WO2023113805A2

WO2023113805A2 - Recombinant aav for treatment of neural disease

Info

Publication number: WO2023113805A2
Application number: PCT/US2021/063882
Authority: WO
Inventors: Laura K. RICHMAN; Roberto CALCEDO DEL HOYO; Douglas N. SANDERS; Lisa M. Stanek; Christopher TIPPER; Richard Lu
Original assignee: Affinia Therapeutics Inc.
Priority date: 2021-12-16
Filing date: 2021-12-16
Publication date: 2023-06-22

Description

RECOMBINANT AAV FOR TREATMENT OF NEURAL DISEASE

1. SEQUENCE LISTING

[0001] The instant application contains a Sequence Listing, which has been submitted via EFS-Web and is hereby incorporated herein by reference in its entirety. Said ASCII copy, created on Month XX, 202X, is named 50312WO_CRF_sequencelisting.txt, and is XXX bytes in size.

2. BACKGROUND OF THE INVENTION

[0002] Adeno-associated virus (AAV) has become the vector system of choice for in vivo gene therapy. A growing variety of recombinant AAVs (rAAVs) engineered to deliver therapeutic nucleic acids have been developed and tested in nonhuman primates and humans, and the FDA has recently approved two rAAV gene therapy products for commercialization.

[0003] Although AAV vectors are safer and less inflammatory than other viruses, toxicities have occurred following administration of high doses of rAAVs for gene therapy. Thus, local administration of rAAVs to a target tissue or organ has been used to improve targeting and reduce systemic toxicity. Further, various natural and synthetic AAV variants have been tested to develop an AAV vector with desired tropism and specificity.

[0004] In general, the capsid is thought to be the primary determinant of infectivity and hostvector related properties such as adaptive immune responses, tropism, specificity, potency, and bio-distribution. Indeed, several of these properties are known to vary between natural serotypes and engineered AAV variants.

[0005] Treatment of diseases of the central nervous system (CNS) remains an intractable problem. Examples of CNS diseases include inherited genetic diseases such as the lysosomal storage diseases and brain cancer such as brain metastasis of breast cancer (BMBC). BMBC is observed in about 10-15% of women with stage IV breast cancer. The risk of the brain metastasis is usually highest for women with more aggressive subtypes of breast cancer, such as HER2-positive or triple-negative breast cancer. Currently, therapeutics for these CNS diseases are limited because many of them, when delivered intravenously, do not cross the blood-brain barrier, or, when delivered directly to the brain, are not widely distributed. Thus, therapies for the CNS diseases need to be developed. [0006] To date, however, there is little understanding as to how changes on the AAV capsid alter their biological properties and AAV vectors with a desired tropism and specificity to therapeutic targets, such as the central nervous system (CNS), have not yet been available. Species-specific differences in AAV tropism, for example between mice and nonhuman primates (NHP), has made it difficult to develop AAV vectors that have a desired tropism in humans.

3. SUMMARY OF THE INVENTION

[0007] Applicant has demonstrated that a single injection of Anc80L65, a rationally designed synthetic vector (described in WO2015/054653, which is incorporated by reference in its entirety herein), into the CSF of adult cynomolgus monkeys leads to more efficient transduction of broad regions of the CNS and strikingly outperforms the capabilities of AAV9 to target the cortex and deep brain nuclei. A single CSF injection of Anc80L65 distributes more broadly throughout the cortex and into deep brain nuclei compared to AAV9 delivered with either ICM or LP injection. Anc80L65 distribution by LP injection throughout the cortex was on par with ICM delivery, while AAV9 showed little to no transduction in the cortex following the LP route of delivery. ICM and LP delivery of both Anc80L65 and AAV9 led to robust transduction of the spinal cord and ventral horn motor neurons. The ability of Anc80L65 to mediate efficient expression in neurons and astrocytes across large regions of the NHP brain following a single LP injection has broad implications for treatment of a wide range of neurologic disorders. Availability of a relatively noninvasive method of delivery makes Anc80L65 a superior therapeutic modality to other available AAVs, including AAV9.

[0008] Applicant further developed and tested Anc80L65 for delivery of various coding sequences of anti-HER2 antigen binding protein (ABP) for treatment of BMBC. AAV genomic constructs with a coding sequence of anti-HER2 antigen (i.e., trastuzumab) operably linked to a different promoter (i.e., CMV promoter or UbC promoter) were tested for their capability to deliver and express the transgene in wide brain targets. Additionally, AAV genomic vectors with the heavy chain coding sequences and the light chain coding sequences of trastuzumab in different orders (5'-HC-LC-3' or 5'-LC-HC-3') were tested. The study demonstrated that a construct including UbC promoter operably linked to the heavy chain and the light chain coding sequences in the 5' to 3' order induces significantly better transduction and expression of trastuzumab compared to other constructs, when delivered to the mouse brain.

[0009] The Anc80L65 selected from these studies is expected to induce high level expression of a therapeutic protein (e.g., trastuzumab) across broad brain regions, thereby effectively treating various neurologic disorders, such as BMBC.

[0010] Accordingly, the present disclosure provides a method of transferring a polynucleotide to the central nervous system (CNS) of a subject, the method comprising: administering to the subject an effective dose of: a recombinant adeno-associated virus (rAAV) comprising: a capsid comprising: a capsid protein having the amino acid sequence of SEQ ID NO: 1 or a variant thereof, and the polynucleotide encapsulated by the capsid; thereby transferring the polynucleotide to the CNS.

[0011] In some embodiments, the polynucleotide comprises a coding sequence of a therapeutic protein. In some embodiments, the subject has a CNS disease. In some embodiments, the CNS disease is a lysosomal storage disease (LSD). In some embodiments, the CNS disease is a leukodystrophy.

[0012] In some embodiments, the CNS disease is metachromatic leukodystrophy (MLD). In some embodiments, the polynucleotide comprises a coding sequence encoding Arylsulfatase A (ARSA) or a functional variant thereof. In some embodiments, the polynucleotide comprises a coding sequence selected from SEQ ID NO: 2-4.

[0013] In some embodiments, the CNS disease is Krabbe's leukodystrophy. In some embodiments, the polynucleotide comprises a coding sequence of galactocerebroside betagalactosidase or a functional variant thereof.

[0014] In some embodiments, the CNS disease is GM1 gangliosidosis. In some embodiments, the polynucleotide comprises a coding sequence of galactosidase beta 1 (GLB- 1) or a functional variant thereof.

[0015] In some embodiments, the CNS disease is a cancer. In some embodiments, the CNS disease is metastatic breast cancer. In some embodiments, the therapeutic protein is an antigen binding protein against human epidermal growth factor receptor 2 (HER2). In some embodiments, the polynucleotide comprises a sequence of SEQ ID NO: 5. [0016] In some embodiments, the polynucleotide comprises a coding sequence of an antigen. In some embodiments, the antigen is a viral or bacterial antigen. In some embodiments, the effective dose is sufficient to immunize the subject. In some embodiments, the effective dose is sufficient to induce an immune response to the subject.

[0017] In some embodiments, the polynucleotide further comprises a regulatory sequence operably linked to the coding sequence. In some embodiments, the regulatory sequence comprises a CMV promoter or a UbC promoter. In some embodiments, the regulatory sequence comprises a UbC promoter having the sequence of SEQ ID NO: 7.

[0018] In some embodiments, the administration induces protein expression from the polynucleotide in the substantia nigra of the subject. In some embodiments, the administration induces protein expression from the polynucleotide in the caudate nuclei of the subject. In some embodiments, the administration induces protein expression from the polynucleotide in the ependyma of the subject. In some embodiments, the administration induces protein expression from the polynucleotide in the cortex of the subject.

[0019] In some embodiments, the administration is to the cerebrospinal fluid (CSF) of the subject. In some embodiments, the administration is selected from intrathecal administration, intracranial administration, intracerebroventricular (ICV) administration and administration to the lateral ventricles of the brain of the subject. In some embodiments, the intrathecal administration is by lumbar puncture (LP) and/or intra cisterna magna (ICM) injection. In some embodiments, the step of administering is performed by ICM injection. In some embodiments, the step of administering is performed by lumbar puncture (LP).

[0020] In some embodiments wherein the administration is to the cerebrospinal fluid (CSF) of the subject, the effective dose is between 1E10 to 1E16 genome copy numbers (GC) of the AAV. In some embodiments, the effective dose is 1E9 GC to 1E14 GC per gram brain mass. In some embodiments, the effective dose is administered at a concentration of 1E12 GC/ml to 1E17 GC/ml.

[0021] In some embodiments, the effective dose is administered systemically. In some embodiments, the step of administration is performed intravenously. In some embodiments, the effective dose is between 1E10 - 1E16 genome copy numbers (GC) of the AAV. In some embodiments, the effective dose is between 1E9 - 1E15 genome copy numbers (GC) of the AAV per kg body weight. [0022] In some embodiments, the effective dose is an amount sufficient to induce detectable expression of the therapeutic protein in the CNS. In some embodiments, the effective dose is an amount sufficient to induce detectable expression of the therapeutic protein in the substantia nigra. In some embodiments, the effective dose is an amount sufficient to induce detectable expression of the therapeutic protein in the caudate nuclei. In some embodiments, the effective dose is an amount sufficient to induce detectable expression of the therapeutic protein in the ependyma. In some embodiments, the effective dose is an amount sufficient to induce detectable expression of the therapeutic protein in the cortex.

[0023] In another aspect, the present disclosure provides a method of treating a disease of the central nervous system (CNS), the method comprising: administering to the CNS of a subject an effective dose of: a recombinant adeno-associated virus (rAAV), the rAAV comprising: a capsid polypeptide having the amino acid sequence of SEQ ID NO: 1 or a variant thereof, and a polynucleotide encoding a therapeutic protein.

[0024] In yet another aspect, the present disclosure provides a method of vaccination with a transgene, the method comprising: administering to the central nervous system (CNS) of a subject an effective dose of: a recombinant adeno-associated virus (rAAV), the rAAV comprising: a capsid polypeptide having the amino acid sequence of SEQ ID NO: 1 or a variant thereof, and a polynucleotide encoding an antigen.

[0025] In one aspect, the present disclosure provides a recombinant adeno-associated virus (rAAV) comprising: a capsid comprising: a capsid protein having the amino acid sequence of SEQ ID NO: 1, and a polynucleotide encapsulated by the capsid, wherein the polynucleotide encodes a therapeutic protein associated with a CNS disease.

[0026] In some embodiments, the CNS disease is metachromatic leukodystrophy (MLD). In some embodiments, the therapeutic protein is Arylsulfatase A (ARSA) or a functional variant thereof, the polynucleotide comprises a coding sequence selected from SEQ ID NOs: 2-4.

[0027] In some embodiments, the CNS disease is Krabbe's leukodystrophy. In some embodiments, the polynucleotide comprises a coding sequence of galactocerebrosidase or a functional variant thereof. [0028] In some embodiments, the CNS disease is GM1 gangliosidosis. In some embodiments, the therapeutic protein is galactosidase beta 1 (GLB-1) or a functional variant thereof.

[0029] In some embodiments, the CNS disease is cancer. In some embodiments, the CNS disease is metastatic breast cancer. In some embodiments, the therapeutic protein is an antigen binding protein against human epidermal growth factor receptor 2 (HER2).

[0030] In some embodiments, the ABP against HER2 is trastuzumab. In some embodiments, the coding sequence comprises from 5' to 3', a coding sequence of a heavy chain of the ABP against HER2 and a coding sequence of a light chain of the ABP against HER2. In some embodiments, the coding sequence comprises from 5' to 3', a coding sequence of a light chain of the ABP against HER2 and a coding sequence of a heavy chain of the ABP against HER2.

[0031] In some embodiments, the coding sequence of a heavy chain comprises a sequence of SEQ ID NO: 13, 15 or 17. In some embodiments, the coding sequence of a light chain comprises a sequence of SEQ ID NO: 14, 16 or 18. In some embodiments, the coding sequence comprises: a heavy chain coding sequence of SEQ ID NO: 13 and a light chain coding sequence of SEQ ID NO: 14; a heavy chain coding sequence of SEQ ID NO: 15 and a light chain coding sequence of SEQ ID NO: 16; or a heavy chain coding sequence of SEQ ID NO: 17 and a light chain coding sequence of SEQ ID NO: 18.

[0032] In some embodiments, the coding sequence further comprises a self-cleaving peptide between the coding sequence of the heavy chain and the coding sequence of the light chain. In some embodiments, the self-cleaving peptide is selected from the group consisting of F2A, P2A, T2A and E2A. In some embodiments, the self-cleaving peptide has the sequence of SEQ ID NO: 21.

[0033] In some embodiments, the coding sequence further comprising one or more coding sequence of interleukin 2 signal sequence (IL2SS). In some embodiments, one coding sequence of IL2SS is located at 5' end of the heavy chain coding sequence. In some embodiments, one coding sequence of IL2 SS is located at 5' end of the light chain coding sequence. In some embodiments, a first coding sequence of IL2 SS is located at 5' end of the heavy chain coding sequence and a second coding sequence of IL2 SS is located at 5' end of the light chain coding sequence. [0034] In some embodiments, the polynucleotide comprises a coding sequence of SEQ ID NO: 5. In some embodiments, the polynucleotide comprises a coding sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 5.

[0035] In some embodiments, the polynucleotide comprises the sequence of SEQ ID NO: 8- 18, or a fragment thereof.

[0036] In some embodiments, the polynucleotide comprises the sequence of SEQ ID NO: 8. In some embodiments, the polynucleotide comprises the sequence of SEQ ID NO: 9.

[0037] In some embodiments, the polynucleotide further comprises a regulatory sequence operably linked to the coding sequence. In some embodiments, the regulatory sequence comprises a CMV promoter or a UbC promoter. In some embodiments, the regulatory sequence comprises a UbC promoter having the sequence of SEQ ID NO: 7.

[0038] In another aspect, the present disclosure provides a pharmaceutical composition comprising any of the rAAV described herein. In yet another aspect, the present disclosure provides a unit dose comprising the pharmaceutical composition described herein.

[0039] In another aspect, the present disclosure provides a method of transferring a polynucleotide to the central nervous system (CNS) of a subject, the method comprising: administering to the subject an effective dose of: any of the rAAV described herein, any of the pharmaceutical compositions described herein, or any of the unit doses described herein.

[0040] In another aspect, the present disclosure provides a method of transferring a polynucleotide to the central nervous system (CNS) of a subject, the method comprising: administering to the CNS an effective dose of: a recombinant adeno-associated virus (rAAV) comprising: a capsid having the amino acid sequence of SEQ ID NO: 1 or a variant thereof, and a polynucleotide having the nucleic acid sequence of SEQ ID NO: 8 or 9, wherein the polynucleotide is encapsulated by the capsid, wherein the subject has metastatic breast cancer.

[0041] In another aspect, the present disclosure provides a recombinant adeno-associated virus (rAAV) comprising: a capsid having the amino acid sequence of SEQ ID NO: 1, and a polynucleotide encapsulated by the capsid having the nucleic acid sequence of SEQ ID NO: 8 or 9. 4. BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS

[0042] These and other features, aspects, and advantages of the present invention will become better understood with regard to the following description, and accompanying drawings.

[0043] FIG. 1 summarizes the NHP study design described in Example 6.2.

[0044] FIGs. 2A-2D are immunohistochemistry (IHC) images of brain sections, obtained from NHPs administered with (i) Anc80L65-CAG-GFP or (ii) AAV9-CAG-GFP by intraci sternal magna injection (ICM) or lumbar-puncture (LP). Brown stain = GFP expression (arrows). Inset in Anc80L65-LP (FIG. 2B) shows mostly neuronal staining. FIG. 2A shows GFP expression after administration of Anc80L65 via ICM injection. FIG. 2B shows GFP expression after administration of Anc80L65 via LP. FIG. 2C shows GFP expression after administration of AAV9 via ICM injection. FIG. 2D shows GFP expression after administration of AAV via LP.

[0045] FIGs. 3A-3C are IHC images of brain sections including cortex, obtained from a NHP administered with vehicle (FIG. 3 A), Anc80L65-CAG-GFP (FIG. 3B), or AAV9-CAG-GFP (FIG. 3C). Brown stain = GFP expression.

