WO2023116718A1 - Method for preparing random sgrna library of target sequence by means of enzymatic method - Google Patents

Abstract

Provided in the present invention is a method for preparing a random sgRNA library of a target sequence by means of an enzymatic method. The preparation method comprises the steps of: nicking a PAM region of the target sequence of sample DNA with a random nickase Nt.CviPII; linking the fragmented DNA to a linker magnetic bead containing a BbsI enzyme cleavage site; performing cleavage with BbsI to release DNA; performing random primer extension; linking same to an sgRNA skeleton containing an MmeI enzyme cleavage site; performing cleavage with MmeI to release a protospacer region; linking same to a T7 promoter sequence; performing amplification to obtain an sgRNA library template containing the T7 promoter; and finally obtaining the sgRNA library by means of in vitro transcription. According to the method for preparing a random sgRNA library of a target sequence by means of an enzymatic method in the present application, all sgRNA groups randomly covering a target region can be prepared at one time, and the method has the advantages of a low cost, simple production, uniform coverage, small bias, no limitation on the length of a target sequence, no need for large-design sgRNA, etc., and has an important application value in the capture and removal of target genes.

Description

Enzymatic target sequence random sgRNA library preparation method technical field

The application belongs to the field of biotechnology, and in particular relates to a method for preparing a random sgRNA library of target sequences by enzymatic method.

Background technique

Since its development, CRISPR gene editing technology has been widely used in various fields such as gene therapy, in vitro diagnosis, gene capture and target gene removal, and won the 2020 Nobel Prize in Physiology and Medicine. It is an efficient and practical technology. The practical CRISPR system is mainly composed of two parts, one is the Cas protein with two endonuclease active sites, which is responsible for cutting the two strands of DNA at the target site; the other is the DNA pairing sequence with the target site The guide RNA (sgRNA) that binds to the Cas protein sequence is responsible for recruiting the Cas protein and guiding the Cas protein to bind to the complementary paired target site. In the CRISPR system, the Cas protein first binds to the sgRNA to form a Cas-sgRNA complex, which is retrieved on the DNA. When the region complementary to the sgRNA (protospacer, ProtoSpacer) is retrieved, and there is an NGG sequence (PAM sequence) at the 3' end of the ProtoSpacer region, the Cas protein unwinds the target site, making the unwound double-stranded DNA Entering the DNA cutting active domain of the Cas protein, the Cas protein cuts the double-stranded DNA, resulting in a double-strand DNA break. The broken DNA is repaired by homologous recombination (HR) or non-homologous end joining (NHEJ) and other DNA damage repair methods to complete the editing of the target gene. Cas proteins currently used for commercial applications mainly include Cas9, Cas12, Cas13, and Cas14 and their variants. Different Cas proteins recognize PAM sequences and requirements, and the length of ProtoSpacer is also different. Therefore, different CRISPR systems have different application scenarios.

In addition to the purification and preparation of Cas protein, the in vitro construction and synthesis of sgRNA is also an important part of the commercial application of CRISPR. Conventional methods need to use primer synthesis to synthesize target sgRNA primers containing the T7 promoter, then use overlapping PCR to obtain the full-length sgRNA backbone template, and use in vitro transcription to obtain the required sgRNA. This method is time-consuming, low-cost, and highly controllable. It has been commercialized on a large scale and has become the main form of sgRNA preparation in vitro, but it still has the problem of low throughput. Gene capture or removal usually requires the capture or removal of a large region of the genome, covering a length of 1Mbp or even the entire complete genomic DNA. This requires the design and synthesis of tens of millions of sgRNAs. In the design and synthesis of sgRNA, both cost and technology are great challenges.

Contents of the invention

The application provides a method for preparing an enzymatic target sequence random sgRNA library, the steps of which include:

(1) Treat sample DNA with random nickase Nt.CviPII, Nt.CviPII cuts the PAM region of the target sequence to obtain fragmented double-stranded DNA, denatures the double-stranded DNA to obtain fragmented single-stranded DNA, Wherein, the denaturation treatment adopts conventional high temperature denaturation;

(2) In the reaction system of step (1), add the linker magnetic bead that contains BbsI restriction site, the 3 ' end of linker connects fragmented single-stranded DNA;

(3) Cut the DNA connected to the magnetic beads with BbsI enzyme to release the single-stranded DNA;

(4) Random primer extension to make single-stranded DNA form double-stranded DNA;

(5) connecting the sgRNA backbone containing the MmeI restriction site on the 3' end of the double-stranded DNA;

(6) Cutting the ligation product of step (5) with MmeI to release the protospacer region;

(7) connecting the T7 promoter sequence at the 5' end of the original spacer region;

(8) amplification obtains the sgRNA library template containing T7 promoter; and

(9) In vitro transcription to obtain sgRNA library.

