  • the antibody comprises a heavy chain set forth in SEQ ID NO: 19 and a light chain set forth in SEQ ID NO: 20.
  • the substitutions are conservative amino acid substitutions.
  • the antibody or antigen binding unit thereof is chimeric, humanized or fully human.
  • the antibody or antigen-binding unit thereof is a monoclonal antibody (including a full-length monoclonal antibody), a multispecific antibody or an antigen-binding unit thereof (e.g., a bispecific antibody or an antigen-binding unit thereof) ).
  • the antibodies have two heavy chains of identical sequence and two light chains of identical sequence.
  • the Fc regions pair to form disulfide bonds.
  • an antibody or antigen-binding unit thereof of the invention is an isolated antibody or antigen-binding unit thereof.
  • an antibody of the invention or an antigen-binding unit thereof, is a monoclonal antibody or fragment thereof.
  • the present invention also provides a biological material for
  • An expression vector comprising a polynucleotide encoding the antibody of the present invention or an antigen-binding unit thereof; or,
  • a cell comprising one or more polynucleotides encoding the antibody of the present invention or an antigen-binding unit thereof.
  • the present invention also provides a pharmaceutical composition comprising the antibody or antigen-binding unit thereof provided in the present invention.
  • a pharmaceutical composition comprising the antibody or antigen-binding unit thereof provided in the present invention.
  • These compositions may be included in kits, such as diagnostic kits.
  • the present invention also provides methods for alleviating or treating symptoms of cancer or other disorders by administering to a patient one or more folate receptor alpha-binding antibodies or antigen-binding units thereof in need thereof.
  • the antibody is administered in a dose sufficient to alleviate or treat the symptoms of cancer or other disorders in the patient.
  • the patient is a human.
  • the anti-FR ⁇ antibodies of the invention are used in combination with one or more other therapies.
  • Suitable additional therapies include drugs, radiotherapy and/or surgical therapies already available for a particular application (eg, cancer).
  • the anti-FR ⁇ antibody is used in combination with one or more other chemotherapeutic or antineoplastic agents.
  • the other chemotherapy is radiation therapy.
  • the chemotherapeutic agent is a cell death inducer.
  • the anti-FR ⁇ antibody and other agent are formulated as a single therapeutic composition and the anti-FR ⁇ antibody and other agent are administered simultaneously.
  • the anti-FR ⁇ antibody and other agent are independent of each other, for example prepared as separate therapeutic compositions, and the anti-FR ⁇ antibody and other agent are administered at the same time, or the anti-FR ⁇ antibody and other agent are administered at different times during the treatment regimen.
  • other reagents for example, the anti-FR ⁇ antibody is administered before the other agent, the anti-FR ⁇ antibody is administered after the other agent, or the anti-FR ⁇ antibody and the other agent are administered on an alternating schedule.
  • the anti-FR ⁇ antibodies and other agents are administered in a single dose or in multiple doses.
  • the present invention also provides an antibody-drug conjugate (ADC), which comprises the antibody or its antigen-binding unit of the present invention coupled to a drug through a linker, or a pharmaceutically acceptable Accepted salts or solvates.
  • ADC antibody-drug conjugate
  • the linker is a cleavable linker.
  • the drug is an anticancer drug, a cytotoxic drug, a cell differentiation factor, a stem cell trophic factor, a steroid drug, a drug for treating an autoimmune disease, an anti-inflammatory drug or a drug for treating an infectious disease .
  • the drug is an anticancer drug.
  • the drug is a tubulin inhibitor, a DNA damaging agent, or a DNA topoisomerase inhibitor.
  • the tubulin inhibitor is selected from dolastatin, auristatin, and maytansine.
  • the drug is auristatin (auristatin), selected from monomethyl auristatin E (monomethyl auristatin E; MMAE), monomethyl auristatin F (monomethyl auristatin F; MMAF) or auristatin (auristatin F; AF).
  • auristatin selected from monomethyl auristatin E (monomethyl auristatin E; MMAE), monomethyl auristatin F (monomethyl auristatin F; MMAF) or auristatin (auristatin F; AF).
  • the drug is a DNA damaging agent, such as calicheamicins, duocarmycins, antramycin derivatives PBD (pyrrolobenzodiazepine, pyrrolobenzodiazepine and diazepines).
  • a DNA damaging agent such as calicheamicins, duocarmycins, antramycin derivatives PBD (pyrrolobenzodiazepine, pyrrolobenzodiazepine and diazepines).
  • the drug is a DNA topoisomerase inhibitor or a salt thereof, such as irinotecan, irinotecan hydrochloride, exinotecan derivatives, camptothecin, 9-amino Camptothecin, 9-nitrocamptothecin, 10-hydroxycamptothecin, 9-chloro-10-hydroxycamptothecin, camptothecin derivatives SN-38, 22-hydroxycamptothecin, topose Kang, Letotecan, Belotecan, Exitecan, Homosilatecan, 6,8-Dibromo-2-methyl-3-[2-(D-xylopyranosyl Amino)phenyl]-4(3H)-quinazolinone, 2-cyano-3-(3,4-dihydroxyphenyl)-N-(phenylmethyl)-(2E)-2-propene Amide, 2-cyano-3-(3,4-dihydroxyphenyl)-N-(3E)-2-propen
  • the DNA topoisomerase inhibitor is camptothecin, 10-hydroxycamptothecin, topotecan, belotecan, irinotecan, 22-hydroxycamptothecin Or Exitecan.
  • the drug has an amino group or an amino group substituted by an alkyl group, which is connected to the linker through an amide bond.
  • the drug is or its stereoisomers, wherein
  • X 1 and X 2 are each independently:
  • amino amino substituted by an amino protecting group
  • C1-C6 aminoalkyl optionally substituted by an amino protecting group or C1-C6 alkyl at the amino portion
  • C1-C6 alkyl connected to a heterocycle optionally substituted by one or more C1-C6 alkyl, C1-C6 alkoxy, amino, halogen, nitro or cyano,
  • An amino-substituted heterocyclic group which is optionally substituted by a protecting group or one or more C1-C6 alkyl groups at the nitrogen atom of the heterocyclic part or the amino part,
  • Heterocyclic amino which is optionally substituted by a protecting group or a C1-C6 alkyl group at the nitrogen atom of the heterocyclic part or the amino part,
  • a carbamoyl group optionally substituted by a carbamoyl protecting group or a C1-C6 alkyl group,
  • X 3 is C1-C6 alkyl
  • X 4 is H, -(CH 2 ) q -CH 3 , -(CHR n ) q -CH 3 , C3-C8 carbocyclyl, -O-(CH 2 ) q -CH 3 , arylene group -CH 3 , -(CH 2 ) q -arylene-CH 3 , -arylene-(CH 2 ) q -CH 3 , -(CH 2 ) q -(C3-C8 carbocyclyl)-CH 3 , -( C3-C8 carbocyclyl)-(CH 2 ) q -CH 3 , C3-C8 heterocyclyl, -(CH 2 ) q -(C3-C8 heterocyclyl)-CH 3 , -(C3-C8 heterocyclyl base)-(CH 2 ) q -CH 3 , -(CH 2 ) q C(O)NR n (CH 2 )
  • y 0, 1 or 2;
  • Y is O, S or CR 1 R 2 , wherein R 1 and R 2 are each independently H or C1-C6 alkyl;
  • s and t are each independently 0, 1 or 2, but not 0 at the same time.
  • X 4 is H or C1-C6 alkyl.
  • the heterocycle is azetidine, niverazine, morpholine, pyrrolidine, piperidine, imidazole, thiazole, oxazole, or pyridine.
  • the amino protecting group is formyl, acetyl, trityl, tert-butoxycarbonyl, benzyl or p-methoxybenzyloxycarbonyl.
  • the drug is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N
  • X 1 and X 2 are each independently C1-C6 alkyl, halogen or -OH; ** is connected to the linker.
  • the drug is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N
  • X 1 and X 2 are each independently C1-C6 alkyl, halogen or -OH; ** is connected to the linker.
  • X 1 and X 2 are each —CH 3 .
  • X and X are each independently F, Cl, Br or I.
  • X and X are each F.
  • X 1 and X 2 are each independently —CH 3 , F, or —OH.
  • X 1 and X 2 are each independently F or —CH 3 .
  • X 1 is —CH 3 and X 2 is F.
  • the antibody drug conjugate provided by the present invention has the structure shown in formula I, or a stereoisomer, or a pharmaceutically acceptable salt or solvate thereof:
  • Abu is an antibody or its antigen-binding unit; the antibody or its antigen-binding unit specifically binds folate receptor ⁇ ; D is a drug;
  • R is selected from: -(CH 2 ) r -, -(CHR m ) r -, C3-C8 carbocyclyl, -O-(CH 2 ) r -, arylene , -(CH 2 ) r -arylene-, -arylene-(CH 2 )r-, -(CH 2 ) r -(C3-C8 carbocyclyl)-, -(C3-C8 carbocyclyl )-(CH 2 ) r -, C3-C8 heterocyclyl, -(CH 2 ) r -(C3-C8 heterocyclyl)-, -(C3-C8 heterocyclyl)-(CH 2 ) r -, -(CH 2 ) r C(O)NR m (CH 2 ) r -, -(CH 2 CH 2 O) r -, -
  • L is -(AA) i -(FF) f -, wherein, AA is an amino acid or a polypeptide, and i is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20; each FF is independently Wherein each R F is independently C1-C6 alkyl, C1-C6 alkoxy, -NO 2 or halogen; z is 0, 1, 2, 3 or 4; f is 1, 2, 3, 4, 5, 6 , 7, 8, 9 or 10; where * connects to AA, ** connects to D;
  • n is an integer of 1-24, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 or 24;
  • p is an integer of 1-10, eg 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.
  • the drugs are anticancer drugs, cytotoxic drugs, cell differentiation factors, stem cell trophic factors, steroid drugs, drugs for treating autoimmune diseases, anti-inflammatory drugs or drugs for treating infectious diseases.
  • the drug is an anticancer drug.
  • the drug is a tubulin inhibitor, a DNA damaging agent, or a DNA topoisomerase inhibitor.
  • the tubulin inhibitor is selected from dolastatins, auristatins, and maytansines.
  • the drug is an auristatin such as MMAE, MMAF or AF.
  • the drug is a DNA damaging agent, such as calicheamicins, duocarmycins, antramycin derivatives PBD (pyrrolobenzodiazepine, pyrrolobenzodiazepine, aza).
  • a DNA damaging agent such as calicheamicins, duocarmycins, antramycin derivatives PBD (pyrrolobenzodiazepine, pyrrolobenzodiazepine, aza).
  • the drug is a DNA topoisomerase inhibitor or a salt thereof, such as irinotecan, irinotecan hydrochloride, camptothecin, 9-aminocamptothecin, 9-nitrocamptothecin Camptothecin, 10-hydroxycamptothecin, 9-chloro-10-hydroxycamptothecin, camptothecin derivatives SN-38, 22-hydroxycamptothecin, topotecan, letotecan, belo Tecan, Exitecan, Exitecan Derivatives, Homosilatecan, 6,8-Dibromo-2-methyl-3-[2-(D-xylopyranosylamino) Phenyl]-4(3H)-quinazolinone, 2-cyano-3-(3,4-dihydroxyphenyl)-N-(phenylmethyl)-(2E)-2-acrylamide, 2-cyano-3-(3,4-dihydroxyphenyl)-
  • the DNA topoisomerase inhibitor is camptothecin, 10-hydroxycamptothecin, topotecan, belotecan, irinotecan, 22-hydroxycamptothecin Or Exitecan.
  • the drug is Tubulysins, taxane drug derivatives, leptomycine derivatives, CC-1065 and its analogs, Amatoxins, splice body inhibitors, benzo (and) diazepines (PBD ) dimers, doxorubicin, methotrexate, vincristine, vinblastine, daunorubicin, mitomycin C, melphalan or chlorambucil derivatives.
  • PBD diazepines
  • the drug has an amino group or an amino group substituted with an alkyl group, which is linked to FF through an amide bond.
  • the drug is in one or more embodiments.
  • X 1 and X 2 are each independently:
  • amino amino substituted by an amino protecting group
  • C1-C6 aminoalkyl optionally substituted by an amino protecting group or C1-C6 alkyl at the amino portion
  • C1-C6 alkyl connected to a heterocycle optionally substituted by one or more C1-C6 alkyl, C1-C6 alkoxy, amino, halogen, nitro or cyano,
  • An amino-substituted heterocyclic group which is optionally substituted by a protecting group or one or more C1-C6 alkyl groups at the nitrogen atom of the heterocyclic part or the amino part,
  • Heterocyclic amino which is optionally substituted by a protecting group or a C1-C6 alkyl group at the nitrogen atom of the heterocyclic part or the amino part,
  • a carbamoyl group optionally substituted by a carbamoyl protecting group or a C1-C6 alkyl group,
  • X 3 is C1-C6 alkyl
  • X 4 is H, -(CH 2 ) q -CH 3 , -(CHR n ) q -CH 3 , C3-C8 carbocyclyl, -O-(CH 2 ) q -CH 3 , arylene group -CH 3 , -(CH 2 ) q -arylene-CH 3 , -arylene-(CH 2 ) q -CH 3 , -(CH 2 ) q -(C3-C8 carbocyclyl)-CH 3 , -( C3-C8 carbocyclyl)-(CH 2 ) q -CH 3 , C3-C8 heterocyclyl, -(CH 2 ) q -(C3-C8 heterocyclyl)-CH 3 , -(C3-C8 heterocyclyl base)-(CH 2 ) q -CH 3 , -(CH 2 ) q C(O)NR n (CH 2 )
  • y 0, 1 or 2;
  • Y is O, S or CR 1 R 2 , wherein R 1 and R 2 are each independently H or C1-C6 alkyl;
  • s and t are each independently 0, 1 or 2, but not 0 at the same time.
  • X 4 is H or C1-C6 alkyl.
  • the heterocycle is azetidine, niverazine, morpholine, pyrrolidine, piperidine, imidazole, thiazole, oxazole, or pyridine.
  • the amino protecting group is formyl, acetyl, trityl, tert-butoxycarbonyl, benzyl or p-methoxybenzyloxycarbonyl.
  • the drug is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N
  • X 1 and X 2 are each independently C1-C6 alkyl, halogen or -OH; ** is connected to L.
  • the drug is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N
  • X 1 and X 2 are each independently C1-C6 alkyl, halogen or -OH; ** is connected to L.
  • X 1 and X 2 are each —CH 3 .
  • X and X are each independently F, Cl, Br or I.
  • X and X are each F.
  • X 1 and X 2 are each independently —CH 3 , F, or —OH.
  • X 1 and X 2 are each independently F or —CH 3 .
  • X 1 is —CH 3 and X 2 is F.
  • R is -(CH 2 ) r -.
  • R is -(CH 2 ) r -, and r is 1 or 5.
  • each AA is independently selected from the following amino acid or peptide sequences: Val-Cit, Val-Lys, Phe-Lys, Lys-Lys, Ala-Lys, Phe-Cit, Leu-Cit, Ile -Cit, Trp, Cit, Phe-Ala, Phe-Phe-Lys, D-Phe-Phe-Lys, Gly-Phe-Lys, Leu-Ala-Leu, Ile-Ala-Leu, Val-Ala-Val, Ala - Leu-Ala-Leu, ⁇ -Ala-Leu-Ala-Leu and Gly-Phe-Leu-Gly.
  • AA is Val-Cit and i is 1.
  • each FF is independently Wherein each R F is independently C1-C6 alkyl, C1-C6 alkoxy, -NO 2 or halogen; wherein * is connected to AA, ** is connected to D.
  • halo is F and z is 0, 1, 2, 3 or 4.
  • R F is -CH 3 , F, -NO 2 or -OCH 3 .
  • z is 0.
  • z is 1 or 2.
  • each FF is independently Among them, * is connected to AA, and ** is connected to D.
  • f is 1.
  • FF is f is 1; where * connects to AA, ** connects to D.
  • L is Where * connects to B, ** connects to D.
  • L is Where * connects to B, ** connects to D.
  • G is n is 4-12.
  • n is 4-8.
  • n 4.
  • n 8.
  • p is 2-8.
  • p is 4-8.
  • p is 6-8.
  • p is 7-8.
  • p is 7.
  • p 7.4.
  • p is 8.
  • the Abu is an antibody or an antigen-binding unit thereof provided by the present invention.
  • the antibody drug conjugate has the structure shown in formula I-1 or its stereoisomer or pharmaceutically acceptable salt or solvate:
  • Abu is an antibody or an antigen-binding unit thereof provided by the present invention.
  • R is selected from: -(CH 2 ) r -, -(CHR m )r-, C3-C8 carbocyclyl, -O-(CH 2 ) r -, arylene, -(CH 2 ) r -arylene Base-, -arylene-(CH 2 )r-, -(CH 2 ) r -(C3-C8 carbocyclyl)-, -(C3-C8 carbocyclyl)-(CH 2 ) r -, C3 -C8 heterocyclyl, -(CH 2 ) r -(C3-C8 heterocyclyl)-, -(C3-C8 heterocyclyl)-(CH 2 ) r -, -(CH 2 ) r C(O) NR m (CH 2 ) r -, -(CH 2 CH 2 O) r -, -(CH 2 CH 2 O) r -CH 2 -
  • D is a drug
  • n is an integer of 1-24, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23 or 24;
  • p is 1-10, eg 1, 2, 3, 4, 5, 6, 7, 7.4, 8, 9 or 10.
  • the drugs are anticancer drugs, cytotoxic drugs, cell differentiation factors, stem cell trophic factors, steroid drugs, drugs for treating autoimmune diseases, anti-inflammatory drugs or drugs for treating infectious diseases.
  • the drug is a tubulin inhibitor, a DNA damaging agent, or a DNA topoisomerase inhibitor.
  • the tubulin inhibitor is selected from dolastatin, auristatins and maytansines.
  • the drug is an auristatin such as MMAE, MMAF or AF.
  • the drug is a DNA damaging agent, such as calicheamicins, duocarmycins, antramycin derivatives PBD (pyrrolobenzodiazepine, pyrrolobenzodiazepine, aza).
  • a DNA damaging agent such as calicheamicins, duocarmycins, antramycin derivatives PBD (pyrrolobenzodiazepine, pyrrolobenzodiazepine, aza).
  • the drug is a DNA topoisomerase inhibitor or a salt thereof, such as irinotecan, irinotecan hydrochloride, camptothecin, 9-aminocamptothecin, 9-nitrocamptothecin Camptothecin, 10-hydroxycamptothecin, 9-chloro-10-hydroxycamptothecin, camptothecin derivatives SN-38, 22-hydroxycamptothecin, topotecan, letotecan, belo Tecan, Exitecan, Homosilatecan, 6,8-Dibromo-2-methyl-3-[2-(D-xylopyranosylamino)phenyl]-4(3H )-quinazolone, 2-cyano-3-(3,4-dihydroxyphenyl)-N-(phenylmethyl)-(2E)-2-acrylamide, 2-cyano-3- (3,4-dihydroxyphenyl)-N-(3-hydroxyphenylprop
  • the DNA topoisomerase inhibitor is camptothecin, 10-hydroxycamptothecin, topotecan, belotecan, irinotecan, 22-hydroxycamptothecin Or Exitecan.
  • the drug is Tubulysins, taxane drug derivatives, leptomycine derivatives, CC-1065 and its analogs, Amatoxins, splice body inhibitors, benzo (and) diazepines (PBD ) dimers, doxorubicin, methotrexate, vincristine, vinblastine, daunorubicin, mitomycin C, melphalan, or chlorambucil derivatives.
  • PBD diazepines
  • the drug is in one or more embodiments.
  • X 1 and X 2 are each independently:
  • amino amino substituted by an amino protecting group
  • C1-C6 aminoalkyl optionally substituted by an amino protecting group or C1-C6 alkyl at the amino portion
  • C1-C6 alkyl connected to a heterocycle optionally substituted by one or more C1-C6 alkyl, C1-C6 alkoxy, amino, halogen, nitro or cyano,
  • An amino-substituted heterocyclic group which is optionally substituted by a protecting group or one or more C1-C6 alkyl groups at the nitrogen atom of the heterocyclic part or the amino part,
  • Heterocyclic amino which is optionally substituted by a protecting group or a C1-C6 alkyl group at the nitrogen atom of the heterocyclic part or the amino part,
  • a carbamoyl group optionally substituted by a carbamoyl protecting group or a C1-C6 alkyl group,
  • X 3 is C1-C6 alkyl
  • X 4 is H, -(CH 2 ) q -CH 3 , -(CHR n ) q -CH 3 , C3-C8 carbocyclyl, -O-(CH 2 ) q -CH 3 , arylene group -CH 3 , -(CH 2 ) q -arylene-CH 3 , -arylene-(CH 2 ) q -CH 3 , -(CH 2 ) q -(C3-C8 carbocyclyl)-CH 3 , -( C3-C8 carbocyclyl)-(CH 2 ) q -CH 3 , C3-C8 heterocyclyl, -(CH 2 ) q -(C3-C8 heterocyclyl)-CH 3 , -(C3-C8 heterocyclyl base)-(CH 2 ) q -CH 3 , -(CH 2 ) q C(O)NR n (CH 2 )
  • y 0, 1 or 2;
  • Y is O, S or CR 1 R 2 , wherein R 1 and R 2 are each independently H or C1-C6 alkyl;
  • s and t are each independently 0, 1 or 2, but not 0 at the same time.
  • X 4 is H or C1-C6 alkyl.
  • the heterocycle is azetidine, acetalzine, morpholine, pyrrolidine, piperidine, imidazole, thiazole, oxazole or pyridine.
  • the amino protecting group is formyl, acetyl, trityl, tert-butoxycarbonyl, benzyl or p-methoxybenzyloxycarbonyl.
  • the drug is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N
  • X 1 and X 2 are each independently C1-C6 alkyl, halogen or -OH; ** is connected to other parts of the antibody drug conjugate.
  • the drug is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N
  • X 1 and X 2 are each independently C1-C6 alkyl, halogen or -OH; ** is connected to other parts of the antibody drug conjugate.
  • X 1 and X 2 are each —CH 3 .
  • X and X are each independently F, Cl, Br or I.
  • X and X are each F.
  • X 1 and X 2 are each independently —CH 3 , F, or —OH.
  • X 1 and X 2 are each independently F or —CH 3 .
  • X 1 is —CH 3 and X 2 is F.
  • R is -(CH 2 ) r -.
  • R is -(CH 2 ) r -, and r is 1 or 5.
  • n is 4-12.
  • n is 4-8.
  • n 4.
  • n 8.
  • p is 2-8.
  • p is 4-8.
  • p is 6-8.
  • p is 7-8.
  • p is 7.
  • p 7.4.
  • p is 8.
  • the antibody drug conjugate has the structure shown in formula I-2 or I-2-1 or its stereoisomer or pharmaceutically acceptable salt or solvate:
  • Abu is an antibody or an antigen-binding unit thereof provided by the present invention.
  • R is selected from: -(CH 2 ) r -, -(CHR m )r-, C3-C8 carbocyclyl, -O-(CH 2 ) r -, arylene, -(CH 2 ) r -arylene Base-, -arylene-(CH 2 )r-, -(CH 2 ) r -(C3-C8 carbocyclyl)-, -(C3-C8 carbocyclyl)-(CH 2 ) r -, C3 -C8 heterocyclyl, -(CH 2 ) r -(C3-C8 heterocyclyl)-, -(C3-C8 heterocyclyl)-(CH 2 ) r -, -(CH 2 ) r C(O) NR m (CH 2 ) r -, -(CH 2 CH 2 O) r -, -(CH 2 CH 2 O) r -CH 2 -
  • D is a drug
  • n is an integer of 1-24, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23 or 24;
  • p is 1-10, eg 1, 2, 3, 4, 5, 6, 7, 7.4, 8, 9 or 10.
  • the drugs are anticancer drugs, cytotoxic drugs, cell differentiation factors, stem cell trophic factors, steroid drugs, drugs for treating autoimmune diseases, anti-inflammatory drugs or drugs for treating infectious diseases.
  • the drug is a tubulin inhibitor, a DNA damaging agent, or a DNA topoisomerase inhibitor.
  • the tubulin inhibitor is selected from dolastatins, auristatins, and maytansines.
  • the drug is an auristatin such as MMAE, MMAF or AF.
  • the drug is a DNA damaging agent, such as calicheamicins, duocarmycins, antramycin derivatives PBD (pyrrolobenzodiazepine, pyrrolobenzodiazepine, aza).
  • a DNA damaging agent such as calicheamicins, duocarmycins, antramycin derivatives PBD (pyrrolobenzodiazepine, pyrrolobenzodiazepine, aza).
  • the drug is a DNA topoisomerase inhibitor or a salt thereof, such as irinotecan, irinotecan hydrochloride, camptothecin, 9-aminocamptothecin, 9-nitrocamptothecin Camptothecin, 10-hydroxycamptothecin, 9-chloro-10-hydroxycamptothecin, camptothecin derivatives SN-38, 22-hydroxycamptothecin, topotecan, letotecan, belo Tecan, Exitecan, Homosilatecan, 6,8-Dibromo-2-methyl-3-[2-(D-xylopyranosylamino)phenyl]-4(3H )-quinazolone, 2-cyano-3-(3,4-dihydroxyphenyl)-N-(phenylmethyl)-(2E)-2-acrylamide, 2-cyano-3- (3,4-dihydroxyphenyl)-N-(3-hydroxyphenylprop
  • the DNA topoisomerase inhibitor is camptothecin, 10-hydroxycamptothecin, topotecan, belotecan, irinotecan, 22-hydroxycamptothecin Or Exitecan.
  • the drug is Tubulysins, taxane drug derivatives, leptomycine derivatives, CC-1065 and its analogs, Amatoxins, splice body inhibitors, benzo (and) diazepines (PBD ) dimers, doxorubicin, methotrexate, vincristine, vinblastine, daunorubicin, mitomycin C, melphalan, or chlorambucil derivatives.
  • PBD diazepines
  • the drug is in one or more embodiments.
  • X 1 and X 2 are each independently:
  • amino amino substituted by an amino protecting group
  • C1-C6 aminoalkyl optionally substituted by an amino protecting group or C1-C6 alkyl at the amino portion
  • C1-C6 alkyl connected to a heterocycle optionally substituted by one or more C1-C6 alkyl, C1-C6 alkoxy, amino, halogen, nitro or cyano,
  • An amino-substituted heterocyclic group which is optionally substituted by a protecting group or one or more C1-C6 alkyl groups at the nitrogen atom of the heterocyclic part or the amino part,
  • Heterocyclic amino which is optionally substituted by a protecting group or a C1-C6 alkyl group at the nitrogen atom of the heterocyclic part or the amino part,
  • a carbamoyl group optionally substituted by a carbamoyl protecting group or a C1-C6 alkyl group,
  • X 3 is C1-C6 alkyl
  • X 4 is H, -(CH 2 ) q -CH 3 , -(CHR n ) q -CH 3 , C3-C8 carbocyclyl, -O-(CH 2 ) q -CH 3 , arylene group -CH 3 , -(CH 2 ) q -arylene-CH 3 , -arylene-(CH 2 ) q -CH 3 , -(CH 2 ) q -(C3-C8 carbocyclyl)-CH 3 , -( C3-C8 carbocyclyl)-(CH 2 ) q -CH 3 , C3-C8 heterocyclyl, -(CH 2 ) q -(C3-C8 heterocyclyl)-CH 3 , -(C3-C8 heterocyclyl base)-(CH 2 ) q -CH 3 , -(CH 2 ) q C(O)NR n (CH 2 )
  • y 0, 1 or 2;
  • Y is O, S or CR 1 R 2 , wherein R 1 and R 2 are each independently H or C1-C6 alkyl;
  • s and t are each independently 0, 1 or 2, but not 0 at the same time.
  • X 4 is H or C1-C6 alkyl.
  • the heterocycle is azetidine, acetalzine, morpholine, pyrrolidine, piperidine, imidazole, thiazole, oxazole or pyridine.
  • the amino protecting group is formyl, acetyl, trityl, tert-butoxycarbonyl, benzyl or p-methoxybenzyloxycarbonyl.
  • the drug is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N
  • X 1 and X 2 are each independently C1-C6 alkyl, halogen or -OH; ** is connected to other parts of the antibody drug conjugate.
  • the drug is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N
  • X 1 and X 2 are each independently C1-C6 alkyl, halogen or -OH; ** is connected to other parts of the antibody drug conjugate.
  • X 1 and X 2 are each —CH 3 .
  • X and X are each independently F, Cl, Br or I.
  • X and X are each F.
  • X 1 and X 2 are each independently —CH 3 , F, or —OH.
  • X 1 and X 2 are each independently F or —CH 3 .
  • X 1 is —CH 3 and X 2 is F.
  • R is -(CH 2 ) r -.
  • R is -(CH 2 ) r -, and r is 1 or 5.
  • n is 4-12.
  • n is 4-8.
  • n 4.
  • n 8.
  • p is 2-8.
  • p is 4-8.
  • p is 6-8.
  • p is 7-8.
  • p is 7.
  • p 7.4.
  • p is 8.
  • the antibody drug conjugate has the structure shown in formula I-3 or its stereoisomer or pharmaceutically acceptable salt or solvate:
  • Abu is an antibody or an antigen-binding unit thereof provided by the present invention.
  • D is a drug
  • n is an integer of 1-24, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23 or 24;