[0046] FIGs. 4A-4B are IHC images of a brain section including ependyma and caudate nucleus, obtained from a NHP administered Anc80L65-CAG-GFP by ICM injection. FIG. 4B is an enlarged image of a portion of FIG. 4A. Brown stain = GFP expression.

[0047] FIGs. 5 A-5B are IHC images of a brain section including caudate nucleus, obtained from a NHP administered with Anc80L65-CAG-GFP by ICM injection. FIG. 5B is an enlarged image of a portion of FIG. 5 A. Brown stain = GFP expression.

[0048] FIG. 6 is an IHC image of a brain section including substantia nigra, obtained from a NHP administered with Anc80L65-CAG-GFP by ICM injection. Brown stain = GFP expression.

[0049] FIGs. 7A and 7B are IHC images of a brain section including perivascular cells, obtained from a NHP administered with Anc80L65-CAG-GFP by ICM injection. FIG. 7B is an enlarged image of a portion of FIG. 7 A. Brown stain = GFP expression. [0050] FIGs. 8A and 8B are IHC images of a brain section including cortex, obtained from a NHP administered with Anc80L65-CAG-GFP by ICM injection. FIG. 8B is an enlarged image of a portion of FIG. 8 A. Brown stain = GFP expression.

[0051] FIG. 9 is an IHC image of a brain section including cortex, obtained from a NHP administered with Anc80L65-CAG-GFP by lumbar puncture (LP). Brown stain = GFP expression.

[0052] FIGs. 10A-10C provide one-way analysis of transgene expression determined by measurement of mRNA transcript of eGFP calculated according to the equation: % eGFP expression = (eGFP cp/uL RPP30 cp/uL) x 100, in various brain regions in animals administered with AAV9-CAG-GFP by ICM injection or with Anc80L65-CAG-GFP by LP. FIG. 10A provides data for the frontal cortex; FIG. 10B provides data for the motor cortex; and FIG. 10C provides data for the parietal lobe of the cortex.

[0053] FIGs. 11 A-l IB provide one-way analysis of transgene expression determined by measurement of mRNA transcript of eGFP calculated according to the equation: % eGFP expression = (eGFP cp/uL RPP30 cp/uL) x 100, in various brain regions administered with AAV9-CAG-GFP by ICM injection or with Anc80L65-CAG-GFP by LP. FIG. 11 A provides data for the caudate nucleus; and FIG. 1 IB provides data for the globus pallidus.

[0054] FIGs. 12A-12B provide one-way analysis of transgene expression determined by measurement of mRNA transcript of eGFP calculated according to the equation: % eGFP expression = (eGFP cp/uL RPP30 cp/uL) x 100, in various brain regions administered with AAV9-CAG-GFP by ICM injection or with Anc80L65-CAG-GFP by LP. FIG. 12A provides data for the putamen; and FIG. 12B provides data for the substantia nigra.

[0055] FIGs. 13 A- 17 provide one-way analysis of viral genome (DNA) copy per diploid genome (VGC/DG) determined by measurement of the genome copy numbers using ddPCR and calculation of (VGC/DG) values using the equation: VGC/DG = (eGFP cp/uL RPP30 cp/uL) x 2. Each figure provides data for a different brain region or liver, including cerebellar cortex (FIG. 13 A), dorsal root ganglia, cervical (FIG. 13B), dorsal root ganglia, lumbar (FIG. 14A), frontal cortex (FIG. 14B), liver (FIG. 15 A), motor cortex (FIG. 15B), spinal cord, cervical (FIG. 16 A), spinal cord, lumbar (FIG. 16B), and sciatic nerve (FIG. 17). [0056] FIGs. 18 A, 18B, 19A, 19B, 20A, 20B and 21 provide one-way analysis of transgene expression determined by measurement of mRNA transcript of eGFP calculated according to the equation: % eGFP expression = (eGFP cp/uL RPP30 cp/uL) x 100. Each figure provides data for a different brain region, including caudate nucleus (FIG. 18 A), frontal cortex (FIG. 18B), globus pallidus (FIG. 19 A), motor cortex (FIG. 19B), parietal cortex (FIG. 20A), putamen (FIG. 20B), and substantia nigra (FIG. 21).

[0057] FIGs. 22A-22D are immunohistochemistry (IHC) images of brain sections, obtained from NHPs administered with Anc80L65-CAG-GFP or AAV9-CAG-GFP by intraci sternal magna injection. Brown stain = GFP expression. FIG. 22 A shows GFP expression in the cortex after administration of Anc80L65-CAG-GFP. FIG. 22B shows GFP expression in the caudate nucleus after administration of Anc80L65-CAG-GFP. FIG. 22C shows GFP expression in the cortex after administration of AAV9-CAG-GFP. FIG. 22D shows GFP expression in the caudate nucleus after administration of AAV9-CAG-GFP.

[0058] FIGs. 23 and 24 illustrate the GFP mRNA expression measured by ddPCR in the NHP brain and spinal cord 2 weeks after ICM or LP delivery of AAV9-CAG-GFP or Anc80L65-CAG-GFP. FIG. 23 provides %GFP expression in the frontal cortex, motor cortex, and parietal cortex. FIG. 24 Provides %GFP expression in the caudate nucleus, globus palidus, putamen, and substantia nigra.

[0059] FIG. 25 illustrates the vector genome copy analysis via qPCR. VGCs per cell (presented as mean vector genome copies per diploid genome VGC/DG) in NHPs injected with Anc80L65-CAG-GFP and AAV9-CAG-GFP by LP or ICM injection are provided.

[0060] FIGs. 26A-26F are double immunofluorescence (IF) staining images of brain sections administered with Anc80L65-CAG-GFP (FIG. 26A, 26B and 26C) or AAV9-CAG-GFP (FIG. 26D, 26E and 26F). The transgene expression from the AAVs was detected by staining against GFP and cell types were detected by staining against cell-type specific markers, including NeuN for neurons (FIG. 26A and FIG. 26D), GFAP for astrocytes (FIG. 26B and FIG. 26E), and Ibal for microglial cells (FIG. 26C and FIG. 26F). Examples were imaged from the motor cortex. In all cases, GFP+ cells are shown in red, the cell specific marker is shown in green, and the merged images are shown with double-labeled cells in yellow/orange (arrows for double-labeled cells). [0061] FIGs. 27A-27F are double immunofluorescence (IF) staining images of brain sections from NHP administered with Anc80L65-CAG-GFP via LP (FIG. 27A, 27B and 27C) or via ICM (FIG. 27D, 27E and 27F). Examples were imaged from the motor cortex. The transgene expression from Anc80L65 was detected by staining against GFP and oligodendrocyte cells were detected by staining against oligodendrocyte specific marker OLIG2, shown in green (FIG. 27A and FIG. 27D). GFP+ cells are shown in red (FIG. 27B and FIG. 27E). The merged images are shown with double-labeled cells in yellow/orange (arrows for double-labeled cells) (FIG. 27C and FIG. 27F).

[0062] FIG. 28 provides a schematic of the experimental design for testing rAAV constructs encoding an antigen binding protein against human epidermal growth factor receptor 2 (HER2), as described in Example 6.3.

[0063] FIG. 29 illustrates brain samples obtained for testing transgene transfer and expression by rAAVs, as described in Example 6.3.

[0064] FIGs. 30A-30B provide one-way ANOVA analysis of viral genome (DNA) copy per diploid genome (VGC/DG) determined by measurement of the genome copy numbers using ddPCR and calculation of (VGC/DG) values using the equation: VGC/DG = (Trastuzumab cp/uL RPP30 cp/uL) x 2 for each of the five treatment groups described in Section 6.3 on day 13 (FIG. 30A) and day 30 (FIG. 30B).

[0065] FIGs. 31A-31B provide one-way ANOVA analysis of transgene expression determined by measurement of mRNA transcript of Trastuzumab calculated according to the equation: % Trastuzumab expression = (Trastuzumab cp/uL RPP30 cp/uL) x 100 for each of the five treatment groups described in Section 6.3 on day 13 (FIG. 31 A) and day 30 (FIG.

3 IB).

[0066] FIGs. 32A-32B provide one-way ANOVA analysis of transgene protein expression determined by measuring Trastuzumab protein expression in brain tissue using a HER2- binding ELISA and presented as absorbance normalized to total protein loaded. HER2- binding ELISAs were performed for the five treatment groups described in Section 6.3 on day 13 (FIG. 32A) and day 30 (FIG. 32B).

[0067] FIG. 33 provides a schematic of a polynucleotide encoding Trastuzumab (Her2 Heavy Chain and Her2 Light Chain) according to one embodiment. ITR - inverted terminal repeat. CMV - human cytomegalovirus (CMV) immediate-early enhancer and promoter. (-)35 Signal. IL-2 SS - interleukin 2 signal sequence. Furin P2A - porcine teschovirus-1 2 A selfcleaving peptide. SV40\polyA\signal - simian vacuolating virus 40 poly A signal.

[0068] FIG. 34 provides a schematic of a polynucleotide encoding Trastuzumab (Her2 Heavy Chain and Her2 Light Chain) according one embodiment. ITR - inverted terminal repeat. UbC - promoter of the human polyubiquitin C gene (UBC). (-)35 Signal. IL-2 SS - interleukin 2 signal sequence. Furin P2A - porcine teschovirus-1 2A self-cleaving peptide. SV40\polyA\signal - simian vacuolating virus 40 poly A signal.

[0069] FIG. 35 a schematic of the experimental procedure for testing and selecting candidate rAAV constructs, as described in Example 6.3 and 6.4.

[0070] FIG. 36 illustrates brain samples obtained for testing transgene transfer and expression, including the sagittal dissection and slab processing for forebrain, midbrain, and cerebellum.

[0071] FIG. 37A provides one-way ANOVA analysis of vector genome detection determined by measurement of AAV vector genomic DNA in forebrain tissue and presented as vector genome copies per diploid genome (VGC/DG) for each of the four treatment groups on day 28 as described in Section 6.4.

[0072] FIG. 37B provides one-way ANOVA analysis of transgene expression determined by measurement of mRNA transcript of Trastuzumab in forebrain tissue calculated according to the equation: % Trastuzumab expression = (Trastuzumab cp/uL RPP30 cp/uL) x 100 for each of the four treatment groups on day 28 as described in Section 6.4.

[0073] FIG. 37C provides one-way ANOVA analysis of transgene protein expression determined by measuring Trastuzumab protein expression in forebrain tissue using a HER2- binding ELISA and presented as absorbance normalized to total protein loaded. HER2- binding ELISAs were performed on day 28 for the five treatment groups described in Section 6.4.

[0074] FIG. 38A provides one-way ANOVA analysis of vector genome detection determined by measurement of AAV vector genomic DNA in midbrain tissue and presented as vector genome copies per diploid genome (VGC/DG) for each of the four treatment groups on day

28 as described in Section 6.4.

[0075] FIG. 38B provides one-way ANOVA analysis of transgene expression determined by measurement of mRNA transcript of Trastuzumab in midbrain tissue calculated according to the equation: % Trastuzumab expression = (Trastuzumab cp/uL RPP30 cp/uL) x 100 for each of the four treatment groups on day 28 as described in Section 6.4.

[0076] FIG. 38C provides one-way ANOVA analysis of transgene protein expression determined by measuring Trastuzumab protein expression in midbrain tissue using a HER2- binding ELISA and presented as absorbance normalized to total protein loaded. HER2- binding ELISAs were performed on day 28 for the five treatment groups described in Section 6.4.

[0077] FIG. 39A provides one-way ANOVA analysis of vector genome detection determined by measurement of AAV vector genomic DNA in cerebellum tissue and presented as vector genome copies per diploid genome (VGC/DG) for each of the four treatment groups on day 28 as described in Section 6.4.

[0078] FIG. 39B provides one-way ANOVA analysis of transgene expression determined by measurement of mRNA transcript of Trastuzumab in cerebellum tissue calculated according to the equation: % Trastuzumab expression = (Trastuzumab cp/uL RPP30 cp/uL) x 100 for each of the four treatment groups on day 28 as described in Section 6.4.

[0079] FIG. 39C provides one-way ANOVA analysis of transgene protein expression determined by measuring Trastuzumab protein expression in cerebellum tissue using a HER2 -binding ELISA and presented as absorbance normalized to total protein loaded.

HER2 -binding ELISAs were performed on day 28 for the five treatment groups described in Section 6.4.

[0080] FIG. 40 are immunohistochemistry (IHC) images of brain sections, obtained from mice in each of the treatment groups described in Section 6.4. Brown stain = IgG Fc expression (proxy for Trastuzumab protein). * indicates representative image for 3/10 animas. ** indicates representative image for 7/10 animals. *** indicates representative image for 2/10 animals. White arrows indicate cerebral cortex. Black arrows indicate choroid plexus. Double black arrows indicate hippocampus. 5. DETAILED DESCRIPTION OF THE INVENTION

5.1. Definitions

[0081] The term "antigen binding protein" or "ABP" as used herein includes an antibody, or functional fragment thereof. The ABP can exist in a variety of form including, for example, a polyclonal antibody, monoclonal antibody, camelized single domain antibody, intracellular antibody ("intrabodies"), recombinant antibody, multispecific antibody, antibody fragment, such as, Fv, Fab, F(ab)2, F(ab)3, Fab', Fab'-SH, F(ab')2, single chain variable fragment antibody (scFv), tandem/bis-scFv, Fc, pFc', scFvFc (or scFv-Fc), disulfide Fv (dsfv), bispecific antibody (bc-scFv) such as BiTE antibody; camelid antibody, resurfaced antibody, humanized antibody, fully human antibody, single-domain antibody (sdAb, also known as NANOBODY®), chimeric antibody, chimeric antibody comprising at least one human constant region, and the like. "Antibody fragment" refers to at least a portion of the variable region of the immunoglobulin that binds to its target, e.g., the tumor cell.

[0082] As used herein, the term "CDR" or "complementarity determining region" refers to the noncontiguous antigen combining sites found within the variable region of heavy chain and light chain polypeptides that are involved in antigen binding.

5.2. Recombinant Adeno-Associated Virus

[0083] One aspect of the present disclosure provides an rAAV comprising a capsid (Anc80L65 capsid) comprising: a capsid protein comprising the amino acid sequence of SEQ ID NO: 1, and the polynucleotide encapsulated by the capsid. The polynucleotide can encode a therapeutic protein. In a particular embodiment, the polynucleotide includes a coding sequence of Trastuzumab, including a heavy chain (SEQ ID NO: 19) and a light chain (SEQ ID NO: 20).

5.2.1. Capsid

[0084] The rAAV used in various embodiments of the present disclosure comprises a capsid formed with VP1, VP2 and VP3 capsid proteins. In a particular embodiment, the capsid is formed with VP1, VP2 and VP3 capsid proteins of Anc80L65. In some embodiments, VP1 protein has the amino acid sequence of SEQ ID NO: 1. In some embodiments, the VP1 protein comprises a sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 1. In some embodiments, VP2 and VP3 proteins have a portion of the amino acid sequence of SEQ ID NO: 1. In some embodiments, VP2 has a sequence corresponding to amino acids 138 to 736 of SEQ ID NO: 1 and VP3 protein can have a sequence corresponding to amino acids 203 to 736 of SEQ ID NO: 1. In some embodiments, VP2 has a sequence corresponding to a sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to amino acids 138 to 736 of SEQ ID NO: 1 and VP3 protein can have a sequence corresponding to a sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to amino acids 203 to 736 of SEQ ID NO: 1.

5.2.2. Polynucleotide

[0085] The rAAV disclosed herein comprises a polynucleotide encapsulated by the capsid. The polynucleotide comprises a sequence encoding a protein, peptide or RNA for treatment of a CNS disease. In some embodiments, the polynucleotide comprises a coding sequence of a protein associated with a CNS disease.

[0086] In some embodiments, the polynucleotide comprises a coding sequence of a therapeutic protein (e.g., genetically deficient protein in a subject with a CNS disease, antigen binding protein), RNAs (e.g., inhibitory RNAs or catalytic RNAs), or target antigens (e.g., oncogenic antigens, autoimmune antigens). In some embodiments, the rAAV comprises a polynucleotide encoding a tRNA, miRNA, gene editing guide RNA, or RNA-editing guide RNA.