Preferably, the sample DNA is genomic DNA, PCR product or DNA library.

Preferably, the forward sequence of the adapter magnetic beads described in step (2) is /biotin/-TTTTTGAAGA (SEQ ID NO: 1), and the reverse sequence is /NH2C6/-NNNNNNNHGGTCTTCAAAAA-/NH2C6/ (SEQ ID NO: 2), the two sequences are annealed at an equimolar concentration, and the magnetic beads are streptavidin magnetic beads.

Preferably, T4 DNA ligase or E.coli DNA ligase is used in step (2) to connect the fragmented DNA to the adapter.

Preferably, the random primer described in step (4) is a random hexamer primer, and the extension adopts Klenow DNA polymerase.

Preferably, the sgRNA backbone described in step (5) is a double-stranded DNA formed by complementary pairing of two single-stranded DNAs, wherein the forward sequence is /rApp/-CGGTTGGAGCTAGAAATAGCAAGTCAACCTAACGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT-/NH2C6/ (SEQ ID NO: 3); The directional sequence is /NH2C6/-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCGTTAGGTTGACTTGCTATTTCTAGCTCCAACC-/ddG/ (SEQ ID NO: 4).

Preferably, T4 DNA ligase mutant K159L is used in step (5) to connect the sgRNA backbone with the double-stranded DNA.

Preferably, step (7) uses T4 DNA ligase, the forward sequence of the T7 promoter is /NH2C6/-TTCTAATACGACTCACTATAGGNN (SEQ ID NO: 5), and the reverse sequence is /ddC/-CTATAGTGAGTCGTATTAGAA-/NH2C6/( SEQ ID NO:6).

Preferably, the forward sequence of the primer pair used in the amplification reaction described in step (8) is TTCTAATACGACTCACTATAGG (SEQ ID NO: 7), and the reverse sequence is AAAAGCACCGACTCGGTGCC (SEQ ID NO: 8).

Preferably, step (9) uses T7 RNA polymerase to perform transcription, and uses RNA recovery magnetic beads to recover the sgRNA library.

The application has the following beneficial effects:

The enzymatic target sequence random sgRNA preparation method ERSP (Enzymatical Random sgRNA Preparation) of this application can prepare all sgRNA groups randomly covering the target region at one time. The principle and process of ERSP are as follows: Use the random nickase Nt.CviPII to cut the PAM region of the target sequence; DNA denaturation, magnetic beads are connected to the linker containing the BbsI recognition site; BbsI is cut to release the DNA; the sgRNA backbone containing MmeI is connected; Cut with MmeI to obtain the sequence of the protospacer region; connect to the T7 promoter; amplify to obtain the sgRNA library with the T7 promoter; transcribe in vitro to obtain the target sequence sgRNA library. ERSP has the advantages of low cost, simple production, uniform coverage, small bias, no restriction on the length of the target sequence, and no need to design sgRNA in large quantities. It has important application value in the capture and removal of target genes.

Description of drawings

Figure 1 is a schematic diagram of the principle and flow of ERSP technology.

Figure 2 shows the effect of different input amounts of Nt.CviPII on DNA fragmentation. The left lane is 0.5U, the middle lane is 1U, and the right lane is 2U.

Figure 3 is the DNA electrophoresis image after connecting the sgRNA backbone. On the left is 18S/28S DNA, and on the right is human whole genome DNA.

Figure 4 is the electrophoresis of the amplification products of the 18S/28S DNA (left) and the full coverage sgRNA library of human genome DNA (right) constructed by ERSP.

Figure 5 is the electrophoresis diagram of the sgRNA library prepared by in vitro transcription of the amplified products of the 18S/28S DNA (left) and the full-coverage sgRNA library of human genome DNA (right) constructed by ERSP.