  • p is 1-10, eg 1, 2, 3, 4, 5, 6, 7, 7.4, 8, 9 or 10.
  • the drugs are anticancer drugs, cytotoxic drugs, cell differentiation factors, stem cell trophic factors, steroid drugs, drugs for treating autoimmune diseases, anti-inflammatory drugs or drugs for treating infectious diseases.
  • the drug is a tubulin inhibitor, a DNA damaging agent, or a DNA topoisomerase inhibitor.
  • the tubulin inhibitor is selected from dolastatin, auristatins and maytansines.
  • the drug is an auristatin such as MMAE, MMAF or AF.
  • the drug is a DNA damaging agent, such as calicheamicins, duocarmycins, antramycin derivatives PBD (pyrrolobenzodiazepine, pyrrolobenzodiazepine, aza).
  • a DNA damaging agent such as calicheamicins, duocarmycins, antramycin derivatives PBD (pyrrolobenzodiazepine, pyrrolobenzodiazepine, aza).
  • the drug is a DNA topoisomerase inhibitor or a salt thereof, such as irinotecan, irinotecan hydrochloride, camptothecin, 9-aminocamptothecin, 9-nitrocamptothecin Camptothecin, 10-hydroxycamptothecin, 9-chloro-10-hydroxycamptothecin, camptothecin derivatives SN-38, 22-hydroxycamptothecin, topotecan, letotecan, belo Tecan, Exitecan, Homosilatecan, 6,8-Dibromo-2-methyl-3-[2-(D-xylopyranosylamino)phenyl]-4(3H )-quinazolone, 2-cyano-3-(3,4-dihydroxyphenyl)-N-(phenylmethyl)-(2E)-2-acrylamide, 2-cyano-3- (3,4-dihydroxyphenyl)-N-(3-hydroxyphenylprop
  • the DNA topoisomerase inhibitor is camptothecin, 10-hydroxycamptothecin, topotecan, belotecan, irinotecan, 22-hydroxycamptothecin Or Exitecan.
  • the drug is Tubulysins, taxane drug derivatives, leptomycine derivatives, CC-1065 and its analogs, Amatoxins, splice body inhibitors, benzo (and) diazepines (PBD ) dimers, doxorubicin, methotrexate, vincristine, vinblastine, daunorubicin, mitomycin C, melphalan, or chlorambucil derivatives.
  • PBD diazepines
  • the drug is in one or more embodiments.
  • X 1 and X 2 are each independently:
  • amino amino substituted by an amino protecting group
  • C1-C6 aminoalkyl optionally substituted by an amino protecting group or C1-C6 alkyl at the amino portion
  • C1-C6 alkyl connected to a heterocycle optionally substituted by one or more C1-C6 alkyl, C1-C6 alkoxy, amino, halogen, nitro or cyano,
  • An amino-substituted heterocyclic group which is optionally substituted by a protecting group or one or more C1-C6 alkyl groups at the nitrogen atom of the heterocyclic part or the amino part,
  • Heterocyclic amino which is optionally substituted by a protecting group or a C1-C6 alkyl group at the nitrogen atom of the heterocyclic part or the amino part,
  • a carbamoyl group optionally substituted by a carbamoyl protecting group or a C1-C6 alkyl group,
  • X 3 is C1-C6 alkyl
  • X 4 is H, -(CH 2 ) q -CH 3 , -(CHR n ) q -CH 3 , C3-C8 carbocyclyl, -O-(CH 2 ) q -CH 3 , arylene group -CH 3 , -(CH 2 ) q -arylene-CH 3 , -arylene-(CH 2 ) q -CH 3 , -(CH 2 ) q -(C3-C8 carbocyclyl)-CH 3 , -( C3-C8 carbocyclyl)-(CH 2 ) q -CH 3 , C3-C8 heterocyclyl, -(CH 2 ) q -(C3-C8 heterocyclyl)-CH 3 , -(C3-C8 heterocyclyl base)-(CH 2 ) q -CH 3 , -(CH 2 ) q C(O)NR n (CH 2 )
  • y 0, 1 or 2;
  • Y is O, S or CR 1 R 2 , wherein R 1 and R 2 are each independently H or C1-C6 alkyl;
  • s and t are each independently 0, 1 or 2, but not 0 at the same time.
  • X 4 is H or C1-C6 alkyl.
  • the heterocycle is azetidine, acetalzine, morpholine, pyrrolidine, piperidine, imidazole, thiazole, oxazole or pyridine.
  • the amino protecting group is formyl, acetyl, trityl, tert-butoxycarbonyl, benzyl or p-methoxybenzyloxycarbonyl.
  • the drug is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N
  • X 1 and X 2 are each independently C1-C6 alkyl, halogen or -OH; ** is connected to other parts of the antibody drug conjugate.
  • the drug is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N
  • X 1 and X 2 are each independently C1-C6 alkyl, halogen or -OH; ** is connected to other parts of the antibody drug conjugate.
  • X 1 and X 2 are each —CH 3 .
  • X and X are each independently F, Cl, Br or I.
  • X and X are each F.
  • X 1 and X 2 are each independently —CH 3 , F, or —OH.
  • X 1 and X 2 are each independently F or —CH 3 .
  • X 1 is —CH 3 and X 2 is F.
  • n is 4-12.
  • n is 4-8.
  • n 4.
  • n 8.
  • p is 2-8.
  • p is 4-8.
  • p is 6-8.
  • p is 7-8.
  • p is 7.
  • p 7.4.
  • p is 8.
  • the antibody drug conjugate has the structure shown in formula I-4 or I-4-1 or its stereoisomer or pharmaceutically acceptable salt or solvate:
  • Abu is an antibody or an antigen-binding unit thereof provided by the present invention.
  • D is a drug
  • n is an integer of 1-24, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23 or 24;
  • p is 1-10, eg 1, 2, 3, 4, 5, 6, 7, 7.4, 8, 9 or 10.
  • the drugs are anticancer drugs, cytotoxic drugs, cell differentiation factors, stem cell trophic factors, steroid drugs, drugs for treating autoimmune diseases, anti-inflammatory drugs or drugs for treating infectious diseases.
  • the drug is a tubulin inhibitor, a DNA damaging agent, or a DNA topoisomerase inhibitor.
  • the tubulin inhibitor is selected from dolastatins, auristatins, and maytansines.
  • the drug is an auristatin such as MMAE, MMAF or AF.
  • the drug is a DNA damaging agent, such as calicheamicins, duocarmycins, antramycin derivatives PBD (pyrrolobenzodiazepine, pyrrolobenzodiazepine, Aza), DNA topoisomerase inhibitors.
  • a DNA damaging agent such as calicheamicins, duocarmycins, antramycin derivatives PBD (pyrrolobenzodiazepine, pyrrolobenzodiazepine, Aza), DNA topoisomerase inhibitors.
  • the drug is a DNA topoisomerase inhibitor or a salt thereof, such as irinotecan, irinotecan hydrochloride, camptothecin, 9-aminocamptothecin, 9-nitrocamptothecin Camptothecin, 10-hydroxycamptothecin, 9-chloro-10-hydroxycamptothecin, camptothecin derivatives SN-38, 22-hydroxycamptothecin, topotecan, letotecan, belo Tecan, Exitecan, Homosilatecan, 6,8-Dibromo-2-methyl-3-[2-(D-xylopyranosylamino)phenyl]-4(3H )-quinazolone, 2-cyano-3-(3,4-dihydroxyphenyl)-N-(phenylmethyl)-(2E)-2-acrylamide, 2-cyano-3- (3,4-dihydroxyphenyl)-N-(3-hydroxyphenylprop
  • the DNA topoisomerase inhibitor is camptothecin, 10-hydroxycamptothecin, topotecan, belotecan, irinotecan, 22-hydroxycamptothecin Or Exitecan.
  • the drug is Tubulysins, taxane drug derivatives, leptomycine derivatives, CC-1065 and its analogs, Amatoxins, splice body inhibitors, benzo (and) diazepines (PBD ) dimers, doxorubicin, methotrexate, vincristine, vinblastine, daunorubicin, mitomycin C, melphalan, or chlorambucil derivatives.
  • PBD diazepines
  • the drug is in one or more embodiments.
  • X 1 and X 2 are each independently:
  • amino amino substituted by an amino protecting group
  • C1-C6 aminoalkyl optionally substituted by an amino protecting group or C1-C6 alkyl at the amino portion
  • C1-C6 alkyl connected to a heterocycle optionally substituted by one or more C1-C6 alkyl, C1-C6 alkoxy, amino, halogen, nitro or cyano,
  • An amino-substituted heterocyclic group which is optionally substituted by a protecting group or one or more C1-C6 alkyl groups at the nitrogen atom of the heterocyclic part or the amino part,
  • Heterocyclic amino which is optionally substituted by a protecting group or a C1-C6 alkyl group at the nitrogen atom of the heterocyclic part or the amino part,
  • a carbamoyl group optionally substituted by a carbamoyl protecting group or a C1-C6 alkyl group,
  • X 3 is C1-C6 alkyl
  • X 4 is H, -(CH 2 ) q -CH 3 , -(CHR n ) q -CH 3 , C3-C8 carbocyclyl, -O-(CH 2 ) q -CH 3 , arylene group -CH 3 , -(CH 2 ) q -arylene-CH 3 , -arylene-(CH 2 ) q -CH 3 , -(CH 2 ) q -(C3-C8 carbocyclyl)-CH 3 , -( C3-C8 carbocyclyl)-(CH 2 ) q -CH 3 , C3-C8 heterocyclyl, -(CH 2 ) q -(C3-C8 heterocyclyl)-CH 3 , -(C3-C8 heterocyclyl base)-(CH 2 ) q -CH 3 , -(CH 2 ) q C(O)NR n (CH 2 )
  • y 0, 1 or 2;
  • Y is O, S or CR 1 R 2 , wherein R 1 and R 2 are each independently H or C1-C6 alkyl;
  • s and t are each independently 0, 1 or 2, but not 0 at the same time.
  • X 4 is H or C1-C6 alkyl.
  • the heterocycle is azetidine, acetalzine, morpholine, pyrrolidine, piperidine, imidazole, thiazole, oxazole or pyridine.
  • the amino protecting group is formyl, acetyl, trityl, tert-butoxycarbonyl, benzyl or p-methoxybenzyloxycarbonyl.
  • the drug is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N
  • X 1 and X 2 are each independently C1-C6 alkyl, halogen or -OH; ** is connected to other parts of the antibody drug conjugate.
  • the drug is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N
  • X 1 and X 2 are each independently C1-C6 alkyl, halogen or -OH; ** is connected to other parts of the antibody drug conjugate.
  • X 1 and X 2 are each independently —CH 3 , F, Cl, Br, or I.
  • X and X are each F.
  • X 1 and X 2 are each independently —CH 3 , F, or —OH.
  • X 1 and X 2 are each —CH 3 .
  • X 1 and X 2 are each independently F or —CH 3 .
  • X 1 is —CH 3 and X 2 is F.
  • n is 4-12.
  • n is 4-8.
  • n 4.
  • n 8.
  • p is 2-8.
  • p is 4-8.
  • p is 6-8.
  • p is 7-8.
  • p is 7.
  • p 7.4.
  • p is 8.
  • the antibody drug conjugate has the formula I-5, I-5-1, I-6, I-6-1, I-7, I-7-1, I- 8.
  • Abu is an antibody or an antigen-binding unit thereof provided by the present invention.
  • D is a drug
  • p is 1-10, eg 1, 2, 3, 4, 5, 6, 7, 7.4, 8, 9 or 10.
  • the drugs are anticancer drugs, cytotoxic drugs, cell differentiation factors, stem cell trophic factors, steroid drugs, drugs for treating autoimmune diseases, anti-inflammatory drugs or drugs for treating infectious diseases.
  • the drug is a tubulin inhibitor, a DNA damaging agent, or a DNA topoisomerase inhibitor.
  • the tubulin inhibitor is selected from dolastatins, auristatins, and maytansines.
  • the drug is an auristatin such as MMAE, MMAF or AF.
  • the drug is a DNA damaging agent, such as calicheamicins, duocarmycins, antramycin derivatives PBD (pyrrolobenzodiazepine, pyrrolobenzodiazepine, aza).
  • a DNA damaging agent such as calicheamicins, duocarmycins, antramycin derivatives PBD (pyrrolobenzodiazepine, pyrrolobenzodiazepine, aza).
  • the drug is a DNA topoisomerase inhibitor or a salt thereof, such as irinotecan, irinotecan hydrochloride, camptothecin, 9-aminocamptothecin, 9-nitrocamptothecin Camptothecin, 10-hydroxycamptothecin, 9-chloro-10-hydroxycamptothecin, camptothecin derivatives SN-38, 22-hydroxycamptothecin, topotecan, letotecan, belo Tecan, Exitecan, Homosilatecan, 6,8-Dibromo-2-methyl-3-[2-(D-xylopyranosylamino)phenyl]-4(3H )-quinazolone, 2-cyano-3-(3,4-dihydroxyphenyl)-N-(phenylmethyl)-(2E)-2-acrylamide, 2-cyano-3- (3,4-dihydroxyphenyl)-N-(3-hydroxyphenylprop
  • the DNA topoisomerase inhibitor is camptothecin, 10-hydroxycamptothecin, topotecan, belotecan, irinotecan, 22-hydroxycamptothecin Or Exitecan.
  • the drug is Tubulysins, taxane drug derivatives, leptomycine derivatives, CC-1065 and its analogs, Amatoxins, splice body inhibitors, benzo (and) diazepines (PBD ) dimers, doxorubicin, methotrexate, vincristine, vinblastine, daunorubicin, mitomycin C, melphalan, or chlorambucil derivatives.
  • PBD diazepines
  • the drug is in one or more embodiments.
  • X 1 and X 2 are each independently:
  • amino amino substituted by an amino protecting group
  • C1-C6 aminoalkyl optionally substituted by an amino protecting group or C1-C6 alkyl at the amino portion
  • C1-C6 alkyl connected to a heterocycle optionally substituted by one or more C1-C6 alkyl, C1-C6 alkoxy, amino, halogen, nitro or cyano,
  • An amino-substituted heterocyclic group which is optionally substituted by a protecting group or one or more C1-C6 alkyl groups at the nitrogen atom of the heterocyclic part or the amino part,
  • Heterocyclic amino which is optionally substituted by a protecting group or a C1-C6 alkyl group at the nitrogen atom of the heterocyclic part or the amino part,
  • a carbamoyl group optionally substituted by a carbamoyl protecting group or a C1-C6 alkyl group,
  • X 3 is C1-C6 alkyl
  • X 4 is H, -(CH 2 ) q -CH 3 , -(CHR n ) q -CH 3 , C3-C8 carbocyclyl, -O-(CH 2 ) q -CH 3 , arylene group -CH 3 , -(CH 2 ) q -arylene-CH 3 , -arylene-(CH 2 ) q -CH 3 , -(CH 2 ) q -(C3-C8 carbocyclyl)-CH 3 , -( C3-C8 carbocyclyl)-(CH 2 ) q -CH 3 , C3-C8 heterocyclyl, -(CH 2 ) q -(C3-C8 heterocyclyl)-CH 3 , -(C3-C8 heterocyclyl base)-(CH 2 ) q -CH 3 , -(CH 2 ) q C(O)NR n (CH 2 )
  • y 0, 1 or 2;
  • Y is O, S or CR 1 R 2 , wherein R 1 and R 2 are each independently H or C1-C6 alkyl;
  • s and t are each independently 0, 1 or 2, but not 0 at the same time.
  • X 4 is H or C1-C6 alkyl.
  • the heterocycle is azetidine, acetalzine, morpholine, pyrrolidine, piperidine, imidazole, thiazole, oxazole or pyridine.
  • the amino protecting group is formyl, acetyl, trityl, tert-butoxycarbonyl, benzyl or p-methoxybenzyloxycarbonyl.
  • the drug is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N
  • X 1 and X 2 are each independently C1-C6 alkyl, halogen or -OH; ** is connected to other parts of the antibody drug conjugate.
  • the drug is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N
  • X 1 and X 2 are each independently C1-C6 alkyl, halogen or -OH; ** is connected to other parts of the antibody drug conjugate.
  • the C1-C6 alkyl is -CH 3 .
  • the halogen is F.
  • X 1 and X 2 are each independently —CH 3 , F, or —OH.
  • X 1 and X 2 are each —CH 3 .
  • X and X are each independently F, Cl, Br or I.
  • X and X are each F.
  • X 1 and X 2 are each independently F or —CH 3 .
  • X 1 is —CH 3 and X 2 is F.
  • p is 2-8.
  • p is 4-8.
  • p is 6-8.
  • p is 7-8.
  • p is 7.
  • p 7.4.
  • p is 8.
  • the antibody drug conjugate has the formula I-12, I-12-1, I-13, I-13-1, I-14, I-14-1, I- 15. I-15-1, I-16, I-16-1, I-17, I-17-1, I-18, I-18-1, I-19, I-19-1, I- 20. I-20-1, I-21, I-21-1, I-22, I-22-1, I-23, I-23-1, I-24, I-24-1, I- 25. Or the structure shown in I-25-1 or its stereoisomer or pharmaceutically acceptable salt or solvate:
  • Abu is an antibody or an antigen-binding unit thereof provided by the present invention.
  • p is 1-10, eg 1, 2, 3, 4, 5, 6, 7, 7.4, 8, 9 or 10.
  • p is 2-8.
  • p is 4-8.
  • p is 6-8.
  • p is 7-8.
  • p is 7.
  • p 7.4.
  • p is 8.
  • the antibody drug conjugate in the medicament has a DAR(p) of 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10. In one or more embodiments, the antibody drug conjugate in medicament has an average DAR(p) of 2-9. In one or more embodiments, the antibody drug conjugate in medicament has an average DAR(p) of 4-9. In one or more embodiments, the antibody drug conjugate in medicament has an average DAR(p) of 6-8.5. In one or more embodiments, the average DAR(p) of the antibody drug conjugate in medicament is 6-8. In one or more embodiments, the average DAR(p) of the antibody drug conjugate in medicament is 7-8.
  • the antibody drug conjugates of the invention are used in combination with one or more other therapies.
  • Suitable additional therapies include existing pharmaceutical and/or surgical therapies for a particular application, such as cancer.
  • the antibody drug conjugate is used in combination with one or more other chemotherapeutic or antineoplastic agents.
  • the other chemotherapeutic agent is radiation therapy.
  • the chemotherapeutic agent is a cell death inducer.
  • the antibody drug conjugate and other agent are prepared as a single therapeutic composition and the antibody drug conjugate and other agent are administered simultaneously.
  • the antibody drug conjugate and other reagents are independent of each other, for example, prepared as separate therapeutic compositions, and the antibody drug conjugate and other reagents are administered at the same time, or administered at different times during the treatment regimen.
  • Antibody drug conjugates and other reagents are administered before the other agent, the antibody drug conjugate is administered after the other agent, or the antibody drug conjugate and other agent are administered on an alternating schedule.
  • the antibody drug conjugates and other agents are administered in a single dose or in multiple doses.
  • the present invention also provides a pharmaceutical composition, which comprises the antibody of the present invention or its antigen-binding unit, or antibody-drug conjugate, as well as pharmaceutically acceptable carriers, excipients and / or excipients.
  • the pharmaceutical composition further comprises optional other anticancer drugs.
  • the pharmaceutical composition provided by the present invention can be administered by any convenient route, such as by infusion or bolus injection, absorbed through the epithelium or mucous membrane of the skin (such as oral mucosa, rectal and intestinal mucosa, etc.), and can be co-administered with other biologically active agents .
  • the pharmaceutical composition can be administered intravenously, orally, rectally, parenterally, intracerebrally, intravaginally, intraperitoneally, externally (e.g. by powder, ointment, drops, etc.) or transdermal patch), orally, or by oral or nasal spray.
  • the present invention provides the antibody or its antigen binding unit, biological material (selected from polynucleotides, expression vectors and cells), antibody drug conjugates, pharmaceutical compositions Use of at least one in the preparation of medicaments for treating and/or preventing diseases.
  • the disease is a disease associated with folate receptor alpha expression.
  • the disease is a disease associated with overexpression of folate receptor alpha.
  • the disease is a folate receptor alpha expressing tumor.
  • the disease is a tumor that overexpresses folate receptor alpha.
  • the disease is a folate receptor alpha expressing cancer.
  • the disease is a cancer that overexpresses folate receptor alpha.
  • the drug for treating tumors also includes other anticancer drugs.
  • the present invention provides antibodies or antigen-binding units thereof, biological materials (selected from polynucleotides, expression vectors, and cells), antibody-drug conjugates as described herein, and/or The application of the pharmaceutical composition in the treatment and/or prevention of diseases.
  • the disease is a disease associated with folate receptor alpha expression.
  • the disease is a disease associated with overexpression of folate receptor alpha.
  • the disease is a folate receptor alpha expressing tumor.
  • the disease is a tumor that overexpresses folate receptor alpha.
  • the disease is a folate receptor alpha expressing cancer.
  • the disease is a cancer that overexpresses folate receptor alpha.
  • the disease is cancer, autoimmune disease, inflammatory disease or infectious disease.
  • One or more embodiments provide a method for treating and/or preventing a disease, the method comprising administering to a patient in need an effective amount of an antibody or an antigen-binding unit thereof, a biological material (selected from polynucleotide , expression vectors and cells), antibody drug conjugates and/or pharmaceutical compositions comprising them.
  • the disease is a disease associated with folate receptor alpha expression.
  • the disease is a disease associated with overexpression of folate receptor alpha.
  • the disease is a folate receptor alpha expressing tumor.
  • the disease is a tumor that overexpresses folate receptor alpha.
  • the disease is a folate receptor alpha expressing cancer. In one or more embodiments, the disease is a cancer that overexpresses folate receptor alpha. In one or more embodiments, the effective amount refers to the amount of active compound or agent that results in the biological or pharmaceutical effect of a tissue, system, animal, individual, and human being sought by the researcher, veterinarian, physician, or other clinician. With response, this includes treating a disease.
  • cancer examples include, but are not limited to, solid tumors, hematological cancers, and metastatic lesions. Specific examples of such cancers include, but are not limited to, colorectal cancer, lung cancer, ovarian cancer, uterine cancer, endometrial cancer, peritoneal cancer, fallopian tube cancer, pancreatic cancer, squamous cell carcinoma of the head and neck, nasopharyngeal cancer, laryngeal cancer, lung adenocarcinoma Cancer, liver cancer, breast cancer, brain cancer, kidney cancer, renal cell carcinoma, colon cancer, testicular cancer, cervical cancer, bladder cancer, retinoblastoma, glioblastoma, mesothelioma, oral epithelioid carcinoma, Choriocarcinoma and head and neck cancer.
  • the antibody or its antigen-binding unit or antibody-drug conjugate can be formulated into a pharmaceutical composition and administered to the patient in a form suitable for the selected route of administration, such as gastrointestinal Topically, intravenously (iv), intramuscularly, topically or subcutaneously.
  • the dosage (such as a single dosage) of the antibody or its antigen-binding unit or antibody-drug conjugate is 1 mg/kg-10 mg/kg; or, 1.2 mg/kg -8.0mg/kg; alternatively, 1.2mg/kg-6.5mg/kg; alternatively, 1.2mg/kg-5.0mg/kg; alternatively, 1.2mg/kg-3.5mg/kg; alternatively, 1.2mg/kg-2.4 mg/kg; or, 2.4mg/kg-8.0mg/kg; or, 2.4mg/kg-6.5mg/kg; or, 2.4mg/kg-5.0mg/kg; or, 2.4mg/kg-3.5mg/kg kg; or, 3.5mg/kg-8.0mg/kg; or, 3.5mg/kg-6.5mg/kg; or, 3.5mg/kg-5.0mg/kg; or, 5.0mg/kg-8.0mg/kg; or, 5.0mg/kg-8.0mg/kg; or,
  • the dosage (such as a single dosage) of the antibody or its antigen-binding unit or antibody-drug conjugate is about 1 mg/kg, 1.2 mg/kg, 1.5 mg/kg , about 2.0mg/kg, 2.4mg/kg, about 3.0mg/kg, about 3.5mg/kg, about 4.0mg/kg, about 4.5mg/kg, about 5.0mg/kg, about 5.5mg/kg, about 6.0 mg/kg, about 6.5 mg/kg, about 7.0 mg/kg, about 7.5 mg/kg, about 8.0 mg/kg, about 8.5 mg/kg, about 9 mg/kg, about 10 mg/kg, or any two of these values range between values (inclusive) or any value therein.
  • the single administration dose of the antibody or its antigen-binding unit or antibody-drug conjugate is 1 mg/kg-10 mg/kg; or, 1.2 mg/kg-8.0 mg/kg; or, 1.2mg/kg-6.5mg/kg; or, 1.2mg/kg-5.0mg/kg; or, 1.2mg/kg-3.5mg/kg; or, 1.2mg/kg-2.4mg/kg; or, 2.4mg/kg-8.0mg/kg; or, 2.4mg/kg-6.5mg/kg; or, 2.4mg/kg-5.0mg/kg; or, 2.4mg/kg-3.5mg/kg; or, 3.5mg /kg-8.0mg/kg; or, 3.5mg/kg-6.5mg/kg; or, 3.5mg/kg-5.0mg/kg; or, 5.0mg/kg-8.0mg/kg; or, 5.0mg/kg-8.0mg/kg; or, 5.0mg/kg-8.0mg/
  • the single administration dose of the antibody or its antigen binding unit or antibody drug conjugate is about 1 mg/kg, 1.2 mg/kg, 1.5 mg/kg, about 2.0 mg/kg , 2.4mg/kg, about 3.0mg/kg, about 3.5mg/kg, about 4.0mg/kg, about 4.5mg/kg, about 5.0mg/kg, about 5.5mg/kg, about 6.0mg/kg, about 6.5 mg/kg, about 7.0 mg/kg, about 7.5 mg/kg, about 8.0 mg/kg, about 8.5 mg/kg, about 9 mg/kg, about 10 mg/kg, or a range between any two of these values (including endpoints) or any value in them.
  • the dosage of the antibody or its antigen-binding unit or antibody drug conjugate (for example, a single dosage) is 50 mg-1000 mg; or, 50 mg-600 mg; or, 60 mg- 600mg; or, 100mg-600mg; or, 72mg-480mg; or, 72mg-390mg; or, 72mg-300mg; or, 72mg-210mg; or, 72mg-144mg; or, 144mg-480mg; or, 144mg-300mg; or, 144mg-210mg; or, 210mg-480mg; or, 210mg-390mg; or, 210mg-300mg; or, 300mg-480mg; or, 300mg-390mg; or, 84mg-455mg; or, 84mg-350mg; or, 84mg-245mg; or, 84mg-168mg; or, 168mg-5
  • the antibody or its antigen-binding unit or antibody-drug conjugate is administered at a dosage (such as a single dosage) of about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg , about 72mg, about 80mg, about 84mg, about 90mg, about 95mg, about 100mg, about 105mg, about 110mg, about 120mg, about 130mg, about 140mg, about 144mg, about 145mg, about 150mg, about 155mg, about 160mg, about 165mg, about 168mg, about 170mg, about 175mg, about 180mg, about 190mg, about 200mg, about 210mg, about 220mg, about 230mg, about 240mg, about 245mg, about 250mg, about 260mg, about 270mg, about 280mg, about 290mg, About 300mg, about 310mg,
  • the single administration dose of the antibody or its antigen-binding unit or antibody drug conjugate is 50 mg-1000 mg; or, 50 mg-600 mg; or, 60 mg-600 mg; or, 100 mg- 600mg; or, 72mg-480mg; or, 72mg-390mg; or, 72mg-300mg; or, 72mg-210mg; or, 72mg-144mg; or, 144mg-480mg; or, 144mg-390mg; or, 144mg-210mg; or, 210mg-480mg; or, 210mg-390mg; or, 210mg-300mg; or, 300mg-480mg; or, 300mg-390mg; or, 390mg-480mg; 84mg-455mg; or, 84mg-350mg; or, 84mg-245mg; or, 84mg-168mg; or, 168mg-5
  • the single administration dose of the antibody or its antigen binding unit or antibody drug conjugate is about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 72 mg, about 84 mg , about 90mg, about 100mg, about 105mg, about 110mg, about 120mg, about 130mg, about 140mg, about 144mg, about 145mg, about 150mg, about 155mg, about 160mg, about 165mg, about 168mg, about 170mg, about 175mg, about 180mg, about 190mg, about 200mg, about 210mg, about 220mg, about 230mg, about 240mg, about 245mg, about 250mg, about 260mg, about 270mg, about 280mg, about 290mg, about 300mg, about 310mg, about 315mg, about 320mg, About 330mg, about 340mg, about