[0087] In some embodiments, the polynucleotide comprises a coding sequence of a secretory protein. A secretory protein is a protein, whether it be endocrine or exocrine, which is secreted by a cell. Secretory proteins include but are not limited to hormones, enzymes, toxins, and antimicrobial peptides. In some embodiments, secretory proteins are synthesized in the endoplasmic reticulum. In some embodiments, the polynucleotide comprises a coding sequence of a secretory protein associated with a CNS disease.

[0088] In some embodiments of the present disclosure, the rAAV comprises one or more transgene. A transgene may be, for example, a reporter gene (e.g., beta-lactamase, betagalactosidase (LacZ), alkaline phosphatase, thymidine kinase, green fluorescent polypeptide (GFP), chloramphenicol acetyltransferase (CAT), or luciferase, or fusion polypeptides that include an antigen tag domain such as hemagglutinin or Myc), or a therapeutic gene (e.g., genes encoding hormones or receptors thereof, growth factors or receptors thereof, differentiation factors or receptors thereof, immune system regulators (e.g., cytokines and interleukins) or receptors thereof, enzymes, RNAs (e.g., inhibitory RNAs or catalytic RNAs), or target antigens (e.g., oncogenic antigens, autoimmune antigens)). In some embodiments, the rAAV comprises an expressible polynucleotide encoding a therapeutic tRNA, miRNA, gene editing guide RNA, or RNA-editing guide RNA.

[0089] In some embodiments, the polynucleotide comprises a coding sequence of a protein deficient in a subject (e.g., a human) having a CNS disease. In some embodiments, the coding sequence encodes one or more of a protein known to be associated with a disease selected from: Adrenoleukodystrophy, Alexander Disease, Alzheimer disease, Amyotrophic lateral sclerosis, Angelman syndrome, Ataxia telangiectasia, Canavan disease, Charcot- Marie-Tooth syndrome, Cockayne syndrome, Chronic inflammatory demyelinating polyneuropathy (CIDP), Deafness, Duchenne muscular dystrophy, Epilepsy, Essential tremor, Fragile X syndrome, Friedreich's ataxia, Gaucher disease, GM1 gangliosidosis, GM2 gangliosidoses, Huntington disease, Frontotemporal Degeneration (FTD), Lesch-Nyhan syndrome, Maple syrup urine disease, Menkes syndrome, Metachromatic leukodystrophy (MLD), Myotonic dystrophy, Multiple sclerosis, Narcolepsy, Neurofibromatosis, Niemann- Pick disease, Parkinson's disease, Phenylketonuria, Prader-Willi syndrome, Refsum disease, Rett syndrome, Spinal muscular atrophy, Spinocerebellar ataxia, Tangier disease, Tay-Sachs disease, Tuberous sclerosis, Von Hippel-Lindau syndrome, Williams syndrome, Wilson's disease, or Zellweger syndrome.

[0090] In some embodiments, the coding sequence encodes a protein known to be associated with a lysosomal storage disease, as known in the art and as described herein.

[0091] In some embodiments, the coding sequence encodes a protein known to be associated with a demyelinating or white matter disease, as known in the art and as described herein.

[0092] In some embodiments, the polynucleotide comprises a coding sequence of an antigen that can induce an immune response in a subject when administered. In some embodiments, the polynucleotide comprises a coding sequence of viral or bacterial antigen. In some embodiments, the antigen is useful for immunizing a subject (e.g., a human, an animal (e.g., a companion animal, a farm animal, an endangered animal). For example, antigen can be obtained from an organism (e.g., a pathogenic organism) or an immunogenic portion or component thereof (e.g., a toxin polypeptide or a by-product thereof). By way of example, pathogenic organisms from which immunogenic polypeptides can be obtained include viruses (e.g., picornavirus, enteroviruses, orthomyxovirus, reovirus, retrovirus), prokaryotes (e.g., Pneumococci, Staphylococci, Listeria, Pseudomonas), and eukaryotes (e.g., amebiasis, malaria, leishmaniasis, nematodes). It would be understood that the methods described herein and compositions produced by such methods are not to be limited by any particular transgene. In some embodiments, the polynucleotide comprises a coding sequence which has been codon optimized.

[0093] In some embodiments, the polynucleotide comprises a coding sequence of hASPA (aminoacylase 2) for treatment of Canavan disease. In some embodiments, the polynucleotide comprises a coding sequence of hAADC for treatment of AADC deficiency. In some embodiments, the polynucleotide comprises a coding sequence of one or more of NTN, hGDNF, and hAADC for treatment of Parkinson's disease. In some embodiments, the polynucleotide comprises a coding sequence of one or more of hNGF and hAPOE2 for treatment of Alzheimer's disease. In some embodiments, the polynucleotide comprises a coding sequence of SMN for treatment of SMA1. In some embodiments, the polynucleotide comprises a coding sequence of Glial fibrillary acidic protein (GFAP) for treatment of Alexander Disease. In some embodiments, the polynucleotide comprises a coding sequence of one or more selected from: allograft inflammatory factor 1 (AIF-1), lymphatic hyaluronan receptor (LYVE-1/XLKD1), FYN binding protein (FYB), P2RY1 (purinergic receptor P2Y, G-protein-coupled, 1), and MLLT3 (myeloid/lymphoid or mixed-lineage leukemia translocated to, 3), for treatment of chronic inflammatory demyelinating polyneuropathy (CIDP). In some embodiments, the polynucleotide comprises a coding sequence of one or more of a gene described in D'Netto MJ, et al. "Risk alleles for multiple sclerosis in multiplex families." Neurology. 2009 Jun 9;72(23): 1984-8 (incorporated herein by reference), for treatment of multiple sclerosis. In some embodiments, the polynucleotide comprises a coding sequence of one or more of a gene selected from IL2RA, IL7R, EVI5, KIAA0350, and CD58, for treatment of multiple sclerosis.

[0094] In some embodiments, the polynucleotide further comprises a regulatory sequence regulating expression from the coding sequence. In some embodiments, the polynucleotide comprises a regulatory sequence directing expression of the gene product in a target cell. In some embodiments, when the polynucleotide comprises a regulatory sequence directing expression of the gene product in a target cell, the regulatory sequence and the gene are considered operably linked. In some embodiments, the regulatory sequence is a promoter sequence. In some embodiments, the regulatory sequence is a combination of one or more promoter sequences and one or more enhancer sequences. In some embodiments, the regulatory sequence comprises a CMV or UbC promoter. In some embodiments, the regulatory sequence is selected from SEQ ID NO: 6 or 7. In some embodiments, the regulatory sequence has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 6 or 7. In some embodiments, the regulatory sequence has 80%, 85%, 90%, 95%, 96%, 97%, 98%, or greater sequence identity to SEQ ID NO: 6 or 7. In some embodiments, the polynucleotide further comprises non-coding sequences at 3' to the coding sequence. Non-limiting examples of non-coding sequences at 3' to the coding sequence include a poly(A) signal and a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE).

[0095] In some embodiments, the polynucleotide further comprises a target sequence to one or more miRNA. In some embodiments, the miRNA is expressed or active only in a specific cell, tissue or organ. In some embodiments, the miRNA is expressed or active only in dorsal root ganglia (DRG). In some embodiments, the polynucleotide comprises a target sequence to miR-183, miR-182, or miR-96. In some embodiments, the polynucleotide comprises more than one target sequences, wherein each target sequence is specific to miR-183, miR-182, or miR-96. In some embodiments, the polynucleotide comprises at least two tandem repeats of the target sequences which comprise at least a first miRNA target sequence and at least a second miRNA target sequence which may be the same or different, as described in WO2020132455A1, the contents of which are incorporated by reference. In some embodiments, the target sequences to one or more miRNA are located at the 3' end of the polynucleotide. In certain embodiments, the polynucleotide comprises at least two tandem repeats of the miRNA target sequences that are located at 3' UTR. In certain embodiments, the polynucleotide comprises three tandem repeats of miRNA target sequences. In certain embodiments, the at least two DRG-specific miRNA target sequences are located at both the 5' UTR and the 3' UTR. In some embodiments, the two or more consecutive miRNA target sequences are continuous and not separated by a spacer.

[0096] In some embodiments, the polynucleotide comprises more than one coding sequence. In some embodiments, the multiple coding sequences are separated by one or more selfcleaving peptides. The self-cleaving peptides can be 2A self-cleaving peptides. Non-limiting examples of self-cleaving peptides include 2A peptides (18-22 amino acids), including a peptide from foot-and-mouth disease virus (F2A), porcine teschovirus-1 (P2A), Thoseaasigna virus (T2A), or equine rhinitis A virus (E2A). In some embodiments, the polypeptide comprises Furin P2A. In some embodiments, the Furin P2A has the sequence of SEQ ID NO: 21. In some embodiments, the multiple coding sequences are separated by one or more internal ribosome entry site (IRES).

[0097] In some embodiments, the polynucleotide further comprises AAV's inverted terminal repeats (ITRs).

[0098] In some embodiments, the polynucleotide further comprises a signal sequence encoding a signal peptide. In some embodiments, a signal peptide enhances secretion of a polypeptide (e.g., any of the antigen-binding proteins (ABP)) encoded by the coding sequences described herein) from the cell in which the polynucleotide is transferred. A nonlimiting example of a signal sequence includes an interleukin-2 (IL-2) signal sequence. In some embodiments, the signal sequence has the sequence of SEQ ID NO: 22. One of skill in the art would appreciate that other signal sequences could be used along with the methods described herein to enhance secretion.

5.2.2.1 Polynucleotide for treatment of lysosomal storage disease

[0099] In some embodiments, the rAAV provided herein is used to transfer a polynucleotide to a subject having a lysosomal storage disease, e.g., a lack or deficiency in a lysosomal storage enzyme. In some embodiments, the polynucleotide comprises a coding sequence of ZFN for safe insertion of hIDUA for treatment of MPS 1. In some embodiments, the polynucleotide comprises a coding sequence of ZFN for safe insertion of hIDS for treatment of MPSII. In some embodiments, the polynucleotide comprises a coding sequence of hSGSH for treatment of MPS IIIA. In some embodiments, the polynucleotide comprises a coding sequence of hNAGLU for treatment of MPSIIIB. In some embodiments, the polynucleotide comprises a coding sequence of hCLN2, hCLN3, or hCNL6 for treatment of LINCL (Batten disease). In some embodiments, the polynucleotide comprises a coding sequence of human arylsulfatase A (hARSA) for treatment of MLD.

[0100] In some embodiments, the rAAV comprises a polynucleotide comprising a coding sequence of a gene associated with the lysosomal storage disease as provided in TABLE 1.

[0101] In some embodiments, the rAAV comprises a polynucleotide containing a coding sequence of ARSA, or functional variant thereof, for treatment of arylsulfatase A deficiency or metachromatic leukodystrophy (MLD). In some embodiments, the coding sequence has been codon optimized. In some embodiments, the coding sequence encodes a functional variant of ARSA, having improved enzyme or other protein activity, and/or longer half-life compared to a naturally occurring ARSA protein. In some embodiments, the coding sequence of ARSA described in US 2019/0352624 (Univ Bonn Rheinische Friedrich Wilhems) is used, the patent publication is incorporated by reference in its entirety herein. In some embodiments, the coding sequence is selected from SEQ ID Nos: 3-5. In some embodiments, the coding sequence has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID No: 3, 4, or 5. In some embodiments, the coding sequence has 80%, 85%, 90%, 95%, 96%, 97%, 98%, or greater sequence identity to SEQ ID No: 3, 4, or 5.

[0102] In some embodiments, the rAAV comprises a polynucleotide containing a coding sequence of beta-galactosidase- 1 (GLB-1), or functional variant thereof, for treatment of GM1 gangliosidosis. In some embodiments, the coding sequence has been codon optimized. In some embodiments, the coding sequence encodes a functional variant of GLB-1, having improved enzyme or other protein activity, and/or longer half-life, compared to naturally occurring GLB-1.

[0103] In some embodiments, the rAAV comprises a polynucleotide containing a coding sequence of galactocerebroside, or a functional variant thereof, for treatment of Krabbe's leukodystrophy. In some embodiments, the coding sequence has been codon optimized. In some embodiments, the coding sequence encodes a functional variant of galactocerebroside, having improved enzyme or other protein function and/or longer half-life, compared to naturally occurring galactocerebroside.

5.2.2.1 Polynucleotide for treatment of brain cancer

[0104] In some embodiments, the rAAV provided herein is used for treating a subject having brain cancer. In some embodiments, rAAV comprises a polynucleotide comprising a coding sequence of a gene associated with treating cancer.

[0105] In some embodiments, the polynucleotide encapsulated by the capsid is a polynucleotide encoding an antigen binding protein (ABP). In some embodiments, the polynucleotide comprises a coding sequence of an ABP specific to a tumor cell. In some embodiments, the polynucleotide comprises a coding sequence of an ABP specific to a brain tumor antigen.

[0106] In some embodiments, the ABP is a monoclonal antibody. In some embodiments, the ABP is selected from a human antibody, a humanized antibody, or a chimeric antibody. In some embodiments, the antibody is a single chain variable fragment (scFv).

[0107] In some embodiments, the polynucleotide comprises a coding sequence of an immunoglobulin constant region. In some embodiments, the polynucleotide comprises a coding sequence of a Fab, Fab', F(ab')2, Fv, scFv, (scFv)2, single chain antibody molecule, dual variable domain antibody, single variable domain antibody, linear antibody, V domain antibody, or bispecific tandem bivalent scFvs.

[0108] In some embodiments, the polynucleotide comprises a coding sequence of a heavy chain constant region of a class selected from IgG, IgA, IgD, IgE, and IgM. In some embodiments, the polynucleotide comprises a coding sequence of a heavy chain constant region of the class IgG and a subclass selected from IgGl, IgG2, IgG3, and IgG4. In some embodiments, the polynucleotide comprises a coding sequence of a heavy chain constant region of IgG.

[0109] In some embodiments, the polynucleotide comprises a coding sequence of a heavy chain of an ABP. In some embodiments, the polynucleotide comprises a coding sequence of a light chain of an ABP. In some embodiments, the polynucleotide comprises coding sequences of a heavy chain and a light chain. In some embodiments, the polynucleotide comprises from 5' to 3' coding sequences of a heavy chain of an ABP and a light chain of an ABP. In some embodiments, the polynucleotide comprises from 5' to 3' coding sequences of a light chain of an ABP and a heavy chain of an ABP. In some embodiments, the polynucleotide comprises a self-cleaving peptide between the heavy chain coding sequence and the light chain coding sequence. In some embodiments, the heavy chain coding sequence is linked to interleukin 2 signal sequence. In some embodiments, the light chain coding sequence is linked to interleukin 2 signal sequence.

[0110] In some embodiments, the ABP encoded by the polynucleotide is an ABP specific to human epidermal growth factor receptor 2 (HER2). In some embodiments, the coding sequence encodes an antibody, (e.g., trastuzumab), or a modification thereof. In some embodiments, the coding sequence encodes an ABP comprising the CDRs of trastuzumab or variants thereof. In some embodiments, the coding sequence encodes trastuzumab having the sequence of a heavy chain of SEQ ID NO: 19 and a light chain of SEQ ID NO: 20. In some embodiments, the coding sequence has been codon optimized. In some embodiments, the anti-HER2 ABP is encoded by a coding sequence of trastuzumab described in US2013/0273650 (Wu), incorporated by reference in its entirety herein. In some embodiments, the anti-HER2 ABP is encoded by a coding sequence of trastuzumab described in US10,780,182 (Wilson), incorporated by reference in its entirety herein.

[0111] In some embodiments, the polynucleotide comprises a coding sequence of a heavy chain of trastuzumab or a coding sequence of a light chain of trastuzumab.

[0112] In some embodiments, the heavy chain coding sequence has the sequence of SEQ ID NO: 13, 15, or 17. In some embodiments, the heavy chain coding sequence has a sequence having at least 90%, 95%, 97%, 98%, or 99% identity to SEQ ID NO: 13, 15 or 17. In some embodiments, the heavy chain coding sequence is linked to interleukin 2 signal sequence.