Figure 6 shows the distribution of Nt.CviPII restriction sites on the DNA of 18S rRNA (shaded area).

Figure 7 shows the effect detection of 18S/28S ERSP library on CRISPR removal of rRNA.

Figure 8 is the detection of the effect of the human whole genome ERSP library on CRISPR removal of the human host genome.

Detailed ways

In order to further describe the specific content of the present application, the present application will be described in detail below in conjunction with the embodiments. The operating methods and reagents involved in the examples are well known to those skilled in the art. It should be understood that the specific examples described below are only used to describe the application in detail, but the implementation of the application is not limited by the following examples . The adapter sequences and modifications used in this example are shown in Table 1, and N is any base among A, T, C, and G. The process of ERSP is shown in Figure 1.

Table 1 Linker sequences and modifications

Example 1: ERSP process

(1) Preparation of magnetic beads containing Bbs linker

BbsI-F and BbsI-R were dissolved in 100mM NaCl to 100μM, mixed with equimolar concentration, reacted at 95°C for 5min, and decreased by 1°C per minute. After the reaction, the annealed linker was diluted to 10 μM with water. Take 20 μL of the diluted adapter, add 5 μL of streptavidin magnetic beads C1 (Thermo), and rotate and mix at room temperature for 30 min. Wash the magnetic beads 3 times with 100mM NaCl.

(2) Restriction enzyme cleavage that recognizes the PAM sequence

Table 2 Restriction enzyme digestion system

components	Dosage
human genomic DNA	1μg
10×rCutSmart buffer	1μL
Nt.CviPII (NEB)	0.5-2U
Hydrate to	10μL

React at 37°C for 30 minutes, react at 98°C for 10 minutes, and place on ice immediately. The effect of different input amounts of Nt.CviPII on DNA fragmentation is shown in Figure 2.

Table 3 Linker magnetic beads with BbsI restriction site

components	Dosage
The above reaction system	10 μL
50%PEG8000	8μL

10×T4 Ligase Reaction Buffer	5μL
Hydrate to	50μL

Resuspend the magnetic beads in the prepared reaction system, add 2000U T4 DNA Ligase (NEB) and mix well, connect at 20°C for 1h, shake for 15s every 3min, and rotate at 1000rpm/min. After the reaction, the magnetic beads were washed 3 times with 100mM NaCl. Prepare 30 μL (10 U) of BbsI (NEB) reaction system according to the instructions, resuspend the magnetic beads, digest at 37°C for 1 hour, shake for 15 seconds every 3 minutes, and rotate at 1000 rpm/min. After the reaction, take the supernatant. React at 94°C for 10 min, and place on ice immediately.

Table 4 Random primer extension system

components	Dosage
The above reaction system	30μL
1mM N6	1μL
10 x NEBuffer ™ 2	3μL
Klenow fragment(NEB)	10U
Hydrate to	60μL

React at 37°C for 20 minutes. React at 60°C for 5 minutes.

(3) sgRNA backbone connection with side-cutting active restriction enzyme cleavage site

Skeleton annealing: sg-F and sg-R were dissolved in 100mM NaCl solution to 100μM, mixed with equimolar concentrations, reacted at 95°C for 5min, and decreased by 1°C per minute. After the reaction, the annealed matrix was diluted to 10 μM with water.

Table 5 Skeleton connection system

components	Dosage
The above reaction system	60μL
10 μM sgRNA Backbone Adapter	5μL
10×T4 Ligase Reaction Buffer	5μL
50%PEG8000	10 μL
T4 DNA Ligase(K159L)	2000U
Hydrate to	100μL

React at 20°C for 30 minutes. After the reaction, add 50 μL Ampure DNA beads to recover DNA. 22 μL water for elution. Sequences above 140bp were recovered from DNA gel. The DNA electrophoresis image after connecting the sgRNA backbone is shown in Figure 3.

(5) MmeI digestion

Table 6

components	Dosage
DNA recovered from above	20 μL
10×rCutSmart buffer	3μL
MmeI	5U
Hydrate to	30μL

Reaction at 37°C for 2h. After the reaction, add 70 μL Ampure DNA beads to recover DNA. 42 μL water for elution.