  • the method comprises at least 1, at least 2, at least 3, at least 4, at least 5, or at least 6 treatment cycles.
  • a treatment cycle is at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks, at least 6 weeks, or at least 7 weeks.
  • a treatment cycle is 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, or the range between any two of these values (including endpoints ) or any value in it.
  • the antibody, or antigen-binding unit thereof, or antibody-drug conjugate is administered in a single dose.
  • the dose is administered every 2 days to once every 6 weeks.
  • the administration is administered twice in about 1 week, or administered once in about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, or about 7 weeks.
  • the administration is once every 2 days, once every 3 days, once every 4 days, once every 5 days, twice a week, once a week Dosing once, once every 2 weeks, once every 3 weeks, once every 4 weeks, once every 5 weeks or once every 6 weeks.
  • the patient is treated for one treatment cycle. In one or more embodiments, the patient receives multiple (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12) treatment cycles treat. In one or more embodiments, the patient is treated until the condition is in remission and no longer requires treatment.
  • the antibody or antigen-binding unit thereof or antibody-drug conjugate or pharmaceutical composition comprising the same is administered by injection.
  • the antibody or antigen binding unit thereof or antibody drug conjugate or pharmaceutical composition comprising the same is administered by subcutaneous (s.c.) injection, intraperitoneal (i.p.) injection, parenteral injection, arterial Administration by intravenous injection or intravenous (i.v.) injection.
  • the antibody or its antigen-binding unit or antibody-drug conjugate or pharmaceutical composition comprising the same is administered by infusion.
  • the antibody or its antigen-binding unit or antibody-drug conjugate or pharmaceutical composition comprising the same is administered by bolus injection.
  • the antibody or its antigen-binding unit or antibody-drug conjugate or pharmaceutical composition comprising the same is administered by intravenous injection. In one or more embodiments, the antibody or antigen binding unit thereof or antibody drug conjugate or pharmaceutical composition comprising the same is administered by intravenous infusion.
  • the amount of antibody or antigen-binding unit thereof or antibody drug conjugate administered will depend on the nature of the drug, the extent to which the cell surface triggers internalization, transport and release of the drug, and the disease being treated and the condition of the patient (e.g., age, sex, weight, etc.).
  • the antibody or antigen binding unit thereof or antibody drug conjugate or pharmaceutical composition comprising the same is administered by intravenous (i.v.) infusion (ie, intravenous infusion).
  • intravenous infusion ie, intravenous infusion
  • the duration of the intravenous infusion is about 10 minutes, about 15 minutes, about 20 minutes, about 25 minutes, about 30 minutes, about 40 minutes, about 50 minutes, about 55 minutes, about 60 minutes , about 65 minutes, about 70 minutes, about 75 minutes, about 81 minutes, about 87 minutes, about 90 minutes, about 95 minutes, or a range between any two of these values (inclusive) or any value therein.
  • the intravenous infusion time is ⁇ 30 minutes.
  • the intravenous infusion time is > 60 minutes.
  • the intravenous infusion time is > 90 minutes.
  • the present invention provides a pharmaceutical composition suitable for injection, such as a bolus injection pharmaceutical composition or an infusion solution (drip) comprising the antibody or its antigen-binding unit or antibody drug conjugate type pharmaceutical composition.
  • Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
  • suitable carriers include solvents or dispersion media of physiological saline, bacteriostatic water, or phosphate buffered saline (PBS), ethanol, polyalcohols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, etc.), and suitable mixture.
  • the pharmaceutical composition further includes a pharmaceutically acceptable carrier.
  • the pharmaceutically acceptable carrier may comprise antibacterial and/or antifungal agents, such as parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like.
  • the pharmaceutically acceptable carrier may contain isotonic agents, such as sugars, polyalcohols (such as mannitol, sorbitol), sodium chloride.
  • the pharmaceutical composition comprises at least 0.1% of the antibody or its antigen-binding unit or antibody drug conjugate. The percentage of antibody can vary and is between about 2% and 90% by weight of a given dosage form. The amount of the antibody or its antigen-binding unit or antibody-drug conjugate in this pharmaceutical composition can be an effective amount for administration.
  • the present invention provides a method for preparing a pharmaceutical composition: separately combining the antibody or its antigen-binding unit or antibody-drug conjugate described herein with a pharmaceutically acceptable carrier (such as water for injection, saline, etc.) mixed.
  • a pharmaceutically acceptable carrier such as water for injection, saline, etc.
  • the method of mixing the above-mentioned antibody or its antigen-binding unit or antibody-drug conjugate with a pharmaceutically acceptable carrier is generally known in the art.
  • the present invention provides a kit comprising the antibody or its antigen-binding unit, antibody-drug conjugate or pharmaceutical composition comprising it described herein and instructions for guiding patient administration .
  • One or more embodiments also provide a product comprising the anti-FR ⁇ antibody of the present invention or its antigen-binding unit, antibody-drug conjugate, or a pharmaceutical composition comprising the same;
  • a package insert, instructions or label indicating that the anti-FR ⁇ antibody, antibody drug conjugate or pharmaceutical composition comprising the same of the present invention is used for treating and/preventing diseases related to the expression of folate receptor ⁇ .
  • antibodies of the invention have a variety of uses.
  • antibodies of the invention can be used as therapeutic agents, as reagents in diagnostic kits or as diagnostic tools, or as reagents in competition assays to generate therapeutic agents.
  • Figure 1 shows a schematic diagram of the ADC conjugation.
  • FIG. 1 shows the endocytosis of ADC1.
  • FIG. 3 shows the bystander effect of ADC1.
  • Figure 4 shows the tumor suppressive effect of ADC1 in vivo.
  • Figure 5 shows the tumor suppressive effect of ADC1 in vivo.
  • Figure 6 shows the growth curves (mean ⁇ standard error) of the tumor volume of mice in each group in the LU11554 xenograft model.
  • Figure 7 shows the growth curves (mean ⁇ standard error) of the tumor volume of mice in each group in the LU5197 xenograft model.
  • an entity refers to one or more such entities, for example "an antibody” should be understood as one or more antibodies, therefore, the term “a” (or “an” ), “one or more” and “at least one” may be used interchangeably herein.
  • the term “comprising” or “comprising” means that the antibody, composition or method, etc. includes the listed elements, such as components or steps, but does not exclude others.
  • “Consisting essentially of” means that the antibody, composition or method excludes other elements that have a fundamental influence on the characteristics of the combination, but does not exclude elements that have no essential influence on the antibody, composition or method.
  • Consisting of means excluding elements not specifically recited.
  • antibody refers to immunoglobulin (Ig) molecules and immunologically active portions of immunoglobulin molecules, ie, molecules that contain an antigen binding site that specifically binds (immunoreacts with) an antigen.
  • “Specific binding” or “immunoreactive” or “against” means that the antibody reacts with one or more epitopes of the target antigen and does not react with other polypeptides, or with very low affinity (KD>10 -6 g/ ml) combined with other polypeptides.
  • Antibodies include, but are not limited to, monoclonal antibodies, chimeric antibodies, dAbs (domain antibodies), single chain antibodies, Fab, Fab- and F(ab') 2 fragments, Fv and Fab expression libraries.
  • antibody includes a wide variety of polypeptides that can be distinguished biochemically.
  • classes of heavy chains include gamma, mu, alpha, delta or epsilon ( ⁇ , ⁇ , ⁇ , ⁇ , ⁇ ), with some subclasses (eg ⁇ 1- ⁇ 4).
  • the nature of this chain determines the "class” of the antibody as IgG, IgM, IgA, IgG or IgE, respectively.
  • the immunoglobulin subclasses (isotypes), eg, IgGl, IgG2, IgG3, IgG4, IgG5, etc., are well characterized and the functional specificities conferred are also known.
  • the immunoglobulin molecule is of the IgG class.
  • the two heavy chains and the two light chains are linked by disulfide bonds in a "Y" configuration, where the light chains begin at the mouth of the "Y” and continue through the variable region surrounding the heavy chains.
  • Antibodies, antigen binding units or derivatives disclosed in the present invention include but are not limited to polyclonal, monoclonal, multispecific, fully human, humanized, primatized, chimeric antibodies, single chain antibodies, epitope binding Fragments (eg Fab-like, Fab'-like and F(ab') 2- like), single-chain Fvs-like (scFv)-like.
  • Light chains can be classified as kappa ( ⁇ ) or lambda ( ⁇ ). Each heavy chain can be associated with a kappa or lambda light chain.
  • kappa
  • lambda
  • Each heavy chain can be associated with a kappa or lambda light chain.
  • immunoglobulins are produced by hybridomas, B cells, or genetically engineered host cells, their light and heavy chains are joined by a covalent bond, and the "tail" portions of the two heavy chains are linked by a covalent disulfide bond or non-covalent bonding.
  • the amino acid sequence extends from the N-terminus at the forked end of the Y configuration to the C-terminus at the bottom of each chain.
  • the variable region of an immunoglobulin kappa light chain is V ⁇ ; the variable region of an immunoglobulin lambda light chain is V ⁇ .
  • variable region of the light chain (VL) and the variable region of the heavy chain (VH) determine antigen recognition and specificity.
  • the light chain constant region (CL) and the heavy chain constant region (CH) confer important biological properties such as secretion, transplacental movement, Fc receptor binding, complement fixation, etc.
  • the numbering of constant regions increases as they become farther away from the antigen-binding site or amino terminus of the antibody.
  • the N-terminal portion is the variable region and the C-terminal portion is the constant region; the CH3 and CL domains actually comprise the carboxy-terminal ends of the heavy and light chains, respectively.
  • each antigen-binding domain In naturally occurring antibodies, the six “complementarity determining regions" or “CDRs” present in each antigen-binding domain are short, A non-contiguous sequence of amino acids that specifically binds to an antigen. The remaining other amino acids in the antigen-binding domain, referred to as the "framework" regions, show less intermolecular variability.
  • the framework regions mostly adopt a ⁇ -sheet conformation, and the CDRs form loop structures attached to them, or in some cases form part of the ⁇ -sheet structure. Thus, the framework regions position the CDRs in the correct orientation by forming a scaffold through non-covalent interchain interactions.
  • the antigen-binding domain with the CDRs in specific positions forms a surface complementary to the epitope on the antigen that facilitates the non-covalent binding of the antibody to its antigenic epitope.
  • a surface complementary to the epitope on the antigen that facilitates the non-covalent binding of the antibody to its antigenic epitope.
  • those of ordinary skill in the art can identify the amino acids comprising CDR and framework regions by known methods (see Kabat, E., et al., U.S. Department of Health and Human Services, Sequences of Proteins of Immunological Interest, (1983) and Chothia and Lesk, J. Mol. Biol., 196:901-917 (1987)).
  • mAb monoclonal antibody
  • CDRs complementarity determining regions
  • single-chain antibody refers to an antibody formed by linking the heavy chain variable region (VH) and the light chain variable region (VL) through a 15-20 amino acid linker.
  • Linkers can be rich in glycine for flexibility, and serine or threonine for solubility, and can link the N-terminus of VH to the C-terminus of VL, or vice versa.
  • the protein has had its constant regions removed and a linker introduced, it retains the specificity of the original immunoglobulin.
  • ScFv molecules are generally known in the art, for example as described in US Pat. No. 5,892,019.
  • antigen binding site or "binding portion” refers to that portion of an immunoglobulin molecule that is involved in antigen binding.
  • the antigen binding site is formed by the amino acid residues of the N-terminal variable (V) regions of the heavy (H) and light (L) chains.
  • VH heavy-chain variable region
  • VL light-chain variable region
  • FR framework region
  • FR amino acid sequences in immunoglobulins that occur naturally between or adjacent to hypervariable regions.
  • the three hypervariable regions of the light chain and the three hypervariable regions of the heavy chain are arranged relative to each other in three-dimensional space to form an antigen-binding surface.
  • the antigen-binding surface is complementary to the three-dimensional surface of the bound antigen, and the three hypervariable regions of each heavy and light chain are referred to as "complementarity determining regions" or "CDRs.”
  • CDRs complementarity determining regions
  • the heavy chain variable region comprises VH FR1, VH CDR1, VH FR2, VH CDR2, VH FR3, VH CDR3, and VH FR4.
  • the light chain variable region comprises VL FR1 , VL CDR1 , VL FR2, VL CDR2, VL FR3, VL CDR3 and VL FR4.
  • the alignment of the amino acids of each domain can be compared with Kabat Sequences of Proteins of Immunological Interest (National Institutes of Health (1987 and 1991)) or the article of Chothia and Lesk (J.Mol.Biol.196:901-917 (1987); Chothia et al., Nature 342:878-883 (1989)) agree with the definition.
  • the framework region and CDR region of the humanized antibody do not have to correspond exactly to the parental sequence, for example, the CDR or consensus framework of the donor antibody can be mutated by substitution, insertion and/or deletion of at least one amino acid residue, making the CDR at this site Or the framework residues do not correspond to the donor antibody or the consensus framework.
  • the term "consensus framework” refers to the framework regions in the consensus immunoglobulin sequences.
  • the term "consensus immunoglobulin sequence” refers to a sequence formed from the most frequently occurring amino acids (or nucleotides) in a family of related immunoglobulin sequences (see, e.g., Winnaker, From Genes to Clones [From Genes to Clones] to cloning] (Verlagsgesellschaft, Weinheim, Germany 1987)). In a family of immunoglobulins, each position in the consensus sequence is occupied by the amino acid in that family that occurs most frequently at that position. If two amino acids occur equally frequently, either can be included in the consensus sequence.
  • CDR complementarity determining regions
  • Kabat et al. also defined a numbering system applicable to the variable region sequences of any antibody.
  • One of ordinary skill in the art can apply this "Kabat numbering" system to any variable region sequence independently of other experimental data other than the sequence itself.
  • “Kabat numbering” refers to the numbering system proposed by Kabat et al., U.S. Dept. of Health and Human Services in "Sequence of Proteins of Immunological Interest” (1983).
  • Antibodies can also use the EU or Chothia numbering system.
  • Antibodies disclosed in the present invention may be derived from any animal, including but not limited to fish, birds and mammals.
  • the antibody is of human, murine, donkey, rabbit, goat, camel, llama, horse or chicken origin.
  • the variable regions may be of condricthoid origin (eg, from sharks).
  • a "heavy chain constant region” includes at least one of a CH1 domain, a hinge (eg, upper, middle, and/or lower hinge region) domain, a CH2 domain, a CH3 domain, or a variant or fragment.
  • the heavy chain constant regions of antibodies can be derived from different immunoglobulin molecules.
  • the heavy chain constant region of a polypeptide can include a CH1 domain derived from an IgG1 molecule and a hinge region derived from an IgG3 molecule.
  • the heavy chain constant region may comprise a hinge region derived partly from an IgG1 molecule and partly from an IgG3 molecule.
  • part of the heavy chain may comprise a chimeric hinge region derived partly from an IgGl molecule and partly from an IgG4 molecule.
  • a “light chain constant region” includes a portion of the amino acid sequence from an antibody light chain.
  • the light chain constant region comprises at least one of a constant kappa domain or a constant lambda domain.
  • a “light chain-heavy chain pair” refers to a collection of light and heavy chains that can form dimers through disulfide bonds between the CL domain of the light chain and the CH1 domain of the heavy chain.
  • a "VH domain” includes the amino-terminal variable domain of an immunoglobulin heavy chain.
  • a "CH1 domain” comprises the first constant region of an immunoglobulin heavy chain.
  • the CH2 domain is not closely paired with other domains, but rather two N-linked branched carbohydrate chains are inserted between the two CH2 domains of the intact native IgG molecule.
  • the CH3 domain extends from the CH2 domain to the C-terminus of the IgG molecule and contains approximately 108 residues.
  • a "hinge region” includes part of the heavy chain region connecting the CH1 domain and the CH2 domain.
  • the hinge region comprises approximately 25 residues and is flexible, allowing the two N-terminal antigen-binding regions to move independently.
  • the hinge region can be subdivided into three distinct domains: upper, middle and lower hinge domains (Roux et al., J. Immunol 161:4083 (1998)).
  • Disulfide bond refers to a covalent bond formed between two sulfur atoms.
  • a thiol group of cysteine can form a disulfide bond or bridge with a second thiol group.
  • the CH1 and CL regions are linked by a disulfide bond.
  • a “chimeric antibody” refers to any antibody whose variable regions are obtained or derived from a first species and whose constant regions (which may be complete, partial or modified) are derived from a second species.
  • the variable regions are of non-human origin (eg, mouse or primate) and the constant regions are of human origin.
  • epitope as used herein includes any determinant region of a protein capable of specifically binding to an immunoglobulin or fragment thereof or a T cell receptor.
  • Epitope-determining regions usually consist of chemically active surface groups of molecules (such as amino acids or sugar side chains) and usually have specific three-dimensional structural properties as well as specific charge properties.
  • the term "specific binding” refers to the type of non-covalent interaction that occurs between an immunoglobulin molecule and an antigen for which the immunoglobulin is specific.
  • the strength or affinity of an immunological binding interaction can be expressed in terms of the equilibrium dissociation constant (KD) of the interaction, where a smaller KD represents a greater affinity.
  • KD equilibrium dissociation constant
  • the immunological binding properties of selected polypeptides can be quantified using methods well known in the art. One such method entails measuring the rates of antigen binding site/antigen complex formation and dissociation, where those rates depend on the concentration of the complex partners, the affinity of the interaction, and geometric parameters that affect the rates equally in both directions.
  • association rate constants (k on ) and “dissociation rate constants” (k off ) can be determined by calculating concentrations and actual association and dissociation rates (see Nature 361:186-87 (1993)).
  • the koff / kon ratio eliminates all affinity-independent parameters and is equal to the equilibrium dissociation constant, KD (see generally Davies et al. (1990) Annual Rev Biochem 59:439-473).
  • Specific binding can be measured by radioligand binding assays, surface plasmon resonance (SPR), flow cytometry binding assays, or similar assays known to those of skill in the art.
  • isolated used in the present invention with respect to cells, nucleic acids, polypeptides, etc.
  • isolated DNA, RNA, polypeptide refers to one or the other components in the natural environment of the cell, such as DNA or RNA.
  • isolated molecules refers to a nucleic acid or peptide that is substantially free of cellular material, viral material, or cell culture medium when produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized.
  • isolated nucleic acid is intended to include fragments of nucleic acid that do not occur in nature, and do not exist in nature.
  • isolated is also used herein to refer to cells or polypeptides that are separated from other cellular proteins or tissues.
  • Isolated polypeptide is intended to include purified and recombinant polypeptides. Isolated polypeptides and the like will usually be prepared by at least one purification step.
  • the isolated nucleic acid, polypeptide, etc. has a purity of at least about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 99%, or values thereof The range between any two values in (inclusive) or any value in it.
  • an “isolated” antibody is one that has been separated and/or recovered from a component of its natural environment. Some components of its natural environment are substances that would preclude the diagnostic or therapeutic use of the antibody, and may include enzymes, hormones, and other proteinaceous or nonproteinaceous solutes.
  • the antibody is purified to the following extent: (1) the antibody is greater than 95% by weight, such as greater than 99%, as determined by the Lowry method; (2) by using rotor cup sequencing or (3) by SDS-PAGE under reducing or non-reducing conditions, using Coomassie blue or silver staining to detect homogeneity.
  • Isolated antibody includes antibody in situ within recombinant cells. Ordinarily, isolated antibody will be prepared by at least one or more purification steps. In some embodiments, the isolated antibody is at least about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 99% pure, or any two of these values The range in between (inclusive) or any value therein.
  • encoding when applied to a polynucleotide refers to a polynucleotide which is said to "encode” a polypeptide which, in its native state or when manipulated by methods well known to those skilled in the art, is transcribed and/or Or translation may result in the polypeptide and/or fragments thereof.
  • polypeptides or polynucleotides refers to polypeptides or polynucleotides, meaning forms of polypeptides or polynucleotides that do not occur in nature, non-limiting examples may be produced by combination of polynucleotides or polynucleotides that do not normally exist or peptide.
  • sequence identity means that two polynucleotide or amino acid sequences are identical (ie, are identical on a nucleotide-by-nucleotide or residue-by-residue basis) over the window of comparison.
  • percent sequence identity is calculated by comparing two optimally aligned sequences over a comparison window, determining the number of positions where the same amino acid residue occurs in both sequences to give the number of matching positions, dividing The number of matching positions was divided by the total number of positions in the comparison window (ie, the window size), and the result was multiplied by 100 to obtain the percent sequence identity.
  • At least 90% sequence identity is about 90% sequence identity, about 91% sequence identity, about 92% sequence identity, about 93% sequence identity, about 95% sequence identity, about 96% sequence identity , about 97% sequence identity, about 98% sequence identity, about 99% sequence identity, or a range between any two of these values, inclusive, or any value therein.
  • amino acid refers to an organic compound containing both amino and carboxyl groups, such as an ⁇ -amino acid, which can be encoded by a nucleic acid directly or in the form of a precursor.