[0113] In some embodiments, the light chain coding sequence has the sequence of SEQ ID NO: 14, 16, or 18. In some embodiments, the light chain coding sequence has a sequence having at least 90%, 95%, 97%, 98%, or 99% identity to SEQ ID NO: 14, 16, or 18. In some embodiments, the light chain coding sequence is linked to interleukin 2 signal sequence.

[0114] In some embodiments, the polynucleotide comprises both a coding sequence of a heavy chain of Trastuzumab and/or a coding sequence of a light chain of Trastuzumab. In some embodiments, the polynucleotide comprises a self-cleaving peptide between the coding sequence of a heavy chain and the coding sequence of a light chain. In some embodiments, the self-cleaving peptide is a 2A peptide (18-22 amino acids). In some embodiments, the 2A peptide is F2A, P2A, T2A, or E2A. In some embodiments, the self-cleaving peptide has the sequence of SEQ ID NO: 21.

[0115] In some embodiments, the heavy chain coding sequence comprises a heavy chain variable domain (VH) comprising a sequence having at least 90%, 95%, 97%, 98%, or 99% identity to SEQ ID NOs: 26, 28, or 30. In some embodiments, the light chain coding sequence comprises a light chain variable domain (VL) comprising a sequence having at least 90%, 95%, 97%, 98%, or 99% identity to SEQ ID NOs: 27, 29, or 31. In some embodiments, the polynucleotide comprises both a coding sequence of a heavy chain variable domain comprising a sequence having at least 90%, 95%, 97%, 98%, or 99% identity to SEQ ID NOs: 26, 28, or 30 and the light chain variable domain comprising a sequence having at least 90%, 95%, 97%, 98%, or 99% identity to SEQ ID NOs: 27, 29, or 31.

[0116] In some embodiments, the coding sequence encodes an anti-Her2 ABP comprising the CDRs of trastuzumab or variants thereof. In some embodiments, the heavy chain coding sequence comprises a sequence of SEQ ID NO: 32. In some embodiments, the coding sequence encodes trastuzumab comprising a CDR3 having a sequence of SEQ ID NO: 33.

[0117] In some embodiments, the polynucleotide comprises a coding sequence having the sequence of SEQ ID NO: 5. In some embodiments, the coding sequence has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 5. In some embodiments, the coding sequence has 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or greater sequence identity to SEQ ID NO: 5.

[0118] In some embodiments, the coding sequence of anti-Her2 ABP comprises from 5' to 3' : a heavy chain coding sequence followed by a light chain coding sequence. In some embodiments, the coding sequence of anti-Her2 ABP comprises from 5' to 3': a light chain coding sequence followed by a heavy chain coding sequence.

[0119] In some embodiments, the polypeptide comprises from 5' to 3', coding sequences of interleukin 2 signal peptide, a heavy chain of anti-Her2 ABP, a self-cleaving peptide, interleukin 2 signal peptide, and a light chain of anti-Her2 ABP. In some embodiments, the polypeptide comprises from 5' to 3', coding sequences of interleukin 2 signal peptide, a light chain of anti-Her2 ABP, a self-cleaving peptide, interleukin 2 signal peptide, and a heavy chain of anti-Her2 ABP.

[0120] In some embodiments, the polynucleotide (e.g., a polynucleotide encoding an ABP specific to human epidermal growth factor receptor 2 (HER2)) is or comprises a sequence selected from SEQ ID NOs: 8-12. In some embodiments, the polynucleotide comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NOs: 8-12. In some embodiments, the polynucleotide has 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or greater sequence identity to SEQ ID NOs: 8-12. [0121] In some embodiments, the polynucleotide (e.g., a polynucleotide encoding an ABP specific to HER2) is or comprises a sequence of SEQ ID NO: 8. In some embodiments, the polynucleotide is or comprises a sequence of SEQ ID NO: 9.

[0122] In some embodiments, the polynucleotide (e.g., a polynucleotide encoding an ABP specific to HER2) comprises one or more mutations in the heavy chain and/or light chain coding sequences that result in an amino acid substitution.

[0123] In some embodiments, the one or more mutations enhance antibody-dependent cellular cytotoxicity (ADCC). In some embodiments, the polynucleotide includes a coding sequence comprising one or more mutations that lead to amino acid substitutions at amino acid residues 239, 332, and/or 330. In some embodiments, the amino acid substitutions include S239D, I332E, and/or A330L.

[0124] In some embodiments, one or more mutations enhance antibody effector function. In some embodiments, the polynucleotide includes a coding sequence comprising one or more mutations that lead to amino acid substitutions at amino acid residues 356 and/or 358 in the heavy chain amino acid sequence. In some embodiments, the amino acid substitutions include D356E and/or L358M. In some embodiments, the polynucleotide has the sequence of SEQ ID NOs: 5, 8, or 9.

[0125] In some embodiments, the ABP encoded by the polynucleotide is a recombinant humanized monoclonal antibody that targets the extracellular dimerization domain (Subdomain II) of the human epidermal growth factor receptor 2 protein (HER2). For example, pertuzumab can be used. The amino acid sequences of its heavy chain and light chain are provided, e.g., in drugbank.ca/drugs/DB06366 (synonyms include 2C4, MOAB 2C4, monoclonal antibody 2C4, and rhuMAb-2C4) on this database at accession number DB06366.

[0126] In some embodiments, the ABP encoded by the polynucleotide is MM- 121/SAR256212, a fully human monoclonal antibody that targets the HER3 receptor [Merrimack's Network Biology] and which has been reported to be useful in the treatment of non-small cell lung cancer (NSCLC), breast cancer and ovarian cancer.

[0127] In some embodiments, the ABP encoded by the polynucleotide is SAR256212, a fully human monoclonal antibody that targets the HER3 (ErbB3) receptor [Sanofi Oncology], [0128] In some embodiments, the ABP encoded by the polynucleotide is anti-Her3/EGFR antibody, RG7597 [Genentech], described as being useful in head and neck cancers.

[0129] In some embodiments, the ABP encoded by the polynucleotide is margetuximab (or MGAH22), a next-generation, Fc-optimized monoclonal antibody (mAb) that targets HER [MacroGenics],

[0130] In some embodiments, other human epithelial cell surface markers and/or other tumor receptors or antigens are targeted by a protein (e.g., ABP or enzyme) encoded by the polynucleotide encapsulated by the rAAV. Examples of other cell surface marker targets include: 5T4, CA-125, CEA (e.g., targeted by labetuzumab), CD3, CD19, CD20 (e.g., targeted by rituximab), CD22 (e.g., targeted by epratuzumab or veltuzumab), CD30, CD33, CD40, CD44, CD51 (also integin αvP3), CD133 (e.g., glioblastoma cells), CTLA-4 (e.g., Ipilimumab used in treatment of neuroblastoma), Chemokine (C-X-C Motif) Receptor 2 (CXCR2) (expressed in different regions in brain; e.g., Anti-CXCR2 (extracellular) antibody # ACR-012 (Alomene Labs)); EpCAM, fibroblast activation protein (FAP) [see, e.g., WO 2012020006 A2, brain cancers], folate receptor alpha (e.g., pediatric ependymal brain tumors, head and neck cancers), fibroblast growth factor receptor 1 (FGFR1) (see, e.g., WO2012125124A1 for discussion treatment of cancers with anti-FGFRl antibodies), FGFR2 (see, e.g., antibodies described in WO2013076186A and WO2011143318A2), FGFR3 (see, e.g., antibodies described in U.S. Pat. No. 8,187,601 and W02010111367A1), FGFR4 (see, e.g., anti-FGFR4 antibodies described in WO2012138975A1), hepatocyte growth factor (HGF) (see, e.g., antibodies in WO2010119991 A3), integrin α5pi, IGF-1 receptor, gangioloside GD2 (see, e.g., antibodies described in WO2011160119A2), ganglioside GD3, transmembrane glycoprotein NMB (GPNMB) (associated with gliomas, among others and target of the antibody glembatumumab (CR011), mucin, MUC1, phosphatidylserine (e.g., targeted by bavituximab, Peregrine Pharmaceuticals, Inc], prostatic carcinoma cells, PD-L1 (e.g., nivolumab (BMS-936558, MDX-1106, ONO-4538), a fully human gG4, e.g., metastatic melanoma], platelet-derived growth factor receptor, alpha (PDGFR a) or CD140, tumor associated glycoprotein 72 (TAG-72), tenascin C, tumor necrosis factor (TNF) receptor (TRAIL-R2), vascular endothelial growth factor (VEGF)-A (e.g., targeted by bevacizumab) and VEGFR2 (e.g., targeted by ramucirumab). Other antibodies and their targets include, e.g., APN301 (hul4.19-IL2), a monoclonal antibody [malignant melanoma and neuroblastoma in children, Apeiron Biologies, Vienna, Austria], See, also, e.g., monoclonal antibody, 8H9, which has been described as being useful for the treatment of solid tumors, including metastatic brain cancer. The monoclonal antibody 8H9 is a mouse IgGl antibody with specificity for the B7H3 antigen [United Therapeutics Corporation], This mouse antibody can be humanized. Still other immunoglobulin constructs targeting the B7-H3 and/or the B7-H4 antigen may be used in various embodiments of the present disclosure. Another ABP is S58 (anti-GD2, neuroblastoma). Cotara™ [Perregrince Pharmaceuticals] is a monoclonal antibody described for treatment of recurrent glioblastoma. Other ABPs may include, e.g., avastin, ficlatuzumab, medi-575, and olaratumab. Still other immunoglobulin constructs or monoclonal antibodies may be selected for use in various embodiments of the present disclosure. See, e.g., Medicines in Development Biologies, 2013 Report, pp. 1-87, a publication of PhRMA's Communications & Public Affairs Department. (202) 835-3460, which is incorporated by reference herein.

[0131] In some embodiments, the polynucleotide is operably linked to a regulatory sequence. In some embodiments, the regulatory sequence comprises a promoter sequence. In some embodiments, the regulatory sequence comprises a CMV or UbC promoter. In some embodiments, the regulatory sequence is selected from SEQ ID NO: 6 or 7.

[0132] In some embodiments, the polynucleotide further comprises a poly(A) signal.

5.3. Methods of Treatment

[0133] In one aspect, the present disclosure provides a method of transferring a polynucleotide to the central nervous system (CNS) of a subject, the method comprising: administering to the subject an effective dose of a recombinant adeno-associated virus (rAAV) described herein. The rAAV comprises a capsid comprising a capsid protein having the amino acid sequence of SEQ ID NO: 1 or a variant thereof, and the polynucleotide encapsulated by the capsid.

[0134] In some embodiments, the present disclosure provides a method of treating a disease of the central nervous system (CNS), the method comprising: administering to the CNS of a subject a therapeutically effective dose of: a rAAV, the rAAV comprising: a capsid protein having the amino acid sequence of SEQ ID NO: 1 or a variant thereof, and a polynucleotide encoding a therapeutic protein. [0135] In some embodiments, the present disclosure provides a method of vaccination with a transgene, the method comprising: administering to the central nervous system (CNS) of a subject an effective dose of: a rAAV, the rAAV comprising: a capsid protein having the amino acid sequence of SEQ ID NO: 1 or a variant thereof, and a polynucleotide encoding an antigen.

[0136] A rAAV as described herein can be used in research and/or therapeutic applications. In some embodiments, a rAAV is for genetically modifying a cell in vitro or in vivo. In some embodiments, a rAAV is used for gene therapy or for vaccination in a human or animal. More specifically, a rAAV can be used for gene addition, gene augmentation, genetic delivery of a polypeptide therapeutic, genetic vaccination, gene silencing, genome editing, gene therapy, RNAi delivery, cDNA delivery, mRNA delivery, miRNA delivery, miRNA sponging, genetic immunization, optogenetic gene therapy, transgenesis, DNA vaccination, or DNA immunization of brain cells or non-brain cells.

5.3.1. Subject

[0137] The present disclosure provides a method of transferring a polynucleotide to the central nervous system (CNS) of a subject, e.g., a mammal. In some embodiments, the subject is a human. In some embodiments, the subject has a CNS disease. In some embodiments, the subject has a genetic defect associated with CNS disease or disorder.

[0138] In some embodiments, the CNS disease or disorder is selected from Adrenoleukodystrophy, Alexander Disease, Alzheimer disease, Amyotrophic lateral sclerosis, Angelman syndrome, Ataxia telangiectasia, Canavan disease, Charcot-Marie-Tooth syndrome, Cockayne syndrome, Chronic inflammatory demyelinating polyneuropathy (CIDP), Deafness, Duchenne muscular dystrophy, Epilepsy, Essential tremor, Fragile X syndrome, Friedreich's ataxia, Gaucher disease, GM1 gangliosidosis, GM2 gangliosidoses, Huntington disease, Frontotemporal Degeneration (FTD), Lesch-Nyhan syndrome, Maple syrup urine disease, Menkes syndrome, Metachromatic leukodystrophy (MLD), Myotonic dystrophy, Multiple sclerosis, Narcolepsy, Neurofibromatosis, Niemann-Pick disease, Parkinson's disease, Phenylketonuria, Prader-Willi syndrome, Refsum disease, Rett syndrome, Spinal muscular atrophy, Spinocerebellar ataxia, Tangier disease, Tay-Sachs disease, Tuberous sclerosis, Von Hippel-Lindau syndrome, Williams syndrome, Wilson's disease, and Zellweger syndrome. [0139] In some embodiments, the CNS disease or disorder is a demyelinating or white matter disease. In some embodiments, the subject has a monogenic defect. In some embodiments, the subject has a genetic defect in a protein expressed in the CNS. In some embodiments, the subject has a monogenetic defect in a protein expressed in the CNS.

[0140] In some embodiments, the subject has a lysosomal storage disease (LDS). In some embodiments, the subject has a disease selected from: mucopolysaccharidosis type I e.g., Hurler syndrome and the variants Scheie syndrome and Hurler-Scheie syndrome; Hunter syndrome; mucopolysaccharidosis type III, e.g., Sanfilippo syndrome; mucopolysaccharidosis type IV, e.g., Morquio syndrome; mucopolysaccharidosis type VI, e.g., Maroteaux-Lamy syndrome; mucopolysaccharidosis type II; mucopolysaccharidosis type III; mucopolysaccharidosis type IV; mucopolysaccharidosis type VI; mucopolysaccharidosis type VII; mucopolysaccharidosis type VIII; mucopolysaccharidosis type IX; Tay-Sachs disease; Sandhoff disease; GM1 gangliosidosis; Fabry disease; Krabbe's disease; leukodystrophy; metachromatic leukodystrophy; Pompe disease; Fucosidosis deficiency; alpha-mannosidosis deficiency; beta-mannosidosis deficiency; Gaucher disease; Infantile Batten Disease; Classic Late Infantile Batten Disease; Juvenile Batten Disease; Batten, other forms Niemann-Pick disease; Niemann-Pick disease without sphingomyelinase deficiency; and Wolman disease.

[0141] In some embodiments, the subject has a brain cancer. In some embodiments, the subject has brain metastases of a cancer. In some embodiments, the subject has brain metastases of breast cancer. In some embodiments, the subject has brain metastases of HER2 positive breast cancer.

5.3.2. Route of Administration

[0142] The present disclosure provides a method of administering an rAAV to transfer a polynucleotide to the CNS. In some embodiments, the rAAV is administered locally or systematically.

[0143] In certain embodiments, the rAAV is administered locally to the CNS. In some embodiments, rAAV is administered to the cerebral spinal fluid (CSF) of said subject. In some embodiments, the rAAV is administered to the cistemae magna, intraventricular space, brain ventricle, subarachnoid space, intrathecal space and/or ependyma of the subject. [0144] In some embodiments, rAAV is administered by intrathecal administration, intracranial administration, intracerebroventricular (ICV), or intraparenchymal administration or administration to the lateral ventricles of the brain.

[0145] In some embodiments, rAAV is administered by lumbar injection (e.g., into the lumbar cistern) and/or injection into the intra cisterna magna (ICM).