(6) T7 promoter connection

Joint annealing: Dissolve T7-F and T7-R with 100mM NaCl solution to 100μM, take 10μL T7-F and 10μL T7-R in a PCR tube. React at 95°C for 5 minutes, decreasing by 1°C per minute. After the reaction, the annealed linker was diluted to 10 μM with water.

Table 7 Joint connection system:

components	Dosage
DNA recovered from above	40μL
10 μM T7 linker	5μL
10×T4 Ligase Reaction Buffer	5μL
T4 DNA Ligase	2000U
Hydrate to	50μL

Reaction at 20°C for 1h. After the reaction, add 22.5 μL Ampure DNA beads to recover the DNA and remove the unconnected adapters. 22 μL water for elution.

(5) sgRNA library amplification

Table 8 sgRNA library amplification system

components	Dosage
DNA recovered from above	20 μL
10 μM sgPCR-F/R	5μL
Phusion High-Fidelity PCR Master Mix	25 μL

Hydrate to

50μL

After denaturation at 98°C for 3 min, library cycles were amplified by denaturation at 98°C for 10 s, annealing at 60°C for 20 s, and extension at 72°C for 10 s. The amplified product was recovered with 70 μL Ampure DNA beads and eluted with 22 μL DEPC water. The electropherogram of the amplification product is shown in Figure 4.

(6) In vitro transcription of sgRNA library

Table 9

components	Dosage
DNA recovered from above	1μg
10×Transcription Buffer	2μL
CTP/GTP/ATP/UTP(100mM each)	2μL
T7 RNA Polymerase Mix(Yeasen)	2μL
Hydrate to	20 μL

After reacting at 37°C for 4h, add 10U DNase I (TAKARA), and react at 37°C for 1h. Add 50 μL Ampure RNA beads (Beckman) to recover RNA. The size of sgRNA was detected by agarose gel electrophoresis.

The electropherogram of the sgRNA library prepared by in vitro transcription of the amplified product is shown in Figure 5.

Example 2: Application of ERSP on removal of rRNA and host genome.

In this example, according to the ERSP method in Example 1, a random sgRNA library covering 18S rRNA and 28S rRNA was prepared using human RNA as a template; a random sgRNA library covering human genomic DNA was prepared using human genomic DNA as a template Library, referred to as ERSP library, and applied to rRNA removal and host genome removal. The specific implementation is as follows:

Table 10 sgRNA library and Cas9 protein pre-assembly:

components	Dosage
ERSP library	2-10μg
Cas9 (NEB)	0.2-0.5μg
500mM NaCl	1μL
total capacity	5μL

37°C for 30min.

Table 11 CRISPR cleavage

components

Dosage

Cas9-sgRNA library	5μL
RNA or DNA library	1-100ng
10×NEB buffer 3.1	1μL
total capacity	10 μL

37°C for 30-90min, 90°C for 10min.

(5) Library amplification

Table 12

components	Dosage
The above reaction system	10μL
Index Primer F/R(Yeasen,12610)	5μL
2×Canace PCR mix	25 μL
Hydrate to	50μL

After denaturation at 98°C for 3 min, library cycles were amplified by denaturation at 98°C for 10 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s. The amplified product was recovered with 45 μL Ampure DNA beads and eluted with 22 μL DEPC water.

The prepared library was sequenced and analyzed on the Illumina NovaSeq 6000 platform after Qsep100 quality inspection.

Nt.CviPII restriction site has a wide random distribution on 18S rRNA (see Figure 6).

The results of RNA library construction and sequencing are shown in Figure 7. The sgRNA library prepared by ERSP method can effectively remove 18S and 28S rRNA. The DNA library construction and sequencing results are shown in Figure 8. The sgRNA library prepared by the ERSP method can effectively remove the human host genomic DNA during the DNA library construction process.

In summary, this application provides an enzymatic target sequence random sgRNA preparation method ERSP (Enzymatical Random sgRNA Preparation), which can prepare all sgRNA groups randomly covering the target region at one time. The principle and process of ERSP are as follows: Use the random nickase Nt.CviPII to cut the PAM region of the target sequence; DNA denaturation, magnetic beads are connected to the linker containing the BbsI recognition site; BbsI is cut to release the DNA; the sgRNA backbone containing MmeI is connected; Cut with MmeI to obtain the sequence of the protospacer region; connect to the T7 promoter; amplify to obtain the sgRNA library with the T7 promoter; transcribe in vitro to obtain the target sequence sgRNA library. ERSP has the advantages of low cost, simple production, uniform coverage, small bias, no restriction on the length of the target sequence, and no need to design sgRNA in large quantities. It has important application value in the capture and removal of target genes.