  • a single amino acid is encoded by a nucleic acid consisting of three nucleotides (so-called codons or base triplets). Each amino acid is encoded by at least one codon. The fact that the same amino acid is encoded by different codons is called “degeneracy of the genetic code”.
  • Amino acids include natural amino acids and unnatural amino acids.
  • the twenty conventional amino acids and their abbreviations follow conventional usage. See Immunology-A Synthesis (2nd ed., edited by E.S. Golub and D.R. Gren, Sinauer Associates, Sunderland 7 Mass. (1991)). Stereoisomers of the twenty conventional amino acids (e.g., D-amino acids), unnatural amino acids (such as ⁇ -, ⁇ -disubstituted amino acids), N-alkyl amino acids, lactic acid, and other unconventional amino acids may also be suitable for use in Components of the polypeptides of the disclosure.
  • Examples of unconventional amino acids include: 4-hydroxyproline, ⁇ -carboxyglutamate, ⁇ -N,N,N-trimethyllysine, ⁇ -N-acetyllysine, O-phosphoserine , N-acetylserine, N-formylmethionine, 3-methylhistidine, 5-hydroxylysyl, ⁇ -N-methylarginine and other similar amino acids and imino acids (such as 4 - hydroxyproline).
  • the left-hand direction is the amino-terminal direction and the right-hand direction is the carboxy-terminal direction, consistent with standard usage and convention.
  • Conventional (or natural) amino acids include alanine (three-letter code: Ala, one-letter code: A), arginine (Arg, R), asparagine (Asn, N), aspartic acid (Asp, D ), cysteine (Cys, C), glutamine (Gln, Q), glutamic acid (Glu, E), glycine (Gly, G), histidine (His, H), isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), serine (Ser, S), threonine (Thr, T), tryptophan (Trp, W), tyrosine (Tyr, Y) and valine (Val, V).
  • polypeptide is intended to encompass the singular as well as the plural “polypeptides” and refers to a molecule formed of amino acid monomers linked linearly by amide bonds (also known as peptide bonds).
  • polypeptide refers to any chain or chains of two or more amino acids, and does not refer to a specific length of the product.
  • the definition of “polypeptide” includes peptide, dipeptide, tripeptide, oligopeptide, "protein”, “amino acid chain” or any other term used to refer to a chain of two or more amino acids, and the term “polypeptide” may Used in place of, or interchangeably with, any of the above terms.
  • polypeptide is also intended to refer to the products of post-expression modifications of the polypeptide, including but not limited to glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, or non-natural Amino acid modifications that occur.
  • a polypeptide may be derived from a natural biological source or produced by recombinant techniques, but it need not be translated from a specified nucleic acid sequence, it may be produced by any means including chemical synthesis.
  • substantially identical means that two peptide sequences share at least 80% sequence identity, preferably at least 90% sequence identity when optimally aligned such as by the GAP or BESTFIT programs using default gap weights identity, more preferably at least 95% sequence identity, and most preferably at least 99% sequence identity.
  • amino acid or polypeptide when an amino acid or polypeptide is a constituent part of a molecule (such as an antibody or ADC), the amino acid or polypeptide refers to the amino acid residue or polypeptide residue (whether written or not), that is, its interaction with other parts of the molecule
  • some of its groups such as a hydrogen atom of its amino group and/or a hydroxyl group of a carboxyl group
  • covalent bonds such as amide bonds
  • a polynucleotide is composed of a specific sequence of four bases: adenine (A), cytosine (C), guanine (G), thymine (T), or when the polynucleotide is RNA Thymine was replaced with uracil (U).
  • a "polynucleotide sequence” may be denoted by the letters of the polynucleotide molecule. This letter designation can be entered into a database in a computer with a central processing unit and used in bioinformatics applications such as for functional genomics and homology searches.
  • polynucleotide polynucleotide
  • oligonucleotide oligonucleotide
  • a polynucleotide can have any three-dimensional structure and can perform any function, known or unknown.
  • polynucleotides genes or gene fragments (e.g., probes, primers, EST or SAGE tags), exons, introns, messenger RNA (mRNA), transfer RNA, ribose Somatic RNA, ribozyme, cDNA, dsRNA, siRNA, miRNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes and primers.
  • a polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs.
  • nucleotides can be made before or after assembly of the polynucleotide.
  • the sequence of nucleotides may be interrupted by non-nucleotide components.
  • Polynucleotides may be further modified after polymerization, for example by conjugation with labeling components.
  • the term also refers to double-stranded and single-stranded molecules. Unless otherwise stated or required, any embodiment of a polynucleotide of the present disclosure includes the double-stranded form and each of the two complementary single-stranded forms known or predicted to constitute the double-stranded form.
  • Identity or sequence identity of a nucleic acid or polynucleotide sequence (or polypeptide or antibody sequence) with another sequence having a certain percentage (e.g. 90%, 95%, 98% or 99%) means when the sequence When aligned, this percentage of bases (or amino acids) is identical in the two sequences being compared.
  • This alignment and percent identity or sequence identity can be determined visually or using software programs known in the art, such as those described by Ausubel et al.eds. (2007) in Current Protocols in Molecular Biology. It is preferred to use the default parameters for the alignment.
  • Biologically equivalent polynucleotides are polynucleotides that share the above indicated percentages of identity and encode polypeptides having the same or similar biological activity.
  • the left-hand end of a single-stranded polynucleotide sequence is the 5' end, and the left-hand direction of a double-stranded polynucleotide sequence is referred to as the 5' direction.
  • the direction of addition of 5' to 3' of the nascent RNA transcript is called the direction of transcription; the sequence region on the DNA strand that is identical to the RNA sequence and 5' at the 5' end of the RNA transcript is called the "upstream sequence"; the DNA The region of sequence on the strand identical to the RNA sequence and 3' to the 3' end of the RNA transcript is referred to as "downstream sequence".
  • residue positions that are not identical differ by conservative amino acid substitutions.
  • amino acid sequence of an antibody or immunoglobulin molecule are encompassed by the present disclosure, provided that the amino acid sequence identity remains at least 90%, such as at least 92%, 95%, 98% or 99%.
  • the changes are conservative amino acid substitutions.
  • Conservative amino acid substitutions are substitutions that occur within a family of amino acids that are related in their side chains.
  • Amino acids encoded by genes can be roughly divided into the following categories: (1) acidic amino acids are aspartate and glutamate; (2) basic amino acids are lysine, arginine, and histidine; (3) non-polar amino acids alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan); Glycine, Asparagine, Glutamine, Cysteine, Serine, Threonine, Tyrosine.
  • amino acids include (i) the aliphatic-hydroxyl family of serine and threonine; (ii) the amide-containing family of asparagine and glutamine; (iii) the aliphatic family of alanine, valine, leucine and isoleucine; and (iv) phenylalanine, tryptophan and tyrosine of the aromatic family.
  • conservative amino acid substitution groups are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, Glutamic acid-aspartic acid, and asparagine-glutamine.
  • amino acid substitutions have the effect of (1) reducing susceptibility to proteolysis, (2) reducing susceptibility to oxidation, (3) altering binding affinity for protein complex formation, ( 4) altering binding affinity, and (5) conferring or improving other physicochemical or functional properties of such analogs.
  • Analogs may include various muteins that differ in sequence from the naturally occurring peptide sequence. For example, single or multiple amino acid substitutions (preferably conservative amino acid substitutions) may be made in naturally occurring sequences (preferably in portions of the polypeptide other than domains that form intermolecular contacts).
  • Conservative amino acid substitutions should not significantly alter the structural properties of the parent sequence (eg, the substituted amino acid should not tend to disrupt the helical structure present in the parent sequence, or disrupt other types of secondary structure that characterize the parent sequence).
  • Examples of secondary and tertiary structures of artificially recognized polypeptides are described in Proteins, Structures and Molecular Principles (Creighton ed., W.H. Freeman and Company, New York (1984)); Introduction to Protein Structure (C. Branden and J. Tooze eds. , Garland Publishing, New York, N.Y. (1991)); and Thornton et al. Nature 354:105 (1991).
  • the number of amino acids for conservative amino acid substitutions of VL and VH can be about 1, about 2, about 3, about 4, about 5, about 6, about 8, about 9, about 10, about 11 1, about 13, about 14, about 15 conservative amino acid substitutions, or a range between any two of these values (inclusive) or any value therein.
  • the heavy chain constant region, the light chain constant region, the conservative amino acid substitutions of the heavy chain or the light chain can have about 1, about 2, about 3, about 4, about 5, about 6, about 8 amino acids about 9, about 10, about 11, about 13, about 14, about 15, about 18, about 19, about 22, about 24, about 25, about 29, About 31, about 35, about 38, about 41, about 45 conservative amino acid substitutions, or a range between any two of these values (inclusive) or any value therein.
  • agent means a chemical compound, a mixture of chemical compounds, a biological macromolecule or an extract made from a biological material.
  • label refers to the incorporation of a detectable label, for example, by incorporation of a radioactively labeled amino acid, or attachment to avidin that can be labeled (for example, containing a fluorescent label or optically detectable). Enzymatic activity detected by the method or calorimetric method (streptavidin) detected by the biotin-based moiety of the polypeptide. In certain instances, markers or markers may also be therapeutic. Various methods of labeling polypeptides and glycoproteins are known in the art and can be used.
  • labels for polypeptides include, but are not limited to, the following: radioisotopes or radionuclides (eg, 3 H, 14 C, 15 N, 35 S, 90 Y, 99 Tc, 111 In, 125 I, 131 I ), fluorescent labels (eg, FITC, rhodamine, lanthanide phosphors), enzyme labels (eg, horseradish peroxidase, ⁇ -galactosidase, luciferase, alkaline phosphatase), chemiluminescence Tag, biotinyl, predetermined polypeptide epitope recognized by the secondary reporter gene (eg, leucine zipper pair sequence, secondary antibody binding site, metal binding domain, epitope tag).
  • radioisotopes or radionuclides eg, 3 H, 14 C, 15 N, 35 S, 90 Y, 99 Tc, 111 In, 125 I, 131 I
  • fluorescent labels eg, FITC, rhodamine
  • labels are attached via spacer arms of various lengths to reduce possible steric hindrance.
  • the term “medicament” or “drug” refers to a compound or composition capable of inducing a desired therapeutic effect when properly administered to a patient.
  • EC 50 means the half-maximal effect concentration (concentration for 50% of maximal effect, EC 50 ) refers to the concentration that can cause 50% of the maximal effect.
  • IC50 means 50% inhibitory concentration, ie the concentration of drug or inhibitor required to inhibit a given biological process by half.
  • Treatment means therapeutic treatment and prophylactic or preventive measures, the purpose of which is to prevent, slow down, ameliorate or stop an undesirable physiological change or disorder, such as the progression of a disease, including but not limited to the following whether detectable or undetectable Relief of symptoms, reduction of disease extent, stabilization of disease state (i.e. not worsening), delay or slowing of disease progression, amelioration, remission, alleviation or disappearance of disease state (whether partial or total), prolongation and Expected survival without treatment, etc.
  • Patients in need of treatment include those who already have a condition or disorder, are susceptible to having a condition or disorder, or are in need of prevention of the condition or disorder, and can or are expected to benefit from the administration of an antibody or pharmaceutical composition disclosed herein for detection , patients who benefit from the diagnostic process and/or treatment.
  • cancer means or is intended to describe the physiological condition in mammals that is typically characterized by uncontrolled cell growth.
  • examples of cancer include, but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, or leukemia. More specific examples of such cancers include, but are not limited to, colorectal cancer, lung cancer, ovarian cancer, uterine cancer, endometrial cancer, salivary gland cancer, peritoneal cancer, fallopian tube cancer, pancreatic cancer, thyroid cancer, squamous cell carcinoma of the head and neck, nasopharyngeal Carcinoma, laryngeal cancer, lung adenocarcinoma, lung squamous cell carcinoma, liver cancer, hepatocellular carcinoma, gastrointestinal cancer, glioblastoma, breast cancer, brain cancer, kidney cancer, renal cell carcinoma, colon cancer, rectal cancer, prostate cancer carcinoma, vulvar cancer, testicular cancer, squamous cell carcinoma, small cell lung cancer, cervical cancer, bladder cancer,
  • overexpressed or “overexpressed” interchangeably refer to a gene that is usually transcribed or translated at a detectably higher level in certain cells, such as cancer cells, compared to normal cells.
  • Overexpression can be of protein or RNA (due to increased transcription, posttranscriptional processing, translation, posttranslational processing, altered stability, and altered protein degradation), as well as localized overexpression due to altered protein trafficking patterns (nuclear localization increased) and enhanced functional activity, such as, for example, increased enzymatic hydrolysis of substrates.
  • Overexpression can be 5%, 10%, 20%, 30%, 50%, 60%, 70%, 80%, 90% or more compared to normal or control cells.
  • the anti-FR ⁇ antibodies and antibody drug conjugates of the present invention are used to treat solid tumors that may overexpress folate receptor ⁇ .
  • tumor overexpressing folate receptor alpha refers to a tumor (including benign tumors and cancers) overexpressing folate receptor alpha.
  • folate receptor alpha expression in a tumor sample above background levels in immune tissue indicates that the tumor is a folate receptor alpha overexpressing tumor.
  • Methods for detecting folate receptor alpha expression in tumors are known in the art, such as immunohistochemical assays.
  • "FR ⁇ negative cells” are cells in a sample of cells that lack folate receptor alpha above background (eg, as determined by immunohistochemical techniques).
  • administering means delivering a substance (eg, an anti-folate receptor alpha antibody or ADC) for a therapeutic purpose (eg, treating a folate receptor alpha-related disorder).
  • a substance eg, an anti-folate receptor alpha antibody or ADC
  • Modes of administration can be parenteral, enteral and topical.
  • Parenteral administration is usually by injection, including but not limited to intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcutaneous, intraarticular, vesicular Subarachnoid, intraspinal, and intrasternal injections and infusions.
  • an effective amount refers to an amount of a drug, such as an antibody or ADC, sufficient to reduce or ameliorate the severity and/or amelioration of a disorder (e.g., cancer) or one or more symptoms thereof or duration; prevent progression of a condition; cause regression of a condition; prevent recurrence, development, onset, or progression of one or more symptoms associated with a condition; detect a condition; The amount of prophylactic or therapeutic effect.
  • an effective amount of an antibody can inhibit tumor growth (e.g., inhibit an increase in tumor volume); reduce tumor growth (e.g., reduce tumor volume); reduce the number of cancer cells; one or more symptoms.
  • an effective amount can improve disease free survival (DFS), improve overall survival (OS), or reduce the likelihood of relapse.
  • DFS disease free survival
  • OS overall survival
  • patient and “subject” are used interchangeably and refer to any mammal in need of diagnosis, prognosis or treatment, including but not limited to humans, dogs, cats, guinea pigs, rabbits, rats, mice, horses, cattle etc.
  • the patient is a human.
  • the term "in need” means that a patient has been identified as being in need of a particular method or treatment. In some embodiments, identification may be by any diagnostic means. A patient may in need thereof during any of the methods and treatments described herein.
  • administering refers to administering a substance for a therapeutic purpose (eg, treating a tumor).
  • tumor-treating drug refers to an agent having the functional property of inhibiting the development or progression of tumors in humans, especially malignant (cancerous) lesions such as carcinoma, sarcoma, lymphoma or leukemia. Inhibition of metastasis is in many cases a property of antineoplastic agents.
  • pharmaceutically acceptable carrier generally refers to any type of non-toxic solid, semi-solid or liquid filler, diluent, encapsulating material or formulation auxiliary, etc.
  • carrier refers to a diluent, adjuvant, excipient or carrier with which the active ingredient can be administered to a patient.
  • Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions.
  • Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glyceryl monostearate, talc, sodium chloride, skim milk powder, glycerol, Propylene, ethylene glycol, water, ethanol, etc.
  • the composition if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents such as acetates, citrates or phosphates.
  • Antibacterial agents such as benzyl alcohol or methylparaben, antioxidants such as ascorbic acid or sodium bisulfite, chelating agents such as ethylenediaminetetraacetic acid, and tonicity adjusting agents such as sodium chloride or dextrose are also contemplated.
  • These compositions may take the form of solutions, suspensions, emulsions, tablets, pills, capsules, powders, sustained release formulations and the like.
  • the composition can be formulated as a suppository, with traditional binders and carriers such as triglycerides.
  • Oral formulations can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, and the like.
  • compositions will contain a clinically effective dose of the antibody or antigen-binding fragment, preferably in purified form, together with an appropriate amount of carrier to provide a form suitable for administration to the patient.
  • the formulation should be suitable for the mode of administration.
  • the parent formulation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
  • antibody drug conjugate refers to a binding protein (such as an antibody or antigen-binding unit thereof) linked to one or more chemical drugs, which may optionally be therapeutic or cytotoxic agents.
  • the ADC comprises an antibody, a drug (eg, a cytotoxic drug) and a linker enabling attachment or conjugation of the drug to the antibody.
  • Non-limiting examples of drugs that may be included in the ADC are mitotic inhibitors, antitumor antibiotics, immunomodulators, vectors for gene therapy, alkylating agents, antiangiogenic agents, antimetabolites, boron-containing agents, chemical Protective agents, hormones, antihormonal agents, corticosteroids, photoactive therapeutic agents, oligonucleotides, radionuclide agents, topoisomerase inhibitors, kinase inhibitors (eg, TEC-family kinase inhibitors and serine/threonine amino acid kinase inhibitors) and radiosensitizers.
  • mitotic inhibitors eg, TEC-family kinase inhibitors and serine/threonine amino acid kinase inhibitors
  • antibody drug conjugate and “ADC” are used interchangeably.
  • anti-folate receptor alpha antibody drug conjugate and “anti-FR ⁇ antibody drug conjugate” and “anti-folate receptor alpha ADC” are used interchangeably and refer to compounds that specifically bind folate receptor An ADC of an antibody in which the antibody is conjugated to one or more drugs.
  • the anti-FR ⁇ ADC comprises an antibody conjugated to exixetecan.
  • the anti-FR ⁇ antibody or ADC binds to folate receptor alpha (eg, human folate receptor alpha).
  • DAR drug antibody conjugation ratio
  • the term “drug antibody conjugation ratio” or “DAR” refers to the amount of drug (eg, exinotecan) of an ADC to which an antibody is attached.
  • the DAR of an ADC can range from 1 to 10, but depending on the number of attachment sites on the antibody, higher loadings (eg 20) are also possible.
  • the term DAR may be used when referring to the amount of drug loaded onto a single antibody, or alternatively, the average or mean DAR of a group of ADCs. In some embodiments, its value is selected from 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.
  • the average binding number of the small molecule drug that is, the average drug binding number of the antibody, or called the average drug-antibody coupling ratio
  • its value is selected from about 0 to about 10, or about 2 to about 8.
  • the drug antibody conjugation ratio is about 3 to about 6.
  • the drug-to-antibody conjugation ratio is about 6 to about 8, or about 7 to about 8.
  • the DAR value can be denoted by p in this paper. Those skilled in the art understand that different batches of the same ADC may have slightly different average DAR values (p).
  • the DAR value of ADC can be determined by ultraviolet-visible absorption spectroscopy (UV-Vis), high-performance liquid chromatography-hydrophobic chromatography (HPLC-HIC), high-performance liquid chromatography-reversed-phase chromatography (RP-HPLC), liquid chromatography-mass spectrometry (LC-MS) and other determinations. These techniques are described in Ouyang, J. Methods Mol Biol, 2013, 1045: p.275-83.
  • substituents are defined below.
  • substituents e.g., alkyl, alkenyl, alkynyl, alkoxy, aminoalkoxy, aminoalkyl, aminoalkylamino, alkylamino, heterocyclyl, heterocyclylamino, and aryl
  • Cx-Cy or “Cx-y”
  • x is the minimum value of carbon atoms
  • y is the maximum value of carbon atoms.
  • C1-C6 alkyl refers to an alkyl group containing from 1 to 6 carbon atoms.
  • a substituent is described as "substituted by,” a hydrogen atom on carbon or nitrogen is replaced by a non-hydrogen group.
  • a substituted alkyl substituent is an alkyl substituent in which at least one hydrogen atom on the alkyl is replaced by a non-hydrogen group.
  • a monofluoroalkyl is an alkyl group substituted with one fluoro group
  • a difluoroalkyl group is an alkyl group substituted with two fluoro groups. It should be recognized that if more than one substitution is present on a substituent, each substitution may be the same or different (unless otherwise stated).
  • substituents include, but are not limited to, hydroxyl, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 alkoxy, C1-C6 aminoalkoxy, halogen, nitro, cyano , mercapto, alkylthio, amino, C1-C6 aminoalkyl, C1-C6 aminoalkylamino, C1-C6 alkyl attached to a heterocycle, C1-C6 alkylamino attached to a heterocycle, heterocyclyl , amino-substituted heterocyclyl, heterocyclic amino, carbamoyl, morpholin-1-yl, piperidin-1-yl, -(CH 2 ) q -CH 3 , -(CHR n ) q -CH 3 , C3-C8
  • Alkyl means a saturated aliphatic hydrocarbyl group, and the term includes straight and branched chain hydrocarbyl groups.
  • C1-C20 alkyl such as C1-C6 alkyl.
  • C1-C20 alkyl refers to an alkyl group having 1 to 20 carbon atoms, for example having 1 carbon atom, 2 carbon atoms, 3 carbon atoms, 4 carbon atoms, 5 carbon atoms, 6 carbon atoms, 7 carbon atoms, 8 carbon atoms, 9 carbon atoms, 10 carbon atoms, 11 carbon atoms, 12 carbon atoms, 13 carbon atoms, 14 carbon atoms, 15 carbon atoms, 16 carbon atoms, 17 carbon atoms carbon atoms, 18 carbon atoms, 19 carbon atoms or 20 carbon atoms.
  • alkyl groups include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, n-pentyl, neopentyl, n-hexyl, and the like.