[0146] In some embodiments, rAAV is administered to the ventricular system. In some embodiments, rAAV is administered to the rostral lateral ventricle; and/or administered to the caudal lateral ventricle; and/or administered to the right lateral ventricle; and/or administered to the left lateral ventricle; and/or administered to the right rostral lateral ventricle; and/or administered to the left rostral lateral ventricle; and/or administered to the right caudal lateral ventricle; and/or administered to the left caudal lateral ventricle.

[0147] In some embodiments, rAAV is administered such that the rAAV contacts ependymal cells of said subject. Such ependymal cells express the encoded polypeptide and optionally the polypeptide is expressed by the cells.

[0148] In some embodiments, the polypeptide is expressed and/or is distributed in the lateral ventricle, CSF, and/or brain (e.g., striatum, thalamus, medulla, cerebellum, occipital cortex, and/or prefrontal cortex).

[0149] In some embodiments, rAAV is administered intravenously or systemically.

[0150] To deliver the rAAV specifically to a particular region of the CNS, especially to a particular region of the brain, it may be administered by stereotaxic microinjection. For example, on the day of surgery, patients can have the stereotaxic frame base fixed in place (screwed into the skull). The brain with stereotaxic frame base (MRI-compatible with fiduciary markings) can be imaged using high resolution MRI. The MRI images can then be transferred to a computer that runs stereotaxic software. A series of coronal, sagittal and axial images can be used to determine the target site of vector injection, and trajectory. The software directly translates the trajectory into 3 -dimensional coordinates appropriate for the stereotaxic frame. Burr holes can be drilled above the entry site and the stereotaxic apparatus localized with the needle implanted at the given depth. The vector in a pharmaceutically acceptable carrier can then be injected. The AAV vector can be then administrated by direct injection to the primary target site and retrogradely transported to distal target sites via axons. Additional routes of administration can be used, e.g., superficial cortical application under direct visualization, or other non- stereotaxic application.

101511 In some embodiments, rAAV is delivered by a pump. The pump may be implantable. Another convenient way to administer the rAAV is to use a cannula or a catheter.

[0152] In some embodiments, rAAV is administered by Convection-enhanced delivery (CED) (Nguyen et al., (2003) J. Neurosurg. 98:584-590), which has been used clinically in gene therapy (AAV2-hAADC) for Parkinson's disease (Fiandaca et al., (2008) Exp. Neurol. 209:51-57). The underlying principle of CED involves pumping infusate into brain parenchyma under sufficient pressure to overcome the hydrostatic pressure of interstitial fluid, thereby forcing the infused particles into close contact with the dense perivasculature of the brain. Pulsation of these vessels acts as a pump, distributing the particles over large distances throughout the parenchyma (Hadaczek et al., (2006) Hum. Gene Ther. 17:291-302). To increase the safety and efficacy of CED, a reflux-resistant cannula (Krauze et al., (2009)Methods Enzymol. 465:349-362) can be employed along with monitored delivery with real-time MRI. Monitored delivery allows for the quantification and control of aberrant events, such as cannula reflux and leakage of infusate into ventricles (Eberfing et al., (2008) Neurology 70: 1980-1983; Fiandaca et al., (2009) Neuroimage 47 Suppl. 2:T27-35; Saito et al., (2011) Journal of Neurosurgery Pediatrics 7:522-526). US20190111157A1 provides improved procedures to achieve widespread expression of AAV vectors in the cortex and/or striatum.

[0153] In some embodiments, the rAAV is administered to the striatum. In some embodiments, the rAAV is administered to at least the putamen and the caudate nucleus of the striatum. In some embodiments, the rAAV is administered to at least the putamen and the caudate nucleus of each hemisphere of the striatum. In some embodiments, the rAAV is administered to at least one site in the caudate nucleus and two sites in the putamen.

[0154] In some embodiments, rAAV is delivered by intraparenchymal administration to a specific area of the brain. In some embodiments, rAAV is delivered by intraparenchymal administration to putamen, striatum, basal forebrain region, substantia nigra and/or ventral tegmental area.

[01551 In some embodiments of the above aspects and embodiments, the rAAV is delivered by stereotactic delivery. In some embodiments, the rAAV is delivered by convection enhanced delivery (CED). In some embodiments, the rAAV is delivered using a CED delivery system. In some embodiments, the CED system comprises a cannula. In some embodiments, the cannula is a reflux-resistant cannula or a stepped cannula. In some embodiments, the CED system comprises a pump. In some embodiments, the pump is a manual pump. In some embodiments, the pump is an osmotic pump. In some embodiments, the pump is an infusion pump.

5.4. Pharmaceutical Compositions

[0156] In another aspect, the present invention provides a pharmaceutical composition comprising the rAAV described above [See Section 5.2], and a pharmaceutically acceptable excipient.

[0157] In some embodiments, the pharmaceutical composition is formulated for local administration to the CNS or for systemic administration. In some embodiments, the pharmaceutical composition comprises a CSF, e.g., ultrafiltrate of plasma or synthetic cerebrospinal fluid. An rAAV of the present disclosure can be administered to a subject (e.g., a human or non-human mammal) in a suitable carrier. Suitable carriers include saline, which may be formulated with a variety of buffering solutions (e.g., phosphate buffered saline), lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, and water. An rAAV typically is administered in sufficient amounts to transduce or infect the desired cells and to provide sufficient levels of gene transfer and expression to provide a therapeutic benefit without undue adverse effects.

[0158] In some embodiments, the pharmaceutical composition can be used to deliver the polynucleotide to a target within a mammalian subject. When the pharmaceutical composition is administered, the rAAV of the present disclosure can achieve a higher infection of target cells following administration to a mammalian subject as compared to an rAAV comprising a AAV9 capsid protein administered by the same route of administration and in the same dose. In some embodiments, the rAAV of the present disclosure achieves higher expression in target cells of the polynucleotide encapsulated by the rAAV following administration to a subject as compared to the polynucleotide encapsulated by a rAAV comprising an AAV9 capsid protein administered by the same route of administration and in the same dose. [0159] Targeting of rAAVs can be tested in an experimental animal by measuring rAAV infection or expression of a polynucleotide. In some embodiments, targeting is measured in a non-human primate (NHP), mice, rats, birds, rabbits, guinea pigs, hamsters, farm animals (including pigs and sheep), dogs, or cats.

[0160] Targeting of rAAVs can be measured after systemic or local administration of rAAVs. In some embodiments, targeting of rAAVs is measured after intravenous infusion of rAAVs or local administration to CNS. In certain embodiments, targeting is measured after administration to the CNS by lumbar puncture (LP) via injection into the lumbar cistern (e.g., approximately L3-L4) or intra cisterna magna (ICM) administration.

[0161] In some embodiments, targeting of rAAVs is measured by measuring the ratio between the copy numbers of the transgene transcripts and a housekeeping gene (e.g., RPP30, actin, GAPDH or ubiquitin) transcripts. In a particular embodiment, the transcripts are measured by RT-ddPCR. In some embodiments, the ratio is measured after a first administration into a mammal such as a primate, e.g., monkey (such as cynomolgus or rhesus macaque) or a mouse.

[0162] In some embodiments, rAAV of the present disclosure provides the ratio of infection (i.e., expression) in a brain (or target region of the brain) or other tissue (or non-target region of the brain) of at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 150, at least 200, at least 500, at least 1000 fold, compared to AAV9.

[0163] In some embodiments, a brain: comparative tissue infection ratio is measured by comparing the ratios between the copy numbers of the transgene transcripts and house keeping gene (e.g., RPP30) transcripts in the same organs (e.g., brain) or in the same tissues (e.g., caudate nucleus, frontal cortex, globus pallidum, motor cortex, parietal cortex, putamen, substantia nigra) in two individual or two groups of animals, each administered with a test rAAVtest (e.g., Anc80L65) or AAV9.

[0164] In some embodiments, the rAAVtest achieves infection ratio of at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least, at least 10, at least 20, at least 30, at least 40, or at least 50 compared to AAV9 in the brain. In some embodiments, the rAAVtest achieves infection ratio of at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least, at least 10, at least 20, at least 30, at least 40, or at least 50 compared to AAV9 at one of the target tissues, caudate nucleus, frontal cortex, globus pallidum, motor cortex, parietal cortex, putamen, and substantia nigra.

5.4.1. Effective Dose

[0165] The dose of a rAAV administered to a subject will depend primarily on factors such as the condition being treated, and the age, weight, and health of the subject. For example, a therapeutically effective dosage of the rAAV to be administered to a human subject generally is in the range of from about 0.1 ml to about 10 ml of a solution containing concentrations of from about 1E12 to 1E17 genome copies (GCs) of rAAV per ml. For systemic administration, a therapeutically effective dosage of the rAAV to be administered to a human subject generally is in the range of from about 0.1 ml to about 10 ml or a larger volume of a solution containing rAAV.

[0166] In some embodiments, the effective dose is between 1E10 to 1E16 genome copy numbers (GC) of the rAAV per subject. In some embodiments, the effective dose for a human patient corresponds to a monkey dose of 1E12 to 1E15 GC of the rAAV. In some embodiments, the effective dose for a human patient corresponds to a monkey dose of 1E13 to 1E14 GC of the rAAV. In some embodiments, the effective dose for a human patient corresponds to a monkey dose of about 4E13 GC of the rAAV.

[0167] In some embodiments, the effective dose is 1E11 to 1E15 GC of the rAAV per a gram brain mass. In some embodiments, the effective dose is 1E11 to 1E13 GC of the rAAV per a gram brain mass. In some embodiments, the effective dose is 1E11 to 1E12 GC of the rAAV per a gram brain mass. In some embodiments, the effective dose is 1E12 to 1E14 GC of the rAAV per a gram brain mass. In some embodiments, the effective dose is about 5E11 GC of the rAAV per a gram brain mass. In some embodiments, the effective dose is about 2.5E11 GC of the rAAV per a gram brain mass. In some embodiments, the effective dose is about 5E10 GC of the rAAV per a gram brain mass. In some embodiments, the effective dose is about 2.5E10 GC of the rAAV per a gram brain mass. [0168] In some embodiments, the effective dose is between 1E10 - 1E16 genome copy numbers (GC) of the rAAV per kg body weight. In some embodiments, the effective dose is between 1E11 - 1E15 genome copy numbers (GC) of the rAAV per kg body weight. In some embodiments, the effective dose is between 1E12 - 5E14 genome copy numbers (GC) of the rAAV per kg body weight. In some embodiments, the effective dose is between 0.5E13 - 2E14 genome copy numbers (GC) of the rAAV per kg body weight.

[0169] Transduction and/or expression of a transgene can be monitored at various time points following administration by DNA, RNA, or protein assays. In some instances, the levels of expression of the transgene can be monitored to determine the frequency and/or amount of dosage. Dosage regimens similar to those described for therapeutic purposes also may be utilized for immunization.

[0170] In one aspect, the present invention provides a unit dose of rAAV provided herein. The unit dose comprises about 0.1 ml to about 10 ml of a solution containing concentrations of from about 1E9 to 1E17 genome copies (GCs) per ml of rAAV described herein. In some embodiments, the unit dose contains about 1E10 to 1E16 genome copies (GCs) per ml of rAAV described herein. In some embodiments, the unit dose contains about 1E11 to 1E15 genome copies (GCs) per ml of rAAV described herein. In some embodiments, the unit dose contains about 1E12 to 1E14 genome copies (GCs) per ml of rAAV described herein. In some embodiments, the unit dose contains about 2E13 genome copies (GCs) per ml of rAAV described herein.

[0171] In some embodiments, the unit dose contains about 1E10 to 1E16 genome copies (GCs) of rAAV described herein. In some embodiments, the unit dose contains about 1E11 to 1E15 genome copies (GCs) of rAAV described herein. In some embodiments, the unit dose contains about 1E12 to 1E15 genome copies (GCs) of rAAV described herein. In some embodiments, the unit dose contains about 1E13 to E15 genome copies (GCs) of rAAV described herein.

[0172] The unit dose further comprises a pharmaceutically acceptable excipient.

5.5. Summary of Experimental Observations

[0173] Applicant evaluated distribution of AAV9 and Anc80L65 vectors (SEQ ID No: 1) encoding the EGFP reporter 14 days following injection by either lumbar puncture (LP) injection into the lumbar cistern (approximately L3-L4) or intra cisterna magna (ICM) injection (4E¹³gc/animal; 2E¹³ vg/ml) in adult cynomolgus macaques. Applicant demonstrated that a single injection of Anc80L65 into the CSF of adult cynomolgus monkeys led to the efficient transduction of broad regions of the CNS.

[0174] Following ICM injection, Anc80L65 distributes more broadly throughout the cortex and into deep brain nuclei compared to AAV9. Following LP injection, Anc80L65 distribution throughout the cortex was on par with ICM delivery and superior to that seen with AAV9 via ICM delivery. AAV9 showed limited transduction in the cortex following LP delivery. AAV9 and Anc80L65 efficiently transduced spinal cord ventral horn motor neurons with both routes of administration.

[0175] Specifically, Anc80L65 transducing both neurons and astrocytes. Rare oligodendrocyte transduction was also observed in cortical regions with Anc80L65, however no microglial cells were found to be transduced using the microglial marker Ibal . AAV9 showed a similar tropism in the nonhuman primate CNS to Anc80L65, transducing largely neurons and astrocytes. Similar to Anc80L65 no microglial double labeling was observed. Oligodendrocyte transduction was not observed with AAV9, however there was less transduction overall in the CNS compared to Anc80L65 making it a difficult comparison.

[0176] Applicant further tested delivery and expression of a therapeutic gene (a coding sequence of anti-Her2 antibody, trastuzumab) in an AAV genomic construct encapsulated by Anc80L65 capsid in RAG knockout mice after ICV injection. The tested AAV constructs contained codon optimized coding sequences of the heavy chain and light chain of trastuzumab, in the order of the heavy chain and the light chain coding sequences, or the light chain and the heavy chain coding sequences, from 5' to 3' direction. In the experiment, constructs containing a heavy chain coding sequence followed by a light chain coding sequence from 5' to 3' provided the highest levels of trastuzumab mRNA and protein expression.

[0177] Expression of trastuzumab was further tested using AAV constructs containing different regulatory sequences, either a CMV promoter or a UbC promoter. In the experiment, constructs having a UbC promoter provided significantly better mRNA and protein expression in various brain regions compared to similar AAV constructs containing a CMV promoter. [0178] This work demonstrated the ability of Anc80L65 to target widespread regions of the CNS following CSF routes of delivery and outperforms the distribution of AAV9 in targeting cortical and deep brain regions. The ability of Anc80L65 to mediate efficient gene transfer and expression in neurons and astrocytes throughout the brain and spinal cord of NHPs supports use of Anc80L65 vector for treatment of a wide range of neurologic disorders. In particular, Anc80L65 was demonstrated to be effective in delivering and expressing trastuzumab. Additionally, an AAV construct containing the trastuzumab heavy chain coding sequence followed by trastuzumab light chain coding sequence under the control of a UbC promoter was particularly effective in inducing high level expression of trastuzumab in various brain regions.

6. EXAMPLES

6.1. Experimental Procedures

6.1.1. Lumbar Puncture (LP) injection

[0179] The animal was injected with anesthesia and were placed in lateral recumbency. A 22- gauge Gerti Marx spinal needle was percutaneously inserted into the lumbar cistern (approximately L3-L4). Fluoroscopy was used for guidance if necessary. Once the needle was placed, the stylet was removed, and positive cerebral spinal fluid (CSF) flow confirmed, and predose CSF was collected. The test article syringe was then attached to the needle and the test article slowly infused by hand as a slow bolus over approximately 120±5 seconds. After completion of the injection, the needle was removed, and brief pressure was applied by hand over the injection site. Animal was then be placed in the Trendelenburg position (30°, head down) for a minimum of approximately 10 minutes. The animal was then allowed to recover naturally from anesthesia. Lumbar puncture is an intrathecal injection.

6.1.2. Intracisternal Magna (ICM) injection

[0180] The animal was injected with anesthesia and placed in lateral recumbency. A 22- gauge spinal needle was advanced percutaneously into the cistema magna, correct needle placement was verified by the presence of positive cerebral spinal fluid (CSF) flow, and predose CSF was collected. An appropriate Test Article syringe was then be connected to the spinal needle and the Test Article was administered by hand via a slow bolus injection (120±5 seconds). After completion of the injection, the syringe was removed, and pressure was applied briefly by hand. Animal was then placed in the Trendelenburg position (30°, head down) for a minimum of approximately 10 minutes. The animal was then be allowed to recover naturally from anesthesia.