Claims (10)

1. A method for preparing an enzymatic target sequence random sgRNA library, the steps comprising:

   (1) Treat sample DNA with random nickase Nt.CviPII, Nt.CviPII cuts the PAM region of the target sequence to obtain fragmented double-stranded DNA, denatures the double-stranded DNA to obtain fragmented single-stranded DNA;

   (2) In the reaction system of step (1), add the linker magnetic bead that contains BbsI restriction site, the 3 ' end of linker connects fragmented single-stranded DNA;

   (3) Cut the DNA connected to the magnetic beads with BbsI enzyme to release the single-stranded DNA;

   (4) Random primer extension to make single-stranded DNA form double-stranded DNA;

   (5) connecting the sgRNA backbone containing the MmeI restriction site at the 3' end of the double-stranded DNA;

   (6) Cutting the ligation product of step (5) with MmeI to release the protospacer region;

   (7) connecting the T7 promoter sequence at the 5' end of the original spacer region;

   (8) amplification obtains the sgRNA library template containing T7 promoter; and

   (9) In vitro transcription to obtain sgRNA library.
2. The method for preparing a random sgRNA library with enzymatic target sequences according to claim 1, wherein the sample DNA is genomic DNA, a PCR product or a DNA library.
3. The preparation method of the enzymatic target sequence random sgRNA library according to claim 1, wherein, the linker forward sequence of the adapter magnetic beads described in step (2) is /biotin/-TTTTTGAAGA (SEQ ID NO: 1), and the reverse The sequence is /NH2C6/-NNNNNNNHGGTCTTCAAAAA-/NH2C6/ (SEQ ID NO: 2), the two sequences are annealed at an equimolar concentration, and the magnetic beads are streptavidin magnetic beads.
4. The method for preparing a random sgRNA library of enzymatic target sequences according to claim 3, wherein in step (2), T4 DNA ligase or E.coli DNA ligase is used to connect the fragmented DNA to the adapter.
5. The preparation method of the enzymatic target sequence random sgRNA library according to claim 1, wherein the random primer described in step (4) is a 6-base random primer, and the extension adopts Klenow DNA polymerase.
6. The preparation method of the enzymatic target sequence random sgRNA library according to claim 1, wherein the sgRNA backbone described in step (5) is a double-stranded DNA formed by complementary pairing of two single-stranded DNAs, wherein the forward sequence is/ rApp/-CGGTTGGAGCTAGAAATAGCAAGTCAACCTAACGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT-/NH2C6/ (SEQ ID NO: 3); reverse sequence is /NH2C6/-AAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCGTTAGGTTGACTTGCTATTTCTAGCTCC AACC-/ddG/ (SEQ ID NO: 4).
7. The preparation method of enzymatic target sequence random sgRNA library according to claim 6, wherein, use T4 DNA ligase to connect sgRNA backbone and double-stranded DNA in step (5).
8. The preparation method of the enzymatic target sequence random sgRNA library according to claim 1, wherein, step (7) adopts T4 DNA ligase, and the forward sequence of the T7 promoter is /NH2C6/-TTCTAATACGACTCACTATAGGNN (SEQ ID NO: 5), the reverse sequence is /ddC/-CTATAGTGAGTCGTATTAGAA-/NH2C6/(SEQ ID NO:6).
9. The preparation method of the enzymatic target sequence random sgRNA library according to claim 1, wherein, the forward sequence of the primer pair used in the amplification reaction described in step (8) is TTCTAATACGACTCACTATAGG (SEQ ID NO: 7), reverse The directed sequence is AAAAGCACCGACTCGGTGCC (SEQ ID NO: 8).
10. The preparation method of enzymatic target sequence random sgRNA library according to claim 1, wherein, step (9) adopts T7 RNA polymerase to transcribe, adopts RNA recovery magnetic beads to reclaim the sgRNA library.

Images