  • the alkyl group may be unsubstituted or substituted with one or more substituents including, but not limited to, alkyl, alkoxy, cyano, hydroxyl, carbonyl, carboxy, aryl, heteroaryl, Amino, halogen, sulfonyl, sulfinyl, phosphono, etc.
  • alkenyl by itself or as part of another substituent refers to an unsaturated branched, straight-chain or cyclic alkyl group having at least one carbon-carbon double bond by removal of the double bond from a single carbon atom of the parent alkene obtained from a hydrogen atom.
  • Typical alkenyl groups include, but are not limited to, vinyl; propenyl (e.g., prop-1-en-1-yl, prop-1-en-2-yl, prop-2-en-1-yl, prop-2-enyl -2-yl, cycloprop-1-en-1-yl); cycloprop-2-en-1-yl; butenyl (such as but-1-en-1-yl, but-1-en-2 -yl, 2-methyl-prop-1-en-1-yl, but-2-en-1-yl, but-2-en-2-yl, but-1,3-dien-1-yl , But-1,3-dien-2-yl, Cyclobut-1-en-1-yl, Cyclobut-1-en-3-yl, Cyclobut-1,3-dien-1-yl, etc. )wait.
  • propenyl e.g., prop-1-en-1-yl, prop-1-en-2-yl, prop-2-en-1-yl, prop-2
  • alkynyl by itself or as part of another substituent refers to an unsaturated branched, straight-chain or cyclic alkyl group having at least one carbon-carbon triple bond through a single carbon atom from the parent alkyne Obtained by removing a hydrogen atom.
  • Typical alkynyl groups include, but are not limited to, ethynyl; propynyl (such as prop-1-yn-1-yl, prop-2-yn-1-yl, etc.); butynyl (such as but-1-yn-1 -yl, but-1-yn-3-yl, but-3-yn-1-yl, etc.) and the like.
  • Carbocyclyl means a stable non-aromatic monocyclic or polycyclic hydrocarbon radical consisting only of carbon and hydrogen atoms, which may include fused or bridged ring systems, having from 3 to 15 carbon atoms, e.g. Has 3 to 10 (eg 3, 4, 5, 6, 7, 8, 9 or 10) carbon atoms and is saturated or unsaturated and attached to the remainder of the molecule by a single bond.
  • Monocyclic radicals include, for example, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and cyclooctyl.
  • Polycyclic radicals include, for example, adamantyl, norbornyl, decalinyl, and the like.
  • carbocyclic groups may be optionally substituted with one or more substituents independently selected from the group consisting of alkyl, halogen, haloalkyl, cyano, nitro, oxo, aryl, aralkyl radical, carbocyclyl, carbocyclylalkyl, heterocyclyl, heterocyclylalkyl, heteroaryl, heteroarylalkyl.
  • Aryl refers to an all-carbon monocyclic or all-carbon fused ring with a fully conjugated pi-electron system, typically having 5-14 carbon atoms, eg, 6, 10, 12, 14 carbon atoms.
  • Aryl groups may be unsubstituted or substituted with one or more substituents including, but not limited to, alkyl, alkoxy, cyano, hydroxyl, carboxy, aryl, aralkyl, amine, Halogen, sulfonyl, sulfinyl, phosphono.
  • unsubstituted aryl groups include, but are not limited to, phenyl, naphthyl, and anthracenyl.
  • Heterocyclyl means a stable 3- to 18-membered aromatic or non-aromatic ring substituent consisting of 2 to 8 (eg 2, 3, 4, 5, 6, 7 or 8) carbon atoms and It consists of 1 to 6 (1, 2, 3, 4, 5 or 6) heteroatoms selected from nitrogen, oxygen and sulfur.
  • the heterocyclyl group can be a monocyclic, bicyclic, tricyclic or tetracyclic ring system, which can include fused or bridged ring systems; and the nitrogen, carbon or sulfur atoms in the heterocyclyl group can optionally be replaced by oxidized; the nitrogen atom is optionally quaternized; and the heterocyclyl can be partially or fully saturated.
  • heterocyclic groups include, but are not limited to, dioxolanyl, dioxinyl, thienyl[1,3]dithianyl, decahydroisoquinolyl, imidazolinyl, imidazolidinyl, iso Thiazolidinyl, isoxazolidinyl, morpholinyl, octahydroindolyl, octahydroisoindolyl, 2-oxopiperazinyl, 2-oxopiperidinyl, 2-oxopyrrolidinyl , oxazolidinyl, piperidinyl, piperazinyl, 4-piperidinonyl, piperrolidinyl, pyrazolidinyl, quinuclidinyl, thiazolidinyl, 1,2,4-thiadiazole -5(4H)-yl, tetrahydrofuranyl, trioxanyl, trithianyl, triazin
  • the heterocyclic group may be optionally substituted by one or more substituents selected from the group consisting of alkyl, alkenyl, halogen, haloalkyl, cyano, oxo, thioxo , nitro, aryl, aralkyl, cycloalkyl, cycloalkylalkyl, optionally substituted heterocyclyl, optionally substituted heterocyclylalkyl, optionally substituted heteroaryl, optionally substituted hetero Arylalkyl.
  • Alkoxy means the formula -O-(alkyl), wherein alkyl is as defined herein.
  • alkoxy groups are methoxy, ethoxy, n-propoxy, 1-methylethoxy (isopropoxy), n-butoxy, isobutoxy, sec-butoxy , tert-butoxyl. Alkoxy groups can be substituted or unsubstituted.
  • Halogen means fluorine (F), chlorine (Cl), bromine (Br), or iodine (I).
  • Amino refers to -NH2 .
  • Niro refers to -NO2 .
  • Carboxy means -COOH.
  • Stereoisomer refers to isomeric compounds that have the same sequence of bonding of the atoms but differ in the arrangement of the atoms in space. Stereoisomers can have one or more stereocenters and each center can exist as R or S, and stereoisomers can also be cis-trans isomers. Stereoisomers of compounds provided herein include any one or appropriate mixtures of all diastereomeric, enantiomeric and cis-trans isomeric forms thereof.
  • Pharmaceutically acceptable salts include pharmaceutically acceptable salts of compounds with a wide variety of organic and inorganic counterions well known in the art, only exemplary salts include, when the molecule contains an acidic functional group, organic or inorganic salts Such as lithium salt, sodium salt, potassium salt, calcium salt, magnesium salt, ammonium salt, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, 2-dimethylaminoethanol, 2-di Ethylaminoethanol, Dicyclohexylamine, Lysine, Arginine, Histidine, Caffeine, Procaine, Choline, Betaine, Ethylenediamine, Glucosamine, Methylglucosamine, Cocoa Alkali, purine piperazine, piperidine, N-ethyl, piperidine, polyamine resin and tetraalkylammonium salt, etc.; and when the molecule contains basic functional groups, organic or inorganic acid
  • acids include sulfuric acid, nitric acid, phosphoric acid, propionic acid, glycolic acid, pyruvic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic cinnamic acid, mandelic acid, methanesulfonic acid, Ethylsulfonic acid, p-toluenesulfonic acid salicylic acid, etc.
  • Solvates include hydrates.
  • the antibody provided by the invention is an anti-folate receptor ⁇ antibody or an antigen-binding unit thereof.
  • an antibody of the invention is capable of specifically binding human folate receptor alpha.
  • the invention provides a humanized anti-FR ⁇ antibody or an antigen-binding unit thereof.
  • these antibodies are collectively referred to as anti-FR ⁇ antibodies.
  • the anti-FR ⁇ antibody or its antigen-binding unit of the present invention has characteristics including but not limited to binding to FR ⁇ (such as human FR ⁇ ) in vitro, binding to cells expressing FR ⁇ , high affinity, and strong internalization ability.
  • the anti-FR ⁇ antibody of the present invention can specifically bind to folate receptor ⁇ (FOLR1), but not to folate receptor ⁇ (FOLR2) or folate receptor ⁇ (FOLR3).
  • FOLR1 folate receptor ⁇
  • FOLR2 folate receptor ⁇
  • FOLR3 folate receptor ⁇
  • the antigen-binding fragment or antigen-binding unit of an anti-FR ⁇ antibody is a Fab, Fab', F(ab') 2 , Fv, disulfide-linked Fv, scFv, single domain antibody or diabody Antibody.
  • the anti-FR ⁇ antibody is a multispecific antibody (eg, a bispecific antibody).
  • the anti-FR ⁇ antibody can be a monoclonal antibody.
  • the binding specificity of the antibody disclosed in the present invention or its antigen-binding unit can be determined by in vitro experiments, such as co-immunoprecipitation, radioimmunoassay (RIA), surface plasmon resonance, flow cytometry (Facs) or enzyme-linked immunosorbent assay (ELISA). ) to detect.
  • in vitro experiments such as co-immunoprecipitation, radioimmunoassay (RIA), surface plasmon resonance, flow cytometry (Facs) or enzyme-linked immunosorbent assay (ELISA).
  • the invention also includes antibodies that bind to the same epitope as the anti-FR ⁇ antibodies described herein.
  • an antibody of the invention specifically binds an epitope comprising one or more amino acid residues on human FR ⁇ .
  • the antibody comprises a heavy chain constant region, such as an IgGl, IgG2, IgG3, IgG4, IgA, IgE, IgM, or IgD constant region.
  • an anti-FR ⁇ antibody or an antigen-binding unit thereof comprises a human IgG constant domain, a human IgA constant domain, a human IgE constant domain, a human IgM constant domain, and a human IgD constant domain.
  • Immunoglobulin heavy chain constant domain such as an IgGl, IgG2, IgG3, IgG4, IgA, IgE, IgM, or IgD constant region.
  • the anti-FR ⁇ antibody or antigen binding unit thereof comprises an IgG1 heavy chain constant region, an IgG2 heavy chain constant region, an IgG3 heavy chain constant region, or an IgG4 heavy chain constant region.
  • the heavy chain constant region is an IgGl heavy chain constant region or an IgG4 heavy chain constant region.
  • the antibody or antigen binding unit thereof comprises a light chain constant region, eg, a kappa light chain constant region or a lambda light chain constant region. In one or more embodiments, the antibody or antigen binding unit thereof comprises a kappa light chain constant region.
  • the Fc portion of an antibody mediates several important effector functions (e.g., cytokine induction, antibody-dependent cell-mediated cytotoxicity (ADCC), phagocytosis, complement-dependent cytotoxicity (CDC), and antibody and antigen-antibody complexing drug half-life/clearance). In some cases, these effector functions are desirable for therapeutic antibodies, but in other cases may be unnecessary or even deleterious, depending on the therapeutic goal.
  • Certain human IgG isotypes, particularly IgGl and IgG3, mediate ADCC and CDC via binding to Fc ⁇ Rs and complement CIq, respectively.
  • the nascent Fc receptor (FcRn) is a key component determining the circulating half-life of antibodies.
  • At least one amino acid residue in the constant region of the antibody is substituted such that the effector function of the antibody is altered.
  • substitution of amino acid residues in the Fc region of an antibody to alter antibody effector function is described in US Pat. Nos. 5,648,260 and 5,624,821, which are incorporated herein by reference.
  • the invention includes labeled anti-FR ⁇ antibodies, or antigen-binding units thereof, wherein the antibody is derivatized or linked to one or more functional molecules (eg, another peptide or protein).
  • a labeled antibody can be derived by functionally linking (by chemical coupling, gene fusion, non-covalent association or otherwise) an antibody of the invention, or an antigen-binding unit thereof, to one or more other molecular entities, which One or more other molecular entities such as another antibody (e.g., a bispecific or diabody), a detectable reagent, a pharmaceutical agent, can mediate the interaction of an antibody or its antigen-binding unit with another molecule (such as an avidin streptavidin core region or polyhistidine tag) and/or a cytotoxic or therapeutic agent selected from the group consisting of: mitotic inhibitors, antitumor antibiotics, immunomodulators, gene therapy Carriers, alkylating agents, antiangiogenic agents, antimetabolites,
  • an antibody of the invention is linked to a detectable reagent, for example, by incorporation of a radiolabeled amino acid, or by attachment to an avidin that can be labeled (for example, containing a fluorescent label or Polypeptides with biotinyl moieties detectable by optical methods or calorimetrically detected enzymatic activity (streptavidin).
  • a detectable reagent for example, by incorporation of a radiolabeled amino acid, or by attachment to an avidin that can be labeled (for example, containing a fluorescent label or Polypeptides with biotinyl moieties detectable by optical methods or calorimetrically detected enzymatic activity (streptavidin).
  • markers or markers may also be therapeutic.
  • Various methods of labeling polypeptides and glycoproteins are known in the art and can be used.
  • labels for polypeptides include, but are not limited to, the following: radioisotopes or radionuclides (eg, 3 H, 14 C, 15 N, 35 S, 90 Y, 99 Tc, 111 In, 125 I, 131 I ), fluorescent labels (eg, FITC, rhodamine, lanthanide phosphors), enzyme labels (eg, horseradish peroxidase, ⁇ -galactosidase, luciferase, alkaline phosphatase), chemiluminescence Tag, biotinyl, predetermined polypeptide epitope recognized by the secondary reporter gene (eg, leucine zipper pair sequence, secondary antibody binding site, metal binding domain, epitope tag).
  • labels are attached via spacer arms of various lengths to reduce possible steric hindrance.
  • an antibody of the invention or an antigen-binding unit thereof can be used to detect the presence of FRa (eg, human FRa) in a sample.
  • the antibody comprises a detectable reagent.
  • the antibodies are polyclonal antibodies, or more preferably monoclonal antibodies. Whole antibodies or antigen-binding units thereof (eg, Fab, scFv or F(ab') 2 ) can be used.
  • the detection methods of the described embodiments can be used to detect analyte mRNA, protein or genomic DNA in a biological sample both in vitro and in vivo.
  • in vitro detection techniques for analyte mRNA include Northern hybridization and in situ hybridization
  • in vitro detection techniques for analyte protein include enzyme-linked immunosorbent assay (ELISA), Western blot, immunoprecipitation, and immunofluorescence
  • in vitro detection techniques for analyte genomic DNA include Southern hybridization.
  • techniques for in vivo detection of analyte proteins include introducing into a patient a labeled anti-analyte protein antibody.
  • antibodies can be labeled with a radioactive label, the presence and location of which can then be detected in the patient by standard imaging techniques.
  • folate receptor alpha can be detected in a biological sample as part of a clinical testing procedure, eg, to determine the efficacy of a given treatment regimen. Detection can be facilitated by conjugating (eg, physically linking) the antibody to a detectable substance.
  • detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials.
  • suitable enzymes include horseradish peroxidase, alkaline phosphatase, ⁇ -galactosidase, or acetylcholinesterase;
  • suitable prosthetic complexes include streptavidin/biotin and avidin/ Biotin;
  • suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylfluorescein, dansyl chloride, or phycoerythrin;
  • an example of a luminescent material includes luciferin Minol;
  • bioluminescent materials include luciferase, luciferin, and aequorin;
  • suitable radioactive materials include125I,131I , 35S , or3H .
  • the anti-FR ⁇ antibody of the present invention includes a humanized antibody or an antigen-binding unit thereof. These antibodies, or antigen-binding units thereof, are suitable for administration to a human without causing an adverse immune response in the human to the administered immunoglobulin.
  • the humanized anti-FR ⁇ antibody of the present invention or its antigen binding unit comprises VH CDR1 as shown in SEQ ID NO:5; VH CDR2 as shown in SEQ ID NO:6; and as shown in VH CDR3 shown in SEQ ID NO:7.
  • the humanized anti-FR ⁇ antibody of the present invention or its antigen-binding unit comprises VL CDR1 as shown in SEQ ID NO: 8; VL CDR2 as shown in SEQ ID NO: 9; and as shown in VL CDR3 shown in SEQ ID NO:10.
  • the humanized anti-FR ⁇ antibody of the present invention or its antigen-binding unit comprises VH CDR1 shown in SEQ ID NO: 5; VH CDR2 shown in SEQ ID NO: 6; VH CDR3 shown in ID NO:7; VL CDR1 shown in SEQ ID NO:8; VL CDR2 shown in SEQ ID NO:9; VL CDR3 shown in SEQ ID NO:10.
  • the humanized anti-FR ⁇ antibody or antigen-binding unit thereof of the invention further comprises a framework region.
  • the framework regions of the exemplary antibody VH and VL herein are shown in Table 1.
  • the humanized anti-FR ⁇ antibody of the present invention or its antigen-binding unit comprises VH FR1 as shown in SEQ ID NO: 1; VH CDR1 as shown in SEQ ID NO: 5; VH FR2 as shown in SEQ ID NO:2; VH CDR2 as shown in SEQ ID NO:6; VH FR3 as shown in SEQ ID NO:3; VH CDR3 as shown in SEQ ID NO:7; VH FR4 shown in SEQ ID NO: 11.
  • the humanized anti-FR ⁇ antibody or antigen-binding unit thereof of the present invention comprises VH FR1 as shown in SEQ ID NO:29; VH CDR1 as shown in SEQ ID NO:5; VH FR2 as shown in SEQ ID NO:30; VH CDR2 as shown in SEQ ID NO:6; VH FR3 as shown in SEQ ID NO:31; VH CDR3 as shown in SEQ ID NO:7; VH FR4 shown in SEQ ID NO: 11.
  • the humanized anti-FR ⁇ antibody of the present invention or its antigen-binding unit comprises VL FR1 as shown in SEQ ID NO: 12; VL CDR1 as shown in SEQ ID NO: 8; VL FR2 as shown in SEQ ID NO:13; VL CDR2 as shown in SEQ ID NO:9; VLFR3 as shown in SEQ ID NO:4; VL CDR3 as shown in SEQ ID NO:10; VLFR4 shown in ID NO:14.
  • the humanized anti-FR ⁇ antibody of the present invention or its antigen-binding unit comprises VL FR1 as shown in SEQ ID NO: 12; VL CDR1 as shown in SEQ ID NO: 8; VL FR2 as shown in SEQ ID NO:13; (4) VL CDR2 as shown in SEQ ID NO:9; VLFR3 as shown in SEQ ID NO:32; VL CDR3 as shown in SEQ ID NO:10; and VL FR4 as shown in SEQ ID NO:14.
  • the humanized anti-FR ⁇ antibody of the present invention or its antigen-binding unit comprises: a heavy chain variable region comprising VH FR1 as shown in SEQ ID NO: 1; as shown in SEQ ID NO VH CDR1 shown in :5; VH FR2 shown in SEQ ID NO:2; VH CDR2 shown in SEQ ID NO:6; VH FR3 shown in SEQ ID NO:3; VH CDR3 as shown; and VH FR4 as shown in SEQ ID NO:11; and light chain variable region, comprising VL FR1 as shown in SEQ ID NO:12; VL CDR1 as shown in SEQ ID NO:8 VL FR2 as shown in SEQ ID NO:13; VL CDR2 as shown in SEQ ID NO:9; VL FR3 as shown in SEQ ID NO:4; VL CDR3 as shown in SEQ ID NO:10; and VLFR4 as shown in SEQ ID NO:14.
  • the humanized anti-FR ⁇ antibody of the present invention or its antigen-binding unit comprises: a heavy chain variable region comprising VH FR1 as shown in SEQ ID NO: 29; as shown in SEQ ID NO VH CDR1 shown in :5; VH FR2 shown in SEQ ID NO:30; VH CDR2 shown in SEQ ID NO:6; VH FR3 shown in SEQ ID NO:31; VH CDR3 as shown; and VH FR4 as shown in SEQ ID NO:11; and light chain variable region, comprising VL FR1 as shown in SEQ ID NO:12; VL CDR1 as shown in SEQ ID NO:8 VL FR2 as shown in SEQ ID NO:13; VL CDR2 as shown in SEQ ID NO:9; VL FR3 as shown in SEQ ID NO:32; VL CDR3 as shown in SEQ ID NO:10; and VL FR4 as shown in SEQ ID NO:14.
  • the humanized anti-FR ⁇ antibody of the present invention or its antigen binding unit, its heavy chain variable region comprises the amino acid sequence shown in SEQ ID NO: 15, or with SEQ ID NO: 15
  • the indicated amino acid sequence has suitable sequence identity to an amino acid sequence, such as at least 80% sequence identity, or at least 90% sequence identity, or at least 95% sequence identity, or at least 99% sequence identity
  • And/or its light chain variable region comprises an amino acid sequence as shown in SEQ ID NO: 16, or an amino acid sequence with suitable sequence identity compared with the amino acid sequence shown in SEQ ID NO: 16, such as having at least 80 % sequence identity, or at least 90% sequence identity, or at least 95% sequence identity, or at least 99% sequence identity.
  • at least the CDRs of these amino acid sequences having sequence identity are unchanged.
  • the humanized anti-FR ⁇ antibody of the present invention or its antigen-binding unit comprises a heavy chain variable region as shown in SEQ ID NO: 15 and a light chain as shown in SEQ ID NO: 16 variable region.
  • the humanized anti-FR ⁇ antibody or antigen binding unit thereof of the present invention further comprises a heavy chain constant region comprising the amino acid sequence shown in SEQ ID NO: 17, or An amino acid sequence having suitable sequence identity compared to the amino acid sequence shown in SEQ ID NO: 17, such as having at least 80% sequence identity, or at least 90% sequence identity, or at least 95% sequence identity, or at least 99% sequence identity.
  • the humanized anti-FR ⁇ antibody or antigen binding unit thereof of the present invention further comprises a light chain constant region comprising the amino acid sequence shown in SEQ ID NO: 18, or An amino acid sequence having suitable sequence identity compared to the amino acid sequence shown in SEQ ID NO: 18, such as having at least 80% sequence identity, or at least 90% sequence identity, or at least 95% sequence identity, or at least 99% sequence identity.
  • the heavy chain of the humanized anti-FR ⁇ antibody of the present invention or its antigen-binding unit comprises the amino acid sequence shown in SEQ ID NO: 19, or the amino acid sequence shown in SEQ ID NO: 19 Amino acid sequences having suitable sequence identity compared to the sequences, such as having at least 80% sequence identity, alternatively at least 90% sequence identity, alternatively at least 95% sequence identity, alternatively at least 99% sequence identity.
  • the light chain of the humanized anti-FR ⁇ antibody of the present invention or its antigen-binding unit comprises the amino acid sequence shown in SEQ ID NO: 20, or the amino acid sequence shown in SEQ ID NO: 20 Amino acid sequences having suitable sequence identity compared to the sequences, such as having at least 80% sequence identity, alternatively at least 90% sequence identity, alternatively at least 95% sequence identity, alternatively at least 99% sequence identity.
  • the heavy chain of the humanized anti-FR ⁇ antibody or its antigen binding unit of the present invention further comprises a signal peptide, such as MDWTWRILFLVAAATGAHS (SEQ ID NO: 21), its nucleotide sequence is atggattggacctggagaatcctgttcctggtggccgccgccaccggcgctcattct (SEQ ID NO:25).
  • a signal peptide such as MDWTWRILFLVAAATGAHS (SEQ ID NO: 21)
  • its nucleotide sequence is atggattggacctggagaatcctgttcctggtggccgccgccaccggcgctcattct (SEQ ID NO:25).
  • the light chain of the humanized anti-FR ⁇ antibody or its antigen binding unit of the present invention further comprises a signal peptide, such as MEAPAQLLFLLLLWLPDTTG (SEQ ID NO: 22), its nucleotide sequence is atggaggcccctgcccagctgctgttcctgctgctgctgtggctgcctgataccaccggc (SEQ ID NO:26).
  • a signal peptide such as MEAPAQLLFLLLLWLPDTTG (SEQ ID NO: 22
  • its nucleotide sequence is atggaggcccctgcccagctgctgttccctgctgctgtggctgcctgataccaccggc (SEQ ID NO:26).
  • the binding dissociation equilibrium constant (KD) of the humanized anti-FR ⁇ antibody or antigen-binding unit thereof of the invention to FR ⁇ is about 1 ⁇ M or less. In one or more embodiments, the humanized anti-FR ⁇ antibody of the invention or an antigen-binding unit thereof binds to FR ⁇ with a KD between about 100 nM and about 1 pM or lower. In one or more embodiments, the humanized anti-FR ⁇ antibody of the invention or an antigen-binding unit thereof binds to FR ⁇ with a KD between about 10 nM and about 1 pM or lower. In one or more embodiments, the humanized anti-FR ⁇ antibody of the invention or an antigen-binding unit thereof binds to FR ⁇ with a KD between about 1 nM and about 0.1 nM or lower.
  • the KD of the humanized anti-FR ⁇ antibody of the present invention or its antigen-binding unit binding to human FR ⁇ is about 1 ⁇ M to about 1 pM between or lower. In one or more embodiments, the KD of the humanized anti-FR ⁇ antibody of the present invention or its antigen-binding unit binding to human FR ⁇ is between about 100 nM to about 1 pM or lower; or, between about 10 nM to about 1 pM or lower; or, between about 1 nM to about 1 pM or lower.
  • the anti-FR ⁇ antibody or its antigen-binding unit of the present invention can be coupled with a drug to form an anti-FR ⁇ antibody-drug conjugate (anti-FR ⁇ ADC).
  • antibody drug conjugates (ADCs) can selectively deliver one or more drugs to target tissues (e.g., tumors expressing FR ⁇ ), antibody drug conjugates (ADCs) can increase the efficacy of antibodies in treating diseases (e.g., cancer ) in the therapeutic effect.
  • the antibody drug conjugate (ADC) of the present invention comprises the anti-FR ⁇ antibody or its antigen-binding unit described herein and at least one drug (such as exinotecan).
  • the ADC of the present invention has properties including but not limited to binding to FRa (such as human FRa) in vitro, binding to cells expressing FRa, high affinity, strong internalization ability, and reducing or inhibiting the growth of cancer cells or tumors.
  • Antigen-binding fragments or antigen-binding units of anti-FR ⁇ antibodies of the invention can be conjugated to the drugs described herein. Therefore, in one or more embodiments, the antigen-binding fragment or antigen-binding unit of the anti-FR ⁇ antibody described herein is coupled to a drug through a linker to form an anti-FR ⁇ ADC.