6.1.3. Immunohistochemistry (IHC)

[0181] Two weeks after injection, tissue samples were collected and preserved in 10% neutral buffered formalin (NBF) for 48-72 hours, then transferred to 70% ethanol. The brain was placed into a pre-chilled brain matrix and sliced into 4 mm sections, then hemisected. Even-numbered hemisected slabs were preserved in 10% NBF and used for immunohistochemistry (IHC). Odd-numbered hemisected brain slabs were frozen on dry ice and stored at -60 to -90°C until used for ddPCR analysis.

[0182] For detection of GFP expression, slides were incubated with antibodies against GFP (GeneTex, GTX20290) diluted 1 : 1,000 in Monet Blue Diluent (Biocare Medical, PD901). The slides were washed with Valent Wash Buffer (Biocare Medical, VLT8013MX) and incubated with anti-rabbit antibody conjugated with Farma HRP for 30 minutes (Biocare Medical, BRR4009). The slides were washed and then reacted with Betazoid DAB for 5minutes (Biocare Medical, BDB2004) and counterstained with Mayer's Hematoxylin for 5 minutes (StatLab, HXMMHPT). After the reactions with Betazoid DAB or Mayer's Hematoxylin, the slides were washed with Aqua Rinse (Biocare Medical, VLT8012MX).

[0183] GFP staining by 3,3'-diaminobenzidine (DAB): Sections (3 per each 6-mm block: separation of 2 mm) were washed 3 times in PBST followed by treatment with 1% H2O2. Sections were stained with the primary anti-GFP antibody diluted 1 : 1000 in Da Vinci Green Diluent as previously described (Lluis Samaranch, Ernesto A. Salegio, Waldy San Sebastian, Adrian P. Kells, John R. Bringas, John Forsayeth, and Krystof S. Bankiewicz Human Gene Therapy. Volume: 24 Issue 5: March 20, 2013, incorporated herein by reference).

[0184] For detection of Trastuzumab expression, slides were incubated with antibodies against IgG (Fc). IgG (Fc) can serve as a proxy for Trastuzumab expression.

6.1.4. Double-immunofluorescence:

[0185] Fluorescence immunostaining of different cellular markers (NeuN, GFAP, Ibal, Olig2+) with GFP as previously described (San Sebastian et al., 2013). Sample Collection:

[0186] Tissue samples were collected and preserved in 10% neutral buffered formalin (NBF) for 48 -72 hours, then transferred to 70% ethanol. The brain was placed into a pre-chilled brain matrix and sliced into 4 mm sections, then hemisected. Even-numbered hemisected slabs were preserved in 10% NBF and used for immunohistochemistry (IHC). Odd-numbered hemisected brain slabs were frozen on dry ice and stored at -60 to -90°C until used for ddPCR analysis.

Immunohistochemistry protocol for GFP expression: o Bake slides for 15 minutes at 55-65 Celsius to remove paraffin o Load slides onto Valent Staining Platform (Biocare Medical) o Vai DePar 8 minutes (Biocare Medical, V^rLT8001MM) o Lo pH AR at 98 Celsius for 60 minutes (Biocare Medical, VLT8004MM) o Peroxidazed 1 for 5 minutes (Biocare Medical, PX968) o Background Punisher for 5 minutes (Biocare Medical, BP974) o GFP (GeneTex, GTX20290) 1 : 1,000 in Monet Blue Diluent (Biocare Medical, PD90I) o Rabbit on Farma HRP for 30 minutes (Biocare Medical, BRR4009) o Betazoid DAB for 5minutes (Biocare Medical, BDB2004) o Counterstain with Mayer's Hematoxylin for 5 minutes (StatLab, HXMMHPT)

[0187] Valent Wash Buffer (Biocare Medical, VLT8013MX) was used after all steps expect for Betazoid DAB and Mayer's Hematoxylin. Aqua Rinse (Biocare Medical, VLT8012MX) was used after these reagents.

Dual staining methods for the IBA1, NeuN and GFAP with the GFP:

[0188] Reagents:

• GFP (GeneTex, GTX20290) 1 : 1,000, GFAP ( Cell Signaling, 3670) 1 :500 in Monet Blue Diluent (Biocare Medical, PD901)

• GFP (GeneTex, GTX20290) 1 : 1,000, IB Al ( Millipore, MABN92) 1 :250 in Monet Blue Diluent (Biocare Medical, PD901)

GFP (GeneTex, GTX20290) 1 : 1,000, NeuN ( Abeam, abl04224) 1 :250 in Monet Blue Diluent (Biocare Medical, PD901) [0189] Protocol: o Bake slides for 15 minutes at 55-65 Celsius to help remove paraffin o Load slides onto Valent Staining Platform (Biocare Medical) o Vai DePar 8 minutes (Biocare Medical, VLT8001MM) o Lo pH AR at 98 Celsius for 60 minutes (Biocare Medical, VLT8004MM) o Peroxidazed 1 for 5 minutes (Biocare Medical, PX968) o Background Punisher for 10 minutes (Biocare Medical, BP974) o Primary Antibody Cocktail: Rabbit 594nm (Invitrogen, A32740) 1 :500, Mouse 488nm (Invitrogen, A-21202) 1 :500, cocktailed together in Da Vinci Green for 60 minutes (Biocare Medical, PD900) o Coverslip with Prolong Diamond Antifade Reagent with DAPI o Valent Wash Buffer (Biocare Medical, VLT8013MX) was used after all steps.

6.1.5. ddPCR

[0190] After euthanasia and exsanguination, brains were placed into a pre-chilled brain matrix and sliced into 4mm sections, then hemisected. Odd numbered hemisected slabs were frozen over dry ice, then stored at -60°C to -90°C until analyzed. Brain regions were isolated using 2mm or 3mm diameter tissue punches (Miltex, Cat. No.: 95039-098 and 98PUN6-4) prior to nucleic acid isolation.

[0191] Tissues were homogenized in a Qiagen Tissuelyser II (20rps for 2 min) in lysis buffer from the Qiagen Dneasy Blood and Tissue Kit or the Qiagen RNeasy Lipid Tissue Mini Kit following the standard Qiagen protocol. Samples were eluted in 50uL of buffer. Prior to analysis, DNA and RNA concentration and quality were determined using a NanoDrop One, using the nucleic acid (DNA or RNA) program. DNA samples were analyzed for biodistribution of vector genomes using a duplexed ddPCR method targeting the transgene (eGFP) and a reference gene (RPP30). RNA samples were analyzed for expression of the eGFP transgene using a duplexed, one-step RT-ddPCR method) and a reference gene (RPP30).

Dual staining method for Olig2 and GFP (performed at StageBio);

[0192] Reagents:

• GFP (GeneTex, GTX20290) 1 : 1,000, Olig2 (Millipore, MABN50) 1 :250 in Monet Blue Diluent (Biocare Medical, PD901) [0193] Protocol: o Bake slides for 15 minutes at 55-65 Celsius to help remove paraffin o Load slides onto Valent Staining Platform (Biocare Medical) o Vai DePar 8 minutes (Biocare Medical, VLT8001MM) o Lo pH AR at 98 Celsius for 60 minutes (Biocare Medical, VLT8004MM) o Peroxidazed for 5 minutes (Biocare Medical, PX968) o Background Punisher for 10 minutes (Biocare Medical, BP974) o Primary Antibody Cocktail: Biotinylated Mouse (Vector Laboratories, BA-9200)

1 : 500 in Da Vinci Green Diluent o Rabbit 594nm (Invitrogen, A32740) 1 :500, Streptavidin 488nm (Invitrogen, SI 1223) 1 :500, cocktailed together in Da Vinci Green for 60minutes (Biocare Medical, PD900) o Coverslip with Prolong Diamond Antifade Reagent with DAPIValent Wash Buffer (Biocare Medical, VLT8013MX) was used after all steps.

[0194] DNA analysis:

[0195] For isolation of DNA, tissues were homogenized in a Qiagen Tissuelyser II (20rps for 2 min) in lysis buffer from the Qiagen DNeasy Blood and Tissue Kit (Part No. 69506), following the standard Qiagen protocol. Samples were eluted in 50uL of AE buffer. Prior to analysis, DNA concentration and quality were determined using a NanoDrop One, using the nucleic acid (DNA) program.

[0196] DNA samples were analyzed for biodistribution of vector genomes using a duplexed ddPCR method targeting the transgene (eGFP or Trastuzumab) and a reference gene (RPP30). Specific primer probe sequences are listed in the table below.

[0197] The samples were analyzed following the standard Bio-Rad ddPCR protocol for probe-based analysis of DNA biodistribution. Briefly, reaction mixes containing the 2 primer probe sets, DNA samples and Bio-Rad ddPCR Supermix for Probes (no dUTP) (Part No. 186-3024) were prepared according to the recipe in the table below.

* DNA samples were pre-diluted to 2ng/μL (liver), lOng/μL (DRG, no dilution for the samples with the concentration < lOng/μL) and 20ng/μL (other samples) using nuclease- free water.

[0198] After droplet generation, reactions were amplified using the thermal cycling program indicated below.

[0199] Data is reported in vector genomes copied per diploid genome (VGC/DG). The formula for calculating the output is VGC/DG = (eGFP cp/μL RPP30 cp/μL) x 2 for eGFP or VGC/DG = (Trastuzumab cp/μL RPP30 cp/μL) x 2 for Trastuzumab.

[0200] RNA analysis:

[0201] For isolation of mRNA, tissues were homogenized in a Qiagen Tissuelyser II (20rps for Imin) in 1ml of Qiazol from the Qiagen RNeasy Lipid Tissue Mini Kit (Part No. 74804), following the standard Qiagen protocol. Samples were eluted in 50μL of Nuclease-free water. Prior to analysis, RNA concentration and quality were determined using a NanoDrop One, using the nucleic acid (RNA) program.

[0202] DNA samples were analyzed for expression of the eGFP transgene or the Trastuzumab transgene using a duplexed, one-step RT-ddPCR method targeting the transgene (eGFP or Trastuzumab) and a reference gene (RPP30). Specific primer probe sequences are listed in the table below.

[0203] The samples were analyzed following the standard Bio-Rad RT-ddPCR protocol for probe-based analysis of RNA expression. Briefly, reaction mixes containing the 2 primer probe sets, RNA samples and Bio-Rad One-Step RT-ddPCR Advanced Kit for Probes (Part No. 186-4021) were prepared according to the recipe in the table below.

* RNA samples were pre-diluted to 20ng/μL using nuclease-free water.

[0204] After droplet generation, reactions were amplified using the thermal cycling program indicated below.

[0205] Data is reported as % eGFP expression, which is calculated according to the formula, % eGFP expression = (eGFP cp/μL RPP30 cp/μL) x 100 or % Trastuzumab expression = (Trastuzumab cp/μL RPP30 cp/μL) x 100.

6.1.6. Her2-Binding ELISA

[0206] For Her2 -Binding ELISA, Eagle Biosciences Humanized Anti-Her-2 (Herceptin/Trastuzumab) ELISA Assay Kit (Cat. No. AHR31-K01) was used according to the manufacturer's instructions with variations as described herein. This anti-Her2 ELISA is a method used to quantify the binding of functional Trastuzumab using a sandwich method where a microwell titer plate is coated with recombinant HER2 protein. [0207] Briefly, microwells from a microwell titer plate were coated with recombinant HER2 protein. Assay calibrators, controls, and test samples (brain tissue lysates) were added into the designated microwells. Immediately, 100 μL of lx assay buffer was added and plate was sealed and incubated for 1 hour on a small orbit radius shaker at 400 to 450 rpm. Each microwell was washed with working wash solution (i.e., mild buffer), and a secondary antibody specific to Human IgG antibody was added to each well. The secondary antibody was conjugated to a Horseradish Peroxidase enzyme, which provided the mechanism for colorimetric quantification of Trastuzumab. A second wash step was performed to remove unbound secondary antibody. A substrate solution, which reacts with the Horseradish Peroxidase enzyme to create a colored product, was added to each well and incubated for 30 minutes. The color density at the end of the incubation period was proportional to the amount of Trastuzumab bound to the plate in the first step. A standard curve of known concentrations was used to calibrate the measurement of Trastuzumab in test samples. The reaction was stopped by the addition of a high pH buffer. The amount of colored product generated in each well was measured by a plate reader, which passed light through the liquid in the well and measured the absorbance of the colored liquid. The absorbance of the standard curve was plotted and the absorbance of the test samples was compared to the standard curve plot to determine the amount of Trastuzumab in the test sample. Data is presented as absorbance normalized to total protein loaded.

6.2. Broad CNS penetration and wide distribution of Anc80L65 compared to AAV9

[0208] The objective of this study is to determine the biodistribution and initial feasibility of Anc80L65 vector compared to AAV9 vector, when administered by a single lumbar puncture or intra-ci sterna magna administration. The results confirm broad penetration and wide distribution of Anc80L65 compared to AAV9.

[0209] Two AAV constructs were used in the experiment: (i) Anc80L65-CAG-GFP, and (ii) AAV9-CAG-GFP, each including an AAV genome construct containing a coding sequence of GFP. GFP was used to detect distribution of AAVs and expression of the transgene. Cynomolgus monkeys were used as the subject animals.

[0210] Total 14 animals were divided into 6 groups as summarized in the FIG. 1 and TABLE

2. Animals in Group 1 and 4 are control animals administered with vehicle. Animals in Group 2 and 5 were administered with 4E13vg (viral genome or GC) of Anc80L65, and animals in Group 3 and 6 were administered with 4E13vg of AAV9. Two routes of administration were tested - animals in Group 1-3 were administered by ICM, and animals in Group 4-6 were administered by LP. Animals were sacrificed on day 14 or 15 after the vehicle or AAV administration and their organ samples were collected for analysis.

[0211] Collected samples were processed for IHC and stained with an antibody against GFP. Images of the IHC staining are provided in FIGs. 2A-9 and 22A-22D. FIGs. 2A-2D provide immunohistochemistry (IHC) images of cortical tissue from the brain sections obtained from NHPs administered with Anc80L65 or AAV9 by intraci sternal magna injection or lumbar- puncture. FIGs. 22A-22D provide IHC images of brain sections of cortex and caudate nucleus obtained from NHPs administered with Anc80L65 or AAV9 by intraci sternal magna injection.

[0212] These results show transgene (GFP) expression capabilities of Anc80L65 are superior compared to AAV9 both by ICM and LP administrations. More cells were stained for GFP expression in the cortex and caudate nucleus after administration of Anc80L65 compared to AAV9. FIGs. 2A-2D further show that ICM administration provides better results than LP administration with both vectors (i.e., Anc80L65 and AAV9) in terms of breadth of distribution within the brain.

[0213] IHC results in other parts of the brain are also provided - specifically, in the cortex (FIGs. 3A-3C, 8A-8C and 9), ependyma and caudate nucleus (FIGs. 4A-4B), caudate nucleus (FIGs. 5A-5B), substantia nigra (FIG. 6), and perivascular cells (FIG. 7A-7B). The results show broad penetration and wide distribution of Anc80L65 compared to AAV9. [0214] To characterize cell types expressing GFP after Anc80L65 or AAV9 administration, the NHP brain sections were double stained for GFP and a cell-type specific marker. FIGs. 26A-26F and FIGs. 27A-27F provide the images of the double staining — against GFP and a marker for neurons (NeuN) (FIGs. 26A and 26D), against GFP and a marker for astrocytes (FIGs. 26B and 26E), against GFP and a marker for microglial cells (ibal), against GFP and a marker for oligodendrocyte (FIGs. 27A, 27B and 27C) in the motor cortex transfected with Anc80L65 or AAV9. In all cases, GFP+ cells are shown in red, the cell specific marker is shown in green, and the merged images are shown with double-labeled cells in yellow/orange (arrows). The staining results show that Anc80L65 can mediate efficient transgene expression in neurons, astrocytes and oligodendrocytes across large regions of the NHP brain following a single LP or ICM injection. This suggests that Anc80L65 can be used for clinical applications to treat a wide range of neurologic disorders, particularly using a relatively noninvasive route of administration such as LP.