  • Anti-FR ⁇ ADCs of the invention comprise an antibody or antigen-binding unit thereof that specifically binds FR ⁇ (eg, human FR ⁇ ) linked to one or more drugs.
  • the specificity of the ADC can be determined by the specificity of the antibody (eg, anti-FR ⁇ antibody).
  • the anti-FR ⁇ antibody is linked to one or more drugs (eg, DNA topoisomerase inhibitors) that are delivered to the FR ⁇ -expressing cells, especially cancer cells expressing FR ⁇ .
  • the anti-FR ⁇ antibody drug conjugate comprises an anti-FR ⁇ antibody coupled to a drug (eg, exinotecan) via a linker.
  • the anti-FR ⁇ antibodies described herein provide ADCs with the ability to bind FR ⁇ such that drugs attached to the antibodies can be delivered to cells expressing FR ⁇ , particularly cancer cells expressing FR ⁇ .
  • the ADC is a structure as shown in Formula I or a stereoisomer or a pharmaceutically acceptable salt or solvate thereof.
  • Abu is Antibody 1.
  • the ADC is ADC1 or ADC2, or a pharmaceutically acceptable salt or solvate thereof.
  • the antibody-drug conjugates of the present invention have obvious bystander effect.
  • the ADC of the invention binds to FRa with a binding-dissociation equilibrium constant (KD) of about 1 ⁇ or less. In one or more embodiments, the ADC of the invention binds FRa with a KD between about 100 nM and about 1 pM or lower. In one or more embodiments, the ADC of the invention binds FRa with a KD between about 10 nM to about 1 pM or lower. In one or more embodiments, the ADC of the invention binds FRa with a KD between about 1 nM to about 1 pM or lower.
  • KD binding-dissociation equilibrium constant
  • the ADC of the present invention binds to human FR ⁇ (such as the antigen FR ⁇ -His shown in SEQ ID NO: 28) with a KD of about 1 ⁇ M or lower. In one or more embodiments, the ADC of the present invention binds to human FR ⁇ with a KD between about 100 nM to about 1 pM or lower; or, between about 10 nM to about 1 pM or lower; or, between about 1 nM to about 1 pM or lower; Between about 1 pM or less; alternatively, between about 1 nM to about 0.1 nM or less; alternatively, between about 0.5 nM to about 0.1 nM or less.
  • the invention also provides the preparation method of the intermediate and the antibody drug conjugate.
  • the intermediates and antibody drug conjugates of the present invention can be prepared by known preparations and methods.
  • the methods for preparing intermediate compounds 1-7 and compound 7 are as follows.
  • the first step the compound of general formula 1-1 and the compound of general formula 1-1' react under alkaline conditions to obtain the compound of general formula 1-2;
  • the second step reacting the compound of general formula 1-2 and general formula (AA) i -(FF 1 ) f under alkaline conditions in the presence of a condensing agent to obtain the compound of general formula 1-3;
  • the third step remove the amino protecting group W of the compound of general formula 1-3 to obtain the compound of general formula 1-4;
  • the fourth step the compound of general formula 1-4 and the compound of general formula 1-5 are reacted under alkaline conditions to obtain the compound of general formula 1-6;
  • the fifth step reacting the compound of general formula 1-6 and bis(p-nitrophenyl)carbonate under basic conditions to obtain the compound of general formula 1-7.
  • the first step the compound of general formula 1 and the compound of general formula 1' react under alkaline conditions to obtain the compound of general formula 2;
  • the second step the compound of general formula 2 reacts with the compound of general formula (AA) i -(FF 1 ) f under alkaline conditions in the presence of a condensing agent to obtain the compound of general formula 3;
  • the third step remove the amino protecting group W of the compound of general formula 3 to obtain the compound of general formula 4;
  • the fourth step the compound of general formula 4 and the compound of general formula 5 are reacted under alkaline conditions to obtain the compound of general formula 6;
  • the fifth step the compound of general formula 6 is reacted with bis(p-nitrophenyl)carbonate under basic conditions to obtain the compound of general formula 7.
  • W 1 is an amino protecting group, such as 9-fluorenylmethoxycarbonyl
  • W 2 is a carboxylic acid active ester, such as succinimide ester.
  • R F is F.
  • z is 0.
  • z is 1 or 2.
  • the intermediate is:
  • R, n are as described herein.
  • the intermediate is:
  • R, n are as described herein.
  • the intermediate is:
  • n is as described herein.
  • the intermediate is:
  • n is as described herein.
  • the intermediate is:
  • the above-mentioned basic conditions can be provided by reagents, which include organic bases and inorganic bases, and said organic bases include but not limited to triethylamine, diethylamine, N-methylmorpholine, pyridine, hexahydropyridine, N,N-diisopropylethylamine, n-butyllithium, lithium diisopropylamide, potassium acetate, sodium tert-butoxide or potassium tert-butoxide, the inorganic bases include but not limited to sodium hydride, potassium phosphate , sodium carbonate, potassium carbonate, cesium carbonate, sodium hydroxide and lithium hydroxide.
  • organic bases include but not limited to triethylamine, diethylamine, N-methylmorpholine, pyridine, hexahydropyridine, N,N-diisopropylethylamine, n-butyllithium, lithium diisopropylamide, potassium acetate, sodium
  • the above-mentioned condensing agent can be selected from N,N,N',N'-tetramethyl-O-(7-azabenzotriazol-1-yl)urea hexafluorophosphate, 4-(4,6-dimethyl Oxy-1,3,5-triazin-2-yl)-4-methylmorpholine chloride, 1-hydroxybenzotriazole and 1-(3-dimethylaminopropyl)-3-ethane Carbodiimide Hydrochloride, N,N'-Dicyclohexylcarbodiimide, N,N'-Diisopropylcarbodiimide, O-Benzotriazole-N,N,N ',N'-tetramethyluronium tetrafluoroborate, 1-hydroxybenzotriazole, 1-hydroxy-7-azobenzotriazole, O-benzotriazole-N,N,N ',N'-tetramethyluronium hexafluorophosphate
  • the methods for preparing intermediate compounds 1-8 and compound 8 are as follows.
  • the compound of general formula 7 is reacted with D in the presence of a condensing agent under basic conditions to obtain the compound of general formula 8.
  • n, AA, R, i, f, FF 2 , FF, D are as described herein.
  • the intermediate shown is:
  • R, n, D are as described herein.
  • the intermediate is:
  • R, n, D are as described herein.
  • the intermediate is:
  • n and D are as described herein.
  • the intermediate is:
  • n and D are as described herein.
  • the intermediate is:
  • the above-mentioned basic conditions can be provided by reagents, which include organic bases and inorganic bases, and said organic bases include but not limited to triethylamine, diethylamine, N-methylmorpholine, pyridine, hexahydropyridine, N,N-diisopropylethylamine, n-butyllithium, lithium diisopropylamide, potassium acetate, sodium tert-butoxide or potassium tert-butoxide, the inorganic bases include but not limited to sodium hydride, potassium phosphate , sodium carbonate, potassium carbonate, cesium carbonate, sodium hydroxide and lithium hydroxide.
  • organic bases include but not limited to triethylamine, diethylamine, N-methylmorpholine, pyridine, hexahydropyridine, N,N-diisopropylethylamine, n-butyllithium, lithium diisopropylamide, potassium acetate, sodium
  • the above-mentioned condensing agent can be selected from N,N,N',N'-tetramethyl-O-(7-azabenzotriazol-1-yl)urea hexafluorophosphate, 4-(4,6-dimethyl Oxy-1,3,5-triazin-2-yl)-4-methylmorpholine chloride, 1-hydroxybenzotriazole and 1-(3-dimethylaminopropyl)-3-ethane Carbodiimide Hydrochloride, N,N'-Dicyclohexylcarbodiimide, N,N'-Diisopropylcarbodiimide, O-Benzotriazole-N,N,N ',N'-tetramethyluronium tetrafluoroborate, 1-hydroxybenzotriazole, 1-hydroxy-7-azobenzotriazole, O-benzotriazole-N,N,N ',N'-tetramethyluronium hexafluorophosphate
  • the methods for preparing intermediate compounds 1-9 and compound 9 are as follows.
  • n, AA, R, i, f, FF, D, Abu are as described herein.
  • the coupling schematic diagram is shown in Figure 1.
  • the interchain disulfide bond on the anti-FR ⁇ antibody provided by the present invention is reduced and opened by a thiol reducing agent to generate a free sulfhydryl group, and then undergoes a coupling reaction with the compound of formula 8 , to obtain the antibody-drug conjugate shown in formula 9.
  • the above-mentioned weakly acidic conditions can be provided by reagents, which include organic acids and inorganic acids, and said organic acids include but are not limited to acetic acid, benzoic acid, tartaric acid, oxalic acid, malic acid, citric acid, ascorbic acid, citric acid, citrate Rhenic acid, salicylic acid, caffeic acid, sorbic acid, quinic acid, oleanolic acid, succinic acid, chlorogenic acid, formic acid, propionic acid, the inorganic acids include but not limited to carbonic acid, nitrous acid, acetic acid , hypochlorous acid, hydrofluoric acid, sulfurous acid, hydrogen sulfuric acid, silicic acid, metasilicate, phosphoric acid, metaphosphoric acid, sodium bicarbonate, sodium bisulfite.
  • organic acids include but are not limited to acetic acid, benzoic acid, tartaric acid, oxalic acid, malic acid, citric acid, ascorbic acid,
  • the drug conjugate can be purified by conventional methods, such as preparative high-performance liquid chromatography (prep-HPLC) and other methods.
  • pre-HPLC preparative high-performance liquid chromatography
  • the anti-FR ⁇ antibody or its antigen-binding unit, and the antibody-drug conjugate coupled with the anti-FR ⁇ antibody of the present invention can be incorporated into a pharmaceutical composition suitable for administration.
  • a pharmaceutical composition suitable for administration suitable for administration.
  • the principles and considerations involved in the preparation of such compositions and guidance for selecting components are well known in the art, see, e.g., Remington's Pharmaceutical Sciences: The Science And Practice Of Pharmacy, 19th Ed., Mack Pub. Co., Easton , Pa.: 1995; Drug Absorption Enhancement: Concepts, Possibilities, Limitations, And Trends, Harwood Academic Publishers, Langhorne, Pa., 1994; Peptide And Protein Drug Delivery, Advances In Parenteral Sciences, Volume 4, 1991, M. Dekker , New York.
  • compositions generally comprise an antibody or an antigen-binding unit thereof or an antibody-drug conjugate and a pharmaceutically acceptable carrier.
  • antibody fragments or antigen binding units are used as minimal inhibitory fragments that specifically bind to a target protein binding domain.
  • the pharmaceutical composition further comprises an anti-cancer agent (eg, an immune checkpoint inhibitor).
  • the term "pharmaceutically acceptable carrier” is intended to include any and all solvents, stabilizers, buffers, dispersion media, coatings, bacteriostats, isotonic and absorption delaying agents compatible with pharmaceutical administration. agent etc. Suitable carriers are described in Remington's Pharmaceutical Sciences. Such carriers or diluents may optionally include, but are not limited to, water, physiological saline, Ringer's solution, dextrose solution, and 5% human serum albumin.
  • formulations to be used for in vivo administration must be sterile, which is readily accomplished by filtration through sterile membrane filters.
  • compositions can be formulated in dosage unit form for ease of administration and uniformity of dosage.
  • Dosage unit form as used herein refers to physically separable units suited as unitary dosages for the subjects to be treated; each unit containing a predetermined quantity of a drug calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. or a plurality of said antibodies.
  • the pharmaceutical composition can be presented in a container or dispenser and packaged with instructions for administration.
  • compositions of the present invention may also contain other active ingredients, preferably those with complementary activities that do not adversely affect each other, depending on the particular condition to be treated.
  • the composition may include agents that enhance its function, such as cytotoxic agents, cytokines, chemotherapeutics, or growth inhibitory agents.
  • active ingredients are suitably present in combination in amounts effective for the intended purpose.
  • the pharmaceutical composition provided by the present invention can be administered by any convenient route, such as by infusion or bolus injection, absorbed through the epithelium or mucous membrane of the skin (such as oral mucosa, rectal and intestinal mucosa, etc.), and can be co-administered with other biologically active agents .
  • the pharmaceutical composition can be administered intravenously, orally, rectally, parenterally, intracisternally, intravaginally, intraperitoneally, externally (e.g. by powder, ointment, drops, etc.) or transdermal patch), orally, or by oral or nasal spray.
  • the pharmaceutical composition is formulated into a pharmaceutical composition suitable for intravenous injection into a human body according to conventional procedures.
  • Pharmaceutical compositions for intravenous administration are generally solutions in sterile isotonic aqueous buffer.
  • the pharmaceutical composition may also contain a solubilizer and a local anesthetic such as lidocaine to relieve pain at the injection site.
  • the active ingredients are presented alone or in combination in unit dosage form, eg, as a dry lyophilized powder or water-free concentrate, in a hermetically sealed container such as an ampoule or sachet indicating the quantity of active agent.
  • the composition may be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline.
  • an ampoule of sterile water or saline for injection can be used so that the active ingredient can be mixed before administration.
  • compositions of the present invention may be formulated as neutral or salt forms.
  • the antibodies or antigen-binding units thereof or ADCs described herein are useful in a variety of applications including, but not limited to, methods of therapy, such as the treatment of tumors.
  • the antibody or antigen-binding unit thereof or ADC can be used to inhibit tumor growth, reduce tumor volume, and/or reduce tumorigenicity of a tumor.
  • the method of use can be an in vitro, ex vivo or in vivo method.
  • an antibody, or antigen-binding unit thereof, or ADC described herein is an antagonist of the FR ⁇ to which it binds.
  • the method of inhibiting tumor growth comprises contacting a tumor with an anti-FR ⁇ antibody or antigen binding unit thereof or ADC or a pharmaceutical composition comprising the same in vitro.
  • an immortalized cell line or cancer cell expressing FR ⁇ is cultured in a medium supplemented with an anti-FR ⁇ antibody or antigen-binding unit thereof or ADC or a pharmaceutical composition comprising the same.
  • tumor cells are isolated from a patient sample and added to a culture medium containing an anti-FR ⁇ antibody or antigen-binding unit thereof or ADC or a pharmaceutical composition comprising the same.
  • the method of inhibiting tumor growth comprises contacting a tumor or tumor cells in vivo with an anti-FR ⁇ antibody or antigen binding unit thereof or ADC or a pharmaceutical composition comprising the same.
  • the antibody or its antigen-binding unit or ADC provided by the present invention or the pharmaceutical composition comprising it can be used for diagnosis, prognosis, monitoring, treatment, alleviation and/or prevention of diseases and disorders related to abnormal expression of FR ⁇ in patients.
  • diseases and conditions associated with abnormal expression of FR ⁇ are identified in patients by using conventional methods, the antibody or its antigen-binding unit or ADC of the present invention or a pharmaceutical composition comprising the same can be administered.
  • the degree of FR ⁇ expression is detected by immunohistochemistry (IHC), flow cytometry or nucleic acid hybridization and the like.
  • IHC immunohistochemistry
  • WO 2014/036495 and WO 2015/031815 provide exemplary antibodies, detection methods and kits for detecting FR ⁇ , all of which are incorporated herein by reference.
  • the present invention relates to a method for treating a disease related to FR ⁇ as a therapeutic target, thereby improving, slowing down, inhibiting, treating or preventing any disease associated with abnormal expression of FR ⁇ (for example, overexpression of FR ⁇ ) or Disease; relates to providing methods for treating tumors (including benign tumors and cancers) in patients, methods for relieving symptoms of tumors (including benign tumors and cancers) in patients, and methods for avoiding recurrence of tumors (including benign tumors and cancers) in patients, the methods comprising adding The patient is administered an effective amount of any antibody or antigen-binding unit thereof or ADC described herein.
  • the present invention provides a method for preventing, treating or improving diseases, the method comprising administering an effective amount of an anti-FR ⁇ antibody or its antigen-binding unit or ADC or a pharmaceutical combination comprising the same to a patient in need things.
  • the present invention provides the use of the antibody or its antigen-binding unit or ADC in the preparation of medicaments for preventing, treating or improving diseases.
  • the present invention provides the use of the antibody or its antigen-binding unit or ADC in preventing, treating or improving diseases.
  • the disease is a disease associated with abnormal expression of FR ⁇ . In one or more embodiments, the disease is a disease associated with overexpression of FR ⁇ .
  • the disease is a tumor expressing FRa. In one or more embodiments, the disease is a tumor overexpressing FRa. In one or more embodiments, the disease is a cancer that overexpresses FRa. In one or more embodiments, the disease is a cancer overexpressing human FRa.
  • the present invention provides a method for treating tumors (including benign tumors and cancers), the method comprising administering to a patient in need thereof an effective amount of an anti-FR ⁇ antibody or an antigen-binding unit thereof or ADC or comprising pharmaceutical composition.
  • the present invention provides the use of the antibody or its antigen-binding unit or ADC in the preparation of a medicament for treating tumors (including benign tumors and cancers).
  • the present invention provides the use of the antibody or its antigen-binding unit or ADC in the treatment of tumors (including benign tumors and cancers).
  • cancer examples include, but are not limited to, solid tumors, hematological cancers, and metastatic lesions. Specific examples of such cancers include, but are not limited to, colorectal cancer, lung cancer, ovarian cancer, uterine cancer, endometrial cancer, peritoneal cancer, fallopian tube cancer, pancreatic cancer, squamous cell carcinoma of the head and neck, nasopharyngeal cancer, laryngeal cancer, lung adenocarcinoma Cancer, liver cancer, breast cancer, brain cancer, kidney cancer, renal cell carcinoma, colon cancer, testicular cancer, cervical cancer, bladder cancer, retinoblastoma, glioblastoma, mesothelioma, oral epithelioid carcinoma, Choriocarcinoma and head and neck cancer.
  • cancers include ovarian cancer, epithelial ovarian cancer, primary peritoneal cancer of the ovary, or fallopian tube cancer.
  • the cancer is metastatic or advanced cancer.
  • the patient is a patient with increased expression levels of FR ⁇ .
  • the patient is a human.
  • the patient can be a mammal into which FRa has been introduced (eg, by administering FRa or by expressing a FRa transgene).
  • Antibodies or antigen-binding units thereof or ADCs of the invention can be administered to human patients for therapeutic purposes.
  • an antibody of the invention, or an antigen-binding unit thereof, or an ADC can be administered to a non-human mammal expressing FRa (for veterinary purposes or as an animal model of human disease).
  • Animal models of such human diseases can be used to assess the therapeutic efficacy of the antibodies of the invention, or antigen-binding units thereof, or ADCs (eg, dose testing and dosing time courses).
  • the specific dosage and treatment regimen for any particular patient will depend on various factors, including the particular antibody or derivative (e.g., ADC or pharmaceutical composition) used, the patient's age and weight, general health, sex, and diet, and Timing of administration, frequency of metabolism, drug combination, and severity of the particular disease being treated. These factors are in the judgment of the medical caregiver, who is within the purview of those of ordinary skill in the art.
  • the dosage will also depend on the individual patient to be treated, the route of administration, the type of formulation, the nature of the compound employed, the severity of the disease and the effect desired.
  • the dosage used can be determined by principles of pharmacology and pharmacokinetics well known in the art.
  • the effective amount refers to the amount of active compound or agent that results in the biological or pharmaceutical response of the tissue, system, animal, individual and human being sought by the researcher, veterinarian, physician or other clinician, including the treatment of a disease .
  • the effective dose ranges from about 0.1 mg/kg to about 100 mg/kg, and the dosing frequency can be, for example, once a month, once every two weeks, or once every three weeks Once, twice every three weeks, three times every four weeks, once a week, twice a week, etc.
  • the administration method can be intravenous infusion, intravenous injection, subcutaneous injection, intramuscular injection, etc. It is to be noted that dosage values may vary with the type and severity of the condition to be alleviated.
  • the specific dosage regimen can be adjusted at any time according to the needs of the patient and the professional judgment of the person administering the composition or supervising the administration of the composition, and the dosage ranges set forth herein are exemplary only, It is not intended to limit the scope or practice of the claimed compositions.
  • Methods of administration of an antibody or antigen-binding unit thereof or ADC include, but are not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, nasal, epidural, and oral.
  • the pharmaceutical compositions may be administered by any convenient route, such as by infusion or bolus injection, absorbed through the epithelium or mucous membranes (eg, oral mucosa, rectal and intestinal mucosa, etc.), and may be co-administered with other biologically active agents.
  • compositions containing an antibody of the invention may be administered orally, rectally, parenterally, intracisternally, intravaginally, intraperitoneally, topically (such as by powder, ointment, drops or transdermal patch), oral administration or nasal spray administration.
  • parenteral refers to modes of administration including intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous and intraarticular injection and infusion.
  • the mode of administration can be systemic administration or local administration.
  • Pulmonary administration is also possible, for example by use of an inhaler or nebulizer, and by use of nebulized formulations.
  • Antibodies of the invention, or antigen-binding units thereof, or ADCs may be administered topically to the area in need of treatment; by, but not limited to, local infusion during surgery, for example local application in conjunction with post-operative wound dressings, by injection, by catheter, This is achieved by means of a suppository or by means of an implant, which is a porous, non-porous or gelatinous material comprising membranes (eg silicone rubber membranes) or fibers.
  • an antibody of the invention, or an antigen-binding unit thereof, or an ADC care must be taken to use materials that do not absorb proteins.
  • the methods for treating diseases are usually tested in vitro, including administering the antibody or ADC of the present invention, then testing the desired therapeutic or preventive activity in an acceptable animal model in vivo, and finally administering to humans.
  • Suitable animal models including transgenic animals, are known to those of ordinary skill in the art.
  • in vitro assays for demonstrating therapeutic use of the antibodies or antigen binding units thereof or ADCs of the invention include the effect of the antibodies or antigen binding units thereof or ADCs on cell lines or patient tissue samples.
  • the effect of antibodies or antigen binding units thereof or ADCs on cell lines and/or tissue samples can be detected using techniques known to those skilled in the art, such as those disclosed elsewhere herein.
  • In vitro assays useful in determining whether to administer an antibody, or antigen-binding unit thereof, or ADC, in accordance with the present invention include in vitro cell culture assays in which patient tissue samples are grown in culture and exposed to or otherwise administered the antibody or its Antigen binding unit or ADC, and observe the effect of such antibody or antigen binding unit or ADC on the tissue sample.
  • Various known delivery systems can be used to administer the antibodies of the invention, or antigen-binding units thereof, or polynucleotides or ADCs encoding the same, such as encapsulation in liposomes, microparticles, microcapsules, recombinant cells capable of expressing the compounds, subject Body-mediated endocytosis (see, eg, Wu and Wu, 1987, J. Biol. Chem. 262:4429-4432), construction of nucleic acids as part of retroviruses or other vectors, etc.
  • the antibodies of the invention, or antigen-binding units thereof, or ADCs may be combined with other therapeutic or prophylactic regimens, comprising one or more antibodies of the invention, or antigen-binding units thereof, or ADCs, and one or more other The therapeutic agents or methods are used together or in combination.
  • the antibody or antigen-binding unit thereof, or ADC, and the other therapeutic agent may be administered simultaneously or separately.
  • an antibody of the invention, or an antigen-binding unit thereof, or ADC may be administered before or after another other therapeutic agent is administered.
  • the antibody of the present invention or its antigen-binding unit or ADC when administered to the patient, the antibody disclosed herein or its antigen-binding unit or ADC or pharmaceutical composition or immunoconjugate may also be administered to the patient in combination.
  • antibodies of the invention, or antigen-binding units thereof, or ADCs may be used with immune checkpoint inhibitors. In one or more embodiments, antibodies of the invention, or antigen-binding units thereof, or ADCs, are administered in combination with other therapeutic or prophylactic regimens, such as radiation therapy.
  • Such combination therapy encompasses simultaneous administration (where two or more formulations are contained in the same formulation or in separate formulations), and separate administration, in which case it may be followed by administration of other therapies, such as treatment modalities and/or Administration of an antibody or antigen-binding unit thereof or ADC of the invention occurs before, simultaneously with, and/or after the therapeutic agent.
  • Antibodies or antigen binding units thereof or ADCs and/or other therapies, eg therapeutics or treatment modalities may be administered during active disease or during remission or less active disease.
  • Antibodies or antigen-binding units thereof or ADCs can be administered before, concurrently with, after, or during remission of other treatments.
  • the antibodies, antigen-binding units, or derivatives disclosed herein are modified to reduce their immunogenicity using art-recognized techniques.
  • antibodies can be humanized, primatized, deimmunized or chimeric antibodies can be prepared. These types of antibodies are derived from non-human antibodies, usually murine or primate antibodies, which retain or substantially retain the antigen-binding properties of the parent antibody but are less immunogenic in humans.
  • framework residues in the human framework regions will be replaced by corresponding residues from the CDR donor antibody, such as residues that improve antigen binding.
  • These framework substitutions can be identified by methods known in the art, such as by simulating the interaction of CDRs and framework residues to identify framework residues important for antigen binding and by sequence alignment to identify abnormal framework residues at specific positions ( See US Patent 5,585,089; the entire contents of which are incorporated herein by reference).
  • Antibodies can be humanized using various techniques known in the art, such as CDR grafting (EP 239,400; WO 91/09967; US Patents 5,225,539, 5,530,101 and 5,585,089), repair or surface rearrangement (EP 592,106; EP 519,596) , and chain rearrangements (US Patent 5,565,332), the entire contents of which are incorporated herein by reference.
  • Antibodies can be engineered by recombinant DNA techniques to replace CH1, CH2, CH3, hinge and/or framework domains with corresponding human sequences (see WO 92102190 and U.S. Patent Nos. 5,530,101; 5,585,089; 5,693,761; 5,693,792; 5,714,350; and 5,777,085).
  • Ig cDNA to construct chimeric immunoglobulin genes is also known in the art (Liu et al. P.N.A.S. 84:3439 (1987) and J. Immunol. 139:3521 (1987)).
  • mRNA is isolated from antibody-producing hybridomas or other cells and used to produce cDNA.
  • cDNA can be amplified by polymerase chain reaction using specific primers (US Patents 4,683,195 and 4,683,202).
  • libraries are constructed and screened to isolate sequences of interest.
  • the DNA sequences encoding the antibody variable regions are then fused to human constant region sequences.
  • the sequence of the human constant region gene can be found in Sequences of Proteins of immunological Interest published by Kabat et al.
  • Human C region genes can be easily obtained from known clones. The choice of isotype will be guided by the desired effector function, such as activity in complement fixation or antibody-dependent cellular cytotoxicity. Preferred isotypes are IgG1 and IgG2. Either human light chain constant region, kappa or lambda, can be used, and chimeric humanized antibodies can be expressed by conventional methods.
  • Deimmunization can also be used to reduce the immunogenicity of antibodies.
  • the term "deimmunization” includes altering antibodies to modify T cell epitopes (see eg WO/9852976 A1 and WO/0034317 A2).
  • the heavy and light chain variable region sequences from a starting antibody are analyzed and a human T cell epitope "map" from each variable region is generated, showing the epitopes relative to the complementarity determining regions (CDRs) and the positions of other key residues within the sequence.
  • CDRs complementarity determining regions
  • Individual T-cell epitopes from T-cell epitope maps are analyzed to identify alternative amino acid substitutions with lower risk of altering antibody activity.
  • a series of alternative heavy chain variable region sequences and light chain variable region sequences comprising combinations of amino acid substitutions are designed and these sequences are subsequently incorporated into a series of binding polypeptides.
  • Genes for the complete heavy and light chains containing the modified variable and human constant regions are then cloned into expression vectors, and the plasmids are subsequently transformed into cell lines to produce complete antibodies.
  • Antibodies are then compared using appropriate biochemical and biological assays to identify the best antibody.
  • Fully human antibodies that recognize selective epitopes can be produced using a technique known as "guided selection.” In this approach, selected non-human monoclonal antibodies are used to guide the selection of fully human antibodies that recognize the same epitope (see US Patent 5,565,332, the entire contents of which are incorporated herein by reference).
  • Single-chain Fv can be found in techniques for producing single-chain units (US Patent 4,694,778).
  • Single-chain fusion peptides are generated by amino acid bridging of the heavy and light chain fragments of the Fv region to form single-chain units.
  • the technique of assembling functional Fv fragments in E. coli can also be used (Skerra et al., Science 242:1038-1041 (1988)).
  • antigen-binding fragments such as Fab, F(ab') 2 and Fv can be prepared by cleavage of intact proteins, eg, by protease or chemical cleavage. Including but not limited to: (i) digesting antibody molecules with pepsin to obtain F(ab') 2 fragments; (ii) obtaining Fab fragments by reducing the disulfide bond of F(ab') 2 fragments; (iii) using papain and Treatment of antibody molecules with reducing agents produces Fab fragments, and (iv) Fv fragments.
  • one or more CDRs of an antibody of the invention can be inserted into a framework region, eg, into a human framework region, to construct a humanized antibody.
  • the framework regions may be naturally occurring or consensus framework regions, preferably human framework regions (see Chothia et al., J. Mol. Biol. 278:457-479 (1998) for a list of human framework regions).
  • Some polynucleotides may encode an antibody that specifically binds at least one epitope of an antigen of interest produced by a combination of framework regions and CDRs.
  • One or more amino acid substitutions may be made within the framework regions, and the amino acid substitutions may be selected to improve binding of the antibody to its antigen.
  • substitution or deletion of cysteine residues in one or more variable regions involved in interchain disulfide bond formation can be performed in this way, thereby producing antibody molecules lacking one or more interchain disulfide bonds.
  • Other modifications to polynucleotides within the skill of the art are also encompassed in the present invention.
  • Antibodies can be prepared using conventional recombinant DNA techniques. Antibody-producing vectors, cell lines, and the like can be selected, constructed, and cultured using techniques known to those skilled in the art. These techniques are described in various laboratory manuals and major publications, such as Recombinant DNA Technology for Production of Protein Therapeutics in Cultured Mammalian Cells, D.L. hacker, F.M. Wurm, in Reference Module in Life Sciences, 2017, which in its entirety includes The supplementary content is incorporated by reference in its entirety.
  • the anti-FR ⁇ antibody or antigen-binding unit thereof of the present invention is modified in glycosylation.
  • an aglycosylated antibody can be prepared (ie, the antibody lacks glycosylation).
  • Glycosylation can be altered, for example, to increase the affinity of the antibody for antigen.
  • modifications can be accomplished, for example, by altering one or more glycosylation sites within the antibody sequence.
  • one or more amino acid substitutions can be made to eliminate one or more variable region glycosylation sites, thereby eliminating glycosylation at that site.
  • deglycosylation increases the affinity of the antibody for antigen.
  • Antibody (eg, anti-FR ⁇ antibody) genes can be inserted into expression vectors by standard methods (eg, ligation of antibody gene fragments and complementary restriction sites on the vector, or blunt ligation if no restriction sites are present).
  • Expression vectors can be plasmids, retroviruses, YACs, EBV-derived episomes, and the like.
  • DNA encoding the full-length light and heavy chains can be inserted into expression vectors such that the genes are operably linked to transcriptional and translational control sequences.
  • “Operably linked” means that the antibody gene is linked into the vector such that the transcriptional and translational control sequences within the vector perform their intended function of regulating the transcription and translation of the antibody gene.
  • the consensus sequences of the heavy and light chain J regions can be used to design oligonucleotides used as primers to introduce useful restriction sites within the J region for subsequent ligation of the V region segment to the human C region segment.
  • the C region cDNA can be modified by site-directed mutagenesis to place a restriction site at an analogous position in the human sequence.
  • the expression vector already carries antibody constant region sequences prior to insertion of antibody-related light or heavy chain gene sequences.
  • one approach to converting the VH and VL sequences associated with an anti-FR ⁇ antibody into a full-length antibody gene is to insert them into expression vectors already encoding the heavy and light chain constant regions, respectively, such that the VH segment is operably linked to a CH segment within the vector, and the VL segment is operably linked to a CL segment within the vector.
  • Recombinant expression vectors can encode signal peptides that promote secretion of antibody heavy and light chains from host cells.
  • the antibody heavy and light chain genes can be cloned into a vector encoding a signal peptide that promotes secretion of the antibody heavy and light chains from the host cell such that the signal peptide is linked in frame to the amino termini of the antibody heavy and light chain genes.
  • the signal peptide can be an immunoglobulin signal peptide or a heterologous signal peptide (i.e., a signal peptide from a non-immunoglobulin protein), for example, MDWTWRILFLVAAATGAHS (SEQ ID NO: 21), MEAPAQLLFLLLLWLPDTTG (SEQ ID NO: 22).
  • a heterologous signal peptide i.e., a signal peptide from a non-immunoglobulin protein
  • the recombinant expression vector may also carry regulatory sequences that control the expression of the antibody chain genes in the host cell. Regulatory sequences include promoters, enhancers and other expression control elements (eg, polyadenylation signals) that control the transcription or translation of the antibody chain genes. Such regulatory sequences are described, for example, in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA, 1990. Those skilled in the art understand that the design of expression vectors, including the selection of regulatory sequences, may depend on factors such as the selection of host cells to be transformed, the expression level of the desired protein, and the like.
  • Suitable regulatory sequences for expression in mammalian host cells include viral elements that direct high-level protein expression in mammalian cells, such as those derived from cytomegalovirus (CMV) (e.g., CMV promoter/enhancer), Simian virus 40 (SV40 ) (eg SV40 promoter/enhancer), adenovirus (eg adenovirus major late promoter (AdMLP)) and polyoma promoters and/or enhancers.
  • CMV cytomegalovirus
  • SV40 Simian virus 40
  • AdMLP adenovirus major late promoter
  • recombinant expression vectors can carry additional sequences, such as sequences that regulate replication of the vector in a host cell (eg, an origin of replication) and selectable marker genes.
  • a selectable marker gene facilitates selection of host cells into which the vector has been introduced (see, eg, US Patents 4,399,216, 4,634,665, and 5,179,017).
  • marker genes that confer resistance to drugs such as G418, hygromycin, or methotrexate to host cells into which the vector has been introduced can often be selected.
  • Suitable selectable marker genes include the dihydrofolate reductase (DHFR) gene (for use in DHFR-host cells with methotrexate selection/amplification), the neo gene (for G418 selection) and the GS gene .
  • DHFR dihydrofolate reductase
  • neo for G418 selection
  • GS gene for G418 selection
  • expression vectors encoding the heavy and light chains are transfected into host cells by standard techniques.
  • Antibodies of the present invention can be produced by recombinantly expressing the heavy and light chain genes of the antibody in host cells.
  • host cells are transfected with one or more recombinant expression vectors carrying heavy and light chain DNA fragments encoding antibodies, so that the heavy and light chains are expressed in the host cells, and the expressed antibodies can be secreted into the cultured host cells. within the culture medium from which the antibody can be recovered.
  • Transfection refers to a wide variety of techniques commonly used to introduce exogenous DNA into eukaryotic host cells, such as electroporation, lipofection, calcium phosphate precipitation, DEAE-dextran transfection, and the like.
  • Standard recombinant DNA methods for obtaining antibody heavy and light chain genes, incorporating these genes into expression vectors, and introducing the vectors into host cells are well known in the art, e.g., Molecular Cloning; A Laboratory Manual, Second Edition (Sambrook, Fritsch and Maniatis (eds., Cold Spring Harbor, N.Y., 1989), Current Protocols in Molecular Biology (Ausubel, F.M. et al., eds., Greene Publishing Associates, 1989), and those described in U.S. Patent No. 4,816,397.
  • the DNA expressing the antibody heavy chain and light chain can be placed in the same vector or placed in different vectors; if placed in different vectors, the vector expressing the antibody heavy chain and the vector expressing the antibody light chain can be transfected into host cells in an appropriate ratio (such as Tihomir S.
  • an antibody expression vector includes at least one promoter element, an antibody coding sequence, a transcription termination signal, and a polyA tail.
  • GCCACC Kozak sequences
  • Other elements may include enhancers, Kozak sequences (GCCACC, as shown in SEQ ID NO: 33), and donor and acceptor sites for RNA splicing flanking the insert.
  • High-efficiency transcription can be obtained through the early and late promoters of SV40, long terminal repeats from retroviruses such as RSV, HTLV1, HIVI, and early promoters of cytomegalovirus, and other cellular promoters such as muscle Kinetin promoter.
  • Suitable expression vectors may include pIRES1neo, pRetro-Off, pRetro-On, pLXSN, pLNCX, pcDNA3.1(+/-), pcDNA/Zeo(+/-), pcDNA3.1/Hygro(+/-), pSVL , pMSG, pRSVcat, pSV2dhfr, pBC12MI, pCS2 or pCHO1.0, etc.
  • Antibodies (eg, anti-FR ⁇ antibodies) of the invention can be expressed in eukaryotic host cells.
  • expression of antibodies is performed in eukaryotic cells, such as mammalian host cells.
  • Exemplary host cells for expressing antibodies of the invention include Chinese hamster ovary cells (CHO cells) such as CHO-K1 cells, or CHO-S, CHO-dhfr-, CHO/DG44 or ExpiCHO, NSO bone marrow modified from CHO cells Tumor cells, COS cells, Cos1 cells, Cos7 cells, SP2 cells, CV1 cells, mouse L cells, human embryonic kidney cells HEK293 or HEK293T, HEK293F or HEK293E cells modified from HEK293 cells.
  • CHO cells Chinese hamster ovary cells
  • CHO-K1 cells such as CHO-K1 cells, or CHO-S, CHO-dhfr-, CHO/DG44 or ExpiCHO
  • the host cell After the recombinant expression vector encoding the antibody chain gene is introduced into the host cell, the host cell is cultured in a medium for a period of time allowing the expression of the antibody in the host cell or the secretion of the antibody into the medium to produce the antibody.
  • Antibodies can be recovered from the culture medium using standard protein purification methods.
  • Antibody-producing cell lines can be selected, constructed and cultured by using techniques well known to those skilled in the art. These techniques are described in various laboratory manuals and major publications, such as Recombinant DNA Technology for Production of Protein Therapeutics in Cultured Mammalian Cells, D.L. hacker, F.M. Wurm, in Reference Module in Life Sciences, 2017, which in its entirety includes The supplementary content is incorporated by reference in its entirety.
  • host cells can be co-transfected with two recombinant expression vectors, the first recombinant expression vector encoding the antibody heavy chain, and the second recombinant expression vector encoding the antibody light chain.
  • the two recombinant expression vectors may contain the same selectable marker, or they may each contain separate selectable markers.
  • host cells can be transfected with recombinant expression vectors encoding the antibody heavy and light chains.
  • Antibodies of the present invention can also be produced by chemical synthesis (e.g., by the method described in Solid Phase Peptide Synthesis, 2nd Edition, 1984 The Pierce Chemical Co., Rockford, Ill.). Variant antibodies can also be generated using cell-free platforms (see, e.g., Chu et al., Biochemia No. 2, 2001 (Roche Molecular Biologicals) and Murray et al., 2013, Current Opinion in Chemical Biology, 17:420-426).
  • Antibodies of the invention (e.g., anti-FR ⁇ antibodies) produced by recombinant expression can be purified by any method known in the art for purifying immunoglobulin molecules, such as by chromatography (e.g., ion exchange, affinity layers analytical and fractional column chromatography), centrifugation, differential solubility, or any other standard technique for purifying proteins. For example affinity chromatography using protein A or protein G, which mainly provides the IgG fraction in the immune serum. Alternatively, the specific antigen targeted by the immunoglobulin or its epitope can be immobilized on a column to purify the immunospecific antibody by immunoaffinity chromatography.
  • chromatography e.g., ion exchange, affinity layers analytical and fractional column chromatography
  • centrifugation e.g., centrifugation
  • differential solubility e.g., differential solubility
  • affinity chromatography e.g., affinity chromatography using protein A or protein G, which mainly provides the IgG fraction
  • Antibodies of the invention can be fused to heterologous polypeptide sequences known in the art to facilitate purification.
  • the purification of immunoglobulin can refer to the article of D. Wilkinson (The Engineer, published by The Engineer, Inc., Philadelphia Pa., Vol. 14, No. 8 (April 17, 2000), pages 25-28) .
  • mutations can be introduced in the nucleotide sequences encoding the antibodies of the invention using standard techniques known to those skilled in the art, including but not limited to site-directed mutagenesis and PCR-mediated mutations resulting in amino acid substitutions.
  • Variants encode substitutions of less than 50 amino acids relative to the original heavy chain variable region VH CDR1, VH CDR2, VH CDR3 and light chain variable region VL CDR1, VL CDR2, VL CDR3, less than 40 amino acid substitutions, less than 30 amino acid substitutions, less than 25 amino acid substitutions, less than 20 amino acid substitutions, less than 15 amino acid substitutions, less than 10 amino acid substitutions, less than 5 amino acid substitutions
  • a substitution of amino acids a substitution of less than 4 amino acids, a substitution of less than 3 amino acids, or a substitution of less than 2 amino acids.
  • mutations can be introduced randomly along all or part of the coding sequence, for example by saturation mutagenesis, and the resulting mutants can be screened for biological activity to identify mutants that retain activity.
  • substitutions described herein are conservative amino acid substitutions.
  • amino acid sequence of the heavy chain of the exemplary antibody 1 of the present invention is shown in SEQ ID NO: 19, and its coding gene sequence is shown in SEQ ID NO: 23.
  • SEQ ID NO: 19 is as follows:
  • SEQ ID NO: 23 is as follows:
  • amino acid sequence of the light chain of the exemplary antibody 1 of the present invention is shown in SEQ ID NO: 20, and its coding gene sequence is shown in SEQ ID NO: 24.
  • SEQ ID NO: 20 is as follows:
  • SEQ ID NO:24 is as follows:
  • Antigen FR ⁇ -His preparation the amino acid sequence of coding antigen FR ⁇ -His (antigen FR ⁇ -His as shown in SEQ ID NO: 28, by human FR ⁇ ectodomain (as shown in SEQ ID NO: 27, the underlined part is signal Peptide) C-terminus added 8 ⁇ HIS tag (constructed by HHHHHHHH)) cloned into the expression vector to construct the recombinant expression vector, and then stably transformed into CHO-K1 cells, cultured and purified to obtain the antigen FR ⁇ -His.
  • the heavy chain of the anti-FR ⁇ antibody is composed of VH and CH, and the light chain is composed of VL and CL; the amino acid sequence of CH is shown in SEQ ID NO:17, and the amino acid sequence of CL is shown in SEQ ID NO:18.
  • VH CDR and VL CDR are shown in Table 2
  • the framework regions of the heavy chain and the light chain are shown in Table 3
  • the amino acid sequences of the variable regions are shown in Table 4
  • the amino acid sequences of the constant regions are shown in Table 5.
  • the amino acid sequences of the heavy chain and light chain of the control antibody huMOV19 are shown in Table 6.
  • the gene sequences encoding the heavy chain and light chain of the antibody were respectively cloned into expression vectors to construct recombinant expression vectors, then transiently transfected into HEK293F cells, cultivated and purified to obtain antibodies. After sequencing, it was consistent with the expected sequence.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Epidemiology (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Engineering & Computer Science (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Microbiology (AREA)
  • Urology & Nephrology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicinal Preparation (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/CN2022/141572 2021-12-24 2022-12-23 抗FRα抗体及其抗体药物偶联物和用途 Ceased WO2023116911A1 (zh)