[0215] Transgene transfer and expression capabilities of Anc80L65 and AAV9 administered by ICM or LP to NHPs were also tested with ddPCR, by measuring amounts of DNA and mRNA of the transgene (eGFP) in the NHP brain and spinal cord 2 weeks after ICM or LP delivery. DNA genome copies and mRNA transcript copies of the transgene (eGFP) were quantified in comparison to the amounts of DNA genome copies or mRNA transcript copies of a house keeping gene (RPP30), respectively. Specifically, DNA genome copies are reported as vector genomes copies per diploid genome (VGC/DG). The formula for calculating the output is VGC/DG = (eGFP cp/μL + RPP30 cp/μL) x 2. RNA transcript copies are reported as % eGFP expression, which is calculated according to the formula, % eGFP expression = (eGFP cp/μL RPP30 cp/μL) x 100.

[0216] Viral DNA genome copies (VGCs) per diploid genome (i.e., VGCs per cell) measured in the experiment are provided in FIGs. 13A-17. Each figure provides data corresponding to different brain regions or liver, including cerebellar cortex (FIG. 13 A), dorsal root ganglia, cervical (FIG. 13B), dorsal root ganglia, lumbar (FIG. 14 A), frontal cortex (FIG. 14B), liver (FIG. 15 A), motor cortex (FIG. 15B), spinal cord, cervical (FIG. 16A), spinal cord, lumbar (FIG. 16B), and sciatic nerve (FIG. 17). The VGCs data are further analyzed and summarized in FIG. 25. [0217] The data show Anc80L65 led to more vector genome copies per cell in frontal cortex, motor cortex and spinal cord (cervical and lumbar) compared with AAV9, irrespective of injection route as shown in FIG. 25.

[0218] RNA transcripts measured from the experiment are provide in FIGs. 18 A, 18B, 19A, 19B, 20 A, 20B and 21. Each figure provides data corresponding to different brain regions, including caudate nucleus (FIG. 18 A), frontal cortex (FIG. 18B), globus pallidus (FIG. 19 A), motor cortex (FIG. 19B), parietal cortex (FIG. 20 A), putamen (FIG. 20B), and substantia nigra (FIG. 21). Administration of Anc80L65 induced higher levels of GFP expression in several brain regions, including caudate nucleus after ICM administration, globus pallidus after LP administration, motor cortex after both ICM and LP administration, parietal cortex after both ICM and LP administration, and putamen after LP administration.

[0219] One-way statistical analysis of the expression data is provided in FIGs. 10A-FIG. 12B. The analysis results are also tabulated in FIG. 23 and FIG. 24. FIGs. 10A-10C and 23 provide analysis of the data from the frontal cortex (FIG. 10A, FIG. 23), motor cortex (FIG. 10B, FIG. 23); and parietal lobe of the cortex (FIG. 10C, FIG. 23). The data show significantly higher expression of GFP in the cortex of the animals injected with Anc80L65 by ICM or LP compared to AAV9 by ICM or LP. FIGs. 11 A-l IB, FIGs. 12A-12B and FIG. 24 show similar analysis in caudate nucleus (FIG. 11 A, FIG. 24), globus pallidus (FIG. 1 IB, FIG. 24), putamen (FIG. 12A, FIG. 24) and substantia nigra (FIG. 12B, FIG. 24). These figures also show significantly higher GFP expression in the most brain areas of animals injected with Anc80L65 by ICM or LP compared to AAV9 by ICM or LP. These results suggest that both ICM and LP injections of Anc80L65 can be effective ways of delivering and expressing a transgene, superior to ICM administration of AAV9.

[0220] The statistical analysis of the ddPCR data is also provided below in TABLE 3. The table provides fold differences and p-value results from the Tukey -Kramer HSD test showing comparisons of GFP transcript (RNA) expression in various tissues between Anc80L65 (ICM) vs. AAV9 (ICM), Anc80L65 (LP) vs. AAV9 (ICM), and Anc80L65 (LP) vs. AAV9 (LP). Positive differences indicate the magnitude of expression advantage attributed to Anc80L65. Statistically significant p-Values are indicated in red (asterisk). The analysis shows that superiority of Anc80L65 is statistically significant compared to AAV9 in various brain regions.

6.3. Selection of Candidate Nucleic Acid Sequences Encoding an Antigen Binding Protein Against HER2

[0221] This experiment was designed to select candidate nucleic acid sequences encoding an antigen binding protein specific to human epidermal growth factor receptor 2 (HER2) (e.g., an anti-Her2 antigen-binding protein (e.g., Trastuzumab)) for use in the methods described herein. In particular, the experiment was designed to evaluate Heavy Chain (HC) and Light Chain (LC) orientation within the coding sequence and optimized coding sequences for Trastuzumab. The coding sequence for each candidate was encapsulated by an AAV comprising an Anc80L65 capsid and administered to RAG knockout mice.

6.3.1. Experimental Design

[0222] RAG Knockout (RAG KO) (J AX Strain 002216) mice to be treated were divided into five treatment groups (1-5). Group 1 received an ICV saline injection and served as a vehicle control. Group 2 received Anc80L65.CMV.ATX.HCLC by ICV injection. Group 4 received Anc80L65.CMV.W2.HCLC by ICV injection. Group 5 received Anc80L65.CMV.ATX.LCHC by ICV injection. Group 6 was administered the same dose of AAV9.CMV.W1.HCLC by ICV injection as a control.

[0223] Anc80L65.CMV.ATX.HCLC comprises a construct comprising from 5' to 3', CMV promoter and a codon-optimized coding sequence (ATX) of a heavy chain (SEQ ID NO: 13) followed by a light chain (SEQ ID NO: 14), and Anc80L65 capsid encapsulating the construct. Anc80L65.CMV.W2.HCLC comprises a construct comprising from 5' to 3', CMV promoter and a codon-optimized coding sequence (W2) of a heavy chain (SEQ ID NO: 17) followed by a light chain (SEQ ID NO: 18), and Anc80L65 capsid encapsulating the construct. Anc80L65.CMV.ATX.LCHC comprises a construct comprising from 5' to 3', CMV promoter and a codon-optimized coding sequence (ATX) of a light chain (SEQ ID NO: 14) followed by a heavy chain (SEQ ID NO: 13), and Anc80L65 capsid encapsulating the construct. Anc80L65.CMV.Wl.HCLC comprises a construct comprising from 5' to 3', CMV promoter and a codon-optimized coding sequence (Wl) of a heavy chain (SEQ ID NO: 15) followed by a light chain (SEQ ID NO: 16), and Anc80L65 capsid encapsulating the construct.

[0224] Coding sequences for Wl heavy chain and W2 heavy chain have 88.5% sequence identity and encode for proteins having 98.9% sequence identity. W2 heavy chain includes a complementarity determining region 3 (CDR3) comprising a coding sequence of TGGGGCGGCGACGGCTTATACGCCATGGACTAC (SEQ ID NO: 32), encoding the amino acid sequence of WGGDGLYAMDY (SEQ ID NO: 33). Wl heavy chain includes a CDR3 comprising a coding sequence of TGGGGAGGCGACGGCTTCTACGCCATGGACTAT (SEQ ID NO: 34), encoding the amino acid sequence of WGGDGFYAMDY (SEQ ID NO: 35). Light chain coding sequences for W1 and W2 have 88.9% sequence identity, and each encode the amino acid sequence of SEQ ID NO: 20.

[0225] Table 4 provides a summary of the experimental design including experimental conditions for Groups 1-5 (see also FIG. 28).

[0226] Tissues were collected at day 14 and day 30 post injection to assess vector biodistribution (AAV genomic DNA), Trastuzumab mRNA transcript expression, and Trastuzumab protein expression (Her2 -binding detected by ELISA). Upon harvesting, brains were removed and placed in a Stainless Steel Sagittal Brain Matrix. Brains were cut in half in sagittal plans using Blade 1 and then slabs were collected as shown in FIG. 29. Slabs were placed into a tube and flash frozen or placed into fixative containing 10% NBF for 24 hours at room temperature for histology. Table 5 provides a summary of the tissue usage upon harvesting.

6.3.2. Vector Genome Detection

[0227] Vector genome (i.e., AAV vector genomic DNA) was measured by ddPCR and presented as vector genome copies per diploid genome (VGC/DG). Tissues were harvested 13 and 30 days after injection and DNA was isolated. DNA was analyzed using the Bio-Rad ddPCR Supermix for Probes (no dUTP) (Bio-Rad 1863024) in combination with primers and probes specific for DNA encoding the Trastuzumab transgene and DNA encoding the nonhuman primate RPP30 reference. Primers and probes were designed to include intronic sequences to prevent contaminating RNA from interfering with accurate quantitation of vector genomes. After thermal cycling, samples were analyzed on the Bio-Rad QX200 Droplet Reader instrument using the Absolute Quantitation program. See Section 6.1.5 for additional experimental details.

[0228] The results of the vector genome measurements are provided in FIG. 30A (day 13) and FIG. 30B (day 30). Using the All Pairs, Tukey HSD test (also called Tukey-Kramer), which shows the significance tests of all combinations of pairs, revealed Group 4 (Anc80L65.CMV.W2.HCLC) and Group 6 (AAV9.CMV.W1.HCLC) had the highest levels of AAV DNA at day 13 (FIG. 30 A) and Anc80L65.CMV.ATX.LCHC had the highest level of AAV DNA at day 30 (FIG. 30B).

6.3.3. Gene Expression

[0229] Trastuzumab mRNA expression was measured by RT-ddPCR and presented as percentage of reference gene expression (Trastuzumab transcripts /RPP30 transcripts x 100). Tissues were harvested at day 13 and 30 after injection and RNA was isolated. RNA from samples were analyzed using the Bio-Rad One-Step RT-ddPCR Advanced Kit for Probes (Bio-Rad 1864022) in combination with primers and probes specific for the Trastuzumab transgene and the non-human primate RPP30 reference gene. The reverse primer for both targets acted as the reverse transcription primer for the reverse transcription step. Where possible, primers and probes were designed across exon-exon junctions to prevent crossreactivity with contaminating DNA. After thermal cycling, samples were analyzed on the QX200 Droplet Reader instrument using the Absolute Quantitation program. See Section 6.1.5 for additional experimental details.

[0230] The results for Trastuzumab RNA expression measurements are provided in FIG. 31 A (day 13) and FIG. 3 IB (day 30). Tukey-Kramer analysis revealed Group 4 (Anc80L65.CMV.W2.HCLC) and Group 6 (AAV9.CMV.W1.HCLC) had the highest levels of Trastuzumab RNA expression at day 13 (FIG. 31 A) and Group 6 had the highest levels of Trastuzumab RNA expression at day 30 (FIG. 31B).

6.3.4. Protein Expression

[0231] Trastuzumab protein levels in brain tissue was measured by a HER2 -binding ELISA and presented as absorbance normalized to total protein loaded. See Section 6.1.6 for additional experimental details.

[0232] The results for Trastuzumab protein level measurements are provided in FIG. 32A (day 13) and FIG. 32B (day 30). Tukey-Kramer analysis revealed Group 4 (Anc80L65.CMV.W2.HCLC) had the highest levels of Trastuzumab protein at day 13 (FIG. 32A) followed by Group 6 (AAV9.CMV.W1.HCLC). At day 30, Group 4 and 6 had similar levels of Trastuzumab protein (FIG. 32B).

6.3.5. Conclusion

[0233] This experiment was designed to select candidate nucleic acid sequences encoding an anti-Her2 antigen-binding protein for use in the methods described herein.

[0234] Vector genomes and Trastuzumab RNA and protein were observed in brains for each treatment group. Additionally, vector genomes and Trastuzumab RNA were observed in the spinal cord for each treatment group (protein measurements were not performed for spinal cord tissue). Table 6 provides a summary for each treatment group.

[0235] Overall, administration of Group 4 Anc80L65.CMV.W2.HCLC produced the highest RNA and protein expression for Trastuzumab amongst the various AAVs tested comprising an Anc80L65 capsid.

6.4. Promoter Selection Study

[0236] This experiment was performed to select candidate promoter sequences for further experimentation. In particular, the experiment was designed to evaluate Trastuzumab expression using either a CMV promoter (SEQ ID NO: 6) or a UbC promoter (SEQ ID NO: 7). The construct included a coding sequence of Trastuzumab (HER.W2.DELM) having the sequence of SEQ ID NO: 5. The HER.W2.DELM has a sequence identical to W2 tested in the experiments described in 6.3, except that it includes D356E and L358M mutations in the CH2.CH3 fragment.

[0237] Each Trastuzumab polynucleotide construct including either a CMV promoter or a UbC promoter was encapsulated by an Anc80L65 capsid and administered to RAG knockout mice.

6.4.1. Experimental Design

[0238] RAG KO mice to be treated were divided into four treatment groups (Group 1-4). Group 1 received an ICV injection of formulation buffer and served as a vehicle control. Group 2 received Anc80L65.CMV.HER.W2.DELM by ICV injection.

CMV.HER.W2.DELM of the Anc80L65.CMV.HER.W2.DELM corresponds to SEQ ID NO: 8 (see FIG. 33 for a schematic of the construct). Group 3 received Anc80L65.UBC.HER.W2.DELM by ICV injection. UBC.Her2W2.DELM of the Anc80L65.UBC.HER.W2.DELM AAV corresponds to SEQ ID NO: 9 (see FIG. 34 for a schematic of the construct). Group 4 received Anc80L65.CMV-Wl by ICV injection. CMV- W1 of the Anc80L65.CMV-Wl corresponds to SEQ ID NO: 10. Table 7 provides a summary of the experimental design for experimental Groups 1-4 (see also FIG. 35).

[0239] Table 8 provides a summary of the sedimentation velocity (SV-AUC) for rAAV prepared for Groups 2, 3, and 4. Table 8 shows that about 20% of each virus prep included partial capsids.

[0240] Tissues were collected at day 14 and day 28 post injection to assess vector biodistribution (AAV genomic DNA), Trastuzumab RNA expression, Trastuzumab protein expression (Her2 -binding detected by ELISA), and cellular biodistribution using IHC (anti- IgG Fc). Upon harvesting, brains were removed and placed in a Stainless Steel Sagittal Brain Matrix. Brains were cut in half sagittal plans and then slabs were collected as shown in FIGs. 36A-D. Slabs were placed into a tube and flash frozen or placed into fixative for histology containing 10% neutral buffered formalin for 24 hours at room temperature.

6.4.2. Vector Genome Detection

[0241] Vector genome (i.e., AAV vector genomic DNA) was measured by ddPCR and presented as vector genome copies per diploid genome (VGC/DG). Tissues were processed as described in Section 6.3.2 except tissues were harvested at a single time point (day 28).

See also Section 6.1.5 for additional experimental details.

[0242] The results of the vector genome measurements are provided in FIG. 37A (forebrain), FIG. 38A (midbrain), and FIG. 39A (cerebellum). FIG. 37A and FIG. 38A show that transduction with Group 3 (Anc80L65.UBC.HER.W2.DELM) did not produce statistically significant difference in vector genome copies per diploid cell as compared to either Groups 2 or 4. FIG. 39A show that Group 3, which include the UbC promoter, produced statistically significant differences in vector genome copies per diploid genome in cerebellum (FIG. 37 A) as compared to Group 2 and/or Group 4, both of which include a polynucleotide comprising the CMV promoter. Statistically significant differences between the means were determined by an ANOVA one-way test followed by Dunnett multiple comparison tests with P-values indicated with asterisks. * P <0.05, ** p < 0.005; *** p <0.001; **** p < 0.0001, ns = not significant.

6.4.3. Gene Expression

[0243] Trastuzumab mRNA expression was measured by RT-ddPCR and presented as percentage of reference gene expression (Trastuzumab transcripts /RPP30 transcripts x 100). Tissues were processed as described in Section 6.3.3 except tissues were harvested at a single time point (day 28). See also Section 6.1.5 for additional experimental details.