Priority Applications (3)

Application Number Priority Date Filing Date Title
US18/722,899 US20250059274A1 (en) 2021-12-24 2022-12-23 ANTI-FRa ANTIBODY, AND ANTIBODY-DRUG CONJUGATE AND USE THEREOF
JP2024537958A JP2024547111A (ja) 2021-12-24 2022-12-23 抗FRα抗体及びその抗体薬物コンジュゲート並びに使用
EP22910217.3A EP4455164A1 (en) 2021-12-24 2022-12-23 ANTI-FRalpha ANTIBODY, AND ANTIBODY-DRUG CONJUGATE AND USE THEREOF

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
CN202111602429.4 2021-12-24
CN202111602429 2021-12-24
CN202211408028 2022-11-10
CN202211408028.X 2022-11-10

Publications (1)

Publication Number Publication Date
WO2023116911A1 true WO2023116911A1 (zh) 2023-06-29

Family

ID=86879676

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2022/141572 Ceased WO2023116911A1 (zh) 2021-12-24 2022-12-23 抗FRα抗体及其抗体药物偶联物和用途

Country Status (5)

Country Link
US (1) US20250059274A1 (https=)
EP (1) EP4455164A1 (https=)
JP (1) JP2024547111A (https=)
CN (1) CN116333135A (https=)
WO (1) WO2023116911A1 (https=)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN118791615A (zh) * 2024-07-22 2024-10-18 上海生物制品研究所有限责任公司 抗FRα抗体或抗原结合片段、抗体偶联药物及其应用
WO2026022310A1 (fr) * 2024-07-24 2026-01-29 Skymab Biotherapeutics Conjugue anticorps-medicament comprenant un anticorps anti-pmel-17 et ses utilisations

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2024263367A1 (en) 2023-04-27 2025-11-13 CSPC Megalith Biopharmaceutical Co., Ltd. Antibody-drug conjugate
EP4735047A1 (en) * 2023-06-28 2026-05-06 Université de Tours Pegylated linkers and uses thereof
WO2025036307A1 (zh) * 2023-08-11 2025-02-20 百奥泰生物制药股份有限公司 抗frα抗体药物偶联物在治疗疾病中的应用
WO2025140416A1 (zh) * 2023-12-28 2025-07-03 上海宏成药业有限公司 抗folr1特异性抗体的发明及应用
WO2025190255A1 (zh) * 2024-03-12 2025-09-18 百奥泰生物制药股份有限公司 治疗宫颈癌、胸腺肿瘤或激素受体阳性和her2阴性乳腺癌的方法
CN120919340A (zh) * 2024-05-09 2025-11-11 百奥泰生物制药股份有限公司 抗FRα抗体药物偶联物和PD-1拮抗剂在治疗肿瘤中的应用
WO2026002191A1 (zh) * 2024-06-29 2026-01-02 百奥泰生物制药股份有限公司 新型药物偶联物及其用途
CN121606577A (zh) * 2024-08-27 2026-03-06 百奥泰生物制药股份有限公司 抗FRα抗体药物偶联物和VEGF拮抗剂在治疗肿瘤中的应用

Citations (39)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR50E (fr) 1901-07-17 1902-10-13 Roche Un nouveau procédé de dégrisage du velours
US4399216A (en) 1980-02-25 1983-08-16 The Trustees Of Columbia University Processes for inserting DNA into eucaryotic cells and for producing proteinaceous materials
US4510245A (en) 1982-11-18 1985-04-09 Chiron Corporation Adenovirus promoter system
US4634665A (en) 1980-02-25 1987-01-06 The Trustees Of Columbia University In The City Of New York Processes for inserting DNA into eucaryotic cells and for producing proteinaceous materials
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4694778A (en) 1984-05-04 1987-09-22 Anicon, Inc. Chemical vapor deposition wafer boat
EP0239400A2 (en) 1986-03-27 1987-09-30 Medical Research Council Recombinant antibodies and methods for their production
US4816397A (en) 1983-03-25 1989-03-28 Celltech, Limited Multichain polypeptides or proteins and processes for their production
US4816567A (en) 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
US4946778A (en) 1987-09-21 1990-08-07 Genex Corporation Single polypeptide chain binding molecules
WO1991009967A1 (en) 1989-12-21 1991-07-11 Celltech Limited Humanised antibodies
US5168062A (en) 1985-01-30 1992-12-01 University Of Iowa Research Foundation Transfer vectors and microorganisms containing human cytomegalovirus immediate-early promoter-regulatory DNA sequence
EP0519596A1 (en) 1991-05-17 1992-12-23 Merck & Co. Inc. A method for reducing the immunogenicity of antibody variable domains
US5179017A (en) 1980-02-25 1993-01-12 The Trustees Of Columbia University In The City Of New York Processes for inserting DNA into eucaryotic cells and for producing proteinaceous materials
US5225539A (en) 1986-03-27 1993-07-06 Medical Research Council Recombinant altered antibodies and methods of making altered antibodies
US5258498A (en) 1987-05-21 1993-11-02 Creative Biomolecules, Inc. Polypeptide linkers for production of biosynthetic proteins
EP0592106A1 (en) 1992-09-09 1994-04-13 Immunogen Inc Resurfacing of rodent antibodies
US5530101A (en) 1988-12-28 1996-06-25 Protein Design Labs, Inc. Humanized immunoglobulins
US5565332A (en) 1991-09-23 1996-10-15 Medical Research Council Production of chimeric antibodies - a combinatorial approach
US5624821A (en) 1987-03-18 1997-04-29 Scotgen Biopharmaceuticals Incorporated Antibodies with altered effector functions
US5693792A (en) 1992-02-18 1997-12-02 Otsuga Kagaku Kabushiki Kaisha β-lactam and cephem compounds and processes for their production
US5714350A (en) 1992-03-09 1998-02-03 Protein Design Labs, Inc. Increasing antibody affinity by altering glycosylation in the immunoglobulin variable region
US5777085A (en) 1991-12-20 1998-07-07 Protein Design Labs, Inc. Humanized antibodies reactive with GPIIB/IIIA
US5807715A (en) 1984-08-27 1998-09-15 The Board Of Trustees Of The Leland Stanford Junior University Methods and transformed mammalian lymphocyte cells for producing functional antigen-binding protein including chimeric immunoglobulin
WO1998052976A1 (en) 1997-05-21 1998-11-26 Biovation Limited Method for the production of non-immunogenic proteins
US5892019A (en) 1987-07-15 1999-04-06 The United States Of America, As Represented By The Department Of Health And Human Services Production of a single-gene-encoded immunoglobulin
WO2000034317A2 (en) 1998-12-08 2000-06-15 Biovation Limited Method for reducing immunogenicity of proteins
WO2003016466A2 (en) 2001-08-17 2003-02-27 Eli Lilly And Company ANTI-Aβ ANTIBODIES
JP4968615B2 (ja) 2004-12-16 2012-07-04 日本電気株式会社 二次電池用電解液及び二次電池
WO2014036495A2 (en) 2012-08-31 2014-03-06 Immunogen Inc. Diagnostic assays and kits for detection of folate receptor 1
WO2014057687A1 (ja) * 2012-10-11 2014-04-17 第一三共株式会社 抗体-薬物コンジュゲート
WO2015031815A2 (en) 2013-08-30 2015-03-05 Immunogen, Inc. Antibodies and assays for detection of folate receptor 1
WO2015054400A2 (en) * 2013-10-08 2015-04-16 Immunogen, Inc. Anti-folr1 immunoconjugate dosing regimens
CN105308072A (zh) * 2013-05-14 2016-02-03 伊缪诺金公司 抗folr1免疫缀合物给药方案
WO2019243825A1 (en) * 2018-06-21 2019-12-26 Curadev Pharma Limited Small molecule modulators of human sting, conjugates and therapeutic applications
US20210093733A1 (en) * 2016-11-21 2021-04-01 Obi Pharma, Inc. Conjugated biological molecules, pharmaceutical compositions and methods
CN112739717A (zh) * 2018-06-29 2021-04-30 璟尚生物制药公司 三特异性拮抗剂
CN115429893A (zh) * 2021-06-02 2022-12-06 百奥泰生物制药股份有限公司 药物偶联物及其用途

Patent Citations (45)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR50E (fr) 1901-07-17 1902-10-13 Roche Un nouveau procédé de dégrisage du velours
US4399216A (en) 1980-02-25 1983-08-16 The Trustees Of Columbia University Processes for inserting DNA into eucaryotic cells and for producing proteinaceous materials
US4634665A (en) 1980-02-25 1987-01-06 The Trustees Of Columbia University In The City Of New York Processes for inserting DNA into eucaryotic cells and for producing proteinaceous materials
US5179017A (en) 1980-02-25 1993-01-12 The Trustees Of Columbia University In The City Of New York Processes for inserting DNA into eucaryotic cells and for producing proteinaceous materials
US4510245A (en) 1982-11-18 1985-04-09 Chiron Corporation Adenovirus promoter system
US4816397A (en) 1983-03-25 1989-03-28 Celltech, Limited Multichain polypeptides or proteins and processes for their production
US4816567A (en) 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
US4694778A (en) 1984-05-04 1987-09-22 Anicon, Inc. Chemical vapor deposition wafer boat
US5807715A (en) 1984-08-27 1998-09-15 The Board Of Trustees Of The Leland Stanford Junior University Methods and transformed mammalian lymphocyte cells for producing functional antigen-binding protein including chimeric immunoglobulin
US5168062A (en) 1985-01-30 1992-12-01 University Of Iowa Research Foundation Transfer vectors and microorganisms containing human cytomegalovirus immediate-early promoter-regulatory DNA sequence
US4683202B1 (https=) 1985-03-28 1990-11-27 Cetus Corp
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4683195B1 (https=) 1986-01-30 1990-11-27 Cetus Corp
EP0239400A2 (en) 1986-03-27 1987-09-30 Medical Research Council Recombinant antibodies and methods for their production
US5225539A (en) 1986-03-27 1993-07-06 Medical Research Council Recombinant altered antibodies and methods of making altered antibodies
US5648260A (en) 1987-03-18 1997-07-15 Scotgen Biopharmaceuticals Incorporated DNA encoding antibodies with altered effector functions
US5624821A (en) 1987-03-18 1997-04-29 Scotgen Biopharmaceuticals Incorporated Antibodies with altered effector functions
US5258498A (en) 1987-05-21 1993-11-02 Creative Biomolecules, Inc. Polypeptide linkers for production of biosynthetic proteins
US5892019A (en) 1987-07-15 1999-04-06 The United States Of America, As Represented By The Department Of Health And Human Services Production of a single-gene-encoded immunoglobulin
US4946778A (en) 1987-09-21 1990-08-07 Genex Corporation Single polypeptide chain binding molecules
US5585089A (en) 1988-12-28 1996-12-17 Protein Design Labs, Inc. Humanized immunoglobulins
US5530101A (en) 1988-12-28 1996-06-25 Protein Design Labs, Inc. Humanized immunoglobulins
US5693761A (en) 1988-12-28 1997-12-02 Protein Design Labs, Inc. Polynucleotides encoding improved humanized immunoglobulins
WO1991009967A1 (en) 1989-12-21 1991-07-11 Celltech Limited Humanised antibodies
EP0519596A1 (en) 1991-05-17 1992-12-23 Merck & Co. Inc. A method for reducing the immunogenicity of antibody variable domains
US5565332A (en) 1991-09-23 1996-10-15 Medical Research Council Production of chimeric antibodies - a combinatorial approach
US5777085A (en) 1991-12-20 1998-07-07 Protein Design Labs, Inc. Humanized antibodies reactive with GPIIB/IIIA
US5693792A (en) 1992-02-18 1997-12-02 Otsuga Kagaku Kabushiki Kaisha β-lactam and cephem compounds and processes for their production
US6350861B1 (en) 1992-03-09 2002-02-26 Protein Design Labs, Inc. Antibodies with increased binding affinity
US5714350A (en) 1992-03-09 1998-02-03 Protein Design Labs, Inc. Increasing antibody affinity by altering glycosylation in the immunoglobulin variable region
EP0592106A1 (en) 1992-09-09 1994-04-13 Immunogen Inc Resurfacing of rodent antibodies
WO1998052976A1 (en) 1997-05-21 1998-11-26 Biovation Limited Method for the production of non-immunogenic proteins
WO2000034317A2 (en) 1998-12-08 2000-06-15 Biovation Limited Method for reducing immunogenicity of proteins
WO2003016466A2 (en) 2001-08-17 2003-02-27 Eli Lilly And Company ANTI-Aβ ANTIBODIES
JP4968615B2 (ja) 2004-12-16 2012-07-04 日本電気株式会社 二次電池用電解液及び二次電池
WO2014036495A2 (en) 2012-08-31 2014-03-06 Immunogen Inc. Diagnostic assays and kits for detection of folate receptor 1
WO2014057687A1 (ja) * 2012-10-11 2014-04-17 第一三共株式会社 抗体-薬物コンジュゲート
CN105308072A (zh) * 2013-05-14 2016-02-03 伊缪诺金公司 抗folr1免疫缀合物给药方案
WO2015031815A2 (en) 2013-08-30 2015-03-05 Immunogen, Inc. Antibodies and assays for detection of folate receptor 1
WO2015054400A2 (en) * 2013-10-08 2015-04-16 Immunogen, Inc. Anti-folr1 immunoconjugate dosing regimens
US20210093733A1 (en) * 2016-11-21 2021-04-01 Obi Pharma, Inc. Conjugated biological molecules, pharmaceutical compositions and methods
WO2019243825A1 (en) * 2018-06-21 2019-12-26 Curadev Pharma Limited Small molecule modulators of human sting, conjugates and therapeutic applications
CN112739717A (zh) * 2018-06-29 2021-04-30 璟尚生物制药公司 三特异性拮抗剂
CN115429893A (zh) * 2021-06-02 2022-12-06 百奥泰生物制药股份有限公司 药物偶联物及其用途

Non-Patent Citations (31)

* Cited by examiner, † Cited by third party
Title
"Current Protocols in Molecular Biology", 1989, GREENE PUBLISHING ASSOCIATES
"Drug Absorption Enhancement: Concepts, Possibilities, Limitations, And Trends", 1994, HARWOOD ACADEMIC PUBLISHERS
"Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOR
"Proteins: Structures and Molecular Principles", 1984, W. H. FREEMAN AND COMPANY
"The Scientist", vol. No, 17 April 2000, SCIENTIST, INC., pages: 25 - 28
CHOTHIA ET AL., J. MOL. BIOL., vol. 196, 1987, pages 901 - 917
CHOTHIA ET AL., J. MOL. BIOL., vol. 278, 1998, pages 457 - 479
CHOTHIA ET AL., NATURE, vol. 342, 1989, pages 878 - 883
CHU ET AL., BIOCHEMIA, no. 2, 2001
DAVIES ET AL., ANNUAL REV BIOCHEM, vol. 59, 1990, pages 439 - 473
E. DIAMANDIST. CHRISTOPOULUS: "Immunoassay,", 1996, ACADEMIC PRESS, INC.
GOEDDEL: "Gene Expression Technology: Methods in Enzymology", vol. 185, 1990, ACADEMIC PRESS
HADI BAYAT ET AL.: "Evaluation of different vector design strategies for the expression of recombinant monoclonal antibody in CHO cells", PREPARATIVE BIOCHEMISTRY & BIOTECHNOLOGY, vol. 48, no. 8, 2018, pages 822 - 829
J. IMMUNOL., vol. 139, 1987, pages 3521
J. R. CROWTHER: "Remington's Pharmaceutical Sciences: The Science And Practice Of Pharmacy,", vol. 42, 1995, MACK PUB. CO.
KABAT ET AL.: "Peptide And Protein Drug Delivery, Advances In Parenteral Sciences", vol. 4, 1991, N.I.H. PUBLICATION
KABAT, E ET AL.: "Sequences of Proteins of Immunological Interest", 1983, U.S. DEPT. OF HEALTH AND HUMAN SERVICES
LIU ET AL., P.N.A.S, vol. 84, 1987, pages 3439
MURRAY ET AL., CURRENT OPINION IN CHEMICAL BIOLOGY, vol. 17, 2013, pages 420 - 426
NATURE, vol. 361, 1993, pages 186 - 87
OUYANG, METHODS MOL BIOL, vol. 1045, 2013, pages 275 - 83
P. TIJSSEN: "Practice and Theory of Enzyme Immunoassays", 1985, ELSEVIER SCIENCE PUBLISHERS
ROCHE MOLECULAR BIOLOGICALS
ROUX ET AL., J. IMMUNOL., vol. 161, 1998, pages 4083
SKERRA ET AL., SCIENCE, vol. 242, 1988, pages 1038 - 1041
STEFAN SCHLATTER ET AL.: "On the Optimal Ratio of Heavy to Light Chain Genes for Efficient Recombinant Antibody Production by CHO Cells", BIOTECHNOL PROGRESS, vol. 21, 2005, pages 122 - 133, XP072298569, DOI: 10.1021/bp049780w
THORNTON ET AL., NATURE, vol. 354, 1991, pages 105
TIHOMIR S. DODEV ET AL.: "A tool kit for rapid cloning and expression of recombinant antibodies", SCIENTIFIC REPORTS, vol. 4, 2014
WINTERHARRIS, IMMUNOL TODAY, vol. 14, no. 43, 1993, pages 46
WRIGHT ET AL., CRIT. REVIEWS IN IMMUNOL., 1992, pages 12125 - 168
WUWU, J. BIOL. CHEM., vol. 262, 1987, pages 4429 - 4432

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN118791615A (zh) * 2024-07-22 2024-10-18 上海生物制品研究所有限责任公司 抗FRα抗体或抗原结合片段、抗体偶联药物及其应用
WO2026022310A1 (fr) * 2024-07-24 2026-01-29 Skymab Biotherapeutics Conjugue anticorps-medicament comprenant un anticorps anti-pmel-17 et ses utilisations
FR3164899A1 (fr) * 2024-07-24 2026-01-30 Skymab Biotherapeutics Conjugue anticorps-medicament et ses utilisations

Also Published As

Publication number Publication date
US20250059274A1 (en) 2025-02-20
EP4455164A1 (en) 2024-10-30
CN116333135A (zh) 2023-06-27
JP2024547111A (ja) 2024-12-26

Similar Documents

Publication Publication Date Title
EP4455164A1 (en) ANTI-FRalpha ANTIBODY, AND ANTIBODY-DRUG CONJUGATE AND USE THEREOF
US20240269315A1 (en) Drug conjugate and use thereof
US12138313B2 (en) Anti-cub domain-containing protein 1 (CDCP1) antibodies, antibody drug conjugates, and methods of use thereof
US20250262316A1 (en) Antibody-drug conjugate and application thereof
EP4556027A1 (en) Anti-nectin-4 antibody drug conjugate and use thereof
EP4538291A1 (en) Anti-nectin-4 antibody, and antibody-drug conjugate and use thereof
EP4534105A1 (en) Anti-cldn18.2 antibody, and antibody-drug conjugate and use thereof
HK40095865A (zh) 抗FRα抗体及其抗体药物偶联物和用途
HK40092171A (zh) 抗体药物偶联物及其用途
HK40109051A (zh) 抗nectin-4抗体药物偶联物及应用
HK40087898A (zh) 药物偶联物及其用途
WO2026002191A1 (zh) 新型药物偶联物及其用途
HK40114669A (zh) 抗-含cub结构域蛋白1(cdcp1)抗体、抗体药物缀合物及其使用方法
HK40014209A (en) Anti-cub domain-containing protein 1 (cdcp1) antibodies, antibody drug conjugates, and methods of use thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22910217

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2024537958

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2022910217

Country of ref document: EP

Effective date: 20240724