[0244] The results for Trastuzumab RNA expression measurements are provided in FIG. 37B (forebrain), FIG. 38B (midbrain), and FIG. 39B (cerebellum). FIG. 37B and FIG. 39B show that Group 3 (Anc80L65.UBC.HER.W2.DELM) produced statistically significant differences in Trastuzumab RNA expression in forebrain (FIG. 37B; P=0.0029) and cerebellum (FIG. 39B; P<0.0001) as compared to Group 2 and/or Group 4, both of which include a polynucleotide comprising the CMV promoter. Statistically significant differences between the means were determined by an ANOVA one-way test followed by Dunnett multiple comparison tests with P-values indicated with asterisks. * P <0.05, ** p < 0.005; *** p <0.001; **** p < 0.0001, ns = not significant.

6.4.4. Protein Expression

[0245] Trastuzumab protein expression in brain tissue was measured by a HER2 -binding ELISA and presented as absorbance normalized to total protein loaded. Tissues were processed as described in Section 6.3.4 except tissues were harvested on day 28. [0246] The results of Trastuzumab protein expression measurements are provided in FIG. 37C (forebrain), FIG. 38C (midbrain), and FIG. 39C (cerebellum). FIG. 38C and FIG 39C show that Group 3 (Anc80L65.UBC.HER.W2.DELM) produced statistically significant differences in Trastuzumab protein expression in midbrain (FIG. 38C; P=0.0007) and cerebellum (FIG. 39C; P<0.0001) as compared to Group 2 and/or Group 4, both of which include a polynucleotide comprising the CMV promoter. Statistically significant differences between the means were determined by an ANOVA one-way test followed by Dunnett multiple comparison tests with P-values indicated with asterisks. * P <0.05, ** p < 0.005; *** p <0.001; **** p < 0.0001, ns = not significant.

[0247] For IHC analysis, Tissue samples were collected at day 28 post vector administration and immediately placed into 10% neutral buffered formalin for approximately 48 hours and then transferred to 70% ethanol. Samples in ethanol were shipped at ambient temperature to Histoserv (Germantown, MD). See Section 6.1.3 for additional experimental details.

[0248] FIG. 40 shows representative images of brain-cross sections obtained after staining with human IgG Fc (used as a proxy for Trastuzumab expression). Trastuzumab expression was higher and had greater biodistribution in Group 3 (Anc80L65.UBC.HER.W2.DELM) than Group 2 (Anc80L65.CM. HER.W2.DELM) and/or Group 4 (Anc80L65.CMV-Wl).

6.4.5. Conclusion

[0249] This experiment was designed to evaluate Trastuzumab expression using either a CMV promoter or a UbC promoter. Each promoter-Trastuzumab polynucleotide construct was encapsulated by a rAAV comprising an Anc80L65 capsid and administered to RAG knockout mice.

[0250] Group 3 (RAG KO mice administered a rAAV comprising an Anc80L65 capsid and a polynucleotide including a UBC promoter driving Trastuzumab expression) resulted in statistically significant increases in Trastuzumab RNA expression and Trastuzumab protein levels as compared to mice in Group 2 or Group 4. In forebrain tissue, Group 3 had Trastuzumab RNA expression statistically significantly greater than Group 2 or Group 4 (FIG. 37B). For example, forebrains from Group 3 had 27x greater Trastuzumab RNA expression than to Group 2 and 20x greater Trastuzumab RNA expression than Group 4. In the midbrain, Group 3 had Trastuzumab protein expression statistically significantly greater than Group 2 or Group 4 (FIG. 38C). For example, midbrains from Group 3 had 21x greater Trastuzumab protein than Group 2 and 74x greater Trastuzumab protein than Group 4. In the cerebellum, Group 3 showed vector genome levels statically significantly greater than Group

2 or Group 4 (FIG. 39A). Additionally, in the cerebellum, Group 3 had expression of both Trastuzumab RNA (FIG. 39B) and Trastuzumab protein (FIG. 39C) at statistically significantly greater levels compared to Groups 2 or 4. In particular, cerebellum from Group

3 had 12x greater Trastuzumab RNA expression compared to Group 2 and 1 lx greater Trastuzumab RNA expression compared to Group 4. In both the forebrain and midbrain where there was no significant difference between vector genome copy number among Groups 2, 3, and 4, Group 3 produced statistically significant increases in Trastuzumab RNA in the forebrain (FIG. 37B) and Trastuzumab protein in the midbrain (FIG. 38C).

[0251] Table 9 provides a summary of vector genome detection, Trastuzumab RNA expression, and Trastuzumab protein expression from this experiment.

[0252] Overall, administration of Anc80L65.UBC.HER.W2 to RAG KO mice (Group 3) resulted in statistically significant increases in Trastuzumab RNA and protein expression levels as compared to mice treated with either Anc80L65.CMV.HER.W2 (Group 2) or Anc80L65.CMV.HER.W 1 (Group 4). Additionally, IHC using IgG Fc (a proxy for Trastuzumab protein expression) showed stronger expression and greater biodistribution of Trastuzumab protein in Group 3 compared to Group 2 or 4. This data supported selection of the UbC promoter. 7. EQUIVALENTS AND INCORPORATION BY REFERENCE

[0253] While the invention has been particularly shown and described with reference to a preferred embodiment and various alternate embodiments, it will be understood by persons skilled in the relevant art that various changes in form and details can be made therein without departing from the spirit and scope of the invention.

[0254] All references, issued patents and patent applications cited within the body of the instant specification are hereby incorporated by reference in their entirety, for all purposes.

8. SEQUENCE LISTING

Ł G G G

Claims

WHAT IS CLAIMED IS:

1. A method of transferring a polynucleotide to the central nervous system (CNS) of a subject, the method comprising: administering to the subject an effective dose of: a recombinant adeno-associated virus (rAAV) comprising: a capsid comprising: a capsid protein having the amino acid sequence of SEQ ID NO: 1 or a variant thereof, and the polynucleotide encapsulated by the capsid; thereby transferring the polynucleotide to the CNS.

2. The method of claim 1, wherein the polynucleotide comprises a coding sequence of a therapeutic protein.

3. The method of claim 2, wherein the subject has a CNS disease.

4. The method of claim 3, wherein the CNS disease is a lysosomal storage disease (LSD).

5. The method of claim 3, wherein the CNS disease is a leukodystrophy.

6. The method of claim 5, wherein the CNS disease is metachromatic leukodystrophy

(MLD).

7. The method of claim 6, wherein the polynucleotide comprises a coding sequence encoding Arylsulfatase A (ARSA) or a functional variant thereof.

8. The method of claim 7, wherein the polynucleotide comprises a coding sequence selected from SEQ ID NO: 2-4.

9. The method of claim 5, wherein the CNS disease is Krabbe's leukodystrophy.

10. The method of claim 9, wherein the polynucleotide comprises a coding sequence of galactocerebroside beta-galactosidase or a functional variant thereof.

11. The method of claim 3, wherein the CNS disease is GM1 gangliosidosis.

12. The method of claim 8, wherein the polynucleotide comprises a coding sequence of galactosidase beta 1 (GLB-1) or a functional variant thereof. The method of claim 3, wherein the CNS disease is a cancer. The method of claim 13, wherein the CNS disease is metastatic breast cancer. The method of claim 14, wherein the therapeutic protein is an antigen binding protein against human epidermal growth factor receptor 2 (HER2). The method of claim 15, wherein the polynucleotide comprises a sequence of SEQ ID NO: 5. The method of claim 1, wherein the polynucleotide comprises a coding sequence of an antigen. The method of claim 17, wherein the antigen is a viral or bacterial antigen. The method of claim 17, wherein the effective dose is sufficient to immunize the subject. The method of claim 17, wherein the effective dose is sufficient to induce an immune response to the subject. The method of any one of claims 2-20, wherein the polynucleotide further comprises a regulatory sequence operably linked to the coding sequence. The method of claim 21, wherein the regulatory sequence comprises a CMV promoter or a UbC promoter. The method of claim 22, wherein the regulatory sequence comprises a UbC promoter having the sequence of SEQ ID NO: 7. The method of any one of claims 1-23, wherein the administration induces protein expression from the polynucleotide in the substantia nigra of the subject. The method of any one of claims 1-23, wherein the administration induces protein expression from the polynucleotide in the caudate nuclei of the subject. The method of any one of claims 1-23, wherein the administration induces protein expression from the polynucleotide in the ependyma of the subject. The method of any one of claims 1-23, wherein the administration induces protein expression from the polynucleotide in the cortex of the subject. The method of any of claims 1-27, wherein the administration is to the cerebrospinal fluid (CSF) of the subject. The method of claim 28, wherein the administration is selected from intrathecal administration, intracranial administration, intracerebroventricular (ICV) administration and administration to the lateral ventricles of the brain of the subject. The method of claim 28, wherein the intrathecal administration is by lumbar puncture (LP) and/or intra cistema magna (ICM) injection. The method of claim 30, wherein the step of administering is performed by ICM injection. The method of claim 30, wherein the step of administering is performed by lumbar puncture (LP). The method of any one of claims 1-32, wherein the effective dose is between 1E10 to 1E16 genome copy numbers (GC) of the rAAV. The method of any one of claims 1-32, wherein the effective dose is 1E9 GC to 1E14 GC per gram brain mass. The method of any one of claims 1-32, wherein the effective dose is administered at a concentration of 1E12 GC/ml to 1E17 GC/ml. The method of any one of claims 1-35, wherein the effective dose is administered systemically. The method of claim 36, wherein the step of administration is performed intravenously. The method of any one of claims 1-32, wherein the effective dose is between 1E10 - 1E16 genome copy numbers (GC) of the rAAV. The method of any one of claims 1-32, wherein the effective dose is between 1E9 - 1E15 genome copy numbers (GC) of the rAAV per kg body weight. The method of any one of claims 2-39, wherein the effective dose is an amount sufficient to induce detectable expression of the therapeutic protein in the CNS. The method of any one of claims 2-39, wherein the effective dose is an amount sufficient to induce detectable expression of the therapeutic protein in the substantia nigra. The method of any one of claims 2-39, wherein the effective dose is an amount sufficient to induce detectable expression of the therapeutic protein in the caudate nuclei. The method of any one of claims 2-39, wherein the effective dose is an amount sufficient to induce detectable expression of the therapeutic protein in the ependyma. The method of any one of claims 2-39, wherein the effective dose is an amount sufficient to induce detectable expression of the therapeutic protein in the cortex. A method of treating a disease of the central nervous system (CNS), the method comprising: administering to the CNS of a subject an effective dose of: a recombinant adeno-associated virus (rAAV), the rAAV comprising: a capsid polypeptide having the amino acid sequence of SEQ ID NO: 1 or a variant thereof, and a polynucleotide encoding a therapeutic protein. A method of vaccination with a transgene, the method comprising: administering to the central nervous system (CNS) of a subject an effective dose of: a recombinant adeno-associated virus (rAAV), the rAAV comprising: a capsid polypeptide having the amino acid sequence of SEQ ID NO: 1 or a variant thereof, and a polynucleotide encoding an antigen. A recombinant adeno-associated virus (rAAV) comprising: a capsid comprising: a capsid protein having the amino acid sequence of SEQ ID NO: 1, and a polynucleotide encapsulated by the capsid, wherein the polynucleotide comprises a coding sequence of a therapeutic protein associated with a CNS disease. The rAAV of claim 47, wherein the CNS disease is metachromatic leukodystrophy (MLD) The rAAV of claim 48, wherein the therapeutic protein is Arylsulfatase A (ARSA) or a functional variant thereof. The rAAV of claim 49, wherein the polynucleotide comprises a coding sequence selected from SEQ ID NO: 2-4. The method of claim 47, wherein the CNS disease is Krabbe's leukodystrophy. The method of claim 51, wherein the polynucleotide encodes galactocerebrosidase or a functional variant thereof. The rAAV of claim 47, wherein the CNS disease is GM1 gangliosidosis. The rAAV of claim 53, wherein the therapeutic protein is galactosidase, beta 1 (GLB-1) or a functional variant thereof. The rAAV of claim 47, wherein the CNS disease is cancer. The rAAV of claim 55, wherein the CNS disease is metastatic breast cancer. The rAAV of claim 56, wherein the therapeutic protein is an antigen binding protein (ABP) against human epidermal growth factor receptor 2 (HER2). The rAAV of claim 57, wherein the ABP against HER2 is trastuzumab. The rAAV of claim 57 or claim 58, wherein the coding sequence comprises from 5' to 3', a coding sequence of a heavy chain of the ABP against HER2 and a coding sequence of a light chain of the ABP against HER2. The rAAV of claim 57 or claim 58, wherein the coding sequence comprises from 5' to 3', a coding sequence of a light chain of the ABP against HER2 and a coding sequence of a heavy chain of the ABP against HER2. The rAAV of claim 59 or claim 60, wherein the coding sequence of a heavy chain comprises a sequence of SEQ ID NO: 13, 15 or 17. The rAAV of any one of claims 59-61, wherein the coding sequence of a light chain comprises a sequence of SEQ ID NO: 14, 16 or 18. The rAAV of any one of claims 57-62, wherein the coding sequence comprises: a. a heavy chain coding sequence of SEQ ID NO: 13 and a light chain coding sequence of SEQ ID NO: 14; b. a heavy chain coding sequence of SEQ ID NO: 15 and a light chain coding sequence of SEQ ID NO: 16; or c. a heavy chain coding sequence of SEQ ID NO: 17 and a light chain coding sequence of SEQ ID NO: 18. The rAAV of any one of claims 59-63, further comprising a self-cleaving peptide between the coding sequence of the heavy chain and the coding sequence of the light chain. The rAAV of claim 64, wherein the self-cleaving peptide is selected from the group consisting of F2A, P2A, T2A and E2A. The rAAV of claim 65, wherein the self-cleaving peptide has the sequence of SEQ ID NO: 21. The rAAV of any one of claims 59-66, further comprising one or more coding sequence of interleukin 2 signal sequence (IL2SS). The rAAV of claim 67, wherein one coding sequence of IL2SS is located at 5' end of the heavy chain coding sequence. The rAAV of claim 67, wherein one coding sequence of IL2SS is located at 5' end of the light chain coding sequence. The rAAV of claim 67, wherein a first coding sequence of IL2SS is located at 5' end of the heavy chain coding sequence and a second coding sequence of IL2SS is located at 5' end of the light chain coding sequence. The rAAV of claim 57, wherein the polynucleotide comprises a coding sequence of SEQ ID NO: 5. The rAAV of claim 57, wherein the polynucleotide comprises a coding sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 5. The rAAV of claim 57, wherein the polynucleotide comprises the sequence of SEQ ID NO: 8-18, or a fragment thereof. The rAAV of claim 73, wherein the polynucleotide comprises the sequence of SEQ ID NO: 8. The rAAV of claim 73, wherein the polynucleotide comprises the sequence of SEQ ID NO: 9. The rAAV of any one of claims 47-73, wherein the polynucleotide further comprises a regulatory sequence operably linked to the coding sequence. The rAAV of claim 76, wherein the regulatory sequence comprises a CMV promoter or a UbC promoter. The rAAV of claim 77, wherein the regulatory sequence comprises a UbC promoter having the sequence of SEQ ID NO: 7. A pharmaceutical composition comprising the rAAV of any one of claims 47-78. A unit dose comprising the pharmaceutical composition of claim 79. A method of transferring a polynucleotide to the central nervous system (CNS) of a subject, the method comprising: administering to the subject an effective dose of: the rAAV of any one of claims 47-78, the pharmaceutical composition of claim 79, or the unit dose of claim 80. A method of transferring a polynucleotide to the central nervous system (CNS) of a subject, the method comprising: administering to the CNS an effective dose of: a recombinant adeno-associated virus (rAAV) comprising: a capsid having the amino acid sequence of SEQ ID NO: 1 or a variant thereof, and a polynucleotide having the nucleic acid sequence of SEQ ID NO: 8 or 9, wherein the polynucleotide is encapsulated by the capsid, wherein the subject has metastatic breast cancer. A recombinant adeno-associated virus (rAAV) comprising: a capsid having the amino acid sequence of SEQ ID NO:1 or a variant thereof, and a polynucleotide encapsulated by the capsid having the nucleic acid sequence of SEQ ID NO: 8 or 9.